Use of postbiotics for treating or preventing disruptions of the gut-brain axis

Abstract

Provided herein are postbiotic compositions prepared using fermentation and herbal substrate compositions for the treatment or prevention of the disruption of the gut-brain axis. Such postbiotic compositions can be used to treat or prevent neurological diseases or disorders, such as synucleinopathies, including but not limited to Parkinson's disease.

Description

USE OF POSTBIOTICS FOR TREATING OR PREVENTING DISRUPTIONS OF THEGUT-BRAIN AXISCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application No. 63 / 632,374 filed April 10, 2024, the contents of which are incorporated herein by reference in their entirety.SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted in XML format via Patent Center and is hereby incorporated by reference in its entirety. Said XML copy, created on March 28, 2025, is named 084487-000101 WOPT SL. xml and is 150,869 bytes in size.FIELD

[0003] The present disclosure is broadly concerned with postbiotic compositions and methods of using them to prevent or treat disruptions of the gut-brain axis.BACKGROUND

[0004] Body systems beyond the nervous system are impacted in neurological disease. Among these, gastrointestinal (GI) health and the role of the gut microbiome is a component of nervous system disorders, including in synucleinopathies such as Parkinson’s disease (PD), dementia with Lewy bodies (DLB), and multiple system atrophy (MSA). As Gl abnormalities are common in PD and can precede the manifestation of the movement disorder, the GI system can contribute to PD pathogenesis. Significant perturbation of the gut microbial community has been consistently reported in PD patients compared to healthy individuals. However, whether this contributes to the disease process in PD or is a consequence of the disease remains unknown. There is need for therapeutics for synucleinopathies, and for diseases or disorders related to disruptions of the gut-brain axis.SUMMARY

[0005] Examples are provided herein to enhance understanding of the present disclosure.

[0006] In one aspect, described herein is a method of treating or preventing a disease or disorder associated with a disruption in the gut-brain axis, the method comprising administering to a subject in need thereof an effective amount of a postbiotic composition.

[0007] In one aspect, described herein is a method of treating or preventing a neurological disease or disorder, the method comprising administering to a subject in need thereof an effective amount of a postbiotic composition.

[0008] In one aspect, described herein is a method of treating or preventing a synucleinopathy, the method comprising administering to a subject in need thereof an effective amount of a postbiotic composition.

[0009] In some embodiments of any of the aspects, the disease or disorder is selected from the group consisting of: Parkinson’s disease (PD); REM Sleep Behavior Disorder; dementia with Lewy bodies (DLB); pure autonomic failure (PAF); and multiple system atrophy (MSA).

[0010] In some embodiments of any of the aspects, the disease or disorder is Parkinson’s disease.

[0011] In some embodiments of any of the aspects, the disease or disorder is REM SleepBehavior Disorder.

[0012] In some embodiments of any of the aspects, administering the postbiotic composition is associated with at least one of the following outcomes, as compared to a negative control such as a subject not receiving the postbiotic composition or the treated subject prior to being administered the postbiotic composition: higher diversity in microbiome; higher abundance of beneficial microbiome species (e.g., Faecalibacterium, Akkermansia, and / or Ruminococcus); decreased abundance of pathogenic or non-beneficial microbiome species (e.g., Scardovia, Escherichia-Shigella, and / or Streptococcus),' decreased alpha-synuclein accumulates or inclusions (e.g., in samples from the stool, colon, gut, skin, and / or CSF); decreased inflammatory cytokines (e.g., tumor necrosis factor-alpha (TNFa), interleukin- ip (IL-1(3), and / or interleukin-6 (IL-6)); decreased immune activation; decreased constipation; decreased stool hardness; decreased bowel movement frequency; decreased incidence or severity of sleep behavior disorders; decreased incidence or severity of Parkinson’s symptoms (e.g., tremor in hands, arms, legs, jaw, or head; muscle stiffness; slowness of movement; impaired balance and coordination); increased cognitive function; decreased depression; decreased anxiety; and / or increased quality of life.

[0013] In some embodiments of any of the aspects, the postbiotic comprises the products of fermentation of herbal material comprising an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus, with at least one Bifidobacterium species and at least one Lactobacillus species.(0014] In some embodiments of any of the aspects, the postbiotic comprises the products of fermentation of herbal material comprising ashwagandha root and elderberry, with at least one Bifidobacterium species and at least one Lactobacillus species.

