Method for preparing 2-amino-4-methylthio-butanoic acid or 2-hydroxy-4-methylthio-butanoic acid

By reacting 2,3-tetrahydrofurandione with methyl mercaptan to generate α-keto-γ-methylthiobutyric acid, and then using biocatalysis to convert it into 2-amino-4-methylthio-butyric acid or 2-hydroxy-4-methylthio-butyric acid, the problems of excessive by-products and the use of highly toxic substances in chemical synthesis methods are solved, and green and efficient methionine production is achieved.

WO2025195344A1PCT designated stage Publication Date: 2025-09-25MOJIA (SHANGHAI) BIOTECH CO LTD
View PDF 14 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/083036
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-03-19
Filing Date
2025-03-18
Publication Date
2025-09-25

AI Technical Summary

Technical Problem

The existing chemical synthesis method for producing methionine has problems such as many by-products, complex equipment, high energy consumption and the use of highly toxic substances, resulting in high production costs and difficulty in industrialization.

Method used

2,3-Tetrahydrofurandione is reacted with methyl mercaptan to generate α-keto-γ-methylthiobutyric acid, which is then catalyzed by transaminase, amino acid dehydrogenase or α-hydroxy acid dehydrogenase to generate 2-amino-4-methylthio-butyric acid or 2-hydroxy-4-methylthio-butyric acid. The biocatalytic process is used to reduce the generation of by-products and equipment requirements.

Benefits of technology

The green and sustainable production of methionine and hydroxymethionine is achieved, production costs are reduced, process steps are simplified, and the use of highly toxic substances is reduced, making the process suitable for industrial production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025083036_25092025_PF_FP_ABST
    Figure CN2025083036_25092025_PF_FP_ABST
Patent Text Reader

Abstract

A method for preparing 2-amino-4-methylthio-butanoic acid or 2-hydroxy-4-methylthio-butanoic acid by using 2,3-tetrahydrofurandione. The method mainly comprises the following steps: subjecting lactic acid and formaldehyde to enzymatic catalysis to synthesize an intermediate 2,3-tetrahydrofurandione, then using a chemical method to synthesize α-keto-γ-methylthiobutanoic acid or a salt thereof, and then carrying out an enzyme-catalyzed reaction to respectively synthesize 2-amino-4-methylthio-butanoic acid or 2-hydroxy-4-methylthio-butanoic acid.
Need to check novelty before this filing date? Find Prior Art

Description

Preparation method of 2-amino-4-methylthio-butyric acid or 2-hydroxy-4-methylthio-butyric acid Technical Field

[0001] The present invention belongs to the field of biological and chemical technology and relates to a method for preparing 2-amino-4-methylthio-butyric acid or a salt thereof, or 2-hydroxy-4-methylthio-butyric acid or a salt thereof, by combining enzyme catalysis and organic synthesis. Specifically, the present invention relates to a method for preparing 2-amino-4-methylthio-butyric acid or a salt thereof, or 2-hydroxy-4-methylthio-butyric acid or a salt thereof from 2,3-tetrahydrofurandione. Background Art

[0002] Methionine, also known as methionine and 2-amino-4-methylthio-butyric acid, is an essential amino acid that plays an important role in human growth, development, and health. It is widely used in various industries, including medicine, food, and cosmetics. It is also an essential additive in animal feed, used to increase lean meat content in poultry and shorten the feeding cycle. Currently, commercially available methionine for feed is mainly divided into methionine and hydroxymethionine (also known as "2-hydroxy-4-methylthio-butyric acid" and "liquid methionine"), both of which have the same physiological function in organisms. In recent years, global demand for methionine has increased year by year, but my country's methionine production cannot meet the needs of the rapidly developing feed industry, so it mainly relies on imports from overseas.

[0003] Currently, methionine is primarily produced by chemical synthesis and fermentation. Due to the low yield of the fermentation method, chemical synthesis is widely used by methionine manufacturers worldwide. Chemical synthesis can be further divided into the hydantoin method and the cyanohydrin method. While the hydantoin method, which is used to synthesize methionine, is a relatively mature process, it produces a large amount of byproducts such as sodium sulfate, is complex in terms of technology and equipment, and consumes a lot of energy. The cyanohydrin method, while having a shorter process, also produces highly toxic substances such as hydrogen cyanide, requiring high equipment safety requirements and generating three wastes.

[0004] Therefore, it is particularly important to seek a green, efficient, cost-effective method that is easy to industrialize.

[0005] Summary of the Invention

[0006] The present invention provides a method for producing methionine using 2,3-tetrahydrofurandione. In this method, 2,3-tetrahydrofurandione, which has a lactone structure, reacts with methyl mercaptan salt to produce the methionine precursor α-keto-γ-methylthiobutyric acid. The reaction is easy to carry out and has a high conversion rate. This precursor can produce liquid methionine under the catalysis of α-hydroxy acid dehydrogenase, and can also produce methionine under the catalysis of transaminase and amino acid dehydrogenase, simultaneously meeting the synthesis requirements of both products. The 2,3-tetrahydrofurandione used in this method can be synthesized in a one-pot process from lactic acid and formaldehyde, where lactic acid can be further obtained through glucose metabolism. The raw material cost required for the reaction is low, the steps are simple, and the generation of by-products is greatly reduced. In addition, the production process does not require the use of highly toxic substances such as hydrocyanic acid and natural gas, reducing equipment requirements and corresponding costs, and achieving the green and sustainable production requirements of methionine and hydroxymethionine.

[0007] In one aspect, the present application provides a method for preparing 2-amino-4-methylthio-butyric acid or a salt thereof, or 2-hydroxy-4-methylthio-butyric acid or a salt thereof, the method comprising the following steps:

[0008] (1) converting 2,3-tetrahydrofurandione into α-keto-γ-methylthiobutyric acid or a salt thereof; and

[0009] (2) converting the α-keto-γ-methylthiobutyric acid or its salt prepared in step (1) into 2-amino-4-methylthio-butyric acid or its salt, or 2-hydroxy-4-methylthio-butyric acid or its salt.

[0010] In certain embodiments, step (1) comprises reacting 2,3-tetrahydrofurandione with methyl mercaptan or a salt thereof to obtain α-keto-γ-methylthiobutyric acid or a salt thereof. In certain embodiments, the methyl mercaptan salt is potassium methyl mercaptan or sodium methyl mercaptan.

[0011] In certain embodiments, step (1) comprises adjusting the temperature to greater than 120° C. (eg, 160° C.) In certain embodiments, step (1) comprises adjusting the pH to less than 2 (eg, 1).

[0012] In certain embodiments, step (2) includes a sub-step (2-1), wherein the sub-step (2-1) includes: converting the α-keto-γ-methylthiobutyric acid or a salt thereof prepared in step (1) into 2-amino-4-methylthio-butyric acid or a salt thereof in the presence of a transaminase. In certain embodiments, the sub-step (2-1) includes: converting the α-keto-γ-methylthiobutyric acid or a salt thereof prepared in step (1) into 2-amino-4-methylthio-butyric acid or a salt thereof in the presence of a transaminase, a glutamate dehydrogenase, a formate dehydrogenase, glutamate, and ammonium formate. In certain embodiments, the NCBI accession number of the transaminase is WP_001087611.1. In certain embodiments, the NCBI accession number of the glutamate dehydrogenase is NP_391659.2. In certain embodiments, the Uniprot accession number of the formate dehydrogenase is P33160.3.

[0013] In certain embodiments, step (2) includes a sub-step (2-2), wherein the sub-step (2-2) includes: converting the α-keto-γ-methylthiobutyric acid or a salt thereof prepared in step (1) into 2-amino-4-methylthio-butyric acid or a salt thereof in the presence of an amino acid dehydrogenase. In certain embodiments, the sub-step (2-2) includes: converting the α-keto-γ-methylthiobutyric acid or a salt thereof prepared in step (1) into 2-amino-4-methylthio-butyric acid or a salt thereof in the presence of an amino acid dehydrogenase, a formate dehydrogenase, and ammonium formate. In certain embodiments, the NCBI accession number of the amino acid dehydrogenase is: WP_124765558.1, or a mutant thereof having 1 to 3 amino acid mutations compared thereto. In certain embodiments, the amino acid dehydrogenase comprises the amino acid sequence shown in SEQ ID NO: 15. In certain embodiments, the Uniprot accession number of the formate dehydrogenase is: P33160.3.

[0014] In certain embodiments, step (2) includes a sub-step (2-3), wherein the sub-step (2-3) includes: converting the α-keto-γ-methylthiobutyric acid or its salt prepared in step (1) into 2-hydroxy-4-methylthio-butyric acid or its salt in the presence of an α-hydroxy acid dehydrogenase. In certain embodiments, the sub-step (2-3) includes: converting the α-keto-γ-methylthiobutyric acid or its salt prepared in step (1) into 2-hydroxy-4-methylthio-butyric acid or its salt in the presence of an α-hydroxy acid dehydrogenase, a formate dehydrogenase, and ammonium formate. In certain embodiments, the NCBI accession number of the α-hydroxy acid dehydrogenase is: VZT40586, or a mutant thereof having 1 to 5 amino acid mutations. In certain embodiments, the α-hydroxy acid dehydrogenase comprises the amino acid sequence shown in SEQ ID NO: 12. In certain embodiments, the Uniprot accession number of the formate dehydrogenase is: P33160.3.

[0015] In another aspect, the present application provides a nucleic acid molecule comprising a polynucleotide sequence encoding a reactive enzyme or protein. In certain embodiments, the reactive enzyme or protein is selected from the group consisting of lactate oxidase, catalase, aldolase, hemoglobin, lactate dehydrogenase, NADH oxidase, acetyl-CoA synthetase, acetyl-CoA reductase, alcohol dehydrogenase, formyl-CoA reductase, 2-hydroxyacyl-CoA synthase, transaminase, glutamate dehydrogenase, formate dehydrogenase, amino acid dehydrogenase, α-hydroxy acid dehydrogenase, and combinations thereof.

[0016] In another aspect, the present application provides a recombinant vector comprising one, two, or more nucleic acid molecules described herein. In certain embodiments, the same recombinant vector comprises nucleic acid molecules encoding a transaminase, a glutamate dehydrogenase, and a formate dehydrogenase. In certain embodiments, the same recombinant vector comprises nucleic acid molecules encoding an amino acid dehydrogenase and a formate dehydrogenase. In certain embodiments, the same recombinant vector comprises nucleic acid molecules encoding the α-hydroxy acid dehydrogenase and the formate dehydrogenase.

[0017] In another aspect, the application provides a protein expression system comprising a recombinant vector according to the application or integrating a nucleic acid molecule according to the application into a host genome. In certain embodiments, a recombinant vector comprising a nucleic acid molecule encoding a transaminase, a glutamate dehydrogenase, and / or a formate dehydrogenase is expressed in a suitable protein expression system. In certain embodiments, a recombinant vector comprising a nucleic acid molecule encoding the amino acid dehydrogenase and / or the formate dehydrogenase is expressed in a suitable protein expression system. In certain embodiments, a recombinant vector comprising a nucleic acid molecule encoding the α-hydroxy acid dehydrogenase and / or the formate dehydrogenase is expressed in a suitable protein expression system. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] FIG1 shows an exemplary synthetic route for synthesizing lactate using 2-hydroxyacyl-CoA synthase.

[0019] FIG2A shows an exemplary synthetic route to 2,3-tetrahydrofurandione.

[0020] FIG2B shows another exemplary synthetic route to 2,3-tetrahydrofurandione.

[0021] FIG2C shows an exemplary synthetic route to α-keto-4-methylthio-butyric acid.

[0022] FIG2D shows an exemplary synthetic route to 2-hydroxy-4-methylthio-butyric acid.

[0023] FIG2E shows an exemplary synthetic route to 2-amino-4-methylthio-butyric acid.

[0024] FIG2F shows another exemplary synthetic route to 2-amino-4-methylthio-butyric acid.

[0025] FIG3A shows the HPLC spectrum of the whole-cell reaction of lactate oxidase catalyzing the production of pyruvate.

[0026] FIG3B shows the HPLC spectrum of the pyruvate produced by the whole-cell reaction of lactate dehydrogenase.

[0027] Figures 4A and 4B show the HPLC spectra of the multi-enzyme cascade reaction catalyzing the production of 4-hydroxy-2-oxobutanoic acid.

[0028] Figure 4C shows the HPLC spectrum of lactonization of 4-hydroxy-2-oxobutanoic acid to 2,3-tetrahydrofurandione.

[0029] FIG5 shows the H NMR spectrum of the prepared 2,3-tetrahydrofurandione.

[0030] FIG6 shows the HPLC spectrum of chemically synthesized α-keto-γ-methylthiobutyric acid.

[0031] FIG7 shows the HPLC spectrum of the whole-cell reaction of α-hydroxy acid dehydrogenase catalyzing the production of hydroxymethionine.

[0032] FIG8 shows the HPLC spectrum of the whole-cell reaction of amino acid dehydrogenase catalyzing the production of methionine.

[0033] FIG9 shows the HPLC spectrum of the methionine produced by the whole-cell reaction catalyzed by the transaminase.

[0034] Detailed Description of the Invention

[0035] Although the present application will disclose various aspects and embodiments below, it is obvious that various equivalent changes and modifications can be made to it by those skilled in the art without violating the spirit and scope of the subject matter of the present application. The various aspects and embodiments disclosed in the present application are only for illustration and are not intended to limit the present application. The actual scope of protection of the present application is subject to the claims. Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as those of ordinary skill in the art to which the present invention belongs. All references, patents, and patent applications cited in this application are incorporated herein by reference in their entirety.

[0036] The present invention is based on the fact that 4-hydroxy-2-oxobutyric acid has the same carbon skeleton as methionine, and the carbonyl group serves as an active group and can be reduced to a chiral hydroxyl group or reductively aminated to generate a chiral amine. Thus, a method is provided for combining enzyme catalysis and chemical synthesis to produce α-keto-γ-methylthiobutyric acid in high yield using the methionine precursor skeleton 2,3-tetrahydrofurandione, thereby achieving the simultaneous production of 2-amino-4-methylthio-butyric acid and 2-hydroxy-4-methylthio-butyric acid.

[0037] In one aspect, the present application provides a method for preparing 2-amino-4-methylthio-butyric acid or a salt thereof, or 2-hydroxy-4-methylthio-butyric acid or a salt thereof, the method comprising the following steps:

[0038] (1) converting 2,3-tetrahydrofurandione into α-keto-γ-methylthiobutyric acid or a salt thereof; and

[0039] (2) converting the α-keto-γ-methylthiobutyric acid or its salt prepared in step (1) into 2-amino-4-methylthio-butyric acid or its salt, or 2-hydroxy-4-methylthio-butyric acid or its salt.

[0040] The steps (1) and (2) of the present invention are described in detail below.

[0041] Step (1)

[0042] In step (1) of the present invention, 2,3-tetrahydrofurandione is converted into α-keto-γ-methylthiobutyric acid or a salt thereof.

[0043] In this application, 2,3-tetrahydrofurandione refers to a compound having the following chemical structure:

[0044] In certain embodiments, step (1) of the present application includes reacting 2,3-tetrahydrofurandione with methyl mercaptan or a salt thereof, and treating to obtain α-keto-γ-methylthiobutyric acid or a salt thereof (for example, as shown in Figure 2C). In certain embodiments, the methyl mercaptan salt of the present application includes an alkali metal salt of methyl mercaptan, for example, potassium methyl mercaptan, sodium methyl mercaptan, etc. In certain embodiments, step (1) of the present application includes reacting 2,3-tetrahydrofurandione with methyl mercaptan or a salt thereof (for example, potassium methyl mercaptan, sodium methyl mercaptan) under suitable reaction conditions, and treating to obtain α-keto-γ-methylthiobutyric acid or a salt thereof. In certain embodiments, the α-keto-γ-methylthiobutyrate described in the present application includes an alkali metal salt of α-keto-γ-methylthiobutyric acid, for example, potassium α-keto-γ-methylthiobutyrate, sodium α-keto-γ-methylthiobutyrate, etc.

[0045] In certain embodiments, step (1) comprises adjusting the temperature to greater than 120°C (e.g., 120°C to 300°C, 120°C to 250°C, 120°C to 200°C, 120°C to 180°C, or 125°C, 130°C, 135°C, 140°C, 145°C, 150°C, 155°C, 160°C, 165°C, 170°C, 175°C, 180°C, 185°C, 190°C, 195°C, 200°C, etc.). In certain embodiments, step (1) comprises adjusting the temperature to 160°C.

[0046] In certain embodiments, step (1) comprises adjusting the pH to less than 2 (e.g., 1.9, 1.8, 1.7, 1.6, 1.5, 1.4, 1.3, 1.2, 1.1, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, 0.1). In certain embodiments, step (1) comprises adjusting the pH to 1.

[0047] In certain embodiments, step (1) comprises: dissolving 2,3-tetrahydrofurandione and methyl mercaptan or its salt (e.g., potassium methyl mercaptan, sodium methyl mercaptan) in a solvent, heating to 120-300°C (e.g., 125°C, 130°C, 135°C, 140°C, 145°C, 150°C, 155°C, 160°C, 165°C, 170°C, 175°C, 180°C, 185°C, 190°C, 195°C, etc.) , 200℃, 210℃, 220℃, 230℃, 240℃, 250℃, 260℃, 270℃, 280℃, 290℃, etc.) and react for 0.5 to 5 hours (for example, 0.5 hour, 0.6 hour, 0.7 hour, 0.8 hour, 0.9 hour, 1 hour, 1.5 hours, 2 hours, 2.5 hours, 3 hours, 3.5 hours, 4 hours, 4.5 hours, 5 hours, etc.).

[0048] In certain embodiments, step (1) comprises: dissolving 2,3-tetrahydrofurandione and methyl mercaptan or a salt thereof (eg, potassium methyl mercaptan, sodium methyl mercaptan) in a solvent, heating the mixture to 160° C., and reacting the mixture for 1 hour.

[0049] In certain embodiments, step (1) comprises: dissolving 2,3-tetrahydrofurandione and methyl mercaptan or a salt thereof (e.g., potassium methyl mercaptan, sodium methyl mercaptan) in dimethylacetamide, heating to 160° C., and reacting for 1 hour. In certain embodiments, step (1) comprises: dissolving 2,3-tetrahydrofurandione and potassium methyl mercaptan in dimethylacetamide, heating to 160° C., and reacting for 1 hour.

[0050] In certain embodiments, step (1) comprises: dissolving 2,3-tetrahydrofurandione and methyl mercaptan or a salt thereof (e.g., potassium methyl mercaptan, sodium methyl mercaptan) in a solvent, heating to 120-300° C. (e.g., 125° C., 130° C., 135° C., 140° C., 145° C., 150° C., 155° C., 160° C., 165° C., 170° C., 175° C., 180° C., 185° C., 190° C., 195° C., 200° C., 210° C., 220° C., 230° C., 240° C., 250° C., 260° C., 270° C., 280° C., 290° C., etc.) for a reaction time of 0.5-5 hours (e.g., 0 .5 hours, 0.6 hours, 0.7 hours, 0.8 hours, 0.9 hours, 1 hour, 1.5 hours, 2 hours, 2.5 hours, 3 hours, 3.5 hours, 4 hours, 4.5 hours, 5 hours, etc.), then the reaction system is cooled to 10-50°C, the pH value of the reaction system is adjusted to less than 2 (for example, 1.9, 1.8, 1.7, 1.6, 1.5, 1.4, 1.3, 1.2, 1.1, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, 0.1), and the target product (i.e., α-keto-γ-methylthiobutyric acid or its salt) is extracted.

[0051] In certain embodiments, step (1) comprises: dissolving 2,3-tetrahydrofurandione and methyl mercaptan or a salt thereof (e.g., potassium methyl mercaptan, sodium methyl mercaptan) in a solvent, heating the mixture to 160° C., reacting the mixture for 1 hour, then cooling the reaction system to 20-30° C., and adjusting the pH value of the reaction system to 1.

[0052] In certain embodiments, step (1) comprises: dissolving 2,3-tetrahydrofurandione and methyl mercaptan or a salt thereof (e.g., potassium methyl mercaptan, sodium methyl mercaptan) in dimethylacetamide, heating the mixture to 160° C., reacting the mixture for 1 hour, then cooling the reaction system to 20-30° C., and adjusting the pH of the reaction system to 1.

[0053] In certain embodiments, step (1) comprises: dissolving 2,3-tetrahydrofurandione and potassium methyl mercaptan in dimethylacetamide, heating the mixture to 160° C., reacting the mixture for 1 hour, then cooling the reaction system to 20-30° C., and adjusting the pH value of the reaction system to 1.

[0054] Those skilled in the art can prepare the 2,3-tetrahydrofurandione used in step (1) by various methods. In certain embodiments, 2,3-tetrahydrofurandione is prepared from lactic acid or a salt thereof. In certain embodiments, 2,3-tetrahydrofurandione is prepared by the following steps:

[0055] (a) providing lactic acid or a salt thereof; and

[0056] (b) converting the lactic acid or its salt described in step (a) into the 2,3-tetrahydrofurandione.

[0057] Step (a)

[0058] In the present application, step (a) is a step of providing lactic acid or a salt thereof. The lactic acid or a salt thereof in step (a) can be commercially available or freshly prepared. Exemplary lactates include lactate ions (i.e., CH3CH(OH)COO - ) and cations (e.g., magnesium ions, calcium ions, sodium ions, potassium ions, ammonium ions). Lactic acid can be prepared by reacting an alkaline agent (e.g., magnesium hydroxide, calcium hydroxide, sodium hydroxide, potassium hydroxide, ammonia water) under appropriate conditions. In this application, lactate includes alkali metal lactate, such as potassium lactate, sodium lactate, etc.

[0059] In certain embodiments, step (a) comprises: generating lactic acid or a salt thereof by enzymatically reacting acetaldehyde with formaldehyde in the presence of 2-hydroxyacyl-CoA synthase.

