Drug-polymer complex, pharmaceutical composition, and drug delivery polymer

Abstract

The present invention provides a drug-polymer complex that includes a drug and a drug delivery polymer having a phosphocholine group, and that exhibits a dissociation constant (KD) of 1.0×10-6M or less with respect to STARD7.

Description

Drug-polymer conjugates, pharmaceutical compositions, and polymers for drug delivery

[0001] The present invention relates to drug-polymer conjugates, pharmaceutical compositions, drug delivery polymers, and drug delivery methods.

[0002] Generally, when drugs are administered systemically via oral or intravenous injection, they accumulate not only in the affected area but also in normal tissues. As a result, side effects may occur, requiring changes or discontinuation of treatment. In response to this, drug delivery systems (DDS) have been developed that selectively deliver drugs to the affected area, with the aim of reducing side effects.

[0003] To increase the amount of drug accumulated at the affected site, efforts are underway to develop target-oriented DDSs that target the affected site. Traditionally, research has focused on increasing cellular uptake, but in recent years, it has become clear that many intractable diseases such as cancer, heart disease, and diabetes are closely related to mitochondria, so interest is also turning to drug delivery to intracellular mitochondria.

[0004] For drug delivery to mitochondria, several techniques have been proposed that utilize positively charged and hydrophobic structures or moieties. For example, the use of mitoporters, which are composed of liposomes with a lipid bilayer and contain octaarginine on their surface (Non-Patent Document 1), and the use of proteins or peptides containing triphenylphosphonium (TPP) groups or signals recognized by transport proteins on the mitochondrial membrane have been proposed (e.g., Non-Patent Documents 2 and 3). The use of phosphocholine (PC) groups, which are relatively polar and zwitterionic, has also been proposed (Patent Document 1).

[0005] WO2020 / 116640

[0006] Yamada Y. et al. , Biochim Biophys Acta. 2008 Feb; 1778(2):423-32 Liberman E. A. et al. , Nature, volume 222, pages 1076-1078 (1969) Swati Biswas et al. , Adv Drug Deliv Rev. 2014 Feb; 0:26-41

[0007] Mitochondrial targeting using a positively charged and hydrophobic structure or moiety has the following problems in in vivo application: (i) it may form aggregates with negatively charged plasma proteins in the blood, and the aggregates may be eliminated from the body by the reticuloendothelial system or may cause clogging of capillaries; (ii) it may nonspecifically interact with lipid bilayers, resulting in adsorption to the cell membranes of various cells, causing off-targeting; (iii) even if it is taken up into cells, it may interact with various negatively charged intracellular substances such as mRNA, causing off-targeting within the cells; and (iv) even if it is delivered to mitochondria, the surfactant-like structure may mix with the lipid bilayer, resulting in destruction of the mitochondrial membrane; and therefore, it is difficult to put it into practical use. Furthermore, with regard to mitochondrial targeting using PC groups described in Patent Document 1, sufficient consideration has not been given to its in vivo application.

[0008] The present invention has been made to solve the above-mentioned problems, and a main object of the present invention is to provide a technology that enables drug delivery to mitochondria in vivo, particularly a technology that enables drug delivery selectively to the mitochondria of cancer cells.

[0009] [1] According to one aspect of the present invention, a drug delivery system is provided that contains a drug and a drug delivery polymer having a phosphocholine group, and has a dissociation constant (K Ｄ ) is 1.0 x 10 －６

[0023]

[0024]

[0025]

[0026]

[0027]

[0028]

[0029]

[0030]

[0031]

[0032]

[0033]

[0034]

[0035]

[0036]

[0037]

[0038]

[0039]

[0040]

[0041]

[0038]

[0042]

[0039]

[0043]

[0044]

[0039]

[0045]

[0046]

[0047]

[0050]

[0051]

[0052]

[0053]

[0054]

[0055]

[0056]

[0057]

[0058]

[0059]

[0060]

[0061]

[0062]

[0063]

[0064]

[0065]

[0070]

[0071]

[0072]

[0073]

[0074]

[0075]

[0080]

[0081]

[0082]

[0083]

[0084]

[0085]

[0086]

[0087]

[0088]

[0090]

[0091]

[0092]

[0093]

[0094]

[0095]

[0096]

[0097]

[0098]

[0099]

[0100]

[0099]

[0099]

[0101]

[0099]

[0099]

[0099]

[0099]

[0102]

[0099]

[0099]

[0099]

[0099]

[0099]

[0103]

[0099] [ [7] In the drug-polymer conjugate according to any one of [4] to [6] above, the molecular weight (Mw) of each of the two or more polymer chains of the drug delivery polymer may be 200 to 50,000. [8] In the drug-polymer conjugate according to any one of [4] to [7] above, the drug may be bound to at least one of the two or more polymer chains. [9] In the drug-polymer conjugate according to any one of [1] to [8] above, the drug delivery polymer may comprise a hydrophilic polymer composed of poly(ethylene glycol), poly(saccharide), poly(vinylpyrrolidone), poly(vinyl alcohol), poly(acrylamide), poly(acrylic acid), poly(methacrylamide), poly(methacrylic acid), poly(methacrylic acid ester), poly(acrylic acid ester), poly(amino acid), poly(malic acid), or a derivative thereof.

[10] In the drug-polymer conjugate according to any one of [1] to [9] above, the drug may comprise at least one selected from a physiologically active substance, a fluorescent reagent, and a contrast agent.

[11] According to another aspect of the present invention, there is provided a pharmaceutical composition comprising the drug-polymer conjugate according to any one of [1] to

[10] above.

[12] According to another aspect of the present invention, there is provided a method for producing a phosphocholine-binding protein having two or more polymer chains, at least one of which has a phosphocholine group bound to it, and a dissociation constant (K) for STARD7. Ｄ ) is 1.0 x 10 －６

[13] The drug delivery polymer according to

[12] above may be a polymer that exhibits a zeta potential of 0 or less when measured as a polymer having sulfo-cy5 introduced at one end of the two or more polymer chains and an uncharged group at the other end.

[14] The drug delivery polymer according to

[12] or

[13] above may have a molecular weight (Mw) of 5,000 to 100,000.

[15] In the drug delivery polymer according to any of

[12] to

[14] above, the molecular weight (Mw) of each of the two or more polymer chains may be 200 to 50,000.

[16] The drug delivery polymer according to any one of

[12] to

[15] above may comprise a hydrophilic polymer composed of poly(ethylene glycol), poly(saccharide), poly(vinylpyrrolidone), poly(vinyl alcohol), poly(acrylamide), poly(acrylic acid), poly(methacrylamide), poly(methacrylic acid), poly(methacrylic acid ester), poly(acrylic acid ester), poly(amino acid), poly(malic acid), or a derivative thereof.

[0010] According to the present invention, mitochondrial targeting, preferably in vivo mitochondrial targeting, can be suitably carried out by using a drug-polymer conjugate or a drug delivery polymer (DDS polymer) that has a certain level or higher binding affinity with a phospholipid transfer protein "STARD7 (StAR-related lipid transfer domain protein 7)" that has the activity of transporting phosphatidylcholine to mitochondria.

[0011] 1 is an image of a drug-polymer conjugate prepared in an experimental example. (a) is a microscopic image of an in vitro assessment of mitochondrial accumulation, and (b) is a graph showing the fluorescence intensity in mitochondria. (b) is a diagram explaining the preparation scheme of ligand-conjugated gold nanoparticles. (c) is a TEM image of cells incubated with ligand-conjugated gold nanoparticles. (d) is an image showing the colocalization of mitochondria and drug-polymer conjugates in STARD7-inactivated cells and native cells. (e) is a graph showing the results of a quantitative evaluation of mitochondrial accumulation of a drug-polymer conjugate. (f) is a fluorescent image of the tumor and organ surfaces of a mouse administered with a drug-polymer conjugate. (g) is a graph showing the fluorescence intensity of tumors and organs of a mouse administered with a drug-polymer conjugate. (h) is an image of a tumor with stained mitochondria. (i) is an image of a tumor section with stained mitochondria. (ii) is a graph showing the results of a quantitative evaluation of the accumulation of a drug-polymer conjugate in tumor mitochondria. (iii) is a graph showing the results of an in vitro assessment of the uptake of a protein-polymer conjugate into mitochondria. (iv) is a graph showing the results of an evaluation of nucleic acid delivery to mitochondria. 20 is a diagram illustrating the preparation scheme of a ligand-conjugated Sim-polymer conjugate. This is a graph showing the results of cytotoxicity evaluation of a ligand-conjugated Sim-polymer conjugate by MTT assay. This is a graph showing the results of cytotoxicity evaluation of a ligand-conjugated Sim-polymer conjugate by CCK-8 assay. This is a graph showing the results of measuring reactive oxygen species generated from mitochondria in cells treated with a ligand-conjugated Sim-polymer conjugate. This is a graph showing the results of measuring changes in mitochondrial membrane potential in cells treated with a ligand-conjugated Sim-polymer conjugate. This is a graph showing the results of measuring changes in mitochondrial membrane potential in cells treated with a ligand-conjugated Sim-polymer conjugate. This is a graph showing the normalized and quantified fluorescence intensity of sulfo-Cy5 bound to a ligand-conjugated polymer in a blood vessel. This is an image capturing the extravasation of a ligand-conjugated polymer. This is a graph showing the quantification of the fluorescence intensity of each label in the region of interest in FIG. 20. This is a diagram showing observation images and colocalization rates at multiple time points after the start of observation for cells treated with PC-8-PEG20.1 is a graph showing the relationship between the contact time between lysosomes and mitochondria and the type of ligand.

[0012] Preferred embodiments of the present invention (e.g., drug-polymer conjugates and DDS polymers that can be suitably applied to in vivo mitochondrial targeting) are described below, but the present invention is not limited to these embodiments. Furthermore, unless inappropriate in the context, each embodiment can be combined as appropriate. Furthermore, in this specification, the term "to" indicating a numerical range includes the upper and lower numerical limits.

