Application of human pluripotent stem cell exosome-derived circular RNA (Ribonucleic Acid) in preparation of anti-inflammatory drugs for hepatic fibrosis
By regulating macrophage phenotype through the circular RNA hsa_circ_0076798 derived from human pluripotent stem cell exosomes, the inflammatory response of liver fibrosis was resolved, and the prevention and treatment of liver fibrosis was achieved, providing important theoretical and clinical application value.
Patent Information
- Application Number
- CN202510815762.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-18
- Publication Date
- 2025-10-10
AI Technical Summary
Currently, there is no effective treatment to prevent and reverse liver fibrosis, especially by targeting macrophages to regulate their phenotype to inhibit inflammatory responses. Existing circRNAs are mainly derived from serum and mesenchymal stem cell exosomes, and there is a lack of research on the anti-inflammatory function of circRNAs derived from human pluripotent stem cell exosomes in liver fibrosis.
Using human pluripotent stem cell exosome-derived circular RNA hsa_circ_0076798, we acted on miR-1184 to relieve the inhibition of DICER1, regulate macrophage phenotype, and prepare drugs to prevent and treat inflammation and reverse liver fibrosis. We also established a cell model overexpressing hsa_circ_0076798 to verify its anti-inflammatory effect in macrophages.
hsa_circ_0076798 can stably inhibit the inflammatory response of M1 macrophages and promote the phenotype of M2 macrophages, providing ideas and methods for the prevention and treatment of liver fibrosis. It has low immunogenicity and cytotoxicity, is easy to store, and has potential therapeutic value.
Smart Images

Figure BDA0005455181640000071 
Figure BDA0005455181640000072 
Figure BDA0005455181640000091
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of circular RNA, and specifically relates to the use of circular RNA (hsa_circ_0076798) derived from human pluripotent stem cell exosomes in the preparation of anti-inflammatory drugs for liver fibrosis. Background Art
[0002] Continuous deterioration of liver fibrosis can lead to the development of liver cancer, but there is currently no effective treatment. The inflammatory response is closely related to liver fibrosis, and macrophages are key cells in the inflammatory response. By promoting the activation or apoptosis of hepatic stellate cells and the formation or degradation of fibrillar collagen, macrophages have a bidirectional regulatory effect that promotes or reverses liver fibrosis. Affected by the surrounding environment, the gene expression of macrophages themselves will change, polarizing into two phenotypes, namely M1 macrophages (pro-inflammatory type) and M2 macrophages (anti-inflammatory type). M1 macrophages secrete pro-inflammatory factors and enhance adaptive immunity; M2 macrophages secrete anti-inflammatory factors and play an important role in damage repair and tissue reconstruction. Because macrophages have extremely strong plasticity, targeting macrophages to regulate their phenotype can prevent or treat liver inflammation, thereby curbing the trend of liver disease to liver fibrosis, cirrhosis and liver cancer in the early stages.
[0003] Non-coding RNA has a strong potential to regulate gene expression. Among them, circular RNA (circRNA) is a class of endogenous non-coding RNA molecules. Because circRNA is rich in miRNA binding sites, it acts as a miRNA sponge. This miRNA sponge adsorption function acts as a competing endogenous RNA (ceRNA) to competitively bind to miRNA, thereby relieving the inhibitory effect of miRNA on its target gene and regulating gene expression. It plays an important role in the diagnosis and treatment of diseases. Studies have shown that overexpression of hsa_circ_0070963 can reduce type I collagen and α-SMA by sponging miR-223-3p, thereby inhibiting the activation of hepatic stellate cells. Wang et al. (Wang W, Dong R, Guo Y, et al. CircMTO1 inhibits liver fibrosis via regulation of miR-17-5p and Smad7[J]. Journal of Cellular and Molecular Medicine, 2019, 23(8): 5486-5496.) showed that serum circMT01 has a good diagnostic value for liver fibrosis in patients with chronic hepatitis B, and the restoration of circMT01 inhibits the activation of hepatic stellate cells through the miR-17-5p / Smad7 axis. Silencing of hsa_circ_0071410 increased the expression of miR-9-5p and further alleviated hepatic stellate cell activation. These data reveal the role of circRNA in hepatic stellate cell activation. Therefore, circRNAs act as miRNA “molecular sponges” and participate in various signaling cascades through the circRNA / miRNA / mRNA axis to regulate gene expression, including signals related to apoptosis, invasion, vascularization, and metastasis.
[0004] The circRNAs studied by the above-mentioned technology are derived from serum and mesenchymal stem cell exosomes, etc., and the effect of circRNA hsa_circ_0076798 derived from human pluripotent stem cell exosomes on liver disease has not been studied. In addition, there are currently no reports on the anti-inflammatory function of hsa_circ_0076798 in liver fibrosis. Summary of the Invention
[0005] The present invention aims to provide the use of circular RNA derived from human pluripotent stem cell exosomes in the preparation of anti-inflammatory drugs for liver fibrosis. The circRNA (hsa_circ_0076798) in exosomes from human pluripotent stem cells (hESCs) has the potential to regulate macrophage phenotypes and inhibit inflammatory responses, providing insights and methods for preventing and treating inflammation and reversing liver fibrosis.
[0006] The purpose of the present invention is achieved through the following technical solutions:
[0007] Use of circular RNA derived from human pluripotent stem cell exosomes in the preparation of anti-inflammatory drugs for liver fibrosis, wherein the circular RNA has a CircBase ID of hsa_circ_0076798.
[0008] The DNA sequence corresponding to the circular RNA is (from the 5 end to the 3 end): GTGGCAATGCAGTGGTGGATGGTTGTGGCAAGGCCCAGAACAGCACGGAGCTCGCTGC AGAGGAGTACACCCTCATGAGCATAGACACCATCATCAATGGGAAG.
[0009] The invention relates to an application of the human pluripotent stem cell exosome-derived circular RNA in the preparation of a preparation for preventing and treating inflammation and reversing liver fibrosis.
[0010] The human pluripotent stem cell exosomes are obtained by expanding human embryonic stem cells in 2D culture, then performing 3D suspension culture, collecting the supernatant, and centrifuging.
[0011] The hsa_circ_0076798 derived from human embryonic stem cell exosomes relieves the inhibition of DICER1 by acting on miR-1184, and the expressed DICER1 regulates its downstream TNF / NF-κB signaling pathway to promote macrophage phenotypic polarization and inhibit liver inflammatory response.
[0012] The non-coding circular RNA (104 bp in length) of the present invention can play an anti-inflammatory role in the process of resisting liver fibrosis.
[0013] The present invention establishes a cell model overexpressing hsa_circ_0076798: an hsa_circ_0076798 overexpression lentiviral vector is used to upregulate hsa_circ_0076798 levels in human M1 macrophages. By detecting changes in macrophage phenotype and inflammation-related indicators, it is further confirmed at the cellular level that hsa_circ_0076798 has the effect of inhibiting the inflammatory phenotype of M1 macrophages.
[0014] Compared with the prior art, the present invention has the following advantages and beneficial effects:
[0015] 1) The circRNA (hsa_circ_0076798) in human embryonic stem cell exosomes of the present invention has the function of regulating macrophage phenotype and inhibiting inflammatory response, providing ideas and methods for the preparation of drugs for preventing and treating inflammation and reversing liver fibrosis, and providing an idea, target and technical platform for the prevention and treatment of inflammatory infiltration in liver fibrosis, which has important theoretical significance and clinical application value.
