Recombinant alphaherpesvirus vectors

RDGACVs address the limitations of existing herpesvirus vaccines by using heat-regulated, replication-defective alphaherpesviruses to express heterologous antigens, enhancing immune responses and offering effective prevention and treatment for herpesvirus-related diseases.

WO2025214935A1PCT designated stage Publication Date: 2025-10-16HSF PHARMA
View PDF 14 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2025/059413
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-04-11
Filing Date
2025-04-07
Publication Date
2025-10-16

AI Technical Summary

Technical Problem

Current vaccines for herpesviruses, such as HSV-1 and HSV-2, have not been effective in preventing or treating oral or genital herpes, and replication-defective alphaherpesviruses used as vectors for gene therapy or vaccines have limitations in inducing robust immune responses.

Method used

Development of replication-defective, genome amplification-controlled alphaherpesviruses (RDGACVs) that express heterologous surface antigens, utilizing heat shock promoters to regulate essential viral genes and incorporate heterologous transactivators, enabling controlled replication and enhanced immune response through heat activation.

Benefits of technology

RDGACVs induce potent humoral and cellular immune responses, providing effective preventative and therapeutic vaccination against diseases caused by herpesviruses and other pathogens by expressing heterologous surface proteins.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure EP2025059413_16102025_PF_FP_ABST
    Figure EP2025059413_16102025_PF_FP_ABST
Patent Text Reader

Abstract

Disclosed are novel recombinant alphaherpesviruses that comprise (a) a heat shock promoter that controls the expression of a first viral gene that is essential for the replication of the viral genome, (b) a disabling deletion, insertion or mutation in a second viral gene that is essential for virus propagation but is not involved in the replication of the viral genome, and (c) inserted in its genome an expressible heterologous gene for a surface protein of a pathogen. The recombinant alphaherpesviruses can be used to vaccinate a subject against a pathogens that displays the heterologous surface protein that is expressed by the recombinant virus or an immunologically related protein.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] RECOMBINANT ALPHAHERPESVIRUS VECTORS

[0002] TECHNICAL FIELD

[0003] The present disclosure relates to novel recombinant alphaherpesviruses and their use in vaccination.

[0004] BACKGROUND OF THE INVENTION

[0005] Alphaherpesviridae include herpes-simplex-virus-1 (HSV-1), herpes-simplex-virus-2 (HSV-2) and Varicella-zoster-virus (VZV), which viruses cause disease in humans. HSV-1 causes oral herpes, and HSV-1 and HSV-2 genital herpes. VZV is responsible for chickenpox in children and young adults and shingles in adults, primarily older adults. The latter alphaherpesviruses typically enter the host through the skin or a mucosal membrane. The viruses are neurotropic, causing latent infection in sensory nerve cells. A successful chickenpox vaccine derived from an attenuated Oka strain of VZV was introduced in 1981 and remains in use today. Research on vaccines against disease caused by HSV-1 and HSV-2 has been ongoing since the 1970s. Chentoufi et al. (2022) Front Immunol 13: 849515. Unfortunately, these efforts failed to result in an effective vaccine that treats or prevents oral or genital herpes. Vaccine candidates tested included various replicationdefective recombinants of HSV-1 and HSV-2 including an HSV-1 glycoprotein H deletion strain (SC16AgH), an HSV-2 strain containing a disabled UL29 (ICP8) gene, HSV-2 strain dl5-29 containing deletions in the UL5 and UL29 genes and an HSV-2 strain containing a deletion in glycoprotein D. A newer approach to developing HSV-1- or HSV-2-directed vaccines makes use of so-called replication-competent controlled alphaherpesviruses. Bloom et al. (2018) (J Virol 92: e00616-18). These recombinants are non-replicating but, subsequent to administration to an animal subject, can be activated to undergo limited, efficient replication in the administration site. The activated recombinants have been shown to induce significantly more potent humoral and cellular immune responses than replication-defective recombinants, resulting in superior protective effects. Robust humoral and cellular responses were also obtained to heterologous antigens expressed from a replication-competent controlled alphaherpesvirus. Replication-defective alphaherpesviruses have also been used as vectors of heterologous proteins. Extensive research has been carried out on the use of replication-defective alphaherpesviruses, in particular HSV-1 , as vectors for gene therapy of diverse neuropathies and other diseases including epilepsy, multiple sclerosis, Alzheimer disease, focal diseases, diabetes, chronic pain and lysosomal storage diseases. Manservigi et al. (2010) Open Virol J 4: 123-156. Typically, the vectors that expressed heterologous cell-internal proteins or signaling molecules contained deletions in various combinations of regulatory immediate early genes such as the ICPO, 4, 22, and 27 genes of HSV-1. Manservigo et al. (2010); Artusi et al. (2018) Diseases 6: 74. Replication-defective alphaherpesviruses were also explored as vaccine vectors. For example, a LIL29 (ICP8)-deleted HSV-2 strain expressing co-stimulation molecule B7-2 enhanced the T cell response elicited in wild type mice. Vagvala et al. (2009) J Virol 83: 953-960. An ICP27- deleted HSV-1 recombinant expressing HIV Env and Nef proteins was investigated as a potential HIV vaccine. Murphy et al. (2000) J Virol 74: 7745-7754. The immune response to an ICP4, IC22, ICP27 triple-deleted HSV-1 recombinant expressing the model antigen OVA was also investigated. Lauterbach et al. (2004) J Virol 78: 4020-4028. Another study probed the immune response against bacterial p-galactosidase induced by virus recombinant d106 that contains deletions in the ICP4, ICP27, ICP22, and ICP47 genes and harbors an expressible gene for p- galactosidase. Watanabe et al. (2007) Virology 357: 186-198. A further study investigated the vaccine effects of a gD-deleted HSV-2 recombinant expressing an influenzavirus hemagglutinin. Kaugars et al. (2021) Proc Natl Acad Sci USA 118: e2110714118.

[0006] SUMMARY OF THE INVENTION

[0007] The present disclosure relates to recombinant alphaherpesviruses that are replication-defective, genome amplification-controlled alphaherpesviruses expressing a heterologous surface antigen, abbreviated as RDGACV. An RDGACV comprises (a) a heat shock promoter that controls the expression of a first gene of the RDGACV, which first gene is essential for the replication of the genome of the RDGACV, (b) a disabling deletion, insertion or mutation in a second gene of the RDGACV or the promoter controlling the second gene, the second gene being essential for a step in the maturation of the RDGACV, which step occurs subsequent to the replication of the genome of the RDGACV and without which step no infectious progeny virus is produced and (c) inserted in the genome of the RDGACV an expressible heterologous gene for a surface protein or parts of a surface protein of a virus that, typically, is not an alphaherpesvirus or of another pathogen. Embodiments in which the heterologous gene does not encode a surface protein of the virus or pathogen but an internal protein is also encompassed by the present disclosure. The term “maturation” refers to processes that occur subsequent to the replication of the viral genome and that are necessary for the production and egress from the infected cell of infectious progeny viruses. The first gene is, typically, a replication-essential immediate early or early viral gene, and the second gene is a replication-essential late viral gene. No gene that is essential for replication of the viral genome is disabled in an RDGACV (the first gene not being disabled but subjected to regulation). An RDGACV can be derived from an HSV-1 , an HSV-2 or a varicella zoster virus (VZV). Hence, a wildtype (isolated from a natural source) HSV-1 , HSV-2 or varicella zoster virus can be used as the backbone for the construction of an RDGACV. RDGACVs derived from an HSV-1 or an HSV-2, i.e. , constructed using an HSV-1 or an HSV-2 as the backbone, can additionally comprise a disabled ICP47 gene (i.e., lacking a functional ICP47 gene). Expressible heterologous genes for a surface protein include, but are not limited to, genes for influenza virus surface proteins such as hemagglutinins and neuraminidases or parts thereof, genes for human immunodeficiency virus (HIV) surface proteins such as the Env protein or parts thereof and genes for coronavirus surface proteins such as S (spike) proteins or parts thereof. The term “parts of a surface protein” refers to peptides and polypeptides comprising a stretch of the complete amino acid sequence of a surface protein. Regarding the heat shock promoter control of genome replication of an RDGACV, the first viral gene can be controlled directly by a (heterologous) heat shock promoter. In this case, a heat shock promoter functionally replaces (typically, replaces or displaces) the native promoter of the first gene. Control can also be indirect. In this case, the RDGACV comprises a transactivator gene cassette that includes a heat shock promoter and a functionally linked gene for a regulated or unregulated transactivator. In addition, the promoter of the first gene is functionally replaced by a heterologous promoter that is responsive to the transactivator. The disclosure further encompasses a vaccine composition comprising an effective amount of an RDGACV and a pharmaceutically acceptable carrier or excipient. An RDGACV can be used for preventative or therapeutic vaccination against diseases caused by viruses or other pathogens that display the heterologous surface protein that is expressed by the RDGACV or a protein that is immunologically related to the latter protein. The term “immunologically related” refers to the breath of the immune response elicited by an RDGACV, which immune response can be expected to not only target the surface protein expressed by the RDGACV but also proteins that are closely related. How broad the immune response will be will depend on multiple factors including the nature of the expressed surface protein. BRIEF DESCRIPTION OF FIGURES

[0008] Figure 1 : Recombinant HSV-GS64. Panel (A): Schematic representation of the genome of the HSV-GS64: “HSP70B / GAL4-GLP65”: HLP65 gene controlled by an assembly comprising an HSP70B promoter and a GAL4 promoter; “CMV IE-CA09 HA”: Hemagglutinin gene of influenza virus CA09 (A / California / 07 / 2009(H1 N1)) controlled by a CMV IE (cytomegalovirus immediate early) promoter; “HSP70B4CP4”: ICP4 gene controlled by an HSP70B promoter; “mKRT14CP8”: ICP8 gene controlled by a mouse keratin 1 promoter; GAL4-VP19c”: VP19c gene controlled by a GAL4 promoter; “TRL, TRs: long and short terminal repeats; “UL, Us-: long and short unique regions; “IRL, IRs-: long and short internal repeats. Panel (B): Single-step growth curve for HSV- GS64. Viral titers at different times after infection are shown. “PFU”: plaque-forming unit; “Uli”: ulipristal. * p < 0.05, comparing to the Heat + Uli group at 12 and 24 h.

