Protein useful for production of human milk oligosaccharide dslnt

Abstract

The present invention addresses the problem of providing a technique for producing an oligosaccharide containing a Neu5Ac alpha 2-6 GlcNAc structure such as a DSLNT. The problem is solved by a protein containing a catalytic domain of ST6GALNAC6 protein.

Description

Proteins useful for producing human milk oligosaccharide DSLNT

[0001] The present invention relates to a technique for producing oligosaccharides containing a Neu5Acα2-6GlcNAc structure.

[0002] Human milk oligosaccharides (HMOs) are solid components found in breast milk and are the third most important component after lactose and lipids. Human colostrum contains approximately 20 g / L of HMOs, while mature milk contains 12-13 g / L. More than 160 HMOs have been identified in breast milk, and they are known to contribute to the formation and maintenance of intestinal flora in breastfed infants, as well as anti-infective, anti-inflammatory, brain function activation, and nutritional improvement effects (Non-Patent Document 1). Currently, in Europe and the United States, HMOs such as 2'-fucosyllactose (2'-FL), 3-fucosyllactose (3-FL), and 6'-sialyllactose (6'-SL) have begun to be added to infant formula.

[0003] Necrotizing enterocolitis (NECO) is a potentially fatal disease that primarily affects preterm and low birth weight infants. Neonatal intestinal blood flow disorders and bacterial infections increase the risk of NECO. Breast milk donation is effective in preventing NECO. In particular, the HMO component of breast milk, disialyllacto-N-tetraose (DSLNT), significantly reduces the incidence of NECO (Non-Patent Document 2). Currently, in situations where newborns are unable to obtain sufficient breast milk from their mothers, donor milk is provided from human milk banks to prevent NECO. Because this requires donor breast milk and storage, the development of a new, stable preventative agent is highly desirable.

[0004] Urashima T, Katayama T, Fukuda K, Hirabayashi J (2021) Human milk oligosaccharides and innate immunity. In:Comprehensive Glycoscience, Second edition (Barchi J ed.) Elsevier. Doi: 10.1016 / B978-0-12-8194745-1.00009-2.Jantscher-Krenn E, Zherbtsov M, Nissan C, Goth YS, Guner YS, Naidu N, Choudhury B, Grishin AV, Fird HR,Bode L (2012) The human milk oligosaccharide disialyllacto-N-tetraose prevents necrotizing enterocolitis in neonatal rats. Gut, 61, 1417-1425.

[0005] Despite its importance, the biosynthetic pathway of DSLNT remains unclear, and its synthesis by microbial fermentation has been difficult. The enzyme essential for DSLNT synthesis, which catalyzes the transfer of sialic acid to the 6-position of N-acetylglucosamine (GlcNAc) in a free oligosaccharide via an alpha2,6 linkage, is unknown.

[0006] An objective of the present invention is to provide a technique for producing oligosaccharides containing a Neu5Acα2-6GlcNAc structure, such as DSLNT.

[0007] In light of the above problems, the present inventors have conducted extensive research and found that the ST6GALNAC6 protein catalyzes the transfer of sialic acid to the 6-position of N-acetylglucosamine (GlcNAc) in free oligosaccharides via an alpha2,6 linkage with high specificity. Based on this finding, the present inventors have conducted further research and completed the present invention. Specifically, the present invention encompasses the following aspects:

[0008] Item 1. A composition for producing oligosaccharides containing a Neu5Acα2-6GlcNAc structure, comprising a protein containing the catalytic domain of the ST6GALNAC6 protein or a cell containing a polynucleotide containing a coding sequence for said protein.

[0009] Item 1A. Use of a protein comprising the catalytic domain of the ST6GALNAC6 protein or a cell comprising a polynucleotide comprising a coding sequence for said protein for producing oligosaccharides comprising a Neu5Acα2-6GlcNAc structure.

[0010] Item 2. The composition of Item 1, wherein the protein does not contain a transmembrane domain.

[0011] Item 3. The composition according to Item 1 or 2, wherein the ST6GALNAC6 protein is a protein consisting of the amino acid sequence A1 set forth in any one of SEQ ID NOs: 1 to 25, or a protein consisting of the amino acid sequence A2 having 70% or more identity to the amino acid sequence A1.

[0012] Item 4. The composition according to Item 3, wherein the amino acid sequence A2 has an identity of 90% or more to the amino acid sequence A1.

[0013] Item 5. The composition according to any one of Items 1 to 4, wherein the catalytic domain is region a1 consisting of amino acids 90 to 310 in the amino acid sequence of wild-type human ST6GALNAC6 protein shown in SEQ ID NO: 1, or region a2 corresponding to region a1 in the amino acid sequence of another ST6GALNAC6 protein.

[0014] Item 6. The composition according to Item 4, wherein the catalytic domain is region a1 consisting of amino acids 90 to 310 in the amino acid sequence of wild-type human ST6GALNAC6 protein shown in SEQ ID NO: 1, or region a2 corresponding to region a1 in the amino acid sequence of another ST6GALNAC6 protein.

[0015] Item 7. The composition according to any one of Items 1 to 6, comprising an amino acid sequence B1 set forth in any one of SEQ ID NOs: 1 and 26 to 29, or an amino acid sequence B2 having 90% or more identity to said amino acid sequence B1.

[0016] Item 8. The composition according to Item 1, wherein the oligosaccharide containing the Neu5Acα2-6GlcNAc structure is DSLNT and / or LSTb.

[0017] Item 9. The composition according to any one of Items 1 to 8, which is used in a reaction for converting an oligosaccharide containing GlcNAc but not a Neu5Acα2-6GlcNAc structure into an oligosaccharide containing a Neu5Acα2-6GlcNAc structure.

[0018] Item 10. A method for producing an oligosaccharide containing a Neu5Acα2-6GlcNAc structure, comprising contacting a protein containing the catalytic domain of the ST6GALNAC6 protein with an oligosaccharide containing GlcNAc but not containing a Neu5Acα2-6GlcNAc structure in the presence of an N-acetylneuraminic acid donor.

[0019] Item 11. A protein comprising the catalytic domain of the ST6GALNAC6 protein and not comprising the transmembrane domain.

[0020] Item 12. The protein according to Item 11, comprising an amino acid sequence C1 set forth in any one of SEQ ID NOs: 26 to 29, or an amino acid sequence C2 having 90% or more identity to the amino acid sequence C1.

[0021] Item 13. A polynucleotide comprising a coding sequence for the protein according to Item 11 or 12.

[0022] Item 14. A cell comprising the polynucleotide according to Item 13.

[0023] The present invention provides a technology for producing oligosaccharides containing a Neu5Acα2-6GlcNAc structure, such as DSLNT, and oligosaccharides (LSTb) that can be converted to DSLNT by a known reaction. Specifically, the present invention provides a protein containing the catalytic domain of the ST6GALNAC6 protein, a composition for producing oligosaccharides containing a Neu5Acα2-6GlcNAc structure, such as DSLNT and / or LSTb, a method for producing oligosaccharides containing a Neu5Acα2-6GlcNAc structure, such as DSLNT and / or LSTb, a polynucleotide containing a coding sequence for the protein, and a cell containing the polynucleotide.