[0060] In this application, "2-hydroxyacyl-CoA synthase," also referred to as 2-hydroxyacyl-CoA synthase or HACS, can catalyze the acyl condensation reaction between aldehydes (e.g., formaldehyde, acetaldehyde) and formyl-CoA. The 2-hydroxyacyl-CoA synthase described herein includes synthetic 2-hydroxyacyl-CoA synthase, wild-type 2-hydroxyacyl-CoA synthase, or truncations, homologs, or analogs thereof. The 2-hydroxyacyl-CoA synthase described herein can have a variety of sources, for example, from microorganisms such as bacteria and fungi. In certain embodiments, the 2-hydroxyacyl-CoA synthase described herein is derived from Candida boidinii or Conidiobolus coronatus.

[0061] As used herein, the term "truncate" refers to a peptide formed by removing one or more amino acids from one or both ends of a wild-type polypeptide. For example, a "2-hydroxyacyl-CoA synthase truncate" refers to a peptide formed by removing one or more amino acids from one or both ends of a wild-type 2-hydroxyacyl-CoA synthase. Therefore, "truncate" herein does not include the full-length wild-type polypeptide. In certain embodiments, a 2-hydroxyacyl-CoA synthase truncate still retains the functionality of a 2-hydroxyacyl-CoA synthase, for example, still catalyzing the acyl condensation reaction between an aldehyde and an acyl-CoA.

[0062] As used herein, the terms "protein," "proteins," "polypeptides," and "peptides" are used interchangeably and refer to polymers of amino acids. The proteins, polypeptides, or peptides described herein may contain natural amino acids or non-natural amino acids (e.g., β-fluoroalanine, 1-methylhistidine, γ-methyleneglutamic acid, α-methylleucine, 4,5-dehydrolysine, hydroxyproline, 3-fluorophenylalanine, 3-aminotyrosine, 4-methyltryptophan, etc.), or analogs or mimetics of amino acids. The proteins, polypeptides, or peptides described herein may be obtained by any method known in the art, such as, but not limited to, natural isolation, recombinant expression, chemical synthesis, and the like.

[0063] In certain embodiments, the 2-hydroxyacyl-CoA synthase described herein comprises the amino acid sequence set forth in SEQ ID NO: 18 or 19 (NCBI Accession No.: OWB57166.1 or KXN72624.1). In certain embodiments, the amino acid sequence of the 2-hydroxyacyl-CoA synthase described herein is set forth in SEQ ID NO: 18 or 19. A homolog or analog of a wild-type 2-hydroxyacyl-CoA synthase can be a modified 2-hydroxyacyl-CoA synthase that contains one, two, three, four, five, six, seven, eight, nine, ten, or more amino acid substitutions, deletions, and / or insertions compared to a wild-type or naturally occurring 2-hydroxyacyl-CoA synthase (e.g., SEQ ID NO: 18 or 19), while retaining the essential function of catalyzing the acyl condensation reaction between an aldehyde and an acyl-CoA. Therefore, in certain embodiments, the 2-hydroxyacyl-CoA synthase described herein is substantially homologous to the polypeptide shown in SEQ ID NO: 18 or 19.

[0064] As used herein, the term "homologous" refers to a nucleic acid sequence (or its complement) or an amino acid sequence that has at least 60% (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) sequence identity with another sequence when optimally aligned.

[0065] In certain embodiments, the amino acid sequence of the 2-hydroxyacyl-CoA synthase described herein has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 18 or 19 and still retains the function of a 2-hydroxyacyl-CoA synthase (e.g., the function of catalyzing the acyl condensation reaction between an aldehyde and an acyl-CoA).

[0066] When "percent (%) sequence identity" is used for amino acid sequences (or nucleic acid sequences), it refers to the percentage of amino acid (or nucleic acid) residues in a candidate sequence that are identical to those in a reference sequence, after alignment and, if necessary, introduction of gaps to maximize the number of identical amino acids (or nucleic acids). In other words, the percentage (%) sequence identity of an amino acid sequence (or nucleic acid sequence) can be calculated by dividing the number of amino acid residues (or bases) identical to the reference sequence to be compared by the total number of amino acid residues (or bases) in the candidate sequence or the reference sequence (whichever is shorter). Conservative substitutions of amino acid residues may or may not be considered identical residues. Sequences can be aligned to determine the percentage sequence identity of amino acid (or nucleic acid) sequences using tools disclosed in the art, such as BLASTN, BLASTp (National Center for Biotechnology Information (NCBI), see also Altschul SF et al., J. Mol. Biol., 215: 403-410 (1990); Stephen F et al., Nucleic Acids Res., 25: 3389-3402 (1997)), ClustalW2 (European Bioinformatics Institute website, see Higgins DG et al., Methods in Enzymology, 266: 383-402 (1996); Larkin MA et al., Bioinformatics (Oxford, England), 23(21): 2947-8 (2007)), and ALIGN or Megalign (DNASTAR) software. Those skilled in the art can use the default parameters of the tool or appropriately adjust the parameters according to the needs of the comparison, for example, by selecting a suitable algorithm.

[0067] "Still retaining" the "function" of an enzyme or protein means that the function or activity of the enzyme or protein is not affected at all or is reduced or increased by at most 1%, at most 2%, at most 3%, at most 4%, at most 5%, at most 6%, at most 7%, at most 8%, at most 9%, at most 10%, at most 15%, at most 20%, at most 25%, at most 30%, etc. compared to the function or activity of its wild-type counterpart. For example, a 2-hydroxyacyl-CoA synthase having at least 80% sequence identity to SEQ ID NO: 18 or 19 "still retains the function of a 2-hydroxyacyl-CoA synthase" means that the function of the 2-hydroxyacyl-CoA synthase is not affected at all, or is reduced or increased by at most 1%, at most 2%, at most 3%, at most 4%, at most 5%, at most 6%, at most 7%, at most 8%, at most 9%, at most 10%, at most 15%, at most 20%, at most 25%, at most 30%, etc., compared to the function of the wild-type 2-hydroxyacyl-CoA synthase (e.g., whose amino acid sequence is set forth in SEQ ID NO: 18 or 19).

[0068] In certain embodiments, formaldehyde is converted to formyl-CoA by formyl-CoA reductase.

[0069] In this application, "formyl-CoA reductase," also referred to as Acyl-CoA reductase or ACR, catalyzes the conversion of formaldehyde to formyl-CoA. The formyl-CoA reductase described herein includes synthetic formyl-CoA reductase, wild-type formyl-CoA reductase, or truncations, homologs, or analogs thereof. The formyl-CoA reductase described herein can be derived from a variety of sources, for example, from microorganisms such as bacteria and fungi. In certain embodiments, the formyl-CoA reductase described herein is derived from Listeria, for example, Listeria monocytogenes.

[0070] In certain embodiments, the formyl-CoA reductase described herein comprises the amino acid sequence set forth in SEQ ID NO:20 (NCBI Accession No.: MBV1006252.1). In certain embodiments, the amino acid sequence of the formyl-CoA reductase described herein is set forth in SEQ ID NO:20. Homologs or analogs of wild-type formyl-CoA reductase can be modified formyl-CoA reductases that contain one, two, three, four, five, six, seven, eight, nine, ten, or more amino acid substitutions, deletions, and / or insertions compared to a wild-type or naturally occurring formyl-CoA reductase (e.g., SEQ ID NO:20), while retaining the essential function of catalyzing the conversion of formaldehyde to formyl-CoA. Therefore, in certain embodiments, the formyl-CoA reductase described herein is substantially homologous to the polypeptide set forth in SEQ ID NO:20.

[0071] In certain embodiments, the amino acid sequence of the formyl-CoA reductase described herein has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO:20 and still retains the function of a formyl-CoA reductase (e.g., the function of catalyzing the conversion of formaldehyde to formyl-CoA).

[0072] In certain embodiments, formaldehyde is converted into formyl-CoA by formyl-CoA reductase, and then acetaldehyde and the generated formyl-CoA undergo a condensation reaction under the action of 2-hydroxyacyl-CoA synthase to generate lactyl-CoA, and then lactic acid is generated.

[0073] In the present application, acetaldehyde can be commercially available or freshly prepared. For example, in certain embodiments, ethanol is used as a reaction starting material and is converted into acetaldehyde under the action of alcohol dehydrogenase. For another example, in certain embodiments, acetic acid is used as a reaction starting material and is converted into acetyl-CoA under the action of acetyl-CoA synthetase, and then acetyl-CoA is converted into acetaldehyde under the action of acetyl-CoA reductase. For another example, in certain embodiments, acetic acid is used as a reaction starting material and is converted into acetyl phosphate under the action of acetyl kinase, and then acetyl phosphate is converted into acetyl-CoA under the action of phosphate acetyltransferase, and then acetyl-CoA is converted into acetaldehyde under the action of acetyl-CoA reductase.

[0074] When ethanol is used as the reaction starting material, ethanol is converted into acetaldehyde under the action of alcohol dehydrogenase. In this application, "alcohol dehydrogenase" is also referred to as alcohol dehydrogenase or ADH, which can catalyze the oxidation of primary alcohols (e.g., ethanol) to aldehydes (e.g., acetaldehyde) or ketones. The alcohol dehydrogenase described in this application includes artificially synthesized alcohol dehydrogenase, wild-type alcohol dehydrogenase or its truncation, homolog or analog. The alcohol dehydrogenase described in this application can have a variety of sources, for example, from microorganisms such as bacteria and fungi. In certain embodiments, the alcohol dehydrogenase described in this application is from Saccharomyces cerevisiae.

[0075] In certain embodiments, the alcohol dehydrogenase described herein comprises the amino acid sequence set forth in SEQ ID NO: 21 (NCBI Accession No.: AAA34411.1). In certain embodiments, the amino acid sequence of the alcohol dehydrogenase described herein is set forth in SEQ ID NO: 21. A homolog or analog of a wild-type alcohol dehydrogenase can be a modified alcohol dehydrogenase that contains one, two, three, four, five, six, seven, eight, nine, ten, or more amino acid substitutions, deletions, and / or insertions compared to a wild-type or naturally occurring alcohol dehydrogenase (e.g., SEQ ID NO: 21), while retaining the essential function of catalyzing the conversion of a primary alcohol to an aldehyde or ketone. Thus, in certain embodiments, the alcohol dehydrogenase described herein is substantially homologous to the polypeptide set forth in SEQ ID NO: 21.

[0076] In certain embodiments, the amino acid sequence of the alcohol dehydrogenase described herein has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 21 and still retains the function of alcohol dehydrogenase (e.g., the function of catalyzing the conversion of a primary alcohol to an aldehyde or ketone).

[0077] When acetic acid is used as the starting material for the reaction, acetic acid is converted into acetyl-CoA by the action of acetyl-CoA synthetase (or, acetyl-CoA is converted into acetyl phosphate by the action of acetyl kinase, and then acetyl phosphate is converted into acetyl-CoA by the action of phosphate acetyltransferase), and then acetyl-CoA is converted into acetaldehyde by the action of acetyl-CoA reductase.

[0078] In this application, "acetyl-CoA synthetase," also referred to as acetyl-CoA synthetase or ACS, is capable of converting acetic acid into acetyl-CoA. The acetyl-CoA synthetase described herein includes synthetic acetyl-CoA synthetase, wild-type acetyl-CoA synthetase, or truncations, homologs, or analogs thereof. The acetyl-CoA synthetase described herein can have a variety of sources, for example, from microorganisms such as bacteria and fungi. In certain embodiments, the acetyl-CoA synthetase described herein is derived from Escherichia coli (E. coli) or Bacillus subtilis.

[0079] In certain embodiments, the acetyl-CoA synthetase described herein comprises the amino acid sequence set forth in SEQ ID NO: 22 (Uniprot Accession No.: P27550.2) or SEQ ID NO: 23 (GenBank Accession No.: SPY14848.1). In certain embodiments, the amino acid sequence of the acetyl-CoA synthetase described herein is set forth in SEQ ID NO: 22 or 23. A homolog or analog of a wild-type acetyl-CoA synthetase can be a modified acetyl-CoA synthetase that contains one, two, three, four, five, six, seven, eight, nine, ten, or more amino acid substitutions, deletions, and / or insertions compared to a wild-type or naturally occurring acetyl-CoA synthetase (e.g., SEQ ID NO: 22 or 23), while retaining the essential function of catalyzing the conversion of acetate to acetyl-CoA. Therefore, in certain embodiments, the acetyl-CoA synthetase described herein is substantially homologous to the polypeptide set forth in SEQ ID NO: 22 or 23.

[0080] In certain embodiments, the amino acid sequence of the acetyl-CoA synthetase described herein has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 22 or 23 and still retains the function of the acetyl-CoA synthetase (e.g., the function of catalyzing the conversion of acetate to acetyl-CoA).

[0081] In this application, "acetyl-CoA reductase," also referred to as acetyl-CoA reductase, catalyzes the conversion of acetyl-CoA to acetaldehyde. The acetyl-CoA reductase described herein includes synthetic acetyl-CoA reductase, wild-type acetyl-CoA reductase, or truncations, homologs, or analogs thereof. The acetyl-CoA reductase described herein can be derived from a variety of sources, for example, from microorganisms such as bacteria and fungi. In certain embodiments, the acetyl-CoA reductase described herein is derived from Listeria monocytogenes.

[0082] In certain embodiments, the acetyl-CoA reductase described herein comprises the amino acid sequence set forth in SEQ ID NO: 20 (NCBI Accession No.: MBV1006252.1). In certain embodiments, the amino acid sequence of the acetyl-CoA reductase described herein is set forth in SEQ ID NO: 20. A homolog or analog of a wild-type acetyl-CoA reductase can be a modified acetyl-CoA reductase that contains one, two, three, four, five, six, seven, eight, nine, ten, or more amino acid substitutions, deletions, and / or insertions compared to a wild-type or naturally occurring acetyl-CoA reductase (e.g., SEQ ID NO: 20), while retaining the essential function of catalyzing the conversion of acetyl-CoA to acetaldehyde. Therefore, in certain embodiments, the acetyl-CoA reductase described herein is substantially homologous to the polypeptide set forth in SEQ ID NO: 20.

[0083] In certain embodiments, the amino acid sequence of the acetyl-CoA reductase described herein has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 20 and still retains the function of acetyl-CoA reductase (e.g., the function of catalyzing the conversion of acetyl-CoA to acetaldehyde).

[0084] In certain embodiments, a recombinant vector comprising a nucleic acid molecule encoding the acetyl-CoA synthetase, acetyl-CoA reductase, alcohol dehydrogenase, formyl-CoA reductase, or 2-hydroxyacyl-CoA synthase is expressed in a suitable protein expression system and mixed with ethanol (or acetic acid) and formaldehyde for an enzymatic reaction.

[0085] For example, when ethanol and formaldehyde are used as reaction starting materials, a recombinant vector containing nucleic acid molecules encoding alcohol dehydrogenase, formyl-CoA reductase, and 2-hydroxyacyl-CoA synthase is expressed in a suitable protein expression system and mixed with ethanol and formaldehyde to undergo an enzymatic reaction. For example, a nucleic acid molecule encoding alcohol dehydrogenase is cloned into a vector (e.g., a plasmid) to obtain a first recombinant vector; a nucleic acid molecule encoding formyl-CoA reductase is cloned into a vector (e.g., a plasmid) to obtain a second recombinant vector; a nucleic acid molecule encoding 2-hydroxyacyl-CoA synthase is cloned into a vector (e.g., a plasmid) to obtain a third recombinant vector; the first, second, and third recombinant vectors are expressed in a suitable protein expression system and mixed with ethanol and formaldehyde to undergo an enzymatic reaction to produce lactic acid. In certain embodiments, the first, second, and third recombinant vectors are the same recombinant vector, i.e., nucleic acid molecules expressing alcohol dehydrogenase, formyl-CoA reductase, and 2-hydroxyacyl-CoA synthase are constructed on a single recombinant vector. In certain embodiments, the first recombinant vector, the second recombinant vector, and the third recombinant vector are different recombinant vectors, that is, nucleic acid molecules expressing alcohol dehydrogenase, formyl-CoA reductase, and 2-hydroxyacyl-CoA synthase are constructed on different recombinant vectors. When ethanol and formaldehyde are used as reaction starting materials, two molecules of NADH are generated simultaneously with the generation of one molecule of lactic acid. The generated additional NADH can be used in sub-steps (2-3) of the present invention (described in detail below), thereby achieving NAD + regeneration.

[0086] In certain embodiments, step (a) comprises the following sub-steps:

[0087] √ 2-hydroxyacyl-CoA synthases from Candida boidinii and Conidiobolus coronatus were codon-optimized and gene-synthesized, and cloned into the pCDFduet plasmid to obtain the recombinant plasmids pCDFduet-CbHACS and pCDFduet-CdcHACS, respectively;

[0088] √ Select formyl-CoA reductase from Listeria monocytogenes for codon optimization and gene synthesis, and clone it into the pET-PCT5 plasmid to obtain the recombinant plasmid pET-PCT5-LmACR;

[0089] √The ADH2 gene from Saccharomyces cerevisiae was amplified by PCR and cloned into the pET-PCT5-LmACR plasmid to obtain pET-PCT5-LmACR-ADH2;

[0090] √ Transform the recombinant plasmids pCDFduet-CbHACS (or pCDFduet-CdcHACS) and pET-PCT5-LmACR-ADH2 into competent E. coli cells, pick a single colony and inoculate it into LB liquid medium and culture overnight;

[0091] √Then transfer the cells to LB liquid medium containing streptomycin or ampicillin for culture and collect the cells;

[0092] √ The collected bacteria, ethanol and formaldehyde are mixed to undergo an enzymatic reaction to produce lactic acid or its salts.

[0093] For another example, when acetic acid and formaldehyde are used as reaction starting materials, a recombinant vector containing nucleic acid molecules encoding acetyl-CoA synthetase, acetyl-CoA reductase, formyl-CoA reductase, and 2-hydroxyacyl-CoA synthase is expressed in a suitable protein expression system and mixed with acetic acid and formaldehyde to carry out an enzymatic reaction. For example, a nucleic acid molecule encoding acetyl-CoA synthetase is cloned into a vector (e.g., a plasmid) to obtain a first recombinant vector; a nucleic acid molecule encoding acetyl-CoA reductase is cloned into a vector (e.g., a plasmid) to obtain a second recombinant vector; a nucleic acid molecule encoding formyl-CoA reductase is cloned into a vector (e.g., a plasmid) to obtain a third recombinant vector; a nucleic acid molecule encoding 2-hydroxyacyl-CoA synthase is cloned into a vector (e.g., a plasmid) to obtain a fourth recombinant vector; the first, second, third, and fourth recombinant vectors are expressed in a suitable protein expression system and mixed with acetic acid and formaldehyde to carry out an enzymatic reaction to produce lactic acid. In certain embodiments, the first, second, third, and fourth recombinant vectors are the same recombinant vector, i.e., nucleic acid molecules expressing acetyl-CoA synthetase, acetyl-CoA reductase, formyl-CoA reductase, and 2-hydroxyacyl-CoA synthetase are constructed on a single recombinant vector. In certain embodiments, the first, second, third, and fourth recombinant vectors are different recombinant vectors, i.e., nucleic acid molecules expressing acetyl-CoA synthetase, acetyl-CoA reductase, formyl-CoA reductase, and 2-hydroxyacyl-CoA synthetase are constructed on different recombinant vectors, respectively.

[0094] In certain embodiments, step (a) comprises the following sub-steps:

[0095] √ 2-hydroxyacyl-CoA synthases from Candida boidinii and Conidiobolus coronatus were codon-optimized and gene-synthesized, and cloned into the pCDFduet plasmid to obtain the recombinant plasmids pCDFduet-CbHACS and pCDFduet-CdcHACS, respectively;

[0096] √ Select formyl-CoA reductase from Listeria monocytogenes for codon optimization and gene synthesis, and clone it into the pET-PCT5 plasmid to obtain the recombinant plasmid pET-PCT5-LmACR;

[0097] √ The acetyl-CoA synthetase genes from E. coli and Bacillus subtilis were selected, amplified by PCR, and cloned into the pET-PCT5-LmACR plasmid to obtain the recombinant plasmids pET-PCT5-LmACR-EcACS and pET-PCT5-LmACR-BsACS, respectively;

[0098] √ Transform the recombinant plasmids pCDFduet-CbHACS (or pCDFduet-CdcHACS) and pET-PCT5-LmACR-EcACS (or pET-PCT5-LmACR-BsACS) into competent E. coli cells, pick a single colony and inoculate it into LB liquid medium and culture overnight;

[0099] √Then transfer the cells to LB liquid medium containing streptomycin or ampicillin for culture and collect the cells;

[0100] √ The collected bacteria, acetic acid and formaldehyde are mixed to carry out an enzymatic reaction to produce lactic acid or its salts.

[0101] Figure 1 shows an exemplary reaction scheme for step (a). Specifically, ethanol (or acetic acid) and formaldehyde are used as starting reactants to produce lactic acid or a salt thereof under the catalytic action of alcohol dehydrogenase (or acetyl-CoA synthetase, acetyl-CoA reductase), formyl-CoA reductase, and 2-hydroxyacyl-CoA synthase.

[0102] Step (b)

[0103] In the present application, step (b) is a step of converting the lactic acid or a salt thereof obtained in step (a) into 2,3-tetrahydrofurandione. In certain embodiments, step (b) is a step of converting the lactic acid or a salt thereof obtained in step (a) into 2,3-tetrahydrofurandione via pyruvic acid or a salt thereof.

[0104] In certain embodiments, step (b) comprises sub-step (b-1), sub-step (b-2), and sub-step (b-3):

[0105] (b-1) converting the lactic acid or a salt thereof described in step (a) into pyruvic acid or a salt thereof;

[0106] (b-2) converting the pyruvic acid or a salt thereof prepared in sub-step (b-1) into 4-hydroxy-2-oxobutanoic acid or a salt thereof; and

[0107] (b-3) converting the 4-hydroxy-2-oxobutanoic acid or its salt prepared in sub-step (b-2) into 2,3-tetrahydrofurandione.