[0013] A. Drug-Polymer Conjugates Drug-polymer conjugates according to embodiments of the present invention comprise a drug and a drug delivery polymer having phosphocholine (PC) groups (PC group-containing DDS polymers). The average particle size of drug-polymer conjugates according to embodiments of the present invention is typically greater than 5 nm, for example, greater than 5.2 nm, greater than 5.5 nm, or greater than 6 nm. The PC group is a zwitterionic group represented by formula (I):

[0014] The dissociation constant (K Ｄ ) is, for example, 1.0 × 10 －６ M or less, preferably 5.0 × 10 －７ M or less, more preferably 3.0 × 10 －７ M or less, more preferably 2.0 × 10 －７ M or less, and even more preferably 5.0 × 10 －８ M or less, for example, 1.0 × 10 －９ M or more or 1.0 x 10 －８M or more. If the dissociation constant is within the above range, the drug-polymer conjugate can be suitably taken up into mitochondria via STARD7. The reason for such an effect is presumed to be that, without limiting the present invention in any way, a drug-polymer conjugate having the above dissociation constant is efficiently taken up into mitochondria because the PC group can be suitably recognized by STARD7. The above dissociation constant can be measured using surface plasmon resonance (SPR). STARD7 is typically mammalian STARD7, preferably human STARD7.

[0015] Hereinafter, drug-polymer conjugates according to embodiments of the present invention will be described in two separate embodiments: a first embodiment in which the drug-polymer conjugate contains one drug delivery polymer (DDS polymer), and a second embodiment in which the drug-polymer conjugate contains two or more DDS polymers. The drug-polymer conjugates may be formed by utilizing covalent and / or non-covalent interactions, and may be, for example, conjugates, associations, or aggregates.

[0016] A-1. First Embodiment The drug-polymer conjugate in the first embodiment comprises one PC group-containing DDS polymer and one or more drugs. The PC group-containing DDS polymer and the drug may be covalently bonded (including by coordinate bonding) directly or via a linker, or may be conjugated by non-covalent interactions. Preferably, the PC group-containing DDS polymer and the drug are covalently bonded. Any linker used in DDS applications can be used as the linker. The number of atoms in the main chain of the linker can be, for example, 1 to 20, preferably 1 to 15, and more preferably 1 to 10.

[0017] In a drug-polymer conjugate having a configuration in which one PC group-containing DDS polymer is bound to one or more drugs, the PC group-containing DDS polymer may be a branched polymer having two or more polymer chains. Specifically, the drug-polymer conjugate may include a branched PC group-containing DDS polymer having two or more polymer chains, and a drug bound to at least one of the two or more polymer chains.

[0018] The polymer constituting the PC group-containing DDS polymer is preferably a hydrophilic polymer with high biocompatibility. Examples include poly(ethylene glycol), poly(saccharide), poly(vinylpyrrolidone), poly(vinyl alcohol), poly(acrylamide), poly(acrylic acid), poly(methacrylamide), poly(methacrylic acid), poly(methacrylic acid ester), poly(acrylic acid ester), poly(amino acid), poly(malic acid), or derivatives thereof. Among these, poly(ethylene glycol) is preferred. In one embodiment, the PC group-containing DDS polymer is composed of a polymer that has no charge at physiological pH (pH 7.4).

[0019] The number of polymer chains in the branched PC group-containing DDS polymer is, for example, 3 or more, preferably 4 or more, more preferably 5 or more, and even more preferably 6 to 32, and may be, for example, 7 or more or 8 or more, and may be, for example, 24 or less, 20 or less, or 16 or less. When the number of polymer chains is within the above range, it is possible to suitably achieve both suppression of steric hindrance and ensuring the introduction amount of PC groups.

[0020] The PC group-containing DDS polymer has at least one PC group. The number of PC groups that the PC group-containing DDS polymer has (the number of PC groups per polymer molecule) is not limited as long as the drug-polymer conjugate satisfies the above-mentioned dissociation constant for STARD7, and is preferably 3 or more, more preferably 4 or more, even more preferably 5 or more, and still more preferably 6 to 32, for example, 7 or more or 8 or more, and may be, for example, 24 or less, 20 or less, or 16 or less. In one embodiment, the dissociation constant (K Ｄ ) is, for example, 1.0 × 10 －６ M or less, preferably 5.0 × 10 －７ M or less, more preferably 3.0 × 10 －７ M or less, more preferably 2.0 × 10 －７ M or less, and even more preferably 5.0 × 10 －８ M or less, for example, 1.0 × 10 －９ M or more or 1.0 x 10 －８ It may be M or more.

[0021] In the PC group-containing DDS polymer, the PC group may be introduced at any position, preferably at the end of the polymer chain. Since the PC group introduced at the end of the polymer chain is easily exposed on the surface of the drug-polymer conjugate, a drug-polymer conjugate with high affinity for STARD7 can be suitably obtained. In the branched PC group-containing DDS polymer, the PC group is bonded to at least one polymer chain, preferably to two or more polymer chains, and more preferably to the ends of two or more polymer chains.

[0022] The molecular weight of the PC group-containing DDS polymer (Mw of the entire polymer, regardless of whether it is linear or branched) is, for example, 5,000 to 100,000, preferably 10,000 to 50,000, more preferably 12,000 to 50,000, even more preferably 15,000 to 50,000, and still more preferably 20,000 to 40,000, and may be 20,000 to 35,000 or 20,000 to 30,000. The polydispersity index (PDI) of the PC group-containing DDS polymer may be, for example, 1.1 or less. When the PC group-containing DDS polymer is branched, the molecular weight (Mw) of each polymer chain is typically 200 or more, preferably 1,000 or more, and may be, for example, 1,500 or more or 2,000 or more, and typically 50,000 or less, preferably 5,000 or less, and may be, for example, 4,000 or less or 3,000 or less. The molecular weight of each polymer chain may be the same or different. When the molecular weight of each polymer chain is similar, the degree of exposure of the terminal group can also be similar. The molecular weight (Mw) can be measured, for example, by gel permeation chromatography (GPC). When the molecular weight of the PC group-containing DDS polymer and / or the molecular weight of each polymer chain is within the above range, in vivo mitochondrial targeting can be more effectively performed.

[0023] The PC group equivalent of the PC group-containing DDS polymer (molecular weight of PC group-containing DDS polymer / number of PC groups) is, for example, 200 to 10,000, preferably 1,000 to 5,000, and more preferably 1,000 to 4,000, and may be 1,500 or more or 2,000 or more, and may be 3,000 or less or 2,500 or less. When the PC group equivalent is within the above range, the degree of exposure of PC groups on the surface of the drug-polymer conjugate is increased, and a drug-polymer conjugate that satisfies the above-mentioned dissociation constant for STARD7 can be suitably obtained.

[0024] A branched PC group-containing DDS polymer, when measured as a polymer having sulfo-cy5 (hereinafter also referred to as "sulfo-cy5") bonded to the end of one polymer chain and having uncharged groups (e.g., PC groups, acetyl groups) at the ends of the other polymer chains, can be a polymer that exhibits a zeta potential of preferably 0 or less, more preferably -3 or less, for example, a zeta potential of -15 to -3, -12 to -4, or -11 to -5. When one polymer chain has a negatively charged end group (e.g., sulfo-cy5) and the other polymer chain has an uncharged end group, it is believed that the zeta potential decreases when the exposed level of the charged end group is high, and increases when the exposed level is low. Thus, the zeta potential can correspond to the exposed level of each polymer chain end group in the branched PC group-containing DDS polymer. A PC group-containing DDS polymer having a structure in which a PC group is bonded to the polymer chain end in a polymer backbone exhibiting the above-mentioned zeta potential can exhibit a sufficiently small dissociation constant with STARD7.

[0025] Any appropriate substance can be used as the drug depending on the purpose. For example, substances (biologically active substances) having physiological activities such as cytostatic activity, antitumor activity, immunomodulatory activity, antiviral activity, antibacterial activity, and anti-inflammatory activity are preferably used. Specific examples of drugs include proteins or peptides (e.g., antibodies or functional fragments thereof, hormones, and enzymes), nucleic acids (e.g., high molecular weight nucleic acids such as plasmid DNA and mRNA, and low molecular weight nucleic acids such as siRNA, miRNA, antisense nucleic acids, and aptamers), and other physiologically active substances (e.g., antitumor agents, signal transduction inhibitors, antimetabolites, analgesics, anti-inflammatory agents, and antibacterial agents). The drug may also be a detection reagent such as a fluorescent dye or a contrast agent. Only one drug or two or more drugs may be used. Two or more drugs or two or more drugs may be used in the form of a complex. The drug may be bound to any appropriate site of the PC group-containing DDS polymer, for example, to the end of the polymer chain or to a side chain of the polymer chain.

[0026] The mass (molecular weight) of the drug is not particularly limited. Specifically, the mass (molecular weight) of the drug may be less than 500 or greater than 500. The drug may be, for example, a low-molecular-weight drug having a mass (molecular weight) of less than 500, a medium-molecular-weight drug having a mass (molecular weight) of 500 or greater but less than 2000, or a high-molecular-weight drug having a mass (molecular weight) of 2000 or greater. In one embodiment, the other physiologically active substance may be a low-molecular-weight drug or a medium-molecular-weight drug. The mass of the protein, nucleic acid, etc. may be, for example, 1000 Da to 150,000 Da, or, for example, 3000 Da to 150,000 Da.

[0027] The number of drugs bound to the PC group-containing DDS polymer (the number of drugs per drug-polymer conjugate) may be 1 or more, for example, 2 or more, or 3 or more. The upper limit of the number of drugs is not limited as long as the dissociation constant for STARD7 is maintained, and may be, for example, 10,000 or less or 100 or less. Different types of drugs may be used in combination. For example, in the case of a drug-polymer conjugate in which an antibody is bound to a fluorescent dye, the delivery efficiency of the antibody can be examined by detecting the fluorescence of the fluorescent dye.

[0028] The average particle size of the drug-polymer conjugate is, for example, greater than 5.2 nm, preferably greater than 6 nm. When the average particle size is, for example, 5 nm or less, or, for example, 5.2 nm or less or 6 nm or less, the drug-polymer conjugate tends to be easily excreted in urine via the kidney. The average particle size is not limited as long as it satisfies the dissociation constant for STARD7. The average particle size is typically 100 nm or less, preferably 30 nm or less, and may be, for example, 20 nm or less or 10 nm or less. The average particle size can be measured using a dynamic light scattering (DLS) measurement device.

