Novel microorganism and use thereof
Novel Bacillus velezensis strains KNR42, #220-22, and NS15, or their mutants, when formulated into microbial preparations, address the low efficacy of conventional pesticides by offering enhanced plant disease control activity.
Patent Information
- Application Number
- PCT/JP2025/012685
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-02-05
- Filing Date
- 2025-03-28
- Publication Date
- 2025-10-02
AI Technical Summary
Conventional microbial pesticides have low efficacy in controlling plant diseases, necessitating the development of microbial pesticides with enhanced disease control activity.
The use of novel microorganisms, specifically Bacillus velezensis strains KNR42, #220-22, and NS15, or their mutants, which are cultured under specific conditions and formulated into microbial preparations for plant disease control.
These microorganisms exhibit excellent control activity against plant diseases, effectively reducing disease severity and providing broad-spectrum protection against various pathogens.
Smart Images

Figure JPOXMLDOC01-APPB-T000001 
Figure JPOXMLDOC01-APPB-T000002 
Figure JPOXMLDOC01-APPB-T000003
Abstract
Description
Novel microorganisms and their uses
[0001] The present invention relates to a novel microorganism and the use of said novel microorganism.
[0002] As one method for controlling plant diseases caused by pathogenic bacteria, the use of microbial pesticides using microorganisms or cultures of microorganisms, etc. For example, Patent Document 1 discloses the use of a composition containing a culture of a Bacillus strain as a plant disease control agent.
[0003] Japan Special Table Publication No. 2015-534457
[0004] Conventional microbial pesticides have a problem in that they have low efficacy in controlling plant diseases, and there is a demand for the development of microbial pesticides with excellent disease control efficacy.
[0005] The present invention has been made in view of the above problems, and an object of the present invention is to provide a microorganism or the like that exhibits excellent control activity against plant diseases.
[0006] The present inventors have conducted extensive research aimed at solving the above problems, and as a result have discovered a novel microorganism that exhibits excellent control activity against plant diseases, leading to the completion of the present invention.
[0007] A microorganism according to one aspect of the present invention relates to a microorganism belonging to Bacillus veresensis (accession number: NITE BP-03832), a microorganism belonging to Bacillus veresensis (accession number: NITE BP-04073), a microorganism belonging to Bacillus veresensis (accession number: NITE BP-04126), or a mutant thereof having a plant disease control effect.
[0008] According to one aspect of the present invention, a microorganism that exhibits excellent control activity against plant diseases can be provided.
[0009] Unless otherwise specified in this specification, the expression "A to B" representing a numerical range means "A or more (including and greater than A) and B or less (including and less than B)."
[0010] [Novel Microorganism] (KNR42) A microorganism according to one embodiment of the present invention is a microorganism belonging to the genus Bacillus velezensis (also referred to as B. velezensis) and having the accession number NITE BP-03832. Hereinafter, this microorganism may be referred to as KNR42 or the KNR42 strain.
[0011] KNR42 is a microorganism isolated by spontaneous mutation from a soil isolate as a parent strain, and was assigned to Bacillus berezensis based on sequence analysis of the 16S rDNA ribosomal RNA gene.
[0012] KNR42 was deposited at the National Patent Microorganism Depositary (NPMD) of the National Institute of Technology and Evaluation (hereinafter referred to as “NITE”), Room 122, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture (original deposit date: February 22, 2023, accession number: NITE BP-03832).
[0013] KNR42 may be cultured according to a general culture method used for Bacillus microorganisms, and the culture may be performed in a stationary culture using a liquid or solid medium, a batch culture using a liquid medium, or a fed-batch culture in which a carbon source, an organic nitrogen source, and / or inorganic salts are continuously added to the culture system.
[0014] Any carbon source that can be utilized by the above-mentioned strain can be used as a carbon source for the medium, including sugars such as glucose, galactose, lactose, sucrose, maltose, malt extract, blackstrap molasses, starch syrup, and starch hydrolysates, as well as various synthetic or natural carbon sources that can be utilized by KNR42.
[0015] Similarly, nitrogen sources for the medium include organic nitrogen-containing substances such as peptone, meat extract, yeast extract, soybean flour, and corn steep liquor, as well as various synthetic or natural substances that can be utilized by the strain.
[0016] Furthermore, inorganic salts such as salt and phosphates, salts of metals such as calcium, magnesium and iron, vitamins, amino acids and other trace nutrients can also be added as needed, according to common methods for microbial cultivation.
[0017] For example, the culture pH may be 5 to 9, the culture temperature may be 20° C. to 40° C., and the culture time may be 1 to 14 days.
[0018] As used herein, the term "ST medium" refers to a medium comprising, consisting essentially of, or consisting of 1-5 g / L starch, 1-5 g / L glucose, 5-20 g / L soybean peptone, 1-5 g / L yeast extract, and 0.5-2 g / L polypeptone.
[0019] As used herein, the term "SS medium" refers to a medium comprising, consisting essentially of, or consisting of 10-60 g / L starch, 3-15 g / L glucose, 3-15 g / L dry yeast powder, and 1-6 g / L corn steep liquor.
[0020] As used herein, the term "CP-YD medium" refers to a medium comprising, consisting essentially of, or consisting of 5-20 g / L glucose, 2-10 g / L potato peptone, and 2-10 g / L yeast extract.
[0021] As used herein, the term "PD medium" refers to a medium comprising, consisting essentially of, or consisting of 1-4 g / L potato infusion powder and 5-20 g / L glucose.
[0022] As used herein, the term "PDA medium" refers to a medium comprising, consisting essentially of, or consisting of 1-4 g / L potato infusion powder, 5-20 g / L glucose, and 5-20 g / L agar.
[0023] As used herein, the term "MH medium" refers to a medium comprising, consisting essentially of, or consisting of 0.5 to 2 g / L meat infusion powder, 5 to 17.5 g / L casein hydrolysate, and 0.3 to 1.5 g / L starch.
[0024] As used herein, the term "YPD medium" refers to a medium comprising, consisting essentially of, or consisting of 3-15 g / L glucose, 0.5-2 g / L animal-derived peptone, and 2-10 g / L yeast extract.
[0025] As used herein, the term "LB medium" refers to a medium comprising, consisting essentially of, or consisting of 3-30 g / L sodium chloride, 3-30 g / L tryptone, and 1-15 g / L yeast extract.
[0026] As used herein, the term "LBA medium" refers to a medium comprising, consisting essentially of, or consisting of 3-30 g / L sodium chloride, 3-30 g / L tryptone, 1-15 g / L yeast extract, and 5-20 g / L agar.
[0027] (#220-22) A microorganism according to one embodiment of the present invention belongs to the genus Bacillus berezensis and has accession number NITE BP-04073. Hereinafter, this microorganism may be referred to as #220-22 or strain #220-22.
[0028] #220-22 is a microorganism isolated by spontaneous mutation from a soil isolate as a parent strain, and was assigned to Bacillus berezensis based on sequence analysis of the 16S rDNA ribosomal RNA gene.
[0029] #220-22 was deposited at the National Institute of Technology and Evaluation (hereinafter abbreviated as “NITE”) Patent Microorganism Depositary (NPMD), Room 122, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture (original deposit date: February 2, 2024, accession number: NITE BP-04073).
[0030] The culture method, medium, and culture conditions (eg, culture pH, culture temperature, culture time) of #220-22 are the same as those of KNR42.
[0031] (NS15) A microorganism according to one embodiment of the present invention is a microorganism belonging to the genus Bacillus berezensis and having accession number NITE BP-04126. Hereinafter, this microorganism may be referred to as NS15 or the NS15 strain.
[0032] NS15 is a microorganism isolated by spontaneous mutation from a soil isolate as a parent strain, and was assigned to Bacillus berezensis based on sequence analysis of the 16S rDNA ribosomal RNA gene.
[0033] NS15 was deposited at the National Patent Microorganism Depositary (NPMD) of the National Institute of Technology and Evaluation (hereinafter abbreviated as "NITE"), Room 122, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture (original deposit date: June 6, 2024, accession number: NITE BP-04126).
[0034] The culture method, medium, and culture conditions (eg, culture pH, culture temperature, culture time) of NS15 are the same as those of KNR42.
[0035] (Mutants of KNR42 strain, #220-22 strain, or NS15 strain) Mutants of the KNR42 strain, #220-22 strain, or NS15 strain are also included in one embodiment of the present invention.
[0036] As used herein, the term "mutant" includes any mutant derived from the KNR42 strain, the #220-22 strain, or the NS15 strain, as long as the strain has the mycological properties of the KNR42 strain, the #220-22 strain, or the NS15 strain shown in the Examples below and has a plant disease control effect.
[0037] Examples of the above-mentioned mycological properties include biochemical properties (for example, enzyme activity, carbohydrate metabolism) and the like.
[0038] The enzymatic activity of the mutant of the KNR42 strain is, for example, identical to at least 1, 2, 3, 4, 5, 10, 15, or 20 of the enzymatic activities of the KNR42 strain shown in Table 6. Furthermore, the carbohydrate metabolism of the mutant of the KNR42 strain is, for example, identical to at least 1, 2, 3, 4, 5, 10, 20, 30, 40, or 49 of the carbohydrate metabolism of the KNR42 strain shown in Table 9.
[0039] The enzyme activity of the mutant strain #220-22 is, for example, identical to at least 1, 2, 3, 4, 5, 10, 15, or 20 of the enzyme activities of the #220-22 strain shown in Table 7. Furthermore, the carbohydrate metabolism of the mutant strain #220-22 is, for example, identical to at least 1, 2, 3, 4, 5, 10, 20, 30, 40, or 49 of the carbohydrate metabolism of the #220-22 strain shown in Table 10.
[0040] The enzymatic activity of the NS15 strain mutant is, for example, identical to at least 1, 2, 3, 4, 5, 10, 15, or 20 of the enzymatic activities of the NS15 strain shown in Table 8. Furthermore, the carbohydrate metabolism of the NS15 strain mutant is, for example, identical to at least 1, 2, 3, 4, 5, 10, 20, 30, 40, or 49 of the carbohydrate metabolism of the NS15 strain shown in Table 11.
[0041] Mutants of the KNR42, #220-22, or NS15 strain can be obtained by artificially inducing mutations in the KNR42, #220-22, or NS15 strain using ultraviolet irradiation, X-ray irradiation, a mutagen (e.g., N-methyl-N-nitro-N-nitrosoguanidine), or the like, and then selecting strains that have a plant disease control effect. Furthermore, mutants of the KNR42, #220-22, or NS15 strain also include natural mutants of the KNR42, #220-22, or NS15 strain, so long as they have a plant disease control effect.
[0042] As used herein, "a fungal strain effective in controlling plant diseases" refers to a fungal strain effective in preventing or curing plant diseases. Here, "a fungal strain effective in preventing plant diseases" refers to a fungal strain that, when sprayed with a pathogen of a plant disease under the same favorable conditions except for the application of the fungal strain, develops a lower level of disease after a certain period of time than the level of disease in plants to which the fungal strain is not applied. Furthermore, "a fungal strain effective in curing plant diseases" refers to a fungal strain that, when plants infected with the plant disease are cultivated for a certain period of time under the same favorable conditions except for the application of the fungal strain, develops a lower level of disease in plants to which the fungal strain is applied than in plants to which the fungal strain is not applied.
[0043] Whether a strain has a plant disease control effect can be confirmed by comparing the lesions in the treated plot with those in the untreated plot. If the lesions in the treated plot are reduced compared to those in the untreated plot, the strain is evaluated as having a plant disease control effect. For example, this can be confirmed using a method such as that described in the Examples below. Specifically, if the control titer calculated by the following formula (1) is 10 or more, the strain is evaluated as having a plant disease control effect. Control titer = [1 - (area or diameter of lesions in the treated plot / area or diameter of lesions in the untreated plot)] x 100 (1) In formula (1), "treated lesions" are lesions formed in a treated plot (e.g., leaves) treated with the strain. "Untreated lesions" are lesions formed in a treated plot not treated with the strain.
[0044] In the following description of the specification, the term "KNR42 strain, #220-22 strain, or NS15 strain" may be used to mean "KNR42 strain, #220-22 strain, or NS15 strain, or a mutant thereof."
[0045] [Culture-Derived Product of KNR42 Strain, #220-22 Strain, or NS15 Strain] A culture-derived product according to one embodiment of the present invention is a culture-derived product of the KNR42 strain, the #220-22 strain, or the NS15 strain. A culture-derived product according to one embodiment of the present invention is a culture, cultured bacterial cells, a culture supernatant, or an extract. The culture-derived product may also be a mixture of two or more of the culture, cultured bacterial cells, a culture supernatant, and an extract. The culture-derived product may also be a processed product, such as a disrupted product, concentrate, purified product, or dilution of a mixture of one or more of the culture, cultured bacterial cells, a culture supernatant, or an extract.
[0046] As used herein, the term "culture" refers to a liquid culture containing cells of the KNR42 strain, #220-22 strain, or NS15 strain and a medium, cultured under any conditions according to a general culture method.
[0047] As used herein, the term "cultured bacterial cells" refers to bacterial cells obtained by separating them from the culture by centrifugation, membrane separation, or the like.
[0048] As used herein, the term "culture supernatant" refers to a substance obtained by removing bacterial cells from the culture by centrifugation, membrane separation, or the like.
[0049] In this specification, the term "extract" refers to a substance obtained by adding a solvent (water, surfactant, buffer solution, etc.) to the cultured bacterial cells, stirring the mixture, and removing the residue by centrifugation, filtration, or the like.
[0050] The KNR42 strain, #220-22 strain, or NS15 strain contained in the culture-derived product according to one embodiment of the present invention may be a live bacterial cell or a killed bacterial cell.
[0051] [Microbial Preparation] A microbial preparation according to one embodiment of the present invention contains a culture-derived product of the KNR42 strain, the #220-22 strain, or the NS15 strain as an active ingredient. The microbial preparation can be used against various diseases caused by pathogenic bacteria. The microbial preparation can be used as a plant disease control agent, a fungicide such as an agricultural or horticultural fungicide, a plant growth regulator, a seed germination regulator, a soil conditioner, an agricultural chemical, or the like.
[0052] Furthermore, the microbial preparation according to one embodiment of the present invention can also be used as a medical antibacterial agent and an antibacterial agent for animals, which are used as antifungal agents or agents for controlling internal parasites; an antibacterial agent and an antifungal agent for wood, paper or pulp, adhesives or paints, fibers, leather, etc.; an industrial disinfectant for cooling water channels in manufacturing plants, etc.; a food preservative; feed for disease control in animals such as livestock; and the like.
[0053] The microbial preparation according to one embodiment of the present invention can also be used as an agent for controlling internal parasites in livestock, poultry, pets, etc., or as an antifungal agent.
[0054] As used herein, the term "plant" includes whole individuals (for example, adults, seedlings, bulbs, seed potatoes, and seeds), and tissues (for example, leaves, stems, flowers, roots, and parts thereof).
[0055] As used herein, the term "pathogenic microorganism" refers to a microorganism (bacteria, fungi, etc.) that causes plant diseases, and specific examples include, but are not limited to, the following microorganisms: Taphrina spp. (e.g., Taphrina deformans, T. pruni, etc.), Pneumocystis spp., Geotrichum spp., Candida spp. (e.g., Candida albicans, C. sorbosa, etc.), Pichia spp. (e.g., Pichia kluyveri, etc.), Capnodium spp., Fumago spp., Hypocapnodium spp., Cercospora spp. (e.g. Cercospora apii, C. asparagi, C. beticola, C. capsici, C. carotae, C. kaki, C. kikuchii, C. zonata, etc.), Cercosporidium spp., Cladosporium spp. (e.g. Cladosporium colocasiae, C. cucumerinum, C. variabile etc.), Davidiella spp., Didymosporium spp., Heterosporium spp. (e.g., Heterosporium allii, etc.), Mycosphaerella spp. (e.g., Mycosphaerella arachidis, M. berkeleyi, M. cerasella, M. fijiensis, M. fragariae, M. graminicola, M. nawae, M. pinodes, M. pomi, M. zingiberis, etc.), Mycovellosiella spp. (e.g., Mycovellosiella fulva, M. nattrassii, etc.), Paracercospora spp. (e.g., Paracercospora egenula, etc.), Phaeoisariopsis spp., Phaeoramularia spp., Pseudocercospora spp. (e.g., Pseudocercospora abelmoschi, P. fuligena, P. vitis, etc.), Pseudocercosporella spp.(e.g., Pseudocercosporella capsellae, etc.), Ramichloridium spp., Ramularia spp., Septogloeum spp., Septoria spp. (e.g., Septoria albopunctata, S. apiicola, S. chrysanthemella, S. helianthi, S. obesa, etc.), Sphaerulina spp., Aureobasidium spp., Kabatiella spp., Plowrightia spp., Stigmina spp., Elsinoe spp. (e.g., Elsinoe ampelina, E. araliae, E. fawcettii, etc.), Sphaceloma spp. (e.g., Sphaceloma caricae, etc.), Ascochyta spp. (e.g., Ascochyta pisi, etc.), Corynespora spp. (e.g., Corynespora cassiicola, etc.), Leptosphaeria spp. (e.g., Leptosphaeria coniothyrium, L. maculans, etc.), Saccharicola spp., Phaeosphaeria spp. (e.g., Phaeosphaeria nodorum, etc.), Ophiosphaerella spp., Setophoma spp., Helminthosporium spp., Alternaria spp. (e.g., Alternaria alternata, A. brassicae, A. brassicicola, A. citri, A. dauci, A. helianthi, A. japonica, A. kikuchiana, A. mali, A. panax, A. porri, A. radicina, A. solani, etc.), Bipolaris spp. (e.g., Bipolaris sorghicola, etc.), Cochliobolus spp. (e.g., Cochliobolus heterostrophus, C. lunatus, C. miyabeanus, etc.), Curvularia spp. (e.g., Curvularia geniculata, C.verruculosa spp., Drechslera spp., Pleospora spp., Pleospora herbarum spp., Pyrenophora spp. teres (Setosphaeria spp.) Setosphaeria turcica (Setosphaeria turcica) Stemphylium spp. lycopersici、S. solani、S. vesicarium spp., Venturia spp., Venturia carpophila, V. vesicarium spp. Inaequalis、V. nashicola、V. pyrin activity) and Didymella spp. fabae, Hendersonia spp., Phoma spp., Phoma erratica var. mikan、P. exigua var. exigua、P. wasabiae active) Pyrenochaeta spp spp. Botryosphaeria berengeriana f. sp. piricola、B. dothidea activity) Dothiorella spp. Fusicoccum spp. Guignardia spp. Lasiodiplodia spp spp. Phyllosticta spp.(also) Phyllosticta zingiberis spp.(also) Schizothyrium pomi spp.Acrospermum spp.Leptosphaerulina spp.Aspergillus spp., Penicillium spp.(from Penicillium digitatum, P. italicum、P. sclerotigenum spp., Trichophyton spp., Trichophyton mentagrophytes. rubrum spp., Histoplasma spp., Blumeria spp., Blumeria graminis f. sp. hordei、B. gf sp. tritici), Erysiphe spp. cichoracearum、E. c. var. cichoracearum、E. heraclei、E. low activity) Golovinomyces spp. latisporus spp., Leveillula spp., Leveillula taurica spp., Microsphaera spp., Oidium spp., Oidium neolycopersici spp., Phyllactinia spp.(Phyllactinia kakicola)P. mali、P. moricola, Podosphaera spp., Podosphaera fusca, P. leucotricha、P. pannosa、P. tridactyla var. tridactyla、P. xanthii activity) and Sphaerotheca spp. aphanis、S. fuliginea agent) and Uncinula spp. n. var. necator agent) (Uncinuliella spp.) Uncinuliella simulans var. simulans、U.S. s. var. tandae spp., Blumeriella jaapii spp., Cylindrosporium spp., Diplocarpon spp. mespili、D.rosae spp., Gloeosporium spp., Gloeosporium minus spp., Marssonina spp., Tapesia spp. yallundae, Lachnum spp., Scleromitrula spp., Botryotinia spp. byssoidea、B. cinerea、B. elliptic、B. fabae、B. squamosa agent) Ciborinia spp. Grovesinia spp. Monilia mumecola Monilinia spp. fructigena、M. laxa、M. mali、M. vaccinii-corymbosiactivity), Sclerotinia spp. homoeocarp、S. minor、S. sclerotiorum spp., Valdensia heterodoxa spp., Claviceps spp. sorghicola agent) Epichloe spp. Ephelis japonica Villosiclava virens Hypomyces spp. sp. mori、H. sf sp. low activity) Trichoderma spp.(also) Trichoderma viride activity) Calonectria spp.