[0016] 2) Due to its unique circular structure, circRNA is more stable, and due to the lack of ends, it can have lower immunogenicity and cytotoxicity without modification. In addition, circRNA drugs prepared as circRNAs also have better stability and are easy to store. The development of hsa_circ_0076798, a molecule that regulates gene expression in liver macrophages, will provide a way to treat liver fibrosis and inflammation. Therefore, the present invention can be used to develop small molecule targeted drugs with potential therapeutic value. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 The volcano plot shows the results of 2D-Exo and 3D-Exo circRNA chip sequencing; the red lines on the right indicate circRNAs with increased expression in the 3D-Exo group compared with the 2D-Exo group; the red lines on the left indicate circRNAs with decreased expression in the 3D-Exo group compared with the 2D-Exo group;
[0018] Figure 2 The heat map shows the top 20 differentially expressed circRNAs between 2D-Exo and 3D-Exo;
[0019] Figure 3 RT-qPCR was used to detect the expression level of hsa_circ_0076798 in 2D-Exo and 3D-Exo. The data are expressed as mean ± SD, *P < 0.05, **P < 0.01, and ***P < 0.001.
[0020] Figure 4 qPCR detection of hsa_circ_0076798 expression in normal human liver tissue and liver tissue of patients with liver fibrosis; Data are expressed as mean ± SD, *P < 0.05, **P < 0.01, and ***P < 0.001;
[0021] Figure 5The expression of hsa_circ_0076798 in cells of each group was detected by RT-qPCR. The data are expressed as mean ± SD, *P < 0.05, **P < 0.01, and ***P < 0.001.
[0022] Figure 6 The expression of inflammation-related genes ARG-1, CD206, TNF-α, and IL-1β in each group was detected by qPCR. The data are expressed as mean ± standard deviation, *P < 0.05, **P < 0.01, and ***P < 0.001.
[0023] Figure 7 Immunofluorescence was used to detect the expression of inflammation-related proteins IL-1β and CD206 on cells in each group;
[0024] Figure 8 Western Blot was used to detect the expression of inflammation-related proteins and macrophage surface markers on cells in each group;
[0025] Figure 9 Prediction of interaction binding sites between hsa_circ_0076798 and miR-1184 (circinteractome database);
[0026] Figure 10 The expression of miR-1184 in clinical samples of liver fibrosis; data are expressed as mean ± SD, *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001;
[0027] Figure 11 Prediction of downstream target genes of miR-1184; (A) 5636 target genes were predicted by the tragetscan7 database, and 736 target genes were predicted by miRDB. The Venn diagram shows that 658 target genes were predicted by both databases; (B) Prediction of interaction binding sites between miR-1184 and DICER1 (tragetscan7 database);
[0028] Figure 12 RT-qPCR was used to detect the expression level of DICER1 in liver tissues of patients with fibrosis and healthy controls. Data are expressed as mean ± SD, *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001.
[0029] Figure 13 is the psi-Check2 vector map;
[0030] Figure 14The relative fluorescence intensity of hsa_circ_0076798 wild type (hsa_circ_0076798WT) and mutant (hsa_circ_0076798Mut) after binding to miR-1184 mimics or inhibitors was detected using a dual luciferase reporter system. Data are expressed as mean ± SD, *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001.
[0031] Figure 15 The relative fluorescence intensity of wild-type and mutant DICER1 after binding to miR-1184 mimic was detected by dual-luciferase reporter system; data are expressed as mean ± SD, *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001;
[0032] Figure 16 The expression of inflammation-related genes IL-6, IL-1β, TNF-α, and Arg-1 after miR-1184 knockdown or overexpression; data are expressed as mean ± SD, *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001;
[0033] Figure 17 The expression of inflammation-related proteins CD11c, CD206, IL-6, MCP-1, iNOS, IL-1β, and TNF-α after miR-1184 knockdown or overexpression;
[0034] Figure 18 To explore the optimal knockdown conditions for DICER1 using 6 different siRNAs; (Data are expressed as mean ± SD, *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001;
[0035] Figure 19 The expression of inflammation-related genes IL-6, CCL13, CD68, CCL2, CXCL2, IL-1β, and TNF-α after DICER1 knockdown; data are expressed as mean ± SD, *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001;
[0036] Figure 20 The expression of inflammation-related proteins (CD206, Arg-1, and CD86) after DICER1 knockdown;
[0037] Figure 21Volcano plot showing the differential gene expression between the control group and the DICER1 knockdown group; P value < 0.05, |FC| > 2;
[0038] Figure 22 This is the KEGG pathway enrichment result of differentially expressed genes after DICER1 knockdown;
[0039] Figure 23 The hsa_circ_0076798-miR-1184-DICER1 axis regulates the changes in TNFR1, p65 phosphorylation, and IκBα phosphorylation in the TNF / NF-κB signaling pathway;
[0040] Figure 24 The liver function results of each group of mice in the exosome tail vein injection experiment;
[0041] Figure 25 qPCR was used to detect the expression of inflammation-related genes in the liver of each group of mice. DETAILED DESCRIPTION
[0042] The present invention will be further described in detail below with reference to specific examples, but the embodiments of the present invention are not limited thereto.
[0043] Preparation of exosomes in the embodiment: Diluted Matrigel (DMEM / F12:Matrigel=100:1) was coated on a 6-well cell culture plate, and then the plate was returned to the CO2 incubator for incubation for more than 24 hours; human embryonic stem cells in good condition were selected, the culture medium was discarded, and the cells were washed, and 1 mL of ReLeSR was added. TM After digestion, add 1 mL of mTeSR TM 1 culture medium, aspirate the cell suspension and add it to 2.5mL mTeSR TM 1 medium coated plate (1:6-1:10 ratio), 2D culture, change the medium every day; from the third day, collect the cell supernatant for 2D exosome isolation; 3D-hESC culture is to aspirate the human embryonic stem cell culture medium, wash, add 1mL GCDR digestion, and then add 1mL mTeSR TM 1. Blow the culture medium into a single cell suspension; add 3 mL of mTeSR containing 10 μM Y-27632 (Rocki) TM 1. Place the cells in a low-adhesion six-well plate for 3D suspension culture. After 48 hours, change the medium in each well by half every day. Starting from the third day of culture, collect the supernatant for 3D exosome isolation.
[0044] The hESC-Exosome precipitation step obtained by ultracentrifugation is as follows: the collected hESC supernatant (i.e. 2D culture supernatant or 3D suspension culture three-dimensional supernatant) is divided into 50 mL centrifuge tubes, and centrifuged at 4°C and 300 rpm for 10 minutes to remove larger cell debris and membranes; the supernatant is transferred to a new centrifuge tube, and centrifuged at 4°C and 2000 rpm for 20 minutes to remove cells and apoptotic bodies; the supernatant is transferred to a new centrifuge tube, and centrifuged at 4°C and 10000 rpm for 20 minutes to remove cells, dead cells and cell debris; the supernatant is filtered through a 0.22 μm filter membrane into an ultracentrifuge tube, and centrifuged at 4°C and 100000 rpm for 70 minutes to obtain exosome precipitate and contaminant proteins; all precipitates are collected into an ultracentrifuge tube, and then balanced with a balance tube, and then re-centrifuged at 4°C and 100000 rpm for 70 minutes to obtain exosome precipitate and contaminant proteins; most of the supernatant is removed, and the precipitate is not shaken, and then PBS-washed exosomes are added to the precipitate, and then balanced with a balance tube, and then re-centrifuged at 4°C and 100000 rpm for 70 minutes to obtain pure exosome precipitate; without shaking the exosome precipitate, as much as possible, the supernatant is removed, and only a small amount of supernatant is reserved to resuspend the exosomes.