[0024] In Test Example 1, the results of SDS-PAGE of the obtained ST6GALNAC6_V81 are shown. In Test Example 2, purified ST6GALNAC6_V81 was reacted with the substrate LSTa for 0 and 4 hours, the reaction product was labeled, and then MALDI-TOF-MS analysis was performed. Purple diamonds represent N-acetylneuraminic acid, blue squares represent N-acetylglucosamine, blue circles represent glucose, and yellow circles represent galactose (the same applies to the following figures). In Test Example 2, the substrate LSTa was reacted with purified ST6GALNAC6_V81 for 20 hours in the presence or absence of purified ST6GALNAC6_V81, the reaction product was labeled, and then LC-ESI-MS / MS analysis was performed. In Test Example 2, to confirm that the reaction product was DSLNT, m / z = 755.36 2+ 1 shows the results of MS / MS analysis of the parent MS of ST6GALNAC6. In Test Example 2, the substrate LNT was reacted for 20 hours with or without purified ST6GALNAC6_V81, and the reaction product was labeled and then analyzed by LC-ESI-MS / MS. In Test Example 2, the substrate LSTa was reacted for 24 hours with the same amount of purified ST6GALNAC6_N65, G71, G75, and V81, and the reaction product was labeled and then analyzed by LC-ESI-MS / MS. In Test Example 3, a phylogenetic tree was constructed by comparing the amino acid sequences of the human ST6GALNAC6 protein with ST6GALNAC6 from various mammals and other human ST6GALNAC proteins (ST6GALNAC1, ST6GALNAC2, ST6GALNAC3, ST6GALNAC4, and ST6GALNAC5). In Test Example 4, ST6GALNAC family proteins (ST6GALNAC1, ST6GALNAC2, ST6GALNAC3, ST6GALNAC4, ST6GALNAC5, ST6GALNAC6) were expressed, and the DSLNT synthesis activity for the substrate LSTa was evaluated. In Test Example 5, the ST6GALNAC6 protein, which was expressed in an Escherichia coli expression system, was used as an enzyme source, and the DSLNT synthesis activity for the substrate LSTa was evaluated.

[0025] 1. Definitions, etc. In this specification, the expressions "contain" and "comprise" include the concepts of "contain," "comprise," "consist essentially of," and "consist only of."

[0026] As used herein, the term "conservative substitution" refers to the substitution of an amino acid residue with an amino acid residue having a similar side chain. For example, substitution between amino acid residues having basic side chains such as lysine, arginine, and histidine constitutes a conservative substitution. Other examples of conservative substitutions include substitution between amino acid residues having acidic side chains such as aspartic acid and glutamic acid; amino acid residues having uncharged polar side chains such as glycine, asparagine, glutamine, serine, threonine, tyrosine, and cysteine; amino acid residues having nonpolar side chains such as alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, and tryptophan; amino acid residues having β-branched side chains such as threonine, valine, and isoleucine; and amino acid residues having aromatic side chains such as tyrosine, phenylalanine, tryptophan, and histidine.

[0027] As used herein, nucleotides such as DNA and RNA may be chemically modified as described below. To prevent degradation by hydrolases such as nucleases, the phosphate residue of each nucleotide may be substituted with a chemically modified phosphate residue such as phosphorothioate (PS), methylphosphonate, or phosphorodithioate. The hydroxyl group at the 2-position of the sugar (ribose) of each ribonucleotide may be substituted with -OR (where R represents, for example, CH3(2'-O-Me), CH2CHOCH3(2'-O-MOE), CH2CH2NHC(NH)NH2, CH2CONHCH3, or CH2CH2CN). Furthermore, the base moiety (pyrimidine or purine) may be chemically modified, for example by introducing a methyl group or a cationic functional group into the 5-position of the pyrimidine base, or by substituting a thiocarbonyl group for the carbonyl group at the 2-position. Further examples include, but are not limited to, those in which the phosphate moiety or hydroxyl moiety is modified with, for example, biotin, an amino group, a lower alkylamino group, an acetyl group, etc. Also preferably used are BNA (LNA), in which the conformation of the sugar moiety of the nucleotide is fixed to N-type by bridging the 2' oxygen and 4' carbon of the sugar moiety.

[0028] As used herein, amino acid mutation specifically refers to amino acid deletion, substitution, insertion, or addition.

[0029] As used herein, the term "coding sequence" refers to a base sequence that codes for the amino acid sequence of a protein, and is not particularly limited thereto.

[0030] Herein, the position of an amino acid in an amino acid sequence may be indicated by the single-letter amino acid code plus the amino acid number counting from the N-terminal amino acid. For example, "N65" indicates aspartic acid, the 65th amino acid from the N-terminus. Furthermore, a region consisting of amino acids X to Y in a certain amino acid sequence (X and Y are any natural numbers) refers to the region consisting of the amino acid sequence from the Xth amino acid to the Yth amino acid counting from the N-terminus of the amino acid sequence.

[0031] As used herein, Neu5Ac refers to N-acetylneuraminic acid, GlcNAc refers to N-acetylglucosamine, Glc refers to glucose, and Gal refers to galactose.

[0032] In this specification, an oligosaccharide structure is represented, for example, by Neu5Acα2-3Gal, which represents a structure in which the hydroxyl group at position 2 of N-acetylneuraminic acid is linked to the hydroxyl group at position 3 of galactose via an α-glycosidic bond. Branched oligosaccharide structures are represented, for example, by Galβ1-3(Neu5Acα2-6)GlcNAcβ1-3Gal, which represents a structure in which the hydroxyl group at position 1 of galactose is linked to the hydroxyl group at position 3 of N-acetylglucosamine in GlcNAcβ1-3Gal via a β-glycosidic bond, and the hydroxyl group at position 2 of N-acetylneuraminic acid is linked to the hydroxyl group at position 6 of N-acetylglucosamine in GlcNAcβ1-3Gal via an α-glycosidic bond.

[0033] 2. Protein In one aspect, the present invention relates to a protein comprising the catalytic domain of the ST6GALNAC6 protein (sometimes referred to herein as the "protein of the present invention"). This is described below.

[0034] The ST6GALNAC6 protein has the official name ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 6, and is the expression product of the gene with NCBI Gene ID 30815 in humans.

[0035] The source species of the ST6GALNAC6 protein is not particularly limited as long as it is a mammal. Examples of mammals include humans, cows, goats, sheep, horses, dogs, cats, mice, rats, platypuses, koalas, dolphins, whales, lorises, seals, moles, bears, killer whales, manatees, and sea otters. In a preferred embodiment of the present invention, the source species is humans. In another preferred embodiment of the present invention, the source species is marine mammals.

[0036] The amino acid sequences of wild-type ST6GALNAC6 proteins derived from various biological species are known. For example, the amino acid sequence of human ST6GALNAC6 is the amino acid sequence shown in SEQ ID NO: 1, the amino acid sequence of bovine ST6GALNAC6 is the amino acid sequence shown in SEQ ID NO: 2, the amino acid sequence of caprine ST6GALNAC6 is the amino acid sequence shown in SEQ ID NO: 3, the amino acid sequence of ovine ST6GALNAC6 is the amino acid sequence shown in SEQ ID NO: 4, the amino acid sequence of equine ST6GALNAC6 is the amino acid sequence shown in SEQ ID NO: 5, and the amino acid sequence of canine ST6GALNAC6 is the amino acid sequence shown in SEQ ID NO: 6. The amino acid sequence of cat ST6GALNAC6 is the amino acid sequence shown in SEQ ID NO: 7, the amino acid sequence of mouse ST6GALNAC6 is the amino acid sequence shown in SEQ ID NO: 8, the amino acid sequence of rat ST6GALNAC6 is the amino acid sequence shown in SEQ ID NO: 9, the amino acid sequence of platypus ST6GALNAC6 is the amino acid sequence shown in SEQ ID NO: 10, the amino acid sequence of koala ST6GALNAC6 is the amino acid sequence shown in SEQ ID NO: 11, and the amino acid sequence of vaquita ST6GALNAC6 is the amino acid sequence shown in SEQ ID NO: 12. The amino acid sequence of ST6GALNAC6 is the amino acid sequence shown in SEQ ID NO: 12, the amino acid sequence of blue whale ST6GALNAC6 is the amino acid sequence shown in SEQ ID NO: 13, the amino acid sequence of slow loris ST6GALNAC6 is the amino acid sequence shown in SEQ ID NO: 14, the amino acid sequence of harbor seal ST6GALNAC6 is the amino acid sequence shown in SEQ ID NO: 15, the amino acid sequence of echidna ST6GALNAC6 is the amino acid sequence shown in SEQ ID NO: 16, and the amino acid sequence of brown bear ST6GALNAC6 is the amino acid sequence shown in SEQ ID NO: 1 the amino acid sequence of long-finned pilot whale ST6GALNAC6 is the amino acid sequence shown in SEQ ID NO: 18, the amino acid sequence of polar bear ST6GALNAC6 is the amino acid sequence shown in SEQ ID NO: 19, the amino acid sequence of common dolphin ST6GALNAC6 is the amino acid sequence shown in SEQ ID NO: 20, the amino acid sequence of killer whale ST6GALNAC6 is the amino acid sequence shown in SEQ ID NO: 21, and the amino acid sequence of manatee ST6GALNAC6 is the amino acid sequence shown in SEQ ID NO: 22;The amino acid sequence of elephant seal ST6GALNAC6 is the amino acid sequence shown in SEQ ID NO: 23, the amino acid sequence of minke whale ST6GALNAC6 is the amino acid sequence shown in SEQ ID NO: 24, and the amino acid sequence of sea otter ST6GALNAC6 is the amino acid sequence shown in SEQ ID NO: 25.