[0015] In some embodiments of any of the aspects, the postbiotic composition is prepared according to a process comprising: (a) preparing a culture of microorganisms; (b) preparing a fermentation substrate composition; (c) inoculating the fermentation substrate composition with the culture of microorganisms to generate an inoculate composition; (d) fermenting the inoculate composition for a predetermined amount of time to generate a fermented inoculate composition; and (e) lyophilizing or spray-drying the fermented inoculate composition to obtain the postbiotic composition.

[0016] In some embodiments of any of the aspects, the fermentation substrate composition comprises: herbal material comprising an herb of the Solanaceae or nightshade family and a berry ofthe Sambucus L. genus, in combination with at least one Bifidobacterium species and at least one Lactobacillus species, and liquid water sufficient to suspend or submerge the herbal material.

[0017] In some embodiments of any of the aspects, the fermentation substrate composition comprises: herbal material comprising ashwagandha root and elderberry, in combination with at least one Bifidobacterium species and at least one Lactobacillus species, and liquid water sufficient to suspend or submerge the herbal material.

[0018] In some embodiments of any of the aspects, the fermentation substrate composition further comprises one or more of glucose, sucrose, fructose, honey, and molasses.

[0019] In some embodiments of any of the aspects, the herbal material further comprises an herb of the Astragalus family and / or a legume of the Lens orientalis or Lens culinaris family.

[0020] In some embodiments of any of the aspects, the herbal material further comprises Astragalus membranaceus root and / or and red lentil.

[0021] In some embodiments of any of the aspects, the fermentation substrate comprises: about 2% by weight to about 10% by weight ashwagandha; about 2% by weight to about 10% by weight elderberry; about 2% by weight to about 10% by weight Astragalus membranaceus root; about 0.5% by weight to about 3% by weight red lentil; about 2% by weight to about 10% by weight glucose, sucrose, fructose, honey, or molasses; and / or about 70% by weight to about 95% by weight water.

[0022] In some embodiments of any of the aspects, the predetermined amount of time is about 24 hours to about 10 days.

[0023] In some embodiments of any of the aspects, the culture of microorganisms comprises at least one Bifidobacterium species and at least one Lactobacillus species.

[0024] In some embodiments of any of the aspects, the Bifidobacterium is selected from the group consisting of B. lactis, B. breve, B. infantis, B. longum, and any combination thereof.

[0025] In some embodiments of any of the aspects, the Lactobacillus is selected from the group consisting of L. plantarum, L. acidophilus, L. rhamnosus, L. paracasei, L. casei, and any combination thereof.

[0026] In some embodiments of any of the aspects, the culture of microorganisms comprises a microorganism concentration from about 1.0 x 108CFU / mL to about 1x1012CFU / mL.

[0027] In some embodiments of any of the aspects, administering the postbiotic composition in combination with a synucleinopathy treatment is associated with an improvement in intestinal mucositis, as compared to a negative control such as a subject not receiving the composition or the treated subject prior to being administered the composition.

[0028] In one aspect, described herein is a method of treating a synucleinopathy, the method comprising administering an effective amount of a postbiotic composition to a subject in need thereof, wherein the administering is effective to treat the synucleinopathy, wherein the postbiotic composition comprises the products of fermentation of herbal material comprising an herb of the Solanaceae ornightshade family and a berry of the Sambucus L. genus, with at least one Bifidobacterium species and at least one Lactobacillus species.

[0029] In one aspect, described herein is a method of treating a synucleinopathy, the method comprising administering an effective amount of a postbiotic composition to a subject in need thereof, wherein the administering is effective to treat the synucleinopathy, wherein the postbiotic composition is prepared according to a process comprising: (a) preparing a culture of microorganisms comprising B. lactis, B. infantis, B. breve, L. paracasei, L. rhamnosus, and / or L. casei; (b) preparing a fermentation substrate composition comprising herbal material comprising ashwagandha root and elderberry in combination with liquid water sufficient to suspend or submerge the herbal material; (c) inoculating the fermentation substrate composition with the culture of microorganisms to generate an inoculate composition; (d) fermenting the inoculate composition for a predetermined amount of time to generate a fermented inoculate composition; and (e) lyophilizing or spray-drying the fermented inoculate composition to obtain the postbiotic composition.BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to describe the manner in which the advantages and features of the disclosure can be obtained, reference is made to embodiments thereof which are illustrated in the appended drawings. Understanding that these drawings depict only exemplary embodiments of the disclosure and are not therefore to be considered limiting of its scope, the principles herein are described and explained with additional specificity and detail through the use of the accompanying drawings.