[0108] Sub-step (b-1), sub-step (b-2) and sub-step (b-3) are described in detail below.

[0109] Sub-step (b-1)

[0110] In the present application, sub-step (b-1) is a step of converting the lactic acid or its salt described in step (a) into pyruvic acid or its salt. This sub-step can be achieved in a variety of ways. For example, α-hydroxy acid oxidase uses flavin adenine dinucleotide (FAD) or flavin mononucleotide (FMN) as a coenzyme and utilizes molecular oxygen to oxidatively dehydrogenate lactic acid or lactate to produce pyruvic acid or pyruvate. This type of enzyme does not require the addition of additional cofactors, and the reaction is easy to carry out, but hydrogen peroxide is produced as a by-product. Therefore, catalase is used in conjunction with α-hydroxy acid oxidase, and the oxygen produced by catalyzing the decomposition of hydrogen peroxide can also be provided to α-hydroxy acid oxidase to promote the reaction. In addition, the dissolved oxygen in the aqueous solution is often limited, so a method of combining with hemoglobin can be used to increase the catalytic activity of oxygen-consuming enzymes by virtue of its oxygen binding and release ability. Common α-hydroxy acid oxidases include glycolate oxidase and lactate oxidase, both of which can catalyze the oxidation of lactic acid or lactate to produce pyruvic acid or pyruvate.

[0111] In certain embodiments, sub-step (b-1) comprises converting the lactic acid or a salt thereof described in step (a) into pyruvic acid or a salt thereof in the presence of lactate oxidase or lactate dehydrogenase. In certain embodiments, the pyruvate salt described herein comprises an alkali metal pyruvate salt, such as potassium pyruvate, sodium pyruvate, and the like.

[0112] In certain embodiments, sub-step (b-1) comprises converting the lactic acid or a salt thereof described in step (a) into pyruvic acid or a salt thereof in the presence of lactate oxidase. In certain embodiments, sub-step (b-1) comprises converting the lactic acid or a salt thereof described in step (a) into pyruvic acid or a salt thereof in the presence of lactate oxidase and catalase. In certain embodiments, sub-step (b-1) comprises converting the lactic acid or a salt thereof described in step (a) into pyruvic acid or a salt thereof in the presence of lactate oxidase, catalase, and hemoglobin.

[0113] In this application, "lactate oxidase" is also referred to as lactate oxidase or LOX, which is capable of oxidizing lactic acid or lactate to pyruvic acid or pyruvic acid salt using molecular oxygen. Exemplary lactate oxidases include those with an EC number of EC 1.1.3.2. The lactate oxidases described herein include synthetic lactate oxidases, wild-type lactate oxidases, or truncations, homologs, or analogs thereof. The lactate oxidases described herein can have a variety of sources, for example, from microorganisms such as bacteria and fungi. In certain embodiments, the lactate oxidases described herein are from Enterococcus.

[0114] In certain embodiments, the lactate oxidase described herein comprises the amino acid sequence set forth in SEQ ID NO: 1 (NCBI Accession No.: WP_002373180.1). In certain embodiments, the amino acid sequence of the lactate oxidase described herein is set forth in SEQ ID NO: 1. A homolog or analog of a wild-type lactate oxidase can be a modified lactate oxidase that contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more amino acid substitutions, deletions, and / or insertions compared to a wild-type or naturally occurring lactate oxidase (e.g., SEQ ID NO: 1), while retaining the essential function of catalyzing the oxidation of lactate or lactate to pyruvate or pyruvate with molecular oxygen. Thus, in certain embodiments, the lactate oxidase described herein is substantially homologous to the polypeptide set forth in SEQ ID NO: 1.

[0115] In certain embodiments, the amino acid sequence of the lactate oxidase described herein has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 1 and still retains the function of lactate oxidase (e.g., the function of catalyzing the oxidation of lactate or lactate with oxygen to pyruvate or pyruvate).

[0116] In certain embodiments, the lactate oxidase described herein is L-lactate oxidase. "L-lactate oxidase" refers to an enzyme that specifically utilizes oxygen to oxidize L-lactate or L-lactate to pyruvate or pyruvate.

[0117] In this application, "catalase," also known as catalase, catalyzes the decomposition of hydrogen peroxide into oxygen and water. In certain embodiments, the hydrogen peroxide is produced during the oxidation of lactic acid or lactate to acetone or pyruvate by lactate oxidase. One advantage of converting lactic acid or lactate to pyruvate in step (a) in the presence of both lactate oxidase and catalase is that oxygen can be recycled, simplifying the process and reducing costs.

[0118] The catalase described herein includes synthetic catalase, wild-type catalase, or truncated forms, homologs, or analogs thereof. The catalase described herein can have a variety of sources, for example, from microorganisms such as bacteria and fungi. In certain embodiments, the catalase described herein is derived from Ureibacillus thermosphaericus.

[0119] In certain embodiments, the catalase described herein comprises the amino acid sequence set forth in SEQ ID NO: 3 (NCBI Accession No.: WP_016837596.1). In certain embodiments, the amino acid sequence of the catalase described herein is set forth in SEQ ID NO: 3. A homolog or analog of a wild-type catalase can be a modified catalase that contains one, two, three, four, five, six, seven, eight, nine, ten, or more amino acid substitutions, deletions, and / or insertions compared to a wild-type or naturally occurring catalase (e.g., SEQ ID NO: 3), while retaining the essential function of catalyzing the decomposition of hydrogen peroxide into oxygen and water. Thus, in certain embodiments, the catalase described herein is substantially homologous to the polypeptide set forth in SEQ ID NO: 3.

[0120] In certain embodiments, the amino acid sequence of the catalase described herein has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 3 and still retains catalase function (e.g., the function of catalyzing the decomposition of hydrogen peroxide into oxygen and water).

[0121] In this application, "hemoglobin," also known as hemoglobin, HGB, or Hb, is a protein in the body responsible for transporting oxygen. One advantage of converting lactate or lactate in step (a) to pyruvate or pyruvate in the presence of lactate oxidase, catalase, and hemoglobin is that hemoglobin can bind and release oxygen, thereby achieving efficient oxygen utilization.

[0122] The hemoglobin described herein includes synthetic hemoglobin, wild-type hemoglobin, or truncations, homologs, or analogs thereof. The hemoglobin described herein can have a variety of sources, for example, from microorganisms such as bacteria and fungi. In certain embodiments, the hemoglobin is derived from Vitreoscilla.

[0123] In certain embodiments, the hemoglobin described herein comprises the amino acid sequence set forth in SEQ ID NO: 2 (NCBI Accession No.: WP_019959060.1). In certain embodiments, the amino acid sequence of the hemoglobin described herein is set forth in SEQ ID NO: 2. A homolog or analog of wild-type hemoglobin can be a modified hemoglobin that contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acid substitutions, deletions, and / or insertions compared to wild-type or naturally occurring hemoglobin (e.g., SEQ ID NO: 2), while retaining essential oxygen transport function. Therefore, in certain embodiments, the hemoglobin described herein is substantially homologous to the polypeptide set forth in SEQ ID NO: 2.

[0124] In certain embodiments, the amino acid sequence of the hemoglobin described herein has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 2 and still retains the function of hemoglobin (e.g., the function of carrying oxygen).

[0125] In certain embodiments, a recombinant vector containing a nucleic acid molecule encoding the lactate oxidase, catalase and / or hemoglobin is expressed in a suitable protein expression system and mixed with lactic acid or a salt thereof to undergo an enzymatic reaction to generate pyruvic acid or a salt thereof.

[0126] When only lactate oxidase is used to convert lactic acid or its salt into pyruvic acid or its salt, a recombinant vector containing a nucleic acid molecule encoding the lactate oxidase is expressed in a suitable protein expression system and mixed with lactic acid or its salt to carry out an enzymatic reaction to generate pyruvic acid or its salt.

[0127] When lactate oxidase and catalase are used to convert lactic acid or its salt into pyruvic acid or its salt, a recombinant vector comprising nucleic acid molecules encoding the lactate oxidase and catalase is expressed in a suitable protein expression system and mixed with lactic acid or its salt for enzymatic reaction to generate pyruvic acid or its salt. For example, a nucleic acid molecule encoding lactate oxidase is cloned into a vector (e.g., a plasmid) to obtain a first recombinant vector; a nucleic acid molecule encoding catalase is cloned into a vector (e.g., a plasmid) to obtain a second recombinant vector; the first recombinant vector and the second recombinant vector are expressed in a suitable protein expression system and mixed with lactic acid or its salt for enzymatic reaction to generate pyruvic acid or its salt. In certain embodiments, the first recombinant vector and the second recombinant vector are the same recombinant vector, that is, nucleic acid molecules expressing lactate oxidase and catalase are constructed on a single recombinant vector. In certain embodiments, the first recombinant vector and the second recombinant vector are different recombinant vectors, that is, nucleic acid molecules expressing lactate oxidase and catalase are constructed on different recombinant vectors, respectively.

[0128] When lactate oxidase, catalase and hemoglobin are used to convert lactic acid or its salt into pyruvic acid or its salt, a recombinant vector comprising nucleic acid molecules encoding the lactate oxidase, catalase and hemoglobin is expressed in a suitable protein expression system and mixed with lactic acid or its salt for enzymatic reaction to generate pyruvic acid or its salt. For example, a nucleic acid molecule encoding lactate oxidase is cloned into a vector (e.g., a plasmid) to obtain a first recombinant vector; a nucleic acid molecule encoding catalase is cloned into a vector (e.g., a plasmid) to obtain a second recombinant vector; a nucleic acid molecule encoding hemoglobin is cloned into a vector (e.g., a plasmid) to obtain a third recombinant vector; the first recombinant vector, the second recombinant vector and the third recombinant vector are expressed in a suitable protein expression system and mixed with lactic acid or its salt for enzymatic reaction to generate pyruvic acid or its salt. In certain embodiments, the first recombinant vector, the second recombinant vector and the third recombinant vector are the same recombinant vector, that is, nucleic acid molecules expressing lactate oxidase, catalase and hemoglobin are constructed on a single recombinant vector. In certain embodiments, the first recombinant vector, the second recombinant vector and the third recombinant vector are different recombinant vectors, that is, nucleic acid molecules expressing lactate oxidase, catalase and hemoglobin are respectively constructed on different recombinant vectors.

[0129] In certain embodiments, sub-step (b-1) comprises the following:

[0130] √ Lactate oxidase LOXL from Enterococcus (NCBI accession number: WP_002373180.1), hemoglobin VHb from Vitreoscilla (NCBI accession number: WP_019959060.1), and catalase UtCAT from Ureibacillus thermosphaericus (NCBI accession number: WP_016837596.1) were codon-optimized and gene-synthesized, and cloned into a plasmid to obtain the recombinant plasmid pCDFDuet-p1-VHb-p2-LOXL-RBS-UtCAT;

[0131] √Transform the recombinant plasmid pCDFDuet-p1-VHb-p2-LOXL-RBS-UtCAT into competent E. coli cells, pick a single colony and inoculate it into LB liquid medium and culture overnight;

[0132] √Then transfer the cells to LB liquid medium containing streptomycin for culture and collect the cells;

[0133] √ The collected bacteria are mixed with lactic acid or lactate (e.g., potassium lactate, sodium lactate) to undergo an enzymatic reaction to produce pyruvic acid or its salt.

[0134] In certain embodiments, sub-step (b-1) comprises: converting the lactic acid or its salt described in step (a) into pyruvic acid or its salt in the presence of lactate dehydrogenase. Since lactate dehydrogenase is a type of NAD-dependent kinase, it requires the cofactor NAD to catalyze the oxidative dehydrogenation of lactic acid or its salt and produces one molecule of NADH. In order to push the reaction equilibrium toward the oxidation direction, the introduction of NADH oxidase can achieve NAD + Only a small amount of NAD is needed for regeneration + Alternatively, the reaction can be facilitated by the bacteria themselves. Therefore, in certain embodiments, sub-step (b-1) comprises: converting the lactic acid or a salt thereof described in step (a) into pyruvic acid or a salt thereof in the presence of lactate dehydrogenase and NADH oxidase.

[0135] In the present application, " lactate dehydrogenase " is also referred to as lactate dehydrogenase or LDH, and it can catalyze the oxidative dehydrogenation of lactic acid or its salt to pyruvic acid or its salt. Exemplary lactate dehydrogenases include those enzymes whose EC number is EC1.1.1.27 or EC1.1.1.28. Lactate dehydrogenases described in the present application include synthetic lactate dehydrogenases, wild-type lactate dehydrogenases or their truncations, homologues or analogues. Lactate dehydrogenases described in the present application can have multiple sources, for example, derived from microorganisms such as bacteria and fungi. In certain embodiments, lactate dehydrogenases described in the present application are from Heyndrickxia coagulans. In certain embodiments, lactate dehydrogenases described in the present application are from Heyndrickxia coagulans 2-6.

[0136] In certain embodiments, the lactate dehydrogenase described herein comprises the amino acid sequence shown in SEQ ID NO: 4 (GenBank Accession No.: AEH52590.1). In certain embodiments, the amino acid sequence of the lactate dehydrogenase described herein is shown in SEQ ID NO: 4. A homolog or analog of a wild-type lactate dehydrogenase can be a modified lactate dehydrogenase that contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acid substitutions, deletions and / or insertions compared to a wild-type or naturally occurring lactate dehydrogenase (e.g., SEQ ID NO: 4), while retaining the basic function of catalyzing the oxidative dehydrogenation of lactate or a salt thereof to pyruvate or a salt thereof. Therefore, in certain embodiments, the lactate dehydrogenase described herein is substantially homologous to the polypeptide shown in SEQ ID NO: 4.

[0137] In certain embodiments, the amino acid sequence of the lactate dehydrogenase described herein has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the amino acid sequence shown in SEQ ID NO:4 and still retains the function of lactate dehydrogenase (e.g., the function of catalyzing the oxidative dehydrogenation of lactate or a salt thereof to pyruvate or a salt thereof).

[0138] In certain embodiments, the lactate dehydrogenase described herein is L-lactate dehydrogenase. "L-lactate dehydrogenase" refers to an enzyme that specifically catalyzes the oxidative dehydrogenation of L-lactic acid or its salts to pyruvic acid or its salts.

[0139] In this application, "NADH oxidase" is also referred to as NADH oxidase or NOX, which is capable of oxidizing NADH to produce NAD and HO. The NADH oxidase described in this application includes synthetic NADH oxidase, wild-type NADH oxidase, or truncated forms, homologs, or analogs thereof. The NADH oxidase described in this application can have a variety of sources, for example, from microorganisms such as bacteria and fungi. In certain embodiments, the NADH oxidase described in this application is derived from Streptococcus mutans.

[0140] In certain embodiments, the NADH oxidase described herein comprises the amino acid sequence set forth in SEQ ID NO:5 (NCBI Accession No.: WP_002262226.1). In certain embodiments, the amino acid sequence of the NADH oxidase described herein is set forth in SEQ ID NO:5. A homolog or analog of a wild-type NADH oxidase can be a modified NADH oxidase that contains one, two, three, four, five, six, seven, eight, nine, ten, or more amino acid substitutions, deletions, and / or insertions compared to a wild-type or naturally occurring NADH oxidase (e.g., SEQ ID NO:5), while retaining the essential function of oxidizing NADH to produce NAD and H2O. Thus, in certain embodiments, the NADH oxidase described herein is substantially homologous to the polypeptide set forth in SEQ ID NO:5.

[0141] In certain embodiments, the amino acid sequence of the NADH oxidase described herein has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence shown in SEQ ID NO:5 and still retains the function of NADH oxidase (e.g., the function of oxidizing NADH to produce NAD and H2O).

[0142] In certain embodiments, a recombinant vector containing a nucleic acid molecule encoding the lactate dehydrogenase or NADH oxidase is expressed in a suitable protein expression system and mixed with lactic acid or a salt thereof to undergo an enzymatic reaction to generate pyruvic acid or a salt thereof.

[0143] When only lactate dehydrogenase is used to convert lactic acid or its salt into pyruvic acid or its salt, a recombinant vector containing a nucleic acid molecule encoding the lactate dehydrogenase is expressed in a suitable protein expression system and mixed with lactic acid or its salt to carry out an enzymatic reaction to generate pyruvic acid or its salt.

[0144] When lactate dehydrogenase and NADH oxidase are used to convert lactic acid or its salt into pyruvic acid or its salt, a recombinant vector comprising nucleic acid molecules encoding the lactate dehydrogenase and NADH oxidase is expressed in a suitable protein expression system and mixed with lactic acid or its salt for enzymatic reaction to generate pyruvic acid or its salt. For example, a nucleic acid molecule encoding lactate dehydrogenase is cloned into a vector (e.g., a plasmid) to obtain a first recombinant vector; a nucleic acid molecule encoding NADH oxidase is cloned into a vector (e.g., a plasmid) to obtain a second recombinant vector; the first recombinant vector and the second recombinant vector are expressed in a suitable protein expression system and mixed with lactic acid or its salt for enzymatic reaction to generate pyruvic acid or its salt. In certain embodiments, the first recombinant vector and the second recombinant vector are the same recombinant vector, that is, nucleic acid molecules expressing lactate dehydrogenase and NADH oxidase are constructed on a single recombinant vector. In certain embodiments, the first recombinant vector and the second recombinant vector are different recombinant vectors, that is, nucleic acid molecules expressing lactate dehydrogenase and NADH oxidase are constructed on different recombinant vectors.

[0145] In certain embodiments, sub-step (b-1) comprises the following operations:

[0146] √ L-lactate dehydrogenase WcLdh from Heyndrickxia coagulans 2-6 (GenBank accession number: AEH52590.1) and NADH oxidase SmNOX from Streptococcus mutans (NCBI accession number: WP_002262226.1) were codon-optimized and gene-synthesized, and cloned into a plasmid to generate the recombinant plasmid pCDFDuet-p1-WcLdh-p2-SmNOX;

[0147] √Transform the recombinant plasmid pCDFDuet-p1-WcLdh-p2-SmNOX into competent E. coli cells, pick a single colony and inoculate it into LB liquid medium and culture overnight;

[0148] √Then transfer the cells to LB liquid medium containing streptomycin for culture and collect the cells;

[0149] √ The collected bacteria are mixed with lactic acid or lactate (e.g., potassium lactate, sodium lactate) to undergo an enzymatic reaction to produce pyruvic acid or its salt.

[0150] Sub-step (b-2)

[0151] In the present application, substep (b-2) is the step of converting the pyruvic acid or its salt prepared in substep (b-1) into 4-hydroxy-2-oxobutanoic acid or its salt. This substep can be achieved by various approaches. For example, under the condition of the presence of aldolase, the pyruvic acid or its salt (for example, potassium pyruvate, sodium pyruvate) described in substep (b-1) and formaldehyde are reacted to generate 4-hydroxy-2-oxobutanoic acid or its salt. In some embodiments, the 4-hydroxy-2-oxobutyrate described in the present application includes 4-hydroxy-2-oxobutyric acid alkali metal salts, for example, potassium 4-hydroxy-2-oxobutanoate, sodium 4-hydroxy-2-oxobutanoate, etc.

[0152] In this application, "aldolase" is also referred to as aldolase, which can catalyze the formation of a C-C bond between pyruvic acid and an aldehyde to produce a 2-keto acid derivative. In certain embodiments, the aldolase described herein is a metal ion-dependent Class II pyruvic acid aldolase. Metal ion-dependent Class II pyruvic acid aldolase can tolerate high concentrations (e.g., 1 M) of formaldehyde.

[0153] Aldolase described in the present application comprises synthetic aldolase, wild-type aldolase or its truncate, homologue or analogue.Aldolase described in the present application can have multiple sources, for example, derive from microorganisms such as bacterium, fungi.In certain embodiments, aldolase described in the present application is from intestinal bacteria (Escherichia coli), Pseudomonas (Pseudomonas), Atlanta bacillus (Atlantibacter), Tebuxi Bacillus (Trabulsiella) or Brunneria (Brenneria).In certain embodiments, aldolase described in the present application is from intestinal bacteria K12, Pseudomonas sp.3-2, Atlantibacter subterranea, Trabulsiella odontotermitis or Brenneria izadpanahii.

[0154] In certain embodiments, the aldolase described herein comprises the amino acid sequence set forth in SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10 (NCBI Accession Nos. WP_000992981.1, WP_221399256.1, WP_254486590.1, WP_054179264.1, or WP_208228591.1). In certain embodiments, the aldolase described herein comprises the amino acid sequence set forth in SEQ ID NO: 7 (NCBI Accession No. WP_221399256.1). In certain embodiments, the amino acid sequence of the aldolase described herein is set forth in SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10. In certain embodiments, the amino acid sequence of the aldolase described herein is set forth in SEQ ID NO: 7. A homolog or analog of a wild-type aldolase can be a modified aldolase that contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acid substitutions, deletions and / or insertions compared to a wild-type or naturally occurring aldolase (e.g., SEQ ID NO: 7), while retaining the essential C-C bond forming function. Thus, in certain embodiments, the aldolase described herein is substantially homologous to the polypeptide set forth in SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10.

[0155] In certain embodiments, the amino acid sequence of the aldolase described herein has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence shown in SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, or SEQ ID NO:10 and still retains aldolase function (e.g., C-C bond forming function).

[0156] In certain embodiments, the recombinant vector comprising the nucleic acid molecule encoding the aldolase is expressed in a suitable protein expression system.