(an activity) Candelospora spp spp., Cylindrocladium spp., Fusarium spp. crookwellense、F. culmorum、F. cuneirostrum、F. oxysporum、F. of sp.adzukicola, F. of sp. allii, F. of sp. asparagi, F. of sp. batatas, F. o. f. sp. cepae, F. of sp. colocasiae, F. of sp. conglutinans, F. of sp. cubense, F. of sp. cucumerinum, F. of sp. fabae, F. of sp. fragariae, F. of sp. lactucae, F. of sp. lagenariae, F. of sp. lycopersici, F. of sp. melongenae, F. of sp. melonis, F. of sp. nelumbinicola, F. of sp. niveum, F. of sp. radicis-lycopersici, F. of sp. raphani, F. of sp. spinaciae, F. sporotrichioides, F. solani, F. sf sp. cucurbitae, F. sf sp. eumartii, F. sf sp. glycines, F. sf sp. pisi, F. sf sp. Radicicola, F. virguliforme, etc.), Gibberella spp. (e.g., Gibberella avenacea, G. baccata, G. fujikuroi, G. zeae, etc.), Haematonectria spp., Nectria spp., Ophionectria spp., Caldariomyces spp., Myrothecium spp., Trichothecium spp., Verticillium spp. (e.g., Verticillium albo-atrum, V. dahliae, V. longisporum, etc.), Ceratocystis spp. (e.g., Ceratocystis ficicola, C. fimbriata, etc.), Thielaviopsis spp.(including Thielaviopsis basicola) and Adisciso spp. Monochaetia spp. (including Pestalotia eriobotrifolia spp.) in Pestalotiopsis spp.(Pestalotiopsis funerea) P. longiseta、P. neglecta、P. theae, Physalospora spp., Nemania spp., Nodulisporium spp., Rosellinia spp nivalis spp., Ophiostoma spp., Cryphonectria spp., Cryphonectria parasitica spp., Diaporthe spp. kyushuensis、D. nomurai、D. tanakae, Diaporthopsis spp., Phomopsis spp. fukushii、P. obscurans、P. vexans , Cryptosporella spp , Discula spp , Discula theae-sinensis , Gnomonia spp , Coniella spp , Coryneum spp , Greeneria spp , Melanconis spp., Cytospora spp., Leucostoma spp., Valsa spp.(also, Valsa ceratosperma activity) Tubakia spp., Monosporascus spp., Clasterosporium spp., Gaeumannomyces spp.(such as Gaeumannomyces graminis) Magnaporthe spp.(such as Magnaporthe grisea) Pyricularia spp.(such as Pyricularia zingiberis (Monilochaetes infuscans), Colletotrichum spp.(e.g., Colletotrichum acutatum, C. capsici, C. cereale, C. destructivum, C. fragariae, C. lindemuthianum, C. nigrum, C. orbiculare, C. spinaciae, etc.), Glomerella spp. (e.g., Glomerella cingulata, etc.), Khuskia oryzae, Phyllachora spp. (e.g., Phyllachora pomigena, etc.), Ellisembia spp., Briosia spp., Cephalosporium spp. (e.g., Cephalosporium gramineum, etc.), Epicoccum spp., Gloeocercospora sorghi, Mycocentrospora spp., Peltaster spp. (e.g., Peltaster fructicola, etc.), Phaeocytostroma spp., Phialophora Ascomycota fungi such as Phialophora gregata, Pseudophloeosporella dioscoreae, Pseudoseptoria spp., Rhynchosporium spp. (e.g., Rhynchosporium secalis), Sarocladium spp., Coleophoma spp., and Helicoceras oryzae. Septobasidium spp. (e.g., Septobasidium bogoriense, S. tanakae, etc.), Helicobasidium spp. (e.g., Helicobasidium longisporum, etc.), Coleosporium spp. (e.g., Coleosporium plectranthi, etc.), Cronartium spp., Phakopsora spp. (e.g., Phakopsora artemisiae, P. nishidana, P. pachyrhizi, etc.), Physopella spp. (e.g., Physopella ampelopsidis, etc.), Kuehneola spp.(including Kuehneola japonica species), Phragmidium spp.(including Phragmidium fusiforme), P. mucronatum、P. rosae-multiflorae agent) Gymnosporangium spp. yamadae) and Puccinia spp. brachypodii var. poae-nemoralis、P. crown、P. c. var. crown、P. cynodontis、P. graminis、P. g. subsp. graminicola、P. hordei、P. horiana、P. kuehnii、P. melanocephala、P. recondite、P. striiformis var. striiformis、P. tanaceti var. tanaceti、P. tokyensis、P. zoysiae, Uromyces spp., Uromyces phaseoli var. azukicola、U. p. var. phaseoli、Uromyces viciae-fabae var. viciae-fabae, Naohidemyces vaccinii, Nyssopsora spp., Leucotelium spp., Tranzschelia spp spp.(including Blastospora smilacis) Uredo spp. Sphacelotheca spp. Urocystis spp. Sporisorium spp spp.(Ustilago maydis,U. nuda, Entyloma spp., Exobasidium spp. vexans agent), Microstroma spp., Tilletia spp.controversa, T. laevis, etc.), Itersonilia spp. (e.g., Itersonilia perplexans, etc.), Cryptococcus spp., Bovista spp. (e.g., Bovista dermoxantha, etc.), Lycoperdon spp. (e.g., Lycoperdon curtisii, L. perlatum, etc.), Conocybe spp. (e.g., Conocybe apala, etc.), Marasmius spp. (e.g., Marasmius oreades, etc.), Armillaria spp., Helotium spp., Lepista spp. (e.g., Lepista subnuda, etc.), Sclerotium spp. (e.g., Sclerotium cepivorum, etc.), Typhula spp. (e.g., Typhula incarnata, T. ishikariensis var. ishikariensis, etc.), Athelia spp. (e.g., Athelia Fungi of the phylum Basidiomycota such as Ceratobasidium spp. (e.g., Ceratobasidium cornigerum, etc.), Ceratorhiza spp., Rhizoctonia spp. (e.g., Rhizoctonia solani, etc.), Thanatephorus spp. (e.g., Thanatephorus cucumeris, etc.), Laetisaria spp., Waitea spp., Fomitiporia spp., Ganoderma spp., Chondrostereum purpureum, and Phanerochaete spp.; fungi of the phylum Chitridiomycota such as Olpidium spp.; and fungi of the phylum Blastocladiomycota such as Physoderma spp. Choanephora spp., Choanephoroidea cucurbitae, Mucor spp. (e.g., Mucor fragilis, etc.), Rhizopus spp. (e.g., Rhizopus arrhizus, R. chinensis, R. oryzae, R.Fungi of the subphylum Mucoromycotina such as stolonifer var. stolonifer, etc. Protists of the phylum Cercozoa such as Plasmodiophora spp. (e.g., Plasmodiophora brassicae, etc.), Spongospora subterranea f. sp. Subterranea, etc. Aphanomyces spp. (e.g., Aphanomyces cochlioides, A. raphani, etc.), Albugo spp. (e.g., Albugo macrospora, A. wasabiae, etc.), Bremia spp. (e.g., Bremia lactucae, etc.), Hyaloperonospora spp., Peronosclerospora spp., Peronospora spp. (e.g., Peronospora alliariae - wasabi, P. chrysanthemi - coronarii, P. destructor, P. farinosa f. sp. spinaciae, P. manshurica, P. parasitica, P. sparsa, etc.), Plasmopara spp. (e.g., Plasmopara halstedii, P. nivea, P. viticola, etc.), Pseudoperonospora spp. (e.g., Pseudoperonospora cubensis, etc.), Sclerophthora spp., Phytophthora spp. (e.g., Phytophthora cactorum, P. capsici, P. citricola, P. citrophthora, P. cryptogea, P. fragariae, P. infestans, P. melonis, P. nicotianae, P. palmivora, P. porri, P. sojae, P. syringae, P. vignae f. sp. adzukicola, etc.), Pythium spp. (e.g., Pythium afertile, P. aphanidermatum, P. apleroticum, P. aristosporum, P. arrhenomanes, P. buismaniae, P.debaryanum, P. graminicola, P. horinouchiense, P. irregulare, P. iwayamai, P. myriotylum, P. okanoganense, P. paddicum, P. paroecandrum, P. periplocum, P. spinosum, P. sulcatum, P. sylvaticum, P. ultimum var. ultimum, P. vanterpoolii, P. Oomycetes of the phylum Heterokontophyta, such as P. vexans, P. volutum, etc. Gram-positive bacteria of the Actinobacteria phylum, such as Clavibacter spp. (e.g., Clavibacter michiganensis subsp. michiganensis), Curtobacterium spp., Leifsonia spp. (e.g., Leifsonia xyli subsp. xyli), and Streptomyces spp. (e.g., Streptomyces ipomoeae). Gram-positive bacteria of the Firmicutes phylum, such as Clostridium sp. Gram-positive bacteria of the Tenericutes phylum, such as Phytoplasma. Rhizobium spp. (e.g., Rhizobium radiobacter, etc.), Acetobacter spp., Burkholderia spp. (e.g., Burkholderia andropogonis, B. cepacia, B. gladioli, B. glumae, B. plantarii, etc.), Acidovorax spp. (e.g., Acidovorax avenae subsp. avenae, A. a. subsp. citrulli, A. konjaci, etc.), Herbaspirillum spp., Ralstonia spp. (e.g., Ralstonia solanacearum, etc.), Xanthomonas spp. (e.g., Xanthomonas albilineans, X. arboricola pv. pruni, X. axonopodis pv. vitians, X.campestris e.g. campestris、X. c. e.g. cucurbitae、X. c. e.g. glycines、X. c. e.g. mangiferaeindicae、X. c. e.g. nigromaculans、X. c. e.g. vesicatory、X. citri subsp. citri、X. oryzae e.g. oryzae) and Pseudomonas spp. fluorescence、P. marginalis、P. m. e.g. marginalis、P. savastanoi e.g. glycinea、P. syringae、P. s. e.g. actinidiae、P. s. e.g. eriobotryae、P. s. e.g. helianthi、P. s. e.g. lachrymans、P. s. e.g. maculicola、P. s. e.g. mori、P. s. e.g. morsprunorum, P. s. e.g. spinaciae、P. s. e.g. syringae、P. s. e.g. theae、P. viridiflava spp., Rhizobacter spp., Brenneria spp., Brenneria nigrifluens spp., Dickeya spp. zeae, Erwinia spp., Erwinia amylovora, E. rhapontici agent), Pantoea spp., Pectobacterium spp. carotovorum, P. carotovorum. Proteobacteria (Proteobacteria).
[0056] Specific examples of plant diseases caused by infection and proliferation of these pathogenic fungi include, but are not limited to, the following plant diseases: Peach leaf curl (Taphrina deformans), plum pockets (Taphrina pruni), asparagus leaf spot (Cercospora asparagi), sugar beet leaf spot (Cercospora beticola), bell pepper leaf spot (Cercospora capsici), persimmon angular leaf spot (Cercospora kaki), soybean purple stain (Cercospora kikuchii), peanut brown leaf spot (Mycosphaerella arachidis), cherry brown hole (Cylindrosporium cerasella, Blumeriella jaapii), black sigatoka disease (Mycosphaerella fijiensis), yellow sigatoka disease (Mycosphaerella musicola), Wheat Speckled Leaf Blotch (Mycosphaerella graminicola), Persimmon Circular Leaf Spot (Mycosphaerella nawae), Pea Blight (Mycosphaerella pinodes), Zingiberis Leaf Spot (Mycosphaerella zingiberis), Tomato Leaf Mold (Mycovellosiella fulva), Eggplant Leaf Mold (Mycovellosiella nattrassii), Tomato Leaf Mold (Cercospora fuligena), Grapevine Isariopsis Leaf Spot (Pseudocercospora vitis), Chinese Cabbage Leaf SpotSpot (Pseudocercosporella capsellae), Chrysanthemum Leaf Spot (Septoria chrysanthemella), Chrysanthemum Leaf Blight (Septoria obesa), Grapevine Anthracnose (Elsinoe ampelina), Araliae Scab (Elsinoe araliae), Citrus Scab (Elsinoe fawcettii), Pea Leaf Spot (Ascochyta pisi), Cucumber Corynespora Leaf Spot (Corynespora cassiicola), Rose Stem Canker (Leptosphaeria coniothyrium), Wheat Glume Blotch (Leptosphaeria nodorum), Rose Leaf Spot (Alternaria alternata), Cabbage Leaf Spot (Alternaria brassicae), Carrot Leaf Blight (Alternaria dauci), Black spot of pear (Alternaria kikuchiana), Alternaria blotch of apple (Alternaria mali), Alternaria leaf spot of leek (Alternaria porri), Target spot of sorghum (Bipolaris sorghicola), Southern leaf blight of corn (Cochliobolus heterostrophus), Brown spot of rice (Cochliobolus miyabeanus), Tip blight of garlic (Pleospora herbarum), Stripe leaf blight of barley (Pyrenophora graminea), Net blotch of barley (Pyrenophora teres), Leaf blight of sorghum (Setosphaeria turcica), Northern leaf blotch of corn (Setosphaeriaturcica), asparagus leaf spot (Stemphylium botryosum), Scab (Venturia carpophila) in the Rosaceae subfamily Prunus, Apple scab (Venturia inaequalis), Pear scab (Venturia nashicola), Gummy stem blight (Didymella bryoniae) in the Cucurbitaceae family, Burdock leaf spot (Phoma exigua var. exigua), Streak (Phoma wasabiae) in the Wasabi family, Ring rot (Botryosphaeria berengeriana f. sp. piricola) in the Rosaceae subfamily Prunus, Kiwifruit soft rot (Botryosphaeria dothidea, Lasiodiplodia theobromae, Diaporthe sp.), Citrus common green mold (Penicillium digitatum), Blue mold Powdery mildew on various crops (Penicillium italicum), powdery mildew on barley (Blumeria graminis f. sp. hordei), powdery mildew on wheat (Blumeria graminis f. sp. tritici), powdery mildew on cucumber (Erysiphe betae, Leveillula taurica, Oidium sp., Podosphaera xanthii), powdery mildew on eggplant (Erysiphe cichoracearum, Leveillula taurica, Sphaerotheca fuliginea), powdery mildew on carrots and parsley (Erysiphe heraclei), powdery mildew on peas (Erysiphe pisi), powdery mildew on tomato (Leveillula taurica, Oidium neolycopersici, Oidium sp.), powdery mildew on bell peppers (Leveillula taurica), Pumpkin powdery mildew (Oidium sp., Podosphaera xanthii), Bitter gourd powdery mildew (Oidiumsp.), persimmon powdery mildew (Phyllactinia kakicola), burdock powdery mildew (Podosphaera fusca), apple powdery mildew (Podosphaera leucotricha), rose powdery mildew (Podosphaera pannosa, Uncinuliella simulans var. simulans, U. s. var. tandae), zucchini and melon powdery mildew (Podosphaera xanthii), strawberry powdery mildew (Sphaerotheca aphanis var. aphanis), watermelon and melon powdery mildew (Sphaerotheca fuliginea), grape powdery mildew (Uncinula necator, U. n. var. necator), apple blotch (Diplocarpon mali), rose black spot (Diplocarpon rosae), onion gray mold neck rot (Botrytis allii), Gray mold, Botrytis blight (Botrytis cinerea), Leaf blight of Chinese chives (Botrytis cinerea, B. byssoidea, B. squamosa), Chocolate spot of broad beans (Botrytis cinerea, B. elliptica, B. fabae), Brown rot of Rosaceae (Monilinia fructicola, M. fructigena, M. laxa), Blossom blight of apples (Monilinia mali), Dollar spot of shiitake mushrooms (Sclerotinia homoeocarpa), Cottony rot, Sclerotinia rot, Stem rot (Sclerotinia sclerotiorum), False smut of rice (Villosiclava virens), Root necrosis of soybeans (Calonectria ilicicola), Fusarium blight (Fusarium crookwellense, F. culmorum,Gibberella avenacea, G. zeae, Monographella nivalis), Fusarium blight of barley (Fusarium culmorum, Gibberella avenacea, G. zeae), Dry rot of taro (Fusarium oxysporum, F. solani f. sp. radicicola), Brown rot of yam (Fusarium oxysporum, F. solani f. sp. pisi, F. s. f. sp. radicicola), Fusarium wilt of adzuki bean (Fusarium oxysporum f. sp. adzukicola), Fusarium basal rot of Chinese chive (Fusarium oxysporum f. sp. allii, F. solani f. sp. radicicola), Stem rot of sweet potato (Fusarium oxysporum f. sp. batatas, F. solani), Dry rot of taro (Fusarium oxysporum f. sp. colocasiae), Yellows of cabbage and Komatsuna (Fusarium oxysporum f. sp. conglutinans), Panama disease of banana (Fusarium oxysporum f. sp. cubense), Fusarium wilt of strawberry (Fusarium oxysporum f. sp. fragariae), Root rot of lettuce (Fusarium oxysporum f. sp. lactucae), Fusarium wilt of watermelon (Fusarium oxysporum f. sp. lagenariae, F. o. f. sp. niveum), Fusarium wilt of tomato (Fusarium oxysporum f. sp. lycopersici), Fusarium wilt of melon (Fusarium oxysporum f. sp. melonis), Yellows of radish (Fusarium oxysporum f.sp. raphani), spinach wilt (Fusarium oxysporum f. sp. spinaciae), soybean sudden death syndrome (Fusarium solani f. sp. Glycines, Fusarium virguliforme), rice "Bakanae" disease (Gibberella fujikuroi), radish Verticillium black spot (Verticillium albo-atrum, V. dahliae), tomato, eggplant, and butterbur Verticillium wilt (Verticillium dahliae), fig root blight (Ceratocystis ficicola), sweet potato black rot (Ceratocystis fimbriata), tea gray blight (Pestalotiopsis longiseta, P. theae), Chestnut canker (Cryphonectria parasitica), Citrus black spot (Diaporthe citri), Asparagus stem blight (Phomopsis asparagi), Pear canker (Phomopsis fukushii), Eggplant brown spot (Phomopsis vexans), Tea anthracnose (Discula theae-sinensis), Apple canker (Valsa ceratosperma), Rice blast (Magnaporthe grisea), Strawberry crown rot (Colletotrichum acutatum, C. fragariae, Glomerella cingulata), Apple bitter rot (Colletotrichum acutatum, Glomerella cingulata), Anthracnose (Colletotrichum acutatum, Glomerella)cingulata), plum anthracnose (Anthracnose, Colletotrichum acutatum), grape ripening rot (Colletotrichum acutatum, Glomerella cingulata), garland chrysanthemum anthracnose (Anthracnose, Colletotrichum acutatum), kidney bean anthracnose (Anthracnose, Colletotrichum lindemuthianum), cucurbit anthracnose (Anthracnose, Colletotrichum orbiculare), yam anthracnose (Anthracnose, Glomerella cingulata), chestnut anthracnose (Anthracnose, Glomerella cingulata), persimmon anthracnose (Anthracnose, Glomerella cingulata), adzuki bean brown stem rot (Phialophora gregata), Chinese yam leaf spot (Pseudophloeosporella dioscoreae), barley scald (Rhynchosporium secalis), wheat brown rust (Puccinia recondita), wheat stripe rust (Puccinia striiformis), rust that occurs on various crops, fig rust (Phakopsora nishidana), soybean rust (Phakopsora pachyrhizi), rose rust (Kuehneola japonica, Phragmidium fusiforme, P. mucronatum, P. rosae-multiflorae), pear red rust (Gymnosporangium asiaticum), apple red rust (Gymnosporangium yamadae), lecithin rust (Puccinia allii), chrysanthemum white rust (Puccinia horiana), chrysanthemum black rust (Puccinia tanaceti var. tanaceti), broad bean rust (Uromyces viciae-fabae var. viciae-fabae), sugarcane smut (Sporisoriumscitamineum), Corn smut (Ustilago maydis), Barley loose smut (Ustilago nuda), Tea net blister blight (Exobasidium reticulatum), Tea blister blight (Exobasidium vexans), Stem rot, Southern blight (Athelia rolfsii), Chrysanthemum root and stem rot (Ceratobasidium cornigerum, Rhizoctonia solani), Ginger sheath blight (Rhizoctonia solani), Cabbage seedling damping-off (Rhizoctonia solani), Mitsuba damping-off (Rhizoctonia solani), Lettuce bottom rot (Rhizoctonia solani), Turfgrass brown patch, large patch (Rhizoctonia solani), Rice sheath blight Beet blight (Thanatephorus cucumeris), sugar beet root rot (Thanatephorus cucumeris), sugar beet leaf blight (Thanatephorus cucumeris), fig black mold (Rhizopus stolonifer var. stolonifer), cruciferous vegetables clubroot (Plasmodiophora brassicae), sugar beet black root rot (Aphanomyces cochlioides), cruciferous vegetables white rust (Albugo macrospora), downy mildew that occurs on various crops, lettuce downy mildew (Bremia lactucae), garland chrysanthemum downy mildew (Peronospora chrysanthemi-coronarii), onion and leek downy mildew (Peronospora destructor), spinach downy mildew (Peronospora farinosa f. sp. spinaciae), soybean downy mildew (Peronosporamanshurica), Crucifer downy mildew (Peronospora parasitica), Rose downy mildew (Peronospora sparsa), Sunflower downy mildew (Plasmopara halstedii), Honeybee downy mildew (Plasmopara nivea), Grape downy mildew (Plasmopara viticola), Cucurbit downy mildew (Pseudoperonospora cubensis), Aralia root rot (Phytophthora cactorum), Watermelon brown rot (Phytophthora capsici), Pumpkin late blight (Phytophthora capsici), Bell pepper late blight (Phytophthora capsici), Watermelon late blight (Phytophthora cryptogea), Tomato and potato late blight (Phytophthora infestans), Fig white powdery mildew rot (Phytophthora palmivora), leaf blight of onions (Phytophthora porri), soybean root and stem rot (Phytophthora sojae), adzuki bean stem rot (Phytophthora vignae f. sp. adzukicola), spinach damping-off (Pythium aphanidermatum, P. myriotylum, P. paroecandrum, P. ultimum var. ultimum), konjac root rot (Pythium aristosporum), corn browning root rot (Pythium arrhenomanes, P. graminicola), cabbage damping-off (Pythium buismaniae, P. myriotylum), rice seedling damping-off, ginger root rot rot (Pythiummyriotylum), ginger root rot (Pythium myriotylum, P. ultimum var. ultimum), carrot brown blotted root rot (Pythium sulcatum), tomato bacterial canker (Clavibacter michiganensis subsp. michiganensis), potato scab (Streptomyces spp.), rose crown gall (Rhizobium radiobacter), sorghum bacterial stripe (Burkholderia andropogonis), onion soft rot (Burkholderia cepacia, Pseudomonas marginalis pv. marginalis, Erwinia rhapontici), rice bacterial grain rot (Burkholderia gladioli, B. glumae), watermelon bacterial fruit spot blotch (Acidovorax avenae subsp. citrulli), Bacterial leaf blight (Acidovorax konjaci), Bacterial leaf blight (Ralstonia solanacearum), Bacterial shot hole (Xanthomonas arboricola pv. pruni, Pseudomonas syringae pv. syringae, Brenneria nigrifluens), Bacterial leaf spot (Xanthomonas arboricola pv. pruni), Bacterial leaf spot (Xanthomonas axonopodis pv. vitians), Black rot (Xanthomonas campestris pv. campestris), Bacterial pustule (Xanthomonas campestris) pv.glycines), Bacterial spot of burdock (Xanthomonas campestris pv. nigromaculans), Bacterial spot of bell pepper (Xanthomonas campestris pv. vesicatoria), Citrus canker (Xanthomonas citri subsp. citri), Spring rot of garlic (Pseudomonas cichorii, P. marginalis pv. marginalis, Erwinia sp.), Bacterial rot of lettuce (Pseudomonas cichorii, P. marginalis pv. marginalis, P. viridiflava), Bacterial blossom blight of kiwifruit (Pseudomonas marginalis pv. marginalis, P. syringae pv. syringae, P. viridiflava), Bacterial canker of kiwifruit (Pseudomonas syringae pv. actinidiae), Loquat canker (Pseudomonas syringae pv. eriobotryae), Bacterial spot of Cucurbitaceae (Pseudomonas syringae pv. lachrymans), Bacterial black spot of Brassicaceae (Pseudomonas syringae pv. maculicola), Plum canker (Pseudomonas syringae pv. morsprunorum, Erwinia sp.), Tea shoot blight (Pseudomonas syringae pv. theae), Onion soft rot (Dickeya sp., Pectobacterium carotovorum), Fire blight of Rosaceae (Poidomonaceae) (Erwinia amylovora), Konjac soft rot (PectobacteriumBacterial soft rot (Pectobacterium carotovorum).
[0057] Examples of bacterial strains that can be used as antibacterial agents for medical use or veterinary use include, but are not limited to, tinea fungi such as Trichophyton rubrum and Trichophyton mentagrophytes, Candida fungi such as Candida albicans, Aspergillus fungi such as Aspergillus fumigatus, Cryptococcus fungi such as Cryptococcus neoformas, Gram-negative bacteria such as Escherichia coli, Pseudomonas aeruginosa, and Haemophilus influenzae, and Gram-positive bacteria such as Staphylococcus aureus and Streptococcus pyogenes.
[0058] Examples of fungal strains that can be treated with the antibacterial or antifungal agent include, but are not limited to, wood-rotting fungi such as Tyromyces palustris and Coriolus versicolor, and material-deteriorating microorganisms such as Aspergillus niger, Aspergillus terreus, Eurotium tonophilum, Penicillium citrinum, Penicillium funiculosum, Rhizopus oryzae, Cladosporium cladosporioides, Aureobasidium pullulans, Gliocladium virens, Chaetomium globosum, Fusarium moniliforme, and Myrothecium verrucaria.