[0009] Figure 2: Results of a challenge experiment with mock-immunized or HSV-GS64-immunized mice: Figure 2A shows mice mock-immunized or immunized with HSV-GS64 and challenged intranasally with a lethal dose of influenza virus A / Fort Monmouth / 1 / 1947 (H1 N1) (FM47). Figure 2B shows mice mock-immunized or immunized with HSV-GS64 and challenged intranasally with a lethal dose of influenza virus A / Hong Kong / 4801 / 2014 (H3N2) (HK14). Upper rows: left panel: legend; right panel: survival. Lower rows: left panel: average weights of animals relative to weights on the day of challenge; right panel: relative individual weights of animals immunized with HSV- GS64 in the absence of Uli (ulipristal). * p < 0.05, comparing the mock-immunized group or the group immunized with not-activated HSV-GS64 with groups immunized with heat-activated HSV- GS64; # p < 0.05, comparing groups immunized with heat-activated HSV-GS64 in the presence or absence of Uli.

[0010] DETAILED DESCRIPTION

[0011] Unless otherwise defined below or elsewhere in the present specification, all terms shall have their ordinary meaning in the relevant art.

[0012] “Recombinant alphaherpesvirus” refers to a (wildtype or naturally occurring) alphaherpesvirus whose genome has been altered deliberately by an experimenter using a recombination technique. More generally, the tern relates to a (wildtype or naturally occurring) alphaherpesvirus whose genome has been altered deliberately by an experimenter. Recombinant alphaherpesviruses of the present disclosure are replication-defective, genome amplification- controlled alphaherpesviruses expressing a heterologous surface antigen, abbreviated as RDGACV.

[0013] “Surface protein of a virus or other pathogen” refers to a virus- or other pathogen-encoded protein that protrudes in part through the outer surface of the virus or pathogen into the external space. A surface protein can be recognized by an antibody of the appropriate specificity. While not wishing to be bound by any theory about how RDGACVs induce immune responses, preferred are heterologous surface proteins that are capable of inserting themselves into the cell membrane when expressed in that cell in the absence of any other protein of the virus or other pathogen of which they are components. The hemagglutinins and neuraminidases of influenza viruses and the spike proteins of coronaviruses are such surface proteins.

[0014] “Heterologous” refers to a genetic element or protein from a different organism. For example, an alphaherpesvirus expressing a heterologous transactivator is an alphaherpesvirus genetically modified to carry an expressible gene for a transactivator which gene is not normally contained in its genome. A “heterologous promoter” is a promoter that, as a whole, does not naturally occur in the wildtype alphaherpesvirus that serves as the backbone for the construction of a recombinant alphaherpesvirus that contains the heterologous promoter. The possibility that such a heterologous promoter also contains elements of a viral promoter is encompassed by the term.

[0015] “Replication of virus” or “virus / viral replication” are understood to mean multiplication of viral particles. Replication can be measured by determination of numbers of infectious virus, e.g., plaque-forming units of virus (pfu). Terms such as “replication of the viral genome” or “replication of the genome of the virus” relate to the amplification of the genome of the virus that occurs after infection and is an essential step in the generation of progeny virus. Replication of the viral genome is typically assessed by methods that determine amounts of viral DNA, e.g., by a realtime PCR procedure. More indirect methods that measure levels of viral gene expression, e.g., by RT-PCR of gene transcripts, may also be employed

[0016] A “small-molecule regulator” or “SMR” is understood to be a low molecular weight ligand of a regulated transactivator used in connection with this disclosure. The SMR is capable of activating the transactivator. The SMR is typically, but not necessarily, smaller than about 1000 Dalton (1 kDa). The term “transactivator” is used herein to refer to a transcription factor that can positively affect transcription of a gene controlled by a promoter that is responsive to the transactivator (transactivator-responsive promoter). A transactivator, as the term is used herein, is not a protein of an alphaherpesvirus and is, typically, engineered. A “regulated transactivator” (or “smallmolecule regulator (SMR)-activated transactivator”) is a transacription factor that when activated by the appropriate SMR positively affects transcription of a gene controlled by a transactivator- responsive promoter. An “unregulated transactivator” is transactivating constitutively.

[0017] A “transactivator-responsive promoter” is a promoter that contains one or more sequence elements that can be bound by a transactivator and that is essentially inactive prior to being bound by the transactivator or, in the case of a regulated transactivator, by the SMR-activated transactivator.

[0018] “Activated” when used in connection with a transactivated gene means that the rate of expression of the gene is measurably greater after activation than before activation or, when used in connection with a controllable heterologous promoter means that the transcription-enhancing activity of the promoter is measurably greater after activation than before activation. When used in connection with a SMR-activated transactivator, “active” or “activated” refers to a transactivation-competent form of the transactivator. The transactivator is rendered transactivation-competent by the binding of the appropriate SMR. When used in the context of an RDGACV, the term refers to an RDGACV that has been enabled to amplify its genome by an activation treatment administered to infected cells.

[0019] A “replication-essential gene” is arbitrarily defined herein as a viral gene whose loss of function diminishes the number of progeny virus in an infected cell by at least a factor of ten. Replication efficiency can be estimated, e.g., in a (single-step) growth experiment. For alphaherpesviruses it is well known which genes are replication-essential genes. Nishiyama (1996) (Nagoya L Med Sci (1996) 59: 107-19). The latter term is distinguished from terms such as “gene essential for replication of the viral genome” and the like that relate to a viral gene required for the amplification of the viral genome. Such genes are, typically, immediate early and early genes which are also listed by Nishiyama (1996). A gene that is essential for replication of the genome is arbitrarily defined as a viral gene whose loss of function diminishes the number of genome copies produced in an infected cell by at least a factor of ten. An “effective amount of an RDGACV” is an amount of the virus that upon single or repeated administration to a subject followed by activation confers a therapeutic effect on the treated subject, at a reasonable benefit / risk ratio applicable to any medical treatment. When used in the context of prophylaxis or prevention, an “effective amount of an RDGACV is meant to be an amount which, when administered (and thereafter activated) once or multiple times over the course of a prophylactic or preventative (e.g., vaccination) regime, confers a desired prophylactic effect on the treated subject. In general, what is an effective amount will vary depending on the route of administration as well as the possibility of co-usage with other agents. It will be understood, however, that the total or fractional dosage of compositions of the present disclosure comprising an RDGACV will be decided by the attending physician within the scope of sound medical judgment. The specific effective dose level for any particular subject may be adjusted based on a variety of factors including the disorder being treated and the severity of the disorder; the activity of the RDGACV employed; the specific composition employed; the age, body weight, general health, sex and diet of the subject; the time of administration, route of administration, and rate of elimination of the specific recombinant alphaherpesvirus employed; the duration of the treatment; drugs used in combination or contemporaneously with the RDGACV employed; and like factors well known in the medical arts. The latter factors will be considered in the context of therapeutic applications of RDGACVs as well as in the context of prophylactic or preventative applications.

[0020] An “effective amount of a small-molecule regulator (SMR)” is an amount that when administered to a subject by a desired route is capable of co-activating the heat- and SMR-controlled replication of the genome of an RDGACV (expressing an SMR-activated transactivator) with which the subject concurrently is, has been or will be inoculated.

[0021] A “subject” or a “mammalian subject” is a mammalian animal or a human person.

[0022] “Promoter of a heat shock gene”, “heat shock gene promoter” and “heat shock promoter” are used synonymously. The term encompasses heat shock promoters that are found in nature as well as synthetic heat shock promoters. A synthetic heat shock promoter is a promoter of a gene other than a heat shock gene to which were added sequence elements of the type present in naturally occurring heat shock promoters, which elements confer heat activation on a functionally linked gene. A “heat shock gene” is defined herein as any gene, from any eukaryotic organism, whose activity is enhanced when the cell containing the gene is exposed to a temperature above its normal growth temperature. Typically, such genes are activated when the temperature to which the cell is normally exposed is raised by 3-10°C. Heat shock genes comprise genes for the “classical” heat shock proteins, i.e., HSP110, HSP90, HSP70, HSP60, HSP40, and HSP20-30. They also include other heat-inducible genes such as genes for MDR1 , ubiquitin, FKBP52, heme oxidase and other proteins. The promoters of these genes, the “heat shock promoters”, contain characteristic sequence elements referred to as heat shock elements (HSE) that consist of perfect or imperfect sequence modules of the type NGAAN or AGAAN, which modules are arranged in alternating orientations (Amin et al. (1988) Mol Cell Biol 8: 3761-3769; Xiao and Lis (1988) Science 239: 1139-1142; Fernandes et al. (1994) Nucleic Acids Res 22: 167-173). These elements are highly conserved in all eukaryotic cells such that, e.g., a heat shock promoter from a fruit fly is functional and heat-regulated in a frog cell (Voellmy and Rungger (1982) Proc Natl Acad Sci USA 79: 1776-1780). HSE sequences are binding sites for heat shock (transcription) factors (HSFs; reviewed in Wu (1995) Annu Rev Cell Dev Biol 11 : 441-469. The factor primarily responsible for activation of heat shock genes in vertebrate cells exposed to heat or a proteotoxic stress is heat shock factor 1 (abbreviated as “HSF1”). Baler et al. (1993) Mol Cell Biol 13: 2486- 2496; McMillan et al. (1998) J Biol Chem 273: 7523-7528. Preferred promoters for use in RDGACVs are those of inducible HSP70 genes. A particularly preferred heat shock promoter is the promoter of the human HSP70B gene. Voellmy et al. (1985) Proc Natl Acad Sci USA 82: 4949-4953. It is noted that there exist cognate heat shock genes that encode protein closely related to products of heat shock genes. Such cognate genes are not encompassed by the present definition of a heat shock gene” and their promoters are not encompassed by the above definition of heat shock promoters.

[0023] If the context does not indicate otherwise, the term “vaccine” refers to compositions comprising an RDGACV that can induce an immune response in the subject to which they are administered.

[0024] The term “permissive cells” as used herein refers to mammalian cells that complement the disabled (or not activated) gene function of an RDGACV. For example, permissive cells for an RDGACV with a disabled UL38 (VP19C) gene can be E5 cells (DeLuca and Schaffer (1987) Nucleic Acids Res 15: 4491- 4511) transfected with plasmid construct pVP19c that contains an expressible gene for VP19C (Bloom et al. (2018).