[0037] The ST6GALNAC6 protein may have a mutation in its wild-type amino acid sequence, as long as it has the activity to catalyze the conversion of an oligosaccharide containing GlcNAc but not containing a Neu5Acα2-6GlcNAc structure (hereinafter sometimes referred to as a "substrate oligosaccharide") to an oligosaccharide containing a Neu5Acα2-6GlcNAc structure (hereinafter sometimes referred to as a "target oligosaccharide").

[0038] The substrate oligosaccharide may be linear or branched, but is preferably linear. The number of constituent sugar residues of the substrate oligosaccharide is, for example, 2 to 20, preferably 2 to 10, more preferably 3 to 8, even more preferably 3 to 7, still more preferably 4 to 7, particularly preferably 4 to 6, and particularly preferably 4 to 5. The substrate oligosaccharide preferably contains a Galβ1-3GlcNAcβ1-3Gal structure, more preferably a Neu5Acα2-3Galβ1-3GlcNAcβ1-3Galβ structure or a Galβ1-3GlcNAcβ1-3Galβ1-4Glc structure, and particularly preferably a Neu5Acα2-3Galβ1-3GlcNAcβ1-3Galβ1-4Glc structure.

[0039] The target oligosaccharide is an oligosaccharide in which sialic acid is bound via an alpha2,6 bond to the 6-position of a GlcNAc in a substrate oligosaccharide (preferably, the GlcNAc in a Galβ1-3GlcNAcβ1-3Gal structure, more preferably, the GlcNAc in a Neu5Acα2-3Galβ1-3GlcNAcβ1-3Galβ structure or a Galβ1-3GlcNAcβ1-3Galβ1-4Glc structure, and particularly preferably, the GlcNAc in a Neu5Acα2-3Galβ1-3GlcNAcβ1-3Galβ1-4Glc structure). The target oligosaccharide may be linear or branched, but branched is preferred. The target oligosaccharide may contain, for example, 3 to 21, preferably 3 to 11, more preferably 4 to 9, even more preferably 4 to 8, even more preferably 5 to 8, particularly preferably 5 to 7, and particularly preferably 5 to 6 sugar residues. Preferred target oligosaccharides include DSLNT, LSTb, F-LSTb, S-LNH-II, FDS-LNT-I, FDS-LNT-II, DS-LNH-II, FDS-LNH-I, FDS-LNH-II, TS-LNH, etc.

[0040] The target oligosaccharide is preferably a milk oligosaccharide, which is at least one of the oligosaccharides contained in milk (e.g., human breast milk, cow's milk, etc.), and is not particularly limited thereto.

[0041] Particularly preferred combinations of substrate oligosaccharides and target oligosaccharides include the combination of LSTa and DSLNT and the combination of LNT and LSTb, with the combination of LSTa and DSLNT being particularly preferred. DSLNT is an oligosaccharide officially named disialyllacto-N-tetraose, and is composed of a structure represented by Neu5Acα2-3Galβ1-3(Neu5Acα2-6)GlcNAcβ1-3Galβ1-4Glc. LSTb is an oligosaccharide officially named sialylacto-N-tetraose b, and is composed of a structure represented by Galβ1-3(Neu5Acα2-6)GlcNAcβ1-3Galβ1-4Glc. LSTa is an oligosaccharide officially named sialylacto-N-tetraose a, and is composed of a structure represented by Neu5Acα2-3Galβ1-3GlcNAcβ1-3Galβ1-4Glc. LNT is an oligosaccharide whose official name is lacto-N-tetraose and has a structure represented by Galβ1-3GlcNAcβ1-3Galβ1-4Glc.

[0042] The conversion reaction from a substrate oligosaccharide to a target oligosaccharide is a reaction in which the hydroxy group at position 2 of N-acetylneuraminic acid is linked to the hydroxy group at position 6 of N-acetylglucosamine in the substrate oligosaccharide via an α-glycosidic bond. For example, the conversion reaction from LSTa to DSLNT is a reaction in which the hydroxy group at position 2 of N-acetylneuraminic acid is linked to the hydroxy group at position 6 of N-acetylglucosamine in LSTa via an α-glycosidic bond. As another example, the conversion reaction from LNT to LSTb is a reaction in which the hydroxy group at position 2 of N-acetylneuraminic acid is linked to the hydroxy group at position 6 of N-acetylglucosamine in LNT via an α-glycosidic bond.

[0043] The activity of catalyzing the above conversion reaction can be measured by producing a protein consisting of the catalytic domain (described below) of the ST6GALNAC6 protein (or by adding a sequence that does not affect the activity, such as a secretory signal sequence or a tag sequence, to the domain) according to Test Example 1, and performing a synthase assay for the target oligosaccharide (e.g., a DSLNT synthase assay or an LSTb synthase assay) according to Test Example 2.

[0044] The mutant amino acid sequence can have, for example, 70% or more (preferably 75% or more, more preferably 80% or more, even more preferably 85% or more, still more preferably 90% or more, particularly preferably 95% or more, and particularly preferably 99% or more) identity to the wild-type amino acid sequence.

[0045] Preferred examples of the ST6GALNAC6 protein include a protein consisting of the amino acid sequence A1 set forth in any one of SEQ ID NOS: 1 to 25 (preferably SEQ ID NO: 1), or a protein consisting of an amino acid sequence A2 having 70% or more identity to said amino acid sequence A1 (preferably 75% or more, more preferably 80% or more, even more preferably 85% or more, even more preferably 90% or more, particularly preferably 95% or more, and particularly preferably 99% or more). Amino acid sequence A2 can be an amino acid sequence obtained by mutating one or more amino acids (e.g., 1 to 50, 1 to 30, 1 to 20, 1 to 10, 1 to 5, or 1 to 2) from amino acid sequence A1. In amino acid sequence A2, the mutation is preferably a substitution, deletion, or insertion, more preferably a substitution or deletion, even more preferably a substitution, and particularly preferably a conservative substitution.

[0046] The catalytic activity of the ST6GALNAC6 protein consisting of amino acid sequence A2 is preferably 30% or more, more preferably 50% or more, even more preferably 70% or more, still more preferably 80% or more, particularly preferably 90% or more, and especially preferably 95% or more, relative to 100% of the catalytic activity of the ST6GALNAC6 protein consisting of amino acid sequence A1. The activity ratio can be measured as described above and calculated based on the peak area of ​​the target oligosaccharide (e.g., DSLNT or LSTb) in fluorescence detection as shown in Figure 3.

[0047] The catalytic domain is the part that forms the three-dimensional structure in the C-terminal region of the ST6GALNAC6 protein structure (N-terminal region - transmembrane domain - C-terminal region), and can be easily determined using protein structure prediction programs such as AlphaFold (https: / / alphafold.ebi.ac.uk / ). The structure of human wild-type ST6GALNAC6 protein is shown in Figure 6.

[0048] Specific preferred examples of the catalytic domain include region a1 consisting of amino acids 90 to 310 (preferably 87 to 315, more preferably 84 to 320, even more preferably 82 to 325, still more preferably 80 to 325, particularly preferably 78 to 330, and particularly preferably 75 to 333) in the amino acid sequence of the wild-type human ST6GALNAC6 protein shown in SEQ ID NO: 1, or region a2 corresponding to region a1 in the amino acid sequence of another ST6GALNAC6 protein.