[0059] Examples of fungal strains that are targets of industrial fungicides include, but are not limited to, slime fungi such as Sphaerotilis natans and Zoogloea ramigera.
[0060] Specific examples of endoparasites that are targets of endoparasite control agents include, but are not limited to, the following: Haemonchus, Trichostrongylus, Ostertagia, Nematodirus, Cooperia, Ascaris, Bunostomum, Oesophagostomum, Chabertia, Trichuris, Strongylus, Trichonema, Dictyocaulus, Capillaria, and Heterakis. ), Toxocara, Ascaridia, Oxyuris, Ancylostoma, Uncinaria, Toxascaris, Parascaris and other nematodes; Filariidae nematodes such as Wuchereria, Brugia, Onchoceca, Dirofilaria, Loa and other nematodes; Dracunculidae nematodes such as Deacunculus, Dipylidium caninum), Taenia taeniaeformis, Taenia solium, Taenia saginata, Hymenolepis diminuta, Moniezia benedeni, Diphyllobothrium latum, Diphyllobothrium erinacei), Echinococcus granulosus, Echinococcus multilocularis, Fasciola hepatica, F.trematodes such as Paragonimus gigantica, Paragonimus westermanii, Fasciolopsic bruski, Eurytrema pancreaticum, E. coelomaticum, Clonorchis sinensis, Schistosoma japonicum, Schistosoma haematobium, Schistosoma mansoni, and other trematodes; Eimeria tenella, Eimeria acervulina, Eimeria brunetti, Eimeria maxima, Eimeria necatrix, Eimeria bovis, Eimeria obinodalis, Eimeria ovinoidalis), Eimeria spp., Trypanosomsa cruzi, Leishmania spp., Plasmodium spp., Babesia spp., Trichomonadidae spp., Histomanas spp., Giardia spp., Toxoplasma spp., Entamoeba histolytica, Theileria spp., etc.
[0061] Specific examples of pathogenic fungi that can be treated with antifungal agents include, but are not limited to, the following: tinea fungi such as Trichophyton rubrum and Trichophyton mentagrophytes, candida fungi such as Candida albicans, aspergillus fungi such as Aspergillus fumigatus, and cryptococcal fungi such as Cryptococcus neoformas.
[0062] Furthermore, the microbial preparation according to one embodiment of the present invention can also be used as an insecticide, a herbicide, and a plant growth promoter.
[0063] Specific examples of insects, mites, crustaceans, mollusks and nematodes that can be targeted by insecticides include, but are not limited to, the following.
[0064] Smaller tea tortrix moth (Adoxophyes honmai), smaller apple tortrix moth (Adoxophyes orana fasciata), apple tortrix moth (Archips breviplicanus), green tea tortrix moth (Archips fuscocupreanus), pear fruit moth (Grapholita molesta), tea tortrix moth (Homona magnanima), bean fruit moth (Leguminivora glycinivorella), bean pea leaf moth (Matsumuraeses phaseoli), spring moth (Pandemis heparana), pear leafminer moth (Bucculatrix pyrivorella), peach leafminer moth (Lyonetia clerkella), silver leafminer moth (Lyonetia prunifoliella malinella), tea leafminer moth (Caloptilia theivora), silver leafminer moth (Phyllonorycter ringoniella), citrus leafminer moth (Phyllocnistis citrella), Onion leaf moth (Acrolepiopsis sapporensis), Wild potato leaf moth (Acrolepiopsis suzukiella), Diamondback moth (Plutella xylostella), Persimmon pulp moth (Stathmopoda masinissa), Potato leaf moth (Helcystogramma triannulella), Pink cottonworm (Pectinophora gossypiella), Peach fruit moth (Carposina sasakii), Codling moth (Cydla pomonella), Rice stem borer (Chilo suppressalis), Rice leaf borer (Cnaphalocrocis medinalis), Peach leaf moth (Conogethes punctiferalis), Cotton leaf moth (Diaphania indica), White-striped moth (Etiella zinckenella), Mulberry leaf moth (Glyphodes pyloalis), Hellula undalis, Ostrinia furnacalis, Ostriniascapulalis), European corn borer (Ostrinia nubilalis), grass moth (Parapediasia teterrella), skipper butterfly (Parnara guttata), large cabbage white butterfly (Pieris brassicae), cabbage white butterfly (Pieris rapae crucivora), mugwort geometrie (Ascotis selenaria), soybean looper (Pseudoplusia includens), brown tussock moth (Euproctis pseudoconspersa), gypsy moth (Lymantria dispar), lesser white tussock moth (Orgyia thyellina), American fall webworm (Hyphantria cunea), mulberry leaf moth (Lemyra imparilis), Akebia leaf moth (Adris tyrannus), white-spotted grass moth (Aedia leucomelas), black-and-white cutworm moth (Agrotis ipsilon), turnip cutworm moth (Agrotis segetum), silver looper moth (Autographa nigrisigna), three-leaved golden looper moth (Ctenoplusia agnata), cotton bollworm (Helicoverpa armigera), tobacco budworm (Helicoverpa assulta), cotton ball worm (Helicoverpa zea), tobacco budworm (Heliothis virescens), armyworm moth (Mamestra brassicae), armyworm (Mythimna separata), two-banded leaf cutworm (Naranga aenescens), southern armyworm (Spodoptera eridania), beet armyworm (Spodoptera exigua), fall armyworm (Spodoptera frugiperda), cotton leafworm (Spodoptera littoralis), common cutworm (Spodoptera litura), striped cutworm (Spodoptera depravata), nettle looper moth (Trichoplusia ni), Grapeberry Moss (Endopiza viteana), Tomato Hornworm (ManducaLepidoptera insects such as the tobacco hornworm (Manduca sexta) and the tobacco hornworm (Manduca quinquemaculata).
[0065] Thysanoptera insects such as Frankliniella intonsa, Frankliniella occidentalis, Heliothrips haemorrhoidalis, Scirtothrips dorsalis, Thrips palmi, Thrips tabaci, and Ponticulothrips diospyrosi.
[0066] Spotted stink bug (Dolycoris baccarum), Long-spotted stink bug (Eurydema rugosum), Spiny spotted stink bug (Eysarcoris aeneus), Large spiny spotted stink bug (Eysarcoris lewisi), White spotted stink bug (Eysarcoris ventralis), Shiny green stink bug (Glaucias subpunctatus), Brown marmorated stink bug (Halyomorpha halys), Green stink bug (Nezara antennata), Southern green stink bug (Nezara viridula), Spotted stink bug (Piezodorus hybneri), Brown-winged green stink bug (Plautia crossota), Black rice bug (Scotinophora lurida), Narrow-spotted stink bug (Cletus punctiger), spider stink bug (Leptocorisa chinensis), narrow-legged stink bug (Riptortus clavatus), red-spotted stink bug (Rhopalus maculatus), rice-winged long-horned bug (Cavelerius saccharivorus), rice-winged long-horned bug (Togo hemipterus), red-spotted stink bug (Dysdercus cingulatus), azalea earworm (Stephanitis pyrioides), black-spotted rice bug (Halticus insularis), tarnished plant bug (Lygus lineolaris), long-legged rice bug (Stenodema sibiricum), red-striped rice bug (Stenotus rubrovittatus), narrow-leaved rice bug (Trigonotylus caelestialium), and two-legged leafhopper (Arboridia apicalis), Green long-legged leafhopper (Balclutha saltuella), Large-legged leafhopper (Epiacanthus stramineus), Potato leafhopper (Empoasca fabae), Persimmon leafhopper (Empoasca nipponica), Tea green leafhopper (Empoasca onukii), Bean green leafhopper (Empoascasakaii), Small leafhopper (Macrosteles striifrons), Green rice leafhopper (Nephotettix cincticeps), Cotton fleahopper (Psuedatomoscelis seriatus), Small brown planthopper (Laodelphax striatella), Brown planthopper (Nilaparvata lugens), White-backed planthopper (Sogatella furcifera), Citrus psyllid (Diaphorina citri), Pear psyllid (Psylla pyrisuga), Citrus spiny whitefly (Aleurocanthus spiniferus), Silverleaf whitefly (Bemisia argentifolii), Tobacco whitefly (Bemisia tabaci), Citrus whitefly (Dialeurodes citri), Greenhouse whitefly (Trialeurodes vaporariorum), Grape root aphid (Viteus vitifolii), cotton aphid (Aphis gossypii), willow aphid (Aphis spiraecola), green peach aphid (Myzus persicae), citrus aphid (Toxoptera aurantii), large straw scale (Drosicha corpulenta), Icerya scale (Icerya purchasi), eggplant mealybug (Phenacoccus solani), citrus mealybug (Planococcus citri), Fuji mealybug (Planococcus kraunhiae), mulberry mealybug (Pseudococcus comstocki), hornworm (Ceroplastes ceriferus), ruby scale (Ceroplastes rubens), red scale (Aonidiella aurantii), pear scale (Comstockaspis perniciosa), Tea scale (Fiorinia theae), Tea scale (Pseudaonidia paeoniae), Mulberry scale (Pseudaulacaspis pentagona), Plum scale (PseudaulacaspisHemiptera insects such as Unaspis prunicola, Unaspis euonymi, Unaspis yanonensis, and bedbugs (Cimex lectularius).
[0067] The following insects are also present: cuprea beetle (Anomala cuprea), Japanese beetle (Anomala rufocuprea), green flower beetle (Gametis jucunda), long-legged scarab beetle (Heptophylla picea), Japanese beetle (Popillia japonica), Colorado potato beetle (Leptinotarsa decemlineata), wire-striped wire beetle (Melanotus fortnumi), wire-striped wire beetle (Melanotus tamsuyensis), cigarette beetle (Lasioderma serricorne), small-headed bamboo beetle (Epuraea domina), common ladybird beetle (Epilachna varivestis), 24-spotted ladybird beetle (Epilachna vigintioctopunctata), mealworm beetle (Tenebrio molitor), red flour beetle (Tribolium castaneum), and spotted longhorn beetle (Anoplophora malasiaca), Japanese pine sawyer (Monochamus alternatus), yellow-spotted longhorn beetle (Psacothea hilaris), grape tiger longhorn beetle (Xylotrechus pyrrhoderus), azuki bean weevil (Callosobruchus chinensis), cucumber beetle (Aulacophora femoralis), rice leaf beetle (Chaetocnema concinna), southern corn rootworm (Diabrotica undecimpunctata), western corn rootworm (Diabrotica virgifera), northern corn rootworm (Diabrotica barberi), rice leaf beetle (Oulema oryzae), striped flea beetle (Phyllotreta striolata), eggplant longhorn beetle (Psylliodes angusticollis), peach vest weevil (Rhynchites heros), sweet potato weevil (Cylas formicarius), boll weevil (Anthonomus grandis), rice weevil (Echinocnemus squameus), potato weevil (EuscepesColeoptera insects such as the rice weevil (Hypera postica), rice water weevil (Lissorhoptrus oryzophilus), sulcatus weevil (Otiorhynchus sulcatus), granary weevil (Sitophilus granarius), maize weevil (Sitophilus zeamais), grass weevil (Sphenophorus venatus vestitus), and blue-leaf rove beetle (Paederus fuscipes).
[0068] Soybean pod gall midge (Asphondylia yushimai), wheat gall midge (Sitodiplosis mosellana), melon fly (Bactrocera cucurbitae), Oriental fruit fly (Bactrocera dorsalis), Mediterranean fruit fly (Ceratitis capitata), rice leafminer (Hydrellia griseola), Drosophila suzukii, rice leafminer (Agromyza oryzae), Phytomyza horticola, eggplant leafminer (Liriomyza bryoniae), onion leafminer (Liriomyza chinensis), tomato leafminer (Liriomyza sativae), bean leafminer (Liriomyza trifolii), seed gnat (Delia platura), sugar beet rootminer (Pegomya cunicularia), apple maggot (Rhagoletis pomonella), Hessian fly (Mayetiola destructor), house fly (Musca domestica), stable fly (Stomoxys calcitrans), sheep lice (Melophagus ovinus), cow fly (Hypoderma bovis), cow fly (Hypoderma lineatum), sheep fly (Oestrus ovis), tsetse flies (Glossina palpalis, Glossina morsitans), yellow-legged black fly (Prosimulium yezoensis), horse fly (Tabanus trigonus), Japanese house fly (Telmatoscopus albipunctatus), Tokunaga midge (Leptoconops nipponensis), Culex pipiens pallens, Aedes aegypti, Aedes albopictus Dipteran insects such as Anopheles albopictus and Anopheles hyracanus sinesis.
[0069] Hymenoptera insects such as the chestnut sawfly (Apethymus kuri), turnip sawfly (Athalia rosae), orange sawfly (Arge pagana), pine sawfly (Neodiprion sertifer), chestnut gall wasp (Dryocosmus kuriphilus), army ants (Eciton burchelli, Eciton schmitti), Japanese carpenter ant (Camponotus japonicus), Asian giant hornet (Vespa mandarina), bulldog ants (Myrmecia spp.), fire ants (Solenopsis spp.), and pharaoh ant (Monomorium pharaonis).
[0070] Orthoptera insects such as the field cricket (Teleogryllus emma), mole cricket (Gryllotalpa orientalis), migratory locust (Locusta migratoria), orb-grasshopper (Oxya yezoensis), and desert locust (Schistocerca gregaria).
[0071] Mycoplasma insects such as the spiny white springtail (Onychiurus folsomi), the Siberian white springtail (Onychiurus sibiricus), and the yellow-spotted springtail (Bourletiella hortensis).
[0072] Dictyoptera insects such as the American cockroach (Periplaneta fuliginosa), the Japanese cockroach (Periplaneta japonica), and the German cockroach (Blattella germanica).
[0073] Termite insects such as Coptotermes formosanus, Reticulitermes speratus, and Odontotermes formosanus.
[0074] Siphonaptera, such as cat fleas (Ctenocephalides felis), dog fleas (Ctenocephalides canis), chicken fleas (Echidnophaga gallinacea), human fleas (Pulex irritans), and rat fleas (Xenopsylla cheopis).
[0075] Pediculatus insects such as the chicken body louse (Menacanthus stramineus) and the cow body louse (Bovicola bovis).
[0076] Phthiraptera insects such as cattle lice (Haematopinus eurysternus), pig lice (Haematopinus suis), cattle lice (Linognathus vituli), and woolly cattle lice (Solenopotes capillatus).
[0077] Tarsonemus mites such as cyclamen tarsonemus (Phytonemus pallidus), tea tarsonemus (Polyphagotarsonemus latus), and striped tarsonemus (Tarsonemus bilobatus).
[0078] Scyllid mites such as Penthaleus erythrocephalus and Penthaleus major.
[0079] Spider mites such as rice spider mite (Oligonychus shinkajii), citrus red mite (Panonychus citri), mulberry giant spider mite (Panonychus mori), apple red mite (Panonychus ulmi), Kanzawa spider mite (Tetranychus kanzawai), and twospotted spider mite (Tetranychus urticae).
[0080] Eriophyid mites such as the tea long rust mite (Acaphylla theavagrans), tulip rust mite (Aceria tulipae), tomato rust mite (Aculops lycopersici), citrus rust mite (Aculops pelekassi), apple rust mite (Aculus schlechtendali), false pear rust mite (Eriophyes chibaensis), and citrus rust mite (Phyllocoptruta oleivora).
[0081] Acarid mites such as Rhizoglyphus robini, Tyrophagus putrescentiae, and Tyrophagus similis.
[0082] Mites such as Varroa jacobsoni.
[0083] Ticks such as Boophilus microplus, Rhipicephalus sanguineus, Haemaphysalis longicornis, Haemaphysalis flava, Haemaphysalis campanulata, Ixodes ovatus, Ixodes persulcatus, Amblyomma spp., and Dermacentor spp.
[0084] Mites of the suborder Mesostigmata, such as the red mite (Dermanyssus gallinae), the tropical rat mite (Ornithonyssus bacoti), and the northern fowl mite (Ornithonyssus sylviarum).
[0085] Cheyletiella yasguri, Cheyletiella blakei, and other chigger mites.
[0086] Demodex mites such as Demodex canis and Demodex cati.
[0087] Psoroptes ovis and other mites.
[0088] Scabies mites such as Sarcoptes scabiei, Notoedres cati, and Knemidocoptes spp.
[0089] Crustaceans such as the pillbug (Armadillidium vulgare).
[0090] Gastropods such as apple snails (Pomacea canaliculata), African snails (Achatina fulica), slugs (Meghimatium bilineatum), brown slugs (Limax Valentiana), light blue snails (Acusta despecta sieboldiana), and striped snails (Euhadra peliomphala).
[0091] Nematodes such as the southern root lesion nematode (Pratylenchus coffeae), the northern root lesion nematode (Pratylenchus penetrans), the walnut root lesion nematode (Pratylenchus vulnus), the potato cyst nematode (Globodera rostochiensis), the soybean cyst nematode (Heterodera glycines), the northern root-knot nematode (Meloidogyne hapla), the sweet potato root-knot nematode (Meloidogyne incognita), the rice root lesion nematode (Aphelenchoides besseyi), and the pine wood nematode (Bursaphelenchus xylophilus).
[0092] Adult flies such as horn flies or Haematobia irritans, horse flies or Tabanus spp., stable flies or Stomoxys calcitrans, black flies or Simulium spp., deer flies or Chrysops spp., lice flies or Melophagus ovinus, and tsetse flies or Glossina spp.
[0093] Parasitic fly maggots such as sheep flies (Oestrus ovis and Cuterebra spp.), blow flies or Phaenicia spp., screwworm flies or Cochliomyia hominivorax, cow flies or Hypoderma spp., horse fleeceworm and Gastrophilus.
[0094] Mosquitoes such as Culex spp., Anopheles spp., and Aedes spp.
[0095] When the microbial formulation according to one embodiment of the present invention is used as a herbicide, the application scene is not particularly limited, and when used in paddy fields, it can be used in either soil treatment under flooded conditions or foliage treatment. Examples of paddy field weeds that are targets of herbicides include Chinese sprangletop (Leptochloa chinensis), bearded sprangletop (Leptochloa fascicularis), barnyard grass (Echinochloa crus-galli), junglerice (Echinochloa colonum), late watergrass (Echinochloa oryzicola), southern cutgrass (Leersia hexandra), knotgrass (Paspalum distichum), saramollagrass (Ischaemum rugosum), itchgrass (Rottboellia cochinchinensis), and broadleaf signalgrass (Brachiaria platyphylla), Alexandergrass (Brachiaria plantaginea), large crabgrass (Digitaria sanguinalis), crowfoot grass (Dactyloctenium aegyptium), goosegrass (Eleusine indica), red rice (Oryza sativa), bermuda grass (Cynodon dactylon), as well as Gramineae weeds such as fall panicum (Panicum dichotomiflorum), water chestnut (Eleocharis kuroguwai), globe fringerush (Fimbristylis miliacea), and Japanese bulrush (Japanese scirpus).Weeds of the Cyperaceae family, such as Cyperus serotinus, Cyperus difformis, Cyperus iria, Cyperus rotundus, Cyperus esculentus, and cosmopolitan bulrush, Bolboschoenus martimus, as well as water plantain, Alisma canaliculatum, and pygmy arrowhead, Sagittaria pygmy. Weeds of the Alismataceae family, such as Arrowhead (Sagittaria trifolia) and three-leaf arrowhead (Asian spiderwort (Murdannia keisak) and benghal dayflower (Commelina benghalensis), weeds of the Commelinaceae family, such as heartleaf false pickerelweed (Monochoria korsakowii), oval-leafed pondweed (Monochoria vaginalis), ducksalad (Heteranthera limosa), and water hyacinth (Eichhornia crassipes), weeds of the Pontederiaceae family, such as threestamen waterwort (Threestamen sieboldii),Weeds from the family Elatinaceae, such as Elatine triandra, weeds from the family Lythraceae, such as redstem Ammannia coccinea and Indian toothcup Rotala indica, weeds from the family Oenotheraceae, such as Ludwigia epilobioides and Mexican primrose-willow Ludwigia octovalvis, weeds from the family Rushlike dopatrium Dopatrium junceum, Gratiola japonica, dwarf ambulia Limnophila sessiliflora, prostrate false pimpernel Lindernia pyxidaria, and yellowseed false pimpernel, Weeds from the Scrophulariaceae family, such as Lindernia dubia, weeds from the Amaranthaceae family, such as alligator weed (Alternanthera philoxeroides) and spiny amaranth (Amaranthus spinosus), weeds from the Polygonaceae family, such as water pepper (Polygonum hydropiper), weeds from the Sphenocleaceae family, such as gooseweed (Sphenoclea zeylanica), weeds from the Fabaceae family, such as Indian jointvetch (Aeschynomene indica) and hemp sesbania (Sesbania exaltata), weeds from the Fabaceae family, such as devil's weed (Birdweed), and weeds from the American ragwort family, such as ragwort (Aeschynomene indica). beggarticks, Bidens frondosa), three-lobe beggarticks,Examples of weeds include Asteraceae weeds such as Bidens tripartita, false daisy (Eclipta prostrata), and ageratum conyzoides; Convolvulaceae weeds such as swamp morningglory (Ipomoea aquatica); Marsileaceae weeds such as water clover (Marsilea minuta); Lemnaceae weeds such as common duckmeat (Spirodela polyrhiza) and duckweed (Lemna paucicostata); and Potamogetonaceae weeds such as roundleaf pondweed (Potamogeton distinctus).
[0096] When used in rice paddies, herbicides can be applied at the same time as rice planting, in addition to the usual pre-planting and post-planting applications.