[0157] In certain embodiments, sub-step (b-2) comprises the following operations:

[0158] √ Codon-optimize and gene-synthesize the aldolase from Escherichia coli K12, Pseudomonas sp. 3-2, Atlantibacter subterranea, Trabulsiella odontotermitis, or Brenneria izadpanahii, respectively, and clone them into plasmids to obtain recombinant plasmids;

[0159] √ Transform the obtained recombinant plasmids into competent E. coli cells, pick out single clones and inoculate them into LB liquid medium, and culture overnight;

[0160] √Then transfer the cells to LB liquid medium containing kanamycin for culture and collect the cells;

[0161] √ The collected bacterial cells are mixed with pyruvate or pyruvate salt (e.g., sodium pyruvate, potassium pyruvate) and formaldehyde for an enzymatic reaction to produce 4-hydroxy-2-oxobutyric acid or a salt thereof (e.g., sodium 4-hydroxy-2-oxobutyrate, potassium 4-hydroxy-2-oxobutyrate).

[0162] Sub-step (b-3)

[0163] In the present application, substep (b-3) is a step of converting the 4-hydroxy-2-oxobutanoic acid or a salt thereof prepared in substep (b-2) into 2,3-tetrahydrofurandione. This substep can be achieved in a variety of ways. For example, the 4-hydroxy-2-oxobutanoic acid or a salt thereof prepared in substep (b-2) is subjected to an elimination reaction under elimination reaction conditions to obtain 2,3-tetrahydrofurandione.

[0164] "Elimination reaction" is also called de-reaction or elimination reaction. It causes organic compound molecules to react with other substances and lose some atoms or functional groups. After the reaction, the molecules will produce multiple bonds and become unsaturated organic compounds.

[0165] In certain embodiments, the elimination reaction conditions comprise adjusting the pH to less than 2 (e.g., 1.9, 1.8, 1.7, 1.6, 1.5, 1.4, 1.3, 1.2, 1.1, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, or 0.1).

[0166] Examples of elimination reaction conditions include, but are not limited to, strong acid, strong base, heating, and the like. In certain embodiments, the elimination reaction conditions include adjusting the pH using an acid, for example, one or more acids selected from the group consisting of sulfuric acid, hydrochloric acid, phosphoric acid, and hydrobromic acid. In certain embodiments, the elimination reaction conditions are adjusting the pH to less than 2 using sulfuric acid (e.g., 98% concentrated sulfuric acid).

[0167] In certain embodiments, step (b) comprises converting the lactic acid or a salt thereof and formaldehyde described in step (a) into 2,3-tetrahydrofurandione in the presence of lactate oxidase, catalase, hemoglobin, and aldolase expressed in the same protein expression system. For example, a recombinant vector expressing lactate oxidase, catalase, hemoglobin, and aldolase is constructed, the resulting recombinant vector is transformed into cells (e.g., competent Escherichia coli cells), and the resulting recombinant vector is mixed with lactic acid or a lactate salt (e.g., sodium lactate, potassium lactate) and formaldehyde for an enzymatic reaction to produce 4-hydroxy-2-oxobutyric acid or a salt thereof (e.g., sodium 4-hydroxy-2-oxobutyrate, potassium 4-hydroxy-2-oxobutyrate), and a strong acid (e.g., sulfuric acid) is added to adjust the pH to a strong acid condition (e.g., pH less than 2) to cause an elimination reaction of the 4-hydroxy-2-oxobutyric acid or a salt thereof, thereby producing 2,3-tetrahydrofurandione.

[0168] In certain embodiments, step (b) comprises converting the lactic acid or its salt and formaldehyde described in step (a) into 2,3-tetrahydrofurandione in the presence of lactate dehydrogenase, NADH oxidase, and aldolase expressed in the same protein expression system. For example, a recombinant vector expressing lactate dehydrogenase, NADH oxidase, and aldolase is constructed, the resulting recombinant vector is transformed into cells (e.g., Escherichia coli competent cells), and the resulting recombinant vector is mixed with lactic acid or a lactate salt (e.g., sodium lactate, potassium lactate) and formaldehyde for an enzymatic reaction to produce 4-hydroxy-2-oxobutyric acid or a salt thereof (e.g., sodium 4-hydroxy-2-oxobutyrate, potassium 4-hydroxy-2-oxobutyrate), and a strong acid (e.g., sulfuric acid) is added to adjust the pH to a strong acid condition (e.g., pH less than 2) to cause an elimination reaction of the 4-hydroxy-2-oxobutyric acid or its salt, thereby producing 2,3-tetrahydrofurandione.

[0169] Figure 2A shows an exemplary reaction scheme for step (b). Specifically, lactic acid or a salt thereof is converted to pyruvic acid or a salt thereof in the presence of lactate oxidase and catalase; the resulting pyruvic acid or a salt thereof (e.g., potassium pyruvate, sodium pyruvate) is then reacted with formaldehyde in the presence of aldolase to produce 4-hydroxy-2-oxobutanoic acid or a salt thereof; and the resulting 4-hydroxy-2-oxobutanoic acid or a salt thereof is then subjected to an elimination reaction under elimination reaction conditions (e.g., strong acid conditions) to produce 2,3-tetrahydrofurandione.

[0170] Figure 2B shows another exemplary reaction scheme for step (b). Specifically, lactate or a salt thereof is converted to pyruvate or a salt thereof in the presence of lactate dehydrogenase and NADH oxidase; the resulting pyruvate or a salt thereof (e.g., potassium pyruvate, sodium pyruvate) is then reacted with formaldehyde in the presence of aldolase to produce 4-hydroxy-2-oxobutyric acid or a salt thereof; and the resulting 4-hydroxy-2-oxobutyric acid or a salt thereof is then subjected to an elimination reaction under elimination reaction conditions (e.g., strong acid conditions) to produce 2,3-tetrahydrofurandione.

[0171] 2. Step (2)

[0172] In step (2) of the present invention, the α-keto-γ-methylthiobutyric acid or its salt prepared in step (1) is converted into 2-amino-4-methylthio-butyric acid or its salt, or 2-hydroxy-4-methylthio-butyric acid or its salt.

[0173] In the present application, substeps (2-1) and (2-2) are two different embodiments of preparing 2-amino-4-methylthio-butyric acid or a salt thereof from α-keto-γ-methylthio-butyric acid or a salt thereof; substep (2-3) is an exemplary embodiment of preparing 2-hydroxy-4-methylthio-butyric acid or a salt thereof from α-keto-γ-methylthio-butyric acid or a salt thereof. Substeps (2-1), (2-2), and (2-3) are described in detail below.

[0174] Sub-step (2-1)

[0175] In certain embodiments, step (2) includes a sub-step (2-1), wherein the sub-step (2-1) includes converting the α-keto-γ-methylthiobutyric acid or a salt thereof prepared in step (1) into 2-amino-4-methylthio-butyric acid or a salt thereof in the presence of a transaminase.

[0176] In this application, "2-amino-4-methylthio-butyric acid" is also called methionine, methionine, solid methionine, and its molecular formula is C5H 11 NO2S, the structural formula is Methionine has optical activity and can be divided into L-methionine and D-methionine. In certain embodiments, the methionine is L-methionine. In certain embodiments, the methionine is D-methionine. In certain embodiments, the methionine is DL-methionine (i.e., a mixture of L-methionine and D-methionine).

[0177] In the present application, 2-amino-4-methylthio-butyric acid salts include 2-amino-4-methylthio-butyric acid alkali metal salts, for example, 2-amino-4-methylthio-butyric acid potassium, 2-amino-4-methylthio-butyric acid sodium and the like.

[0178] In the present application, "transaminase" is also referred to as transaminase, which can catalyze a transamination reaction in the presence of an amino donor and an acceptor. Exemplary transaminases include enzymes with an EC number of EC 2.6.1.p (p is an integer greater than 1). Amino donors include, for example, glutamate, alanine, glycine, etc. The transaminases described in the present application include artificially synthesized transaminases, wild-type transaminases, or truncations, homologs, or analogs thereof. The transaminases described in the present application can have a variety of sources, for example, from microorganisms such as bacteria and fungi. In certain embodiments, the transaminases described in the present application are from Enterobacteriaceae.

[0179] In certain embodiments, the transaminase described herein comprises the amino acid sequence set forth in SEQ ID NO: 17 (NCBI Accession No.: WP_001087611.1). In certain embodiments, the amino acid sequence of the transaminase described herein is set forth in SEQ ID NO: 17. A homolog or analog of a wild-type transaminase can be a modified transaminase that contains one, two, three, four, five, six, seven, eight, nine, ten, or more amino acid substitutions, deletions, and / or insertions compared to a wild-type or naturally occurring transaminase (e.g., SEQ ID NO: 17), while retaining the essential function of catalyzing a transamination reaction between an amino donor and an amino acceptor. Thus, in certain embodiments, the transaminase described herein is substantially homologous to the polypeptide set forth in SEQ ID NO: 17.

[0180] In certain embodiments, the amino acid sequence of the transaminase described herein has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 17 and still retains the function of the transaminase (e.g., the function of catalyzing a transamination reaction between an amino donor and an acceptor).

[0181] In certain embodiments, step (2) includes a sub-step (2-1), wherein the sub-step (2-1) comprises: converting the α-keto-γ-methylthiobutyric acid or its salt prepared in step (1) into 2-amino-4-methylthio-butyric acid or its salt in the presence of a transaminase, a glutamate dehydrogenase, and glutamate. In this case, the transaminase transfers the amino group on the glutamate to the α-keto-γ-methylthiobutyric acid or its salt to form methionine and α-ketoglutaric acid, and the glutamate dehydrogenase consumes NH4 + With NADH, glutamate is recovered from α-ketoglutarate.

[0182] In this application, "glutamate dehydrogenase" is also referred to as glutamate dehydrogenase, GLDH or GDH, which can reversibly convert α-ketoglutarate into glutamate. Glutamate dehydrogenase can be NADPH-dependent or NADH-dependent. Exemplary glutamate dehydrogenases include those with EC numbers EC 1.4.1.2 and EC 1.4.1.4. The glutamate dehydrogenases described in this application include synthetic glutamate dehydrogenases, wild-type glutamate dehydrogenases or their truncations, homologs or analogs. The glutamate dehydrogenases described in this application can have a variety of sources, for example, from microorganisms such as bacteria and fungi. In certain embodiments, the glutamate dehydrogenases described in this application are from the genus Amphibacillus or the genus Lysinibacillus. In certain embodiments, the glutamate dehydrogenase described herein is derived from Amphibacillus xylanus DSM 6626 or Lysinibacillus composti WP.

[0183] In certain embodiments, the glutamate dehydrogenase described herein comprises the amino acid sequence set forth in SEQ ID NO: 16 (NCBI Accession No.: NP_391659.2). In certain embodiments, the amino acid sequence of the glutamate dehydrogenase described herein is set forth in SEQ ID NO: 16. A homolog or analog of a wild-type glutamate dehydrogenase can be a modified glutamate dehydrogenase that contains one, two, three, four, five, six, seven, eight, nine, ten, or more amino acid substitutions, deletions, and / or insertions compared to a wild-type or naturally occurring glutamate dehydrogenase (e.g., SEQ ID NO: 16), while retaining the essential function of catalyzing the conversion of α-ketoglutarate to glutamate. Thus, in certain embodiments, the glutamate dehydrogenase described herein is substantially homologous to the polypeptide set forth in SEQ ID NO: 16.

[0184] In certain embodiments, the glutamate dehydrogenase described herein has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 16 and still retains the function of glutamate dehydrogenase (e.g., the function of catalyzing the conversion of α-ketoglutarate to glutamate).

[0185] In certain embodiments, the glutamate dehydrogenase described herein comprises the amino acid sequence set forth in SEQ ID NO: 14 (NCBI Accession No.: WP_124765558.1). In certain embodiments, the amino acid sequence of the glutamate dehydrogenase described herein is set forth in SEQ ID NO: 14. A homolog or analog of a wild-type glutamate dehydrogenase can be a modified glutamate dehydrogenase that contains one, two, three, four, five, six, seven, eight, nine, ten, or more amino acid substitutions, deletions, and / or insertions compared to a wild-type or naturally occurring glutamate dehydrogenase (e.g., SEQ ID NO: 14), while retaining the essential function of catalyzing the conversion of α-ketoglutarate to glutamate. Thus, in certain embodiments, the glutamate dehydrogenase described herein is substantially homologous to the polypeptide set forth in SEQ ID NO: 14.

[0186] In certain embodiments, the amino acid sequence of the glutamate dehydrogenase described herein has 1 to 3 (e.g., 1, 2, or 3) amino acid mutations compared to SEQ ID NO: 14. In certain embodiments, the amino acid sequence of the glutamate dehydrogenase described herein is based on the amino acid sequence of SEQ ID NO: 14, with amino acid mutations at positions 144, 345, and / or 375. In certain embodiments, the amino acid sequence of the glutamate dehydrogenase described herein is based on the amino acid sequence of SEQ ID NO: 14, with amino acid mutations at positions 144, 345, and 375. In certain embodiments, the amino acid sequence of the glutamate dehydrogenase described herein is based on the amino acid sequence of SEQ ID NO: 14, with three point mutations: A144G, V345A, and V375Y. In certain embodiments, the glutamate dehydrogenase described herein comprises the amino acid sequence of SEQ ID NO: 15. In certain embodiments, the amino acid sequence of the glutamate dehydrogenase described herein is as shown in SEQ ID NO: 15.

[0187] In certain embodiments, the glutamate dehydrogenase described herein has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 14 or SEQ ID NO: 15 and still retains the function of glutamate dehydrogenase (e.g., the function of catalyzing the conversion of α-ketoglutarate to glutamate).

[0188] In certain embodiments, step (2) includes a sub-step (2-1), wherein the sub-step (2-1) includes: converting the α-keto-γ-methylthiobutyric acid or its salt prepared in step (1) into 2-amino-4-methylthio-butyric acid or its salt in the presence of a transaminase, a glutamate dehydrogenase, a formate dehydrogenase, glutamate, and ammonium formate. In this case, the transaminase transfers the amino group on the glutamate to the α-keto-γ-methylthiobutyric acid or its salt to form methionine and α-ketoglutaric acid, and the glutamate dehydrogenase consumes NH4 + Glutamate is recovered from α-ketoglutarate using NADH, and formate dehydrogenase utilizes ammonium formate to generate NADH, which is then supplied to glutamate dehydrogenase. An exemplary synthesis route for methionine is shown in Figure 2E.

[0189] In this application, "formate dehydrogenase" is also called formate dehydrogenase or FDH, which can convert formate and NAD + Converted into NADH and CO2. Exemplary formate dehydrogenases include those with EC numbering EC 1.2.1.2. The formate dehydrogenases described herein include synthetic formate dehydrogenases, wild-type formate dehydrogenases, or truncations, homologs, or analogs thereof. The formate dehydrogenases described herein can have a variety of sources, for example, derived from microorganisms such as bacteria and fungi. In certain embodiments, the formate dehydrogenases described herein are from Pseudomonas sp.

[0190] In certain embodiments, the formate dehydrogenase described herein comprises an amino acid sequence as shown in SEQ ID NO: 13 (Uniprot Accession No.: P33160.3). In certain embodiments, the amino acid sequence of the formate dehydrogenase described herein is shown in SEQ ID NO: 13. A homolog or analog of a wild-type formate dehydrogenase may comprise one, two, three, four, five, six, seven, eight, nine, ten or more amino acid substitutions, deletions and / or insertions compared to a wild-type or naturally occurring formate dehydrogenase (e.g., SEQ ID NO: 13), while retaining the essential catalytic activity for the conversion of formate and NAD. + Therefore, in certain embodiments, the formate dehydrogenase described herein is substantially homologous to the polypeptide shown in SEQ ID NO: 13.

[0191] In certain embodiments, the amino acid sequence of the formate dehydrogenase described herein has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 13 and still maintains the function of formate dehydrogenase (e.g., catalyzing the conversion of formate and NAD + function of converting into NADH and CO2).

[0192] When only transaminase is used to convert α-keto-γ-methylthiobutyric acid or its salt into 2-amino-4-methylthio-butyric acid or its salt, a recombinant vector containing a nucleic acid molecule encoding the transaminase is expressed in a suitable protein expression system and mixed with α-keto-γ-methylthiobutyric acid or its salt to carry out an enzymatic reaction to produce 2-amino-4-methylthio-butyric acid or its salt.

[0193] When α-keto-γ-methylthiobutyric acid or a salt thereof is converted into 2-amino-4-methylthio-butyric acid or a salt thereof using a transaminase and a glutamate dehydrogenase, a recombinant vector comprising a nucleic acid molecule encoding the transaminase and the glutamate dehydrogenase is expressed in a suitable protein expression system and mixed with α-keto-γ-methylthiobutyric acid or a salt thereof and glutamate for an enzymatic reaction to produce 2-amino-4-methylthio-butyric acid or a salt thereof. For example, a nucleic acid molecule encoding a transaminase is cloned into a vector (e.g., a plasmid) to obtain a first recombinant vector; a nucleic acid molecule encoding a glutamate dehydrogenase is cloned into a vector (e.g., a plasmid) to obtain a second recombinant vector; the first and second recombinant vectors are expressed in a suitable protein expression system and mixed with α-keto-γ-methylthiobutyric acid or a salt thereof and glutamate for an enzymatic reaction to produce 2-amino-4-methylthio-butyric acid or a salt thereof. In certain embodiments, the first and second recombinant vectors are the same recombinant vector, i.e., the nucleic acid molecules expressing the transaminase and glutamate dehydrogenase are constructed on a single recombinant vector. In certain embodiments, the first and second recombinant vectors are different recombinant vectors, i.e., the nucleic acid molecules expressing the transaminase and glutamate dehydrogenase are constructed on different recombinant vectors, respectively.

[0194] When α-keto-γ-methylthiobutyric acid or its salt is converted into 2-amino-4-methylthio-butyric acid or its salt using transaminase, glutamate dehydrogenase and formate dehydrogenase, a recombinant vector containing nucleic acid molecules encoding the transaminase, glutamate dehydrogenase and formate dehydrogenase is expressed in a suitable protein expression system and mixed with α-keto-γ-methylthiobutyric acid or its salt, glutamate and ammonium formate to carry out an enzymatic reaction to generate 2-amino-4-methylthio-butyric acid or its salt. For example, a nucleic acid molecule encoding a transaminase is cloned into a vector (e.g., a plasmid) to obtain a first recombinant vector; a nucleic acid molecule encoding a glutamate dehydrogenase is cloned into a vector (e.g., a plasmid) to obtain a second recombinant vector; a nucleic acid molecule encoding a formate dehydrogenase is cloned into a vector (e.g., a plasmid) to obtain a third recombinant vector; the first, second, and third recombinant vectors are expressed in a suitable protein expression system and mixed with α-keto-γ-methylthiobutyric acid or a salt thereof, glutamate, and ammonium formate for an enzymatic reaction to generate 2-amino-4-methylthio-butyric acid or a salt thereof. In certain embodiments, the first, second, and third recombinant vectors are the same recombinant vector, that is, nucleic acid molecules expressing transaminase, glutamate dehydrogenase, and formate dehydrogenase are constructed on a single recombinant vector. In certain embodiments, the first, second, and third recombinant vectors are different recombinant vectors, that is, nucleic acid molecules expressing transaminase, glutamate dehydrogenase, and formate dehydrogenase are constructed on different recombinant vectors.

[0195] In certain embodiments, sub-step (2-1) comprises the following:

[0196] √ Glutamate dehydrogenase BsGluDH from Bacillus subtilis subsp. subtilis str.168 (NCBI accession number: NP_391659.2), transaminase ETA from Enterobacteriaceae (NCBI accession number: WP_001087611.1), and formate dehydrogenase PsFDH from Pseudomonas sp. (Uniprot accession number: P33160.3) were codon-optimized and gene synthesized, and cloned into a plasmid to obtain the recombinant plasmid pCDFDuet-P1-PsFDH-P2-ETA-RBS2-BsGluDH;

[0197] √Transform the recombinant plasmid pCDFDuet-P1-PsFDH-P2-ETA-RBS2-BsGluDH into competent E. coli cells, pick a single colony and inoculate it into LB liquid medium and culture overnight;

[0198] √Then transfer the cells to LB liquid medium containing streptomycin for culture and collect the cells;

[0199] √ The collected bacteria are mixed with α-keto-γ-methylthiobutyric acid or its salt, glutamic acid, and ammonium formate to undergo an enzymatic reaction to generate 2-amino-4-methylthio-butyric acid or its salt.

[0200] Sub-step (2-2)

[0201] In certain embodiments, step (2) includes a sub-step (2-2), wherein the sub-step (2-2) includes converting the α-keto-γ-methylthiobutyric acid or a salt thereof prepared in step (1) into 2-amino-4-methylthio-butyric acid or a salt thereof in the presence of an amino acid dehydrogenase.

[0202] In this application, "amino acid dehydrogenase" is also referred to as amino acid dehydrogenase or AADH, which can reduce keto acids to amino acids. The amino acid dehydrogenases described herein include synthetic amino acid dehydrogenases, wild-type amino acid dehydrogenases, or truncations, homologs, or analogs thereof. The amino acid dehydrogenases described herein can have a variety of sources, for example, from microorganisms such as bacteria and fungi. In certain embodiments, the amino acid dehydrogenases described herein are derived from the genus Lysinibacillus. In certain embodiments, the amino acid dehydrogenases described herein are derived from Lysinibacillus composti WP.

[0203] In certain embodiments, the amino acid dehydrogenase described herein comprises the amino acid sequence set forth in SEQ ID NO: 14 (NCBI Accession No.: WP_124765558.1). In certain embodiments, the amino acid dehydrogenase described herein has the amino acid sequence set forth in SEQ ID NO: 14. A homolog or analog of a wild-type amino acid dehydrogenase can be a modified amino acid dehydrogenase that contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more amino acid substitutions, deletions, and / or insertions compared to a wild-type or naturally occurring amino acid dehydrogenase (e.g., SEQ ID NO: 14), while retaining the essential function of catalyzing the reduction of ketoacids to amino acids. Thus, in certain embodiments, the amino acid dehydrogenase described herein is substantially homologous to the polypeptide set forth in SEQ ID NO: 14.