[0049] Other ST6GALNAC6 protein amino acid sequences include wild-type or mutant ST6GALNAC6 protein amino acid sequences of non-humans and mutant ST6GALNAC6 protein amino acid sequences of humans.

[0050] The corresponding region is a region that corresponds when the amino acid sequence of the wild-type human ST6GALNAC6 protein shown in SEQ ID NO: 1 is compared with another ST6GALNAC6 protein amino acid sequence (e.g., comparison using default BLAST parameters). For example, when comparing sequences aligned vertically using BLAST, a certain upper region and a lower region aligned directly below it correspond to each other.

[0051] It is preferable that the protein of the present invention does not contain a transmembrane domain. This makes it easier to express the protein of the present invention in cells and purify it. This can also contribute to suppressing aggregation and improving stability of the purified protein of the present invention. Even if the protein contains a transmembrane domain, problems specific to membrane proteins can be suppressed by using the protein of the present invention in a state where it is inserted into a lipid membrane (e.g., a cell membrane or a membrane of an organelle (e.g., Golgi apparatus)), thereby enabling its use as an enzyme preparation, as described below.

[0052] Transmembrane domains can be determined using transmembrane domain prediction programs such as AlphaFold (https: / / alphafold.ebi.ac.uk / ) and TMHMM (https: / / services.healthtech.dtu.dk / services / TMHMM-2.0 / ).

[0053] In the case of the ST6GALNAC6 protein, specific examples of the transmembrane domain include region b1 consisting of amino acids 44 to 64 in the amino acid sequence of the wild-type human ST6GALNAC6 protein shown in SEQ ID NO: 1, or region b2 corresponding to region b1 in the amino acid sequence of another ST6GALNAC6 protein.

[0054] In a preferred embodiment of the present invention, the protein of the present invention comprises an amino acid sequence B1 set forth in any one of SEQ ID NOs: 1 and 26 to 29, or an amino acid sequence B2 having 90% or more (preferably 95% or more, more preferably 98% or more, and even more preferably 99% or more) identity to the amino acid sequence B1.

[0055] In a particularly preferred embodiment of the present invention, the protein of the present invention comprises an amino acid sequence C1 set forth in any one of SEQ ID NOs: 26 to 29, or an amino acid sequence C2 having 90% or more (preferably 95% or more, more preferably 98% or more, and even more preferably 99% or more) identity to the amino acid sequence C1.

[0056] The amino acid sequence B2 or C2 can be an amino acid sequence obtained by mutating one or more amino acids (e.g., 1 to 50, 1 to 30, 1 to 20, 1 to 10, 1 to 5, or 1 to 2) from the amino acid sequence B1 or C1. In the amino acid sequences B2 and C2, the mutation is preferably a substitution, deletion, or insertion, more preferably a substitution or deletion, even more preferably a substitution, and particularly preferably a conservative substitution.

[0057] SEQ ID NOs: 26 to 29 are amino acid sequences derived from the wild-type human ST6GALNAC6 protein amino acid sequence (SEQ ID NO: 1) by deleting the N-terminal region and transmembrane domain. SEQ ID NO: 26 is the amino acid sequence from N65 to the C-terminus (ST6GALNAC6 N65), SEQ ID NO: 27 is the amino acid sequence from G71 to the C-terminus (ST6GALNAC6 G71), SEQ ID NO: 28 is the amino acid sequence from G75 to the C-terminus (ST6GALNAC6 G75), and SEQ ID NO: 29 is the amino acid sequence from V81 to the C-terminus (ST6GALNAC6 V81). As shown in Figure 6, ST6GALNAC6 G75 and ST6GALNAC6 V81 (particularly ST6GALNAC6 G75) have higher activity than ST6GALNAC6 N65 and ST6GALNAC6 G71.

[0058] Therefore, in a particularly preferred embodiment of the present invention, the protein of the present invention comprises an amino acid sequence D1 set forth in any one of SEQ ID NOs: 28 to 29 (particularly SEQ ID NO: 28), or an amino acid sequence D2 having 90% or more (preferably 95% or more, more preferably 98% or more, and even more preferably 99% or more) identity to the amino acid sequence D1.

[0059] The amino acid sequence D2 can be an amino acid sequence obtained by mutating one or more amino acids (for example, 1 to 50, 1 to 30, 1 to 20, 1 to 10, 1 to 5, or 1 to 2) from the amino acid sequence D1. In the amino acid sequence D2, the mutation is preferably a substitution, deletion, or insertion, more preferably a substitution or deletion, even more preferably a substitution, and particularly preferably a conservative substitution.

[0060] When amino acid sequence D1 is sequence number 28, in amino acid sequence D2, the number of amino acids added to the N-terminal side of amino acid sequence D1 is 3 or less, preferably 2 or less, more preferably 1 or less, and particularly preferably 0.

[0061] When amino acid sequence D1 is sequence number 29, in amino acid sequence D2, the number of amino acids added to the N-terminal side of amino acid sequence D1 is 9 or less, preferably 8 or less, more preferably 7 or less, and particularly preferably 6 or less.

[0062] The protein of the present invention may be modified with an amino acid sequence other than that described above that is not derived from the ST6GALNAC6 protein, such as a secretory signal sequence, a protein tag, a fluorescent protein, a luminescent protein, or a protein or peptide such as a signal sequence for a protease (e.g., a TEV protease recognition sequence), as long as the catalytic activity is not significantly impaired. Examples of protein tags include biotin, His tag, FLAG tag, Halo tag, MBP tag, HA tag, Myc tag, V5 tag, and PA tag.

[0063] The protein of the present invention may be chemically modified as long as the catalytic activity is not significantly impaired.

[0064] The protein of the present invention has a C-terminus containing a carboxyl group (-COOH) or a carboxylate group (-COO － ), amide (-CONH2) or ester (-COOR).

[0065] Here, R in the ester is, for example, C such as methyl, ethyl, n-propyl, isopropyl, n-butyl, etc. 1－6 Alkyl groups; for example, C groups such as cyclopentyl and cyclohexyl 3－8 Cycloalkyl groups such as phenyl and α-naphthyl 6－12 Aryl groups; for example, phenyl-C such as benzyl and phenethyl 1－2 Alkyl group: α-naphthyl-C such as α-naphthylmethyl 1－2 C such as alkyl group 7－14Aralkyl groups, pivaloyloxymethyl groups, etc. are used.

[0066] The protein of the present invention may have a carboxyl group (or carboxylate) other than that at the C-terminus amidated or esterified, such as the C-terminal esters described above.

[0067] Furthermore, in the protein of the present invention, the amino group of the N-terminal amino acid residue is protected by a protecting group (e.g., a C group such as a formyl group or an acetyl group). 1－6 C such as alkanoyl 1－6 those in which the N-terminal glutamine residue that can be generated by cleavage in vivo is pyroglutamated; those in which the substituents on the side chains of amino acids in the molecule (e.g., -OH, -SH, amino group, imidazole group, indole group, guanidino group, etc.) are protected by an appropriate protecting group (e.g., C group such as formyl group, acetyl group, etc.); 1－6 C such as alkanoyl group 1－6 Also included are those protected by an acyl group or the like, or conjugated proteins such as so-called glycoproteins to which sugar chains are bound.

[0068] The protein of the present invention may be in the form of a salt with an acid or a base. The salt is not particularly limited, and either an acid salt or a basic salt can be used. Examples of acid salts include inorganic acid salts such as hydrochloride, hydrobromide, sulfate, nitrate, and phosphate; organic acid salts such as acetate, propionate, tartrate, fumarate, maleate, malate, citrate, methanesulfonate, and paratoluenesulfonate; and amino acid salts such as aspartate and glutamate. Examples of basic salts include alkali metal salts such as sodium salt and potassium salt; and alkaline earth metal salts such as calcium salt and magnesium salt.