[0025] RDGACVs can be used as vaccines or as components of vaccine compositions. Comparison experiments with replication-competent heat-controlled alphaherpesvirus recombinants and corresponding unregulated recombinants suggested that the antigenicity of a heterologous surface protein expressed from an alphaherpesvirus in infected host cells is greatly enhanced by a sublethal heat treatment of the infected cells. This effect occurs when heat treatment and synthesis of the surface protein are coordinated. A heat shock promoter that, upon activation, mediates the replication of the genome of a recombinant alphaherpesvirus carrying an expressible gene for a heterologous surface protein, resulting in the co-amplification of the gene for the surface protein and the subsequent expression of the surface protein from the multiple gene copies can provide this coordination. Heat treatment of the infected cells will enhance the production of heat shock proteins that include cellular protein chaperones. Increased levels of chaperones may stabilize newly synthesized surface proteins as well as enhance their folding and transport to the cell surface. These effects may only occur if the expression of the surface protein is coordinated with the induction of the heat shock response.

[0026] To harness these effects, a viral gene encoding a protein that is essential for the replication of the viral genome is subjected to heat regulation in RDGACVs. Typically, the latter viral gene is an immediate early gene or an early gene. Preferred genes are the ICP4 and ICP8 genes of HSV-1 or homologous genes of other alphaherpesviruses. Heat regulation can be conferred upon the gene by subjecting it to the control of a naturally occurring (e.g., in an animal, plant or fungal cell) or a synthetic heat shock promoter. The activity of heat shock promoters is predominantly controlled by a cellular transcription factor known as heat shock factor (abbreviated as “HSF”). Animal and plant cells harbor multiple HSF. In animal and human cells, heat shock factor 1 (abbreviated as “HSF1”) is the primary regulator of heat shock promoter activity. In an unstressed animal or human cell, HSF1 is present in a multiprotein complex and is transcriptionally inactive. Exposure of the cell to sublethal heat or another proteotoxic stress results in a reversible conversion of HSF1 into a transcriptionally active form. The activation process involves disassembly of the multiprotein complex, trimerization of the HSF1 monomer and modification of the HSF1 molecule, in particular by phosphorylation and dephosphorylation. Activation of HSF1 is transient, lasting at most a few hours, even if the stressful condition persists. To subject a viral gene to heat regulation, a heat shock promoter can be inserted upstream of the sequence encoding the viral protein, displacing or, typically, replacing the native promoter of the viral gene. Alternatively, a heat shock promoter can also be used to control the expression of a gene encoding a transactivator and the viral gene to be subjected to heat regulation is controlled by a promoter that is responsive to the transactivator. The advantage of this indirect heat shock promoter control is that the heat-induced expression of the viral gene lasts longer than it would if it had been directly controlled by the heat shock promoter.

[0027] Any unregulated transactivator may be employed as long as it is transcriptionally competent when synthesized in mammalian cells (in particular, in cells in the vaccine administration site of a subject) and comprises a DNA-binding domain that specifically binds to a DNA sequence element that is present in a corresponding transactivator-responsive promoter. It is understood that the transactivator is not a native regulator of an alphaherpesvirus, i.e., it is a heterologous transactivator. Preferred is a transactivator that only minimally affects the expression of the resident genes in cells of a subject that are targeted by an RDGACV, i.e., that has no undue toxicity in these cells.

[0028] To provide additional safety against unwanted replication (should this be desired), an SMR- activated transactivator can be employed that is active in the presence of the SMR but is essentially inactive in its absence. Preferred is the mifepristone- or ulipristal-activated chimeric transactivator GLP65. This transactivator comprises a DNA-binding domain from yeast transcription factor GAL4, a truncated ligand-binding domain from a human progesterone receptor and a transactivation domain from the human RelA protein (p65). Burcin et al. (1999); Ye et al. (2002). Other exemplary SM R-activated transactivators than cat be incorporated in an RDGACV include tetracycline / doxycycline-regulated tet-on repressors (Gossen and Bujard (1992) Proc Natl Acad Sci USA 89: 5547-51 ; Gossen et al. (1996) Science 268: 1766-69), and transactivators containing a ligand-binding domain of an insect ecdysone receptor. No et al. (1996) Proc Natl Acad Sci USA 93: 3346-51. A stringently ligand-dependent transactivator of this type is the RheoSwitch transactivator developed by Palli and colleagues. Palli et al. (2003) Eur J Biochem 270: 1308-15; Kumar et al. (2004) J Biol Chem 279: 27211-18. The RheoSwitch transactivator can be activated by ecdysteroids such as ponasterone A or muristerone A, or by synthetic diacylhydrazines such as RSL-1 (also known as RH-5849). Dhadialla et al. (1998) Annu Rev Entomol 43: 545-69. Other SM R-activated transactivators may be used, provided that they can be employed to control the activity of a target gene without also causing widespread deregulation of genes in cells of the intended hosts (subjects) and provided further that the associated SMRs have acceptably low toxicity in the hosts at their effective concentrations. It is noted that unregulated transactivators can be obtained from the above SMR-activated transactivators by removal of their respective SMR-binding regions. An unregulated transactivator derived from GLP65 is exemplified below.

[0029] Because inadvertent activation of heat shock promoters may occur under adverse conditions (e.g., high fever), additional safety against inadvertent replication of RDGACVs is provided by the disablement of a viral gene that is essential for a late function, typically a late gene, e.g. a gene that is required for the assembly or egress of the virus and is not involved in any process relating to the replication of the viral genome. Disablement is achieved by an insertion, a deletion, or a mutation in the nucleotide sequence encoding the product of the gene. Disablement can also be attained by rendering the promoter controlling the expression of the gene nonfunctional, deleting the promoter. Or replacing it with a nonfunctional or conditionally nonfunctional promoter. The disabled gene may have encoded a viral capsid protein, a tegument protein or a protein involved in capsid formation. Suitable genes may include but not be limited to the late genes LIL15, LIL18, UL19, IL25, UL26, UL26S, UL32, UL33, UL35, UL38, UL48 and UL49. Nishiyama (1996) Nagoya L Med Sci 59: 107-19. A preferred gene is the LIL38 (VP19C) gene. In a RDGACV no viral gene is disabled that is essential for the replication of the viral genome.

[0030] An RDGACV further expresses a gene for a heterologous surface protein of a viral or other pathogen. The gene for the surface protein may be from an enveloped virus, in particular from an enveloped RNA virus such as a virus of the paramxovirus family including such important human pathogens as respiratory syncytial virus, measles virus, mumps virus, parainfluenza virus and hendra virus. Enveloped RNA viruses also include viruses of the families flaviviridae (hepatitis C virus, tick-borne encephalitis virus), orthomyxoviridae (influenza viruses), rhabdoviridae (rabies virus), coronaviridae (SARS-CoV, MERS.CoV, SARS-CoV-2), retroviridae (human immunodeficiency virus (HIV)), bunyaviridae (hantavirus, Crimean-Congo hemorrhagic fever virus, La Crosse virus, California encephalitis virus, Rift Valley fever virus), arenaviridae (Lassa virus, lymphocytic choriomeningitis virus), togaviridae (Chikungunya virus), filoviridae (Ebolavirus / Marburgvirus), deltaviridae (hepatitis D virus), and matonaviridae (rubella virus). Surface proteins of particular interest are those of an influenza virus (hemagglutinin and neuraminidase), a corona virus (S protein), a retrovirus (Env protein) such as a human immunodeficiency virus (HIV), or a respiratory syncytial virus (RSV). Expressed by a RDGACV may be a full-length surface protein or a segment or fragment of a surface protein. Expression of a surface protein-encoding gene may be driven by any promoter that is active or can be activated when present in the genome of an RDGACV in a host cell infected by the RDGACV in the course of a vaccination procedure. Host cells can be, but are not limited to, cells in the epidermal or dermal layers of the skin or a mucosal membrane of a subject. A preferred promoter is the immediate early cytomegalovirus (CMV IE) promoter.

[0031] In an exemplary vaccine application, a vaccine composition comprising an effective amount of an RDGACV is administered to a subject intraepidermally or intradermally. If the RDGACV comprises an SMR-activated transactivator, an effective amount of the appropriate SMR is coadministered. Alternatively, the SMR may be included in the vaccine composition. The vaccine composition can be administered by injection or, preferably, by means of a microneedle patch. An activated heating pad is applied to the virus administration site shortly (typically, 1-3 hours) after vaccine administration to deliver an activating heat dose to the infected cells in the site. Heating at about 43.5-45.5°C (temperature of the pad surface in contact with the skin) will be for a period of about 10-60 min. Vaccination may be repeated at appropriate at later times. What are appropriate intervals between vaccinations is well known in the medical art.

[0032] More generally, a body site to which an RDGACV is administered, i.e. , the inoculation site, may be heated by any suitable method. Heat may be delivered or produced in the target region by different means including direct contact with a heated surface or a heated liquid, ultrasound, infrared radiation, or microwave or radiofrequency radiation. As discussed in the above specific example, a practical and inexpensive solution may be offered by heating pads (or similar devices of other shapes, e.g., cylinders or cones, for heating mucosal surfaces of the nose, etc.) containing a supercooled liquid that can be triggered to crystallize by mechanical disturbance, releasing heat at the melting temperature of the chemical used. A useful chemical may be sodium thiosulfate pentahydrate that has a melting temperature of about 48°C. U.S. Patents Nos. 3,951 ,127, 4,379,448, and 4,460,546. The technology is readily available and is already being used in health care products. That such heating pads are capable of activating heat shock promoters in all human skin layers has been verified experimentally. Voellmy et al. (2018) Cell Stress Chaperones 23(4): 455-466.

[0033] An “activating heat dose” is a heat dose that causes a transient activation of heat shock factor 1 (HSF1) in cells within the inoculation site region. Activation of HSF1 is evidenced by a detectably increased level of RNA transcripts of a heat shock gene over the level present in cells not exposed to the heat dose or by the detection of phosphorylation of Ser326of human HSF1. Guettouche et al. (2005) BMC Biochemistry 6: 4. Alternatively, it may be evidenced as a detectably increased amount of the protein product of a heat shock gene. Moreover, an activating heat dose may be evidenced by the occurrence of genome replication of an RDGACV, in the presence of an effective concentration of an appropriate small-molecule regulator in the case of an RDGACV comprising a regulated transactivator.

[0034] An activating heat dose can be delivered to the target region at a temperature between about 41°C and about 47°C for a period of between about 1 min and about 180 min. It is noted that heat dose is a function of both temperature and time of exposure. Hence, similar heat doses can be achieved by a combination of an exposure temperature at the lower end of the temperature range and an exposure time at the upper end of the time range, or an exposure temperature at the higher end of the temperature range and an exposure time at the lower end of the time range. Preferably, heat exposure will be at a temperature between about 42°C and about 46°C for a duration of between about 5 min and about 150 min. Most preferably, heat treatment is administered at a temperature between about 43.5°C and about 45.5°C for a duration of between about 10 min and about 60 min. It is noted that it appears feasible to deliver an activating heat dose within a much shorter time, i.e., within seconds or even in the sub-second range, by intense irradiation of the target region. Tolson and Roberts (2005) Methods 35:149-157; Sajjadi et al. (2013) Med Eng Phys 35:1406-1414.