[0029] The drug-polymer conjugate can be produced by any suitable method. For example, the drug-polymer conjugate can be obtained by a method comprising: reacting a branched polymer having a polymer chain with a functional group A introduced at its terminal with a PC group-containing compound having a PC group and a functional group reactive with the functional group A to obtain a PC group-containing DDS polymer, and reacting the unreacted functional group A of the PC group-containing DDS polymer with a functional group of the drug; a method comprising reacting a branched polymer having a polymer chain with a functional group A introduced at its terminal with a drug having a functional group reactive with the functional group A to obtain a drug-conjugated polymer, and reacting the unreacted functional group A of the drug-conjugated polymer with a PC group-containing compound having a functional group reactive with the functional group A and a PC group; or a method comprising reacting a branched polymer having a polymer chain with a functional group A introduced at its terminal and a polymer chain with a functional group B introduced at its terminal with a drug having a functional group reactive with the functional group A and a PC group-containing compound having a PC group and a functional group reactive with the functional group B. The functional group of the drug used in the reaction with the PC group-containing polymer may be a functional group inherent to the drug, or may be a functional group introduced into the drug using a crosslinker or the like.

[0030] Specific examples of combinations of functional groups include an azide group and an alkyne, a thiol group and a (meth)acryloyl group, a thiol group and a maleimide group, a thiol group and a thiol group, a thiol group and a carboxyl group, a (meth)acryloyl group and a hydroxyl group, a (meth)acryloyl group and an amino group, a carboxyl group and an amino group, a carboxyl group and a hydroxyl group, an amino group and a hydroxyl group, an amino group and an NHS ester group, an amino group and an aldehyde group, etc. Branched PEGs and crosslinkers into which various functional groups (e.g., amino group, maleimide, NHS, thiol, acryloyloxy, carboxyl) have been introduced are commercially available. Specific examples of the PC group-containing compound include 6-(O-phosphorylcholine)hydroxyhexanoic acid, 2-(meth)acryloyloxyethyl phosphorylcholine, 3-(meth)acryloyloxypropyl phosphorylcholine, 4-(meth)acryloyloxybutyl phosphorylcholine, 6-(meth)acryloyloxyhexyl phosphorylcholine, 10-(meth)acryloyloxydecyl phosphorylcholine, ω-(meth)acryloyl(poly)oxyethylene phosphorylcholine, 2-(meth)acrylamidoethyl phosphorylcholine, 3-(meth)acrylamidopropyl phosphorylcholine, 4-(meth)acrylamidobutyl phosphorylcholine, 6-(meth)acrylamidohexyl phosphorylcholine, 10-(meth)acrylamidodecyl phosphorylcholine, and ω-(meth)acrylamido(poly)oxyethylene phosphorylcholine.

[0031] A-2. Second Embodiment The drug-polymer conjugate of the second embodiment comprises two or more DDS polymers, including a PC group-containing DDS polymer, and one or more drugs. Examples of the drug-polymer conjugate of the second embodiment include a configuration in which the two or more DDS polymers are covalently bonded to a drug or a carrier (Configuration 1) and a configuration in which the two or more DDS polymers are associated via non-covalent interactions (Configuration 2). In Configuration 1, the DDS polymer and the drug or carrier can be bound directly or via a linker. Drug-polymer conjugates containing two or more DDS polymers can also be suitably used for drug delivery into mitochondria, particularly in vivo, as long as they satisfy the dissociation constant for STARD7. The two or more DDS polymers may include a DDS polymer without PC groups (a PC group-free DDS polymer) in addition to the PC group-containing DDS polymer. In the drug-polymer conjugate of the second embodiment, the DDS polymer can also exert effects such as solubilizing the drug, sustaining its release, improving blood retention, preventing enzymatic degradation, etc. Examples of the drug-polymer conjugate of Configuration 1 include a configuration in which two or more DDS polymers including a PC group-containing DDS polymer are bound to one drug (Configuration 1a), and a configuration in which a PC group-containing DDS polymer and a drug-containing polymer are bound to one carrier or drug (Configuration 1b).

[0032] A-2-1. Structure 1a In the drug-polymer conjugate of structure 1a, preferred examples of the polymer constituting the PC group-containing DDS polymer include the hydrophilic polymers described in section A-1, as well as poly(propylene glycol), poly(ethylene glycol)-poly(propylene glycol), soluble proteins such as albumin, polysaccharides, etc. Of these, poly(ethylene glycol) is preferred.

[0033] The PC group-containing DDS polymer may be linear or branched. The molecular weight of the PC group-containing DDS polymer (if branched, the Mw of each chain) is, for example, 200 or more, preferably 1000 or more, and may be, for example, 1500 or more or 2000 or more, and is typically 50,000 or less, preferably 5000 or less, and may be, for example, 4000 or less or 3000 or less. Only one PC group-containing DDS polymer may be used, or two or more PC group-containing DDS polymers may be used in combination. When two or more PC group-containing DDS polymers are used in combination, the molecular weights of the PC group-containing DDS polymers may be the same or different. Furthermore, when the PC group-containing DDS polymer is branched, the molecular weights of the polymer chains may be the same or different. When the molecular weight of the PC group-containing DDS polymer is within the above range, exposure of the PC groups and coating of the drug can be suitably achieved at the same time.

[0034] In the PC group-containing DDS polymer, the PC group can be bonded to any suitable site on the polymer, preferably to the terminal of the polymer. By bonding a PC group-containing DDS polymer having a terminal with a PC group introduced therein and a terminal with a functional group introduced therein to a drug using the functional group, the surface of the drug can be covered in a layer of the polymer, and the PC group can be exposed on the surface of the polymer layer. The number of PC groups in the PC group-containing DDS polymer can be 1 or more, for example, 1 to 8.

[0035] The same explanation as for the PC group-containing DDS polymer can be applied to the PC group-free DDS polymer, except that it does not have a PC group. The PC group-containing DDS polymer and the PC group-free DDS polymer may be substantially the same polymer except for the presence or absence of PC groups, or may be different polymers (e.g., polymers with different molecular weights, types or ratios of constituent units, etc.).

[0036] The number of PC group-containing DDS polymers bound to one drug is not limited as long as the drug-polymer conjugate exhibits the above-mentioned dissociation constant for STARD7. In one embodiment, the PC group-containing DDS polymers can be bound to the drug so that the number of PC groups contained in the drug-polymer conjugate is, for example, 2 or more, preferably 3 or more, and more preferably 5 or more. The number of PC group-containing DDS polymers bound to one drug can be, for example, 2 or more, or, for example, 7 or more, and can be, for example, 5 x 10 ７ Below, 5 x 10 ４ or less, or 5 x 10 ２ It can be the following:

[0037] The ratio of the number of polymers bound to one drug (PC group-containing DDS polymer: PC group-free DDS polymer) may be, for example, 100:0 to 1:99, preferably 10:90 to 50:50, and more preferably 20:80 to 30:70.

[0038] The drug may be the same as those described above, and preferably is a relatively large drug such as a protein, nucleic acid, polysaccharide, etc. When the drug is a biopolymer such as a protein, nucleic acid, or polysaccharide, its mass may be, for example, 1,000 Da to 150,000 Da, or, for example, 3,000 Da to 150,000 Da.

[0039] The average particle size of the drug-polymer conjugate is, for example, greater than 5.2 nm, and preferably greater than 6 nm. When the average particle size is, for example, 5 nm or less, or, for example, 5.2 nm or less or 6 nm or less, the drug-polymer conjugate tends to be easily excreted in urine via the kidney. The average particle size is not limited as long as it satisfies the dissociation constant for STARD7. The average particle size is preferably 200 nm or less, and may be, for example, 150 nm or less or 100 nm or less. The average particle size can be measured using a dynamic light scattering (DLS) measurement device.

[0040] The drug-polymer conjugate can be produced by any suitable method. For example, the drug-polymer conjugate can be obtained by a method including: reacting a polymer having functional group A introduced at one end and functional group B introduced at the other end with a PC group-containing compound having a PC group and a functional group reactive with functional group A to obtain a PC group-containing DDS polymer; and reacting functional group B of the PC group-containing DDS polymer with a drug having a functional group reactive with functional group B. A PC group-containing DDS polymer and a PC group-free DDS polymer can also be reacted with a drug.

[0041] A-2-2. Structure 1b In the drug-polymer conjugate of structure 1b, the PC group-containing DDS polymer can be the same as that described in section A-2-1. An example of a drug-containing DDS polymer is a PC group-containing DDS polymer in which a drug is substituted for the PC group. Furthermore, instead of or in addition to the PC group-containing DDS polymer or drug-containing DDS polymer, a PC group-drug-containing DDS polymer having a PC group and a drug may be used. The PC group-drug-containing DDS polymer, for example, has a drug introduced into its side chain, a PC group at one end, and a functional group at the other end, and can be bonded to a carrier or a drug via a reaction via the functional group. In the drug-polymer conjugate of structure 1b, a PC group-drug-free DDS polymer having neither a PC group nor a drug may be bonded to a carrier or a drug in addition to the DDS polymer described above, depending on the purpose.

[0042] Preferred examples of carriers or drugs to which the DDS polymer is bound include metal nanoparticles such as gold nanoparticles and metal oxide nanoparticles such as gadolinium oxide nanoparticles. The major axis of the carrier may be, for example, 5 nm to 40 nm, or, for example, 5 nm to 15 nm. These nanoparticles may be spherical or rod-shaped. They may also be dispersed in a buffer solution such as a citrate buffer solution. Metal nanoparticles can also function as contrast agents, and therefore, in this application, the metal nanoparticles may be the drug.

[0043] The number of PC group-containing DDS polymers bound to one carrier or drug is not limited as long as the drug-polymer conjugate exhibits the above-mentioned dissociation constant for STARD7. The number of PC group-containing DDS polymers bound to one carrier or drug may be, for example, 2 or more, or, for example, 7 or more, for example, 5 x 10 ７ Below, 5 x 10 ４ or less, or 5 x 10 ２ It can be the following:

[0044] The ratio (former:latter) of the number of PC group-containing DDS polymers bound to one carrier or drug to the number of PC group-free DDS polymers not containing a drug may be, for example, 100:0 to 1:99, preferably 10:90 to 50:50, and more preferably 20:80 to 30:70.