[0097] Furthermore, the microbial formulation according to one embodiment of the present invention can be used as a herbicide for fields and orchards in any of the treatment methods of soil treatment, soil incorporation treatment, and foliage treatment. Examples of field weeds include fall panicum (Panicum dichotomiflorum), shattercane (Sorghum bicolor), Johnson grass (Sorghum halepense), barnyard grass (Echinochloa crus-galli var. crus-galli), cockspur grass (Echinochloa crus-galli var. praticola), Japanese barnyard millet (Echinochloa utilis), southern crabgrass (Digitaria ciliaris), sourgrass (Digitaria insularis), Jamaican crabgrass (Digitaria horizontalis), wild oat (Avena fatua), and blackgrass (Alopecurus myosuroides), shortawn foxtail (Alopecurus aequalis), windgrass (Apera spica-venti), downy brome (Bromus tectorum), Italian ryegrass (Lolium multiflorum), rigid ryegrass (Lolium rigidum), littleseed canarygrass (Phalaris minor), annual bluegrass (Poa annua), goosegrass (Eleusine indica), green foxtail (Setaria viridis), giant foxtail (Giant foxtail,Poaceae weeds such as Setaria faberi, signalgrass (Brachiaria decumbens), and southern sandbur (Cenchrus echinatus); Cyperaceae weeds such as purple nutsedge (Cyperus rotundus); Solanaceae weeds such as black nightshade (Solanum nigrum) and jimsonweed (Datura stramonium); Malvaceae weeds such as velvetleaf (Abutilon theophrasti) and prickly sida (Sida spinosa); tall morning-glory (Ipomoea Weeds from the Convolvulaceae family, such as purple amaranth (Amaranthus lividus), redroot pigweed (Amaranthus retroflexus), palmer amaranth (Amaranthus palmeri), and tall waterhemp (Amaranthus tuberculatus); weeds from the Amaranthaceae family, such as common cocklebur (Xanthium strumarium), common ragweed (Ambrosia artemisiifolia), and giant ragweed (Ambrosia trifida). ), horseweed,Weeds from the Asteraceae family, such as common sunflower (Helianthus annuus), pineappleweed (Matricaria matricarioides), hairy galinsoga (Galinsoga ciliata), Canada thistle (Cirsium arvense), common groundsel (Senecio vulgaris), and annual fleabane (Erigeron annuus); weeds from the Brassicaceae family, such as variableleaf yellowcress (Rorippa indica), wildmustard (Sinapis arvensis), and shepherd's purse (Capsella bursa-pastoris); weeds from the Oriental lady's thumb (Polygonum sieboldii), common lady's thumb (Polygonum sieboldii), common lady's purse ... Weeds from the Polygonaceae family, such as Persicaria longiseta and wild buckwheat (Polygonum convolvulus); weeds from the Portulacaceae family, such as common purslane (Portulaca oleracea); weeds from the Chenopodiaceae family, such as lambsquarters (Chenopodium album), figleaved goosefoot (Chenopodium ficifolium), kochia (Kochia scoparia), and Russian thistle (Salsola tragus); weeds from the Caryophyllaceae family, such as common chickweed (Stellaria media); weeds from the Persian speedwell (Persian speedwell);Plantaginaceae weeds, such as Veronica persica; Commelinaceae weeds, such as Asiatic dayflower (Commelina communis) and benghal dayflower (Commelina benghalensis); Lamiaceae weeds, such as henbit (Lamium amplexicaule) and purple deadnettle (Lamium purpureum); Euphorbiaceae weeds, such as wild poinsettia (Euphorbia heterophylla) and spotted spurge (Euphorbia maculata); false cleavers (Galium spurium) and Asian madder (Rubia rubia); Examples of weeds that may be included include Rubiaceae weeds such as red violet (Viola tricolor), Violaceae weeds such as field poppy (Papaver rhoeas), Fabaceae weeds such as hemp sesbania (Sesbania exaltata) and sicklepod (Cassia obtusifolia), and Oxalidaceae weeds such as creeping woodsorrel (Oxalis corniculata).
[0098] Furthermore, the herbicide can be used in agricultural and horticultural fields such as paddy fields, upland fields, and orchards, as well as in non-agricultural fields such as lawns, sports fields, vacant lots, roadsides, and railroad tracks, by any of the treatment methods of soil application, soil incorporation treatment, and foliage application. In addition to those listed under field and orchard weeds, the weeds include annual bluegrass (Poa annua), common dandelion (Taraxacum officinale), hairy fleabane (Conyza bonariensis), horseweed (Conyza canadensis), guernsey fleabane (Conyza sumatrensis), wavy bittercress (Caramine flexuosa), white clover (Trifolium repens), lawn pennywort (Hydrocotyle sibthorpioides), Chinese plantain (Plantago asiatica), green kyllinga (Kyllinga brevifolia), and field horsetail (Equisetum arvense). Equisetum arvense) and others.
[0099] The microbial preparation according to one embodiment of the present invention can be used as a plant growth promoter that promotes the growth of useful plants.
[0100] The useful plants include field crops, paddy field crops, horticultural crops, turf, fruit trees, and the like.
[0101] Examples of useful plants include agricultural crops such as corn, rice, wheat, barley, rye, oats, sorghum, cotton, soybeans, peanuts, buckwheat, beets, rapeseed, sunflowers, sugarcane, and tobacco; solanaceae vegetables (eggplant, tomato, bell pepper, chili pepper, potato, etc.), cucurbitaceae vegetables (cucumber, pumpkin, zucchini, watermelon, melon, etc.), cruciferous vegetables (radish, turnip, horseradish, kohlrabi, Chinese cabbage, cabbage, mustard greens, broccoli, cauliflower, etc.), Asteraceae vegetables (burdock, garland chrysanthemum, artichoke, Vegetables such as liliaceae vegetables (leeks, onions, garlic, asparagus), umbelliferous vegetables (carrots, parsley, celery, parsley, etc.), chenopodiaceae vegetables (spinach, Swiss chard, etc.), lamiaceae vegetables (perilla, mint, basil, etc.), strawberries, sweet potatoes, yams, and taro; pome fruits (apples, European pears, Japanese pears, quince, quince, etc.), stone fruits (peaches, plums, nectarines, plums, cherries, apricots, prunes, etc.), citrus fruits (Satsuma mandarins, oranges, lemons, limes, grapefruits, etc.), nuts Fruits such as nuts (chestnuts, walnuts, hazel, almonds, pistachios, cashew nuts, macadamia nuts, etc.), berries (blueberries, cranberries, blackberries, raspberries, etc.), grapes, persimmons, olives, loquats, bananas, coffee, dates, coconuts, and oil palms; tea, mulberry, street trees (ash, birch, dogwood, eucalyptus, ginkgo, lilac, maple, oak, poplar, redbud, liquidambar, plane tree, zelkova, arborvitae, fir, hemlock, juniper, pine, spruce, yew, elm, horse chestnut, etc.), coral tree, non-fruit trees such as Japanese cedar, Japanese cedar, Japanese cypress, croton, Euonymus japonicus, and Photinia japonica; lawns such as lawn grasses (Japanese lawn grass, Korean lawn grass, etc.), Bermuda grasses (Chinese dactylon, etc.), bentgrasses (Japanese marshmallow, Japanese marshmallow, Japanese marshmallow, etc.), bluegrasses (Japanese longgrass, Poa annua, etc.), fescue (Japanese fescue, Japanese marshmallow, Japanese marshmallow, etc.), ryegrass (Lolium multiflorum, Ryegrass, Italian grass, etc.), orchard grass, and Timothy grass; oil crops such as oil palm and Jatropha curcas;Examples of suitable plants include, but are not limited to, flowering plants (roses, carnations, chrysanthemums, lisianthus, baby's breath, gerberas, marigolds, salvia, petunias, verbena, tulips, asters, gentians, lilies, pansies, cyclamen, orchids, lily of the valley, lavender, stocks, snapdragons, primulas, poinsettias, gladioli, cattleyas, daisies, verbena, cymbidiums, and begonias); and ornamental plants.
[0102] Furthermore, the useful plants referred to in the present invention also include plants to which tolerance to HPPD inhibitors such as isoxaflutole, ALS inhibitors such as imazethapyr and thifensulfuron-methyl, EPSP synthase inhibitors such as glyphosate, glutamine synthase inhibitors such as glufosinate, acetyl-CoA carboxylase inhibitors such as sethoxydim, PPO inhibitors such as flumioxazin, and herbicides such as bromoxynil, dicamba and 2,4-D has been imparted by classical breeding methods and genetic engineering techniques.
[0103] Examples of "horticultural plants" that have been made resistant by classical breeding methods include rapeseed, wheat, sunflower, rice, and corn that are resistant to imidazolinone ALS-inhibiting herbicides such as imazethapyr, and these are already on the market under the trade name Clearfield®.
[0104] Similarly, soybeans that have been resistant to sulfonylurea ALS-inhibiting herbicides such as thifensulfuron methyl through classical breeding methods are available, and are already sold under the trade name STS soybean. Similarly, examples of agricultural and horticultural plants that have been resistant to acetyl-CoA carboxylase inhibitors such as trione oxime and aryloxyphenoxypropionic acid herbicides through classical breeding methods include SR corn. Agricultural and horticultural plants that have been resistant to acetyl-CoA carboxylase inhibitors are described in, for example, Proceedings of the National Academy of Sciences of the United States of America (Proc. Natl. Acad. Sci. USA) Vol. 87, pp. 7175-7179 (1990). Mutant acetyl-CoA carboxylases resistant to acetyl-CoA carboxylase inhibitors have been reported in Weed Science, Vol. 53, pp. 728-746 (2005), and plants resistant to acetyl-CoA carboxylase inhibitors can be produced by introducing such mutant acetyl-CoA carboxylase genes into plants using genetic engineering or by introducing resistance-conferring mutations into crop acetyl-CoA carboxylase. Furthermore, plants resistant to acetyl-CoA carboxylase inhibitors / herbicides can be produced by introducing a base substitution mutation-introduced nucleic acid, as typified by chimeraplasty technology (Gura T. 1999. Repairing the Genome's Spelling Mistakes. Science 285: 316-318), into plant cells to induce site-specific amino acid substitution mutations in the crop (acetyl-CoA carboxylase / herbicide target) gene.
[0105] Examples of agricultural and horticultural plants that have been made resistant through genetic engineering include glyphosate-resistant corn, soybean, cotton, rapeseed, and sugar beet varieties, which are already sold under trade names such as Roundup Ready® and Agrisure GT®. Similarly, there are glufosinate-resistant corn, soybean, cotton, and rapeseed varieties that have been made resistant through genetic engineering, which are already sold under trade names such as LibertyLink®. Similarly, bromoxynil-resistant cotton made through genetic engineering is already sold under the trade name BXN.
[0106] The above-mentioned "agricultural and horticultural plants" also include plants that have been made capable of synthesizing selective toxins known to be produced in the genus Bacillus using genetic engineering techniques. Examples of insecticidal toxins expressed in such genetically engineered plants include insecticidal proteins derived from Bacillus cereus and Bacillus popilliae; thuringiensis-derived δ-endotoxins such as Cry1Ab, Cry1Ac, Cry1F, Cry1Fa2, Cry2Ab, Cry3A, Cry3Bb1 or Cry9C, insecticidal proteins such as VIP1, VIP2, VIP3 or VIP3A; insecticidal proteins derived from nematodes; toxins produced by animals such as scorpion toxins, spider toxins, wasp toxins or insect-specific neurotoxins; filamentous fungal toxins; plant lectins; agglutinins; protease inhibitors such as trypsin inhibitors, serine protease inhibitors, patatin, cystatin, papain inhibitors; ricin ribosome-inactivating proteins (RIPs) such as corn-RIP, abrin, saporin, and bryodin; steroid metabolic enzymes such as 3-hydroxysteroid oxidase, ecdysteroid-UDP-glucosyltransferase, and cholesterol oxidase; ecdysone inhibitors; HMG-CoA reductase; ion channel inhibitors such as sodium channel inhibitors and calcium channel inhibitors; juvenile hormone esterase; diuretic hormone receptor; stilbene synthase; bibenzyl synthase; chitinase; and glucanase.
[0107] Toxins expressed in such genetically modified plants also include hybrid toxins, truncated toxins, and modified toxins of δ-endotoxin proteins such as Cry1Ab, Cry1Ac, Cry1F, Cry1Fa2, Cry2Ab, Cry3A, Cry3Bb1, or Cry9C, and insecticidal proteins such as VIP1, VIP2, VIP3, or VIP3A. Hybrid toxins are produced using recombinant technology by combining different domains of these proteins in new ways. A known example of a truncated toxin is Cry1Ab, which lacks a portion of its amino acid sequence. Modified toxins have one or more amino acids substituted in the native toxin.
[0108] Examples of these toxins and recombinant plants capable of synthesizing these toxins are described in patent documents such as EP-A-0374753, WO93 / 07278, WO95 / 34656, EP-A-0427529, EP-A-451878, WO03 / 052073, etc. The toxins contained in these recombinant plants confer resistance to plants, in particular to coleopteran, dipteran and lepidopteran pests.
[0109] Additionally, transgenic plants containing one or more insecticidal pest resistance genes and expressing one or more toxins are already known, and some are commercially available. Examples of these genetically modified plants include YieldGard® (a corn variety expressing the Cry1Ab toxin), YieldGard Rootworm® (a corn variety expressing the Cry3Bb1 toxin), YieldGard Plus® (a corn variety expressing both the Cry1Ab and Cry3Bb1 toxins), Herculex I® (a corn variety expressing the Cry1Fa2 toxin and phosphinothricin N-acetyltransferase (PAT) to confer tolerance to glufosinate), NuCOTN33B® (a cotton variety expressing the Cry1Ac toxin), Bollgard I® (a corn variety expressing the Cry1Ab toxin), and Bollgard® (a corn variety expressing the Cry1Ab toxin). I)™ (cotton variety expressing Cry1Ac toxin), Bollgard II™ (cotton variety expressing Cry1Ac and Cry2Ab toxins), VIPCOT™ (cotton variety expressing VIP toxin), NewLeaf™ (potato variety expressing Cry3A toxin), NatureGard™ Agrisure™ GT Advantage (GA21 glyphosate tolerance trait), Agrisure™ CB Advantage (Bt11 corn borer (CB) trait), Protecta™, and the like.
[0110] The above useful plants also include those that have been given the ability to produce anti-pathogenic substances with selective action using genetic recombination techniques.
[0111] Examples of antipathogenic substances include PR proteins (PRPs, described in EP-A-0392225); ion channel inhibitors such as sodium channel inhibitors and calcium channel inhibitors (known examples include virus-produced KP1, KP4, and KP6 toxins); stilbene synthase; bibenzyl synthase; chitinase; glucanase; peptide antibiotics, antibiotics having a heterocycle, and substances produced by microorganisms such as protein factors involved in plant disease resistance (called plant disease resistance genes, described in WO 03 / 000906). Such antipathogenic substances and genetically modified plants that produce them are described in EP-A-0392225, WO 95 / 33818, EP-A-0353191, etc.
[0112] The useful plants also include crops that have been given useful traits, such as improved oilseed oil components or increased amino acid content, using genetic engineering technology. Examples include VISTIVE® (low-linolene soybeans with reduced linolenic content) and high-lysine (high phoil) corn (corn with increased lysine or oil content).
[0113] Furthermore, stacked varieties that combine multiple of the above-mentioned classical herbicide traits or useful traits such as herbicide tolerance genes, insecticide pest resistance genes, antipathogenic substance production genes, oilseed component modification traits, and amino acid content enhancement traits are also included.
[0114] The bacterial cell concentration of the KNR42 strain, #220-22 strain, or NS15 strain contained in the microbial preparation according to one embodiment of the present invention is, for example, 1 × 10 2 ~1 x 10 12 CFU / mL, preferably 1 x 10 7 ~1 x 10 11 It may be CFU / mL. As used herein, "CFU" refers to colony forming unit.
[0115] The microbial formulation of one embodiment of the present invention is typically prepared by mixing with an appropriate solid or liquid carrier, and optionally adding surfactants, penetrants, spreaders, thickeners, antifreeze agents, binders, anticaking agents, disintegrants, stabilizing agents, etc., to produce a formulation in any dosage form, such as a soluble concentrate, emulsifiable concentrate, wettable powder, water-soluble powder, water-dispersible granules, water-soluble granules, suspension concentrate, concentrated emulsion, suspoemulsion, microemulsion, oil dispersion, dustable powder, granules, and gel. Furthermore, from the viewpoint of labor saving and improved safety, the formulation in any of the above dosage forms can also be enclosed in a water-soluble package.
[0116] Examples of solid carriers include natural minerals such as quartz, kaolinite, pyrophyllite, sericite, talc, bentonite, acid clay, attapulgite, zeolite, and diatomaceous earth; inorganic salts such as calcium carbonate, ammonium sulfate, sodium sulfate, and potassium chloride; synthetic silicic acid; and synthetic silicates.
[0117] Examples of liquid carriers include alcohols such as ethylene glycol, propylene glycol, and isopropanol; aromatic hydrocarbons such as xylene, alkylbenzene, and alkylnaphthalene; ethers such as butyl cellosolve; ketones such as cyclohexanone; esters such as γ-butyrolactone; acid amides such as N-methylpyrrolidone and N-octylpyrrolidone; vegetable oils such as soybean oil, rapeseed oil, cottonseed oil, and castor oil; and water. These solid and liquid carriers may be used alone or in combination of two or more.
[0118] Examples of surfactants include nonionic surfactants such as polyoxyethylene alkyl ethers, polyoxyethylene alkylaryl ethers, polyoxyethylene styrylphenyl ethers, polyoxyethylene polyoxypropylene block copolymers, polyoxyethylene fatty acid esters, sorbitan fatty acid esters, and polyoxyethylene sorbitan fatty acid esters; anionic surfactants such as alkyl sulfates, alkylbenzenesulfonates, ligninsulfonates, alkylsulfosuccinates, naphthalenesulfonates, alkylnaphthalenesulfonates, salts of formalin condensates of naphthalenesulfonic acid, salts of formalin condensates of alkylnaphthalenesulfonic acid, polyoxyethylene alkylaryl ether sulfates or phosphates, polyoxyethylene styrylphenyl ether sulfates or phosphates, polycarboxylates, and polystyrenesulfonates; cationic surfactants such as alkylamine salts and alkyl quaternary ammonium salts; and amphoteric surfactants such as amino acid type and betaine type.
[0119] The content of these surfactants is not particularly limited, but is generally preferably in the range of 0.05 to 20 parts by weight per 100 parts by weight of the preparation of the present invention. These surfactants may be used alone or in combination of two or more.
[0120] By including a surfactant, the control activity of the microbial formulation against plant diseases is further improved.
[0121] When the microbial preparation according to one embodiment of the present invention is used as a plant disease control agent or a fungicide, etc., it may be mixed with other types of herbicides, various insecticides, acaricides, nematicides, fungicides, plant growth regulators, synergists, fertilizers, soil conditioners, etc. at the time of formulation or spraying, if necessary.
[0122] Furthermore, when the microbial formulation according to one aspect of the present invention is used as a plant disease control agent, a fungicide, or the like, it may be used in combination with other pesticides such as microbial formulations or plant hormones. Such combination may involve the application of the microbial formulation according to one aspect of the present invention in combination with the other pesticide, or ....
[0123] In particular, by applying the microbial formulation according to one embodiment of the present invention in combination with other microbial formulations or other pesticides or plant hormones, it is possible to reduce costs by reducing the amount of applied agent, expand the fungicidal and insecticidal spectrum due to the synergistic action of the mixed agent, reduce the burden on the environment, or achieve a higher pest control effect.In this case, it is also possible to combine the microbial formulation with multiple known pesticides at the same time.