[0035] Concerning an RDGACV comprising a regulated transactivator, an SMR should satisfy a number of criteria. Most important will be that the substance is safe; adverse effects should occur at most at an extremely low rate and should be generally of a mild nature. Ideally, an SMR would belong to a chemical group that is not used in human therapy. However, before any substance not otherwise developed for human therapy could be used as an SMR in a medical application of an RDGACV comprising a regulated transactivator, it would have to undergo extensive preclinical and clinical testing. It may be more opportune to select a known and well-characterized drug substance that is not otherwise administered to the specific population targeted for treatment or immunization using an RDGACV comprising a regulated transactivator. Alternatively, a known drug substance that is only used sporadically may be selected as an SMR. In examples described herein, the SMR is a progesterone receptor (PR) antagonist or antiprogestin, e.g., mifepristone or ulipristal. Mifepristone and ulipristal fulfill the latter requirement of typically only needing to be administered sporadically. Mifepristone and ulipristal have excellent human safety records for acute therapy applications.

[0036] An effective concentration of an SMR in the inoculation site is a concentration that enables efficient genome replication of an RDGACV comprising a regulated transactivator in infected cells in that site. What an effective concentration is depends on the affinity of the SMR for its target transactivator. How such effective concentration is achieved and for how long it is maintained also depends on the pharmacokinetics of the particular SMR, which in turn depends on the route or site of administration of the SMR, the metabolism and route of elimination of the SMR, the subject to which the SMR is administered, i.e., the type of subject (human or other mammal), its age, condition, weight, etc. It further depends on the type of composition administered, i.e., whether the composition permits an immediate release or a slow release of the regulator. For a number of well-characterized SMR-transactivator systems, effective concentrations in certain experimental subjects have been estimated and are available from the literature. This applies to systems based on progesterone receptor, ecdysone receptors, estrogen receptors, and tetracycline repressor as well as to dimerizer systems, i.e., transactivators activated by rapamycin or analogs (including non-immunosuppressive analogs), or FK506 or analogs. For example, an effective concentration of mifepristone in rats can be reached by i.p. (intraperitoneal) administration of 5 pg mifepristone per kg body weight (5 pg / kg). Amounts would have to be approximately doubled (to about 10 pg / kg), if the SMR is administered orally. Wang, Y. et al. (1994) Proc Natl Acad Sci USA 91 : 81 SO- 84. Amounts of an SMR that, upon administration by the chosen route to the chosen site, result in an effective concentration are referred to as effective amounts of the SMR in question. How an effective amount of an SMR that results in an effective concentration can be determined is well within the skills of an artisan.

[0037] RDGACVs are incapable of producing progeny virus due to the disablement of a required gene. It may be a desirable feature of an RDGACV-based vaccine that infected host cells in the administration site are effectively lysed and progeny virus is released. This may be achieved by including in a vaccine composition comprising an effective amount of an RDGACV a complementing replication-deficient alphaherpesvirus in an amount that is sufficient to complement the RDGACV. A suitable complementing virus may be KD6, an I CP4(-) replicationincompetent HSV-1 recombinant (Dobson et al. (1990) Neuron 5: 353-360). Upon administration of the composition, cells in the administration site will be infected by both viruses and will produce progeny from both viruses (as one virus complements the other virus in trans). As the viruses disperse, the likelihood of double infection and the ensuing production of virus particles will rapidly decrease.

[0038] Inoculation of a vaccine composition comprising an effective amount of an RDGACV can be by any suitable route. The body site (inoculation site) to which a vaccine composition is administered may typically be in a cutaneous or subcutaneous region located anywhere on the trunk or the extremities of a subject. Preferably, administration of the vaccine composition may be to a cutaneous region located on an upper extremity of the subject. Administration may also be to the lungs or airways, a mucous membrane in an orifice of a subject or any other tissue region in which the vaccine virus is capable of infecting cells and replicating its genome therein.

[0039] Alphaherpesviruses have evolved a multitude of mechanisms for evading immune detection and avoiding destruction. Tortorella et al. (2000) Annu Rev Immunol 18: 861-926. Elimination or weakening of some of these mechanisms could further enhance the potency of a vaccine based on an RDGACV. For example, HSV-1 and HSV-2 express immediate early protein ICP47. This protein binds to the cytoplasmic surfaces of both TAP1 and TAP2, the components of the transporter associated with antigen processing TAP. Advani and Roizman (2005) In: Modulation of Host Gene Expression and Innate Immunity by Viruses (ed. P. Palese), pp. 141-61 , Springer Verlag. ICP47 specifically interferes with MHC class I loading by binding to the antigen-binding site of TAP, competitively inhibiting antigenic peptide binding. Virus-infected human cells (but less so mouse cells) are expected to be impaired in the presentation of antigenic peptides in the MHC class I context and, consequently, to be resistant to killing by CD8+ CTL. Deletion or disablement of the gene that encodes ICP47 ought to significantly increase the potency of a RDGACV vaccine.

[0040] The potency of an RDGACV-based vaccine may also be enhanced by including in the viral genome an expressible gene for a cytokine or other component of the immune system (of subjects). A vaccination study in mice in which replication-defective herpesvirus recombinants expressing various cytokines were compared demonstrated that virus-expressed IL-4 and IL-2 had adjuvant effects. Osiorio & Ghiasi (2003) J Virol 77: 5774-83. Further afield, modulation of dendritic cell function by GM-CSF was shown to enhance protective immunity induced by BCG and to overcome non-responsiveness to a hepatitis B vaccine. Nambiar et al. (2009) Eur J Immunol 40: 153-61 ; Chou et al. (2010) J Immunol 185: 5468-75.

[0041] Expanding upon the basic definition given on p.6 as it relates to vaccine uses, an effective amount of an RDGACV is an amount that upon administration to a subject and genome replication therein results in a detectably enhanced functional immunity of the subject. This enhanced functional immunity may manifest itself as enhanced resistance to infection or re-infection with a circulating virus or other pathogen, or may relate to enhanced suppression / elimination of a current infection. Hence, it may manifest itself by a reduced disease severity, disease duration or mortality subsequent to infection with said virus or other pathogen. Most importantly, immunity can relate to preventive or therapeutic immunity against pathogens expressing and displaying the same or an immunologically related surface protein as the RDGACV. It is noted that a number of factors will influence what constitutes an effective amount of an RDGACV, including to some extent the site and route of administration of the RDGACV to a subject as well as the precise activation regimen utilized. Effective amounts of an RDGACV will be determined in dose-finding experiments. Generally, for vaccine uses, an effective amount of an RDGACV will be from about 104to about 1010plaque-forming units (pfu) of virus in permissive cells. More preferably, an effective amount will be from about 105to about 109pfu of virus, and even more preferably from about 106to about 108pfu of virus in permissive cells. Different or larger amounts may be indicated in certain circumstances.

[0042] An RDGACV expressing a surface antigen of any pathogen may be used in preventative or therapeutic vaccination against the disease caused by the pathogen. More specifically, an RDGACV expressing a surface protein from a respiratory syncytial virus, a measles virus, a mumps virus, a parainfluenza virus or a hendra virus may be used in preventative or therapeutic vaccination against the diseases caused by the latter pathogens. An RDGACV that expresses a surface protein from a hepatitis C virus, a tick-borne encephalitis virus, an influenza virus, a rabies virus, a coronavirus (SARS-CoV, MERS.CoV, SARS-CoV-2), a retrovirus including a human immunodeficiency virus (HIV), a hantavirus, a Crimean-Congo hemorrhagic fever virus, a La Crosse virus, a California encephalitis virus, a Rift Valley fever virus, a Lassa virus, a lymphocytic choriomeningitis virus, a Chikungunya virus, an Ebolavirus / Marburgvirus, a hepatitis D virus, or a rubella virus may be used in preventative or therapeutic vaccination against the diseases caused by the latter pathogens. Surface proteins to be expressed of particular interest are those of an influenza virus (hemagglutinin and neuraminidase), a corona virus (S protein), a retrovirus (Env protein) such as a human immunodeficiency virus (HIV), or a respiratory syncytial virus or RSV (F and G surface proteins). Expressed by a RDGACV may be a full-length surface protein or a segment or fragment of a surface protein.

[0043] A vaccine composition will comprise an effective amount of an RDGACV and, if an SMR is also administered as part of the composition, an effective amount of the SMR. It further comprises, typically, a pharmaceutically acceptable carrier or excipient. It may be administered in the form of a fine powder, e.g., a lyophilizate, under certain circumstances (see, e.g., U.S. Pat. Appl. Publ. No 20080035143; Chen et al. (2017) J Control Release 255: 36-44) or may be incorporated in a microneedle patch or similar device. Prausnitz et al. (2020) Current Opinion in Virology 41 :68- 76. Alternatively, the vaccine composition is an aqueous composition comprising an RDGACV and, as the case may be, an SMR. It may be administered parenterally to a subject as an aqueous solution or, in the case of administration to a mucosal membrane (e.g., airways), possibly as an aerosol thereof. See, e.g., U.S. Pat. No. 5,952,220. When administered by means of a microneedle patch or similar device, administration typically will be epidermally or intradermally.

[0044] The term parenteral as used herein includes subcutaneous, intracutaneous (epidermis and / or dermis), intravenous, intramuscular, intraarticular, intraarterial, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques.

[0045] The vaccine compositions of the present disclosure will typically include a buffer component. The compositions will have a pH that is compatible with the intended use and is typically between about 6 and about 8. A variety of conventional buffers may be employed such as phosphate, citrate, histidine, Tris, Bis-Tris, bicarbonate and the like and mixtures thereof. The concentration of the buffer generally ranges from about 0.01 to about 0.25% w / v (weight / volume).

[0046] Vaccine compositions comprising an RDGACV can further include, for example, preservatives, virus stabilizers, tonicity agents and / or viscosity-increasing substances. As mentioned before, they may also include an appropriate SMR, or a formulation comprising such SMR.