[0045] The number of drug-containing polymers bound to one carrier or drug can be appropriately set depending on the number, types, etc. of drugs bound to the drug-containing polymer. The number of drugs carried on one carrier or drug via drug-containing polymers can be, for example, 1 to 100, or, for example, 5 to 30.

[0046] The drug contained in the drug-containing polymer may be the same as the drugs described in Section A-1. Preferably, a drug having a relatively small size is used, and its mass may be, for example, 1000 Da or less.

[0047] The average particle size of the drug-polymer conjugate is, for example, greater than 5.2 nm, and preferably greater than 6 nm. When the average particle size is, for example, 5 nm or less, or, for example, 5.2 nm or less or 6 nm or less, the drug-polymer conjugate tends to be easily excreted in urine via the kidney. The average particle size is not limited as long as it satisfies the dissociation constant for STARD7. The average particle size is preferably 200 nm or less, and may be, for example, 150 nm or less or 100 nm or less.

[0048] The drug-polymer conjugate can be produced by any suitable method, for example, by preparing a DDS polymer having a functional group at one end, reacting the functional group with a functional group on a carrier or a drug, or chemically adsorbing the DDS polymer onto the surface of the carrier or drug using the functional group.

[0049] A-2-3. Configuration 2 The drug-polymer conjugate of Configuration 2 is an association comprising two or more molecules of a DDS polymer (preferably a PC group-containing DDS polymer) and a drug associated by non-covalent interaction. Examples of the association include nanoparticles such as micelles and vesicles, or polyion complexes (PICs). The drug may be bound to the DDS polymer, or may be encapsulated in the association (e.g., nanoparticles) without being bound.

[0050] The average particle size of the drug-polymer conjugate is, for example, 400 nm or less, preferably 200 nm or less, more preferably 150 nm or less, even more preferably 100 nm or less, and still more preferably 80 nm or less, and is, for example, 20 nm or more or 30 nm or more. The average particle size can be measured using a dynamic light scattering (DLS) measurement device.

[0051] Examples of the drug-polymer conjugate include the aggregates described in paragraphs

[0074] to

[0080] of WO 2020 / 116640. Specifically, PICs are formed by electrostatic interaction between a charged drug and a PC group and a charged polymer having an opposite charge to that of the drug; polymer micelles formed from PC group-containing block copolymers containing a hydrophilic polymer segment and a hydrophobic polymer segment having a PC group at the end and encapsulating a drug; and drug-loaded microparticles formed from PC group-containing biocompatible polymers such as polyglycolic acid (PGA), polylactic acid (PLA), their copolymers (PLGA), poly-ε-caprolactone, and chitosan. These drug-polymer conjugates can also be used to achieve optimal in vivo drug delivery into mitochondria by satisfying the dissociation constant for STARD7. For example, increasing the proportion of PC group-containing DDS polymers in the DDS polymers constituting the aggregate can improve the affinity of the aggregate for STARD7.

[0052] B. Pharmaceutical Composition The pharmaceutical composition according to this embodiment comprises the drug-polymer conjugate described in Section A. The pharmaceutical composition may further comprise a drug other than the drug in the drug-polymer conjugate, depending on the purpose. Furthermore, any appropriate additive may be included as needed. The additive may be any pharmaceutically acceptable additive, and examples thereof include excipients, diluents, solubilizing agents, suspending agents, isotonicity agents, pH adjusters, buffers, stabilizers, etc.

[0053] The pharmaceutical composition may be prepared into any appropriate dosage form, and is typically a parenteral preparation, which may be an injection such as a subcutaneous injection, an intravenous injection, an intramuscular injection, or an intraperitoneal injection, an infusion solution, an eye drop, a nasal drop, or the like.

[0054] C. Methods of Delivering Drugs to Mitochondria According to another aspect of the present invention, there are provided methods of delivering drugs to mitochondria in vivo, comprising administering to an individual to be treated a drug-polymer conjugate described in Section A or a pharmaceutical composition described in Section B.

[0055] Diseases that can be treated by the drug-polymer conjugate described in Section A or the pharmaceutical composition described in Section B include diseases involving mitochondria. Diseases involving mitochondria include mitochondrial diseases, cancer, diabetes, Alzheimer's disease, Parkinson's disease, neurodegenerative diseases, cardiovascular diseases, metabolic diseases, etc. In one embodiment, the drug-polymer conjugate and pharmaceutical composition can be used to deliver drugs to the mitochondria of cancer cells.

[0056] The individual to be treated is typically a human or non-human mammal, including mice, rats, hamsters, rabbits, goats, dogs, cats, monkeys, chimpanzees, cows, horses, pigs, etc.

[0057] Administration to an individual may be systemic or local. Systemic administration includes injections such as intravenous, subcutaneous, and intramuscular injections, or infusions. Local administration includes administration to the skin, mucosa, nose, eyes, etc.

[0058] The dosage can be set at any appropriate amount depending on the disease or symptoms to be treated, the individual to be treated, the method of administration, and the like.

[0059] The present invention will be described in detail below with reference to examples, but the present invention is not limited to these examples. In the following examples, statistical analysis was performed using a two-tailed t test for comparisons between two groups, and analysis of variance (ANOVA) with the Tukey post-hoc test for comparisons between three or more groups.

[0060] Experimental Example 1: Preparation of drug-polymer conjugates (1) PC-bound drug-polymer conjugates 8-branched polyethylene glycol (hereinafter referred to as "8-PEG10-NH") having the structure shown below and three different molecular weights (Mw = 10k, 20k, or 40k) was used. ２ ”, “8-PEG20-NH ２ ”, “8-PEG40-NH ２") were purchased from Creative PEGWorks. Their PDI was 1.02 to 1.06. ２ , 8-PEG20-NH ２ , and 8-PEG40-NH ２ The molecular weights (Mw) of the PEG chains in the formulas are about 1250, about 2500, and about 5000, respectively, and an amino group is introduced at the end of each PEG chain. Sulfo-cyanine 5 succinimidyl ester (hereinafter referred to as "Sulfo-Cy5-NHS") was purchased from Lumiprobe. ２ , 8-PEG20-NH ２ , or 8-PEG40-NH ２ The polymer was mixed with sulfo-Cy5-NHS (1 equivalent relative to the amine) in N,N-dimethylformamide (DMF) and stirred at room temperature for 24 hours. The resulting sulfo-Cy5-labeled polymer was purified by alternating dialysis against methanol and pure water three times each (MWCO: 3,500). The product was recovered by lyophilization. The conjugation of sulfo-Cy5 to the polymer was confirmed by fluorescence detection and １ H-NMR (acetonitrile-d ３The reaction was confirmed by precipitation at 25°C. The sulfo-Cy5-labeled polymer was dissolved in water (10 mg / ml) and mixed with 6-(O-phosphorylcholine) hydroxyhexanoic acid (Fujifilm Wako Pure Chemical Industries, Ltd.) (10 equivalents relative to the amine) and 4-(4,6-Dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholinium chloride n-hydrate (hereinafter referred to as "DMT-MM", Fujifilm Wako Pure Chemical Industries, Ltd.) (10 equivalents relative to the amine) in water at room temperature for 24 hours. Additional DMT-MM (2 equivalents relative to the amine) was added every 6 hours during the reaction. The product was purified by passing through a disposable PD-10 desalting column (Cytiva) containing Sephadex G-25 and recovered by lyophilization. This gave PC-linked drug-polymer conjugates (PC-8-PEG10, PC-8-PEG20, PC-8-PEG40) to which sulfo-Cy5 was attached as a drug. The conjugation of PC to the polymer was carried out by D ２ in O (0.05% V / V TMS) １ When examined by 1 H-NMR, the binding rate of PC to the polymer was 72% to 99%. １ H-NMR (D ２ O) δ = 3.0-3.2 ppm (9H: (CH ３ ) ３ -N-) and δ=1.2-2.2ppm (6H:-CH ２ -CH ２ -CH ２ -CH ２ -CH ２ -)

[0061] (2) Acetylated drug-polymer conjugate: 8-PEG10-NH labeled with sulfo-Cy5 in the same manner as above. ２ , 8-PEG20-NH ２ , and 8-PEG40-NH ２These polymers were dissolved in ultra-dehydrated acetonitrile, and triethylamine (hereinafter referred to as "TEA") (100 equivalents relative to the amine) was added under an argon atmosphere. After stirring at room temperature for 30 minutes, acetic anhydride was dissolved in ultra-dehydrated acetonitrile and added dropwise to the polymer solution. The mixture was stirred at room temperature under an argon atmosphere for 24 hours. The acetonitrile was removed by evaporation. The product (acetylated polymer (Ac-8-PEG)) was redissolved in pure water and purified in the same manner as for the PC-bound drug-polymer conjugates. This gave acetylated drug-polymer conjugates (Ac-8-PEG10, Ac-8-PEG20, Ac-8-PEG40) as negative controls. The degree of acetylation was evaluated using acetonitrile-d ３ (0.05% V / V TMS) １ H-NMR confirmed 72% to 85% acetylation of the amine. １ H-NMR (C ２ D ３ N) δ=1.80-1.85ppm (3H:-CO-CH ３ )

[0062] (3) TPP-bound drug-polymer conjugate: 8-PEG10-NH labeled with sulfo-Cy5 in the same manner as above. ２ , 8-PEG20-NH ２ , and 8-PEG40-NH ２ These polymers were dissolved in water (10 mg / ml) and mixed with (3-Carboxybutyl)triphenylphosphonium bromide (Fujifilm Wako Pure Chemical Industries, Ltd.) (10 equivalents relative to the amine) and DMT-MM (50 equivalents relative to the amine) in water at room temperature for 24 hours. Additional DMT-MM (2 equivalents relative to the amine) was added every 6 hours during the reaction. The products were purified by passing through a disposable PD-10 desalting column (Cytiva) containing Sephadex G-25 and recovered by lyophilization. This gave TPP-linked drug-polymer conjugates (TPP-8-PEG10, TPP-8-PEG20, and TPP-8-PEG40) as positive controls. TPP conjugation to the polymer was confirmed by acetonitrile-d ３ (0.05% V / V TMS)１ When examined by H-NMR, the binding rate of TPP to the polymer was 86% to 87%. １ H-NMR (acetonitrile-d ３ )δ=6.0-9.0ppm(15H:(C ６ H ５ ) ３ -P-)

[0063] The drug-polymer complexes obtained in (1) to (3) above are shown in FIG. 1.