[0124] Examples of types of pesticides that may be mixed with the microbial formulation according to one embodiment of the present invention include compounds listed in The Pesticide Manual, 18th edition, 2018. Specific examples of their common names include, but are not limited to, acibenzolar-S-methyl, acipetax, aldimorph, allyl alcohol, ametoctradin, aminopyrifen, amisulbrom, amobam, ampropylfos, anilazine, azaconazole, azithiram, azoxystrobin, and barium polysulfide. polysulfide), benalaxyl, benalaxyl-M, benodanil, benomyl, benquinox, bentaluron, benthiavalicarb-isopropyl, benthiazole, benzamacril, benzamorph, benzovindiflupyr, binapacryl, biphenyl, bitertanol, bixafen, blasticidin-S, Bordeaux mixture mixture), boscalid, bromoconazole, bupirimate, buthiobate, butylamine, calcium sulfur mixture, captafol, captan, carbamorph,Carbendazim, carboxin, carpropamid, carvone, cheshunt mixture, chinomethionat, chlobenthiazone, chloraniformethane, chloranil, chlorfenazole, chloroneb, chloropicrin, chlorothalonil, chlorquinox, chlozolinate, climbazole, copper acetate, copper carbonate, basic, copper hydroxide, copper naphthenate, copper oleate, copper oxychloride, copper sulfate sulfate), basic copper sulfate (copper sulfate, basic), copper zinc chromate (copper zinc chromate), coumoxystrobin (coumoxystrobin), cresol (cresol), cufraneb (cufraneb), cuprobam (cuprobam), cyazofamid (cyazofamid), cyclafuramid (cyclafuramid), cycloheximide (cycloheximide), cyflufenamid (cyflufenamid), cymoxanil (cymoxanil), cypendazole (cypendazole), cyproconazole (cyproconazole), cyprodinil (cyprodinil), cyprofuram (cyprofuram), dazomet (dazomet), debacarb (debacarb), decafentin (decafentin), dehydroacetate (dehydroacetic acid), dichlobentiazox (dichlobentiazox), dichlofluanid (dichlofluanid),Dichlorone, dichlorophen, dichlozoline, diclobutrazol, diclocymet, diclomezine, dicloran, diethofencarb, difenoconazole, diflumetorim, dimethirimol, dimethomorph omorph), dimoxystrobin, diniconazole, diniconazole-M, dinobuton, dinocap, dinocap-4, dinocap-6, dinocton, dinosulfon, dinoterbone, diphenylamine, dipymetirone rone), dipyrithione, disulfiram, ditalimfos, dithianon, DNOC, dodemorph, dodine, drazoxolon, edifenphos, enestrobin, enoxastrobin, epoxiconazole, ethaboxam aboxam), etaconazole, etem, ethirimol, ethoxyquin, etridiazole, famoxadone, fenamidone, fenaminosulf, phenaminestrobin, fenapanil, fenarimol, fenbuconazole,Fenfuram, fenhexamid, fenitropan, fenoxanil, fenpiclonil, fenpicoxamid, fenpropidin, fenpropimorph, fenpyrazamine, fentin, ferbam, ferimzone, florilpicoxamid florylpicoxamid, fluazinam, fludioxonil, flufenoxystrobin, fluindapyr, flumetover, flumorph, fluopicolide, fluopimomide, fluopyram, fluoroimide, fluotrimazole le), fluoxapiprolin (fluoxapiprolin), fluoxastrobin (fluoxastrobin), fluquinconazole (fluquinconazole), flusilazole (flusilazole), flusulfamide (flusulfamide), flutolanil (flutolanil), flutianil (flutianil), flutriafol (flutriafol), fluxapyroxad (fluxapyroxad), folpet (folpet), fosetyl - aluminum (fosetyl-aluminium), fthalide (fthalide), fuberidazole (fuberidazole), furalaxyl (furalaxyl), furametpyr (furametpyr), furcarbanil (furcarbanil), fluconazole (furconazole), fluconazole - cis (furconazole-cis), flumecyclox (furmecyclox), furophanate (furophanate), glycine (glyodin), griseofulvin (griseofulvin), guazatine (guazatine),Halacrinate, hexachlorobenzene, hexaconazole, hexylthiofos, oxyquinoline sulfate (8-hydroxyquinoline sulfate, hymexazol, imazalil, imibenconazole, iminoctadine-albesilate, iminoctadine-triacetate, inpyrfluxam, iodocarb, ipconazole, ipfentrifluconazole, ipflufenoquin, iprobenfos, iprodione, iprovalicarb, isofetamide, isofetamide, isofleucine, isotianil, isoprothiolane, isopyrazam ), Isovaledione (isovaledione), Kasugamycin (kasugamycin), Kresoxim-methyl (kresoxim-methyl), Laminarin (laminarin), Mancopper (mancopper), Mancozeb (mancozeb), Mandestrobin (mandestrobin), Mandipropamid (mandipropamid), Maneb (maneb), Mebenil (mebenil), Mecarbinzid (mecarbinzid), Mefentrifluconazole (mefentrifluconazole), Mepanipyrim (mepanipyrim), Mepronil (mepronil), Meptyldinocap (meptyldinocap), Metalaxyl (metalaxyl), Metalaxyl -M (metalaxyl-M), Metam (metam), Metazoxolone (metazoxolon), Metconazole (metconazole), Metasulfocarb (methasulfocarb),Methfuroxam, methyltetraprole, metiram, metominostrobin, metrafenone, metsulfovax, milneb, myclobutanil, myclozolin, nabam, naftifine, natamycin, organic nickel (nickel bis (dimethyldithiocarbamate)), nitrostyrene, nitrothal-isopropyl, nuarimol, octhilinone, ofurace, orysastrobin, oxadixyl, oxathiapiprolin, oxyquinoline copper, oxine copper, oxpoconazole fumarate fumarate), oxycarboxin, pefurazoate, penconazole, pencycuron, penflufen, pentachlorophenol, penthiopyrad, orthophenylphenol (2-phenylphenol), phosdiphen, phthalide, picarbutrazox, picoxystrobin, piperalin, polycarbamate, polyoxins, polyoxin-D, potassium azide, potassium hydrogen carbonate, probenazole, prochloraz, procymidone,Propamocarb hydrochloride, propiconazole, propineb, proquinazid, prothiocarb, pyrazophos, pyribencarb, pyrifenox, pyrimethanil, pyriminostrobin, pyroquilon, prothiocarb, prothioconazole, pydiflumetofen, pyracarbolid, pyraclostrobin, pyrametostrobin, pyraoxystrobin, pyrapro poyne), pyraziflumid, pyridaclomethyl, pyridinitril, pyriophenone, pyrisoxazole, pyroxychlor, pyroxyfur, quinacetol-sulfate, quinazamid, quinconazole, quinoxyfen, quinofumelin, quintozene, rabenzazole, salicylanilide, sedaxane, silthiofam, simeconazole, sodium bicarbonate hydrogen carbonate), sodium hypochlorite, spiroxamine, sulfur, tebuconazole, tebufloquin, tecloftalam,Tecnazene (tecnazene), tecoram (tecoram), tetraconazole (tetraconazole), thiabendazole (thiabendazole), thiadifluor (thiadifluor), thicyofen (thicyofen), thifluzamide (thifluzamide), thiochlorfenphim (thiochlorfenphim), thiophanate (thiophanate), thiophanate - methyl (thiophanate-methyl), thiram (thiram), tiadinil (tiadinil), thioximid (tioximid), tolclofos - methyl (tolclofos-methyl), tolprocarb (tolprocarb), tolylfluanid (tolylfluanid), triadimefon (triadimefon), triadimenol (triadimenol), triamiphos (triamiphos), triarimol (triarimol), triazbutil (triazbutil), triazoxide (triazoxide), tributyltin oxide (tributyltin oxide), trichlamide, triclopyricarb, tricyclazole, tridemorph, trifloxystrobin, triflumizole, triforine, triticonazole, validamycin, valifenalate, vinclozolin, zalilamid, zinc naphthenate, zinc sulfate, zineb, ziram, zoxamide, shiitake mycelium extract, and shiitake fruiting body extract, etc. Insecticides: abamectin, acephate, acequinocyl,Acetamiprid, acrinathrin, acinonapyr, afidopyropen, afoxolaner, alanycarb, aldicarb, allethrin, alpha-cypermethrin, alpha-endosulfan, amidoflumet, amitraz, azamethiphos, azinphos-ethyl, azinphos-methyl, azocyclotin, Bacillus thuringiensis thuringiensis), bendiocarb, benfluthrin, benfuracarb, bensultap, benzoximate, benzpyrimoxan, beta-cyfluthrin, beta-cypermethrin, bifenazate, bifenthrin, bioallethrin, bioresmethrin, bistrifluron luron), broflanilide, bromopropylate, buprofezin, butocarboxim, carbaryl, carbofuran, carbosulfan, cartap, chinomethionate, chlorantraniliprole, chlorethoxyfos, chlorfenapyr, chlorfenvinphos,Chlorfluazuron, chlormephos, chlorobenzilate, chloroprallethrin, chlorpyrifos, chlorpyrifos-methyl, chromafenozide, clofentezine, clothianidin, cyanophos, cyantraniliprole, cyclaniliprole, cycloprothrin, cyenopyrafen, cyetpyrafen, cyflumetofen, cyfluthrin, cyhalodiamide, cyhalothrin, cyhexatin, cypermethrin ermethrin), cyphenothrin (cyphenothrin), cyproflanilide (cyproflanilide), cyromazine (cyromazine), deltamethrin (deltamethrin), diacloden (diacloden), diafenthiuron (diafenthiuron), diazinon (diazinon), dichlorvos (dichlorvos), dichloromezotiaz (dicloromezotiaz), dicofol (dicofol), dienochlor (dienochlor) , diflovidadin (diflovidazin), diflubenzuron (diflubenzuron), dimefluthrin (dimefluthrin), dimethoate (dimethoate), dimethylvinphos (dimethylvinphos), dimpropyridaz (dimpropyridaz), dinotefuran (dinotefuran), diofenolan (diofenolan), disulfoton (disulfoton), DNOC (DNOC), d-T-80-phthalthrin (d-tetramethrin),Emamectin benzoate, empenthrin, endosulfan, EPN, epsilon-metofluthrin, epsilon-momfluorothrin, esfenvalerate, ethifencarb, ethiprole, etofenprox, etoxazole, etrimfos, Febantel, fenazaquin, fenbutatin oxide oxide), fenitrothion, fenmezoditiaz, fenobucarb, fenothiocarb, fenoxycarb, fenpropathrin, fenpyroximate, fenthion, fenvalerate, fipronil, flometoquin, flonicamid, fluacrypyrim, fluazuron, flubendiamide ndiamide), fluchlordiniliprole (fluchlorodiniliprole), flucycloxuron (flucycloxuron), flucythrinate (flucythrinate), flufenerim (flufenerim), flufenoxuron (flufenoxuron), flufenprox (flufenprox), flufiprole (flufiprole), fluhexafon (fluhexafon), flumethrin (flumethrin), flupentiofenox (flupentiofenox), flupyradifurone (flupyradifurone), flupyrimin (flupyrimin), fluralaner (fluralaner),Fluvalinate, fluxametamide, fonophos, formetanate, formothion, furathiocarb, gamma-cyhalothrin, halfenprox, halofenozide, heptafluthrin, hexaflumuron, hexythiazox, hydramethylnon, imidacloprid, imiprothrin, indazapyroxamet, indoxacarb, indoxacarb-MP, isocycloseram, iso Fenphos (isofenphos), isoprocarb (isoprocarb), isoxathion (isoxathion), kappa-bifenthrin (kappa-bifenthrin), kappa-tefluthrin (kappa-tefluthrin), lambda-cyhalothrin (lambda-cyhalothrin), lepimectin (lepimectin), lufenuron (lufenuron), malathion (malathion), meperfluthrin (meperfluthrin), metaflumizone (metaflumizone), metalcarb (metalcarb), metaldehyde (metaldehyde), methacrifos (methacrifos), methamidophos (methamidophos), methidathion (methidathion), methomyl (methomyl), methoprene (methoprene), methoxychlor (methoxychlor), methoxyfenozide (methoxyfenozide), methyl bromide (methyl bromide), metofluthrin, milbemectin, momfluorothrin, monocrotophos,Muscalure, nicofluprole, nitenpyram, novaluron, noviflumuron, omethoate, oxazosulfyl, oxydemeton-methyl, oxydeprofos, parathion, parathion-methyl, pentachlorophenol, permethrin, phenothrin, phenthoate, phorate, phosalone, phosmet, phosphamidon, phoxim, pirimicarb, pirimiphos-methyl, praziquantel, profenofos nofos), profluthrin, propaphos, propargite, prothiofos, protrifenbute, pyflubumide, pymetrozine, pyraclofos, pyrafluprole, pyrethrins, pyridaben, pyridalyl, pyrifru Quinazone (pyrifluquinazon), pyrimidifen (pyrimidifen), pyriprole (pyriprole), pyriproxyfen (pyriproxyfen), resmethrin (resmethrin), rotenone (rotenone), silafluofen (silafluofen), spidoxamat (spidoxamat), spinetoram (spinetoram), spinosad (spinosad), spirodiclofen (spirodiclofen), spiromesifen (spiromesifen),Spiropidione (spiropidion), spirotetramate (spirotetramat), spiromesifen (spyromesifen), sulfotep (sulfotep), sulfoxaflor (sulfoxaflor), sulprofos (sulprofos), tau-fluvalinate (tau-fluvalinate), tebufenozide (tebfenozide), tebufenpyrad (tebufenpyrad), teflubenzuron (teflubenzuron), tefluthrin (tefluthorin), terbufos (terbufos), tetrachlorantraniliprole (tetrachlorantraniliprole), tetrachlorvinphos (tetrachlorvinphos), tetramethrin (tetramethrin), tetramethylfluthrin (tetramethylfluthrin), tetranilipro tetraniliprole, thiacloprid, thiamethoxam, thiocyclam, thiodicarb, thiofanox, thiometon, tolfenpyrad, tralomethrin, transfluthrin, triazamate, triazuron, trichlorfon, triflumezopyrim, triflumuron, tyclopyrazoflor, vamidothion, zeta-cypermethrin and the like. Parasitic drugs: esfenvalerate, fenpropathrin, fenvalerate, alphacypermethrin, bifenthrin, cypermethrin, deltamethrin, etofenprox,Lambda-cyhalothrin, permethrin, tefluthrin, zeta-cypermethrin, acetamiprid, clothianidin, dinotefuran, imidacloprid, nitenpyram, thiamethoxam, chromafenozide de), fenoxycarb (fenoxycarb), lufenuron (lufenuron), methoprene (methoprene), pyriproxyfen (pyriproxyfen), triflumuron (triflumuron), chlorpyrifos (chlorpyrifos), chlorpyrifos-methyl (chlorpyrifos-methyl), diazinon (diazinon), dichlorvos (dichlorvos), fenitrothion (fenitrothion), fenthion (fenthion), malathion (mala thion), pirimiphos-methyl (pirimiphos-methyl), tetrachlorvinphos (tetrachlorvinphos), ethiprole (ethiprole), fipronil (fipronil), propoxur (propoxur), carbaryl (carbaryl), bendiocarb (bendiocarb), metoxadiazone (metoxadiazone), fenocarb (fenobucarb), carbofuran (carbofuran), afoxolaner (afoxolaner), fluralaner (fluralaner), fluxametamide (fluxametamide), sarolaner (sarolaner), lotilaner (lotilaner), tigolaner (tigolaner), esafoxolaner (esafoxolaner), modoflaner (modoflaner), umifoxolaner (umifoxolaner), mivorilaner (mivorilaner), avermectin (avermectin), ivermectin (ivermectin), doramectin (doramectin),Eprinomectin, maduramycin, milbemycin, milbemycin oxime oxime), moxidectin, selamectin, indoxacarb, amitraz, bistrifluron, spinosad, albendazole, atovaquone, bithionol, cambendazole, carnidazole, chloroquine, clazuril, clorsulon, closantel, coumaphos, dichlorophen, diethylcarbamazine, diminazene, dinitolmide, dithiazanine iodide iodide), emodepside, epsiprantel, febantel, fenbendazole, flubendazole, glycalpyramide, imidocarb, levamisole, mebendazole, mebendazole, mefloquine hydrochloride, melarsomine dihydrochloride, metronidazole, methylidine, monepantel, morantel tartrate, niclosamide, oxantel pamoate, oxantel tartrate, oxibendazole,Oxyclozanide, piperazine adipate, piperazine citrate, piperazine phosphate, praziquantel, pyrantel pamoate, rafoxanide, tetramisole hydrochloride, thiabendazole, triclabendazole, etc. Antifungal agents: ketoconazole, miconazole nitrate, etc. Antibacterial agents: amoxicillin, ampicillin, bethoxazin, bithionol, bronopol, cefapirin, cefazolin, cefquinome, ceftiofur, chlortetracycline, clavulanic acid acid), danofloxacin, difloxacin, dinitolmide, enrofloxacin, florfenicol, lincomycin, lomefloxacin, marbofloxacin, miloxacin, mirosamycin, nitrapyrin, norfloxacin, octhilinone, ofloxacin, orbifloxacin, oxolinic acid, oxytetracycline, penicillin, streptomycin,Thiamphenicol, tiamulin fumarate, tilmicosin phosphate, acetylisovaleryltylosin acetate, tylosin phosphate, tulathromycin, valnemulin, calcined shell calcium (calcium oxide), Talaromyces, Trichoderma, and Uniothyrium, etc.
[0125] The dosage of the microbial preparation according to one embodiment of the present invention can be appropriately selected depending on the form of the active ingredient of the microbial preparation (the KNR42, #220-22, or NS15 strain, or a culture-derived product of the KNR42, #220-22, or NS15 strain, such as a cultured bacterial cell, culture supernatant, or extract of the KNR42, #220-22, or NS15 strain), the application situation, application time, application method, cultivated crop, etc. For example, when the active ingredient of the microbial preparation is a culture of the KNR42, #220-22, or NS15 strain, the appropriate amount of the active ingredient is approximately 0.1 to 2,000 kg per hectare (ha), and preferably 1 to 500 kg.
[0126] Another aspect of the present invention is a product for plant disease control that contains a culture-derived product of the KNR42 strain, the #220-22 strain, or the NS15 strain and another active ingredient separately as a combined preparation for use in combination in plant disease control.
[0127] [Method of using the microbial formulation] An example of a method of using the microbial formulation according to one embodiment of the present invention is a method for controlling plant diseases. The control method includes a step of applying the microbial formulation to plants or soil. The control method can be carried out in, for example, agricultural land such as fields, paddy fields, lawns, and orchards, or non-agricultural land.
[0128] Examples of plant diseases and pathogens (fungi, bacteria, etc.) that are targets of the plant disease control method according to one embodiment of the present invention are as described above.
[0129] In the above-mentioned step, the microbial preparation can be applied by foliage spraying, soil treatment, seed disinfection, irrigation treatment, water surface treatment, etc., but common methods commonly used by those skilled in the art are also effective.
[0130] In the above step, the microbial preparation may be applied to plants or soil after being diluted 1 to 10,000 times with water, or may be applied to plants or soil without dilution.
[0131] Another aspect of the present invention is a method for regulating seed germination, which comprises applying the microbial formulation to seeds. Another aspect of the present invention is a method for promoting plant growth, which comprises applying the microbial formulation to plants or soil. Another aspect of the present invention is a method for improving soil, which comprises applying the microbial formulation to soil.
[0132] The concentration and amount of the microbial preparation to be used can be appropriately selected depending on the form of the active ingredient of the microbial preparation, the dosage form, the time of use, the method of use, the place of use, the target crop, etc.
[0133] [Summary] The microorganism according to aspect 1 of the present invention is a microorganism belonging to Bacillus veresensis (Accession No.: NITE BP-03832), a microorganism belonging to Bacillus veresensis (Accession No.: NITE BP-04073), a microorganism belonging to Bacillus veresensis (Accession No.: NITE BP-04126), or a mutant thereof having a plant disease control effect.
[0134] The culture-derived product according to the second aspect of the present invention is a culture, cultured bacterial cells, culture supernatant, or extract of the microorganism according to the first aspect of the present invention.
[0135] The microbial preparation according to aspect 3 of the present invention comprises the microorganism according to aspect 1 of the present invention or the culture-derived product according to aspect 2 of the present invention as an active ingredient.
[0136] The microbial preparation according to aspect 4 of the present invention is the microbial preparation according to aspect 3 of the present invention, which may be a bactericide.
[0137] The microbial preparation according to aspect 5 of the present invention is the microbial preparation according to aspect 3 of the present invention, which may be an insecticide.
[0138] A microbial formulation according to a sixth aspect of the present invention is the microbial formulation according to the third aspect of the present invention, which may be a plant disease control agent.
[0139] A microbial formulation according to a seventh aspect of the present invention is the microbial formulation according to the third aspect of the present invention, which may be a herbicide.
[0140] A microbial preparation according to an eighth aspect of the present invention is the microbial preparation according to the third aspect of the present invention, which may be a plant growth promoter.
[0141] A method for controlling plant diseases according to a ninth aspect of the present invention comprises the step of applying the microbial formulation according to any one of the third to eighth aspects of the present invention to plants or soil.
[0142] A method for controlling plant diseases according to a tenth aspect of the present invention is the method according to the ninth aspect of the present invention, wherein the pathogen of the plant disease is a fungus or a bacterium.
[0143] A culture-derived product according to an eleventh aspect of the present invention is a viable cell of the KNR42 strain, the #220-22 strain, or the NS15 strain contained in the culture-derived product according to the second aspect of the present invention.
[0144] A culture-derived product according to Aspect 12 of the present invention is a culture-derived product in which the KNR42 strain, #220-22 strain, or NS15 strain contained in the culture-derived product according to Aspect 2 of the present invention is killed.
[0145] A microorganism according to aspect 13 of the present invention is a microorganism belonging to the genus Bacillus berezensis (accession number: NITE BP-03832) or a mutant thereof having a plant disease control effect.
[0146] A microorganism according to a fourteenth aspect of the present invention is a microorganism belonging to the genus Bacillus berezensis (accession number: NITE BP-04073) or a mutant thereof having a plant disease control effect.
[0147] A microorganism according to aspect 15 of the present invention is a microorganism belonging to the genus Bacillus berezensis (accession number: NITE BP-04126) or a mutant thereof having a plant disease control effect.
[0148] A microorganism according to Aspect 16 of the present invention is a microorganism belonging to Bacillus veresensis (Accession Number: NITE BP-03832), a microorganism belonging to Bacillus veresensis (Accession Number: NITE BP-04073), or a microorganism belonging to Bacillus veresensis (Accession Number: NITE BP-04126).
[0149] A microorganism according to Aspect 17 of the present invention is a microorganism belonging to Bacillus berezensis (Accession No.: NITE BP-03832).
[0150] A microorganism according to aspect 18 of the present invention is a microorganism belonging to the genus Bacillus berezensis (accession number: NITE BP-04073).
[0151] A microorganism according to Aspect 19 of the present invention is a microorganism belonging to Bacillus berezensis (Accession Number: NITE BP-04126).
[0152] A culture-derived product according to Aspect 20 of the present invention is a culture, cultured bacterial cells, culture supernatant, or extract of a microorganism according to any one of Aspects 13 to 19 of the present invention.
[0153] A culture-derived product according to Aspect 21 of the present invention is a culture, culture supernatant, or extract of a microorganism according to any one of Aspects 1, 13 to 19 of the present invention.
[0154] A culture-derived product according to Aspect 22 of the present invention is a culture of a microorganism according to any one of Aspects 1 and 13 to 19 of the present invention.
[0155] A culture-derived product according to Aspect 23 of the present invention is a culture supernatant of a microorganism according to any one of Aspects 1 and 13 to 19 of the present invention.
[0156] A culture-derived product according to Aspect 24 of the present invention is an extract of a microorganism according to any one of Aspects 1 and 13 to 19 of the present invention.
[0157] A culture-derived product according to Aspect 25 of the present invention is a cultured bacterial cell of a microorganism according to any one of Aspects 1 and 13 to 19 of the present invention.
[0158] A microbial preparation according to aspect 26 of the present invention comprises, as an active ingredient, the microorganism according to any one of aspects 1 and 13 to 19 of the present invention or a culture-derived product according to any one of aspects 20 to 25 of the present invention.
[0159] A microbial preparation according to Aspect 27 of the present invention is the microbial preparation according to Aspect 26 of the present invention, which may be a bactericide.
[0160] A microbial preparation according to Aspect 28 of the present invention is the microbial preparation according to Aspect 26 of the present invention, which may be an insecticide.
[0161] A microbial formulation according to Aspect 29 of the present invention is the microbial formulation according to Aspect 26 of the present invention, which may be a plant disease control agent.
[0162] A microbial formulation according to Aspect 30 of the present invention is the microbial formulation according to Aspect 26 of the present invention, which may be a herbicide.
[0163] A microbial preparation according to Aspect 31 of the present invention is the microbial preparation according to Aspect 26 of the present invention, which may be a plant growth promoter.
[0164] A method for controlling plant diseases according to Aspect 32 of the present invention comprises the step of applying the microbial formulation according to any one of Aspects 26 to 31 of the present invention to plants or soil.
[0165] A thirty-third aspect of the present invention relates to the method for controlling plant diseases in the thirty-second aspect of the present invention, wherein the pathogen of the plant disease is a fungus or a bacterium.
[0166] A culture-derived product according to Aspect 34 of the present invention is a viable cell of the KNR42 strain, #220-22 strain, or NS15 strain contained in the culture-derived product according to any one of Aspects 20 to 25 of the present invention.
[0167] A culture-derived product according to Aspect 35 of the present invention is a killed cell of the KNR42 strain, the #220-22 strain, or the NS15 strain contained in the culture-derived product according to any one of Aspects 20 to 25 of the present invention.
[0168] The present invention is described in more detail below, but is not limited thereto. In the examples, "RH" refers to relative humidity. For example, "100% RH" indicates a relative humidity of 100%. [Example 1] Isolation and Characterization of B. velezensis Strains KNR42, #220-22, and NS15 Based on 16S rDNA, rpoB, gyrB, groEL, and recA Sequences. Strains KNR42, #220-22, and NS15 were isolated from LBA medium containing 100 mg / L rifampicin. Using designed primers, PCR amplification and sequencing of the 16S rDNA, rpoB, gyrB, groEL, and recA genes were performed on these isolates. These isolates were identified as B. velezensis by homology searches in databases.
[0169] Colonies of the strain from LBA medium were scraped with a toothpick, inoculated into LB medium, and cultured for 20 hours. DNA was extracted using the NucleoSpin® Microbial DNA Kit. DNA was subjected to 1.0% agarose gel electrophoresis to examine the quality and quantity of DNA.
[0170] <16S rDNA Sequence> The PCR reaction for amplifying 16S rDNA was set up by adding 25 μL of KOD One® PCR Master Mix, 0.25 μL of forward primer (27F: SEQ ID NO: 6, sequence shown in Table 2), and 0.25 μL of reverse primer (1525R: SEQ ID NO: 7, sequence shown in Table 2), 0.25 μL of DNA extract, and sterile water to a total volume of 50 μL. The amplification reaction was carried out using a thermal cycler under the following conditions: initial denaturation at 98°C for 5 seconds, followed by 35 cycles of denaturation at 98°C for 10 seconds, annealing and extension at 72°C for 15 seconds, followed by a final extension at 72°C for 3 minutes.
[0171] The size, quality and quantity of the amplified products were assessed by electrophoresis on a 1.0% agarose gel and comparison with molecular weight markers.
[0172] Excess primers, nucleotides, enzymes, and templates were purified using the Wizard SV Gel and PCR Clean-Up System®. The purified PCR products were sequenced using five primers (27F (SEQ ID NO: 6), 518F (SEQ ID NO: 16), 800F (SEQ ID NO: 17), and 800R (SEQ ID NO: 18); sequences are shown in Table 2).
[0173] Using the software GENETYX (registered trademark), the 5'-end and 3'-end sequences obtained by sequence analysis, which were judged to be less reliable based on the waveform data, were discarded, and the sequences were then assembled to produce 16S rDNA sequences of 1366 bp for the KNR42 strain, 1393 bp for the #220-22 strain, and 1433 bp for the NS15 strain.