[0045] The circRNA (hsa_circ_0076798) in the human embryonic stem cell exosome of the application has the effects of regulating macrophage phenotype and inhibiting inflammatory response, and is used for preparing a medicine for preventing and treating inflammation and reversing liver fibrosis.
[0046] The research method mainly includes the following parts:
[0047] (1) Chip sequencing is used for sequencing analysis and screening of circRNAs of 2D-hESCs-Exosomes and 3D-hESCs-Exosomes, and qPCR is used to verify the expression difference of hsa_circ_0076798 in 2D and 3D exosomes. In addition, verification is also carried out on liver fibrosis clinical samples.
[0048] (2) Cell model with up-regulated hsa_circ_0076798 level:
[0049] A lentiviral vector overexpressing hsa_circ_0076798 was constructed and transfected to upregulate hsa_circ_0076798 levels in the human monocytic cell line THP-1. Twenty-four hours after transfection, the THP-1 cells were polarized into M1 macrophages using PMA (phorbol ester) induction for 48 hours and LPS+IFN-γ (lipopolysaccharide + interferon-γ) induction for 48 hours. Total cell protein was extracted and Western blot analysis was performed to measure inflammatory markers. RNA was extracted and analyzed for inflammatory marker genes using RT-qPCR. Cell slides were prepared and immunofluorescence staining, flow cytometry, and other techniques were used to further examine the anti-inflammatory effects of hsa_circ_0076798. This further confirms at the cellular level that hsa_circ_0076798 has an inhibitory effect on liver inflammation.
[0050] (3) Prediction of the downstream gene miR-1184 / DICER1 of hsa_circ_0076798
[0051] The circinteractome online database was used to predict the downstream target gene of hsa_circ_0076798, miR-1184. The miRNA target gene prediction tools, such as Targetscan and miRbase, were then used to identify the downstream target gene DICER1 of miR-1184. A luciferase reporter gene system was used to further verify whether hsa_circ_0076798 directly targets miR-1184, and whether miR-1184 directly targets DICER1.
[0052] (4) Construction of human macrophages with knockdown / overexpression of miR-1184
[0053] In vitro functional validation experiments were performed using miRNA mimics and inhibitors. The in vitro experiments were divided into positive control group (M1 group, THP-1 polarized into M1 macrophages by PMA, LPS, and iFN-γ), M1 plus mimic negative control reagent miR-Mimic NC co-culture group (M1+miR-Mimic NC group), M1 plus miR-1184 mimic miR-Mimic co-culture group (M1+miR-Mimic group), M1 plus inhibitor negative control reagent miR-inhibitor NC co-culture group (M1+miR-inhibitorNC group), and M1 plus miR-1184 inhibitor miR-inhibitor co-culture group (M1+miR-inhibitor group). qPCR, immunofluorescence, flow cytometry, and Western Blot methods were used to detect the expression of inflammatory factors such as IL6, IL1β, TNF-α, MCP-1, and iNOS, and M1 marker protein CD86, respectively.
[0054] (5) Construction of human macrophages with DICER1 knockdown
[0055] DICER1 was knocked down by siRNA for in vitro functional validation experiments. The in vitro experiments were divided into a positive control group (M1 group, THP-1 polarized into M1 macrophages by PMA, LPS, and iFN-γ) and an M1 group transfected with DICER1 siRNA (M1+siDICER1 group). The expressions of inflammation-related genes (Arg1, Cd206, Tnfα, II1β, etc.) and inflammation-related proteins (MCP-1, CD11C, CD206, ARG-1, etc.) were detected by qPCR and Western Blot methods.
[0056] (6) Transcriptome sequencing after DICER1 knockdown
[0057] After DICER1 knockdown, transcriptome sequencing was performed, and possible pathways downstream of DICER1 were enriched through bioinformatics analysis, and the enriched pathways were verified by Western blotting.
[0058] The present invention, through exosome microarray sequencing and clinical sample validation, found that hsa_circ_0076798 was significantly upregulated in 3D exosomes and significantly reduced in patients with liver fibrosis. Using a lentiviral vector overexpressing hsa_circ_0076798, the human monocytic cell line THP-1 was transfected with hsa_circ_0076798 to upregulate hsa_circ_0076798 expression. After THP-1 cells were induced to become M1 macrophages, the M1 macrophage phenotype and inflammatory markers were examined. The results showed that hsa_circ_0076798 significantly suppressed inflammatory markers at the cellular level and promoted the transition of macrophages from M1 to M2, suggesting that hsa_circ_0076798 could be a potential treatment for liver inflammation.
[0059] In the circRNA-related cell experiments in the following examples, the hsa_circ_0076798 overexpression plasmid and the empty plasmid were provided by biological companies, such as Guangzhou Jisai Biotechnology.
[0060] Example 1: Chip Sequencing of CircRNA Content in 2D-hESC-Exosomes and 3D-hESC-Exosomes
[0061] Circular RNA (circRNA) is generally produced in cells, without 5'-end cap and 3'-end poly(A) tail, and is a covalently linked circular single-stranded RNA. The circRNA molecule is rich in microRNA (miRNA) binding sites, which acts as a miRNA sponge in cells, thereby relieving the inhibition of the target gene combined with miRNA, and increasing the expression level of the target gene. This mechanism is called competitive endogenous RNA (ceRNA) mechanism. The supernatant of 2D and 3D cultured human embryonic stem cells was collected; the exosomes in the supernatant were extracted to obtain 2D-hESC derived exosomes and 3D-hESC derived exosomes (denoted as 2D-Exo and 3D-Exo); circRNA in the exosomes was extracted; exosome sequencing was performed; and bioinformatics analysis was performed on the sequencing results.
[0062] The results are shown in Figure 1 and 2 . Figure 1 The volcano plot shows the differentially expressed circRNAs of 2D-hESC and 3D-hESC derived exosomes (2D-Exo and 3D-Exo); the red part indicates the circRNAs with increased expression in the 3D-Exo group compared with the 2D-Exo group.
[0063] Figure 2 The heat map shows the top 20 differentially expressed circRNAs of 2D-Exo and 3D-Exo. The heat map shows the top 20 differentially expressed circRNAs screened out, and hsa_circRNA_104126 (database common name hsa_circ_0076798, circinteractome database) is the highly expressed circRNA in 3D-Exo.