[0047] Preservatives used in parenteral compositions include phenol, benzyl alcohol, methyl paraben / propylparaben and phenoxyethanol. Phenoxyethanol appears to be the most widely used preservative found in vaccines. Preservatives are generally used in concentrations ranging from about 0.002 to about 1 % w / v. Meyer (2007) J Pharm Sci 96: 3155-67. Preservatives may be present in compositions comprising an RDGACV at concentrations at which they do not or only minimally interfere with the infectivity or genomic replication of the virus.

[0048] Osmolarity can be adjusted with tonicity agents to a value that is compatible with the intended use of the compositions. For example, the osmolarity may be adjusted to approximately the osmotic pressure of normal physiological fluids, which is approximately equivalent to about 0.9 % w / v of sodium chloride in water. Examples of suitable tonicity-adjusting agents include, without limitation, chloride salts of sodium, potassium, calcium and magnesium, dextrose, glycerol, propylene glycol, mannitol, sorbitol and the like, and mixtures thereof. Preferably, the tonicity agent(s) will be employed in an amount to provide a final osmotic value of 150 to 450 mOsm / kg, more preferably between about 220 to about 350 mOsm / kg and most preferably between about 270 to about 310 mOsm / kg. If indicated, the vaccine compositions of the present disclosure can further include one or more viscosity-modifying agents such as cellulose polymers, including hydroxypropylmethyl cellulose, hydroxyethyl cellulose, ethylhydroxyethyl cellulose, hydroxypropyl cellulose, methyl cellulose, carboxymethyl cellulose, glycerol, carbomers, polyvinyl alcohol, polyvinyl pyrrolidone, alginates, carrageenans, guar, karaya, agarose, locust bean, tragacanth and xanthan gums. Such viscosity modifying components are typically employed in an amount effective to provide the desired degree of thickening. Viscosity-modifying agents may be present in compositions comprising an RDGACV at concentrations at which they do not or only minimally interfere with the infectivity or genomic replication of the virus.

[0049] If the composition also contains an SMR, an effective amount of such SMR can be included in the composition in the form of a powder, solution, emulsion or particle. As also provided before, an effective amount of an SMR to be co-delivered with an effective amount of an RDGACV will be an amount that yields an effective concentration of the SMR in the inoculation site. To maintain an SMR at an effective concentration for a more extended period, it may be included in the form of a slow-release formulation (see also below).

[0050] Methods for amplifying herpesviruses are well known in the laboratory art. Industrial scale-up has also been achieved. Hunter (1999) J Virol 73: 6319-26; Rampling et al. (2000) Gene Ther 7: 859- 866; Mundle et al. (2013) PLoS ONE 8: e57224. Various methods for purifying viruses have been disclosed. See, e.g., Mundle et al. (2013) and references cited therein, and Wolf and Reichl (2011) Expert Rev Vaccines 10: 1451-75. An RDGACV will be propagated in a cell line that provides the function of the disabled viral gene in trans.

[0051] While an SMR can be co-administered with a recombinant alphaherpesvirus in a single composition, a composition comprising an RDGACV and a composition comprising an SMR can also be administered separately. The latter composition will comprise an effective amount of an SMR formulated together with one or more pharmaceutically acceptable carriers or excipients.

[0052] A composition comprising an SMR may be administered orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally or via an implanted reservoir, preferably by oral administration, administration by injection or deposition at the site of virus inoculation. The compositions may contain any conventional non-toxic, pharmaceutically acceptable carrier, adjuvant or vehicle. In some cases, the pH of the formulation may be adjusted with pharmaceutically acceptable acids, bases or buffers to enhance the stability of the formulated SMR or its delivery form.

[0053] Liquid dosage forms of an SMR for oral administration include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. In addition, the liquid dosage forms may contain inert diluents commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 ,3-butylene glycol, dimethylformamide, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor, and sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof. Besides inert diluents, the oral compositions can also include, e.g., wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents.

[0054] Injectable preparations, for example sterile injectable aqueous or oleaginous suspensions, may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution, suspension or emulsion in a nontoxic, parenterally acceptable diluent or solvent, for example, as a solution in 1 ,3-butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, ll.S.P. and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid are used in the preparation of injectables.

[0055] The injectable formulations can be sterilized, for example, by filtration through a bacteria-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.

[0056] In order to prolong the effect of an SMR, it may be desirable to slow the absorption of the compound from, e.g., subcutaneous, intracutaneous or intramuscular injection. This may be accomplished by the use of a liquid suspension of crystalline or amorphous material with poor water solubility. The rate of absorption of the SMR then depends upon its rate of dissolution, which, in turn, may depend upon crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered SMR is accomplished by dissolving or suspending the compound in an oil vehicle. Injectable depot forms are made by forming microcapsule matrices of the compound in biodegradable polymers such as polylactide-polyglycolide. Depending upon the ratio of compound to polymer and the nature of the particular polymer employed, the rate of compound release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared by entrapping the compound in liposomes or microemulsions that are compatible with body tissues.

[0057] Compositions for rectal or vaginal administration can be suppositories which can be prepared by mixing the SMR with suitable non-irritating excipients or carriers such as cocoa butter, polyethylene glycol or a suppository wax which are solid at ambient temperature but liquid at body temperature and therefore melt in the rectum or vaginal cavity and release the SMR.

[0058] Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the SMR is mixed with at least one inert, pharmaceutically acceptable excipient or carrier such as sodium citrate or dicalcium phosphate and, as indicated: a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid, b) binders such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia, c) humectants such as glycerol, d) disintegrating agents such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate, e) solution-retarding agents such as paraffin, f) absorption accelerators such as quaternary ammonium compounds, g) wetting agents such as, for example, cetyl alcohol and glycerol monostearate, h) absorbents such as kaolin and bentonite clay, and / or i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof. In the case of capsules, tablets and pills, the dosage form may also comprise buffering agents.

[0059] Solid compositions of a similar type may also be employed as fillers in soft- and hard-filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols and the like.

[0060] The solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings and other coatings well known in the pharmaceutical formulating art. They may optionally contain opacifying agents and can also be of a composition that they release the SMR only, or preferentially, in a certain part of the intestinal tract, optionally, in a delayed manner. Examples of embedding compositions that can be used include polymeric substances and waxes. Dosage forms for topical, intradermal or transdermal administration of an SMR include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants or patches. The SMR is admixed under sterile conditions with a pharmaceutically acceptable carrier and any preservatives or buffers as may be required.

[0061] The ointments, pastes, creams and gels may contain, in addition to an SMR, excipients such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide, or mixtures thereof.

[0062] Powders and sprays can contain, in addition to the SMR, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates and polyamide powder, or mixtures of these substances. Sprays can additionally contain customary propellants.

[0063] Transdermal patches have the added advantage of providing controlled delivery of a compound. Such dosage forms can be made by dissolving or dispensing the compound in the proper medium. Absorption enhancers can also be used to increase the flux of the compound into or across the skin.

[0064] For pulmonary delivery, a composition comprising an effective amount of an SMR is formulated and administered to the subject in solid or liquid particulate form by direct administration e.g., inhalation into the respiratory system. Such solid or liquid particulate forms of the SMR will comprise particles of respirable size: that is, particles of a size sufficiently small to pass through the mouth and larynx upon inhalation and into the bronchi and alveoli of the lungs. Delivery of aerosolized therapeutics, particularly aerosolized antibiotics, is known in the art (see, for example U.S. Pat. Nos. 5,767,068 and 5,508,269, and WO 98 / 43650). A discussion of pulmonary delivery of antibiotics is also found in U.S. Pat. No. 6,014,969.

[0065] What an effective amount of an SM R is will depend on the activity of the particular SM R employed, the route of administration, time of administration, the stability and rate of excretion of the particular SMR as well as the nature of the specific composition administered. It may also depend on the age, body weight, general health, sex and diet of the subject, other drugs used in combination or contemporaneously with the particular SMR employed and like factors well known in the medical arts.

[0066] Ultimately, what is an effective amount of an SMR can be determined in dose-finding experiments, in which genomic replication of an RDGACV in the inoculation site is assessed experimentally. Once an effective amount has been determined in animal experiments, it may be possible to estimate a human effective amount. “Guidance for Industry. Estimating the maximum safe starting dose for initial clinical trials for therapeutics in adult healthy volunteers”, U.S. FDA, Center for Drug Evaluation and Research, July 2005, Pharmacology and Toxicology. For example, as estimated from rat data, an effective human amount of orally administered mifepristone (for activating genomic replication of an RDGACV comprising an antiprogestin-activated transactivator) will be between about 1 and about 100 pg / kg body weight.

[0067] Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. The singular encompasses the plural, unless otherwise stated or clearly contradicted by context.

[0068] The description herein of any aspect or embodiment of the invention using terms such as reference to an element or elements is intended to provide support for a similar aspect or embodiment of the invention that “consists of’,” “consists essentially of” or “substantially comprises” that particular element or elements, unless otherwise stated or clearly contradicted by context (e. g., a composition described herein as comprising a particular element should be understood as also describing a composition consisting of that element, unless otherwise stated or clearly contradicted by context).

[0069] This disclosure is intended to include all modifications and equivalents of the subject matter recited in the aspects or claims presented herein to the maximum extent permitted by applicable law.

[0070] The present disclosure will be understood more readily by reference to the following examples, which are provided by way of illustration only.

[0071] EXAMPLES

[0072] All viruses were constructed using wild type HSV-1 strain 17syn+ as the backbone. Viral recombinants were generated by homologous recombination of engineered plasmids along with purified virion DNA in cells (rabbit skin (RS) cells, Vero or Vero-derived cells, or HEK293T cells) transfected by the calcium phosphate precipitation method. Bloom (1998) Methods Mol Med 10: 369-86. Cell culture and chemical reagents

[0073] Rabbit skin (RS) cells were a gift from E. Wagner and were propagated in Eagle’s Minimal Essential Medium (MEM) (Life Technologies / Thermo Fisher Scientific) supplemented with 5% heat-inactivated calf serum (Atlanta Biologicals, Lawrenceville, GA) and 2 mM L-glutamine. Vero cells obtained from the American Type Culture Collection (ATCC) and Vero-derived E5 cells (DeLuca and Schaffer (1987) Nucleic Acids Res 15: 4491-4511) provided by N. DeLuca were propagated in Dulbecco’s Modified Eagle’s Medium (DMEM) with 10% heat-inactivated fetal bovine serum (FBS). HEK293T cells (ATCC) were grown in complete DMEM supplemented with 10% heat-inactivated FBS and 2 mM L-glutamine. All media were further supplemented with 10 or 250 U / ml of penicillin and 100 or 250 pg / ml of streptomycin (Life Technologies). Where indicated, media were further supplemented with 10 nM ulipristal. All cells were cultured at 37°C under 5% CO2. HSV-1 strain 17syn+ was obtained from J. Stevens. Virus stocks were typically propagated in Vero or E5 cells, or, when indicated, in HEK293T cells. Ulipristal acetate (USP grade) was from D-Innovation Pharmaceutical Inc., Chengdu, Sichuan, PR China.