[0174]
[0175]
[0176]
[0177] Alignment of the 16S rDNA consensus sequences of the KNR42, #220-22, and NS15 strains revealed that the sequences of the three strains were completely identical, excluding differences due to differences in the 5'- and 3'-terminal sequence cutoff ranges. However, as described below, the KNR42, #220-22, and NS15 strains differed in carbohydrate metabolism, protein profile, and fatty acid composition, and their control effects against various plant diseases also differed.
[0178] The 16S rDNA consensus sequence of strain KNR42 was compared with available sequences using the BLAST rRNA / ITS database. The closest species match was the full-length sequence of B. velezensis strain FZB42 and the partial sequence of Calidifontibacillus erzurumensis strain P2, with 99.93% similarity. The next closest match was the partial sequence of B. velezensis strain CBMB205, with 99.85% similarity (shown in Table 1).
[0179]
[0180] <rpoB Sequence> The PCR reaction for amplifying the rpoB gene was set up by adjusting the reaction volume to 50 μL with 25 μL of KOD One® PCR Master Mix, 0.25 μL of forward primer (rpoBF: SEQ ID NO: 8, sequence shown in Table 2), and 0.25 μL of reverse primer (rpoBR: SEQ ID NO: 9, sequence shown in Table 2), 0.25 μL of DNA extract, and sterile water. The amplification reaction was carried out using a thermal cycler under the following conditions: initial denaturation at 98°C for 5 seconds, followed by 35 cycles of denaturation at 98°C for 10 seconds, annealing at 60°C for 5 seconds, and extension at 68°C for 10 seconds, followed by final extension at 72°C for 3 minutes.
[0181] The size, quality and quantity of the amplified products were assessed by electrophoresis on a 1.0% agarose gel and comparison with molecular weight markers.
[0182] Excess primers, nucleotides, enzymes, and templates were purified using the Wizard SV Gel and PCR Clean-Up System®. Purified PCR products were sequenced using the rpoBF primer (SEQ ID NO: 8).
[0183] Using the software GENETYX (registered trademark), sequences at the 5' and 3' ends of the sequence data obtained by sequence analysis were discarded because the waveform data indicated low reliability. This resulted in the creation of consensus sequences for the KNR42 strain (360 bp), the #220-22 strain (359 bp), and the NS15 strain (362 bp).
[0184] KNR42 rpoB consensus sequence (SEQ ID NO: 2) GGCCCGAACATCGGTTTGATCAACTCATTGTCATCATTTGCGAAAGTAAACCGCTTTGGTTTCATTGAGACGCCATACCGCCGCGTTGATCCTGAAACAGGAAAAGTAACGCCTAGAATCGACTACCTGACTGCTGATGAAGAGGATAACTATGTCGTAGCCCAAGCGAATGCTAAGCTG AGCGATGACGGTTCTTTCTTGGATGACAGCATCGTAGCGCGTTTCAGAGGGGAAAACACCGTTGTAGCCCGCAACCGCGTGGATTACATGGACGTATCTCCTAAACAGGTTGTATCTGCTGCGACAGCATGTATTCCGTTCTTGGAAAACGATGACTCGAACCGTGCCCTCATGGGAGCG
[0185] #220-22 rpoB consensus sequence (SEQ ID NO: 20) GGCCCGAACATCGGTTTGATCAACTCATTGTCATCATTTGCGAAAGTAAACCGCTTTGGTTTCATTGAGACGCCATACCGCCGCGTTGATCCTGAAACAGGAAAAGTAACGCCTAGAATCGACTACCTGACTGCTGATGAAGAGGATAACTATGTCGTAGCCCAAGCGAATGCTAAGCT GAGCGATGACGGTTCTTTCTTGGATGACAGCATCGTAGCGCGTTTCAGAGGGGAAAACACCGTTGTAGCCCGCAACCGCGTGGATTACATGGACGTATCTCCTAAACAGGTTGTATCTGCTGCGACAGCATGTATTCCGTTCTTGGAAAACGATGACTCGAACCGTGCCCTCATGGGAGC
[0186] NS15 rpoB consensus sequence (SEQ ID NO: 25) CTGAGGGCCCGAACATCGGTTTGATCAACTCATTGTCATCATTTGCGAAAGTAAACCGCTTTGGTTTCATTGAGACGCCATACCGCCGCGTTGATCCTGAAACAGGAAAAGTAACGCCTAGAATCGACTACCTGACTGCTGATGAAGAGGATAACTATGTCGTAGCCCAAGCGAATGCTAA GCTGAGCGATGACGGTTCTTTCTTGGATGACAGCATCGTAGCGCGTTTCAGAGGGGAAAACACCGTTGTAGCCCGCAACCGCGTGGATTACATGGACGTATCTCCTAAACAGGTTGTATCTGCTGCGACAGCATGTATTCCGTTCTTGGAAAACGATGACTCGAACCGTGCCCTCATGGGA
[0187] Alignment of the rpoB consensus sequences of the strains KNR42, #220-22, and NS15 revealed that the sequences of the three strains were completely identical, except for differences due to differences in the discard ranges of the 5'- and 3'-terminal sequences.
[0188] The rpoB consensus sequence of strain KNR42 was compared with available sequences using the BLAST Nucleotide collection database. Multiple B. velezensis sequence matches were found with 100% similarity. Among the reference strain sequences, the closest species match was B. velezensis strain FZB42 with 99.72% similarity.
[0189] <gyrB Sequence> The PCR reaction for amplifying the gyrB gene was set up by adding 25 μL of KOD One® PCR Master Mix, 0.25 μL of forward primer (gyrBF: SEQ ID NO: 10, sequence shown in Table 2), and 0.25 μL of reverse primer (gyrBR: SEQ ID NO: 11, sequence shown in Table 2), 0.25 μL of DNA extract, and sterile water to a total volume of 50 μL. The amplification reaction was carried out using a thermal cycler under the following conditions: initial denaturation at 98°C for 5 seconds, followed by 35 cycles of denaturation at 98°C for 10 seconds, annealing at 60°C for 5 seconds, and extension at 68°C for 10 seconds, followed by final extension at 72°C for 3 minutes.
[0190] The size, quality and quantity of the amplified products were assessed by electrophoresis on a 1.0% agarose gel and comparison with molecular weight markers.
[0191] Excess primers, nucleotides, enzymes, and templates were purified using the Wizard SV Gel and PCR Clean-Up System®. Purified PCR products were sequenced using the gyrBF primer (SEQ ID NO: 10) and gyrBR primer (SEQ ID NO: 11).
[0192] Using the software GENETYX (registered trademark), sequences at the 5' and 3' ends of the sequence data obtained by sequence analysis were discarded because the waveform data indicated low reliability. This resulted in the creation of consensus sequences for the KNR42 strain (1057 bp), the #220-22 strain (1104 bp), and the NS15 strain (1094 bp).
[0193]
[0194]
[0195]
[0196] Alignment of the gyrB consensus sequences of the strains KNR42, #220-22, and NS15 revealed that the sequences of the three strains were completely identical, except for differences due to differences in the ranges of the sequences discarded on the 5' and 3' ends.
[0197] The gyrB consensus sequence of strain KNR42 was compared to available sequences using the BLAST Nucleotide collection database. The closest species match was B. amyloliquefaciens strain BGP14 with 100% similarity. The closest species match of the reference strain sequence was B. velezensis strain FZB42 with 99.02% similarity.
[0198] groEL Sequence: The PCR reaction for amplifying the groEL gene was set up by adding 25 μL of KOD One® PCR Master Mix, 0.25 μL of forward primer (groELF: SEQ ID NO: 12, sequence shown in Table 2), and 0.25 μL of reverse primer (groELR: SEQ ID NO: 13, sequence shown in Table 2), 0.25 μL of DNA extract, and sterile water to a total volume of 50 μL. The amplification reaction was carried out using a thermal cycler under the following conditions: initial denaturation at 98°C for 5 seconds, followed by 35 cycles of denaturation at 98°C for 10 seconds, annealing at 60°C for 5 seconds, and extension at 68°C for 10 seconds, followed by final extension at 72°C for 3 minutes.
[0199] The size, quality and quantity of the amplified products were assessed by electrophoresis on a 1.0% agarose gel and comparison with molecular weight markers.
[0200] Excess primers, nucleotides, enzymes, and templates were purified using the Wizard SV Gel and PCR Clean-Up System®. Purified PCR products were sequenced using the groELF primer (SEQ ID NO: 12).
[0201] Using the software GENETYX (registered trademark), sequences at the 5' and 3' ends of the sequence data obtained by sequence analysis were discarded because the waveform data indicated low reliability. This resulted in the creation of consensus sequences for the KNR42 strain (509 bp), the #220-22 strain (510 bp), and the NS15 strain (525 bp).
[0202] KNR42 groEL consensus sequence (SEQ ID NO: 4) TAACTGCGGGGGCTAACCCTGTCGGCGTGCGTAAAGGTATGGAACAAGCCGTGACTGTAGCAATCGAAAACTTAAAAGAAATTTCTAAGCCGATCGAAGGCAAAGAGTCTATCGCTCAGGTTGCTGC GATCTCTGCTGCTGATGAGGAAGTCGGAAGCCTTATCGCTGAAGCAATGGAGCGCGTAGGAAACGACGGCGTCATCACAATCGAAGAGTCTAAAGGATTCACAACTGAGCTTGAAGTTGTGGAAGGT ATGCAATTCGACCGCGGATATGCGTCTCCTTACATGGTGACTGACTCTGATAAGATGGAAGCGGTTCTCGATAATCCATACATCTTAATCACAGACAAAAAAATCACAAACATTCAAGAAATCCTTCCTGTGCTTGAGCAAGTTGTACAGCAAGGCAAACCATTGCTTCTGATCGCTGAAGATGTTGAAGGTGAAGCTCTTGCTACACTCGTTGTCAACAAACTTCGCGGCACATTCAACGCTGTTGCCGTTAAA
[0203] #220-22 groEL consensus sequence (sequence number 22) CTTAAAAAACGTAACTGCGGGGCTAACCCTGTCGGCGTGCGTAAGGTATGGAACAAGCCGTGACTGTAGCAATCGAAAACTTAAAAGAAATTTCTAAGCCGATCGAAGGCAAAGAGTCTATCGCTCAGGTTGCTGCGATCTCTGCTGATGAGGAAGTCGGAGCCTTATCGCTGAAGCAATGGAGCCGTAGGAAAACGACGGCGTCATCACAATCGAAGAGTCTAAAGGATTCACAACTGAGCTTGAAGTTCGCGTAGAATCGCGGTCGTCATCACAATCGAAGAGTCTGTGGAAGGTATGCGTACTCGTCTCTTCACATGGTGACTGACTCTGATAAGATGGAAAGCGGTTTCTCGATAATCCATACATCTTAATCACAGACAAAAAAATCACAAACCATTCAAAGATCCTTCCTGTGCTTGAGCAAGTTGTACAGCAAGGCAAACCATTGCTTCTGTACACTCGTTGTCAACAAACTTCGCGGCACATTCAACGCTGTT
[0204] NS15 groEL consensus sequence (SEQ ID NO: 27) GAAGGCCTTAAAAACGTAACTGCGGGGGCTAACCCTGTCGGCGTGCGTAAAGGTATGGAACAAGCCGTGACTGTAGCAATCGAAAACTTAAAAGAAATTTCTAAGCCGATCGAAGGCAAAGAGTCTATCGCTCAGGTTGCTGCGATCTCTGCTGCTGATGAGGAAGTCGGAAGCCTTATCGCTGAAGCAATGGAGCGCGTAGGAAACGACGGCGTCATCACAATCGAAGAGTCTAAAGGATTCACAACTGAGCTTGAAGTTG TGGAAGGTATGCAATTCGACCGCGGATATGCGTCTCCTTACATGGTGACTGACTCTGATAAGATGGAAGCGGTTCTCGATAATCCATACATCTTAATCACAGACAAAAAAATCACAAACATTCAAGAAATC CTTCCTGTGCTTGAGCAAGTTGTACAGCAAGGCAAACCATTGCTTCTGATCGCTGAAGATGTTGAAGGTGAAGCTCTTGCTACACTCGTTGTCAACAAACTTCGCGGCACATTCAACGCTGTTGCCGTTAAA
[0205] Alignment of the groEL consensus sequences of the strains KNR42, #220-22, and NS15 revealed that the sequences of the three strains were completely identical, except for differences due to differences in the discard ranges of the 5'- and 3'-terminal sequences.
[0206] The groEL consensus sequence of strain KNR42 was compared to available sequences using the BLAST Nucleotide collection database. Multiple sequences of B. velezensis were matched with 100% similarity. The closest species match among the reference strain sequences was B. velezensis strain FZB42 with 99.24% similarity.
[0207] <recA sequence> The PCR reaction for amplifying the recA gene was set up by adjusting the reaction volume to 50 μL with 25 μL of KOD One® PCR Master Mix, 0.25 μL of forward primer (recAF: SEQ ID NO: 14, sequence shown in Table 2), and 0.25 μL of reverse primer (recAR: SEQ ID NO: 15, sequence shown in Table 2), 0.25 μL of DNA extract, and sterile water. The amplification reaction was carried out using a thermal cycler under the following conditions: initial denaturation at 98°C for 5 seconds, followed by 35 cycles of denaturation at 98°C for 10 seconds, annealing and extension at 69°C for 15 seconds, followed by final extension at 72°C for 3 minutes.
[0208] The size, quality and quantity of the amplified products were assessed by electrophoresis on a 1.0% agarose gel and comparison with molecular weight markers.
[0209] Excess primers, nucleotides, enzymes, and templates were purified using the Wizard SV Gel and PCR Clean-Up System®. Purified PCR products were sequenced using the recAF primer (SEQ ID NO: 14).
[0210] Using the software GENETYX (registered trademark), sequences at the 5' and 3' ends of the sequence data obtained by sequence analysis were discarded because the waveform data indicated low reliability. This resulted in the creation of consensus sequences for the KNR42 strain (500 bp), the #220-22 strain (509 bp), and the NS15 strain (525 bp).
[0211] KNR42 recA consensus sequence (SEQ ID NO: 5) TCATGAAGCTCGGAGAAAAAACGGATACAAGAATTTCAACGGTGCCAAGCGGTTCCCTTGCACTTGATACCGCTCTCGGAATAGGCGGATACCCGCGCGGACGGATTATTGAAGTATACGGACCTGAAAGCTCAGGTAAAACGACTGTAGCGCTTCACGCAATCGCTGAGGTTCAGGAAAAAGGCGGACAGGCAGCATTTATTGATGCTGAGCATGCTCTTGATCCTGTTTACGCGCAAAAGCTCGGTGTCAATATCGAAGAGCTTCTGCTTTCTCAGCCGGATACGGGAGAGCAGGCGCTAGAGATTGCTGAAGCGCTGGTGCGAAGCGGAGCTGTTGATATCGTGGTCGTTGACTCTGTTGCGGCGCTTGTTCCAAAAGCTGAAATTGAAGGTGACATGGGTGATTCACACGTCGGTTTACAGGCGCGTCTTATGTCTCAGGCGCTCCGTAAGCTTTCCGGCGCCATCAATAAATCTAAAACAATCGCAATCTTTATT
[0212] #220-22 recA consensus sequence (SEQ ID NO: 23) TCATGAAGCTCGGAGAAAAAACGGATACAAGAATTTCAACGGTGCCAAGCGGTTCCCTTGCACTTGATACCGCTCTCGGAATAGGCGGATACCCGCGCGGACGGATTATTGAAGTATACGGACCTGAAAGCTCAGGTAAAACGACTGTAGCGCTTCACGCAATCGCTGAGGTTCAGGAAAAAGGCGGACAGGCAGCATTTATTGATGCTGAGCATGCTCTTGATCCTGTTTACGCGCAAAAGCTCGGTGTCAATATCGAAGAGCTTCTGCTTTCTCAGCCGGATACGGGAGAGCAGGCGCTAGAGATTGCTGAAGCGCTGGTGCGAAGCGGAGCTGTTGATATCGTGGTCGTTGACTCTGTTGCGGCGCTTGTTCCAAAAGCTGAAATTGAAGGTGACATGGGTGATTCACACGTCGGTTTACAGGCGCGTCTTATGTCTCAGGCGCTCCGTAAGCTTTCCGGCGCCATCAATAAATCTAAAACAATCGCAATCTTTATTAACCAGATT
[0213] NS15 recA consensus sequence (SEQ ID NO: 28) GGTTCCATCATGAAGCTCGGAGAAAAAACGGATACAAGAATTTCAACGGTGCCAAGCGGTTCCCTTGCACTTGATACCGCTCTCGGAATAGGCGGATACCCGCGCGGACGGATTATTGAAGTATACGGACCTGAAAGCTCAGGTAAAACGACTGTAGCGCTTCACGCAATCGCTGAGGTTCAGGAAAAAGGCGGACAGGCAGCATTTATTGATGCTGAGCATGCTCTTGATCCTGTTTACGCGCAAAAGCTCGGTGTCAATA TCGAAGAGCTTCTGCTTTCTCAGCCGGATACGGGAGAGCAGGCGCTAGAGATTGCTGAAGCGCTGGTGCGAAGCGGAGCTGTTGATATCGTGGTCGTTGACTCTGTTGCGGCGCTTGTTCCAAAAGCTGAA ATTGAAGGTGACATGGGTGATTCACACGTCGGTTTACAGGCGCGTCTTATGTCTCAGGCGCTCCGTAAGCTTTCCGGCGCCATCAATAAATCTAAAACAATCGCAATCTTTATTAACCAGATTCGTGAAAAAA
[0214] Alignment of the recA consensus sequences of the strains KNR42, #220-22, and NS15 revealed that the sequences of the three strains were completely identical, except for differences due to differences in the discard ranges of the 5'- and 3'-terminal sequences.
[0215] The recA consensus sequence of strain KNR42 was compared to available sequences using the BLAST Nucleotide collection database. Multiple sequences of B. velezensis were matched with 100% similarity. The closest species match among the reference strain sequences was B. velezensis strain FZB42 with 99.60% similarity.
[0216]
[0217] Example 2 Biochemical Characterization of Isolates KNR42, #220-22, and NS15 Antibiotic Susceptibility The antibiotic susceptibility of isolates KNR42, #220-22, and NS15 was tested using paper discs. For antibiotics, colonies of KNR42 were suspended in saline and adjusted to a McFarland density of approximately 0.5. A sterile cotton swab was soaked in the suspension and spread on Mueller-Hinton agar medium. After light drying, a KB disc (Eiken Chemical) pre-filled with antibiotics was placed on the plate and incubated at 25°C for 3 days. The results are shown in Tables 3 to 5.
[0218]
[0219]
[0220]
[0221] <Apizyme> Apizyme (Sysmex bioMérieux) is a method for testing various enzyme activities of microorganisms. This test was conducted at Techno Suruga Lab Co., Ltd. Table 6 shows the results of the enzyme activity test for the KNR42 strain, Table 7 shows the results of the enzyme activity test for the #220-22 strain, and Table 8 shows the results of the enzyme activity test for the NS15 strain. In Tables 6, 7, and 8, "+" indicates positive, "-" indicates negative, and "+w" indicates positive (weak reaction).
[0222]
[0223]
[0224]
[0225] <API 50 CHB> API 50 CHB (Sysmex bioMérieux) is a method for testing carbohydrate metabolism in test bacteria. This test was conducted at Techno Suruga Lab Co., Ltd. The results of the carbohydrate metabolism test for strain KNR42 are shown in Table 9, the results of the carbohydrate metabolism test for strain #220-22 are shown in Table 10, and the results of the carbohydrate metabolism test for strain NS15 are shown in Table 11.
[0226]
[0227]
[0228]
[0229]
[0230]
[0231]
[0232] In Tables 9, 10, and 11, "+" indicates positive and "-" indicates negative. As shown in Tables 9, 10, and 11, the KNR42 strain was negative for D-turanose, while the #220-22 and NS15 strains were positive. In addition, the KNR42 and #220-22 strains were negative for inulin, while the NS15 strain was positive. Furthermore, the KNR42 and #220-22 strains were positive for starch, glycogen, and gentiobiose, while the NS15 strain was negative.
[0233] Example 3 Characterization of KNR42, #220-22, and NS15 Strains by MALDI-TOF Protein Profiles Genus and species identification of the KNR42, #220-22, and NS15 strains by MALDI-TOF mass spectrometry protein fingerprinting was performed by Techno Suruga Lab, Inc. The results for the KNR42 strain are summarized in Table 12, the results for the #220-22 strain in Table 13, and the results for the NS15 strain in Table 14. An explanation of each score value is also provided in Table 15.
[0234]
[0235]
[0236]
[0237]
[0238] As shown in Tables 12, 13, and 14, the protein profiles of the KNR42 strain, the #220-22 strain, and the NS15 strain were different.
[0239] Comparison of the obtained protein profile with the MBT Compass® Library revealed that the KNR42 strain showed the highest similarity to Bacillus amyloliquefaciens ssp plantarum with a score of 2.07, followed by Bacillus amyloliquefaciens with a score of 2.00.
[0240] The strain #220-22 showed the highest similarity to Bacillus amyloliquefaciens, with a score value of 1.72. The second and subsequent similarities had low confidence values, making the identification results inconclusive.
[0241] The NS15 strain showed the highest similarity to Bacillus subtilis DSM 5552 DSM with a score of 1.90, followed by Bacillus subtilis ssp subtilis DSM 5660 DSM with a score of 1.84.
[0242] Although there were differences in reliability, the KNR42, #220-22, and NS15 strains were all identified as belonging to the Bacillus subtilis group, which includes Bacillus amyloliquefaciens, B. atrophaeus, B. halotolerans, B. licheniformis, B. mojavensis, B. sonorensis, B. subtilis, and B. vallismortis. These species cannot be distinguished due to similar mass spectral patterns.
[0243] Example 4 Fatty Acid Compositions of KNR42, #220-22, and NS15 Strains The basic procedures for fatty acid extraction and measurement of KNR42, #220-22, and NS15 strains were performed at Techno Suruga Lab, Inc., in accordance with the Sherlock Microbial Identification System (Version 6.0) (MIDI, USA) bacterial fatty acid composition analysis operating manual (Version 6). The results for the KNR42 strain are shown in Table 16, the results for the #220-22 strain in Table 17, and the results for the NS15 strain in Table 18. Comparison of the fatty acid profiles using Calculation Method TSBA6 and Library TSBA6 showed that the KNR42 strain had a similarity index of 0.365 with Bacillus alcalophilus, the #220-22 strain had a similarity index of 0.479 with Bacillus-pumilus-GC subgroup B, and the NS15 strain had a similarity index of 0.348 with Bacillus-pumilus-GC subgroup B.
[0244]
[0245]
[0246]
[0247] Next, the usefulness of the culture according to one embodiment of the present invention as a pest control agent will be specifically explained in the following examples, but the present invention is not limited to these examples.