[0069] The protein of the present invention may be in the form of a solvate. The solvent is not particularly limited, and examples thereof include water, ethanol, glycerol, and acetic acid.

[0070] When the protein of the present invention is used as an enzyme preparation as described below, it can be easily produced according to its amino acid sequence using known genetic engineering techniques, such as PCR, restriction enzyme digestion, DNA ligation, in vitro transcription / translation (cell-free protein synthesis (e.g., wheat germ cell-free protein synthesis)), and recombinant protein production techniques.

[0071] If the protein of the present invention does not contain a transmembrane domain, it can be easily obtained by expressing it intracellularly by adding a secretion signal or the like as needed, and then recovering the culture supernatant. Furthermore, purification can be performed by combining centrifugation, filtration, molecular sieving, membrane concentration, electrophoresis, column chromatography, dialysis, salting out, and the like, as needed. When applying these methods, physicochemical conditions such as temperature, pressure, pH, and ionic strength can be appropriately set.

[0072] 3. Polynucleotides and Cells In one aspect, the present invention relates to a polynucleotide comprising a coding sequence for a protein of the present invention (herein also referred to as a "polynucleotide of the present invention") and a cell comprising a polynucleotide of the present invention (herein also referred to as a "cell of the present invention"). These are described below.

[0073] The coding sequence of the protein of the present invention is not particularly limited, as long as it is a polynucleotide consisting of a nucleotide sequence that encodes the protein of the present invention.

[0074] In one embodiment, the polynucleotide of the present invention comprises an expression cassette for the protein of the present invention.

[0075] The expression cassette for the protein of the present invention is not particularly limited as long as it is a polynucleotide that can express the protein of the present invention in cells. Typical examples of the expression cassette for the protein of the present invention include a polynucleotide comprising a promoter and a coding sequence for the protein of the present invention placed under the control of the promoter.

[0076] The promoter contained in the expression cassette for the protein of the present invention is not particularly limited and can be selected appropriately depending on the target cell. For example, various Pol II promoters can be used. Pol II promoters are not particularly limited, but examples include the CMV promoter, EF1 promoter, SV40 promoter, MSCV promoter, hTERT promoter, β-actin promoter, and CAG promoter. Other examples of promoters include tryptophan promoters such as trc and tac, lac promoter, T7 promoter, T5 promoter, T3 promoter, SP6 promoter, alcohol (e.g., methanol)-inducible promoter, arabinose-inducible promoter, cold shock promoter, and tetracycline-inducible promoter.

[0077] The polynucleotide of the present invention may contain other elements, as necessary (for example, a multiple cloning site (MCS), a drug resistance gene, an origin of replication, an enhancer sequence, a repressor sequence, an insulator sequence, a reporter protein (e.g., a fluorescent protein), a drug resistance gene coding sequence, etc.).

[0078] The polynucleotide of the present invention may be in the form of a vector. An appropriate vector is selected depending on the intended use (cloning, protein expression) and the type of host cell. Examples of vectors using E. coli as a host include M13 phage or its variants, λ phage or its variants, and pBR322 or its variants (pB325, pAT153, pUC8, etc.); examples of vectors using yeast as a host include pYepSec1, pMFa, pYES2, pPIC3.5K, and pPICZα A; examples of vectors using insect cells as a host include pAc and pVL; and examples of vectors using mammalian cells as a host include pcDNA, pCDM8, and pMT2PC.

[0079] The cells of the present invention are not particularly limited as long as they contain the polynucleotide of the present invention. Examples of cells include Escherichia coli such as Escherichia coli K12, Bacillus bacteria such as Bacillus subtilis MI114, yeast such as Saccharomyces cerevisiae AH22, the Sf cell line derived from Spodoptera frugiperda or the HighFive cell line derived from Trichoplusia ni, and animal cells such as COS7 cells. Preferred animal cells include cultured cells derived from mammals, specifically COS7 cells, CHO cells, HEK293 cells, HEK293FT cells, and HeLa cells.

[0080] In one embodiment, the cell of the present invention expresses the protein of the present invention.

[0081] 4. Uses The proteins of the present invention can catalyze the transfer of sialic acid to the 6-position of N-acetylglucosamine (GlcNAc) in an oligosaccharide via an alpha2,6 bond. The "oligosaccharide" of interest refers to a free oligosaccharide and does not include oligosaccharides contained in glycolipids or glycoproteins. Due to this catalytic activity, the proteins of the present invention can catalyze the conversion of a substrate oligosaccharide to a target oligosaccharide. Therefore, the proteins of the present invention or the cells of the present invention can be used in compositions for producing target oligosaccharides.

[0082] In a preferred embodiment, the present invention relates to an enzyme preparation containing the protein of the present invention (enzyme preparation of the present invention) (Embodiment 1).

[0083] The enzyme preparation of the present invention may contain other ingredients as needed. Examples of other ingredients include excipients, buffers, suspending agents, stabilizers, preservatives, antiseptics, physiological saline, oils, and the like. Examples of excipients that can be used include starch, dextrin, maltose, trehalose, lactose, D-glucose, sorbitol, D-mannitol, sucrose, and glycerol. Examples of buffers that can be used include phosphates, citrates, and acetates. Examples of stabilizers that can be used include propylene glycol and ascorbic acid. Examples of preservatives that can be used include phenol, benzalkonium chloride, benzyl alcohol, chlorobutanol, and methylparaben. Examples of preservatives that can be used include ethanol, benzalkonium chloride, parahydroxybenzoic acid, and chlorobutanol.

[0084] When the enzyme preparation of the present invention is in the form of a solution or a frozen product thereof, the content of the protein of the present invention in the enzyme preparation of the present invention is not particularly limited and is, for example, 0.1 to 100 μg / mL, preferably 0.5 to 10 μg / mL.

[0085] In a preferred embodiment, the present invention relates to a composition for fermentative production of oligosaccharides, which comprises the cell of the present invention (Aspect 2).

[0086] In Aspect 2, the cells of the present invention preferably have the ability to synthesize substrate oligosaccharides and / or N-acetylneuraminic acid donors. Cells having these synthetic abilities are already known and can be produced according to or in accordance with known information (e.g., ChemBioChem 2014, 15, 1896-1900, WO 2015 / 037698, etc.).

[0087] The N-acetylneuraminic acid donor is not particularly limited as long as it is capable of donating N-acetylneuraminic acid in glycosidic bond formation, and examples thereof include, in addition to N-acetylneuraminic acid itself, CMP-N-acetylneuraminic acid and the like.

[0088] In embodiment 2, the cell of the present invention is, in one embodiment, more preferably, a prokaryote belonging to the genus Escherichia, Serratia, Bacillus, Brevibacterium, Corynebacterium, Microbacterium, or Pseudomonas, or a cell of the genus Saccharomyces, Schizosaccharomyces, Kluyveromyces, Trichosporon, Siwaniomyces, Pichia, or Candida.

[0089] In one aspect, the present invention relates to a method for producing a target oligosaccharide (the production method of the present invention), which comprises contacting a protein of the present invention with a substrate oligosaccharide in the presence of an N-acetylneuraminic acid donor.

[0090] Details of the production method of the present invention in embodiment 1 are as follows.

[0091] The contacting is usually carried out in a liquid using water as the main solvent.

[0092] The concentration of the protein of the present invention in the reaction solution is, for example, 0.1 to 100 μg / mL, preferably 0.5 to 10 μg / mL.

[0093] The concentration of the substrate oligosaccharide in the reaction mixture is, for example, 1 to 100 mM, preferably 5 to 30 mM.

[0094] The concentration of the N-acetylneuraminic acid donor in the reaction mixture is, for example, 2 to 200 mM, preferably 10 to 50 mM.

[0095] The molar ratio of the N-acetylneuraminic acid donor to the substrate oligosaccharide in the reaction mixture is, for example, 0.5 to 10, preferably 1.5 to 3.

[0096] The reaction solution may contain other components such as divalent cations, surfactants, BSA, etc.