[0064] Example 2: qRT-PCR verification of the expression of hsa_circ_0076798 in 2D and 3D exosomes
[0065] The specific method is to extract RNA from liver tissue of patients with liver fibrosis and normal human liver tissue according to the RNAiso Plus reagent instructions. 1-2 mL of RNAiso Plus is added to the solution and gently shaken to ensure even distribution of the lysate on the cell surface. The lysate containing the cells is then transferred to a centrifuge tube and repeatedly pipetted until no visible precipitate is present. The solution is allowed to stand at room temperature (15-30°C) for 5 minutes to separate the RNA from the nuclear proteins. Next, chloroform is added to the lysate at a volume equal to one-fifth the volume of RNAiso Plus. The tube is tightly capped and shaken until a milky white emulsion forms. The solution is then allowed to stand at room temperature for 5 minutes and centrifuged at 12,000 × g at 4°C for 15 minutes. After centrifugation, carefully remove the tube from the centrifuge. The solution will now separate into three layers: a colorless upper layer (containing RNA), a middle white protein layer (primarily DNA), and a lower, colored organic phase. The upper layer is transferred to a new centrifuge tube. Next, add 0.5-1 times the volume of isopropanol as the RNAiso Plus volume to the supernatant. Seal the tube and shake it thoroughly. Let it sit at room temperature for 10 minutes, then centrifuge at 12,000 × g at 4°C for 10 minutes. A precipitate will appear at the bottom of the tube. Gently discard the supernatant. Add an equal volume of 75% ethanol solution to the volume of RNAiso Plus. Centrifuge at 7,500 × g at 4°C for 5 minutes, and again carefully discard the supernatant, avoiding the precipitate. Open the tube cap and allow the precipitate to dry at room temperature for 2-7 minutes. Then, add an appropriate amount of RNase-free water to dissolve the precipitate. Finally, measure the RNA concentration using a microspectrophotometer. The OD260 / OD280 ratio should be between 1.7 and 2.1, indicating that the RNA is essentially free of contamination.
[0066] Next, circRNA reverse transcription was performed using the PrimeScript kit. TM RTReagent Kit, the preparation of the reaction system is shown in Table 1.
[0067] Table 1 circRNA reverse transcription system
[0068]
[0069] Gently mix the sample and reverse transcribe at 37°C for 15 minutes; inactivate the reverse transcriptase at 85°C for 5 seconds; obtain cDNA at 4°C and store at -80°C or for subsequent experiments.
[0070] After diluting the obtained cDNA 10-fold, the reaction system was prepared according to Table 2 below:
[0071] Table 2 qPCR reaction system
[0072]
[0073] The qPCR primer sequences for hsa_circ_0076798 are as follows:
[0074] hsa_circ_0076798-F2:TGCAGTGGTGGATGGTTGTG
[0075] hsa_circ_0076798-R2:ACCACTGCATTGCCACCTTC
[0076] The amplified fragment size of hsa_circ_0076798 is 113 bp.
[0077] The reaction system solution was mixed and centrifuged and then loaded onto the centrifuge. The following reaction program was used: pre-denaturation at 95°C for 5 minutes; 40 cycles of 95°C for 15 seconds, 60°C for 15 seconds, and 72°C for 32 seconds; melting curve: 60°C-95°C. GAPDH was used as an internal reference in human M1 macrophages. -ΔΔCT The expression of hsa_circ_0076798 between the treatment and control groups was expressed as fold change, where ΔCT = CT treated - CT internal reference, and ΔΔCT = ΔCT treated - ΔCT control. The fold change of hsa_circ_0076798 between the treatment and control groups was calculated using 2 as the base and -ΔΔCT as the exponent.
[0078] The results are as follows Figure 3 As shown in the figure, the expression level of hsa_circ_0076798 in 3D-Exo was significantly higher than that in 2D-Exo, which was consistent with the bioinformatics analysis results of Example 1.
[0079] Example 3: RT-qPCR verification of hsa_circ_0076798 expression in liver tissue of patients with liver fibrosis
[0080] RNAiso Plus reagent instructions were used as a reference to extract RNA from liver tissue of clinical patients. The subsequent circRNA reverse transcription and qPCR process were consistent with the method in Example 2.
[0081] The expression level of hsa_circ_0076798 has been verified using clinical samples (liver tissues of patients with liver fibrosis and liver tissues of healthy subjects). Figure 4 It was shown that the expression level of hsa_circ_0076798 in liver tissue of patients with liver fibrosis was significantly reduced.
[0082] Example 4: Overexpression of hsa_circ_0076798 in human M1 macrophages to investigate the regulatory effect of hsa_circ_0076798 on the inflammatory phenotype of macrophages
[0083] (1) PEI transfection of HEK-293T cells to produce hsa_circ_0076798 overexpression lentivirus
[0084] To prepare the transfection complex: Add 1.63μg of the packaging plasmids pMD2.G and 4.88μg of psPAX2, along with 6.50μg of the target plasmid, to 520μL of Opti-MEM® (Component A) and gently mix. Add 39μg of PEI to 520μL of Opti-MEM® (Component B) and gently mix. Gently vortex A and B for 1-2 seconds and let stand at room temperature for 5 minutes. Slowly add a drop of the diluted PEI solution (Component B) to the diluted DNA solution (Component A). Immediately, gently vortex and mix for 1-2 seconds. Let stand at room temperature for 20 minutes to obtain the PEI-DNA mixture.
[0085] Resuscitate 293T cells and passage to the 2nd to 5th generation. When cells are fully grown, digest with trypsin, bend into single cells, count and plate (15 cm culture dish / 3.38-3.9×10 6 Inoculate 100 cells and culture for 46 hours. Two hours before transfection (cell confluence approximately 70%), change the cell culture medium (18 mL). Add the PEI-DNA mixture dropwise to the cell culture medium and mix thoroughly. Place in the incubator and continue culturing. After 12 hours of culture, change the medium (25 mL). Collect the viral supernatant 48 and 84 hours after the medium change, filter through a 0.45 μm microporous membrane, and transfer 36 mL of the supernatant to each 50 mL centrifuge tube.
[0086] (2) Concentrate lentivirus by ultracentrifugation.
[0087] Add the viral supernatant to the ultracentrifuge tube, place the ultracentrifuge tube in an ultracentrifuge, screw on the lid, and vacuum for 20 minutes; centrifuge at 4°C, 25,000×g, adjust the speed to 0, and centrifuge for 2 hours; after centrifugation, discard the supernatant, add 50-100 μL of PBS to each ultracentrifuge tube, and shake on ice to dissolve the viral precipitate; aliquot the concentrated virus solution and store in a -80°C refrigerator.
[0088] (3) Cell grouping
[0089] The target THP-1 cells in good condition were seeded into a 6-well plate to a cell concentration of 3×10 5 / mL, 2mL / well, the number of cells in each well is about 6×10 5 The cells were cultured overnight in a 37°C, 5% CO2 incubator. Three experimental groups were set up: a control group (normal THP-1 cells without any treatment), an empty lentivirus group (THP-1 cells were transfected with empty lentivirus), and an hsa_circ_0076798 overexpression group (THP-1 cells were transfected with hsa_circ_0076798 overexpression lentivirus).
[0090] (4) Cell transfection with lentivirus
[0091] The confluence of the cultured cells was between 30% and 50%. Before infection, the virus was removed and slowly thawed on ice. The original culture medium of the cells was aspirated and 2 mL of fresh culture medium was added. According to the MOI value = 50, the titer = 1.39 × 10 10 , add 4.3μL of lentivirus concentrate and 1μL of polybrene. For the infection of suspended or semi-suspended cells, the plate centrifugation transfection technique is used. First, resuspend the cells, then add an appropriate amount of virus solution to the cell culture dish, cover tightly, and then centrifuge at low speed (1200×g) for 1 hour in a plate centrifuge. After centrifugation, move the culture dish to the incubator and continue to culture. On the second day of infection (approximately 24 hours later), remove the virus-containing culture medium, replace it with fresh complete culture medium, and continue to culture at 37°C. 48 hours after infection, PMA was used to induce M0 macrophages, and then LPS and IFN-γ were used to induce M1 macrophages. Finally, RT-qPCR and Western Blot were used to detect changes in macrophage phenotype.