[0064] <Measurement of Particle Size and Zeta Potential> The hydrodynamic diameter and polydispersity index (PDI) of the drug-polymer conjugates obtained in (1) to (3) above were measured by dynamic light scattering (DLS). Furthermore, the surface zeta potential of the drug-polymer conjugates was measured by electrophoretic light scattering (ELS). Specifically, each drug-polymer conjugate was dissolved in deionized water to prepare a measurement sample (4 mg / ml). Measurements were performed at room temperature using a Zatasizer Nano ZS90 (Malvern Instruments Ltd.) equipped with a diode laser (λ = 532 nm) at a detection angle of 173°. The results are shown in Table 1, along with the number of ligands (PC groups, TPP groups, or Ac groups) and the number of sulfo-Cy5 conjugates in each drug-polymer conjugate. Note that the number of ligands and sulfo-Cy5 conjugates is an estimated number calculated from NMR data. Since the affinity between the polymer and the solvent varies depending on the length of the polymer, the type of the ligand, etc., the estimated number of bonds may deviate slightly from the actual value. However, when the sum of the estimated number of bonds of the ligand and the estimated number of bonds of Sulfo-Cy5 is 7 or more, it can be assumed that all of the terminal amino groups have reacted.

[0065]

[0066] <Dissociation constant for STARD7 (K ＤSurface plasmon resonance (SPR) measurements were performed using a BIACORE T200 (Cytiva). First, anti-GST antibodies were bound to carboxyl groups on the surface of a CM5 sensor chip using the EDC coupling method. Specifically, the procedure is as follows. A freshly prepared mixture of 0.2 M N-ethyl-N'-(3-demethylaminopropyl carbodiimide) and 0.05 M N-hydroxysuccineimide in deionized water was injected to chemically activate the carboxyl groups on the gel surface. Next, 98 μL of a 30 μg / mL anti-GST antibody solution in 10 mM sodium acetate (pH 5.0) was injected and immobilized on the activated surface of the dextran gel for 420 seconds using PBS(-) as the mobile phase. Finally, 128 μL of 1 M ethanolamine / HCl (pH 8.5) was injected to ensure that unreacted carboxyl groups on the dextran gel surface were deactivated. Next, the STARD7 protein was immobilized to the anti-GST antibody via the GST tag. Specifically, after immobilization of the anti-GST antibody on the sensor chip, the mobile phase was changed to 150 mM NaCl and 5 mM CaCl. ２The medium was exchanged for 50 mM HEPES (RB; running buffer) containing 50 mM HEPES (RB). Next, a 2 μg / mL solution of GST-tagged STARD7 (LifeSpan BioSciences, "Human STARD7 Protein (Recombinant GST) (aa61-307)-LS-G22208", Lot# LS-G22208 / 198058) in RB was injected until the response unit reached 200 RU. Antibody binding was performed using RB as the reference channel instead of the STARD7 solution. Next, SPR measurements were performed by injecting a series of drug-polymer conjugate solutions in RB at different concentrations (48, 24, 12, 6, and 3 μM) with a contact time of 120 s and a flow rate of 30 μL / min. The resulting response curves were processed using Biacore evaluation software (Cytiva) to determine the dissociation constants. The results are shown in Table 2. The amino acid sequence of STARD7 used in the above measurements is disclosed on the LifeSpan BioSciences website (https: / / www.lsbio.com / proteins / human-stard7-protein-recombinant-gst-aa61-307-ls-g22208 / 22208) and is shown as SEQ ID NO: 1.

[0067]

[0068] In the following experimental examples, unless otherwise specified, the drug-polymer conjugates are the drug-polymer conjugates prepared in (1) to (3) above (those listed in Table 1).

[0069] Experimental Example 2: In Vitro Mitochondrial Accumulation. BxPC3 cells were seeded in 12-well plates at a concentration of 1,000,000 cells / well in RPMI containing 10% v / v FBS and 1% v / v penicillin-streptomycin and incubated overnight. Drug-polymer conjugates were added to the wells containing BxPC3 cells at a concentration of 25 μM and incubated for 24 hours. After thoroughly and carefully washing the cells with fresh medium to remove excess polymer, the cells were incubated with 0.1 mg / mL Hoechst 33342 for 15 minutes to stain the cell nuclei. After thoroughly and carefully washing the cells with fresh medium, the cells were fixed with 4% PFA (4% paraformaldehyde in PBS) at room temperature for 15 minutes. The samples were observed using a confocal laser scanning microscope (CLSM) (LSM 780; Carl Zeiss). Each fluorescence was observed using different excitation (ex.) and emission (em.) filters as follows: Hoechst 33342: ex. 405 nm / em. 410-485 nm, GFP: ex. 488 nm / em. 489-551 nm, Sulfo-Cy5: ex. 633 nm / em. 638-746 nm. Mitochondria were isolated from cells using a mitochondria isolation kit (Abcam) according to the manufacturer's protocol. The content of the drug-polymer conjugate in mitochondria was measured using SPARK （Ｒ） The fluorescence intensity of sulfo-Cy5 in mitochondria was evaluated using a multimode microplate reader (TECAN). The results are shown in Figure 2. In the figure, (a) is a microscopic image, and (b) is a graph showing the fluorescence intensity in mitochondria.

[0070] As shown in FIG. 2, the PC-conjugated drug-polymer conjugates exhibited better mitochondrial accumulation than the Ac-conjugated drug-polymer conjugates and the TPP-conjugated drug-polymer conjugates at all molecular weights.

[0071] Experimental Example 3: Delivery of gold nanoparticles to mitochondria Ligand-conjugated gold nanoparticles were prepared according to the scheme shown in Figure 3. 2-Methacryloyloxyethyl phosphorylcholine (MPC) was conjugated to thiol- and primary amine-terminated PEG via Michael addition to give PC-PEG-NH２ TPP-COOH was conjugated to an amine-terminated PEG, one free and the other tert-butoxycarbonyl (Boc) protected, and after conjugation, the Boc was deprotected to give TPP-PEG-NH ２ The ligand-introduced primary amine-terminated PEG or methoxy and primary amine-terminated PEG was conjugated to lipoic acid by 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide coupling in DMF. The dithiolane moiety of the product was reduced to dihydrolipoic acid to give the thiol-containing polymer (MeO-PEG-(SH)). ２ , PC-PEG-(SH) ２ , TPP-PEG-(SH) ２ These were mixed in the ratios shown in Table 3 and chelated to gold nanoparticles under aqueous conditions. The PEG used was linear, and the molecular weight (Mw) of each was 2,000.

[0072] The size and surface potential of the gold nanoparticles chelated to the polymer were evaluated using DLS and ELS, respectively, and the morphology of the gold nanoparticles was observed by TEM. １２ BxPC3 cells were incubated with gold nanoparticles at a concentration of 0.015 particles / mL for 24 hours, and the intracellular microdistribution of gold nanoparticles was observed using TEM. TEM samples were prepared according to a previous report (Hirabayashi, Y. et al. Science 358, 623-630 (2017)). The results are shown in Table 3 and Figure 4. In Figure 4, (a) and (b) are TEM images of cells incubated with MeO-PEG-S-AuNP and enlarged images of their mitochondrial portions, respectively; (c) and (d) are TEM images of cells incubated with 25% PC-PEG-S-AuNP and enlarged images of their mitochondrial portions, respectively; and (e) is a tomographic image showing the mitochondria and gold nanoparticles in (d) (scale bars for (a) and (c): 500 nm, scale bars for (b) and (d): 200 nm).

[0073]

[0074] As shown in Figure 4, gold nanoparticles with PC groups were confirmed to be translocated into mitochondria and endosomes, but not into the cytoplasm or nucleus. On the other hand, gold nanoparticles with TPP groups were confirmed to be translocated into the cytoplasm, while gold nanoparticles without ligands were distributed mainly within endosomes. This result supports the fact that the selectivity of PC groups for targeting mitochondria is higher than that of TPP groups.

[0075] [Experimental Example 4: STARD7 ＫＤ Accumulation in mitochondria in cells] Lipofectamine was used as follows. （Ｒ）STARD7 was inactivated (knocked out) in BxPC3 cells by transfection with . STARD7 is a protein that transports phosphatidylcholine from peripheral organelles, such as the Golgi apparatus, smooth endoplasmic reticulum, and cytoplasm, to mitochondria. BxPC3 cells were incubated with 5% mitochondria-GFP (BacMam2.0) (Mito-GFP) in RPMI containing 10% v / v FBS and 1% v / v penicillin-streptomycin, and mature cells were washed three times with fresh medium. STARD7-knockout siRNA or scrambled RNA as a negative control was transfected into cells using RNAiMAX. The cells were incubated for 24 hours in medium containing RNAiMAX. After washing the cells three times with fresh medium, 25 μM PC-conjugated drug-polymer conjugate or TPP-conjugated drug-polymer conjugate dissolved in the medium was added, and the cells were incubated for 24 hours. The difference in colocalization of mitochondria and drug-polymer conjugates between STARD7-inactivated and native cells was investigated using colocalization images acquired with a CLSM (LSM 780) and quantitative data from mitochondrial isolation. Specifically, the effect of STARD7 knockdown on mitochondrial accumulation of drug-polymer conjugates was confirmed by imaging Alexa 488-labeled mitochondria in STARD7-knockdown BxPC3 cells incubated with drug-polymer conjugates using an LSM 780. The results are shown in Figure 5. Furthermore, mitochondrial accumulation of drug-polymer conjugates was quantified using a mitochondrial isolation assay. The results are shown in Figure 6.

[0076] As shown in Figures 5 and 6, the mitochondrial accumulation of PC-linked drug-polymer conjugates was effectively suppressed by STARD7 knockdown, whereas the mitochondrial accumulation of TPP-linked drug-polymer conjugates was not affected. These results indicate that PC-linked drug-polymer conjugates are transported via a STARD7-related pathway, whereas TPP-linked drug-polymer conjugates are not transported via this pathway. This suggests that STARD7 transports PC-linked drug-polymer conjugates into mitochondria in cancer cells.