[0097] The pH of the reaction solution is, for example, 5.0 to 8.0, preferably 5.5 to 7.0, and more preferably 6.0 to 6.5.

[0098] The reaction temperature is, for example, 15 to 45°C, 20 to 40°C, 25 to 40°C, 30 to 40°C, or 35 to 38°C.

[0099] The reaction time is, for example, 30 minutes to 48 hours.

[0100] The reaction method is not particularly limited, and may be, for example, a batch method or a continuous method.

[0101] After the reaction, the oligosaccharide can be purified according to or in accordance with a known method for purifying oligosaccharides.

[0102] Details of the production method of the present invention in embodiment 2 are as follows.

[0103] The contact is usually carried out within the cells of the present invention. When the cells of the present invention do not have the ability to synthesize substrate oligosaccharides and / or N-acetylneuraminic acid donors, the production method of the present invention can be carried out by appropriately supplying substrate oligosaccharides and / or N-acetylneuraminic acid donors to the medium.

[0104] The medium is not particularly limited, and any known medium used for fermentative production of oligosaccharides can be used.

[0105] By culturing the cells of the present invention under appropriate conditions, the target oligosaccharides can be obtained.

[0106] The target oligosaccharide obtained by the production method of the present invention can be used by being added to artificial infant formula, etc. DSLNT can significantly reduce the onset of necrotizing enterocolitis, so by adding DSLNT efficiently produced by the technology of the present invention to artificial infant formula, etc., necrotizing enterocolitis can be prevented simply and effectively.

[0107] The present invention will be described in detail below based on examples, but the present invention is not limited to these examples.

[0108] Test Example 1. Preparation of Soluble ST6GALNAC6 <1-1. Cloning of Full-Length Human Wild-Type ST6GALNAC6> A cDNA fragment containing the full-length human wild-type ST6GALNAC6 coding sequence (SEQ ID NO: 30) was obtained by artificial DNA synthesis. Using the resulting synthetic ST6GALNAC6 cDNA fragment as a template, DNA was amplified by PCR using the ST6GALNAC6-EcoRI-F primer (aaaaGAATTCgCCACCatggcttgctcgaggcccccca: SEQ ID NO: 35) and the ST6GALNAC6-NotI-R primer (aaaaGCGGCCGCTTAggtccaggaggggtgggagaag: SEQ ID NO: 36). The amplified DNA was then inserted into the EcoRI-NotI site of the pcDNA6-BSD plasmid to obtain pcDNA-BSD-ST6GALNAC6.

[0109] <1-2. Selection of the initiation site of soluble ST6GALNAC6> From the sequence of full-length human wild-type ST6GALNAC6, amino acids with small, uncharged side chains were selected from the region from Asn65 (N65), immediately after the transmembrane domain, to the start of the putative catalytic domain, and four soluble ST6GALNAC6 variants (SEQ ID NOs: 26 to 29, respectively) with initiation sites at N65, Gly71 (G71), Gly75 (G75), and Val81 (V81) were designed.

[0110] 1-3. Construction of an expression plasmid for soluble ST6GALNAC6 Using pcDNA-BSD-ST6GALNAC6 as a template, ST6GALNAC6_N65-EcoRI-F primer (aaaaGAATTCaatgaggtcttccattacggctccc: SEQ ID NO: 37), ST6GALNAC6_G71-EcoRI-F primer (aaaaGAATTCggctccctgcggggccgtag: SEQ ID NO: 38), ST6GALNAC6_G75-EcoRI-F primer (aaaaGAATTCggccgtagccgccgacctgt: SEQ ID NO: 39), and ST6GALNAC6_G75-EcoRI-F primer (aaaaGAATTCggccgtagccgccgacctgt: SEQ ID NO: 40) were introduced. DNA was amplified by PCR using the ST6GALNAC6_V81-EcoRI-F primer (aaaaGAATTCgtcaacctcaagaagtggagcatca: SEQ ID NO: 40) and the ST6GALNAC6-NotI-R primer (aaaaGCGGCCGCTTAggtccaggaggggtgggagaag: SEQ ID NO: 36). The resulting fragment was inserted into the pcDNA3.1-IHT plasmid (pcDNA3.1 containing a mouse immunoglobulin secretory signal, His The plasmids were inserted into the EcoRI-NotI site of pcDNA3.1-IHT-ST6GALNAC6_N65, pcDNA3.1-IHT-ST6GALNAC6_G71, pcDNA3.1-IHT-ST6GALNAC6_G75, and pcDNA3.1-IHT-ST6GALNAC6_V81, respectively.

[0111] <1-4. Expression and Purification of Soluble ST6GALNAC6> Soluble ST6GALNAC6 was expressed and purified by the following methods 1 and 2, respectively.

[0112] (Method 1) HEK293T cells (2 x 10 7Cells (20 ml medium) were transfected with 15 μg of pcDNA3.1-IHT-ST6GALNAC6_N65, pcDNA3.1-IHT-ST6GALNAC6_G71, pcDNA3.1-IHT-ST6GALNAC6_G75, or pcDNA3.1-IHT-ST6GALNAC6_V81 using Polyethylenimine Max. After half a day, the medium was removed, the cells were washed once with PBS, and then 25 ml of OPTI-MEM was added and cultured in a CO2 incubator for 3.5 days. The resulting culture supernatant was collected, centrifuged, and filtered through a 0.45 μm filter to remove cells. The culture supernatant was passed through a column containing 200 μl of Ni-Sepharose and washed with wash buffer (phosphate buffer, 20 mM imidazole, 500 mM NaCl). The ST6GALNAC6 protein was then eluted with elution buffer (phosphate buffer, 250 mM imidazole, 500 mM NaCl). The protein solution was then applied to a gel filtration column for desalting, recovered in 100 mM MES (pH 6.25), and used in the enzyme assay. The results of SDS-PAGE of the resulting ST6GALNAC6_V81 protein are shown in Figure 1.

[0113] (Method 2) HEK293T cells (1 x 10 6Cells (100 cells / 2 ml medium) were transfected with 1.25 μg of pcDNA3.1-IHT-ST6GALNAC6_N65, pcDNA3.1-IHT-ST6GALNAC6_G71, pcDNA3.1-IHT-ST6GALNAC6_G75, or pcDNA3.1-IHT-ST6GALNAC6_V81. After half a day, the medium was removed, the cells were washed once with PBS, and then 2.5 ml of OPTI-MEM was added and cultured in a CO2 incubator for 3.5 days. The resulting culture supernatant was collected, centrifuged, and filtered to remove the cells. The expressed ST6GALNAC6 protein was adsorbed onto Ni-Sepharose from the culture supernatant, washed with wash buffer (phosphate buffer, 20 mM imidazole, 500 mM NaCl), and then eluted with elution buffer (phosphate buffer, 250 mM imidazole, 500 mM NaCl) for use in enzyme assays.

[0114] Test Example 2. DSLNT synthase assay or LSTb synthase assay <2-1. DSLNT synthase assay> The ST6GALNAC6 protein or other ST6GALNAC family proteins (ST6GALNAC1, ST6GALNAC2, ST6GALNAC3, ST6GALNAC4, ST6GALNAC5) was added to a reaction buffer (125 mM MES (pH 6.25), 10 mM MnCl2, 0.5% Triton X-100, 1 mg / ml BSA, 20 mM CMP-NeuAc, 10 mM LSTa or 1 mM LSTa) at a final concentration of 0.6 μg / ml, and the mixture was allowed to react at 37° C. for a certain period of time.

[0115] 2-2. LSTb synthase assay ST6GALNAC6 protein was added to a reaction buffer (125 mM MES (pH 6.25), 10 mM MnCl2, 0.5% Triton X-100, 1 mg / ml BSA, 20 mM CMP-NeuAc, 10 mM LNT) at a final concentration of 0.6 μg / ml, and the mixture was allowed to react at 37°C for a certain period of time.

[0116] 2-3. Detection of reaction products The reaction products were detected by MALDI-TOF-MS or LC-ESI-MS / MS.