[0092] (5) Verification of hsa_circ_0076798 overexpression efficiency
[0093] The cells were collected, RNA was extracted by trizol method, and the reverse transcription steps were the same as in Example 2. The obtained cDNA was used for qPCR to detect the expression changes of hsa_circ_0076798. The results are shown in Figure 2. Figure 5 As shown, the expression level of hsa_circ_0076798 in the hsa_circ_0076798 overexpression group increased by several thousand times.
[0094] (6) Cell RNA extraction and qPCR experiment
[0095] After collecting the cells, RNA was extracted according to the method in Example 2. Then, the mRNA was reverse transcribed into cDNA using the HiScript III RT SuperMix for qPCR (+gDNA wiper) kit. The specific steps are as follows:
[0096] First, genomic DNA was removed using the reagents and amounts shown in Table 3. Specifically, the reagents were gently pipetted and mixed, and the mixture was reacted at 42° C. for 2 minutes.
[0097] Table 3 Reagents and dosages required for genomic DNA removal
[0098]
[0099] Next, perform a reverse transcription reaction using the reagents and amounts required for the mRNA reverse transcription reaction system in Table 4. Specific reverse transcription reaction conditions are: 37°C for 15 minutes and 85°C for 5 seconds. The resulting cDNA product can be used immediately for qPCR reactions or stored at -20°C for use within six months. For long-term storage, it is recommended to store the product in aliquots at -70°C.
[0100] Table 4 mRNA reverse transcription reaction system
[0101]
[0102]
[0103] Finally, the cDNA product was subjected to qPCR detection, and the specific process was the same as the qPCR detection in Example 2, wherein the inflammation primer sequences are shown in Table 5.
[0104] Table 5 Inflammation primer sequences
[0105]
[0106] RT-qPCR results, such as Figure 6 , showing that compared with the empty control group vector, the hsa_circ_0076798 overexpression group reduced the expression of inflammation-related genes TNF-α and IL-1β, and promoted the expression of anti-inflammatory related genes ARG-1 and CD206.
[0107] (7) Preparation of cell slides and immunofluorescence detection
[0108] During the cell immunofluorescence process, the slides were first immersed in cell culture medium, and cells were grown on the slides before the cell immunofluorescence was performed. Day 1: The slides on which cells had been grown were washed with PBS 3 times for 3 minutes each time; the slides were fixed with 4% paraformaldehyde for 20 minutes, and then washed with PBS 3 times for 3 minutes each time; 0.3% Triton Permeabilize with X-100 at room temperature for 20 minutes; wash the slides with PBS 3 times for 3 minutes each time, aspirate PBS, add normal goat serum on the slides, and block at room temperature for 30 minutes; aspirate the blocking solution, do not wash, add a sufficient amount of diluted primary antibody to each slide and place it in a humidified box, and incubate overnight at 4°C; the next day: place the humidified box in a 37°C incubator and rewarm for 1 hour; wash the slides with PBS 3 times for 5 minutes each time, aspirate excess liquid on the slides and add diluted fluorescent secondary antibody, incubate in a humidified box at 37°C for 1 hour, wash the slides with PBS 3 times for 5 minutes each; counterstain the nucleus: add DAPI and incubate in the dark for 5 minutes to stain the nucleus, wash 5 times with PBS, each for 5 minutes to wash away excess DAPI; aspirate the liquid on the slides, seal the slides with a sealing solution containing anti-fluorescence quencher, and then observe and collect images under a fluorescence microscope.
[0109] The results are as follows Figure 7 As shown in the results, the hsa_circ_0076798 overexpression group inhibited the expression of inflammatory factor IL-1β and inflammatory phenotype-specific protein CD68, and promoted the expression of macrophage anti-inflammatory phenotype-specific protein CD206 and anti-inflammatory factor ARG-1.
[0110] (8) Cell protein extraction and Western Blot detection
[0111] The whole process was performed on ice. 10 μL of PMSF (100 mM) was added to 1 mL of lysis buffer for 30 minutes, and then centrifuged at 12000 rpm at 4°C for 20 minutes. The supernatant after centrifugation was transferred to a new EP tube and stored at -20°C or -80°C. After measuring the protein concentration using the BCA method, the amount of sample loaded was calculated to keep the amount loaded per well consistent. According to the size of the target protein, appropriate upper and lower layers of gel were prepared, and the concentrated gel electrophoresis was performed at a constant voltage of 80 volts and a timer of 20 minutes. The separation gel electrophoresis was performed at a constant voltage of 100 volts and a timer of not less than 120 minutes until the electrophoresis indicator moved to the bottom edge of the gel plate. Then the membrane was transferred at a constant voltage of 100 volts for 1 hour. After transfer, the membrane was placed in TBST in a culture dish and washed on a horizontal shaker for 3×10 minutes. About 5% skimmed milk powder was prepared with TBST, and the washed membrane was placed in it and blocked on a horizontal shaker at room temperature for at least 60 minutes. Prepare primary antibodies: Prepare primary antibody working solution in TBST. Generally, 1 mL of working solution per membrane is sufficient for different primary antibody dilution ratios. In this example, four proteins, CD11c, CD206, ARG-1, and MCP-1, were detected. Incubate overnight at 4°C (8-12 hours on a seesaw shaker). Wash the membrane 3 times for 10 minutes in TBST. Prepare secondary antibody working solution with HRP goat anti-mouse and HRP goat anti-rabbit secondary antibodies and incubate at room temperature for 1.5 hours. Wash again with TBST 3 times for 10 minutes. Add chemiluminescent developer and develop the membrane.
[0112] like Figure 8 As shown, Western Blot results showed that compared with the empty control group vector, the hsa_circ_0076798 overexpression group reduced the expression of inflammation-related proteins CD11c and MCP-1, and promoted the expression of anti-inflammatory related proteins ARG-1 and CD206.
[0113] Example 5: Prediction and verification of the downstream target of hsa_circ_0076798, miR-1184
[0114] Using the circinteractome database, the potential target miRNA with the highest binding score for hsa_circ_0076798 was predicted to be miR-1184 ( Figure 9). RT-qPCR was then used to detect the expression level of miR-1184 in liver tissues of clinical patients with liver fibrosis and healthy subjects. Figure 10 As shown in the results, compared with healthy controls, the expression level of miR-1184 in the liver tissue of patients with clinical liver fibrosis was significantly upregulated, which to some extent also indicates that hsa_circ_0076798 may be correlated with miR-1184, and hsa_circ_0076798 may negatively regulate the expression of miR-1184.
[0115] Example 6: Prediction and verification of miR-1184 downstream target DICER1
[0116] TargetScan and MiRDB target gene prediction data software were used to predict the downstream target genes of miR-1184, and the mRNA with the highest interaction score was DICER1 ( Figure 11 ). The expression of target gene DICER1 in clinical samples was further detected by RT-qPCR. Figure 12 As shown in Figure 3, DICER1 expression was significantly downregulated in liver tissues of patients with clinical liver fibrosis compared with healthy controls.