[0077] When the difference in cellular uptake of the drug-polymer complex before and after treatment using Lipofectamine transfection was compared, there was no difference in cellular uptake between siRNA-treated BxPC3 cells and scrambled RNA-treated BxPC3 cells.

[0078] Experimental Example 5: In vivo biodistribution and accumulation in cancer cells of drug-polymer conjugates Five-week-old female BALB / c nude mice were purchased from Charles River Laboratories Japan. All animal experiments were conducted in accordance with the guidelines for the care and use of laboratory animals established by the University of Tokyo.

[0079] BALB / c nude mice were used as tumor models. BxPC3 cells (5 × 10 ) suspended in 50 μL of RPMI 1640 were cultured. ６ cells ml ‐１ ) was subcutaneously inoculated into the right dorsal region of female BALB / c nude mice (5 weeks old) to prepare tumor models. ３ Once the total volume reached 1000 mg / kg, the samples were subjected to biodistribution and mitochondrial accumulation evaluation.

[0080] (Biodistribution) A series of drug-polymer conjugates (0.2 mM, 100 μL) were administered via the tail vein to 8-week-old BALB / c nude mice bearing BxPC3 tumors. After 24 hours of circulation, the mice were sacrificed, and the tumor, liver, kidney, spleen, heart, and lungs were excised. Fluorescence on the organ surface was evaluated using an IVIS imaging system. The results are shown in Figure 7. The organs and tumors were then weighed and homogenized using a Dounce tissue homogenizer. The red fluorescence intensity (sulfo-Cy5) of each homogenized organ and tumor was measured using a plate reader. The results are shown in Figure 8.

[0081] Figures 7 and 8 show that PC-8-PEG20 selectively accumulates in tumors 24 hours after administration. In contrast, drug-polymer conjugates with a PEG molecular weight of 10K (PC-8-PEG10, TPP-8-PEG10, and Ac-8-PEG10) all showed low accumulation in tumors and other organs. Because the drug-polymer conjugates with a PEG molecular weight of 10K were 5 nm or less in size, they may have been filtered by the kidney and excreted from the body. Furthermore, drug-polymer conjugates with a PEG molecular weight of 40K (PC-8-PEG40, TPP-8-PEG40, and Ac-8-PEG40) and Ac-8-PEG20 all accumulated nonspecifically in tumors and other organs. Furthermore, TPP ligands tended to accumulate more in the liver and kidneys. The above results are considered as follows. While the drug-polymer conjugate with a molecular weight of 40K had low ligand accessibility due to the large molecular weight of PEG, resulting in low ligand specificity, PC-8-PEG20 has good blood retention and ligand accessibility, which may be advantageous for ligand-dependent cellular uptake (e.g., phospholipid transfer protein (PLTP)-mediated cellular uptake) and subsequent mitochondrial transport via STARD7, making it suitable for targeting mitochondria (e.g., in cancer cells) in vivo.

[0082] (Mitochondrial Accumulation) A series of drug-polymer conjugates (0.2 mM, 100 μL) were administered via the tail vein to 8-week-old BALB / c nude mice bearing BxPC3 tumors. After 24 hours of circulation, Hoechst 33342 (16 mM, 100 μL) was administered via the tail vein. 30 minutes later, the mice were sacrificed and the tumors were excised. Portions of the harvested tumors were immediately frozen in an acetone / dry ice mixture and sectioned at 10 μm thickness using a cryostat. The sections were fixed, and mitochondria were stained with rhodamine. The remaining tumor cross-sections and fixed sections were observed using an LSM 780 microscope. Images of the tumors and sections are shown in Figures 9 and 10, respectively. In addition, mitochondria were isolated from portions of the harvested tumors using a tissue mitochondrial isolation kit, and the accumulation of the drug-polymer conjugates in tumor mitochondria was quantitatively evaluated by measuring the fluorescence intensity of the isolated mitochondria. The results are shown in Figure 11.

[0083] As shown in Figure 9, all conjugates with a PEG molecular weight of 40K were confirmed to accumulate in tumors. Furthermore, when the PEG molecular weight was 20K or 10K, the PC-linked drug-polymer conjugates significantly accumulated throughout the tumor. On the other hand, the TPP-linked drug-polymer conjugates showed the lowest accumulation. Furthermore, as shown in Figure 10, only the PC-linked drug-polymer conjugates were confirmed to colocalize with mitochondria in vivo, and quantitative assessment of accumulation also confirmed that the PC-linked drug-polymer conjugates efficiently accumulated in mitochondria (Figure 11).

[0084] [Experimental Example 6: Protein delivery to mitochondria] (Preparation of ligand-bound DNASE1-polymer complex) ３ ) and amines (—NH ２ ) and an 8-branched polyethylene glycol "8-PEG20-(NH ２ ) 7-(N ３ ) was purchased from Creative PEGWorks. ２ ) 7-(N ３The molecular weight (Mw) of each PEG chain in 8-PEG20-(NH) is approximately 2500, and an amino group is introduced at each end of seven PEG chains, and an azide group is introduced at the end of the remaining PEG chain. ２ ) 7-(N ３ The following three ligands were mixed with DMT-MM (10 equivalents relative to the amine) and TEA (100 equivalents relative to the amine) in PBS(-) and the mixture was stirred at room temperature for 24 hours. Additional DMT-MM (2 equivalents relative to the amine) was added every 6 hours during the reaction. 6-(O-phosphorylcholine) hydroxyhexanoic acid (Fujifilm Wako Pure Chemical Industries) (10 equivalents relative to the amine), (3-Carboxybutyl)triphenylphosphonium Bromide (Fujifilm Wako Pure Chemical Industries) (10 equivalents relative to the amine), or Acetic Acid (Tokyo Chemical Industry Co., Ltd.) (10 equivalents relative to the amine) were reacted as each ligand to prepare three ligand-bound polymers (PC-8-PEG20-(N ３ ), TPP-8-PEG20-(N ３ ), and Ac-8-PEG20-(N ３ DBCO-PEG4-NHS Ester (CAS RN: 1427004-19-0) was purchased from Tokyo Chemical Industry Co., Ltd. The three ligand-binding polymers synthesized above were dissolved in DMF at 20 μg / mL, and the resulting DBCO-PEG4-NHS Ester was mixed in 10 mM phosphate buffer at a ratio of 1:1.1 (ligand:DBCO (molar ratio)), and the mixture was frozen at -30°C and thawed at 4°C three times. ３PC-8-PEG20-NHS, TPP-8-PEG20-NHS, and Ac-8-PEG20-NHS were synthesized by click reaction with PEG-8-PEG20-NHS and DBCO. The three polymers were purified by ultracentrifugal filtration (MWCO: 10,000, 3,500 g, 8 min). The purified polymers were reacted with DNASE1 in a 2:1 molar ratio in phosphate buffer (pH 8.0) at 4°C overnight. This resulted in ligand-bound DNASE1-polymer conjugates in which a ligand (PC, TPP, or Ac) was attached to the termini of approximately seven PEG chains and DNASE1 was attached to the terminus of one PEG chain. Three ligand-bound DNASE1-polymer conjugates with different ligands were purified by ultracentrifugal filtration (MWCO: 35,000, 3,500 g, 8 min). The concentration of DNASE1 loaded in the purified complex was quantified using the BCA protein assay (ThermoFisher).

[0085] (In Vitro Mitochondrial Accumulation of Ligand-Bound DNASE1-Polymer Complexes) BxPC3 cells were seeded in 12-well plates at a concentration of 1,000,000 cells / well in RPMI containing 10% v / v FBS and 1% v / v penicillin-streptomycin and incubated overnight. Ligand-bound DNASE1-polymer complexes were added to BxPC3 cells at a DNASE1 concentration of 100 μg / mL and incubated for 3 hours. Cells were thoroughly and carefully washed with fresh medium to remove excess polymer, followed by post-incubation in medium for 21 hours. Next, mitochondria were isolated from the cells using a mitochondrial isolation kit (Abcam) according to the manufacturer's protocol. The amount of DNA remaining in the isolated mitochondria was quantified using PCR. The results are shown in Figure 12.

[0086] As shown in Figure 12, the amount of DNA in mitochondria decreased only in the sample incubated with the PC-bound DNASE1-polymer complex, suggesting that the PC-bound DNASE1-polymer complex was delivered to the mitochondria.

[0087] Experimental Example 7: Nucleic acid delivery to mitochondria (Preparation of ligand-bound ASO-polymer complex) A DBCO-modified ASO targeting the mitochondrial mRNA COX II (COX2) was purchased from Hokkaido System Science Co., Ltd. COX2-targeting ASO 5'-CUUGCGCUGCAUGUGCCAU-spacer-DBCO-3' (SEQ ID NO: 2) A terminal azido (-N ３ ) and amines (—NH ２ ) and an 8-branched polyethylene glycol "8-PEG20-(NH ２ ) 7-(N ３ ) was purchased from Creative PEGWorks. ２ ) 7-(N ３ The molecular weight (Mw) of each PEG chain in 8-PEG20-(NH) is approximately 2500, and an amino group is introduced at each end of seven PEG chains, and an azide group is introduced at the end of the remaining PEG chain. ２ ) 7-(N ３ ) was dissolved in PBS at a concentration of 10 mg / ml. PC-COOH (10 equivalents of amine) or TPP-COOH (10 equivalents of amine) and DMT-MM (10 equivalents of amine) were added to the above solution and reacted at room temperature for 24 hours. Additional DMT-MM (2 equivalents relative to the amine) was added every 6 hours during the reaction. The product was purified using a disposable PD-10 desalting column containing Sephadex G-25 (Cytiva). Two ligand-conjugated polymers (PC-8-PEG20-(N)) were obtained by lyophilization. ３ ), TPP-8-PEG20-(N ３ )) was recovered. ２ ) 7-(N ３ ) was dissolved in ultra-dehydrated acetonitrile. To the above solution, TEA (100 equivalents of amine) was added under an argon atmosphere. After mixing at room temperature for 30 minutes, acetic anhydride was added dropwise to the reaction system. The mixture was stirred at room temperature for 24 hours under an argon atmosphere. The acetonitrile was removed by evaporation, and the resulting acetylated polymer (Ac-8-PEG20-(N ３)) was dissolved in deionized water. Ac-8-PEG20-(N ３ ) was purified and recovered. The polymer was linked to ASO using a click chemistry reaction between DBCO and an azide group. Specifically, (PC, TPP, Ac)-8-PEG20-(N ３ ) was dissolved in deionized water and N ３ One equivalent of ASO was mixed with 1:8000 of PEG-20-COX2, and the mixture was subjected to three cycles of freeze-thawing (freezing at -30°C, thawing at RT). In this way, three types of ligand-bound ASO-polymer conjugates (Ac-8-PEG20-COX2, TPP-8-PEG20-COX2, and PC-8-PEG20-COX2) were obtained.