[0031] Fig. 1 is a schematic showing an exemplary study design for treatment of Parkinson’s disease.DETAILED DESCRIPTION

[0032] The present disclosure provides methods for using postbiotic compositions with advantageous metabolite and secondary metabolite and organic acid levels and profiles to treat or prevent the disruption of the gut-brain axis. As used herein, the term “gut-brain axis” refers to the gut- produced or modulated hormones, gut bacterial metabolites, etc. that influence fiinction of the central and / or peripheral nervous system (e.g., neurons, glial cells, and the like). Postbiotics comprise primary and secondary metabolic products, molecular cues that can be membrane -bound or dissolved, secreted products created by probiotic microorganisms, and / or components of microbial substrates converted or not by microbial activity that influence the gut microbiome and its host.

[0033] According to at least one aspect of the present disclosure, the presently disclosed postbiotic compositions are effective in treating or preventing a neurological disease or disorder. In some aspects, the postbiotic compositions can be used to treat or prevent a synucleinopathy, which is a group of neurodegenerative disorders in which the protein alpha-synuclein accumulates abnormally to fonn inclusions in the cell bodies or axons of neurons or oligodendrocytes and is associated with multisystem neurodegeneration.

[0034] Non-limiting examples of diseases or disorders associated with synucleinopathy include movement disorders, parkinsonism (Parkinson's disease, pantothenate kinase-associated neurodegeneration), dementia (Parkinson's disease dementia, dementia with Lewy body), and autonomic dysfunction (pure autonomic failure, multiple system atrophy). In some embodiments, the subject to be treated has or is diagnosed with a disease or disorder selected from the group consisting of: Parkinson’s disease (PD); REM Sleep Behavior Disorder; dementia with Lewy bodies (DLB); pure autonomic failure (PAF); and multiple system atrophy (MSA). In some embodiments, the subject to be treated has or is diagnosed with REM Sleep Behavior Disorder, which is characterized by complex motor enactment of dreams and is a potential prodromal marker of Parkinson's disease (PD).

[0035] The presently disclosed gut microbiome protecting postbiotic compositions can be prepared according to a process that uses fermentation. In particular, the presently disclosed compositions provide probiotics combined with fermented herbal substrates, and compounds from microbial activity that protects, stimulates and stabilizes a healthy gut ecosystem, thereby protecting the gut-brain axis. It has been surprisingly discovered that the fermentation provides postbiotic compositions with metabolite profiles that can be used to treat or prevent disruption of the gut-brain axis. In particular, the fermentation results in postbiotic compositions with elevated advantageous metabolites, such as 3-hydroxybutyric acid, quercetin, phloionolic acid, wedelolactone, luteolin, N- [(2S)-2-hydroxypropanoyl]-L-leucine, organic acids such as citric acid, succinic acid, lactic acid, glycerol and acetic acid, as well as indole organic acids, and vitamin C.

[0036] As used herein, the term “postbiotic” or “postbiotics” is defined as the metabolites in, the secondary metabolites of, and the secretions, membrane proteins, intra- and / or extra- cellular components of a microbial community.

[0037] In one aspect, described herein is a fermentation substrate composition for use in a fermentation process to prepare a postbiotic composition. In some embodiments of any of the aspects, the fermentation substrate is or comprises an herbal substrate composition or herbal material. In some embodiments of any of the aspects, the substrate composition or herbal material comprises at least one of an herb of the Astragalus family, an herb of the Solanaceae or nightshade family, a berry of the Sambucus L. genus, and a legume of the Lens orientalis or Lens culinaris family. The substrate composition also comprises liquid water, e.g., sufficient to suspend or submerge the plant substrate material.

[0038] In one aspect, described herein is a fermentation substrate composition for use in a fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising at least one of an herb of the Astragalus family, an herb of the Solanaceae or nightshade family, a berry of the Sambucus L. genus, and a legume of the Lens orientalis or Lens culinaris family, in combination with liquid water sufficient to suspend or submerge the herbal material.

[0039] In one aspect, described herein is a fermentation substrate composition for use in a fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus, in combination with liquid water sufficient to suspend or submerge the herbal material.