[0117] Example 7: Dual luciferase verification of the direct binding interaction between hsa_circ_0076798 and miR-1184 (1) Vector and target gene information
[0118] Psi-Check2 vector map Figure 13 shown.
[0119] hsa_circ_0076798 sequence information:
[0120] >hsa_circ_0076798-3UTR-wt:104bp(5'-3')
[0121] GTGGCAATGCAGTGGTGGATGGTTGTGGCAAGGCCCAGAACAGCACGGAGCTC GCTGC AG AGGAGTACACCCTCATGAGCATAGACACCATCATCAATGGGAAG;
[0122] >hsa_circ_0076798-3UTR-mut: (5'-3')
[0123] GTGGCAATGCAGTGGTGGATGGTTGTGGCAAGGCCCAGAACAGCACGGAGCTC CCAGG
[0124] AC AGGAGTACACCCTCATGAGCATAGACACCATCATCAATGGGAAG
[0125] Note: This sequence was directly synthesized into the psi-Check2 vector. The underlined portion of the sequence indicates the binding site; the oblique letters indicate the mutated base.
[0126] >hsa-miR-1184MIMAT0005829
[0127] C CUGCAGC GACUUGAUGGCUUCC
[0128] (2) Dual-fluorescein reporter gene assay (2-1) Plasmid / miRNA co-transfection
[0129] Prepare 293T cells (seeded in 96-well plates) and the target plasmid, and wait until the cell density reaches 50%-70%; add 0.2 μg of the hsa_circ_0076798-3'UTR target plasmid and 0.4 μL of miRNA (final concentration 100 nM, miR-1184 mimic, mimic NC, miR-1184 inhibitor, and inhibitor NC in each group) to 10 μL Opti-MEM serum-free medium, mix thoroughly, and incubate at room temperature; mix the Lipofectamine reagent, dilute 0.4 μL of Lipofectamine reagent with 10 μL Opti-MEM serum-free medium, mix gently, and incubate at room temperature for 5 minutes; gently mix the diluted miRNA, plasmid, and Lipofectamine reagent and incubate at room temperature for 20 minutes; replace the cells with fresh medium before transfection, then add the transfection mixture to the cell wells and mix thoroughly. The cells were cultured at 37°C with 5% CO2. Fresh culture medium was exchanged 6 hours after transfection, and cells were collected for testing 48 hours after transfection.
[0130] (2-2) Reporter fluorescence detection experimental steps
[0131] After removing the culture medium, the cells were washed twice with PBS, then 20 μL of 1x Cell Lysis Buffer was added, and the cells were lysed at room temperature for 5 minutes with gentle shaking. Next, the lysate was centrifuged at 11,200 rpm at room temperature for 2 minutes. The supernatant was collected for subsequent experimental analysis. 100 μL of Luciferase Substrate, which had been equilibrated to room temperature, was added to the enzyme-labeled plate or detection tube, and then 20 μL of cell lysate supernatant was added to the wells of the enzyme-labeled plate or the detection tube. After rapid mixing, the activity of the Firefly luciferase reporter gene was immediately measured on the enzyme-labeled instrument. 100 μL of freshly prepared Renilla substrate working solution was added to the reaction solution, and after rapid mixing, the activity of the Renilla luciferase reporter gene was immediately measured on the enzyme-labeled instrument.
[0132] To directly prove the mutual binding between hsa_circ_0076798 and miR-1184, whether there is a binding site of miR-1184 in the 3'UTR of hsa_circ_0076798 was studied by using a dual-luciferase reporter system. The results are as follows Figure 14 As shown, in the miRNA mimic reaction group, the relative fluorescence intensity (R / F) of the hsa_circ_0076798 3'UTR wild-type plasmid group was significantly lower than that of the hsa_circ_0076798 3'UTR mutant plasmid group; in the miRNA inhibitor reaction group, the relative fluorescence intensity (R / F) of the hsa_circ_0076798 3'UTR wild-type plasmid group was significantly higher than that of the hsa_circ_0076798 3'UTR mutant plasmid group. This indicates that only the wild-type plasmid (containing the binding site) can bind to miR-1184, proving that there is a binding site of miR-1184 in hsa_circ_0076798.
[0133] Example 8: Dual-luciferase verification of the direct binding of DICER1 and miR-1184
[0134] (1) Vector and target gene information
[0135] The psi-Check2 vector map is the same as in Example 7.
[0136] DICER1 sequence information:
[0137] >DICER1-3UTR-wt: 1000 bp (5'-3')
[0138] cctccagcagtccctaggatgatgtagattctctctctctccgtgtgtgcagtagtgccagtc ct gcag tagttgataagctgaatagaaagat
[0139] aagttttcgagaggagaagtgcgccGccttctaggctgttgctctaaaaataaacttagacatatcacacctaaaatat gctgcag attttat
[0140] aattgattggttactttaagaagcaaaacagcaccttacccttagtctccCctaccagtgggggtggttgtgccctgagcacgtgtgtaaa
[0141] ggactggggaggcgtgtcttgaaaaagcaa ctgcag aaattccttatgattgtgtgcaagttagttaacatgaaccttcGgctgctttggttca
[0142] tgaatccaggtgttcccccggcggcggcttcgtcgctccctggaggcaggtgggca ctgcag aggatcactggaatccagatcgagcg
[0143] cagttcatgcaaggccccgttggccaccaactgagaccttgataccttttttaactgcatctgaaattatgttaagagtctttaacccatttgcat
[0144] father ctgcag aagagaaactcatgtcatgtttattacctatatggttggtccatttttatttggacatcaaccacagacaatttaaattttatagatgcacta
[0145] agaattca ctgcagcagcaggttacatagcaaaaatgcaaaggtgaacaggaagtaaatttctggcttttctgctgtaaatagtgaaggaaaatta
[0146] ctaaaatcaagtaaaactaatgcatattatttgattgacaataaaaatatttaccatcacat gctgcag ctgttttttaaggaacatgatgtcattcattcat
[0147] acagtaatcat gctgcag aaatttgcagtctgcaccttatggatcacaattacctttagttgttttttttgtaataattgtagccaagtaaatctccaataa
[0148] agttatcgtctgttca
[0149] >hsa_circ_0076798-3UTR-mut:1000bp(5'-3')
[0150] Cctccagcagtccctaggatgatgtagattcttctccatctctccgtgtgtgcagtagtgccagtc Gt CcT tagttgataagctgaatagaaag
[0151] ataaggttttcgagaggagaagtgcgccGccttctaggctgttgctctaacaaaataaaccttagacatatcacacctaaaatat CcAgGaC at
[0152] tttataattgattggttacttatttaagaagcaaaacacagcacctttacccttagtctccCctaccagtggggtgtggttgtgccctgagcacgtgtg
[0153] taaaggactggggaggcgtgtcttgaaaaagcaa GtC aaattccttatgatgattgtgtgcaagttagttaacatgaaccttcGgctgcttt
[0154] ggttcatgaatccaggtgttcccccggcagtcggcttcttcagtcgctccctggaggcaggtgggca G TKMv aggatcactggaatccagat
[0155] cgagcgcagttcatgcacaaggccccgttggccaccaaactgagaccttgatacctttttttaactgcatctgaaattatgttaagagtctttaaccc
[0156] atttgcattat GtC aagagaaactcatgtcatgtttattacctatatggttggtccatttttatttggacatcaaccacagacaatttaaattttata
[0157] gatgcactaagaattca GtC cagcaggttacatagcaaaaatgcaaaggtgaacaggaagtaaatttctggcttttctgctgtaaatagtga
[0158] aggaaaattactaaaatcaagtaaaactaatgcatattatttgattgacaataaaatatttaccatcacat CcAgGaC ctgttttttaaggaacatga
[0159] tgtcattcattcatacagtaatcat CcAgGaC aaatttgcagtctgcaccttatggatcacaattacctttagttgttttttttgtaataattgtagccaa
[0160] gtaaatctccaataaagttatcgtctgttca
[0161] Note: This sequence was directly synthesized into the psi-Check2 vector. Horizontal lines indicate binding sites; diagonal letters indicate mutated bases.