[0204] In certain embodiments, the amino acid sequence of the amino acid dehydrogenase described herein has 1 to 3 (e.g., 1, 2, or 3) amino acid mutations compared to SEQ ID NO: 14. In certain embodiments, the amino acid sequence of the amino acid dehydrogenase described herein is based on the amino acid sequence set forth in SEQ ID NO: 14, with amino acid mutations at positions 144, 345, and / or 375. In certain embodiments, the amino acid sequence of the amino acid dehydrogenase described herein is based on the amino acid sequence set forth in SEQ ID NO: 14, with amino acid mutations at positions 144, 345, and 375. In certain embodiments, the amino acid sequence of the amino acid dehydrogenase described herein is based on the amino acid sequence set forth in SEQ ID NO: 14, with three point mutations: A144G, V345A, and V375Y. In certain embodiments, the amino acid dehydrogenase described herein comprises the amino acid sequence set forth in SEQ ID NO: 15. In certain embodiments, the amino acid sequence of the amino acid dehydrogenase described herein is set forth in SEQ ID NO: 15.

[0205] In certain embodiments, the amino acid dehydrogenase described herein has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 14 or SEQ ID NO: 15 and still retains the function of the amino acid dehydrogenase (e.g., the function of catalyzing the reduction of keto acids to amino acids).

[0206] In certain embodiments, step (2) includes a sub-step (2-2), wherein the sub-step (2-2) includes: converting the α-keto-γ-methylthiobutyric acid or its salt prepared in step (1) into 2-amino-4-methylthio-butyric acid or its salt in the presence of amino acid dehydrogenase, formate dehydrogenase, ammonium formate, and NAD. In certain embodiments, step (2) includes a sub-step (2-2), wherein the sub-step (2-2) includes: converting the α-keto-γ-methylthiobutyric acid or its salt prepared in step (1) into 2-amino-4-methylthio-butyric acid or its salt in the presence of amino acid dehydrogenase, formate dehydrogenase, ammonium formate, and NAD. + In the presence of 4-nitro-2-nitro-1,4-dihydro-1-methyl-2-nitro-1-propanediol (NADH), the α-keto-γ-methylthiobutyric acid or its salt prepared in step (1) is converted into 2-amino-4-methylthio-butyric acid or its salt. In certain embodiments, the amino acid sequence of the amino acid dehydrogenase is shown in SEQ ID NO: 15, and the amino acid sequence of the formate dehydrogenase is shown in SEQ ID NO: 13. An exemplary synthetic route for methionine is shown in FIG2F.

[0207] When only amino acid dehydrogenase is used to convert α-keto-γ-methylthiobutyric acid or its salt into 2-amino-4-methylthio-butyric acid or its salt, a recombinant vector containing a nucleic acid molecule encoding the amino acid dehydrogenase is expressed in a suitable protein expression system and mixed with α-keto-γ-methylthiobutyric acid or its salt to carry out an enzymatic reaction to produce 2-amino-4-methylthio-butyric acid or its salt.

[0208] When amino acid dehydrogenase and formate dehydrogenase are used to convert α-keto-γ-methylthiobutyric acid or its salt into 2-amino-4-methylthio-butyric acid or its salt, a recombinant vector containing nucleic acid molecules encoding the amino acid dehydrogenase and formate dehydrogenase is expressed in a suitable protein expression system and reacted with α-keto-γ-methylthiobutyric acid or its salt, ammonium formate and NAD. + (or NADH) are mixed to carry out an enzymatic reaction to generate 2-amino-4-methylthio-butyric acid or its salt. For example, a nucleic acid molecule encoding amino acid dehydrogenase is cloned into a vector (e.g., a plasmid) to obtain a first recombinant vector; a nucleic acid molecule encoding formate dehydrogenase is cloned into a vector (e.g., a plasmid) to obtain a second recombinant vector; the first recombinant vector and the second recombinant vector are expressed in a suitable protein expression system and are combined with α-keto-γ-methylthiobutyric acid or its salt, ammonium formate and NAD + (or NADH) are mixed to carry out an enzymatic reaction to generate 2-amino-4-methylthio-butyric acid or a salt thereof. In certain embodiments, the first recombinant vector and the second recombinant vector are the same recombinant vector, i.e., the nucleic acid molecules expressing the amino acid dehydrogenase and the formate dehydrogenase are constructed on a single recombinant vector. In certain embodiments, the first recombinant vector and the second recombinant vector are different recombinant vectors, i.e., the nucleic acid molecules expressing the amino acid dehydrogenase and the formate dehydrogenase are constructed on different recombinant vectors, respectively.

[0209] In certain embodiments, sub-step (2-2) comprises the following:

[0210] √ The amino acid dehydrogenase LcGluDH-M3 from Lysinibacillus composti WP (NCBI accession number: WP_124765558.1) or its triple mutant (A144G+V345A+V375Y, amino acid sequence shown in SEQ ID NO: 15) and the formate dehydrogenase PsFDH from Pseudomonas sp. (Uniprot accession number: P33160.3) were codon-optimized and gene synthesized, and then cloned into a plasmid to obtain the recombinant plasmid pCDFDuet-P1-PsFDH-P2-LcGluDH-M3;

[0211] √Transform the recombinant plasmid pCDFDuet-P1-PsFDH-P2-LcGluDH-M3 into competent E. coli cells, pick a single colony and inoculate it into LB liquid medium and culture overnight;

[0212] √Then transfer the cells to LB liquid medium containing streptomycin for culture and collect the cells;

[0213] √ The collected cells were mixed with α-keto-γ-methylthiobutyric acid or its salt, ammonium formate and NAD + (or NADH) are mixed to carry out enzymatic reaction to generate 2-amino-4-methylthio-butyric acid or its salt.

[0214] Sub-steps (2-3)

[0215] In certain embodiments, step (2) includes a sub-step (2-3), wherein the sub-step (2-3) includes converting the α-keto-γ-methylthiobutyric acid or a salt thereof prepared in step (1) into 2-hydroxy-4-methylthio-butyric acid or a salt thereof in the presence of an α-hydroxy acid dehydrogenase.

[0216] In this application, "2-hydroxy-4-methylthio-butyric acid" is also called liquid methionine, hydroxymethionine, and its molecular formula is C5H 10 O3S, the structural formula is Liquid methionine also has optical activity and can be divided into L-liquid methionine and D-liquid methionine. In certain embodiments, the liquid methionine is L-liquid methionine. In certain embodiments, the liquid methionine is D-liquid methionine. In certain embodiments, the liquid methionine is DL-liquid methionine (i.e., a mixture of L-liquid methionine and D-liquid methionine).

[0217] In the present application, 2-hydroxy-4-methylthio-butyric acid salts include 2-hydroxy-4-methylthio-butyric acid alkali metal salts, for example, 2-hydroxy-4-methylthio-butyric acid potassium, 2-hydroxy-4-methylthio-butyric acid sodium, and the like.

[0218] In this application, "α-hydroxy acid dehydrogenase" is also referred to as alpha-hydroxy acid dehydrogenase or AHDAH, which can reduce α-carbonyl acids to α-hydroxy acids. Exemplary α-hydroxy acid dehydrogenases include those with EC numbering EC 1.1.1.337. The α-hydroxy acid dehydrogenases described in this application include artificially synthesized α-hydroxy acid dehydrogenases, wild-type α-hydroxy acid dehydrogenases or their truncations, homologs or analogs. The α-hydroxy acid dehydrogenases described in this application can have a variety of sources, for example, from microorganisms such as bacteria and fungi. In certain embodiments, the α-hydroxy acid dehydrogenase described in this application is malate dehydrogenase (e.g., L-malate dehydrogenase). In certain embodiments, the malate dehydrogenase described in this application is from Escherichia coli (E. coli).

[0219] In certain embodiments, the malate dehydrogenase described herein comprises the amino acid sequence shown in SEQ ID NO: 11 (NCBI Accession No.: VZT40586). In certain embodiments, the amino acid sequence of the malate dehydrogenase described herein is shown in SEQ ID NO: 11. A homolog or analog of a wild-type malate dehydrogenase can be a modified malate dehydrogenase that contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acid substitutions, deletions and / or insertions compared to a wild-type or naturally occurring malate dehydrogenase (e.g., SEQ ID NO: 11), while retaining the essential function of catalyzing the reduction of an α-carbonyl group to an α-hydroxyl group. Therefore, in certain embodiments, the malate dehydrogenase described herein is substantially homologous to the polypeptide shown in SEQ ID NO: 11.

[0220] In certain embodiments, the amino acid sequence of the malate dehydrogenase described herein has 1 to 5 (e.g., 1, 2, 3, 4, 5) amino acid mutations compared to SEQ ID NO: 11. In certain embodiments, the amino acid sequence of the malate dehydrogenase described herein is based on the amino acid sequence as shown in SEQ ID NO: 11, with amino acid mutations at positions 12, 81, 85, 179, and / or 86. In certain embodiments, the amino acid sequence of the malate dehydrogenase described herein is based on the amino acid sequence as shown in SEQ ID NO: 11, with amino acid mutations at positions 12, 81, 85, 179, and 86. In certain embodiments, the amino acid sequence of the malate dehydrogenase described herein is based on the amino acid sequence as shown in SEQ ID NO: 11, with amino acid mutations at positions 12, 81, 85, 179, and 86. In certain embodiments, the amino acid sequence of the malate dehydrogenase described herein is based on the amino acid sequence as shown in SEQ ID NO: 11, with five mutations at positions I12V, R81A, M85E, G179D, and D86S. In certain embodiments, the malate dehydrogenase described herein comprises the amino acid sequence shown in SEQ ID NO: 12. In certain embodiments, the amino acid sequence of the malate dehydrogenase described herein is shown in SEQ ID NO: 12.

[0221] In certain embodiments, the malate dehydrogenase described herein has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 11 or SEQ ID NO: 12 and still retains the function of malate dehydrogenase (e.g., the function of catalyzing the reduction of an α-carbonyl group to an α-hydroxyl group).

[0222] In certain embodiments, step (2) includes a sub-step (2-3), wherein the sub-step (2-3) comprises: converting the α-keto-γ-methylthiobutyric acid or its salt prepared in step (1) into 2-hydroxy-4-methylthio-butyric acid or its salt in the presence of α-hydroxy acid dehydrogenase, formate dehydrogenase, ammonium formate and NAD. In certain embodiments, step (2) includes a sub-step (2-3), wherein the sub-step (2-3) comprises: converting the α-keto-γ-methylthiobutyric acid or its salt prepared in step (1) into 2-hydroxy-4-methylthio-butyric acid or its salt in the presence of α-hydroxy acid dehydrogenase, formate dehydrogenase, ammonium formate and NAD. +In the presence of 4-nitro-2-nitropropionic acid (or NADH), the α-keto-γ-methylthiobutyric acid or its salt prepared in step (1) is converted into 2-hydroxy-4-methylthio-butyric acid or its salt. In certain embodiments, the amino acid sequence of the α-hydroxy acid dehydrogenase is shown in SEQ ID NO: 12, and the amino acid sequence of the formate dehydrogenase is shown in SEQ ID NO: 13. An exemplary synthesis route for liquid methionine is shown in FIG2D .

[0223] When only α-hydroxy acid dehydrogenase is used to convert α-keto-γ-methylthiobutyric acid or its salt into 2-hydroxy-4-methylthio-butyric acid or its salt, a recombinant vector containing a nucleic acid molecule encoding the α-hydroxy acid dehydrogenase is expressed in a suitable protein expression system and mixed with α-keto-γ-methylthiobutyric acid or its salt to carry out an enzymatic reaction to produce 2-hydroxy-4-methylthio-butyric acid or its salt.

[0224] When α-hydroxy acid dehydrogenase and formate dehydrogenase are used to convert α-keto-γ-methylthiobutyric acid or its salt into 2-hydroxy-4-methylthio-butyric acid or its salt, a recombinant vector containing nucleic acid molecules encoding the α-hydroxy acid dehydrogenase and formate dehydrogenase is expressed in a suitable protein expression system and reacted with α-keto-γ-methylthiobutyric acid or its salt, ammonium formate and NAD. + (or NADH) are mixed to carry out an enzymatic reaction to generate 2-hydroxy-4-methylthio-butyric acid or its salt. For example, a nucleic acid molecule encoding α-hydroxy acid dehydrogenase is cloned into a vector (e.g., a plasmid) to obtain a first recombinant vector; a nucleic acid molecule encoding formate dehydrogenase is cloned into a vector (e.g., a plasmid) to obtain a second recombinant vector; the first recombinant vector and the second recombinant vector are expressed in a suitable protein expression system and are combined with α-keto-γ-methylthiobutyric acid or its salt, ammonium formate and NAD + (or NADH) are mixed to carry out an enzymatic reaction to generate 2-hydroxy-4-methylthio-butyric acid or a salt thereof. In certain embodiments, the first recombinant vector and the second recombinant vector are the same recombinant vector, that is, the nucleic acid molecules expressing α-hydroxy acid dehydrogenase and formate dehydrogenase are constructed on a single recombinant vector. In certain embodiments, the first recombinant vector and the second recombinant vector are different recombinant vectors, that is, the nucleic acid molecules expressing α-hydroxy acid dehydrogenase and formate dehydrogenase are respectively constructed on different recombinant vectors.

[0225] In certain embodiments, sub-steps (2-3) comprise the following:

[0226] Malate dehydrogenase from Pseudomonas aeruginosa (NCBI accession number: VZT40586) or its quintuple mutant (I12V+R81A+M85E+G179D+D86S, amino acid sequence shown in SEQ ID NO: 12) and formate dehydrogenase PsFDH from Pseudomonas sp. (Uniprot accession number: P33160.3) were codon-optimized and gene-synthesized, and then cloned into a plasmid to generate the recombinant plasmid pCDFDuet-P1-PsFDH-P2-PaMDH-5E.

[0227] √Transform the recombinant plasmid pCDFDuet-P1-PsFDH-P2-PaMDH-5E into competent E. coli cells, pick a single colony and inoculate it into LB liquid medium and culture overnight;

[0228] √Then transfer the cells to LB liquid medium containing streptomycin for culture and collect the cells;

[0229] √ The collected cells were mixed with α-keto-γ-methylthiobutyric acid or its salt, ammonium formate and NAD + (or NADH) are mixed to carry out enzymatic reaction to generate 2-hydroxy-4-methylthio-butyric acid or its salt.

[0230] 3. Nucleic Acids

[0231] In certain embodiments, the present application provides nucleic acid molecules comprising polynucleotide sequences encoding various enzymes or proteins (e.g., lactate oxidase, catalase, aldolase, hemoglobin, lactate dehydrogenase, NADH oxidase, acetyl-CoA synthetase, acetyl-CoA reductase, alcohol dehydrogenase, formyl-CoA reductase, 2-hydroxyacyl-CoA synthase, transaminase, glutamate dehydrogenase, formate dehydrogenase, amino acid dehydrogenase, α-hydroxy acid dehydrogenase, etc.).

[0232] The term "nucleic acid" or "polynucleotide" as used in this application refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) and polymers thereof in single-stranded or double-stranded form. Unless otherwise indicated, a specific nucleic acid sequence or polynucleotide sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences, as well as sequences explicitly indicated. Specifically, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected (or all) codons is replaced by mixed bases and / or deoxyinosine residues (see Batzer et al., Nucleic Acid Res. 19: 5081 (1991); Ohtsuka et al., J. Biol. Chem. 260: 2605-2608 (1985) and Rossolini et al., Mol. Cell. Probes 8: 91-98 (1994)).

[0233] In certain embodiments, polynucleotide sequences encoding various enzymes or proteins (e.g., lactate oxidase, catalase, aldolase, hemoglobin, lactate dehydrogenase, NADH oxidase, acetyl-CoA synthetase, acetyl-CoA reductase, alcohol dehydrogenase, formyl-CoA reductase, 2-hydroxyacyl-CoA synthase, transaminase, glutamate dehydrogenase, formate dehydrogenase, amino acid dehydrogenase, α-hydroxy acid dehydrogenase, etc.) are codon-optimized. "Codon optimization" refers to the modification of a nucleic acid sequence in a target cell to enhance expression by replacing at least one, more than one, or a substantial number of codons of a native sequence with codons from genes that may be more frequently or most frequently used in another organism or species. Various species exhibit specific biases for certain codons for specific amino acids. The present invention encompasses codon-optimized synthetic polynucleotide sequences. Various codon optimization techniques are known in the art for improving the translational kinetics of protein coding regions with inefficient translation. These techniques primarily rely on identifying the codon usage of a particular host organism. If a certain gene or sequence is to be expressed in this organism, the coding sequences of these genes and sequences are modified so that one replaces the codons of the sequence of interest with codons more frequently used by the host organism.

[0234] 4. Recombinant vector and its construction method

[0235] In certain embodiments, the recombinant vectors described herein comprise nucleic acid molecules encoding enzymes or proteins required for each reaction as described herein.

[0236] The term "vector" used in this application refers to a vehicle into which a genetic element can be operably inserted to achieve expression of the genetic element, thereby producing a protein, RNA or DNA encoded by the genetic element, or replicating the genetic element. A vector can be used to transform, transduce or transfect a host cell so that the genetic element it carries is expressed in the host cell. Different vectors can be suitable for different host cells. Examples of vectors include, for example, plasmids, phagemids, cosmids, artificial chromosomes, bacteriophages (e.g., lambda phage or M13 phage), and viral vectors. A vector can contain a variety of elements for controlling expression, including promoter sequences, transcription initiation sequences, enhancer sequences, selectable elements, and reporter genes. In addition, a vector can contain an origin of replication. A vector can also include materials that facilitate its entry into cells, including but not limited to virions, liposomes, or protein coatings. A vector can be an expression vector or a cloning vector.

[0237] The term "recombinant vector" used in this application refers to a vector in which the nucleic acid molecule of the present invention is linked to a promoter suitable for a protein expression system, wherein the 5' end of the coding region of the nucleic acid molecule of the present invention is linked downstream of the promoter.

[0238] The term "plasmid" used in this application refers to a genetic element that generally carries a gene that is not a part of a host cell chromosome, and is generally in the form of a circular double-stranded DNA molecule. Such elements can be linear, circular or supercoiled self-replicating sequences, genomic integration sequences, phages or nucleotide sequences of single-stranded or double-stranded DNA or RNA derived from any source. The plasmid used in this application can be commercially available (for example, purchased from Novagen, ThermoFisher, etc.), or can be constructed from available plasmids by open methods well known in the art. It is well known to those skilled in the art that the various plasmids and other clones and expression vectors used in the present invention are also easily obtained. In addition, those skilled in the art can also easily construct any number of plasmids that are applicable to the present invention. In certain embodiments, the plasmid described herein is selected from one or more of the following groups: pCDFDuet, pET28a, pET-PCT5, pcDNA3.3, pMD18-T, pOptivec, pCMV, pEGFP, pIRES, pQD-Hyg-GSeu, pALTER, pBAD, pcDNA, pCal, pL, pET, pGEMEX, pGEX, pCI, pEGFT, pSV2, pFUSE, pVITRO, pVIVO, pMAL, pMONO, pSELECT, p UNO, pDUO, Psg5L, pBABE, pWPXL, pBI, p15TV-L, pPro18, pTD, pRS10, pLexA, pACT2.2, pCMV-SCRIPT.RTM., pCDM8, pCDNA1.1 / a mp, pcDNA3.1, pRc / RSV, PCR2.1, pEF-1, pFB, pSG5, pXT1, pCDEF3, pSVSPORT, pEF-Bos, pRSFDuet-1, pACYDuet-1, and pETDuet-1.

[0239] In certain embodiments, the vectors described herein can co-express two or more (e.g., three, four, five, six, or more) genes of interest. In certain embodiments, the vectors described herein can co-express polynucleotide sequences encoding two or more (e.g., three, four, five, six, or more) enzymes (e.g., lactate oxidase, catalase, aldolase, hemoglobin, lactate dehydrogenase, NADH oxidase, acetyl-CoA synthetase, acetyl-CoA reductase, alcohol dehydrogenase, formyl-CoA reductase, 2-hydroxyacyl-CoA synthase, transaminase, glutamate dehydrogenase, formate dehydrogenase, amino acid dehydrogenase, α-hydroxy acid dehydrogenase). In certain embodiments, the vectors described herein can co-express polynucleotide sequences encoding lactate oxidase, catalase, and aldolase. In certain embodiments, the vectors described herein can co-express polynucleotide sequences encoding lactate oxidase, catalase, aldolase, and hemoglobin. In certain embodiments, the vectors described herein can co-express polynucleotide sequences encoding lactate oxidase, catalase, and hemoglobin. In certain embodiments, the vectors described herein can co-express polynucleotide sequences encoding lactate dehydrogenase, NADH oxidase, and aldolase. In certain embodiments, the vectors described herein can co-express polynucleotide sequences encoding acetyl-CoA synthetase, acetyl-CoA reductase, alcohol dehydrogenase, formyl-CoA reductase, or 2-hydroxyacyl-CoA synthase. In certain embodiments, the vectors described herein can co-express polynucleotide sequences encoding transaminases, glutamate dehydrogenase, and / or formate dehydrogenase. In certain embodiments, the vectors described herein can co-express polynucleotide sequences encoding amino acid dehydrogenases and / or formate dehydrogenases. In certain embodiments, the vectors described herein can co-express polynucleotide sequences encoding α-hydroxy acid dehydrogenase and formate dehydrogenase.

[0240] In certain embodiments, the vectors described herein include 2, 3, 4, 5 or more vectors. In certain embodiments, the vectors described herein are one or more (e.g., two, three or four) vectors selected from the group consisting of pCDFDuet, pET28a and pET-PCT5.