[0040] In one aspect, described herein is a fermentation substrate composition for use in a fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising ashwagandha root and elderberry, in combination with liquid water sufficient to suspend or submerge the herbal material.

[0041] In one aspect, described herein is a fermentation substrate composition for use in a fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus, in combination with at least one Bifidobacterium species and at least one Lactobacillus species, and liquid water sufficient to suspend or submerge the herbal material.

[0042] In one aspect, described herein is a fermentation substrate composition for use in a fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising ashwagandha root and elderberry, in combination with at least one Bifidobacterium species and at least one Lactobacillus species, and liquid water sufficient to suspend or submerge the herbal material.

[0043] In one aspect, described herein is a fermentation substrate composition for use in a fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus, in combination with at least two of the following: B. lactis, B. infantis, B. breve, L. paracasei, L. rhamnosus, and / or L. casei, and liquid water sufficient to suspend or submerge the herbal material.

[0044] In one aspect, described herein is a fermentation substrate composition for use in a fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising ashwagandha root and elderberry, in combination with at least two of the following: B. lactis, B. infantis, B. breve, L. paracasei, L. rhamnosus, and / or £. casei, and liquid water sufficient to suspend or submerge the herbal material.

[0045] In one aspect, described herein is a fermentation substrate composition for use in a fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus, in combination with B. lactis, B. infantis, B. breve, L. paracasei, L. rhamnosus, and L. casei, and liquid water sufficient to suspend or submerge the herbal material.

[0046] In one aspect, described herein is a fermentation substrate composition for use in a fermentation process to prepare a postbiotic composition, the fermentation substrate comprisingherbal material comprising ashwagandha root and elderberry, in combination with B. lactis, B. infantis, B. breve, L. paracasei, L. rhamnosus, and L. casei, and liquid water sufficient to suspend or submerge the herbal material.

[0047] In some embodiments of any of the aspects, the herbal material is provided as a dried powder prior to combination with water. In some embodiments of any of the aspects, the dried powder comprises dried powder of a juice.

[0048] In some embodiments of any of the aspects, the herb of the Astragalus family is Astragalus membranaceus. In some embodiments of any of the aspects, the herb of the Astragalus family is Astragalus membranaceus root. In some embodiments of any of the aspects, the herb is provided as a dried powder.

[0049] In some embodiments of any of the aspects, the herb of the Solanaceae or nightshade family is ashwagandha root. In some embodiments of any of the aspects, the herb is provided as a dried powder.

[0050] In some embodiments of any of the aspects, the berry of the Sambucus L. genus is elderberry. In some embodiments of any of the aspects, the berry is provided as a dried powder.

[0051] In some embodiment of any of the aspects s, the legume of the Lens oriental is or Lens culinaris family is a lentil. In some embodiments of any of the aspects, the legume is red lentil. In some embodiments of any of the aspects, the legume is provided as a dried powder.

[0052] In some embodiments of any of the aspects, the fermentation substrate comprises at least an herb of the Astragalus family and an herb of the Solanaceae or nightshade family. In some embodiments of any of the aspects, the fermentation substrate comprises an herb of the Astragalus family and a berry of the Sambucus L. genus. In some embodiments of any of the aspects, the fermentation substrate comprises an herb of the Astragalus family and a legume of the Lens orientalis or Lens culinaris family. In some embodiments of any of the aspects, the fermentation substrate comprises an herb of the Astragalus family, an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus. In some embodiments of any of the aspects, the fermentation substrate comprises an herb of the Astragalus family, an herb of the Solanaceae or nightshade family and a legume of the Lens orientalis or Lens culinaris family. In some embodiments of any of the aspects, the fermentation substrate comprises an herb of the Astragalus family, a berry of the Sambucus L. genus and a legume of the Lens orientalis or Lens culinaris family. In some embodiments of any of the aspects, the fermentation substrate comprises an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus. In some embodiments of any of the aspects, the fermentation substrate comprises ashwagandha root and elderberry (e.g., elderberry juice). In some embodiments of any of the aspects, the fermentation substrate comprises an herb of the Solanaceae or nightshade family and a legume of the Lens orientalis or Lens culinaris family. In some embodiments of any of the aspects, the fermentation substrate comprises an herb of the Solanaceae or nightshade family, a berry of the Sambucus L. genus and a legume of the Lensorientalis or Lens culinaris family. In some embodiments of any of the aspects, the fermentation substrate comprises a berry of the Sambucus L. genus and a legume of the Lens orientalis or Lens culinaris family. In some embodiments of any of the aspects, an herb of the Astragalus family, an herb of the Solanaceae or nightshade family, a berry of the Sambucus L. genus and a legume of the Lens orientalis or Lens culinaris family.