[0074] Example 1 : Construction of replication-competent controlled recombinant HSV-GS19

[0075] Replication-competent controlled recombinant HSV-GS3 was constructed using wildtype HSV-1 strain 17syn+ as the backbone. It contains, inserted in the UL43 / 44 intergenic region, a gene for antiprogestin-activated transactivator GLP65, which gene is controlled by a promoter assembly comprising a human HSP70B promoter and a GAL4 promoter (promoter responsive to activated GLP65). The native promoters of the ICP4 (both copies) and ICP8 genes are replaced with GAL4 promoters. Transient replication of the HSV-GS3 virus in infected cells is activated by a heat treatment of the cells in the presence of an appropriate concentration of an antiprogestin such as mifepristone or ulipristal. HSV-GS3 has been described in U.S. patents Nos. 10,478,486 and 11 ,497,806, and European patent No. 3185898.

[0076] HSV-GS19 was derived from HSV-GS3 and contains an insertion between the UL37 and UL38 genes of a gene cassette expressing the hemagglutinin (HA) gene of influenzavirus strain A / California / 07 / 2009 driven by the CMV IE promoter. A recombination plasmid was constructed by the following sequential steps. First, a 814 bp fragment containing the region spanning the UL37 / UL38 intergenic region of HSV-1 strain 17syn+ from nt 83,603-84,417 from plasmid NK470 was subcloned into pBluescript that had the multicloning site (MCS) removed (digestion with Kpnl / Sacl) to yield pBS:UL37 / 38. A cassette containing a synthetic CMV IE promoter flanked by the pBS-SK+ MCS was ligated into pBS:UL37 / 38 digested with BspE1 / Afll I, which enzymes cut between the LIL37 and LIL38 genes, to yield the plasmid pl N : U L37 / 38. A codon-optimized version of the full-length HA gene of A / California / 07 / 2009 (Genbank accession KU933485) was synthesized by GeneScript (Piscataway, NJ) and subcloned into pBluescript. The HA gene was excised subsequently from the latter plasmid and inserted behind the CMV promoter in the plasmid pl N : U L37 / 38 to yield plasmid plN:37 / 38-Cal / 07 / HA. To produce recombinant HSV-GS19, RS cells were co-transfected with plasmid plN:37 / 38-Cal / 07 / HA and purified HSV-GS3 virion DNA. Subsequent to the addition of ulipristal to the medium, the co-transfected cells were exposed to 43.5°C for 30 min and then incubated at 37°C. Subsequently, on days 2 and 3, the cells were again incubated at 43.5°C for 30 min and then returned to 37°C. Plaques were picked and amplified on 96-well plates of E5 cells in medium supplemented with ulipristal. One h after infection, the plates were incubated at 43.5°C for 30 min and then further incubated at 37°C. Subsequently, on days 2 and 3, the plates were also shifted to 43.5°C for 30 min and then returned to 37°C. After the wells showed 90-100% cytopathic effect (CPE), the plates were dot-blotted and the dot blot membrane hybridized with a32P-labeled DNA probe prepared by labeling the synthetic HA gene. Several positive plaques were identified and two were subjected to 3 rounds of plaque purification. Initial stocks were prepared for Southern blot analysis and sequencing of the insert. One recombinant clone was verified by southern blot analysis as well as by sequencing of the HA insert and -200 bp of the flanking sequence on each side of the insert. Upon this genetic verification, a master stock was prepared. The ability of this stock to produce the HA protein was confirmed by ELISA on lysates of cells infected at a multiplicity of infection (moi) of 3 and heat- treated in the presence of ulipristal prepared 12 hours post-infection.

[0077] Example 2: Construction of RDGACV HSV-73

[0078] Intermediate recombinant alphaherpesvirus HSV-72 is derived from HSV-GS19 by removing the region encoding the antiprogestin-binding domain from the GLP65 gene as well as the GAL4 promoter present in the promoter assembly driving the expression of the GLP65 gene. Recombination plasmid pINTA was described in Bloom et al. (2015) (J Virol 89: 10668 - 10679). It contains, inserted into sequences of the UL43 / 44 intergenic region of strain 17syn+, a assembly comprising a human HSP70B (HSPA7) promoter and a GAL4 promoter. This assembly is functionally linked to a gene for chimeric transactivator GLP65 comprising a GAL4 DNA-binding domain, a truncated ligand-binding domain from a progesterone receptor (that binds antiprogestins such as ulipristal) and an activation domain. The sequences in pINTA that encode the progesterone receptor ligand-binding domain of the TA were removed using the Q5® Site-Directed Mutagenesis Kit from New England BioLabs (Ipswich, MA) using oligonucleotides DelGLP65 F (5'-GGGTCGACGCCCATGGAA-3') (SEQ ID NO: 1) and DelGLP65 R (5'-CTGGTCGACACCCGGGAATTC-3') (SEQ ID NO: 2). The resulting plasmid was termed pINTAAPRL-BD. The GAL4 promoter of the promoter assembly driving TA expression was deleted by digesting pINTAAPRL-BD with Sgf1 (Vilaboa et al. (2005) Mol Ther 12: 290-298) and self-ligating the larger fragment. The resulting plasmid was named pINTAAPRL- BDAGAL4.

[0079] To produce recombinant HSV-72, RS cells are co-transfected with plasmid pINTAAPRL- BDAGAL4 and purified HSV-19 virion DNA by calcium phosphate precipitation. The transfected cells are exposed to 43.5°C for 30 minutes and then incubated at 37°C. Subsequently, on days 2 and 3, the cells are again incubated at 43.5°C for 30 minutes and then returned to 37°C. Several plaques are picked and amplified on 96-well plates of RS cells (with daily heat treatment). After several rounds of re-plaquing, the several isolates are verified to contain the modified promoter- transactivator gene sequences by PCR and nucleotide sequence analysis. One of these isolates is termed HSV-72.

[0080] Recombinant alphaherpesvirus HSV-73 is derived from recombinant HSV-72. HSV-73 contains an expressible HA gene of A / California / 07 / 2009. In addition, it carries in the UL43 / 44 intergenic region a gene for a constitutively active transactivator that is controlled by a human HSP70B ptomoter, and the native promoters of its ICP4 and ICP8 gene have been replaced with transactivator-responsive (GAL4) promoters. Furthermore, its UL38 / VP19c gene is disabled. To produce recombinant HSV-73, E5 cells transfected 24 h prior to co-transfection with expression vector pVP19c using Lipofectamine 2000 (Life Technologies), are co-transfected with plasmid pBS-KS:UL38Apromoter and purified HSV-72 virion DNA by calcium phosphate precipitation. The transfected cells are exposed to 43.5°C for 30 minutes and then incubated at 37°C. Subsequently, on days 2 and 3, the cells are again incubated at 43.5°C for 30 minutes and then returned to 37°C. Several plaques are picked and amplified on 96-well plates of pVP19c-transfected E5 cells (with daily heat treatment). After several rounds of re-plaquing, initial stocks are prepared for Southern blot analysis and sequence analysis. (At least) one recombinant clone is verified by southern blot analysis as well as by sequencing of the recombination target region at LIL38. A correct recombinant is named HSV-73. A master stock of the recombinant is prepared subsequently. Plasmid pBS-KS:UL38Apromoter was constructed by deletion of the region from -1 to -47 of the LIL38 promoter, i.e., by synthesizing two PCR fragments (one 437 bp and the other 550 bp) on either side of the deletion and cloning these into pBS KS+. Plasmid pVP19c was constructed by PCR- cloning of the promoter and coding sequence of the HSV-1 VP19c gene into pBS KS+ using HSV-1 strain 17syn+ virion DNA as the PCR target.

[0081] Example 3: Construction of RDGACV HSV-74

[0082] RDGACV HSV-74 is derived from recombinant HSV-GS19. HSV-74 contains an expressible HA gene of A / California / 07 / 2009 in the UL37 / 38 intergenic region. In addition, it carries in the UL43 / 44 intergenic region a gene for an antiprogestin-activated transactivator that is controlled by a human HSP70B / GAL4 promoter assembly and the native promoters of its ICP4 and ICP8 gene have been replaced with transactivator-responsive (GAL4) promoters. Furthermore, its UL38A / P19c gene is disabled.

[0083] To produce recombinant HSV-74, E5 cells transfected 24 h prior to co-transfection with expression vector pVP19c using Lipofectamine 2000 (Life Technologies), are co-transfected with plasmid pBS-KS:UL38Apromoter and purified HSV-GS19 virion DNA by calcium phosphate precipitation. Subsequent to the addition of ulipristal to the medium, the transfected cells are exposed to 43.5°C for 30 minutes and then incubated at 37°C. Subsequently, on days 2 and 3, the cells are again incubated at 43.5°C for 30 minutes and then returned to 37°C. Several plaques are picked and amplified on 96-well plates of pVP19c-transfected E5 cells (with daily heat treatment in the presence of ulipristal). After several rounds of re-plaquing, initial stocks are prepared for Southern blot analysis and sequence analysis. (At least) one recombinant clone is verified by Southern blot analysis as well as by sequencing of the recombination target region at UL38. A correct recombinant is named HSV-74. A master stock of the recombinant is prepared subsequently.