[0088] Quantification of Target Mitochondrial mRNA Levels by PCR: 1 mL of serum-free RPMI medium was added to a 6-well plate at 37°C and 5% CO. ２ In an air atmosphere, the above three types of ligand-bound ASO-polymer complexes were incubated with BxPC3 cells (1 × 10 ６The cells were incubated with 1000kJ / well of 1000kcal of 1000kJ / ml PBS for 3 hours. The cells were washed three times with PBS and post-incubated in complete medium for 21 hours. Total RNA was purified from the cells using the RNeasy Mini Kit (Qiagen) according to the manufacturer's protocol. Reverse transcription was performed from the RNA suspension extracted from each sample using the High Capacity RNA-to-cDNA Kit (Thermo Fisher Scientific) according to the manufacturer's protocol. Quantitative PCR analysis was performed from the transcribed cDNA using FastStart Universal SYBR Green Master (ROX) (Thermo Fisher Scientific). The primers used for RT-PCR are shown below. Mitochondrial mRNA encoding COX2 (target mRNA) forward: ATCATCCTAGTCCTCATCG (SEQ ID NO: 3) reverse: GATTTGATGGTAAGGGAGG (SEQ ID NO: 4) Mitochondrial mRNA encoding NADH dehydrogenase subunit 1 (ND1) (control mRNA) forward: TTCCTAATGCTTACCGAACG (SEQ ID NO: 5) reverse: GGTGAAGAGTTTTATGGCGT (SEQ ID NO: 6) β-actin mRNA encoded by nuclear DNA (internal control RNA) forward: GGGACGACATGGAGAAATC (SEQ ID NO: 7) reverse: GAAGGTCTCAAACATGATCTGG (SEQ ID NO: 8) The results are shown in Figure 13. In the figure, the control is a cell sample that was not treated with the ligand-conjugated ASO-polymer conjugate.

[0089] Figure 13(a) shows the ratio of target mRNA expression to control mRNA expression (transcription), expressed relative to the control ratio, which is set to 1. Figure 13(b) shows the expression level of β-actin mRNA, expressed relative to the control ratio, which is set to 1. As shown in Figure 13(a), the expression level of COX2 relative to ND1 in cells treated with PC-8-PEG20-COX2 was significantly reduced. Considering that ND1 is a mitochondrial mRNA but is not the target of the ASO, and that the expression level of β-actin, a cellular mRNA, did not change, PC-8-PEG20-COX2 is thought to have effectively delivered the ASO into mitochondria without affecting other cellular conditions.

[0090] Experimental Example 8: Delivery of small molecule drugs to mitochondria (Preparation of ligand-bound Sim-polymer conjugate) 8-PEG20-NH ２ (All terminals are amine (-NH ２A ligand-bound Sim-polymer conjugate containing Sim as the drug was synthesized using an 8-arm PEG (Creative PEGWorks) with a molecular weight (Mw) of 20kJ, as shown in Figure 14. Simvastatin is an HMG-CoA reductase inhibitor used to lower cholesterol. Simvastatin also exhibits anticancer activity. Specifically, simvastatin reduces mitochondrial membrane potential, releasing Smac / DIABLO and cytochrome C into the cytoplasm and inducing apoptosis in cancer cells. Such simvastatin-induced mitochondrial damage can be augmented by increasing simvastatin delivery to mitochondria. First, the secondary alcohol of simvastatin was reacted with succinyl chloride to create an ester bond. Simvastatin (500 mg, 1 equivalent) dissolved in benzene was lyophilized and dissolved in 10 mL of ultra-dehydrated dichloromethane (DCM). Succinyl chloride (393 μL, 3 equivalents) and TEA (75 μL, 1.5 equivalents) were added to the simvastatin and stirred at room temperature for 3 hours. Then, deionized water was added and stirred for 15 minutes to inactivate the unreacted carboxylic acid chloride. The synthesized simvastatin-COOH was purified by phase separation extraction with DCM and deionized water. The DCM phase was collected and washed five times with additional water. After purification, the DCM was evaporated at 30°C, and the sample was dissolved in benzene and lyophilized to remove as much residual water as possible. This resulted in a deep red viscous liquid. The reaction proceeded as follows: １ H-NMR (methanol-d ４ The simvastatin-COOH was converted to 8-PEG20-NH by EDC / NHS coupling in DMF. ２ In ultra-anhydrous DMF, 8-PEG20-NH ２(500 mg, 1 equiv.) was mixed with simvastatin-COOH (39 mg, 3 equiv.). The mixture was stirred at 4°C for 6 hours. EDC / HCl (7.2 mg, 1.5 equiv.) and TEA (5.2 μL, 1.5 equiv.) were added as catalysts every 2 hours. The polymer was purified by alternating dialysis against pure water and methanol three times each (MWCO of dialysis bag: 3,500; Spectrum Laboratories). The conjugation of simvastatin was １ H-NMR (methanol-d ４ In this way, simvastatin-8-PEG20-(NH ２ ) ７ The above simvastatin-8-PEG20-(NH ２ ) ７ The amino groups of the above-mentioned polymers were capped with each ligand (i.e., PC, TPP, or Ac) in the same manner as above to obtain ligand-bound Sim-polymer conjugates (PC-8-PEG20-Sim, TPP-8-PEG20-Sim, and Ac-8-PEG20-Sim). The ratios of ligand and simvastatin introduced into each ligand-bound Sim-polymer conjugate were as follows: １ H-NMR (methanol-d ４ The surface zeta potential of each ligand-bound Sim-polymer complex was measured by electrophoretic light scattering (ELS) at room temperature using a Zatasizer Nano ZS90. The results shown in the table below suggest that seven ligands and one Sim were bound to the 8-arm PEG.

[0091]

[0092] (Evaluation of Cytotoxicity of Ligand-Conjugated Sim-Polymer Conjugates: MTT Assay) BxPC3 cells suspended in medium (RPMI 1640 containing 10% v / v FBS and 1% v / v penicillin-streptomycin) were incubated overnight in a 96-well cell culture plate (10,000 cells / well) (IWAKI). The medium was replaced with medium containing various Sim concentrations (0-200 μM) of ligand-conjugated Sim-polymer conjugates or free simvastatin, and the cells were incubated for 6 hours. After treatment, the cells were washed with medium and further post-incubated for 48 hours. Cytotoxicity was then measured using an MTT assay kit (Dojindo Laboratories) with slight modifications to the manufacturer's protocol. Briefly, the cells were washed with medium, replaced with 100 μL of PBS(-), and incubated with 20 μL of MTT for 3 hours. The supernatant was carefully removed, and 100 μL of DMSO was added and mixed for 15 minutes. The absorbance at 530 nm was measured using SPARK （Ｒ） Measurement was performed using a multimode microplate reader (TECAN), and the results are shown in Figure 15.

[0093] (Evaluation of Cytotoxicity of Ligand-Conjugated Sim-Polymer Conjugates: CCK-8 Assay) BxPC3 cells were dispensed into a 96-well cell culture plate (IWAKI) at a concentration of 5,000 cells / well. The cells were treated with the ligand-conjugated Sim-polymer conjugates or free simvastatin in the same manner as in the MTT assay described above. The cell viability of the treated samples was evaluated using a CCK-8 assay kit (Dojindo Laboratories) according to the manufacturer's protocol. The results are shown in Figure 16.

[0094] As shown in Figures 15 and 16, TPP-8-PEG20-Sim and PC-8-PEG20-Sim reduced BxPC3 cell viability more effectively than free simvastatin at simvastatin concentrations above 37.5 μM. On the other hand, Ac-8-PEG20-Sim showed no reduction in cell viability compared to free simvastatin. This result indicates that PC and TPP ligands enhanced the cytotoxicity of simvastatin.

[0095] (Evaluation of mitochondrial toxicity of ligand-bound Sim-polymer conjugate) BxPC3 cells (5,000 cells / well) were treated with the ligand-bound Sim-polymer conjugate in the same manner as in the MTT assay described above. （Ｒ） The toxicity of simvastatin to mitochondria in BxPC3 cells was evaluated by measuring reactive oxygen species (ROS) generated from mitochondria using a Red kit (Thermo Fisher Scientific) and measuring changes in mitochondrial membrane potential using a JC-1 mitochondrial membrane potential assay kit (Thermo Fisher Scientific). Measurements of mitochondrial ROS and membrane potential were performed according to the manufacturer's protocols. The results of the ROS measurement and JC-1 assay are shown in Figure 17 and Figures 18A and 18B, respectively.

[0096] Mitochondrial activity was assessed by measuring mitochondrial reactive oxygen species (ROS). As shown in Figure 17, PC-8-PEG20-Sim and TPP-8-PEG20-Sim exhibited increased mitochondrial toxicity at simvastatin concentrations above 75 μM compared with free Sim or Ac-8-PEG20-Sim. This suggests that the PC and TPP ligands contribute to mitochondrial delivery of the Sim-polymer conjugates.