[0053] In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus and Ashwagandha. In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus and elderberry. In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus and red lentil. In some embodiments of any of the aspects, the fermentation substrate comprises ashwagandha and elderberry. In some embodiments of any of the aspects, the fermentation substrate comprises elderberry and red lentil. In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus, ashwagandha and elderberry. In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus, ashwagandha and red lentil. In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus, elderberry and red lentil.

[0054] In some embodiments of any of the aspects, the fermentation substrate further comprises one or more of glucose, sucrose, fructose, honey, and molasses. In some embodiments of any of the aspects, the fermentation substrate further comprises glucose, sucrose, fructose, honey, or molasses.

[0055] The pH of the fermentation substrate can vary, and can change over the course of fermentation. In some embodiments of any of the aspects, the pH of the fermentation substrate is from about 5.0 to about 8.0. In some embodiments of any of the aspects, the pH of the fermentation is from about 5.0 to about 7.5. In some embodiments of any of the aspects, the pH of the fermentation is from about 5.0 to about 7.5, about 5.0 to about 7.0, about 5.0 to about 6.8, about 5.0 to about 6.6, about 5.0 to about 6.4, about 5.0 to about 6.2, about 5.0 to about 6.0, about 5.5 to about 8.0, about 5.5 to about 7.5, about 5.5 to about 7.0, about 5.5 to about 6.8. about 5.5 to about 6.6, about 5.5 to about6.4, about 5.5 to about 6.2, about 5.5 to about 6.0, about 6.0 to about 8.0, about 6.0 to about 7.5, about 6.0 to about 7.0, about 6.0 to about 6.8, about 6.0 to about 6.6, about 6.0 to about 6.4, about 6.0 to about 6.2, about 6.2 to about 8.0, about 6.2 to about 7.5, about 6.2 to about 7.0, about 6.2 to about 6.8, about 6.2 to about 6.6, about 6.2 to about 6.4, about 6.4 to about 8.0, about 6.4 to about 7.5, about 6.4 to about 7.0, about 6.4 to about 6.8, about 6.4 to about 6.6, about 6.6 to about 8.0, about 6.6 to about7.5, about 6.6 to about 7.0, about 6.6 to about 6.8, about 6.8 to about 8.0, about 6.8 to about 7.5, about 6.8 to about 7.0, about 7.0 to about 8.0 or about 7.0 to about 7.5. In some embodiments of any of the aspects, the pH of the fermentation is from about 3.5 to 6.7 (e.g., during the fermentation). In some embodiments of any of the aspects, the pH of the fermentation is from about 3.5 to 4.2 (e.g., end of fermentation). In some embodiments of any of the aspects, the pH of the end product of the fermentation process (e.g., a postbiotic composition) is from 5.0 to 8.0.

[0056] In one aspect, described herein is a fermentation substrate composition for use in a fermentation process to prepare a postbiotic composition, the fermentation substrate comprising at least one herbal material selected from Astragalus membranaceus root, ashwagandha, elderberry and red lentil, in combination with liquid water sufficient to suspend or submerge the herbal material.

[0057] In some embodiments of any of the aspects, the fermentation substrate composition further comprises glucose, sucrose, fructose, honey, or molasses. In some embodiments of any of the aspects, the fermentation substrate composition further comprises a source of fermentable sugar, e.g., glucose, sucrose, fructose, malt extract, molasses, honey, or other fermentable sugar.

[0058] In some embodiments of any of the aspects, the herbal material is provided as a dried powder prior to combination with water.

[0059] In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus membranaceus root and Ashwagandha.

[0060] In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus membranaceus root and elderberry.

[0061] In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus membranaceus root and red lentil.

[0062] In some embodiments of any of the aspects, the fermentation substrate comprises ashwagandha and elderberry.

[0063] In some embodiments of any of the aspects, the fermentation substrate comprises elderberry and red lentil.

[0064] In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus membranaceus root, ashwagandha and elderberry.