[0162] >hsa-miR-1184MIMAT0005829
[0163] C CUGCAGCGACUUGAUGGCUUCC
[0164] (2) Dual fluorescein
[0165] Reporter gene assays
[0166] The specific steps are the same as those in Example 7.
[0167] In order to study the direct interaction between miR-1184 and DICER1, a dual-luciferase reporter system was designed. The psi-Check2 plasmid and mutant plasmid containing the DICER1 3'UTR binding site were constructed. The plasmid and miR-1184 mimic were co-transfected into 293T cells. The fluorescence intensity of each group of cells was detected using a dual-luciferase kit. The results are shown in Figure 2. Figure 15 The results showed that the DICER1 wild-type plasmid could bind to the miR-1184 mimic, inhibiting dual-luciferase gene expression and significantly weakening the fluorescence intensity (R / F). This indicates that the DICER1 3'UTR contains a binding site for miR-1184, which is one of the eight predicted sites.
[0168] Example 9: Regulatory Effects of miR-1184 on Inflammatory Phenotype in Human Macrophages
[0169] miRNA mimics or miRNA inhibitors are a simple and efficient miRNA research tool, and transfection efficiency can be observed through transfection controls.
[0170] (1) Cell grouping
[0171] The miRNA mimic and inhibitor were used to verify the function of miR-1184. The in vitro experiments were divided into five groups, namely, the positive control group (M1 group, THP-1 polarized into M1 macrophages by PMA, LPS and IFN-γ), the M1 plus the miR-1184 mimic negative control reagent mimic NC co-culture group (mimic NC group), the M1 plus the mimic miR-1184mimic co-culture group (miR-1184mimic group), the M1 plus the miR-1184 inhibitor negative control reagent inhibitor NC co-culture group (inhibitor NC group) and the M1 plus the inhibitor miR-1184inhibitor co-culture group (miR-1184inhibitor group).
[0172] (2) Transfection method
[0173] The initial concentration of miRNA mimic is 50nM; the concentration of miRNA inhibitor is 100nM; the initial concentration of miRNA mimic NC is 50nM; the initial concentration of miRNA inhibitor NC is 100nM.
[0174] Inoculate 1×10 5 -5×10 5 Transfer cells to a 24-well plate containing an appropriate amount of complete culture medium so that the cell density at the time of transfection can reach 30-50%; dilute the mimic: use 30 μL 1×riboFECT TM Dilute 1.25 μL of 20 μM miRNA mimic with CP Buffer and mix gently; prepare the mixture (add 3 μL of riboFECT TM CP Reagent, gently pipette to mix, and incubate at room temperature for 0-15 minutes); TM The CP mixture was added to complete culture medium without double antibodies and gently mixed. 100 ng / mL PMA, 100 ng / mL LPS, and 20 ng / mL IFN-γ were added to each group of macrophages for induction and activation. After culturing in a CO2 incubator at 37°C for 48 hours, the cells of each group were collected for detection.
[0175] To clarify the regulatory relationship between miR-1184 and macrophage phenotypic remodeling and inflammation, THP-1 was knocked down or overexpressed according to the above experimental conditions, and then polarized into M1 macrophages. The expression of inflammation-related genes in each group of cells was detected by RT-qPCR. Figure 16 As shown in the results, compared with M1 macrophages, miR-1184 mimic significantly promoted the expression of inflammation-related genes (IL-6, IL-1β, and TNF-α) and suppressed the expression of the anti-inflammatory gene Arg-1, while miR-1184 inhibitor produced the opposite effect. This suggests that miR-1184 has the function of promoting the inflammatory response of macrophages.
[0176] Western Blot was used to detect the expression of inflammation-related and phenotype-related proteins on macrophages in each group. Figure 17Compared with the untreated M1 macrophage group and the NC group, miR-1184 mimic significantly promoted the expression of inflammatory proteins (CD11c, IL-6, MCP-1, iNOS, IL-1β, and TNF-α) and inhibited the expression of the M2 surface marker protein CD206; the miR-1184 inhibitor showed the opposite trend to the miR-1184 mimic group. These results indicate that miR-1184 can, to a certain extent, lead to the aggravation of macrophage inflammation.
[0177] Example 10: Regulatory Effect of DICER1 on Inflammatory Phenotype in Human Macrophages
[0178] (1) Cell grouping
[0179] The target THP-1 cells were seeded into 6-well plates, with the number of cells per well being approximately 2×10 6 The cell suspension volume was 800 μL / well. Two groups were set up according to the experimental requirements: a negative control siRNA group (siRNA NC group, transfected with THP-1 but did not cause any gene silencing) and a DICER1 knockdown group (DICER1 siRNA group, transfected with THP-1 to cause DICER gene silencing).
[0180] (2) Transfection method
[0181] siRNA was transfected into THP-1 cells using RNAFit transfection reagent (purchased from Hanheng Biotechnology). The details are as follows: suspension cells were transfected using the semi-liquid method. On the day of transfection, 10 6 THP-1 cells were added with 800 μL RPMI1640 complete medium; 5 μL of 20 μM siRNA was added to 200 μL Opti-MEM medium and mixed; 7.5 μL RNAFit was added to the above mixture and vortexed for 10 seconds to mix; incubated at room temperature for 10 minutes; 200 μL of incubated transfection complex was added to the prepared 800 μL cell suspension and shaken crosswise; 1 mL of liquid was added after 6 hours; after normal culture in a CO2 incubator for 48 hours, it was used for subsequent detection.
[0182] Next, we verified whether the predicted DICER1 could regulate the inflammatory phenotype of macrophages. Aigi provided the design and synthesis of 6 siRNAs, and tested the knockdown efficiency of the six siRNAs. Knockdown experiments were carried out according to the above siRNA concentration, cell number and transfection time. The results are as follows: Figure 18 As shown, siRNA6 with the highest relative knockdown efficiency was selected for subsequent experiments.
[0183] After THP-1 cells were transfected with siRNA6 to knock down the DICER1 gene and induced to polarize into M1 macrophages, RNA of each group of cells was extracted and converted into cDNA. RT-qPCR results showed that ( Figure 19 ), compared with the untreated M1 group, the expression levels of inflammation-related genes (IL-6, CCL13, CD68, CCL2, CXCL2, IL-1β and TNF-α) in the DICER1 knockdown group (siDICER1) were significantly upregulated, indicating that DICER1 inhibits the inflammatory response of macrophages to a certain extent.