[0241] In this application, the naming convention for recombinant vectors reflects the name of the vector used, the name of the protein expressed, and the number of vector types used. For example, pET-PCT5-LmACR-ADH2 represents a plasmid system constructed by transferring the genes expressing formyl-CoA reductase ACR (LmACR) and ADH2 into the pET-PCT5 vector backbone.

[0242] The term "artificial chromosome" as used in this application refers to an artificially constructed vector system containing the basic functional units of a natural chromosome (e.g., origin of replication, centromere, telomere). In certain embodiments, the artificial chromosome is selected from the group consisting of a yeast artificial chromosome (YAC), a bacterial artificial chromosome (BAC), a P1-derived artificial chromosome (PAC), a mammalian artificial chromosome (MAC), and a human episomal artificial chromosome (HAEC).

[0243] The term "viral vector" as used in this application refers to a nucleic acid vector construct that includes at least one virally derived element and has the ability to be encapsulated into viral vector particles. Various viral vector forms are known in the art. In certain embodiments, the viral vector is selected from the group consisting of retroviruses (e.g., lentiviruses), adenoviruses, adeno-associated viruses, herpes viruses (e.g., herpes simplex virus, Epstein-Barr virus), poxviruses, baculoviruses, papillomaviruses, papovaviruses (e.g., SV40), and cauliflower mosaic virus.

[0244] In certain embodiments, the method for constructing the recombinant vector described herein comprises:

[0245] (i) obtaining a polynucleotide sequence encoding the enzyme or protein described in the present application;

[0246] (ii) obtaining a vector that incorporates the enzyme or protein encoding the reaction described in the present application.

[0247] In certain embodiments, the method for constructing the recombinant vector described in the present application further comprises step (iii): transforming the vector obtained in step (ii) into a host, applying the transformation solution to a culture medium for cultivation, and picking a single clone.

[0248] 5. Protein Expression System

[0249] In certain embodiments, the protein expression system described herein comprises a recombinant vector of a nucleic acid molecule encoding an enzyme or protein required for each reaction as described herein, or integrates the nucleic acid molecule described herein into the host genome.

[0250] The term "protein expression system" as used in this application refers to an expression system that introduces an exogenous expression cassette (comprising a vector containing an expression cassette) in a manner that allows the expression of a recombinant vector or nucleic acid molecule described herein. In some embodiments, the protein expression system is a cell-free expression system. In some embodiments, the protein expression system is a host cell. The host cell also comprises any offspring of the host cell of the present invention or its derivatives. It will be appreciated by those skilled in the art that all offspring may be different from the parent cell because there may be mutations that occur during replication. However, when using a "protein expression system" or "host cell", the offspring of the expression system or cell are comprised. Protein expression systems that can be used for the present invention include bacteria, fungi, plant cells or animal cells. In some embodiments, the protein expression system is a low-level eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell. The expression cassette can be introduced into the protein expression system by methods well known in the art, for example, calcium phosphate transfection, DEAE-dextran-mediated transfection or electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods in Molecular Biology, 1986).

[0251] In some embodiments, the protein expression system is selected from the group consisting of bacteria, fungi, plant cells, and animal cells. In some embodiments, the bacteria is selected from the group consisting of Bacillus, Clostridia, Corynebacterium, Cupriavidus, Delftia, Escherichia, Enterobacter, Erwinia, Klebsiella, Lactobacillus, Lactococcus, Proteus, Pseudomonas, Rhodococcus, Salmonella, Serratia, Shigella, and Streptomyces. In certain embodiments, the bacteria are selected from the group consisting of Escherichia coli, Salmonella typhimurium, Serratia marcescens, Bacillus subtilis, Bacillus licheniformis, and Pseudomonas aeruginosa. In certain embodiments, the fungi are selected from the group consisting of Candida, Saccharomyces cerevisiae, Kluyveromyces, Pichia pastoris, and Schizosaccharomyces pombe. In certain embodiments, the animal cells are selected from the group consisting of COS cells, CHO-S cells, CHO-K1 cells, HEK-293 cells, and 3T3 cells. In certain embodiments, the protein expression system is Escherichia coli. In certain embodiments, the protein expression system is Escherichia coli BL21 (DE3) or Escherichia coli K12.

[0252] With the recombinant vector transformation protein expression system (for example, host cell) of the application, and it is cultivated in the nutrient medium of routine, and described nutrient medium is suitable for inducing promoter, selecting transformant or the gene of amplification coding sequence of interest after modification.In some embodiments, enzyme described in the application can be made by the method for homologous recombination well known in the art.In some embodiments, described host cell can produce the enzyme among the present invention.

[0253] In certain embodiments, the protein expression system described herein can co-express two or more (e.g., three, four, five, six, or more) target genes. In certain embodiments, the protein expression system described herein can co-express polynucleotide sequences encoding two or more (e.g., three, four, five, six, or more) enzymes (e.g., lactate oxidase, catalase, aldolase, hemoglobin, lactate dehydrogenase, NADH oxidase, acetyl-CoA synthetase, acetyl-CoA reductase, alcohol dehydrogenase, formyl-CoA reductase, 2-hydroxyacyl-CoA synthase, transaminase, glutamate dehydrogenase, formate dehydrogenase, amino acid dehydrogenase, α-hydroxy acid dehydrogenase). In certain embodiments, the protein expression system described herein can co-express polynucleotide sequences encoding lactate oxidase, catalase, and aldolase. In certain embodiments, the protein expression system described herein can co-express polynucleotide sequences encoding lactate oxidase, catalase, aldolase, and hemoglobin. In certain embodiments, the protein expression system described herein can co-express polynucleotide sequences encoding lactate oxidase, catalase, and hemoglobin. In certain embodiments, the protein expression system described herein can co-express polynucleotide sequences encoding lactate dehydrogenase, NADH oxidase, and aldolase. In certain embodiments, the protein expression system described herein can co-express polynucleotide sequences encoding acetyl-CoA synthetase, acetyl-CoA reductase, alcohol dehydrogenase, formyl-CoA reductase, or 2-hydroxyacyl-CoA synthase. In certain embodiments, the protein expression system described herein can co-express polynucleotide sequences encoding transaminases, glutamate dehydrogenase, and / or formate dehydrogenase. In certain embodiments, the protein expression system described herein can co-express polynucleotide sequences encoding amino acid dehydrogenases and / or formate dehydrogenases. In certain embodiments, the protein expression system described herein can co-express polynucleotide sequences encoding α-hydroxy acid dehydrogenase and formate dehydrogenase.

[0254] The present invention also provides the following embodiments.

[0255] Embodiment 1: A method for preparing 2-amino-4-methylthio-butyric acid or a salt thereof, or 2-hydroxy-4-methylthio-butyric acid or a salt thereof, the method comprising the following steps:

[0256] (1) converting 2,3-tetrahydrofurandione into α-keto-γ-methylthiobutyric acid or a salt thereof; and

[0257] (2) converting the α-keto-γ-methylthiobutyric acid or its salt prepared in step (1) into 2-amino-4-methylthio-butyric acid or its salt, or 2-hydroxy-4-methylthio-butyric acid or its salt.

[0258] Embodiment 2: The method according to embodiment 1, wherein the 2,3-tetrahydrofurandione is prepared by the following steps:

[0259] (a) providing lactic acid or a salt thereof; and

[0260] (b) converting the lactic acid or its salt described in step (a) into the 2,3-tetrahydrofurandione.

[0261] Embodiment 3: The method according to embodiment 2, wherein step (a) comprises: in the presence of 2-hydroxyacyl-CoA synthase, enzymatically reacting acetaldehyde with formaldehyde to produce lactic acid or a salt thereof.

[0262] Embodiment 4: The method according to embodiment 3, wherein ethanol is converted into acetaldehyde under the action of alcohol dehydrogenase.

[0263] Embodiment 5: The method according to embodiment 3, wherein acetic acid is converted into acetyl-CoA by the action of acetyl-CoA synthetase, and then acetyl-CoA is converted into acetaldehyde by the action of acetyl-CoA reductase.

[0264] Embodiment 6: The method according to any one of embodiments 3 to 5, wherein the formaldehyde is converted into formyl-CoA by the action of formyl-CoA reductase.

[0265] Embodiment 7: The method according to embodiment 6, wherein the acetaldehyde and the formyl-CoA are condensed into lactyl-CoA under the action of the 2-hydroxyacyl-CoA synthase to generate lactic acid.

[0266] Embodiment 8: The method according to embodiment 5, wherein the acetyl-CoA synthetase is derived from Escherichia coli (E. coli) or Bacillus subtilis.

[0267] Embodiment 9: The method of embodiment 6, wherein the formyl-CoA reductase is from Listeria monocytogenes.

[0268] Embodiment 10: The method of any one of Embodiments 3 to 9, wherein the 2-hydroxyacyl-CoA synthase is from Candida boidinii or Conidiobolus coronatus.

[0269] Embodiment 11: The method according to any one of embodiments 3 to 10, wherein a recombinant vector comprising a nucleic acid molecule encoding the acetyl-CoA synthetase, acetyl-CoA reductase, alcohol dehydrogenase, formyl-CoA reductase or 2-hydroxyacyl-CoA synthase is expressed in a suitable protein expression system and mixed with ethanol (or acetic acid) and formaldehyde for an enzymatic reaction.

[0270] Embodiment 12: The method according to any one of Embodiments 2 to 11, wherein step (b) comprises:

[0271] (b-1) converting the lactic acid or a salt thereof described in step (a) into pyruvic acid or a salt thereof;

[0272] (b-2) converting the pyruvic acid or a salt thereof prepared in sub-step (b-1) into 4-hydroxy-2-oxobutanoic acid or a salt thereof; and

[0273] (b-3) converting the 4-hydroxy-2-oxobutanoic acid or its salt prepared in sub-step (b-2) into 2,3-tetrahydrofurandione.

[0274] Embodiment 13: The method according to Embodiment 12, wherein sub-step (b-1) comprises: converting the lactic acid or a salt thereof described in step (a) into pyruvic acid or a salt thereof in the presence of lactate oxidase or lactate dehydrogenase.

[0275] Embodiment 14: The method according to Embodiment 13, wherein sub-step (b-1) comprises: converting the lactic acid or a salt thereof described in step (a) into pyruvic acid or a salt thereof in the presence of lactate oxidase and catalase.

[0276] Embodiment 15: The method according to Embodiment 14, wherein sub-step (b-1) comprises: converting the lactic acid or a salt thereof described in step (a) into pyruvic acid or a salt thereof in the presence of lactate oxidase, catalase and hemoglobin.

[0277] Embodiment 16: The method according to embodiment 14 or 15, wherein the lactate oxidase is L-lactate oxidase.

[0278] Embodiment 17: The method according to any one of embodiments 14 to 16, wherein the lactate oxidase has NCBI accession number: WP_002373180.1.

[0279] Embodiment 18: The method according to any one of embodiments 14 to 16, wherein the catalase has NCBI accession number: WP_016837596.1.

[0280] Embodiment 19: The method according to embodiment 15, wherein the NCBI accession number of the hemoglobin is: WP_019959060.1.

[0281] Embodiment 20: A method according to embodiment 15, wherein a recombinant vector comprising a nucleic acid molecule encoding the lactate oxidase, catalase and / or hemoglobin is expressed in a suitable protein expression system and mixed with lactic acid or a salt thereof to undergo an enzymatic reaction to generate pyruvic acid or a salt thereof.

[0282] Embodiment 21: The method according to embodiment 20, wherein the nucleic acid molecules encoding the lactate oxidase, catalase and hemoglobin are constructed in the same recombinant vector.

[0283] Embodiment 22: The method according to Embodiment 13, wherein sub-step (b-1) comprises: converting the lactic acid or a salt thereof described in step (a) into pyruvic acid or a salt thereof in the presence of lactate dehydrogenase and NADH oxidase.

[0284] Embodiment 23: The method according to embodiment 22, wherein the lactate dehydrogenase is L-lactate dehydrogenase.

[0285] Embodiment 24: The method according to embodiment 22 or 23, wherein the GenBank accession number of the lactate dehydrogenase is: AEH52590.1.

[0286] Embodiment 25: The method of embodiment 22, wherein the NADH oxidase has an NCBI accession number of WP_002262226.1.

[0287] Embodiment 26: The method according to any one of Embodiments 22 to 25, wherein a recombinant vector comprising a nucleic acid molecule encoding the lactate dehydrogenase or NADH oxidase is expressed in a suitable protein expression system and mixed with lactic acid or a salt thereof to carry out an enzymatic reaction to produce pyruvic acid or a salt thereof.

[0288] Embodiment 27: The method according to embodiment 26, wherein the nucleic acid molecules encoding the lactate dehydrogenase and NADH oxidase are constructed in the same recombinant vector.

[0289] Embodiment 28: The method according to Embodiment 12, wherein sub-step (b-2) comprises: reacting the pyruvate or a salt thereof described in sub-step (b-1) with formaldehyde in the presence of aldolase to produce 4-hydroxy-2-oxobutanoic acid or a salt thereof.

[0290] Embodiment 29: The method according to embodiment 28, wherein the aldolase is a metal ion-dependent class II pyruvate aldolase.

[0291] Embodiment 30: The method according to embodiment 28 or 29, wherein the aldolase has an NCBI accession number of: WP_000992981.1, WP_221399256.1, WP_254486590.1, WP_054179264.1 or WP_208228591.1.

[0292] Embodiment 31: The method according to embodiment 30, wherein the aldolase has the NCBI accession number: WP_221399256.1.

[0293] Embodiment 32: The method according to any one of embodiments 28 to 31, wherein the recombinant vector comprising the nucleic acid molecule encoding the aldolase is expressed in a suitable protein expression system.

[0294] Embodiment 33: The method of any one of Embodiments 12 to 32, wherein the pyruvate salt is potassium pyruvate or sodium pyruvate.

[0295] Embodiment 34: The method according to Embodiment 12, wherein sub-step (b-3) comprises: subjecting the 4-hydroxy-2-oxobutanoic acid or its salt prepared in sub-step (b-2) to an elimination reaction under elimination reaction conditions to obtain 2,3-tetrahydrofurandione.

[0296] Embodiment 35: The method according to Embodiment 34, wherein the elimination reaction conditions in sub-step (b-3) include adjusting the pH to less than 2 (e.g., 1).

[0297] Embodiment 36: A method according to Embodiment 35, wherein the elimination reaction conditions in sub-step (b-3) include adjusting the pH using one or more acids selected from the group consisting of sulfuric acid (e.g., 98% concentrated sulfuric acid), hydrochloric acid, phosphoric acid, and hydrobromic acid.

[0298] Embodiment 37: The method according to any one of Embodiments 2 to 36, wherein step (b) comprises: converting the lactic acid or its salt and formaldehyde described in step (a) into 2,3-tetrahydrofurandione in the presence of lactate oxidase, catalase, hemoglobin and aldolase expressed in the same protein expression system.

[0299] Embodiment 38: The method according to any one of Embodiments 2 to 36, wherein step (b) comprises: converting the lactic acid or its salt and formaldehyde described in step (a) into 2,3-tetrahydrofurandione in the presence of lactate dehydrogenase, NADH oxidase and aldolase expressed in the same protein expression system.

[0300] Embodiment 39: The method according to any one of Embodiments 1 to 38, wherein step (1) comprises reacting 2,3-tetrahydrofurandione with methyl mercaptan or a salt thereof to obtain α-keto-γ-methylthiobutyric acid or a salt thereof.

[0301] Embodiment 40: The method of Embodiment 39, wherein step (1) comprises adjusting the temperature to greater than 120°C (e.g., 160°C).

[0302] Embodiment 41: The method of Embodiment 39, wherein step (1) comprises adjusting the pH to less than 2 (e.g., 1).

[0303] Embodiment 42: The method of any one of Embodiments 39 to 41, wherein the methyl mercaptan salt is potassium methyl mercaptan or sodium methyl mercaptan.

[0304] Embodiment 43: A method according to any one of Embodiments 1 to 42, wherein step (2) includes a sub-step (2-1), and the sub-step (2-1) includes: converting the α-keto-γ-methylthiobutyric acid or a salt thereof prepared in step (1) into 2-amino-4-methylthio-butyric acid or a salt thereof in the presence of a transaminase.

[0305] Embodiment 44: A method according to Embodiment 43, wherein the sub-step (2-1) comprises: converting the α-keto-γ-methylthiobutyric acid or its salt prepared in step (1) into 2-amino-4-methylthio-butyric acid or its salt in the presence of transaminase, glutamate dehydrogenase, formate dehydrogenase, glutamate and ammonium formate.

[0306] Embodiment 45: The method according to embodiment 43 or 44, wherein the NCBI accession number of the transaminase is: WP_001087611.1.

[0307] Embodiment 46: The method according to embodiment 44, wherein the NCBI accession number of the glutamate dehydrogenase is: NP_391659.2.

[0308] Embodiment 47: The method according to embodiment 44, wherein the formate dehydrogenase has a Uniprot accession number of P33160.3.

[0309] Embodiment 48: The method according to any one of embodiments 44 to 47, wherein the recombinant vector comprising the nucleic acid molecule encoding the transaminase, glutamate dehydrogenase and / or formate dehydrogenase is expressed in a suitable protein expression system.

[0310] Embodiment 49: The method according to embodiment 48, wherein the nucleic acid molecules encoding the transaminase, glutamate dehydrogenase and formate dehydrogenase are constructed in the same recombinant vector.

[0311] Embodiment 50: The method according to any one of Embodiments 1 to 42, wherein step (2) includes a sub-step (2-2), and the sub-step (2-2) comprises: converting the α-keto-γ-methylthiobutyric acid or a salt thereof prepared in step (1) into 2-amino-4-methylthio-butyric acid or a salt thereof in the presence of an amino acid dehydrogenase.

[0312] Embodiment 51: A method according to Embodiment 50, wherein the sub-step (2-2) comprises: converting the α-keto-γ-methylthiobutyric acid or its salt prepared in step (1) into 2-amino-4-methylthio-butyric acid or its salt in the presence of amino acid dehydrogenase, formate dehydrogenase and ammonium formate.

[0313] Embodiment 52: The method according to embodiment 50 or 51, wherein the NCBI accession number of the amino acid dehydrogenase is: WP_124765558.1, or a mutant having 1 to 3 amino acid mutations compared thereto.

[0314] Embodiment 53: The method of embodiment 52, wherein the amino acid dehydrogenase comprises the amino acid sequence shown in SEQ ID NO:15.

[0315] Embodiment 54: The method according to embodiment 51, wherein the formate dehydrogenase has a Uniprot accession number of P33160.3.

[0316] Embodiment 55: The method according to any one of Embodiments 50 to 54, wherein the recombinant vector comprising the nucleic acid molecule encoding the amino acid dehydrogenase and / or formate dehydrogenase is expressed in a suitable protein expression system.

[0317] Embodiment 56: The method according to embodiment 55, wherein the nucleic acid molecules encoding the amino acid dehydrogenase and formate dehydrogenase are constructed in the same recombinant vector.

[0318] Embodiment 57: The method according to any one of Embodiments 1 to 42, wherein step (2) includes a sub-step (2-3), and the sub-step (2-3) includes: converting the α-keto-γ-methylthiobutyric acid or a salt thereof prepared in step (1) into 2-hydroxy-4-methylthio-butyric acid or a salt thereof in the presence of α-hydroxyacid dehydrogenase.

[0319] Embodiment 58: A method according to Embodiment 57, wherein the sub-step (2-3) comprises: converting the α-keto-γ-methylthiobutyric acid or a salt thereof prepared in step (1) into 2-hydroxy-4-methylthio-butyric acid or a salt thereof in the presence of α-hydroxy acid dehydrogenase, formate dehydrogenase and ammonium formate.

[0320] Embodiment 59: The method according to embodiment 57 or 58, wherein the NCBI accession number of the α-hydroxyacid dehydrogenase is: VZT40586, or a mutant thereof having 1 to 5 amino acid mutations.

[0321] Embodiment 60: The method of embodiment 59, wherein the α-hydroxy acid dehydrogenase comprises the amino acid sequence shown in SEQ ID NO:12.

[0322] Embodiment 61: The method according to embodiment 58, wherein the formate dehydrogenase has the Uniprot accession number: P33160.3.

[0323] Embodiment 62: The method according to any one of embodiments 58 to 61, wherein the recombinant vector comprising the nucleic acid molecule encoding the α-hydroxy acid dehydrogenase and / or formate dehydrogenase is expressed in a suitable protein expression system.

[0324] Embodiment 63: The method according to embodiment 62, wherein the nucleic acid molecules encoding the α-hydroxy acid dehydrogenase and the formate dehydrogenase are constructed in the same recombinant vector.

[0325] The sequence information mentioned in this application is shown in Table 1 below.

[0326] Table 1. Sequence information Example

[0327] The protein expression host Escherichia coli BL21 (DE3) used in the examples of the present invention was purchased from Shanghai Weidi Biotechnology Co., Ltd.

[0328] The plasmids pCDFDuet, pET-PCT5 and pET28a used in the examples of the present invention were purchased from Novagen, USA.

[0329] The LB medium formula is: peptone 10 g / L; yeast powder 5 g / L; NaCl 10 g / L, pH 7.0; sterilized at 115°C for 30 minutes.

[0330] The formula of M9 culture medium is: Na2HPO4 6.78g / L, KH2PO4 3g / L, NaCl 0.5g / L, NH4Cl 1g / L, MgSO4 2mM, thiamine 15μM.

[0331] Example 1: Lactic acid synthesis catalyzed by 2-hydroxyacyl-CoA synthase whole cells

[0332] As shown in the synthesis route diagram of Figure 1, ethanol is converted into acetaldehyde by the action of alcohol dehydrogenase, formaldehyde is converted into formyl-CoA by the action of formyl-CoA reductase (ACR), and acetaldehyde and formyl-CoA are condensed into lactic acid acyl-CoA by 2-hydroxyacyl-CoA synthase to produce lactic acid.