[0065] In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus membranaceus root, ashwagandha and red lentil.(0066] In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus membranaceus root, elderberry and red lentil.

[0067] In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus membranaceus root, ashwagandha, elderberry and red lentil.

[0068] In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2% by weight to about 10% by weight herb of the Astragalus family. In some embodiments of any of the aspects, the substrate composition comprises from about 2.5% by weight to about 5% by weight herb of the Astragalus family.

[0069] In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2% by weight to about 10% by weight Astragalus. In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2.5% by weight to about 5% by weight Astragalus.

[0070] In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2% by weight to about 10% by weight herb of the Solanaceae or nightshade family. In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2.5% by weight to about 5% by weight herb of the Solanaceae or nightshade family.

[0071] In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2% by weight to about 10% by weight ashwagandha. In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2.5% by weight to about 5% by weight ashwagandha.

[0072] In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2% by weight to about 10% by weight berry of the Sambucus L. genus. In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2% by weight to about 10% by weight berry of the Sambucus L. genus.

[0073] In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2% by weight to about 10% by weight elderberry.In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2.5% by weight to about 5% by weight elderberry.

[0074] In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2% by weight to about 10% by weight glucose, sucrose, fructose, honey, or molasses.

[0075] In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2.5% by weight to about 5% by weight glucose, sucrose, fructose, honey, or molasses.

[0076] In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 0.5% by weight to about 3% by weight legume of the Lens orientalis or Lens culinaris family. In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 0.5% by weight to about 1.5% by weight legume of the Lens orientalis or Lens culinaris family.

[0077] In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 0.5% by weight to about 3% by weight red lentil. In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 0.5% by weight to about 1.5% by weight red lentil.

[0078] In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 70% by weight to about 95% by weight water.

[0079] In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 80% by weight to about 90% by weight water.

[0080] In some embodiments of any of the aspects, the fermentation substrate composition comprises: from about 2.5% by weight to about 5% by weight Astragalus', from about 2.5% by weight to about 5% by weight ashwagandha; from about 2.5% by weight to about 5% by weight elderberry; from about 2.5% by weight to about 5% by weight sucrose or molasses; from about 0.5% by weight to about 1.5% by weight red lentil; and from about 80% by weight to about 90% by weight water.

[0081] In some embodiments of any of the aspects, the fermentation substrate composition comprises: from about 2.5% by weight to about 5% by weight ashwagandha; from about 2.5% by weight to about 5% by weight elderberry; from about 2.5% by weight to about 5% by weight sucrose or molasses; from about 0.5% by weight to about 1.5% by weight red lentil; and from about 80% by weight to about 90% by weight water.

[0082] In some embodiments of any of the aspects, the substrate composition comprises: from about 2.5% by weight to about 5% by weight ashwagandha; from about 2.5% by weight to about 5% by weight elderberry; from about 2.5% by weight to about 5% by weight sucrose or molasses; and from about 80% by weight to about 90% by weight water.

[0083] In some embodiments of any of the aspects, the substrate composition comprises: from about 2.5% by weight to about 5% by weight Astragalus; from about 2.5% by weight to about 5% by weight ashwagandha; from about 2.5% by weight to about 5% by weight elderberry; from about 2.5% by weight to about 5% by weight sucrose or molasses; and from about 80% by weight to about 90% by weight water.

[0084] In some embodiments of any of the aspects, the fermentation substrate further comprises at least one Bifidobacterium species and at least one Lactobacillus species.

[0085] In some embodiments of any of the aspects, the Bifidobacterium is selected from the group consisting of B. lactis, B. breve, B. infantis, and any combination thereof. In some embodiments of any of the aspects, the Bifidobacterium is selected from the group consisting of B. lactis, B. breve. B. infantis, B. longum. and any combination thereof. In some embodiments of any of the aspects, the B. longum is B. longum subspecies infantis (B. infantis).

[0086] In some embodiments of any of the aspects, the Lactobacillus is selected from the group consisting of L. plantarum, L. acidophilus, L. rhamnosus, L. paracasei, L. casei, and any combination thereof.

[0087] In some embodiments of any of the aspects, the fermentation substrates comprise at least 2 (e.g., at least 3. at least 4, at least 5, or 6) of the following: B. lactis. B. infantis, B. breve. L. paracasei. L. rhamnosus. and / or L. casei. In some embodiments of any of the aspects, the fermentation substrates comprise at least 2 (e.g., at least 3, at least 4, at least 5, or 6) of the following: B. lactis, B. longum, B. breve, L. paracasei, L. rhamnosus, and / or L. casei.