[0184] Then, Western Blot was used to detect the expression of inflammation-related proteins in each group of cells after DICER1 knockdown. Figure 20 As shown in the results, compared with the control group, the DICER1 knockdown group (siDICER1) showed a significant increase in the M1 macrophage surface marker CD86, while the M2 macrophage surface marker CD206 and the anti-inflammatory protein Arg-1 were significantly decreased. Consistent with the RT-qPCR results above, DICER1 can indeed inhibit the macrophage inflammatory response to a certain extent.
[0185] Example 11: Study on the pathways involved in regulating macrophage phenotype by DICER1
[0186] (1) Transcriptome sequencing
[0187] DICER1 was knocked down. The specific process was the same as Example 10, and total RNA was extracted from cells in each group.
[0188] (2) Bioinformatics Analysis
[0189] The sequencing results of the three DICER1 knockdown groups and the three control groups were used to analyze the differentially expressed genes and enrich the KEGG pathway.
[0190] To investigate the signaling pathways through which the hsa_circ_0076798 / miR-1184 / DICER1 axis regulates macrophage phenotype and inflammatory response, the DICER1 gene in M1 macrophages was knocked down by siRNA. Then, transcriptome sequencing was performed on the M1 control group and the DICER1 knockdown group, and the sequencing results were subjected to bioinformatics analysis.
[0191] Call DESeq2 to normalize the original transcriptome expression matrix (count), perform differential expression analysis, and use a volcano plot to display all significant differentially expressed genes (P value < 0.05, |FC| > 2), as shown in the following example: Figure 21 shown.
[0192] Subsequently, the KEGG pathway enrichment was performed on the screened differential genes, such as Figure 22 As shown in the figure, the bubble chart shows the enrichment of related signaling pathways from high to low significance, among which the TNF / NF-κB signaling pathway is the most significant signaling pathway and is a typical inflammatory signaling pathway.
[0193] To verify the TNF / NF-κB signaling pathway enriched by bioinformatics analysis, the changes in TNFR1, p65 phosphorylation, and IκBα phosphorylation in each group of cells were detected. In the classic NF-κB activation pathway, external inflammatory stimuli such as TNF-α bind to the TNF receptor protein TNFR1, activating IκB kinase (IKK) to phosphorylate IκBα (a protein that inhibits NF-κB). Once IκBα is degraded, the activated form of NF-κB (usually the p50 / p65 heterodimer) is released from its complex and enters the cell nucleus. The p65 subunit in the NF-κB complex is phosphorylated in the cell nucleus. This process can affect the activity of NF-κB and its ability to regulate gene transcription. The results are as follows Figure 23As shown, the left panel results show that compared with the THP-1 group, TNFR1 (TNF receptor protein) is obviously highly expressed on M1 macrophages, the total amount of p65 expression is unchanged, the phosphorylation level is increased, the total amount of IκBα expression is unchanged, and the phosphorylation level is increased, indicating that after THP-1 is induced to polarize into M1 type, the TNF / NF-κB pathway is activated; after hsa_circ_0076798 is overexpressed on M1 type macrophages, the expression of TNFR1 is suddenly reduced, the phosphorylation levels of p65 and IκBα are decreased under the condition that the total amount of expression is unchanged, indicating that hsa_circ_0076798 can inhibit the TNF / NF-κB signal pathway; when miR-1184 is overexpressed on the basis of hsa_circ_0076798 overexpression, the results show that the above phenomenon is reversed, the expression of TNFR1 is up-regulated, the phosphorylation levels of p65 and IκBα are increased under the condition that the total amount of expression is unchanged, indicating that miR-1184 can antagonize the effect of hsa_circ_0076798 on inhibiting the TNF / NF-κB signal pathway, and activate the TNF / NF-κB signal pathway. The right panel results show that when miR-1184 is knocked down on M1 type macrophages, the expression of TNFR1 is suddenly reduced, the phosphorylation levels of p65 and IκBα are decreased under the condition that the total amount of expression is unchanged, which also indicates that miR-1184 has an activating effect on the TNF / NF-κB signal pathway; and on the basis of knocking down miR-1184 on M1 type macrophages, DICIER1 gene is knocked down, and it is found that this phenomenon is reversed again, the expression of TNFR1 is up-regulated, the phosphorylation levels of p65 and IκBα are increased under the condition that the total amount of expression is unchanged, which indicates that the knocking down of DICER1 can offset the knocking down effect of miR-1184, in other words, miR-1184 can combine with DICER1 to inhibit the expression of DICER1 and activate the TNF / NF-κB signal pathway.
[0194] In addition, the present application studies the effect of human embryonic stem cell-derived exosomes on inflammation in mice: tail vein injection of exosomes experiment: 1) normal group, normal BALB / c mice without any treatment, 2) PBS group, liver fibrosis mice injected with PBS through the tail vein, 3) hESC-Exo group (i.e. 3D-hESC-derived exosome group), liver fibrosis mice injected with 100 μg 3D-Exo diluted with 100 μL PBS through the tail vein, 2 times a day, after one week of treatment, similarly, enucleation blood was taken, serum was obtained by centrifugation, and liver function biochemical indicators such as ALT, AST, TBIL, ALB were detected; after the mice were treated by decapitation, the mouse liver was collected, tissue RNA was extracted, and the expression of inflammation-related genes IL-6, TNF-α and IL-1β was detected by RT-qPCR. The test results are as follows Figure 24 and 25 . Figure 24Compared with the PBS group, the hESC-Exo group significantly reduced ALT, AST, and TBIL, and increased ALB, indicating that hESC-Exo can promote the recovery of liver function. Figure 25 Compared with the PBS group, the hESC-Exo group significantly inhibited the expression of inflammation-related genes CD68, IL-6, CCL2 and TNF-α, and promoted the expression of anti-inflammatory-related genes CD206, ARG-1 and CD163.
[0195] Similarly, circular RNA (hsa_circ_0076798) was used to induce inflammation in mice. The effect was similar to that of human embryonic stem cell-derived exosomes in inducing inflammation in mice.
Claims
1. Application of circular RNA derived from human pluripotent stem cell exosomes in the preparation of an anti-inflammatory drug for liver fibrosis, characterized by: CircBase ID of the circular RNA: hsa_circ_0076798; The DNA sequence corresponding to the circular RNA is SEQ ID NO.
1.
2. Use of circular RNA derived from human pluripotent stem cell exosomes in the preparation of a preparation for preventing and treating inflammation and reversing liver fibrosis, characterized by: CircBase ID of the circular RNA: hsa_circ_0076798; The DNA sequence corresponding to the circular RNA is SEQ ID NO.
1.
3. Use of circular RNA derived from human pluripotent stem cell exosomes in the preparation of a drug for regulating macrophage phenotype and inhibiting inflammatory response in liver fibrosis, characterized by: CircBase ID of the circular RNA: hsa_circ_0076798; The DNA sequence corresponding to the circular RNA is SEQ ID NO.
1.
4. The use according to claim 3, characterized in that: The drug acts on miR-1184 to relieve the inhibition of DICER1, and the expressed DICER1 regulates its downstream TNF / NF-κB signaling pathway to promote macrophage phenotype polarization and inhibit liver inflammatory response.
5. The use according to any one of claims 1 to 3, characterized in that: The human pluripotent stem cell exosomes are obtained by expanding human embryonic stem cells in 2D culture, then performing 3D suspension culture, collecting the supernatant, and centrifuging.