[0333] 1.1 Construction of recombinant plasmid

[0334] 1.1.1 Construction of 2-hydroxyacyl-CoA synthase (HACS) recombinant plasmid

[0335] 2-hydroxyacyl-CoA synthase 1 (from Candida boidinii, NCBI accession number: OWB57166.1, amino acid sequence shown in SEQ ID NO: 18) and 2-hydroxyacyl-CoA synthase 2 (from Conidiobolus coronatus, NCBI accession number: KXN72624.1, amino acid sequence shown in SEQ ID NO: 19) were codon-optimized and gene synthesized, and then cloned into the plasmid pCDFduet to obtain recombinant plasmids pCDFduet-CbHACS and pCDFduet-CdcHACS, respectively.

[0336] 1.1.2 Construction of formyl-CoA reductase (ACR) recombinant plasmid

[0337] Formyl-CoA reductase (from Listeria monocytogenes, NCBI accession number: MBV1006252.1, amino acid sequence shown in SEQ ID NO: 20) was codon-optimized and gene synthesized, and cloned into the pET-PCT5 plasmid to obtain the recombinant plasmid pET-PCT5-LmACR.

[0338] 1.1.3 Construction of alcohol dehydrogenase (ADH) recombinant plasmid

[0339] The alcohol dehydrogenase gene from Saccharomyces cerevisiae (NCBI accession number: AAA34411.1, amino acid sequence shown in SEQ ID NO: 21) was selected and cloned into the pET-PCT5-LmACR plasmid by PCR to obtain the recombinant plasmid pET-PCT5-LmACR-ADH2.

[0340] 1.1.4 Construction of acetyl-CoA synthetase (ACS) recombinant plasmid

[0341] The acetyl-CoA synthetase genes from Escherichia coli (E. coli) (Uniprot accession number: P27550.2, amino acid sequence shown in SEQ ID NO: 22) and the acetyl-CoA synthetase genes from Bacillus subtilis (GenBank accession number: SPY14848.1, amino acid sequence shown in SEQ ID NO: 23) were selected, amplified by PCR, and cloned into the pET-PCT5-LmACR plasmid to obtain the recombinant plasmids pET-PCT5-LmACR-EcACS and pET-PCT5-LmACR-BsACS, respectively.

[0342] 1.2 Induction of 2-hydroxyacyl-CoA synthase and formyl-CoA reductase proteins

[0343] For the ethanol-to-acetaldehyde pathway, the recombinant plasmids pCDFduet-CbHACS or pCDFduet-CdcHACS obtained in Examples 1.1.1 and 1.1.3 were co-transformed with pET-PCT5-LmACR-ADH2 into competent E. coli BL21(DE3) cells. A single colony was selected and inoculated into 1-5 mL of LB liquid medium and cultured overnight at 37°C and 200 rpm. A 1% inoculum was then transferred to 100 mL of LB liquid medium containing 50 μL / mL streptomycin or ampicillin. The cells were cultured at 37°C to an OD600 of 0.6-0.8, and IPTG was added to a final concentration of 0.1-0.5 mM. The cells were cultured at 25°C and 180 rpm for 18-24 hours. The cells were harvested by centrifugation at 8000 rpm for 5 minutes, washed twice with saline, and then collected by centrifugation for later use.

[0344] For the pathway of synthesizing acetaldehyde from acetic acid, the recombinant plasmid pCDFduet-CbHACS (or pCDFduet-CdcHACS) obtained in Example 1.1.1 and Example 1.1.4 was co-transformed with pET-PCT5-LmACR-EcACS (or pET-PCT5-LmACR-BsACS), and the above steps were repeated to collect the bacteria.

[0345] 1.3 Whole-cell conversion of ethanol / acetic acid and formaldehyde to lactic acid

[0346] The cells were resuspended in a reaction system containing M9 medium, and 20 mM ethanol and 10 mM formaldehyde were added to the ethanol synthesis acetaldehyde pathway, or 20 mM sodium acetate and 10 mM formaldehyde were added to the acetaldehyde synthesis pathway of acetate, and then the reaction was carried out at room temperature and a constant pH of 7.0 for a total of 12 h.

[0347] 1.4 Sample testing and results

[0348] The reaction sample obtained in Example 1.3 was centrifuged, and the supernatant was filtered through a 0.22 μM filter membrane, and the reaction product was detected by liquid chromatography.

[0349] Liquid phase conditions: The chromatographic column was a Coregel 107H column (7.8×300 mm), the mobile phase was a 7 mM sulfuric acid solution, isocratic elution was adopted (flow rate was 0.4 mL / min), and the detection wavelength was UV 214 nm.

[0350] Liquid phase results showed that the product peak appearing in the above reaction liquid samples coincided with the elution time of lactic acid, and the highest lactic acid concentration produced by pCDFduet-CdcHACS and pET-PCT5-LmACR-EcACS in the acetic acid to acetaldehyde synthesis route was 7.54 mM.

[0351] Example 2: Synthesis of pyruvic acid by multi-enzyme system

[0352] Example 2a L-lactate oxidase whole cells catalyze the synthesis of sodium pyruvate from sodium L-lactate

[0353] 2a.1 Construction of recombinant plasmids encoding catalase, L-lactate oxidase, and hemoglobin

[0354] L-lactate oxidase LOXL (from Enterococcus, NCBI accession number: WP_002373180.1, amino acid sequence shown in SEQ ID NO: 1), hemoglobin VHb (from Vitreoscilla, NCBI accession number: WP_019959060.1, amino acid sequence shown in SEQ ID NO: 2), and catalase UtCAT (from Ureibacillus thermosphaericus, NCBI accession number: WP_016837596.1, amino acid sequence shown in SEQ ID NO: 3) were codon-optimized and synthesized, respectively. LOXL and UtCAT were each tethered to a stop codon and linked with an RBS sequence (GCAACACATTTAAGGAAATCTATT (SEQ ID NO: 24)), and then inserted into the NdeI and XhoI sites of the multirestriction site-2 of the plasmid pCDFDuet to obtain recombinant plasmid 1. The gene encoding VHb was inserted into the NdeI and XhoI sites of the plasmid pET28a to obtain recombinant plasmid 2.

[0355] Using the primers shown in Table 2, the VHb in recombinant plasmid 2 was constructed into the multi-restriction site-1 of the above recombinant plasmid 1 using DNA seamless cloning technology. The steps are as follows:

[0356] Using pCDFDuet-p2-LOXL-RBS-UtCAT as a template, VHb was amplified using primers 1 and 2 to obtain the VHb fragment. Using pCDFDuet-p2-LOXL-RBS-UtCAT as a template, the vector backbone was amplified using primers 3 and 4. Gel excision and recovery were performed, and the recombination reaction was performed according to the system shown in Table 3 at 37°C for 30 min. An appropriate amount of the reaction solution was used to transform competent Escherichia coli BL21(DE3) cells, plated onto LB solid medium supplemented with 50 μL / mL streptomycin, and cultured overnight at 37°C. Single colonies were isolated and verified by sequencing to obtain the recombinant plasmid pCDFDuet-p1-VHb-p2-LOXL-RBS-UtCAT.

[0357] Table 2. Primers for constructing the pCDFDuet-p1-VHb-p2-LOXL-RBS-UtCAT recombinant plasmid

[0358] Table 3. Recombination reaction system

[0359] 2a.2 Induction of Catalase, L-Lactate Oxidase, and Hemoglobin

[0360] The recombinant plasmid pCDFDuet-p1-VHb-p2-LOXL-RBS-UtCAT obtained in Example 2a.1 was transformed into competent E. coli BL21(DE3) cells. A single colony was selected and inoculated into 1-5 mL of LB liquid medium and cultured overnight at 37°C and 200 rpm. A 1% inoculum was then transferred to 100 mL of LB liquid medium containing 50 μL / mL streptomycin. The cells were cultured at 37°C to an OD600 of 0.6-0.8. IPTG was then added to a final concentration of 0.1-0.5 mM. The cells were cultured at 25°C and 180 rpm for 18-24 hours. The cells were harvested by centrifugation at 8000 rpm for 5 minutes, washed twice with saline, and then collected by centrifugation for later use.

[0361] 2a.3 L-lactate oxidase converts sodium L-lactate into pyruvate in whole cells

[0362] The bacteria obtained in Example 2a.2 were resuspended in 0.1 M NaH2PO4-Na2HPO4 buffer (pH 7.0) to a concentration of 40 g wet cells / L. Sodium L-lactate was added to a concentration of 1 M in the reaction system. 0.1% Triton-X100 and 10 mM EDTA were also added, and the cells were transformed at 37°C and 200 rpm for 24 h.

[0363] 2a.4 Sample testing and results

[0364] The reaction sample obtained in 2a.3 was diluted, centrifuged, and the supernatant was filtered through a 0.22 μM filter membrane. The sample was subjected to liquid phase detection.

[0365] Liquid phase conditions: The chromatographic column was a Coregel 107H column (4.6×250 mm), the mobile phase was a 7 mM sulfuric acid solution, isocratic elution was adopted (flow rate was 0.5 mL / min), and the detection wavelength was UV 214 nm.

[0366] The liquid phase results showed (as shown in FIG3A ) that the yield of pyruvate achieved by the three-enzyme system catalyzed reaction using 1M sodium L-lactate as the substrate was 96%.

[0367] Example 2b L-lactate dehydrogenase whole cell catalyzes the synthesis of sodium pyruvate from sodium L-lactate

[0368] 2b.1 Construction of recombinant plasmids encoding L-lactate dehydrogenase and NADH oxidase

[0369] L-lactate dehydrogenase WcLdh (from Heyndrickxia coagulans 2-6, GenBank accession number: AEH52590.1, amino acid sequence shown in SEQ ID NO: 4) and NADH oxidase SmNOX (from Streptococcus mutans, NCBI accession number: WP_002262226.1, amino acid sequence shown in SEQ ID NO: 5) were codon-optimized and synthesized. The gene encoding WcLdh was inserted into the BamHI and HindIII sites of the multirestriction site-1 of the plasmid pCDFDuet, and the gene encoding SmNOX was inserted into the NdeI and XhoI sites of the multirestriction site-2 of the plasmid pCDFDuet, generating the recombinant plasmid pCDFDuet-p1-WcLdh-p2-SmNOX.

[0370] 2b.2 Induction of L-lactate dehydrogenase and NADH oxidase

[0371] The recombinant plasmid pCDFDuet-p1-WcLdh-p2-SmNOX obtained in Example 2b.1 was transformed into competent E. coli BL21(DE3) cells. A single colony was selected and inoculated into 1-5 mL of LB liquid medium and cultured overnight at 37°C and 200 rpm. A 1% inoculum was then transferred to 100 mL of LB liquid medium containing 50 μL / mL streptomycin. The cells were cultured at 37°C to an OD600 of 0.6-0.8. IPTG was then added to a final concentration of 0.1-0.5 mM. The cells were cultured at 25°C and 180 rpm for 18-24 hours. The cells were harvested by centrifugation at 8000 rpm for 5 minutes, washed twice with saline, and then collected by centrifugation for later use.

[0372] 2b.3 Lactate dehydrogenase converts sodium L-lactate into pyruvate in whole cells

[0373] The cells obtained in Example 2b.2 were resuspended in 0.1 M NaH2PO4-Na2HPO4 buffer (pH 7.0) to a concentration of 40 g wet cells / L. Sodium L-lactate was added to a concentration of 1 M in the reaction system, and 1 mM NADPH was added. + , transformed at 37°C and 200 rpm for 24 h.

[0374] 2b.4 Sample testing and results

[0375] The reaction sample obtained in Example 2b.3 was diluted, centrifuged, and the supernatant was filtered through a 0.22 μM filter membrane, and the sample was subjected to liquid phase detection.

[0376] Liquid phase conditions: the chromatographic column was a Coregel 107H column (7.8×300 mm), the mobile phase was a 7 mM sulfuric acid solution, isocratic elution was adopted (flow rate was 0.4 mL / min), and the detection wavelength was UV 214 nm.

[0377] The liquid phase results showed (as shown in FIG3B ) that the yield of pyruvate achieved by the L-lactate dehydrogenase-catalyzed reaction using 1 M sodium L-lactate as a substrate was 91%.

[0378] Example 3: Aldolase whole cell catalyzed synthesis of 4-hydroxy-2-oxobutanoic acid

[0379] 4-Hydroxy-2-oxobutanoic acid can be formed by the condensation of formaldehyde and pyruvate. To obtain an aldolase that can tolerate high formaldehyde concentrations and exhibit high catalytic activity, the aldolase YfaU (EC4.1.2.53) from Escherichia coli K12 (NCBI accession number: WP_000992981.1, amino acid sequence shown as SEQ ID NO: 6) was used as a template. Based on classification information in the NCBI database, a search was conducted to identify Class II aldolases with sequence similarity between 60% and 90%. Aldolases from four different sources were selected to screen for aldolases with high catalytic activity in the presence of high formaldehyde concentrations.

[0380] 3.1 Construction of recombinant aldolase plasmid

[0381] The aldolases (psyf, asyf, toyf, and biyf) from four different sources as shown in Table 4 were codon optimized and gene synthesized, and inserted into the multiple restriction sites NdeI and XhoI of the plasmid pET28a, respectively, to obtain the corresponding four recombinant plasmids pET28a-psyf, pET28a-asyf, pET28a-toyf, and pET28a-biyf.

[0382] 3.2 Induction culture of aldolase

[0383] The four recombinant plasmids obtained in Example 3.1 were transformed into competent E. coli BL21(DE3) cells, and single colonies were selected and inoculated into 1-5 mL of LB liquid medium. Cultured overnight at 37°C and 200 rpm. A 1% inoculum was then transferred to 100 mL of LB liquid medium containing 50 μL / mL kanamycin. Cultured at 37°C until the OD600 reached 0.6-0.8, IPTG was added to a final concentration of 0.1-0.5 mM, and cultured at 25°C and 180 rpm for 18-24 h. The cells were harvested by centrifugation at 8000 rpm for 5 min, washed twice with saline, and then collected by centrifugation for later use.

[0384] 3.3 Whole-cell aldolase converts pyruvate and formaldehyde into 4-hydroxy-2-oxobutyrate

[0385] The cells obtained in Example 3.2 were treated with 0.1M NaH2PO4-N a2 HPO4 was resuspended to a concentration of 40 g wet cells / L, sodium pyruvate was added to make the concentration in the reaction system 1 M, and then an equimolar concentration of formaldehyde aqueous solution was added. The transformation was carried out at 200 rpm at pH 7 and 37°C for 12 h.

[0386] 3.4 Sample testing and results

[0387] The reaction sample obtained in 3.3 was diluted, centrifuged, and the supernatant was filtered through a 0.22 μM filter membrane. The sample was subjected to liquid phase detection.

[0388] Liquid phase conditions: The chromatographic column was a Coregel 107H column (7.8×300 mm), the mobile phase was a 10 mM sulfuric acid solution, isocratic elution was adopted (flow rate was 0.4 mL / min), and the detection wavelength was UV 214 nm.

[0389] The results are shown in Table 4. The conversion rate of aldolase psyf was the highest, reaching 98.7%, indicating that it can tolerate high concentrations of formaldehyde and has high catalytic activity.

[0390] Table 4. Screening results of aldolase activity

[0391] Example 4: Multi-enzyme system catalyzes the synthesis of 2,3-tetrahydrofurandione using L-lactic acid and formaldehyde as substrates

[0392] 4.1 Construction and expression of recombinant bacteria A and B

[0393] The recombinant plasmids obtained in Example 2a and Example 2b (pCDFDuet-p1-VHb-p2-LOXL-RBS-UtCAT and pCDFDuet-p1-WcLdh-p2-SmNOX) were mixed with the recombinant plasmid pET28a-psyf obtained in Example 3 in equal proportions, and then transformed into Escherichia coli BL21 (DE3) competent cells, respectively, to obtain recombinant bacteria A (pCDFDuet-p1-VHb-p2-LOXL-RBS-UtCAT and pET28a-psyf) and recombinant bacteria B (pCDFDuet-p1-WcLdh-p2-SmNOX and pET28a-psyf).

[0394] Pick a single colony and inoculate it into 1-5 mL of LB liquid medium. Cultivate overnight at 37°C and 200 rpm. Then, transfer 1% of the inoculum to 100 mL of LB liquid medium containing 50 μL / mL kanamycin and streptomycin. Cultivate at 37°C until the OD600 reaches 0.6-0.8. Add IPTG to a final concentration of 0.1-0.5 mM. Cultivate at 25°C and 180 rpm for 18-24 hours. Collect the cells by centrifugation at 8000 rpm for 5 minutes. Wash twice with saline and then centrifuge both cultures for later use.

[0395] 4.2 Preparation of 2,3-tetrahydrofurandione by multienzyme system

[0396] L-lactic acid was added to a 1 L reaction system to a concentration of 1 M. 10 M potassium hydroxide was then added to adjust the pH to 7. Recombinant bacteria A and B were weighed and added to the reaction vessel to a concentration of 40 g wet cells / L. Formaldehyde was slowly added (0.05 mol of formaldehyde per hour, for a total of 1 mol over 20 hours). Conversion was carried out at 200 rpm for 24 hours at pH 7 and 37°C. Samples were collected and analyzed for lactic acid conversion by HPLC.

[0397] The results are shown in Figures 4A and 4B. The conversion rates of recombinant bacteria A and recombinant bacteria B were both greater than 99%, and no residual pyruvate was observed. This shows that the consumption of pyruvate promoted the oxidation of lactic acid. After the reaction was completed, centrifugation was carried out at 12,000 rpm for 20 minutes, and the centrifuge was heated at 80°C for half an hour and filtered. The filtrate was adjusted to pH 1 with 1N sulfuric acid and concentrated in vacuo at 65°C. The residue was washed with ethyl acetate, filtered, and the filtrate was concentrated and crystallized to obtain a light yellow solid. The filter cake was the by-product potassium sulfate. The 2,3-tetrahydrofurandione prepared by the reaction was subjected to HPLC and nuclear magnetic resonance spectroscopy (hydrogen spectrum). The results are shown in Figures 4C and 5, confirming that the reaction product was 2,3-tetrahydrofurandione.

[0398] Example 5: Chemical synthesis of α-keto-γ-methylthiobutyric acid

[0399] Example 5a: Scheme 1

[0400] 1 g of 2,3-tetrahydrofurandione and 700 mg of potassium methyl mercaptan were dissolved in 20 ml of dimethylacetamide, heated to 160° C., and reacted for 1 h. The target product α-keto-γ-methylthiobutyric acid was obtained (as shown in FIG6 ), with a conversion rate of over 95%.

[0401] Cool the reaction system to 20-30°C, adjust the pH to 1 with 1N sulfuric acid, dilute with 100 mL of saturated brine, and extract twice with ethyl acetate to extract the desired product into the organic phase. The organic phases were combined, dried over sodium sulfate, and concentrated to obtain a brown liquid. The reaction product was identical to the standard control.

[0402] Example 5b: Scheme 2

[0403] 5b.1 Preparation of methyl 4-chloro-2-oxobutanoate

[0404] Dissolve 1 g of 2,3-tetrahydrofurandione in 20 ml of hydrogen chloride / methanol solution, heat to 80°C, and react for 12 hours. Cool the reaction system to 20-30°C and concentrate by rotary evaporation to obtain crude methyl 4-chloro-2-oxobutanoate with a crude yield of 100%.

[0405] 5b.2 Preparation of α-keto-γ-methylthiobutyric acid

[0406] The crude methyl 4-chloro-2-oxobutanoate obtained in Example 5b.1 was dissolved in 20 ml of dimethylacetamide, added to a sealed tube, cooled to 0°C, and methyl mercaptan was added. After sealing, the tube was reacted at 100°C for 4 h, with a conversion rate of over 95%.

[0407] Cool the reaction system to 20-30°C, dilute with 100 mL of saturated brine, and extract twice with ethyl acetate to extract the desired product into the organic phase. Combine the organic phases, dry over sodium sulfate, and concentrate to obtain a brown liquid. The reaction product is identical to the standard control.

[0408] Example 6: Synthesis of liquid methionine

[0409] 6.1 Construction of α-hydroxyacid dehydrogenase recombinant plasmid

[0410] According to previous reports, L-lactate dehydrogenase and malate dehydrogenase generally have high substrate specificity, showing high activity only on natural substrates. A malate dehydrogenase mutant (EcMdH-5E) from Escherichia coli (E. coli) has high activity towards 4-hydroxy-2-oxobutanoate and is structurally similar to α-keto-γ-methylthiobutanoate. Therefore, based on the sequence alignment of malate dehydrogenase (from Pseudomonas aeruginosa, NCBI accession number: VZT40586, amino acid sequence shown in SEQ ID NO: 11) and EcMdH-5E, five mutations (I12V, R81A, M85E, G179D, and D86S) were introduced at the corresponding sites. The resulting PaMDH-5E (amino acid sequence shown in SEQ ID NO: 12) was codon-optimized and gene synthesized.

[0411] To reduce the use of expensive NADH coenzyme, formate dehydrogenase PsFDH (from Pseudomonas sp., Uniprot accession number: P33160.3, amino acid sequence shown in SEQ ID NO: 13) was introduced to achieve the regeneration of NADH.

[0412] The gene encoding malate dehydrogenase PaMDH-5E was inserted into the second multiple restriction enzyme site of plasmid pCDFDuet, and the gene encoding formate dehydrogenase PsFDH was inserted into the first multiple restriction enzyme site of plasmid pCDFDuet to obtain the recombinant plasmid pCDFDuet-P1-PsFDH-P2-PaMDH-5E.