[0088] In one aspect, described herein is a postbiotic composition, wherein the postbiotic composition is prepared according to a process comprising: (a) preparing a culture of microorganisms;(b) preparing a fermentation substrate composition as described herein, e.g., an herbal fermentationsubstrate composition as described herein; (c) inoculating the fennentation substrate composition with the culture of microorganisms to generate an inoculate composition; (d) fermenting the inoculate composition for a predetermined amount of time to generate a fermented inoculate composition and;(e) lyophilizing or spray -drying the fermented inoculate composition to obtain the postbiotic composition.

[0089] In some embodiments of any of the aspects, the postbiotic composition further comprises a carrier. In some embodiments of any of the aspects, the carrier is resistant starch or maltodextrin.

[0090] In some embodiments of any of the aspects described herein, the predetermined amount of time for fermentation is from about 24 hours to about 10 days. In some embodiments of any of the aspects, the predetermined amount of time is from about 24 hours to about 8 days, about 24 hours to about 7 days, about 24 hours to about 6 days, about 24 hours to about 5 days, about 24 hours to about 4 days, about 24 hours to about 72 hours, about 24 hours to about 48 hours, about 24 hours to about 36 horns, about 36 hours to about 8 days, about 36 hours to about 7 days, about 36 hours to about 6 days, about 36 hours to about 5 days, about 36 hours to about 4 days, about 36 hours to about 72 hours, about 36 hours to about 48 hours, about 48 hours to about 8 days, about 48 hours to about 7 days, about 48 hours to about 6 days, about 48 hours to about 5 days, about 48 hours to about 4 days, about 48 hours to about 72 hours, about 72 hours to about 8 days, about 72 hours to about 7 days, about 72 hours to about 6 days, about 72 hours to about 5 days, or about 72 hours to about 4 days. In some embodiments of any of the aspects, the culture of microorganisms comprises at least one Bifidobacterium species and at least one Lactobacillus species.

[0091] In some embodiments of any of the aspects, the Bifidobacterium is selected from the group consisting of B. lactis, B. breve, B. infantis, and any combination thereof. In some embodiments of any of the aspects, the Bifidobacterium is selected from the group consisting of B. lactis, B. breve. B. infantis, B. longum, and any combination thereof. In some embodiments of any of the aspects, the B. longum is B. longum subspecies infantis (B. infantis).

[0092] In some embodiments of any of the aspects, the Lactobacillus is selected from the group consisting of L. plantarum, L. acidophilus, L. rhamnosus, L. paracasei, L. casei, and any combination thereof.

[0093] It is contemplated that in some embodiments of any of the aspects, other immune- supportive bacteria can be used, alone or in combination with species described herein, to ferment substrates as described herein to provide postbiotic compositions as described herein. Examples are provided, for example, in Schluter et al.. Nature 588: 303-307 (2020). the contents of which are incorporated herein by reference in their entirety.

[0094] In some embodiments of any of the aspects, the culture of microorganisms comprises a microorganism concentration from about 1.0 x 108CFU / mL to about IxlO12CFU / mL. In some embodiments of any of the aspects, the culture of microorganisms comprises a microorganism concentration from about 1.0 x 109CFU / mL to about IxlO11CFU / mL.

[0095] In some embodiments of any of the aspects, the culture of microorganisms further comprises de Man, Rogosa & Sharpe (MRS) broth. In some embodiments or any of the aspects, the fermentation substrate or culture of microorganisms does not include MRS broth. In some embodiments or any of the aspects, the fermentation substrate or culture of microorganisms does not include any animal product.

[0096] In some embodiments of any of the aspects, fermenting the inoculate composition comprises sealing the inoculate composition in a fermentation vat under substantially anaerobic conditions.

[0097] In some embodiments of any of the aspects, fermenting the inoculate composition further comprises incubating the inoculate composition at a temperature from about 33°C to about 40°C. In some embodiments of any of the aspects, fermenting the inoculate composition further comprises incubating the inoculate composition at a temperature from about 33°C to about 37°C.