[0117] For detection using MALDI-TOF-MS, after the enzymatic reaction, the glycans in the reaction mixture were purified using BlotGlyco (Sumitomo Bakelite), the sialic acids were protected with methyl groups, and labeled with O-benzylhydroxylamine. The labeled glycan solution was mixed 1:1 with 10 mg / ml 2,5-dihydroxybenzoic acid (DHB), spotted on a MALDI target plate, and allowed to dry. The sample was measured in positive ion mode using an AXIMA Resonance (Shimadzu Corporation).

[0118] For detection using LC-ESI-MS / MS, after the enzymatic reaction, the glycans in the reaction mixture were purified using BlotGlyco (Sumitomo Bakelite). To fluorescently label the reducing ends of the glycans, a procainamide solution (38.3 mg of procainamide and 44.8 mg of 2-picolineborane dissolved in 1 ml of dimethyl sulfoxide / acetic acid (7:3) and further diluted with 0.8 ml of purified water) was incubated at 65°C for 2 hours. Excess procainamide was removed using a cleanup column. After drying, the labeled glycan solution was suspended in 75% acetonitrile and analyzed using a liquid chromatography (LC)-coupled SYNAPT XS (Waters) fluorescence detector and mass spectrometer. LC was performed using an XBridge Glycan BEH Amide XP Column (Waters) at a column temperature of 60°C, with acetonitrile as mobile phase A and 50 mM ammonium formate as mobile phase B, at a flow rate of 0.2 ml / min. The analysis schedule was as follows: starting at 25% B, 40% B at 40 minutes, 80% B at 42.5 minutes, 80% B until 47.5 minutes, 25% B at 50 minutes, and 25% B until 55 minutes.

[0119] 2-4. Results The results are shown in Figures 2 to 6. Figures 2 to 5 show the results when ST6GALNAC6_V81 obtained by Method 1 was used, and Figure 6 shows the results when ST6GALNAC6_N65, G71, G75, and V81 obtained by Method 2 were used.

[0120] Figure 2 shows the results of reacting the substrate LSTa with purified ST6GALNAC6_V81 for 0 and 4 hours, labeling the reaction product, and then performing MALDI-TOF-MS analysis. Figure 3 shows the results of reacting the substrate LSTa with or without purified ST6GALNAC6_V81 for 20 hours, labeling the reaction product, and then performing LC-ESI-MS / MS analysis. The substrate LSTa and the reaction product were confirmed using a fluorescence detector. Figure 4 shows the results of analyzing the m / z = 755.36 chromatogram to confirm that the reaction product is DSLNT. 2+ The results of MS / MS analysis of the parent MS of DSLNT are shown below. The fragment pattern confirmed that it was DSLNT.

[0121] 5 shows the results of LC-ESI-MS / MS analysis of the substrate LNT after 20 hours of reaction with or without purified ST6GALNAC6_V81. The substrate LNT and the reactant LSTb were identified using a fluorescence detector.

[0122] Figure 6 shows the results of 24-hour reactions of the substrate LSTa with the same amount of purified ST6GALNAC6_N65, G71, G75, and V81, followed by LC-ESI-MS / MS analysis of the labeled reaction products. The amount of DSLNT produced by each enzyme was compared (n = 2, mean ± error).

[0123] 2 to 6 show that proteins containing the catalytic domain of the ST6GALNAC6 protein have catalytic activity in the conversion reaction from LSTa to DSLNT and / or the conversion reaction from LNT to LSTb.

[0124] Test Example 3. Comparison of Amino Acid Sequences of ST6GALNAC6 Proteins. Amino acid sequences were compared between human ST6GALNAC6 protein (SEQ ID NO: 1), ST6GALNAC6 from various mammals (SEQ ID NOs: 2-25), and other human ST6GALNAC proteins (ST6GALNAC1, ST6GALNAC2, ST6GALNAC3, ST6GALNAC4, ST6GALNAC5), and a phylogenetic tree was constructed using Jalview (https: / / www.jalview.org / ) (Figure 7). Even the ST6GALNAC6 from echidna and platypus, which are the most distant from human ST6GALNAC6, shared over 80% identity. Among ST6GALNAC1-5, human ST6GALNAC5, which is closest to human ST6GALNAC6, shared only 42% identity. This indicates that ST6GALNAC6 is conserved across species.

[0125] Test Example 4. Investigation of DSLNT synthesis activity of ST6GALNAC family proteins <4-1. Comparison of amino acid sequences of human ST6GALNAC1 to ST6GALNAC6> The amino acid sequences of human ST6GALNAC6 protein (SEQ ID NO: 1) were compared with those of other human ST6GALNAC proteins (ST6GALNAC1, ST6GALNAC2, ST6GALNAC3, ST6GALNAC4, ST6GALNAC5), and a phylogenetic tree was created using Jalview (https: / / www.jalview.org / ) (Figure 8, left).

[0126] <4-2. Construction of expression plasmids for soluble ST6GALNAC1 to ST6GALNAC5> Using the same procedure as for the soluble ST6GALNAC6 construct, ST6GALNAC1, ST6GALNAC2, ST6GALNAC3, ST6GALNAC4, and ST6GALNAC5 were also constructed using full-length cDNA as a template, with the ST6GALNAC1_N248-EcoRI-infusionF primer (cttccagggaGAATTCaaccaaagactgaaggccgccaa: SEQ ID NO: 41) and the ST6GALNAC1-NotI-infusionR primer (tagac tcgaGCGGCCGCttagttcttggctttggcagttccg: SEQ ID NO: 42), ST6GALNAC2_G61-EcoRI-infusionF primer (cttccagggaGAATTCggaaagggccaggcctgccg: SEQ ID NO: 43), ST6GALNAC2-NotI-infusionR primer (tagactcgaGCGGCCGCttagcgctggtacagctgaagg: SEQ ID NO: 44), ST6GALNAC3_T53-EcoRI- infusionF primer (cttccagggaGAATTCacatacaggcggccccttcg: SEQ ID NO: 45) and ST6GALNAC3-NotI-infusionR primer (tagactcgaGCGGCCGCttaagacaatgtccagtttgg: SEQ ID NO: 46), ST6GALNAC4_T49-EcoRI-infusionF primer (cttccagggaGAATTCactgtgccgggacccctgca: SEQ ID NO: 47) and ST6GALNA C4-NotI-infusionR primer (tagactcgaGCGGCCGCttactcagtcctccaggacg: SEQ ID NO: 48), ST6GALNAC5_G69-EcoRI-infusionF primer (aaaaGAATTCggagtccccgcgggaccgc: SEQ ID NO: 49) and ST6GALNAC5-NotI-R primer (aaaaGCGGCCGCttagaacacaggtttattctcaggatgatttatagcaagtg: SEQ ID NO: 50),DNA was amplified by PCR using the ST6GALNAC5_G73-EcoRI-F primer (aaaaGAATTCggaccgcggccactggacgga: SEQ ID NO: 51) and the ST6GALNAC5-NotI-R primer (aaaaGCGGCCGCttagaacacaggtttattctcaggatgatttatagcaagtg: SEQ ID NO: 50), and the resulting fragment was transformed into pcDNA3.1-IHT Plus The fragments were introduced into the EcoRI-NotI site of each plasmid to obtain pcDNA3.1-IHT-ST6GALNAC1_N248, pcDNA3.1-IHT-ST6GALNAC2_G61, pcDNA3.1-IHT-ST6GALNAC3_T53, pcDNA3.1-IHT-ST6GALNAC4_T49, pcDNA3.1-IHT-ST6GALNAC5_G69, and pcDNA3.1-IHT-ST6GALNAC5_G73, respectively.