[0413] 6.2 Induction of α-hydroxyacid dehydrogenase and formate dehydrogenase

[0414] The recombinant plasmid pCDFDuet-P1-PsFDH-P2-PaMDH-5E obtained in Example 6.1 was transformed into Escherichia coli BL21(DE3) competent cells, and a single colony was selected and inoculated into 1-5 mL of LB liquid medium. Culture was incubated overnight at 37°C and 200 rpm. A 1% inoculum was then transferred to 100 mL of LB liquid medium containing 50 μL / mL streptomycin. Culture was continued at 37°C until the OD600 reached 0.6-0.8. IPTG was then added to a final concentration of 0.1-0.5 mM. Culture was continued at 25°C and 180 rpm for 18-24 h. The cells were harvested by centrifugation at 8000 rpm for 5 min, washed twice with saline, and then harvested by centrifugation for later use.

[0415] 6.3 Whole-cell conversion of α-keto-methylthiobutyrate to liquid methionine

[0416] The cells obtained in Example 6.2 were resuspended in 0.1M KH2PO4-K2HPO4 pH 7.0 to a concentration of 40 g wet cells / L. α-keto-γ-methylthiobutyric acid was added to a concentration of 0.1 M in the reaction system. 120 mM ammonium formate and 0.2 mM NAD were also added. + The transformation was carried out at pH 7, 37°C and 200 rpm for 12 h.

[0417] 6.4 Sample testing and results

[0418] The reaction sample obtained in 6.3 was diluted, centrifuged, and the supernatant was filtered through a 0.22 μM filter membrane. The sample was subjected to liquid chromatography to detect product formation.

[0419] Liquid phase conditions: The chromatographic column was a Coregel 107H column (4.6×250 mm), the mobile phase was a 10 mM sulfuric acid solution, isocratic elution was adopted (flow rate was 0.5 mL / min), and the detection wavelength was UV 214 nm.

[0420] The liquid phase results showed (as shown in FIG7 ) that the substrate conversion rate reached over 99%.

[0421] Example 7: Synthesis of methionine

[0422] Example 7a: Amino acid dehydrogenase catalyzes the synthesis of methionine from α-keto-γ-methylthiobutyrate

[0423] 7a.1 Construction of amino acid dehydrogenase recombinant plasmid

[0424] The amino acid dehydrogenase LcGluDH-M3 is NADH-dependent and is a triple mutant (A144G+V345A+V375Y) of the amino acid dehydrogenase LcGluDH (from Lysinibacillus composti WP, NCBI accession number: WP_124765558.1, amino acid sequence shown in SEQ ID NO: 14). Its amino acid sequence (shown in SEQ ID NO: 15) was codon-optimized and gene synthesized.

[0425] Amino acid dehydrogenases require NAD(P)H and NH4+ to perform their catalytic functions. Therefore, the formate dehydrogenase PsFDH in Example 6 was introduced, and ammonium formate was used as a co-substrate, which not only provided amine but also achieved the regeneration of the coenzyme NADH.

[0426] The gene encoding amino acid dehydrogenase LcGluDH-M3 was inserted into the second multiple restriction enzyme site of the vector pCDFDuet, and the gene encoding formate dehydrogenase PsFDH was inserted into the first multiple restriction enzyme site of the vector pCDFDuet to obtain the recombinant vector pCDFDuet-P1-PsFDH-P2-LcGluDH-M3.

[0427] 7a.2 Induction of Amino Acid Dehydrogenase and Formate Dehydrogenase

[0428] The recombinant vector pCDFDuet-P1-PsFDH-P2-LcGluDH-M3 obtained in Example 7a.1 was transformed into competent E. coli BL21(DE3) cells. A single colony was selected and inoculated into 1-5 mL of LB liquid medium and cultured overnight at 37°C and 200 rpm. A 1% inoculum was then transferred to 100 mL of LB liquid medium containing 50 μg / mL streptomycin. The cells were cultured at 37°C to an OD600 of 0.6-0.8. IPTG was then added to a final concentration of 0.1-0.5 mM. The cells were cultured at 25°C and 180 rpm for 18-24 hours. The cells were harvested by centrifugation at 8000 rpm for 5 minutes, washed twice with saline, and then collected by centrifugation for later use.

[0429] 7a.3 Whole-cell conversion of α-keto-γ-methylthiobutyrate to methionine

[0430] The pH of 0.1M α-keto-γ-methylthiobutyric acid aqueous solution was adjusted to 8.0 with aqueous ammonia, and then 0.2M ammonium formate and 0.2mM NAD + Add to the reaction vessel, finally add 40 g / L wet cells, the reaction volume is 50 mL. The reaction is carried out at 35°C and a constant pH of 8.0.

[0431] 7a.4 Testing and Results

[0432] The reaction sample obtained in 7a.3 was diluted, centrifuged, and the supernatant was filtered through a 0.22 μM filter membrane. The sample was subjected to liquid chromatography to detect the generated product.

[0433] Liquid phase conditions for detecting α-keto-γ-methylthiobutyric acid: the chromatographic column is a Coregel 107H column (4.6×250 mm), the mobile phase is a 10 mM sulfuric acid solution, isocratic elution is adopted (flow rate is 0.5 mL / min), and the detection wavelength is UV 214 nm.

[0434] Specific steps and liquid phase conditions for methionine detection:

[0435] √Methionine was detected using the 2,4-dinitrofluorobenzene derivatization method. The specific steps are as follows: Accurately transfer 100 μL of sample into a 15 mL plastic conical centrifuge tube, add 100 μL of NaHCO3 solution, then add 100 μL of DNFB derivatization agent solution, add 200 μL of acetonitrile, mix well, incubate in a 60°C water bath for 30 min, then add 1 mL of phosphate buffer solution and 1 mL of acetonitrile, and finally add 7.5 mL of H2O, mix well, pass through an organic membrane, and then load the sample.

[0436] Liquid phase conditions: The chromatographic column was a Phenomenex Luna C18 (250 mm*4.6 mm*5 μm), mobile phase A was an aqueous phase containing 0.1% acetic acid and 0.1% triethylamine, mobile phase B was acetonitrile, isocratic elution was used (flow rate was 0.8 mL / min), and the detection wavelength was UV 360 nm.

[0437] The liquid phase results showed (as shown in FIG8 ) that the substrate conversion rate reached over 84.7%.

[0438] Example 7b: Transaminase and glutamate dehydrogenase cascade catalyze the synthesis of methionine from α-keto-γ-methylthiobutyrate

[0439] This example provides a route for synthesizing methionine by combining three enzymes: transaminase transfers the amino group on glutamate to α-keto-γ-methylthiobutyrate to form methionine and α-ketoglutarate, and glutamate dehydrogenase consumes NH4 + It recovers glutamate from α-ketoglutarate with NADH, and uses ammonium formate to generate NADH for glutamate dehydrogenase.

[0440] 7b.1 Construction of recombinant plasmids encoding transaminase and glutamate dehydrogenase

[0441] Codon optimization and gene synthesis were performed on glutamate dehydrogenase BsGluDH (from Bacillus subtilis subsp. subtilis str.168, NCBI accession number: NP_391659.2, amino acid sequence shown in SEQ ID NO: 16), transaminase ETA (from Enterobacteriaceae, NCBI accession number: WP_001087611.1, amino acid sequence shown in SEQ ID NO: 17), and formate dehydrogenase PsFDH in Example 6, respectively. The transaminase ETA and glutamate dehydrogenase BsGluDH were each added with a stop codon, linked with an RBS sequence (GCAACACATTTAAGGAAATCTATT (SEQ ID NO: 29)), and inserted into the second multiple restriction enzyme site of the vector pCDFDuet. The gene encoding formate dehydrogenase PsFDH was inserted into the first multiple restriction enzyme site of the vector pCDFDuet to obtain the recombinant vector pCDFDuet-P1-PsFDH-P2-ETA-RBS2-BsGluDH.

[0442] 7b.2 Induction of Amino Acid Dehydrogenase and Formate Dehydrogenase

[0443] The recombinant vector pCDFDuet-P1-PsFDH-P2-ETA-RBS2-BsGluDH prepared in Example 7b.1 was transformed into competent E. coli BL21(DE3) cells. A single colony was selected and inoculated into 1-5 mL of LB liquid medium and cultured overnight at 37°C and 200 rpm. A 1% inoculum was then transferred to 100 mL of LB liquid medium containing 50 μL / mL streptomycin. The cells were cultured at 37°C to an OD600 of 0.6-0.8. IPTG was then added to a final concentration of 0.1-0.5 mM. The cells were cultured at 25°C and 180 rpm for 18-24 hours. The cells were harvested by centrifugation at 8000 rpm for 5 minutes, washed twice with saline, and then collected by centrifugation for later use.

[0444] 7b.3 Whole-cell conversion of α-keto-γ-methylthiobutyrate to methionine

[0445] A 0.1M aqueous solution of α-keto-γ-methylthiobutyric acid was adjusted to pH 8.0 with ammonia. 0.2M ammonium formate, 0.1mM PLP, and 0.2mM NAD+ were then added to the reaction vessel. 10mM glutamate (previously neutralized to pH 8.0 with ammonia) was then added. Finally, 40g / L of wet cells were added, resulting in a 50mL reaction volume. The reaction was carried out at 35°C and a constant pH of 8.0 for 12 hours.

[0446] 7b.4 Testing and Results

[0447] The reaction sample was diluted, centrifuged, and the supernatant was filtered through a 0.22 μM filter membrane. The sample was subjected to liquid chromatography to detect product formation. The detection method was the same as in Example 7a.4.

[0448] The liquid phase results showed (as shown in FIG9 ) that the substrate conversion rate reached over 97.4%.

Claims

1. A method for preparing 2-amino-4-methylthio-butyric acid or a salt thereof, or 2-hydroxy-4-methylthio-butyric acid or a salt thereof, the method comprising the following steps: (1) converting 2,3-tetrahydrofurandione into α-keto-γ-methylthiobutyric acid or a salt thereof; and (2) converting the α-keto-γ-methylthiobutyric acid or its salt prepared in step (1) into 2-amino-4-methylthio-butyric acid or its salt, or 2-hydroxy-4-methylthio-butyric acid or its salt.

2. The method according to claim 1, wherein the 2,3-tetrahydrofurandione is prepared by the following steps: (a) providing lactic acid or a salt thereof; and (b) converting the lactic acid or its salt described in step (a) into the 2,3-tetrahydrofurandione.

3. The method according to claim 2, wherein step (a) comprises: In the presence of 2-hydroxyacyl-CoA synthase, acetaldehyde and formaldehyde undergo an enzymatic reaction to generate lactic acid or its salt.

4. The method according to claim 3, wherein ethanol is converted into acetaldehyde under the action of alcohol dehydrogenase.

5. The method according to claim 3, wherein acetic acid is converted into acetyl-CoA by acetyl-CoA synthetase, and then acetyl-CoA is converted into acetaldehyde by acetyl-CoA reductase.

6. The method according to any one of claims 3 to 5, wherein the formaldehyde is converted into formyl-CoA by the action of formyl-CoA reductase. 7 . The method according to claim 6 , wherein the acetaldehyde and the formyl-CoA are condensed into lactyl-CoA under the action of the 2-hydroxyacyl-CoA synthase to generate lactic acid. The method according to claim 5 , wherein the acetyl-CoA synthetase is derived from Escherichia coli or Bacillus subtilis .

9. The method of claim 6, wherein the formyl-CoA reductase is from Listeria monocytogenes.

10. The method of any one of claims 3 to 9, wherein the 2-hydroxyacyl-CoA synthase is from Candida boidinii or Conidiobolus coronatus.

11. The method according to any one of claims 3 to 10, wherein a recombinant vector comprising a nucleic acid molecule encoding the acetyl-CoA synthetase, acetyl-CoA reductase, alcohol dehydrogenase, formyl-CoA reductase or 2-hydroxyacyl-CoA synthase is expressed in a suitable protein expression system and mixed with ethanol (or acetic acid) and formaldehyde for an enzymatic reaction.

12. The method according to any one of claims 2 to 11, wherein step (b) comprises: (b-1) converting the lactic acid or a salt thereof described in step (a) into pyruvic acid or a salt thereof; (b-2) converting the pyruvic acid or a salt thereof prepared in sub-step (b-1) into 4-hydroxy-2-oxobutanoic acid or a salt thereof; and (b-3) converting the 4-hydroxy-2-oxobutanoic acid or its salt prepared in sub-step (b-2) into 2,3-tetrahydrofurandione.

13. The method according to claim 12, wherein: Sub-step (b-1) comprises: converting the lactic acid or a salt thereof described in step (a) into pyruvic acid or a salt thereof in the presence of lactate oxidase or lactate dehydrogenase.

14. The method according to claim 13, wherein Sub-step (b-1) comprises: converting the lactic acid or a salt thereof described in step (a) into pyruvic acid or a salt thereof in the presence of lactate oxidase and catalase.

15. The method according to claim 14, wherein Sub-step (b-1) comprises: converting the lactic acid or a salt thereof described in step (a) into pyruvic acid or a salt thereof in the presence of lactate oxidase, catalase and hemoglobin. The method according to claim 14 or 15, wherein the lactate oxidase is L-lactate oxidase.

17. The method according to any one of claims 14 to 16, wherein the lactate oxidase has the NCBI accession number: WP_002373180.

1.

18. The method according to any one of claims 14 to 16, wherein the catalase has the NCBI accession number: WP_016837596.

1.

19. The method according to claim 15, wherein the NCBI accession number of the hemoglobin is: WP_019959060.

1.

20. The method according to claim 15, wherein a recombinant vector comprising a nucleic acid molecule encoding the lactate oxidase, catalase and / or hemoglobin is expressed in a suitable protein expression system and mixed with lactic acid or a salt thereof to undergo an enzymatic reaction to generate pyruvic acid or a salt thereof.

21. The method according to claim 20, wherein the nucleic acid molecules encoding the lactate oxidase, catalase and hemoglobin are constructed into the same recombinant vector.

22. The method according to claim 13, wherein Sub-step (b-1) comprises: converting the lactic acid or a salt thereof in step (a) into pyruvic acid or a salt thereof in the presence of lactate dehydrogenase and NADH oxidase. The method according to claim 22 , wherein the lactate dehydrogenase is L-lactate dehydrogenase.

24. The method according to claim 22 or 23, wherein the GenBank accession number of the lactate dehydrogenase is: AEH52590.

1.

25. The method of claim 22, wherein the NADH oxidase has NCBI accession number WP_002262226.

1.

26. The method according to any one of claims 22 to 25, wherein a recombinant vector comprising a nucleic acid molecule encoding the lactate dehydrogenase or NADH oxidase is expressed in a suitable protein expression system and mixed with lactic acid or a salt thereof to undergo an enzymatic reaction to produce pyruvic acid or a salt thereof.

27. The method according to claim 26, wherein the nucleic acid molecules encoding the lactate dehydrogenase and NADH oxidase are constructed into the same recombinant vector.

28. The method according to claim 12, wherein Sub-step (b-2) comprises: reacting the pyruvate or its salt described in sub-step (b-1) with formaldehyde in the presence of aldolase to produce 4-hydroxy-2-oxobutanoic acid or its salt.

29. The method of claim 28, wherein the aldolase is a metal ion-dependent class II pyruvate aldolase.

30. The method according to claim 28 or 29, wherein the aldolase has the NCBI accession number: WP_000992981.1, WP_221399256.1, WP_254486590.1, WP_054179264.1 or WP_208228591.

1.

31. The method of claim 30, wherein the aldolase has NCBI accession number: WP_221399256.

1.

32. The method according to any one of claims 28 to 31, wherein the recombinant vector comprising the nucleic acid molecule encoding the aldolase is expressed in a suitable protein expression system.

33. The method of any one of claims 12 to 32, wherein the pyruvate salt is potassium pyruvate or sodium pyruvate.

34. The method according to claim 12, wherein Sub-step (b-3) comprises: subjecting the 4-hydroxy-2-oxobutanoic acid or its salt prepared in sub-step (b-2) to an elimination reaction under elimination reaction conditions to obtain 2,3-tetrahydrofurandione.

35. The method according to claim 34, wherein The elimination reaction conditions in sub-step (b-3) include adjusting the pH to less than 2 (eg, 1).

36. The method of claim 35, wherein: The elimination reaction conditions in sub-step (b-3) include adjusting the pH using one or more acids selected from the group consisting of sulfuric acid (eg, 98% concentrated sulfuric acid), hydrochloric acid, phosphoric acid, and hydrobromic acid.

37. The method of any one of claims 2 to 36, wherein step (b) comprises: In the presence of lactate oxidase, catalase, hemoglobin and aldolase expressed in the same protein expression system, the lactic acid or its salt and formaldehyde in step (a) are converted into 2,3-tetrahydrofurandione.

38. The method of any one of claims 2 to 36, wherein step (b) comprises: In the presence of lactate dehydrogenase, NADH oxidase and aldolase expressed in the same protein expression system, the lactic acid or its salt and formaldehyde in step (a) are converted into 2,3-tetrahydrofurandione.

39. The method according to any one of claims 1 to 38, wherein step (1) comprises reacting 2,3-tetrahydrofurandione with methyl mercaptan or a salt thereof to obtain α-keto-γ-methylthiobutyric acid or a salt thereof.

40. The method of claim 39, wherein step (1) comprises adjusting the temperature to greater than 120°C (e.g., 160°C).

41. The method of claim 39, wherein step (1) comprises adjusting the pH to less than 2 (e.g., 1).

42. The method of any one of claims 39 to 41, wherein the methyl mercaptan salt is potassium methyl mercaptan or sodium methyl mercaptan.

43. The method according to any one of claims 1 to 42, wherein step (2) comprises a sub-step (2-1), the sub-step (2-1) comprising: In the presence of transaminase, the α-keto-γ-methylthiobutyric acid or its salt prepared in step (1) is converted into 2-amino-4-methylthio-butyric acid or its salt.

44. The method according to claim 43, wherein said sub-step (2-1) comprises: In the presence of transaminase, glutamate dehydrogenase, formate dehydrogenase, glutamate and ammonium formate, the α-keto-γ-methylthiobutyric acid or its salt prepared in step (1) is converted into 2-amino-4-methylthio-butyric acid or its salt.

45. The method according to claim 43 or 44, wherein the NCBI accession number of the transaminase is: WP_001087611.

1.

46. ​​The method of claim 44, wherein the NCBI accession number of the glutamate dehydrogenase is: NP_391659.

2.

47. The method of claim 44, wherein the formate dehydrogenase has the Uniprot accession number: P33160.

3.

48. The method according to any one of claims 44 to 47, wherein the recombinant vector comprising the nucleic acid molecule encoding the transaminase, glutamate dehydrogenase and / or formate dehydrogenase is expressed in a suitable protein expression system.

49. The method according to claim 48, wherein the nucleic acid molecules encoding the transaminase, glutamate dehydrogenase and formate dehydrogenase are constructed into the same recombinant vector.

50. The method according to any one of claims 1 to 42, wherein step (2) comprises a sub-step (2-2), the sub-step (2-2) comprising: In the presence of amino acid dehydrogenase, the α-keto-γ-methylthiobutyric acid or its salt prepared in step (1) is converted into 2-amino-4-methylthio-butyric acid or its salt.

51. The method of claim 50, wherein said sub-step (2-2) comprises: In the presence of amino acid dehydrogenase, formate dehydrogenase and ammonium formate, the α-keto-γ-methylthiobutyric acid or its salt prepared in step (1) is converted into 2-amino-4-methylthio-butyric acid or its salt.

52. The method according to claim 50 or 51, wherein the NCBI accession number of the amino acid dehydrogenase is: WP_124765558.1, or a mutant having 1 to 3 amino acid mutations compared thereto.

53. The method of claim 52, wherein the amino acid dehydrogenase comprises the amino acid sequence shown in SEQ ID NO:

15.

54. The method of claim 51, wherein the formate dehydrogenase has the Uniprot accession number: P33160.

3.

55. The method according to any one of claims 50 to 54, wherein the recombinant vector comprising the nucleic acid molecule encoding the amino acid dehydrogenase and / or formate dehydrogenase is expressed in a suitable protein expression system.

56. The method according to claim 55, wherein the nucleic acid molecules encoding the amino acid dehydrogenase and formate dehydrogenase are constructed into the same recombinant vector.

57. The method according to any one of claims 1 to 42, wherein step (2) comprises sub-steps (2-3), said sub-steps (2-3) comprising: In the presence of α-hydroxy acid dehydrogenase, the α-keto-γ-methylthiobutyric acid or its salt prepared in step (1) is converted into 2-hydroxy-4-methylthio-butyric acid or its salt.

58. The method of claim 57, wherein said sub-steps (2-3) comprise: In the presence of α-hydroxy acid dehydrogenase, formate dehydrogenase and ammonium formate, the α-keto-γ-methylthiobutyric acid or its salt prepared in step (1) is converted into 2-hydroxy-4-methylthio-butyric acid or its salt.

59. The method according to claim 57 or 58, wherein the NCBI accession number of the α-hydroxy acid dehydrogenase is: VZT40586, or a mutant having 1 to 5 amino acid mutations compared thereto.

60. The method of claim 59, wherein the alpha-hydroxy acid dehydrogenase comprises the amino acid sequence shown in SEQ ID NO:

12.

61. The method of claim 58, wherein the formate dehydrogenase has the Uniprot accession number: P33160.

3.

62. The method according to any one of claims 58 to 61, wherein a recombinant vector comprising a nucleic acid molecule encoding the alpha-hydroxy acid dehydrogenase and / or formate dehydrogenase is expressed in a suitable protein expression system.

63. The method of claim 62, wherein the nucleic acid molecules encoding the α-hydroxy acid dehydrogenase and formate dehydrogenase are constructed into the same recombinant vector.

Citation Information

Patent Citations

  • Method for producing methionine from homoserine

    CN101374806A

  • Method for the production of D,L-2-hydroxy-4-alkylthio butyric acid

    CN101506153A

  • Preparation of methionine or selenomethionine from homoserine via a lactone intermediate

    CN102869646A

  • Method for preparing an amino acid from 2-aminobutyrolactone

    CN103153943A

  • Biosynthesis of products from 1-carbon compounds

    CN107429271A