[0097] Figure 18A shows the normalized green fluorescence intensity. Higher green fluorescence intensity indicates a weakly negatively charged mitochondrial membrane. Figure 18B shows the normalized red fluorescence intensity. Higher red fluorescence intensity indicates a strongly negatively charged mitochondrial membrane. As shown in Figure 18B, the decrease in red fluorescence intensity was greatest for PC-8-PEG20-Sim and greater than that for TPP-8-PEG20-Sim. On the other hand, when cells were treated with PC- or TPP-linked polymers (PC-8-PEG20, TPP-8-PEG20) without simvastatin, only TPP-8-PEG20 significantly altered the mitochondrial surface charge (data not shown). This result suggests that the PC-linked polymer delivered the drug payload, simvastatin, to mitochondria without affecting the mitochondrial membrane charge, and that simvastatin caused a change in the mitochondrial membrane charge. On the other hand, the TPP-conjugated polymer itself affected the mitochondrial membrane charge, and further altered it by delivering simvastatin. Furthermore, since the amounts of simvastatin in the PC and TPP-conjugated polymers were comparable in this experiment, the results suggest that the PC ligand targeted mitochondria more effectively than the TPP ligand in the simvastatin delivery system. Meanwhile, a decrease in green fluorescence intensity indicates a more negatively charged mitochondrial membrane potential or cell death, resulting in a decrease in the number of cells capturing JC-1. Figure 18A suggests that at high simvastatin concentrations, the cell count was significantly reduced due to the cytotoxicity of PC-8-PEG20-Sim. Meanwhile, TPP-8-PEG20-Sim did not decrease green fluorescence intensity as much as PC-8-PEG20-Sim, and even increased it at low simvastatin concentrations. This suggests that TPP-8-PEG20-Sim may have reduced mitochondrial membrane potential at a concentration less than the effective concentration of simvastatin, and that the TPP ligand itself may have adverse effects on cells.

[0098] Experimental Example 9: Evaluation of Blood Retention Eight-week-old BALB / c mice were anesthetized with isoflurane inhalation. The right earlobes of the mice were fixed on an intravital confocal laser scanning microscope (IVCLSM). The series of ligand-conjugated polymers prepared in Example 1 (10 kDa, 20 kDa, or 40 kDa 8-arm PEG conjugated with one sulfo-Cy5 and seven ligands) were intravenously injected into the mice. The fluorescence intensity of sulfo-Cy5 conjugated to the series of ligand-conjugated polymers was evaluated by sequential imaging of the earlobe using IVCLSM. The results are shown in Figure 19. Figure 19 is a graph showing the normalized and quantified intensity of fluorescent labeling within blood vessels.

[0099] As shown in Figure 19, the 10 kDa ligand-conjugated polymers, especially TPP-8-PEG10, were rapidly cleared from the circulation. The 20 kDa and 40 kDa ligand-conjugated polymers exhibited longer blood circulation than the 10 kDa ligand-conjugated polymer. In particular, PC-8-PEG20 exhibited longer blood circulation than TPP-8-PEG20 and Ac-8-PEG20.

[0100] Experimental Example 10: Evaluation of Extravasation Eight-week-old BALB / c nude mice bearing BxPC3 tumors were anesthetized with isoflurane inhalation. Hoechst 33342 was intravenously injected 30 minutes before anesthesia. A skin flap was created around the subcutaneous tumor without damaging the vasa vasorum. The skin flap was then stretched back, allowing the tumor to be attached and fixed to the IVCLSM. 100 μL of a series of ligand-conjugated polymers (PC-8-PEG20, TPP-8-PEG20, and Ac-8-PEG20) at a concentration of 0.2 mM was dissolved in an aqueous solution of 10k FITC-labeled dextran (TCI, Tokyo, Japan) adjusted to a fluorescence intensity of 1,000 a.u. and injected intravenously into the mice. Extravasation around the tumor was visualized by sequential imaging using the IVCLSM. The captured images are shown in Figure 20. The fluorescence intensity of each marker was quantified in the region of interest (ROI) within the rectangular frame in Figure 20. The ROI was located in the tumor nest site. The results are shown in Figure 21. In Figure 21, Ac dextran 10K, TPP dextran 10K, and PC dextran 10K represent the dextran-derived FITC fluorescence intensity in mice administered Ac-8-PEG20, TPP-8-PEG20, and PC-8-PEG20, respectively.

[0101] 20 and 21 show that PC-8-PEG20 exhibits enhanced extravasation compared to other 20 kDa polymers (i.e., TPP-8-PEG20 and Ac-8-PEG20). Enhanced polymer extravasation may increase polymer accumulation in tumors.

[0102] Experimental Example 11: Evaluation of contact time between mitochondria and lysosomes Endosome escape is an effective means of intracellular drug delivery. On the other hand, the above-mentioned ligand-bound drug-polymer conjugate using 8-branched PEG does not have a structure that promotes endosomal escape. Therefore, to confirm a mitochondrial targeting pathway that does not involve endosomal escape, contact between lysosomes and mitochondria was evaluated below. BxPC3 cells in RPMI containing 10% V / V FBS and 1% V / V penicillin-streptomycin were dispensed into an 8-well cover glass chamber at a density of 15,000 cells / well and left for 8 hours. The medium was then diluted with 5% by volume of "CellLight" ＴＭ Lysosomal GFP, BacMam 2.0" and "CellLight ＴＭThe medium was replaced with one containing mitochondrial RFP, BacMam 2.0, and incubated for 36 hours. After extensive washing with fresh medium, the cells were treated with 25 μM of a series of ligand-conjugated polymers for 8 hours. The medium containing the ligand-conjugated polymers was replaced with fresh medium. Subsequently, the cells were incubated with 0.1 mg / mL Hoechst 33342 for 15 minutes to stain the nuclei with blue fluorescence. The medium was replaced with fresh medium. Cells and organelles were observed using a confocal laser scanning microscope (CLSM) (LSM 780; Carl Zeiss) equipped with a ConfoCor 3 module and a 63X oil immersion objective. Movies of lysosome and mitochondrial movement were generated by continuous imaging every 4 seconds using a confocal laser scanning microscope (CLSM) (LSM 880; Carl Zeiss) equipped with a ConfoCor 3 module and a 63X oil immersion objective. Each fluorescence was imaged using various excitation (ex.) and emission (em.) filters: Hoechst 33342: ex. 405 nm / em. 410-485 nm, GFP: ex. 488 nm / em. 489-551 nm, RFP: ex. 555 nm / em. 570-620 nm, and Sulfo-Cy5: ex. 633 nm / em. 638-746 nm. Colocalization rates were obtained using the Zen software on the LSM 880. For cells treated with PC-8-PEG20, images and colocalization rates at multiple time points after the start of observation are shown in Figure 22. The relationship between the contact time between lysosomes and mitochondria and the type of ligand is also shown in Figure 23. In Figure 23, the control represents a sample to which no ligand-conjugated polymer was added.

[0103] As shown in Figure 22, the transfer of PC-8-PEG20 from lysosomes to mitochondria was observed at the contact site between lysosomes and mitochondria. Furthermore, over time, the colocalization of PC-8-PEG20 with lysosomes decreased and the colocalization with mitochondria increased, indicating that PC-8-PEG20 was transported from lysosomes to mitochondria. This result suggests that PC-8-PEG20 was directly transferred from lysosomes to mitochondria. Furthermore, as shown in Figure 23, the contact time between lysosomes and mitochondria was longest in cells treated with PC-8-PEG20, followed by TPP-8-PEG20. This suggests that the ligand-conjugated polymer facilitated the contact between lysosomes and mitochondria.

[0104] The present invention can be suitably used, for example, in the field of DDS.

Claims

1. A drug delivery polymer comprising a drug and a drug delivery polymer having a phosphocholine group, and having a dissociation constant (K Ｄ ) is 1.0 x 10 －６ M or less.

2. The drug-polymer conjugate of claim 1 for delivering said drug to mitochondria.

3. The drug-polymer conjugate of claim 1, having an average particle size of greater than 5.2 nm.

4. The drug-polymer conjugate of claim 1, wherein the drug delivery polymer is a branched polymer having two or more polymer chains, and the phosphocholine group is bound to at least one of the two or more polymer chains.

5. The drug-polymer conjugate of claim 4, wherein the drug delivery polymer is a polymer that exhibits a zeta potential of 0 or less when measured as a polymer having sulfo-cy5 introduced at one end of the two or more polymer chains and an uncharged group at the other end.

6. The drug-polymer conjugate of claim 4, wherein the molecular weight (Mw) of the drug delivery polymer is 5,000 to 100,000.

7. The drug-polymer conjugate of claim 4, wherein the molecular weight (Mw) of each of the two or more polymer chains of the drug delivery polymer is 200 to 50,000.

8. The drug-polymer conjugate of claim 4, wherein the drug is attached to at least one of the two or more polymer chains.

9. The drug-polymer conjugate of claim 1, wherein the drug delivery polymer comprises a hydrophilic polymer composed of poly(ethylene glycol), poly(saccharide), poly(vinylpyrrolidone), poly(vinyl alcohol), poly(acrylamide), poly(acrylic acid), poly(methacrylamide), poly(methacrylic acid), poly(methacrylic acid ester), poly(acrylic acid ester), poly(amino acid), poly(malic acid), or derivatives thereof.

10. The drug-polymer conjugate of claim 1, wherein the drug comprises at least one selected from a physiologically active substance, a fluorescent agent, and an imaging agent.

11. A pharmaceutical composition comprising the drug-polymer conjugate of any one of claims 1 to 10.

12. A method for producing a phosphocholine-binding protein comprising: two or more polymer chains; a phosphocholine group attached to at least one of the two or more polymer chains; and a dissociation constant (K Ｄ ) is 1.0 x 10 －６ A drug delivery polymer having a molecular weight of M or less.

13. The drug delivery polymer described in claim 12, which exhibits a zeta potential of 0 or less when measured as a polymer having sulfo-cy5 introduced at one end of the two or more polymer chains and an uncharged group at the other end.

14. The drug delivery polymer of claim 12, having a molecular weight (Mw) of 5,000 to 100,000.

15. The drug delivery polymer of claim 12, wherein the molecular weight (Mw) of each of the two or more polymer chains is 200 to 50,000.

16. The drug delivery polymer of claim 12, comprising a hydrophilic polymer composed of poly(ethylene glycol), poly(saccharide), poly(vinylpyrrolidone), poly(vinyl alcohol), poly(acrylamide), poly(acrylic acid), poly(methacrylamide), poly(methacrylic acid), poly(methacrylic acid ester), poly(acrylic acid ester), poly(amino acid), poly(malic acid), or derivatives thereof.

Images