[0084] Example 4: Construction of RDGACV HSV-GS64 Replication-competent controlled alphaherpesvirus HSV-GS19 / mKRT1 was derived from HSV- GS19. It contains a heat- and antiprogestin-responsive gene switch that controls ICP4 expression. The recombinant also carries an expressible HA gene of A / California / 07 / 2009(H1 N1). Furthermore, a mouse keratin-1 gene (KRT1) promoter controls the expression of its ICP8 gene. To produce recombinant HSV-GS19 / mKRT1 , HEK293T cells were co-transfected with plasmid pBS-KS:mKRT1-ICP8 and purified HSV-GS19 virion DNA by calcium phosphate precipitation. Subsequent to the addition of ulipristal to the medium, the transfected cells were exposed to 43.5°C for 30 minutes and then incubated at 37°C. Subsequently, on days 2 and 3, the cells were again incubated at 43.5°C for 30 minutes and then returned to 37°C. Several plaques were picked and amplified on 96-well plates of HEK293T cells in medium supplemented with ulipristal. The plates were incubated at 43.5°C for 30 minutes one hour after infection and then incubated at 37°C. Subsequently, on days 2 and 3, the plates were also shifted to 43.5°C for 30 minutes and then returned to 37°C. After the wells showed 90 - 100% CPE, the plates were dot-blotted and the dot blot membrane hybridized with a32P-labeled DNA probe prepared by labeling a mouse mKRT1 promoter segment by random-hexamer priming. A positive well was re-plaqued and reprobed several times, and was verified to have lost the GAL4 promoter at ICP8 and to contain the mKRT1 promoter in its place by PCR and sequence analysis. To construct plasmid pBS- KS:mKRT1-ICP8, plasmid mKRT1 1.2 containing the mKRT1 promoter was subjected to PCR amplification using primers mKRT1-Aatll F (5'-TAGTGACGTCCTGACTGGCTTTAGCCCCTT-3') (SEQ ID NO: 3) and mKRT1-Aatll R (5'-

[0085] AAAGACGTCGCCTTAGAGAGAGGTGAGAGCAAAGACA -3') (SEQ ID NO: 4). The amplified fragment containing mKRT1 sequences from position -995 to position +55 (position +1 referring to the transcription start site) was digested with Aatll and gel-purified. For the vector, pBS- KS:ICP8Apromoter (Bloom et al. (2015) J Virol 89: 10668 -10679) was digested with Aatll. The resulting 4.59 kbp fragment was gel-purified. Ligation of the latter two DNA fragments placed the mKRT1 promoter in front of the ICP8 transcription start site. Subsequent to transformation, several colonies were expanded, and plasmid DNAs subjected to restriction and then sequence analysis to identify pBS-KS:mKRT1-ICP8. The correct orientation of the promoter was also verified by Hindlll digestion. The mKRT1 sequence contains a Hindlll site at position -917, and the MCS of pBS-KS:ICP8Apromoter also contains a Hindlll site.

[0086] Replication-competent controlled alphaherpesvirus HSV-GS63 was derived from HSV- GS19 / mKRT1. Its ICP4 genes are controlled by HSP70B (HSPA7) promoters and its ICP8 gene by a mouse KRT1 promoter. The recombinant also carries an expressible HA gene of A / California / 07 / 2009(H1 N1). The heat- and antiprogestin-responsive gene switch of HSV- GS19 / mKRT1 is retained but is non-functional because the recombinant lacks any GAL4 promoter-controlled gene. To produce HSV-GS63, HEK293T cells were co-transfected with plasmid pBS-KS:HSP70-ICP4 and purified HSV-19 / mKRT1 virion DNA by calcium phosphate precipitation. The transfected cells were exposed to 43.5°C for 30 minutes and then incubated at 37°C. Subsequently, on days 2 and 3, the cells were again incubated at 43.5°C for 30 minutes and then returned to 37°C. Several plaques were picked and amplified on 96-well plates of HEK293T cells. The plates were incubated at 43.5°C for 30 minutes one hour after infection and then incubated at 37°C. Subsequently, on days 2 and 3, the plates were also shifted to 43.5°C for 30 minutes and then returned to 37°C. After the wells showed 90 - 100% CPE, the plates were dot-blotted and the dot blot membrane hybridized with a32P-labeled HSP70B promoter probe. A strongly positive well was re-plaqued and re-probed several times, and was verified to have lost the GAL4 promoters upstream from the ICP4 genes and to contain the HSP70B promoter in their place by PCR and nucleotide sequence analysis. pBS-KS:HSP70-ICP4 was constructed by PCR amplification of a short human HSP70B promoter-containing segment (about 480 bp) from plasmid pHsp70-fluc described in Vilaboa et al. (2005) (Mol. Ther. 12: 290-298) using primers Hsp70promAatllF (5'-ATTCGACGTCTCGCCTCAGGGATCCGACCT-3') (SEQ ID NO: 5 ) and Hsp70promHindlllR (5'-TCTAGAGTCGACCTGCAGGCATGCAAGCTTCTTGT-3') (SEQ ID NO: 6), digestion of the amplified fragment with Aatll and Hindi II and ligation of the digested fragment to Aatl l / H indl I l-digested vector pBS-KS:ICP4Apromoter (described in Bloom et al. (2015) (J Virol 89: 10668 -10679).

[0087] RDGACV HSV-GS64 was derived from recombinant HSV-GS63. A schematic representation of the genome of the RDGACV is shoen in Figure 1 (top). HSV-GSD64 contains an expressible HA gene of A / California / 07 / 2009 in the UL37 / 38 intergenic region. In addition, its ICP4 genes are controlled by human HSP70B promoters and its ICP8 gene by a tissue-selective (mouse KRT1) promoter, it also carries in the UL43 / 44 intergenic region a gene for an antiprogestin-activated transactivator that is controlled by a human HSP70B / GAL4 promoter assembly. Furthermore, its UL38A / P19c gene is conditionally disabled by replacement of the native promoter of the UL38A / P19c gene with a transactivator-responsive (GAL4) promoter. In the absence of an antiprogestin, the UL38A / P19c gene is not expressed. This promoter replacement results in an inactive UL38 / VP19c gene in the absence of an active transactivator that interacts with this promoter.

[0088] To produce recombinant HSV-GS64, HEK293T cells previously transfected with expression plasmid pVP19c were co-transfected with plasmid pBS-KS:GAL4-UL38 and purified HSV-GS63 virion DNA by calcium phosphate precipitation. Subsequent to the addition of ulipristal to the medium, the transfected cells were exposed to 43.5°C for 30 minutes and then incubated at 37°C. Subsequently, on days 2 and 3, the cells were again incubated at 43.5°C for 30 minutes and then returned to 37°C. Several plaques were picked and amplified on 96-well plates of HEK293T cells (with daily heat treatment in the presence of ulipristal). After several rounds of re-plaquing, initial stocks were prepared for Southern blot analysis and sequencing of the insert at LIL38. One recombinant clone was verified by southern blot analysis as well as by sequencing of the GAL4 promoter insert and -200 bp of the flanking sequence on each side of the insert. This recombinant was named HSV-GS64. Plasmid pBS-KS:GAL4-UL38 contains a GAL4 promoter inserted in between the HSV-1 LIL38 recombination arms of plasmid pBS-KS:llL38Apromoter. To construct plasmid pBS-KS:GAL4-UL38, a GAL4-responsive promoter comprising six copies of the yeast GAL4 UAS (upstream activating sequence), the adenovirus E1 b TATA sequence and the synthetic intron Ivs8 was excised from plasmid pGene / v5-HisA (Invitrogen, now Life Technologies) with Aatll and Hindi 11 , and the resulting 473 bp fragment was gel-purified. For the vector, pBS-KS:UL38Apromoter was digested with Aatll and Hindlll, and the resulting 4,285 bp fragment was gel-purified and shrimp alkaline phosphatase-treated. Ligation of the latter two fragments placed the GAL4 promoter in front of the UL38 transcriptional start site.

[0089] Example 5: Construction of RDGACV HSV-76

[0090] RDGACV HSV-76 is derived from recombinant HSV-GS64. HSV-76 contains an expressible HA gene of A / California / 07 / 2009 in the UL37 / 38 intergenic region. In addition, its ICP4 genes are controlled by human HSP70B promoters and its ICP8 gene by a tissue-selective (mouse KRT1) promoter, it also carries in the UL43 / 44 intergenic region a gene for an antiprogestin-activated transactivator that is controlled by a human HSP70B / GAL4 promoter assembly. Furthermore, its UL38A / P19c gene is conditionally disabled by replacement of the native promoter of the UL38A / P19c gene with a transactivator-responsive (GAL4) promoter. In the absence of an antiprogestin, the UL38A / P19c gene is not expressed. Moreover, its ICP47 gene is disabled. ICP47 amino acid residue K31 was changed to G31 , and R32 to G32. Neumann et al. (1997) J Mol Biol 272: 484-492; Galocha et al. (1997) J Exp Med 185: 1565-1572. A 500-bp ICP47-coding sequence-containing fragment was PCR-amplified from virion DNA of strain 17syn+. The fragment was PCR-amplified as two pieces (a “left-hand” and a “right-hand” piece), using two primer pairs. The mutations were introduced through the 5’ PCR primer for the right-hand fragment. The resulting amplified left-hand and mutated right-hand fragments were subcloned into vector pBS, and the sequence in subclones was confirmed by sequence analysis. A subclone containing the 500-bp fragment with the desired mutations in ICP47 codons 31 and 32 was termed pBS:mut-ICP47.

[0091] One pg of pBS:mut-ICP47 is co-transfected with 10 pg of purified HSV-GS64 virion DNA into HEK293T cells previously transfected with expression plasmid pVP19c by calcium phosphate precipitation. The transfected cells are exposed to 43.5°C for 30 minutes and then incubated at 37°C. Subsequently, on days 2 and 3, the cells are again incubated at 43.5°C for 30 minutes and then returned to 37°C. Plaques are picked and amplified on 96 well plates of HEK293T cells in medium supplemented with ulipristal. The plates are incubated at 43.5°C for 30 minutes 1 hour after infection and then incubated at 37°C. Subsequently, on days 2 and 3, the plates are also shifted to 43.5°C for 30 minutes and then returned to 37°C. After the wells show 90 - 100% CPE, the plates are dot-blotted and the dot-blot membrane hybridized with a32P-labeled oligonucleotide probe to the mutated ICP47 region. A positive well is re-plaqued and re-probed several times and verified by sequence analysis to contain the expected mutated ICP47 gene sequence. This recombinant is designated HSV-76.

[0092] Example 6: Construction of RDGACV HSV-77

[0093] HSV-77 comprises a gene for hear- and amtiprogestin co-activated transactivator GLP65. The promoters of its ICP4 and ICP8 genes are replaced with transactivator-responsive (GAL4) promoters. It also comprises inserted in its UL37 / 38 intergenic region an expressible gene for the spike protein of a 2019 SARS-CoV-2 virus (COVID-19-causing virus). Furthermore, its ICP47 and LIL38 (VP19c) genes are disabled.