[0248] Example 5 Characterization of Secondary Metabolites in Culture Medium KNR42, #220-22, and NS15 strains were statically cultured in SS medium at pH 6-9 and 25°C for 12 days to obtain cultures. The resulting cultures were freeze-dried using an FDL-1000 freeze dryer (Tokyo Rikakikai Co., Ltd.). 8.6 g of freeze-dried powder from KNR42, 8.8 g of freeze-dried powder from #220-22, and 8.8 g of freeze-dried powder from NS15 strain were obtained. Each of the resulting powders was immersed in 20 mL of methanol adjusted to pH 3 with trifluoroacetic acid for 2 hours, stirred, and centrifuged at 4°C and 3,000 rpm for 10 minutes to separate the supernatant and precipitate. The supernatant was dried under vacuum using a rotary evaporator to obtain a crude oil extract.
[0249] 500 μL of the crude oil extract was dissolved in an equal volume of methanol and fractionated every 2 minutes using the preparative high performance liquid chromatography (preparative HPLC conditions) shown below to obtain fractions. Note that in the preparative HPLC conditions below, "number / number" refers to the volume ratio of each solvent unless otherwise specified.
[0250] [Preparative HPLC Conditions] Apparatus: Pure C-850 (manufactured by Buchi) Column: YMC-PackPro C18 column (manufactured by YMC, 250 x 20, 5 μm) Column temperature: room temperature Injection volume: 400 μL Solvent: Solution A: 0.1 vol% trifluoroacetic acid aqueous solution Solution B: 0.1 vol% trifluoroacetic acid-acetonitrile solution Gradient conditions: Flow rate: 10 mL / min. After starting the measurement with a mixture ratio of Solution A and Solution B of 55 / 45, the mixture ratio of Solution A and Solution B was changed linearly to 50 / 50 over 5 minutes. Then, the mixture ratio of Solution A and Solution B was changed linearly to 30 / 70 over 15 minutes. Then, the mixture ratio of Solution A and Solution B was changed linearly to 0 / 100 over 3 minutes. Then, only Solution B was pumped for 20 minutes. Detection equipment: photodiode array detector (wavelength: 190-400 nm), evaporative light scattering detector
[0251] The obtained fractions were concentrated under reduced pressure using a CEV-2100 centrifugal evaporator to obtain 10-fold concentrated fractions of each fraction, which were then subjected to an antibacterial activity test using the bioassay method described in Example 5-1.
[0252] [Example 5-1] Fungal pathogens Botrytis cinerea, Septoria nodorum, and Colletotrichum orbiculare were inoculated into 90mm diameter Petri dishes containing PDA medium, and the resulting cultures were incubated at 25°C for 5 days. A loopful of the fungal culture was removed and added to a 30% (volume) glycerol solution to obtain a glycerol stock. 1 mL of the resulting glycerol stock for each fungus was mixed with PDA medium in a 90mm diameter Petri dish to prepare a Petri dish for evaluation. 3 μL of the 10x concentrated fraction obtained by the above method was added dropwise to each quadrant of the evaluation dish and allowed to dry for 10 minutes. The evaluation dishes were then incubated at 25°C for 48 hours, and the inhibition zone around the drop of the 10x concentrated fraction was evaluated on a three-point scale. The results are shown in Table 19 for the fraction derived from KNR42 strain, Table 20 for the fraction derived from #220-22 strain, and Table 21 for the fraction derived from NS15. The fractions derived from KNR42 strain were designated K-1 to K-22, the fractions derived from #220-22 strain R-1 to R-22, and the fractions derived from NS15 N-1 to N-22.
[0253] The evaluation results of antibacterial activity in Tables 19 to 21 are as follows: +++ Strong antibacterial activity ++ Medium antibacterial activity + Weak antibacterial activity - No antibacterial activity
[0254]
[0255]
[0256]
[0257] Of the fractions shown in Tables 19 to 21, those that showed activity of ++ or higher were analyzed by liquid chromatography mass spectrometry (LC / MS analysis conditions) described below. Retention times and associated mass ions (hereinafter referred to as m / z) were measured by electrospray ionization (ESI) under the following conditions. In each chromatography and experimental procedure, "number / number" refers to the volume ratio of each solvent unless otherwise specified.
[0258] [LC / MS Analysis Conditions] Apparatus: 1290 Infinity II (Agilent Technologies) / 6546 LC / Q-TOF (ESI mode, Agilent Technologies) Column: YMC Pack Pro C18 column (YMC, 2.0 × 150 mm, 3 μm) Column temperature: 40°C Injection volume: 1 μL Solvent: Solution A: 0.1 vol% formic acid aqueous solution Solution B: 0.1 vol% formic acid-acetonitrile solution Gradient conditions: Flow rate: 0.3 mL / min. After starting the measurement with a mixture ratio of Solution A and Solution B of 55 / 45, the mixture ratio of Solution A and Solution B was linearly changed to 50 / 50 over 5 minutes. Then, the mixture ratio of Solution A and Solution B was linearly changed to 30 / 70 over 15 minutes. Then, the mixture ratio of Solution A and Solution B was linearly changed to 0 / 100 over 3 minutes. Then, only Solution B was pumped for 20 minutes. Detection equipment: Photodiode array detector (wavelength: 190-400 nm) Data analysis software: Qualitative Analysis 10.0
[0259] The analytical results of the fractions derived from the KNR42 strain are shown in Table 22, those of the #220-22 strain are shown in Table 23, and those of the NS15 strain are shown in Table 24. In the tables, "○" indicates the peak value detected in each fraction.
[0260]
[0261]
[0262]
[0263] Based on the m / z obtained from LC / MS analysis of each fraction, the molecular weight and isolation source were compared with the results of a search for "bacillus" in the compound database "Dictionary of Natural Products," and the secondary metabolic compounds were estimated. As described in Microbial Cell Factories 13(144) 2014 pp1-15 (https: / / doi.org / 10.1186 / s12934-014-0144-x) and PLOS ONE 13(8) 2018 e0202893 (https: / / doi.org / 10.1371 / journal.pone.0202893), "iturin analogues" are "cyclic heptapeptides linked to a β-amino fatty acid chain with 14 to 18 carbon atoms," while fengycin analogues are "cyclic octapeptide-containing decapeptides linked to a β-hydroxy fatty acid chain with 12 to 19 carbon atoms," as described in PLOS ONE 13(8) 2018 e0202893 (https: / / doi.org / 10.1371 / journal.pone.0202893).
[0264] Fraction K-3 contained a substance with a molecular weight of 1462, based on a molecular ion peak at 1463.80 (M+H) in positive ion mode at a retention time of 8.80 min. This determination revealed an apparent molecular weight ion peak at 732.41 (M+H), a doubly charged ion. This result suggested the compound to be one of the following: plipastatin A1 (CAS Registry Number: 103651-09-8), SNA 60-367-2 (CAS Registry Number: 193738-68-0), or a fengycin-related substance. Numbers prefixed with "SNA" indicate compounds registered in the Dictionary of Natural Products.
[0265] Fractions K-7 and K-8 contained a substance with a molecular weight of 1070 based on a molecular ion peak at 1071.58 (M+H) in positive ion mode at a retention time of 9.46 minutes. This determination revealed an apparent molecular weight ion peak at 1093.56 (M+Na). Based on these results, it was presumed to be an iturin-related substance.
[0266] Fractions K-8, K-9, K-10, and K-13 contained a substance with a molecular weight of 1490 based on a molecular ion peak at 1491.83 (M+H) in positive ion mode at a retention time of 9.08 minutes. This determination revealed an apparent molecular weight ion peak at 746.21 (M+H), a doubly charged ion. Based on these results, this substance was presumed to be SNA 60-367-23 (CAS Registry Number: 193738-81-7) or a fengycin-related substance.
[0267] Fractions K-9, K-10, and K-13 contained a substance with a molecular weight of 1476 based on a molecular ion peak at 1477.81 (M+H) in positive ion mode at a retention time of 9.08 minutes. This determination showed an apparent molecular weight ion peak at 739.41 (M+H), a doubly charged ion. This result was consistent with C 17 -fengycin A (CAS Registry Number: 1229022-13-2), SNA 60-367-4 (CAS Registry Number: 193738-69-1), SNA 60-367-17 (CAS Registry Number: 193738-77-1), Plipastatin A 2 (CAS Registry Number: 103955-72-2), SNA 60-367-18 (CAS Registry Number: 193738-78-2), SNA 60-367-21 (CAS Registry Number: 193738-80-6), or a fengycin-related substance.
[0268] The K-10 fraction contained a substance with a molecular weight of 1546 based on a molecular ion peak at 1547.86 (M+H) in positive ion mode at a retention time of 9.15 minutes. This determination showed an apparent molecular weight ion peak at 774.43 (M+H), a doubly charged ion. Based on these results, it was presumed to be a fengycin-related substance.
[0269] Fraction K-10 contained a substance with a molecular weight of 1490 based on a molecular ion peak at 1491.83 (M+H) in positive ion mode at a retention time of 9.16 minutes. This determination revealed an apparent molecular weight ion peak at 746.91 (M+H), a doubly charged ion. Based on these results, this substance was presumed to be SNA 60-367-23 (CAS Registry Number: 193738-81-7) or a fengycin-related substance.
[0270] Fractions K-10 and K-13 contained a substance with a molecular weight of 1560 based on a molecular ion peak at 1561 (M+H) in positive ion mode at a retention time of 9.20 minutes. This determination showed an apparent molecular weight ion peak at 781.94 (M+H), a doubly charged ion. Based on these results, it was presumed to be a fengycin-related substance.
[0271] The K-11 fraction contained a substance with a molecular weight of 1448, based on a molecular ion peak at 1449.78 (M+H) in positive ion mode at a retention time of 8.60 minutes. This determination revealed an apparent molecular weight ion peak at 725.39 (M+H), a doubly charged ion. Based on these results, this substance was presumed to be SNA 60-367-14 (CAS Registry Number: 193738-76-0) or a fengycin-related substance.
[0272] The K-11 and K-14 fractions contained a substance with a molecular weight of 1504 based on a molecular ion peak at 1505.85 (M+H) in positive ion mode at a retention time of 9.35 minutes. This determination showed an apparent molecular weight ion peak at 753.42 (M+H), a doubly charged ion. From these results, C 17 The substance was estimated to be one of the following: fengycin B (CAS Registry Number: 1229022-16-5), plipastatin B2 (CAS Registry Number: 103955-74-4), fengycin XII (CAS Registry Number: 256481-87-5), SNA 60-367-13 (CAS Registry Number: 193738-75-9), or a fengycin-related substance.
[0273] The K-12 fraction contained a substance with a molecular weight of 1462, based on a molecular ion peak at 1463.80 (M+H) in positive ion mode at a retention time of 8.83 minutes. This determination revealed an apparent molecular weight ion peak at 732.40 (M+H), a doubly charged ion. This result suggested that the substance was either plipastatin A1 (CAS Registry Number: 103651-09-8), SNA 60-367-2 (CAS Registry Number: 193738-68-0), or a fengycin-related substance.
[0274] The K-12 fraction contained a substance with a molecular weight of 1504 based on a molecular ion peak at 1505.85 (M+H) in positive ion mode at a retention time of 9.40 min. This determination showed an apparent molecular weight ion peak at 753.42 (M+H), a doubly charged ion. From these results, C 17 The substance was estimated to be one of the following: fengycin B (CAS Registry Number: 1229022-16-5), plipastatin B2 (CAS Registry Number: 103955-74-4), fengycin XII (CAS Registry Number: 256481-87-5), SNA 60-367-13 (CAS Registry Number: 193738-75-9), or a fengycin-related substance.
[0275] The K-13 fraction contained a substance with a molecular weight of 1546 based on a molecular ion peak at 1547.86 (M+H) in positive ion mode at a retention time of 9.08 minutes. This determination showed an apparent molecular weight ion peak at 774.43 (M+H), a doubly charged ion. Based on these results, it was presumed to be a fengycin-related substance.
[0276] The K-13 fraction contained a substance with a molecular weight of 1490 based on a molecular ion peak at 1491.83 (M+H) in positive ion mode at a retention time of 9.22 minutes. This determination revealed an apparent molecular weight ion peak at 746.91 (M+H), a doubly charged ion. Based on these results, the substance was presumed to be SNA 60-367-23 (CAS Registry Number: 193738-81-7) or a fengycin-related substance.
[0277] Fractions R-9 and R-10 contained a substance with a molecular weight of 1448 based on a molecular ion peak at 1449.79 (M+H) in positive ion mode at a retention time of 8.60 minutes. This determination revealed an apparent molecular weight ion peak at 725.39 (M+H), a doubly charged ion. Based on these results, this substance was presumed to be SNA 60-367-14 (CAS Registry Number: 193738-76-0) or a fengycin-related substance.
[0278] Fractions R-10 and R-11 contained a substance with a molecular weight of 1462 based on a molecular ion peak at 1463.80 (M+H) in positive ion mode at a retention time of 8.80 min. This determination revealed an apparent molecular weight ion peak at 732.40 (M+H), a doubly charged ion. This result suggested that the substance was either plipastatin A1 (CAS Registry Number: 103651-09-8), SNA 60-367-2 (CAS Registry Number: 193738-68-0), or a fengycin-related substance.
[0279] Fractions R-10, R-11, and R-12 contained a material with a molecular weight of 1476 based on a molecular ion peak at 1477.81 (M+H) in positive ion mode at a retention time of 8.80 min. This determination showed an apparent molecular weight ion peak at 739.41 (M+H), a doubly charged ion. This result was consistent with C 17 -fengycin A (CAS Registry Number: 1229022-13-2), SNA 60-367-4 (CAS Registry Number: 193738-69-1), SNA 60-367-17 (CAS Registry Number: 193738-77-1), Plipastatin A 2 (CAS Registry Number: 103955-72-2), SNA 60-367-18 (CAS Registry Number: 193738-78-2), SNA 60-367-21 (CAS Registry Number: 193738-80-6), or a fengycin-related substance.
[0280] The R-10 fraction contained a material with a molecular weight of 1476 based on a molecular ion peak at 1477.81 (M+H) in positive ion mode at a retention time of 8.83 minutes. This determination showed an apparent molecular weight ion peak at 739.41 (M+H), a doubly charged ion. This result supports the conclusion that C 17 -fengycin A (CAS Registry Number: 1229022-13-2), SNA 60-367-4 (CAS Registry Number: 193738-69-1), SNA 60-367-17 (CAS Registry Number: 193738-77-1), Plipastatin A 2 (CAS Registry Number: 103955-72-2), SNA 60-367-18 (CAS Registry Number: 193738-78-2), SNA 60-367-21 (CAS Registry Number: 193738-80-6), or a fengycin-related substance.
[0281] The R-12 fraction contained a material with a molecular weight of 1476 based on a molecular ion peak at 1477.82 (M+H) in positive ion mode at a retention time of 9.08 minutes. This determination showed an apparent molecular weight ion peak at 739.41 (M+H), a doubly charged ion. This result supports the conclusion that C 17 -fengycin A (CAS Registry Number: 1229022-13-2), SNA 60-367-4 (CAS Registry Number: 193738-69-1), SNA 60-367-17 (CAS Registry Number: 193738-77-1), Plipastatin A 2 (CAS Registry Number: 103955-72-2), SNA 60-367-18 (CAS Registry Number: 193738-78-2), SNA 60-367-21 (CAS Registry Number: 193738-80-6), or a fengycin-related substance.
[0282] The R-12 fraction contained a substance with a molecular weight of 1490 based on a molecular ion peak at 1491.83 (M+H) in positive ion mode at a retention time of 9.08 minutes. This determination revealed an apparent molecular weight ion peak at 746.21 (M+H), a doubly charged ion. Based on these results, the substance was presumed to be SNA 60-367-23 (CAS Registry Number: 193738-81-7) or a fengycin-related substance.
[0283] The R-12 fraction contained a substance with a molecular weight of 1546 based on a molecular ion peak at 1547.86 (M+H) in positive ion mode at a retention time of 9.08 minutes. This determination showed an apparent molecular weight ion peak at 774.43 (M+H), a doubly charged ion. Based on these results, it was presumed to be a fengycin-related substance.
[0284] Fractions R-12 and R-13 contained a substance with a molecular weight of 1560 based on a molecular ion peak at 1561.87 (M+H) in positive ion mode at a retention time of 9.20 minutes. This determination showed an apparent molecular weight ion peak at 781.44 (M+H), a doubly charged ion. Based on these results, it was presumed to be a fengycin-related substance.
[0285] The R-13 fraction contained a substance with a molecular weight of 1490 based on a molecular ion peak at 1491.83 (M+H) in positive ion mode at a retention time of 9.22 minutes. This determination revealed an apparent molecular weight ion peak at 746.42 (M+H), a doubly charged ion. Based on these results, the substance was presumed to be SNA 60-367-23 (CAS Registry Number: 193738-81-7) or a fengycin-related substance.
[0286] Fractions R-13 and R-14 contained a substance with a molecular weight of 1504 based on a molecular ion peak at 1505.85 (M+H) in positive ion mode at a retention time of 9.35 minutes. This determination showed an apparent molecular weight ion peak at 753.42 (M+H), a doubly charged ion. From these results, C 17The substance was estimated to be one of the following: fengycin B (CAS Registry Number: 1229022-16-5), plipastatin B2 (CAS Registry Number: 103955-74-4), fengycin XII (CAS Registry Number: 256481-87-5), SNA 60-367-13 (CAS Registry Number: 193738-75-9), or a fengycin-related substance.
[0287] The R-14 fraction contained a substance with a molecular weight of 1518 based on a molecular ion peak at 1519.86 (M+H) in positive ion mode at a retention time of 9.58 minutes. This determination showed an apparent molecular weight ion peak at 760.43 (M+H), a doubly charged ion. Based on these results, it was presumed to be a fengycin-related substance.
[0288] The N-10 fraction contained a substance with a molecular weight of 1448, based on a molecular ion peak at 1449.78 (M+H) in positive ion mode at a retention time of 8.60 minutes. This determination revealed an apparent molecular weight ion peak at 725.39 (M+H), a doubly charged ion. Based on these results, the substance was presumed to be SNA 60-367-14 (CAS Registry Number: 193738-76-0) or a fengycin-related substance.
[0289] The N-10 fraction contained a substance with a molecular weight of 1518 based on a molecular ion peak at 1519.82 (M+H) in positive ion mode at a retention time of 8.64 minutes. This determination showed an apparent molecular weight ion peak at 760.41 (M+H), a doubly charged ion. Based on these results, it was presumed to be a fengycin-related substance.
[0290] The N-10 fraction contained a substance with a molecular weight of 1462, based on a molecular ion peak at 1463.80 (M+H) in positive ion mode at a retention time of 8.83 minutes. This determination revealed an apparent molecular weight ion peak at 732.40 (M+H), a doubly charged ion. This result suggested that the compound was either plipastatin A1 (CAS Registry Number: 103651-09-8), SNA 60-367-2 (CAS Registry Number: 193738-68-0), or a fengycin-related substance.
[0291] Fractions N-10, N-11, and N-12 contained a material with a molecular weight of 1476 based on a molecular ion peak at 1477.81 (M+H) in positive ion mode at a retention time of 8.83 minutes. This determination showed an apparent molecular weight ion peak at 739.41 (M+H), a doubly charged ion. This result supports the conclusion of C 17 -fengycin A (CAS Registry Number: 1229022-13-2), SNA 60-367-4 (CAS Registry Number: 193738-69-1), SNA 60-367-17 (CAS Registry Number: 193738-77-1), Plipastatin A 2 (CAS Registry Number: 103955-72-2), SNA 60-367-18 (CAS Registry Number: 193738-78-2), SNA 60-367-21 (CAS Registry Number: 193738-80-6), or a fengycin-related substance.
[0292] The N-11 fraction contained a substance with a molecular weight of 1462, based on a molecular ion peak at 1463.79 (M+H) in positive ion mode at a retention time of 8.80 min. This determination revealed an apparent molecular weight ion peak at 732.40 (M+H), a doubly charged ion. This result suggested that the compound was either plipastatin A1 (CAS Registry Number: 103651-09-8), SNA 60-367-2 (CAS Registry Number: 193738-68-0), or a fengycin-related substance.
[0293] The N-10 fraction contained a substance with a molecular weight of 1532 based on a molecular ion peak at 1533.84 (M+H) in positive ion mode at a retention time of 8.83 minutes. This determination showed an apparent molecular weight ion peak at 767.42 (M+H), a doubly charged ion. Based on these results, it was presumed to be a fengycin-related substance.
[0294] The N-12 fraction contained a substance with a molecular weight of 1490 based on a molecular ion peak at 1491.83 (M+H) in positive ion mode at a retention time of 9.08 minutes. This determination revealed an apparent molecular weight ion peak at 746.42 (M+H), a doubly charged ion. Based on these results, this substance was presumed to be SNA 60-367-23 (CAS Registry Number: 193738-81-7) or a fengycin-related substance.
[0295] The N-12 fraction contained a substance with a molecular weight of 1560 based on a molecular ion peak at 1561.87 (M+H) in positive ion mode at a retention time of 9.20 minutes. This determination showed an apparent molecular weight ion peak at 781.44 (M+H), a doubly charged ion. Based on these results, it was presumed to be a fengycin-related substance.
[0296] The N-12 and N-13 fractions contained a substance with a molecular weight of 1504 based on a molecular ion peak at 1505.85 (M+H) in positive ion mode at a retention time of 9.35 minutes. This determination showed an apparent molecular weight ion peak at 753.42 (M+H), a doubly charged ion. From these results, C 17 The substance was estimated to be one of the following: fengycin B (CAS Registry Number: 1229022-16-5), plipastatin B2 (CAS Registry Number: 103955-74-4), fengycin XII (CAS Registry Number: 256481-87-5), SNA 60-367-13 (CAS Registry Number: 193738-75-9), or a fengycin-related substance.
[0297] [Example 6] Cucumber anthracnose effect test 90 cm 3 Cucumbers (variety: Sagami Hanpaku) were planted in plastic pots and grown to the cotyledon stage. The KNR42 and #220-22 strains were each cultured in CP-YD medium at pH 6-9 and 25°C for 5 days with shaking at 180 rpm until the cell density reached 3.4 x 10 7 CFU / mL of KNR42 CP-YD medium culture and the bacterial cell concentration was 3.6 × 10 8The #220-22 CP-YD medium cultures were obtained, with a CFU / mL. The bacterial cell concentration was measured by the plate smear method. Specifically, the resulting cultures were serially diluted 10,000,000 times with physiological saline, and 0.1 mL of each diluted solution was smeared onto LBA medium and cultured at 25°C for 48 hours. The resulting colonies were visually counted, and the CFU per mL of culture was calculated by multiplying the number of colonies by the dilution factor. The resulting KNR42 CP-YD medium cultures and #220-22 CP-YD medium cultures were sprayed with a spray gun at 5 mL per pot.
[0298] In addition, the KNR42 strain, the #220-22 strain, and the NS15 strain were each statically cultured in SS medium at pH 6 to 9 and 25°C for 10 days until the bacterial cell concentration reached 1.8 × 10 8 CFU / mL of KNR42 SS medium culture, bacterial cell concentration 8.1 × 10 8 CFU / mL of #220-22 SS medium culture, bacterial cell concentration 9.9 x 10 7 NS15 SS medium cultures with a bacterial cell concentration of 100 CFU / mL were obtained. The bacterial cell concentration was calculated by the plate spread method described in Example 6. 5 mL of the KNR42 extract, #220-22 extract, and NS15 extract extracted from the resulting KNR42 SS medium culture, #220-22 SS medium culture, and NS15 SS medium culture were sprayed per pot using a spray gun.