[0127] 4-3. Expression, purification, and DSLNT synthase assay of ST6GALNAC1 to ST6GALNAC6 HEK293T cells (2 x 10^7 cells / 20 ml medium) were transfected with 15 μg of pcDNA3.1-IHT-ST6GALNAC1_N248, pcDNA3.1-IHT-ST6GALNAC2_G61, pcDNA3.1-IHT-ST6GALNAC3_T53, pcDNA3.1-IHT-ST6GALNAC4_T49, pcDNA3.1-IHT-ST6GALNAC5_G69, pcDNA3.1-IHT-ST6GALNAC5_G73, or pcDNA3.1-IHT-ST6GALNAC6_G75 using Polyethylenimine Max. After half a day, the medium was removed, the cells were washed once with PBS, and then 25 ml of OPTI-MEM was added and cultured in a CO2 incubator for 3.5 days. The resulting culture supernatant was collected and cells were removed by centrifugation and filtration through a 0.45 μm filter. The culture supernatant was passed through a column containing 200 μl of Ni-Sepharose. After washing with wash buffer (phosphate buffer, 20 mM imidazole, 500 mM NaCl), the ST6GALNAC1_N248, ST6GALNAC2_G61, ST6GALNAC3_T53, ST6GALNAC4_T49, ST6GALNAC5_G69, ST6GALNAC5_G73, and ST6GALNAC6_G75 proteins were eluted with elution buffer (phosphate buffer, 250 mM imidazole, 500 mM NaCl). The protein solution was subjected to a gel filtration column for desalting, recovered in 100 mM MES (pH 6.25), and used for the enzyme assay. The DSLNT synthase assay and detection of the reaction product were performed according to the methods in Test Example 2.

[0128] 4-4. Results Figure 8 (left) shows a phylogenetic tree constructed based on the amino acid sequences of human ST6GALNAC family proteins. Figure 8 (right) shows the results of 20-hour reactions of purified ST6GALNAC1_N248, ST6GALNAC2_G61, ST6GALNAC3_T53, ST6GALNAC4_T49, ST6GALNAC5_G69, ST6GALNAC5_G73, and ST6GALNAC6_G75 with the substrate LSTa (1 mM). The reaction products were labeled and analyzed by LC-ESI-MS / MS. The LSTa substrate and reaction products were identified using a fluorescence detector. As shown in Figure 8 (right), ST6GALNAC6 exhibited the highest DSLNT synthesis activity. ST6GALNAC5 and ST6GALNAC4 also exhibited weak activity, but their DSLNT activity was less than 10% of that of ST6GALNAC6.

[0129] Test Example 5. Production of ST6GALNAC6 using Escherichia coli and DSLNT synthase assay <5-1. Construction of an ST6GALNAC6 expression plasmid for E. coli> Using pcDNA3.1-IHT-ST6GALNAC6_V81 constructed in 1-3 as a template, DNA was amplified by PCR using the ST6GALNAC6_V81-SmaI-infusion-F primer (ctctttcagggacccgtcaacctcaagaagtggagcatca: SEQ ID NO: 52) and the ST6GALNAC6-SmaI-infusion-R primer (cggatcctggtacccttaggtccaggaggggtgggagaag: SEQ ID NO: 53). The resulting fragment was inserted into the SmaI site of the pET15-SmaI plasmid (a plasmid in which an SmaI site was inserted into pET15, a plasmid for expressing His x 6-tagged proteins) to obtain pET15-ST6GALNAC6_V81.

[0130] 5-2. Expression, purification, and DSLNT synthesis activity of ST6GALNAC6 in E. coli The resulting pET15-ST6GALNAC6_V81 was transformed into E. coli Rosetta (DE3) to obtain colonies. After pre-cultivation at 37°C, the cells were cultured in 250 ml of TBK medium (1.2% Tryptone, 2.4% Yeast Extract, 72 mM KHPO, 17 mM KHPO, 0.4% Glycerol) and the absorbance (OD 600 After culturing until the pH reached 0.6, the cells were incubated at 16°C for 30 minutes, then 0.1 mM isopropyl β-D-thiogalactopyranoside (IPTG) was added and the cells were incubated at 16°C for 20 hours to express the ST6GALNAC6 protein. After incubation, the E. coli cells were harvested and suspended in 20 ml of solubilization buffer (PBS and protease inhibitors). The cells in the suspension were disrupted by sonication. The resulting supernatant was collected and passed through a column containing 200 μl of Ni-Sepharose. After washing with wash buffer (phosphate buffer, 20 mM imidazole, 500 mM NaCl), the ST6GALNAC6 protein was eluted with elution buffer (phosphate buffer, 250 mM imidazole, 500 mM NaCl). The protein solution was subjected to a gel filtration column for desalting, recovered in 100 mM MES (pH 6.25), and used for the enzyme assay. The DSLNT synthase assay using ST6GALNAC6 expressed in E. coli and the detection of the reaction product were performed according to the method in Test Example 2.

[0131] 5-3. Results Figure 9 shows the results of reacting E. coli-expressed ST6GALNAC6_V81 with the substrate LSTa (1 mM) for 20 hours, labeling the reaction product, and then performing LC-ESI-MS / MS analysis. The substrate LSTa and the reaction product were confirmed by a fluorescence detector (top panel of Figure 9) and mass spectrometry (middle panel of Figure 9). To confirm the substrate and reaction product, the m / z = 609.8 in the middle panel of Figure 9 was used. 2+ and m / z = 755.3 2+The results of MS / MS analysis of the parent MS of are shown below. From the fragment pattern, m / z = 609.8 2+ LSTa (lower left panel of Figure 9), m / z = 755.3 2+ This confirmed that ST6GALNAC6 expressed in E. coli also possesses activity.

Claims

1. A composition for producing oligosaccharides containing a Neu5Acα2-6GlcNAc structure, comprising a protein containing the catalytic domain of the ST6GALNAC6 protein or a cell containing a polynucleotide containing the coding sequence of said protein.

2. The composition of claim 1, wherein the protein does not contain a transmembrane domain.

3. The composition described in claim 1, wherein the ST6GALNAC6 protein is a protein consisting of the amino acid sequence A1 shown in any one of SEQ ID NOs: 1 to 25, or a protein consisting of the amino acid sequence A2 having 70% or more identity to the amino acid sequence A1.

4. The composition of claim 3, wherein the amino acid sequence A2 has an identity of 90% or more to the amino acid sequence A1.

5. The composition described in claim 1, wherein the catalytic domain is region a1 consisting of amino acids 90 to 310 in the amino acid sequence of wild-type human ST6GALNAC6 protein shown in SEQ ID NO: 1, or region a2 corresponding to region a1 in another ST6GALNAC6 protein amino acid sequence.

6. The composition described in claim 4, wherein the catalytic domain is region a1 consisting of amino acids 90 to 310 in the amino acid sequence of wild-type human ST6GALNAC6 protein shown in SEQ ID NO: 1, or region a2 corresponding to region a1 in another ST6GALNAC6 protein amino acid sequence.

7. The composition according to claim 1, comprising an amino acid sequence B1 shown in any one of SEQ ID NOs: 1 and 26 to 29, or an amino acid sequence B2 having 90% or more identity to said amino acid sequence B1.

8. The composition described in claim 1, wherein the oligosaccharide containing the Neu5Acα2-6GlcNAc structure is DSLNT and / or LSTb.

9. The composition according to any one of claims 1 to 8, for use in a reaction for converting an oligosaccharide containing GlcNAc but not a Neu5Acα2-6GlcNAc structure into an oligosaccharide containing a Neu5Acα2-6GlcNAc structure.

10. A method for producing an oligosaccharide containing a Neu5Acα2-6GlcNAc structure, which comprises contacting a protein containing the catalytic domain of the ST6GALNAC6 protein with an oligosaccharide containing GlcNAc but not a Neu5Acα2-6GlcNAc structure in the presence of an N-acetylneuraminic acid donor.

11. A protein comprising the catalytic domain of the ST6GALNAC6 protein and not comprising the transmembrane domain.

12. The protein according to claim 11, comprising an amino acid sequence C1 set forth in any one of SEQ ID NOs: 26 to 29, or an amino acid sequence C2 having 90% or more identity to said amino acid sequence C1.

13. A polynucleotide comprising a coding sequence for the protein of claim 11 or 12.

14. A cell comprising the polynucleotide of claim 13.

Images