[0094] To construct recombinant HSV-GS4, one pg of pBS:mut-ICP47 was co-transfected with 10 pg of purified HSV-GS3 virion DNA into E5 cells by calcium phosphate precipitation. Subsequent to the addition of mifepristone to the medium, the transfected cells were exposed to 43.5°C for 30 minutes and then incubated at 37°C. Subsequently on days 2 and 3, the cells were again incubated at 43.5°C for 30 minutes and then returned to 37°C. Plaques were picked and amplified on 96 well plates of E5 cells in media supplemented with mifepristone. The plates were incubated at 43.5°C for 30 minutes 1 hour after infection and then incubated at 37°C. Subsequently on days 2 and 3, the plates were also shifted to 43.5°C for 30 minutes and then returned to 37°C. After the wells showed 90 - 100% CPE, the plates were dot-blotted and the dot-blot membrane hybridized with a32P-labeled oligonucleotide probe to the mutated ICP47 region. A positive well was re-plaqued and re-probed several times and verified by sequence analysis to contain the expected mutated ICP47 gene sequence. This recombinant was designated HSV-GS4.

[0095] HSV-GS41 contains a heat- and antiprogestin-co-activated gene for transactivator GLP65 (TA) inserted in the intergenic region between LIL43 and LIL44. In addition, the native promoters of the ICP4 and the ICP8 genes have been replaced with GAL4-responsive promoters. Furthermore, the LIS12 gene has been mutated to render its protein product (ICP47) nonfunctional. The recombinant further contains a spike protein gene from a SARS CoV-2 (COVID-19) that is expressed from a CMV immediate early promoter. A recombination plasmid was constructed by the following sequential steps. First, the 814 bp fragment containing the region spanning the HSV-1 UL37 / UL38 intergenic region from nt 83,603-84,417 from the plasmid NK470 was subcloned into pBS that had had the MCS (multiple cloning site) removed (digestion with Kpnl / Sacl) to yield pBS:UL37 / 38. A cassette containing a synthetic CMV IE promoter flanked by the pBS-SK+ MCS was ligated into pBS:UL37 / 38 that was digested with BspE1 / Aflll, cutting between the LIL37 and LIL38 genes to yield the plasmid plN:UL37 / 38. Plasmid “pCMV3-2019- nCoV Spike(S1+S2)-long” was obtained from Sino Biologicals (cat. No. VG40589-UT). The SARS CoV-2 spike gene sequence was excised from this plasmid and inserted behind the CMV promoter in the plasmid plN:UL37 / 38 to yield plasmid plN:37 / 38-S (SARS CoV-2). To produce recombinant HSV-GS41 , RS cells were co-transfected with plasmid plN:37 / 38-S (SARS CoV-2) and purified HSV-GS4 virion DNA. Subsequent to the addition of mifepristone to the medium, the co-transfected cells were exposed to 43.5°C for 30 min and then incubated at 37°C. Subsequently, on days 2 and 3, the cells were again incubated at 43.5°C for 30 min and then returned to 37°C. Picking and amplification of plaques, screening (using a32P-labeled DNA probe prepared from the spike protein-coding sequence) and plaque purification was performed essentially as described above and in Bloom et al. (2015). The resulting plaque-purified recombinant HSV-GS41 was verified by Southern blot as well as by PCR and DNA sequence analysis of the recombination junctions.

[0096] To construct recombinant HSV-77, E5 cells transfected 24 h prior to co-transfection with expression vector pVP19c using Lipofectamine 2000 (Life Technologies), are co-transfected with plasmid pBS-KS:UL38Apromoter and purified HSV-GS41 virion DNA by calcium phosphate precipitation. Subsequent to the addition of ulipristal to the medium, the transfected cells are exposed to 43.5°C for 30 minutes and then incubated at 37°C. Subsequently, on days 2 and 3, the cells are again incubated at 43.5°C for 30 minutes and then returned to 37°C. Several plaques are picked and amplified on 96-well plates of pVP19c-transfected E5 cells (with daily heat treatment in the presence of ulipristal). After several rounds of re-plaquing, initial stocks are prepared for Southern blot analysis and sequence analysis. (At least) one recombinant clone is verified by Southern blot analysis as well as by sequencing of the recombination target region at UL38. A correct recombinant is named HSV-77.

[0097] Example 7: Immunization experiment

[0098] RDGACVs HSV-73, HSV-74, HSV-GS64 and HSV-76 or vehicle are administered under anesthesia to the slightly abraded plantar surfaces of both rear feet of adult female BALB / c mice (2.5 x 105PFU (plaque-forming unit) of virus per animal; 10 animals per group). Concurrently, and again 24 h later, the animals inoculated with HSV-74 will receive an intraperitoneal injection of 50 pg / kg of body weight ulipristal. Three hours after inoculation, the mice are subjected to heat treatment (44.5°C for 10 min) by immersion of their hind feet in a temperature-controlled water bath. Three weeks later, all animals will be reinoculated with 2.5 x 105PFU / animal of the recombinant virus they had received before (or vehicle). The animals of the HSV-74 group will be exposed to ulipristal, and all animals will be subjected to heat treatment as before. Three weeks later, all animals are challenged with a several-fold lethal dose of influenzavirus A / California / 07 / 2009(H1 N1) that is administered intranasally. Animals are observed until no more lethal endpoints (> 20% weight loss) are reached, i.e. , until all surviving animals have recovered. It is predicted that all RDGACVs will provide complete protection against the lethal influenza virus challenge. The experiment may be repeated using different influenza H1 N1 strains, influenza strains of different subtypes or even of a different group (group 2) as challenge viruses to determine to which extent the RDGACVs are capable of conferring cross-protection. Example 8: Cross-protection induced by immunization with HSV-GS64

[0099] Young adult BALB / c mice (10 per group) were mock-immunized or immunized twice with HSV- GS64. Three weeks after the second immunization, all animals were challenged intranasally with a lethal dose of influenza virus strain A / Fort Monmouth / 1 / 1947 (H1 N1) (FM47) or strain A / Hong Kong / 4801 / 2014 (H3N2) (HK14). Recombinant HSV-GS64 comprises a gene for a heat- and antiprogestin-activated gene switch and its VP19c gene is under the control of a gene switch- responsive promoter (a GL4 promoter). Therefore, the HSV-GS64 virus proliferates in heat- treated infected cells in the presence of an antiprogestin (ulipristal). It behaves as replication- competent controlled virus of the type described in patent publication W02020 / 104180 (VI R4 WO). In the absence of an antiprogestin, it is an RDGACV of the present disclosure. See Figure 1 (bottom) for the results of a single-cycle growth experiment that was performed as described in Bloom et al. (2018) (Vaccines 12: 537). Hence, the experiment could evaluate whether the protective immune response induced by the vaccine was diminished when no progeny virus is produced. Survival results are found in Figure 2A and B, right panels of the upper rows. The clinical endpoint of the model was >20% weight loss. The results reveal that mock-immunized animals succumbed after challenge with either the H1 N1 virus or the H3N2 virus. HSV-GS64- immunized animals were completely protected against lethality induced by either challenge virus. There was no difference in protection between animals that were immunized in the presence or the absence of antiprogestin ulipristal. Relative average weights of animals after challenge are shown in the left panels of the lower rows in Figure 2A and B, and relative weights of individual animals (vaccinated in the absence of an antiprogestin) are shown in the right panels. The results show that there was no weight loss in HSV-GS64-immunized animals, regardless of the presence or absence of an antiprogestin during vaccination.

[0100] Therefore, virus proliferation was not required for producing the observed complete cross- protective esponses. Note that protective effects were dependent on an activating heat treatment, i.e. on the activation of viral genome replication (Figure 2B).

Claims

CLAIMS1. A recombinant alphaherpesvirus comprising(a) a heat shock promoter that controls the expression of a first gene of the recombinant alphaherpesvirus, which first gene is essential for the replication of the genome of the recombinant alphaherpesvirus(b) a disabling deletion, insertion or mutation in a second gene of the recombinant alphaherpesvirus or the promoter controlling the second gene, the second gene being essential for a step in the maturation of the recombinant alphaherpesvirus, which step occurs subsequent to the replication of the genome of the recombinant alphaherpesvirus and without which step no infectious progeny virus is produced and(c) inserted in its genome an expressible heterologous gene for a surface protein or parts of a surface protein of a virus or another pathogen.

2. The recombinant alphaherpesvirus of claim 1 , wherein the heat shock promoter is functionally linked to the first gene of the recombinant alphaherpesvirus.

3. The recombinant alphaherpesvirus of claim 1 , wherein the heat shock promoter is functionally linked to a gene for a heterologous transactivator that has been inserted in the genome of the recombinant alphaherpesvirus and the first gene of the recombinant alphaherpesvirus is functionally linked to a transactivator-responsive promoter.

4. The recombinant alphaherpesvirus of any of claims 1-3, wherein the first gene is an immediate early or an early gene of the recombinant alphaherpesvirus.

5. The recombinant alphaherpesvirus of any of claims 1-4, wherein the second gene is a late gene of the recombinant alphaherpesvirus.

6. The recombinant alphaherpesvirus of any of claims 1-5, wherein the expressible heterologous gene encodes an influenza virus surface protein or parts thereof.

7. The recombinant alphaherpesvirus of any of claims 1-5, wherein the expressible heterologous gene encodes a human immunodeficiency virus surface protein or parts thereof.

8. The recombinant alphaherpesvirus of any of claims 1-5, wherein the expressible heterologous gene encodes a corona virus surface protein or parts thereof.

9. The recombinant alphaherpesvirus of any of claims 1-8, wherein the recombinant alphaherpesvirus is derived from a virus selected from the group consisting of an HSV-1 , an HSV- 2 and a varicella zoster virus.

10. The recombinant alphaherpesvirus of any of claims 1-8, wherein the recombinant alphaherpesvirus is derived from an HSV-1 or HSV-2 and is lacking a functional ICP47 gene.

11. A vaccine composition comprising an effective amount of the recombinant alphaherpesvirus of any of claims 1-10 and a pharmaceutically acceptable carrier or excipient.

12. The recombinant alphaherpesvirus of any of claims 1-10 for use in preventative or therapeutic vaccination against a disease caused by a virus or other pathogen that displays the surface protein that is expressed by the recombinant alphaherpesvirus or an immunologically related protein.

Citation Information

Patent Citations

  • Novel immunization agents and methods of use

    EP3185898A1

  • Immunization agents and methods of use

    US10478486B2

  • Immunization agents and methods of use

    US11497806B2

  • Human-powered dry powder inhaler and dry powder inhaler compositions

    US20080035143A1

  • Constant temperature device

    US3951127A