[0299] The day after spraying, a conidial suspension (1 x 10 6 The cucumber plants were inoculated by spraying a solution of 100mg of the ointment (100mg / mL) onto the cucumbers, which were then placed in an inoculation box at a temperature of 25°C and a humidity of 100% RH for 2 days. The plants were then placed in a greenhouse (23°C) and kept there for 5 days. The proportion of the formed lesions on the inoculated leaves was measured, and the control titer was calculated according to the following formula. The test results are shown in Table 25. Control titer = [1 - (disease area rate in treated area / disease area rate in untreated area)] x 100
[0300] The KNR42 extract, #220-22 extract, and NS15 extract in this test were obtained by centrifuging 200 mL of KNR42 culture, #220-22 culture, and NS15 culture, respectively, and mixing the microbial cells with 200 mL of a mixed solution of acetone and water [acetone:water = 1:1 (volume ratio)], followed by removing the residue.
[0301]
[0302] [Example 7] Preventive effect test for gray mold on cucumber 90 cm 3 Cucumbers (variety: Sagami Hanpaku) were planted in plastic pots and grown to the cotyledon stage. The KNR42 strain or the #220-22 strain was cultured in MH medium or CP-YD medium at pH 6-9 and 25°C for 5 days with shaking at 180 rpm until the cell density reached 1.4 × 10 8 CFU / mL of KNR42 MH medium culture, 3.4 × 10 7 CFU / mL of KNR42 CP-YD medium culture, 3.6 x 10 8 In addition, the KNR42, #220-22, and NS15 strains were each statically cultured in SS medium at pH 6-9 and 25°C for 10 days, resulting in a bacterial cell concentration of 1.8 × 10 8 CFU / mL of KNR42 SS medium culture, bacterial cell concentration 8.1 × 10 8 CFU / mL of #220-22 SS medium culture, bacterial cell concentration 9.9 x 10 7 CFU / mL of NS15 SS medium cultures were obtained. The bacterial cell concentration was calculated by the plate smear method described in Example 6. The culture supernatant obtained by removing the bacterial cells from the resulting KNR42 culture, #220-22 culture, and NS15 culture was sprayed at 5 mL per pot using a spray gun. After air drying, the treated leaves were cut off and placed in a plastic container. A conidial suspension (1 x 10 6The treated leaves were mixed with the dissolved PDA medium at a volume ratio of 1:1 (cells / mL) and inoculated with 30 μL of the solution dropwise onto the treated leaves. After inoculation, the leaves were left at 20°C and high humidity (100% RH) for 3 days. The diameter of the lesions formed was then measured, and the control titer was calculated according to the following formula. The test results are shown in Table 26. Control titer = [1 - (lesion spot diameter in treated area / lesion spot diameter in untreated area)] x 100
[0303]
[0304] [Example 8] Soybean rust disease effect test 90 cm 3 Soybean (cultivar: Enrei) was planted in a plastic pot and grown to the single-leaf stage. The KNR42, #220-22, and NS15 strains were each cultured in ST medium at pH 6-9 and 25°C for 5 days with shaking at 180 rpm until the cell density reached 7.5 x 10 7 CFU / mL of KNR42 culture, with a bacterial cell concentration of 5.5 × 10 8 CFU / mL of #220-22 culture, with a bacterial cell concentration of 4.0 x 10 7 The NS15 culture was obtained, with a concentration of 100 CFU / mL. The bacterial cell concentration was calculated by the plate smear method described in Example 6. The culture supernatant obtained by removing the bacterial cells from the resulting KNR42 culture, #220-22 culture, and NS15 culture was sprayed at 5 mL per pot with a spray gun. The day after spraying, a conidial suspension (1 x 10 6 Soybeans were inoculated by spraying a solution of 100mg ...
[0305]
[0306] Example 9: Testing the efficacy of Chinese cabbage against soft rot disease. The core of Chinese cabbage was cut into 3 cm squares and disinfected by spraying with 70% by volume ethanol. It was then immersed in a 0.5% by volume aqueous solution of sodium hypochlorite for 20 minutes. It was washed three times with distilled water, the surface moisture was removed with paper, and a hole was made in the center of the core with a pin holder. The KNR42, #220-22, and NS15 strains were each cultured with shaking at 180 rpm for 5 days in PD medium or CP-YD medium at pH 6-9 and 25°C until the bacterial cell concentration reached 1.2 x 10 8 CFU / mL of KNR42 PD medium culture, bacterial cell concentration 9.1 × 10 7 CFU / mL of #220-22 PD medium culture, bacterial cell concentration 3.4 x 10 7 CFU / mL of KNR42 CP-YD medium culture, with a bacterial cell concentration of 3.6 × 10 8 CFU / mL of #220-22 CP-YD medium culture, bacterial cell concentration 1.4 x 10 7 NS15 CP-YD medium cultures were obtained with a concentration of CFU / mL. The bacterial cell concentration was calculated using the plate smear method described in Example 6. 200 μL of the resulting KNR42, #220-22, and NS15 cultures were applied with a brush per treated Chinese cabbage core section. After air drying, the cultures were placed in plastic containers. Pectobacterium carotovorum cells, which had been cultured in YPD medium for 16 hours, were added to 1 / 2 YPD medium, adjusted to an OD600 of 0.2, and inoculated dropwise at 50 μL into the center of the Chinese cabbage core. After inoculation, the samples were placed at 30°C and humid (100% RH) for 1 day. The percentage of lesions formed on the Chinese cabbage core was then measured, and the control value was calculated using the same formula as in Example 6. The test results are shown in Table 28.
[0307]
[0308] [Example 10] Tomato late blight effect test 90 cm 3 Tomatoes (variety: Momotaro) were planted in plastic pots and grown to the two-leaf stage. The KNR42, #220-22, and NS15 strains were each statically cultured in SS medium at pH 6-9 and 25°C for 10 days until the cell concentration reached 1.8 x 10 8CFU / mL of KNR42 SS medium culture, bacterial cell concentration 8.1 × 10 8 CFU / mL of #220-22 SS medium culture, bacterial cell concentration 9.9 x 10 7 In addition, the KNR42 strain and the NS15 strain were each cultured in ST medium at pH 6-9 and 25°C for 5 days with shaking at 180 rpm until the bacterial cell concentration reached 7.5 × 10 7 CFU / mL of KNR42 cultured in ST medium, with a bacterial cell concentration of 4.0 × 10 7 CFU / mL of NS15 ST medium cultures were obtained. The bacterial cell concentration was calculated by the plate smear method described in Example 6. The KNR42 extract, #220-22 extract, and NS15 extract, extracted from the resulting KNR42 culture, #220-22 culture, and NS15 culture, respectively, were sprayed at 5 mL per pot using a spray gun. The day after spraying, a spore suspension (1 x 10) of Phytophthora infestans was added to the pots. 4 The plants were sprayed with a concentration of 1000mg / mL (1000mg / mL) and placed overnight in an inoculation box at 20°C and 100% RH. The plants were then placed in a greenhouse (23°C), and the percentage of lesion area formed on the inoculated leaves 7 days after inoculation was measured, and the control titer was calculated using the same formula as in Example 6. The test results are shown in Table 29. The KNR42 extract, #220-22 extract, and NS15 extract in this test were obtained by centrifuging 200 mL of KNR42 culture, #220-22 culture, and NS15 culture, respectively, to obtain bacterial cells, mixing the bacterial cells with 200 mL of a mixed solution of acetone and water [acetone:water = 1:1 (volume ratio)], and removing the residue.
[0309]
[0310] [Example 11] Wheat blight control effect test 90 cm 3 Wheat (variety: Haruyutaka) was planted in plastic pots and grown to the 1.3 leaf stage. The KNR42, #220-22, and NS15 strains were each cultured in ST medium or CP-YD medium at pH 6-9 and 25°C for 5 days with shaking at 180 rpm until the cell density reached 7.5 x 10 7CFU / mL of KNR42 ST medium culture, 3.4 × 10 7 CFU / mL of KNR42 CP-YD medium culture, 5.5 x 10 8 CFU / mL of #220-22 ST medium culture, 3.6 x 10 8 CFU / mL #220-22 CP-YD medium culture, 4.0 x 10 7 NS15 ST medium culture with 1.4 x 10 CFU / mL 7 NS15 CP-YD medium cultures with a CFU / mL were obtained. The fungal cell concentration was calculated using the plate smear method described in Example 6. The resulting KNR42, #220-22, and NS15 cultures were sprayed at 5 mL per pot using a spray gun. One day after spraying, wheat plants were inoculated by spraying with a conidial suspension of Septoria nodorum, and then placed in an inoculation box at 20°C and 100% RH for two days. The plants were then placed in an air-conditioned greenhouse (20°C, 80% RH) and maintained for eight days. The proportion of lesions formed on the inoculated leaves was measured, and the control titer was calculated according to the following formula. The test results are shown in Table 30. Control titer = [1 - (lesion area ratio in treated area / lesion area ratio in untreated area)] x 100
[0311]
[0312] [Example 12] Cucumber downy mildew effect test 90 cm 3 Cucumbers (variety: Sagami Hanpaku) were planted in plastic pots and grown to the 1.5 leaf stage. The KNR42, #220-22, and NS15 strains were each statically cultured in SS medium at pH 6-9 and 25°C for 10 days until the cell concentration reached 1.8 x 10 8 CFU / mL of KNR42 SS medium culture, bacterial cell concentration 9.9 × 10 7 NS15 SS medium cultures were obtained with a bacterial cell concentration of 100 CFU / mL. The bacterial cell concentration was calculated by the plate smear method described in Example 6. The resulting KNR42 cultures and NS15 cultures were sprayed with a spray gun at 5 mL per pot. The day after spraying, a spore suspension (2 x 10 5The plants were inoculated by spraying a concentration of 100mg / mL of 100mg ...
[0313]
[0314] [Example 13] Insecticidal test against Meloidogyne incognita KNR42 strain was statically cultured in SS medium at pH 6 to 9 and 25°C for 10 days until the fungal cell concentration reached 7.7 x 10 8 The KNR42 strain was cultured in MH medium at pH 6-9 and 25°C for 5 days with shaking at 180 rpm until the bacterial cell concentration reached 1.1 × 10 8 A KNR42 MH medium culture with a cell density of 100 CFU / mL was obtained. The bacterial cell concentration was calculated using the plate smear method described in Example 6. 10 μL of the obtained KNR42 culture was added to each well of a 96-well plate. 40 μL of sterilized water containing second-stage larvae of Meloidogyne incognita (5 second-stage larvae / 4 μL) was added to each well and allowed to stand at 25°C in the dark. The number of inactive larvae was counted 4 days after the addition of the culture medium, and the efficacy (%) relative to the untreated group was calculated using the following formula: efficacy (%) = [(number of inactive larvae) / number of active larvae in the untreated group] × 100
[0315] As a result, both the KNR42 SS medium culture and the KNR42 MH medium culture tested showed an efficiency (%) of 50% or more.
[0316] [Example 14] Insecticidal test against diamondback moth In MH medium, the #220-22 strain was cultured at pH 6 to 9 and 25°C for 5 days with shaking at 180 rpm until the fungal cell concentration reached 4.0 x 10 8 The NS15 strain was cultured in CP-YD medium at pH 6-9 and 25°C for 5 days with shaking at 180 rpm until the cell concentration reached 2.3 × 10 8The KNR42 strain was then statically cultured in SS medium at pH 6-9 and 25°C for 10 days until the bacterial cell concentration reached 1.5 x 10 8 A KNR42 SS medium culture with a cell density of 0.03 CFU / mL was obtained. The bacterial cell concentration was calculated using the plate smear method described in Example 6. A chemical solution was prepared by adding Admix (registered trademark) as a spreading agent to the obtained culture to a final concentration of 0.03% by volume. Cabbage leaves were immersed in this chemical solution for approximately 10 seconds, air-dried, and then placed in a petri dish. Second-instar larvae of the diamondback moth (Plutella xylostella) were released into the dish, five per dish, and the dish was then covered and placed in a thermostatic chamber at 25°C. The number of dead insects after 6 days was counted, and the mortality rate was calculated using the following formula. The test was conducted in duplicate. Mortality rate (%) = (number of dead insects / number of released insects) x 100
[0317] As a control, a drug solution prepared by adding Admix (registered trademark) to MH medium, CP-YD medium, or SS medium to a final concentration of 0.03% by volume was tested.
[0318] As a result, the mortality rates of the control MH medium, CP-YD medium, and SS medium were all 0%, while the #220-22 MH medium culture, NS15 CP-YD medium culture, and KNR42 SS medium culture all showed mortality rates of 80% or more.
[0319] [Example 15] Insecticidal test against green peach aphid The KNR42 strain was statically cultured in SS medium at pH 6 to 9 and 25°C for 10 days until the fungal cell concentration reached 1.5 x 10 8 A KNR42 SS medium culture with a bacterial cell concentration of 0.03 CFU / mL was obtained. The bacterial cell concentration was calculated by the plate smear method described in Example 6. A chemical solution was prepared by adding Admix (registered trademark) as a spreading agent to the obtained culture to a final concentration of 0.03% by volume. Wet absorbent cotton was placed in a glass petri dish with an inner diameter of 3 cm, and a kale leaf of the same diameter was placed on top of it. Four wingless female adult peach aphids (Myzus persicae) were released, and one day later the prepared chemical solution was sprayed (2.5 mg / cm) in a rotary spray tower. 2) and placed in a thermostatic chamber at 25°C. After 6 days, the number of dead insects was counted and the mortality rate was calculated using the same formula as in Example 14. The test was conducted in two groups.
[0320] As a control, a drug solution prepared by adding Admix (registered trademark) to SS medium to a final concentration of 0.03% by volume was used.
[0321] As a result, the mortality rate of the control SS medium was 0%, whereas the KNR42 SS medium cultures tested showed a mortality rate of 80% or more.
[0322] [Example 16] Insecticidal test against two-spotted spider mites. The #220-22 strain was statically cultured in SS medium at pH 6 to 9 and 25°C for 10 days until the fungal cell concentration reached 5.5 x 10 8 A #220-22 SS medium culture was obtained, with a final concentration of CFU / mL. The bacterial cell concentration was calculated using the plate smear method described in Example 6. A drug solution was prepared by adding Admix (registered trademark) as a spreading agent to the resulting culture to a final concentration of 0.03% by volume. Kidney bean leaves were cut and placed on moist filter paper in a 7-cm inner diameter polystyrene cup. Twospotted spider mite (Tetranychus urticae) larvae were inoculated onto each cup, at 10 per leaf. The prepared drug solution was sprayed at 2.5 mL per polystyrene cup using a rotary spray tower and placed in a thermostatic chamber at 25°C. The number of dead insects was counted after 6 days, and the mortality rate was calculated using the same formula as in Example 14. The test was conducted in two groups.
[0323] As a control, a drug solution prepared by adding Admix (registered trademark) to SS medium to a final concentration of 0.03% by volume was used.
[0324] As a result, the mortality rate of the control SS medium was 24%, while the #220-22 SS medium culture exhibited a mortality rate of 80% or more.
[0325] [Example 17] Herbicidal effect test by pre-emergence treatment under flooded conditions. The #220-22 strain and the NS15 strain were each cultured in MH medium at pH 6 to 9 and 25°C for 5 days with shaking at 180 rpm until the cell concentration reached 4.0 x 10 8CFU / mL of #220-22 MH medium culture, 3.4 x 10 8 NS15 MH medium cultures were obtained, with a bacterial cell concentration of 100 CFU / mL. The bacterial cell concentration was calculated using the plate smear method described in Example 6. MH medium was also prepared as a control. Alluvial soil was placed in a test tube (3 cm diameter, 35 mL volume), and water was added and mixed to create a 4 cm waterlogged condition. Echinochloa oryzicola seeds were sown in the test tube. On the day of sowing, 120 μL of the culture or control MH medium was applied to the water surface. The test tubes were placed in a greenhouse at 25-30°C, and plants were grown. Two weeks after treatment, the effects on various plants were evaluated according to the following criteria. The results are shown in Table 32. A in Table 32 indicates Echinochloa oryzicola.
[0326] (Evaluation criteria for Example 17) 5: Herbicide rate of 90% or more (almost complete death) 4: Herbicide rate of 70% or more but less than 90% 3: Herbicide rate of 40% or more but less than 70% 2: Herbicide rate of 20% or more but less than 40% 1: Herbicide rate of 5% or more but less than 20% 0: Herbicide rate less than 5% (almost no effect)
[0327]
[0328] [Example 18] Herbicidal effect test by foliar treatment In MH medium, the #220-22 strain and the KNR42 strain were each cultured with shaking at 180 rpm for 5 days at pH 6 to 9 and 25°C until the cell concentration reached 4.0 x 10 8 CFU / mL of #220-22 MH medium culture and the bacterial cell concentration was 2.1 x 10 8 Furthermore, the NS15 strain was statically cultured in SS medium at pH 6-9 and 25°C for 10 days until the bacterial cell concentration reached 8.3 × 10 7 NS15 SS medium cultures were obtained with a bacterial cell concentration of 100 CFU / mL. The bacterial cell concentration was calculated using the plate smear method described in Example 6. MH medium and SS medium were also prepared as controls. Sterilized diluvial soil was placed in cell seedling pots (2.5 cm x 2.5 cm), and seeds of Amaranthus retroflexus and Vibrio viridis were spot-sown. The seeds were covered with approximately 0.5 cm of soil and then grown in a greenhouse at 25-30°C.
[0329] After 8 days of growth, 150 μL of the culture or control MH or SS medium was uniformly applied using a small sprayer. Two weeks after treatment, the effects on the various plants were investigated according to the criteria in Example 17. The results are shown in Table 33. In Table 33, B indicates Amaranthus retroflexus and C indicates Viridis viridis.
[0330]
[0331] [Example 19] Herbicidal Effect Test by Soil Treatment The KNR42 strain was cultured in ST medium at pH 6 to 9 and 25°C for 5 days with shaking at 180 rpm until the cell concentration reached 9.0 x 10 7 KNR42 ST medium cultures with CFU / mL were obtained. The bacterial cell concentration was calculated using the plate smear method described in Example 6. ST medium was also prepared as a control. Sterilized diluvial soil was placed in cell seedling pots (2.5 cm x 2.5 cm), and seeds of Amaranthus retroflexus and Vibrio viridis were spot-sown and covered with soil to a depth of approximately 0.5 cm. Next, 150 μL of the culture or control ST medium was uniformly applied to the soil surface using a small sprayer. The cell seedling pots were placed in a greenhouse at 25-30°C and plants were grown. Two weeks after treatment, the effects on the various plants were evaluated according to the criteria described in Example 17. The results are shown in Table 34. In Table 34, B indicates Amaranthus retroflexus, and C indicates Vibrio viridis.
[0332]
[0333] Example 20 Plant Pathogenic Fungal Mycelial Growth Inhibition Test The KNR42 strain, #220-22 strain, and NS15 strain were each cultured overnight in LB medium at pH 6 to 9 and 28°C with shaking at 140 rpm. 5 μL of the resulting culture was added dropwise to LBA medium and PDA medium, thoroughly air-dried, and then cultured at 25°C for 2 days.
[0334] In the center of these plates, 5mm square mycelial fragments of one of the following plant pathogens were placed and cultured on PDA medium at 25°C for 7 days: Cercospora kikuchii (causing purple spot of soybean), Cercospora beticola (causing brown spot of sugar beet), Corynespora cassiicola (causing brown spot of cucumber), Corynespora cassiicola (causing brown ring spot of soybean), Fusarium oxysporum (causing wilt of tomato), Fusarium graminearum (causing Fusarium graminearum), Alternaria mali (causing leaf spot of apple), Colletotrichum theae-sinensis (causing anthracnose of tea), and Botryosphaeria berengeriana f.sp. pyricola (causing ring spot of apple). As controls, cultures of KNR42, #220-22, and NS15 strains were inoculated into untreated LBA and PDA media in the same manner. These were cultured at 25°C, and the inhibitory effect on mycelial growth of KNR42, #220-22, and NS15 strains was examined. The results are shown in Table 35. In Table 35, + indicates an inhibitory effect on mycelial growth, and - indicates no inhibitory effect on mycelial growth.
[0335] As a result of dual culture tests, strains KNR42, #220-22 and NS15 showed inhibitory effects on the mycelial growth of all of the above plant pathogens on LBA and PDA media.
[0336]
[0337] Example 21 Plant Growth Promoting Effect Test Corn (Seed Treatment) The #220-22 strain and the NS15 strain were each cultured in MH medium or CP-YD medium at pH 6 to 9 and 25°C for 5 days with shaking at 180 rpm until the cell concentration reached 4.0 x 10 8 CFU / mL of #220-22 MH medium culture, 5.3 x 10 8 CFU / mL of #220-22 CP-YD medium culture, 3.4 x 10 8 CFU / mL of #NS15 MH medium culture, 2.3 x 108 An NS15 CP-YD medium culture was obtained with a bacterial cell concentration of 100 CFU / mL. The bacterial cell concentration was calculated using the plate smear method described in Example 6. Corn (Gold Dent KD502) seeds were placed in a 15 mL plastic tube, 10 mL of the culture was added, and the seeds were soaked at room temperature for 1 hour. Control seeds were soaked in sterilized water. The soaked seeds were sown in 9 cm polypots, and 10 days after sowing, the total plant height, aboveground fresh weight, and belowground fresh weight were measured. The results are shown in Table 36.
[0338] As a result of the growth promotion effect test, #220-22 CP-YD medium culture and NS15 MH medium culture showed a growth promotion effect on corn.
[0339]
[0340] The microorganisms according to the present disclosure exhibit excellent control activity against plant diseases and can be used as microbial pesticides.
[0341] NITE BP-03832 NITE BP-04073 NITE BP-04126
Claims
1. A microorganism belonging to Bacillus veresensis (Accession No.: NITE BP-03832), a microorganism belonging to Bacillus veresensis (Accession No.: NITE BP-04073), a microorganism belonging to Bacillus veresensis (Accession No.: NITE BP-04126), or a mutant thereof having a plant disease control effect.
2. A culture-derived product which is a culture, cultured bacterial cells, culture supernatant or extract of the microorganism described in claim 1.
3. A microbial preparation containing the microorganism described in claim 1 or the culture-derived product described in claim 2 as an active ingredient.
4. The microbial preparation according to claim 3, which is a bactericide.
5. The microbial preparation according to claim 3, which is a plant disease control agent.
6. A method for controlling plant diseases, comprising the step of applying the microbial preparation according to claim 3 to plants or soil.
7. The method for controlling the plant disease according to claim 6, wherein the pathogen of the plant disease is a fungus or a bacterium.
Citation Information
Patent Citations
Bacillus velezensis for inhibiting or antagonizing phytopathogens and isolated culture method and application of bacillus velezensis
CN111286479A
Cited By
Complex microbial inoculant, preparation method thereof and application of complex microbial inoculant in degradation of corn straws
CN121699753A
Bacillus velezensis and application thereof in prevention and control of fruit flies
CN122256205A