[0098] In some embodiments of any of the aspects, fermenting the inoculate composition further comprises purging the fermentation vat with nitrogen gas such that the percentage of oxygen in the fermentation vat is maintained < 1.5%.

[0099] In some embodiments of any of the aspects, the inoculate composition is maintained at a pH from about 5.0 to about 8.0. In some embodiments, the pH of the fermentation is maintained from about 5.0 to about 7.5. In some embodiments, the pH of the fermentation is maintained from about 5.0 to about 7.5, about 5.0 to about 7.0. about 5.0 to about 6.8, about 5.0 to about 6.6, about 5.0 to about 6.4, about 5.0 to about 6.2, about 5.0 to about 6.0, about 5.5 to about 8.0, about 5.5 to about 7.5, about 5.5 to about 7.0, about 5.5 to about 6.8. about 5.5 to about 6.6, about 5.5 to about 6.4, about 5.5 to about 6.2, about 5.5 to about 6.0, about 6.0 to about 8.0, about 6.0 to about 7.5, about 6.0 to about 7.0, about 6.0 to about 6.8, about 6.0 to about 6.6, about 6.0 to about 6.4, about 6.0 to about 6.2, about 6.2 to about 8.0, about 6.2 to about 7.5. about 6.2 to about 7.0. about 6.2 to about 6.8. about 6.2 to about 6.6. about 6.2 to about 6.4. about 6.4 to about 8.0. about 6.4 to about 7.5, about 6.4 to about 7.0, about 6.4 to about 6.8. about 6.4 to about 6.6. about 6.6 to about 8.0, about 6.6 to about 7.5, about 6.6 to about 7.0, about 6.6 to about 6.8, about 6.8 to about 8.0, about 6.8 to about 7.5, about 6.8 to about 7.0, about 7.0 to about 8.0 or about 7.0 to about 7.5. In some embodiments of any of the aspects, the pH of the fermentation is from about 3.5 to 6.7 (e.g., during the fermentation). In some embodiments of any of the aspects, the pH of the fermentation is from about 3.5 to 4.2 (e g., end of fermentation). In some embodiments of any of the aspects, the pH of the end product of the fermentation process (e.g.. a postbiotic composition) is from 5.0 to 8.0.

[0100] In some embodiments of any of tire aspects, the final bacteria content post fermentation is about 1.0 x 108to about 1 x 1011colony-forming units per milliliter (cfu / ml) of living bacteria. In some embodiments of any of the aspects, the final bacteria content post fermentation is about 1.0 x 109to about 1 x 1010cfu / ml. In some embodiments of any of the aspects, the final bacteria content post fermentation is about 1.0 x 106to about 1.5 x 109cfu / ml.

[0101] In some embodiments of any of the aspects, the bacterial content after drying (e.g., spray drying or freeze drying) is about 1 x 10sactive-fluorescent units per gram (afu / g; e.g.. using flow cytometry) to about 2 x 109afu / g of bacterial cells, e.g., living or non-living. In some embodiments of any of the aspects, the bacterial content after drying is about 1 x 108afu / g to about 1.5 x 109afu / g. In some embodiments of any of the aspects, the bacterial content after drying is about 1 x IO8afu / g to about 1 x 1 ()9afu / g. In some embodiments of any of the aspects, the bacterial content after drying is about 5 x 108afu / g to about 2 x 109afu / g. In some embodiments of any of the aspects, the bacterial content after drying is about 5 x 108afu / g to about 1.5 x 109afu / g. In some embodiments of any of the aspects, the bacterial content after drying is about 5 x 108afu / g to about 1 x 109afu / g. In some embodiments of any of the aspects, the bacterial content after drying is about 5 x 108afu / g to about 8.8 x 108afu / g. In some embodiments of any of the aspects, the bacterial content after drying is about 5 x 108afu / g to about 8.5 x 108afu / g. In some embodiments of any of the aspects, the bacterial content after dry ing is about 5 x 108afu / g to about 8.2 x 108afu / g. In some embodiments of any of die aspects, the bacterial content after dry ing is about 5 x 108afu / g to about 8.0 x 108afu / g.

[0102] In some embodiments of any of the aspects, the postbiotic composition after dry ing (e.g., spray drying or freeze dry ing) comprises non-viable or non-living bacteria. In some embodiments of any of the aspects, the postbiotic composition after drying (e g., spray drying or freeze drying) comprises a low level of viable or living bacteria. In embodiments where the postbiotic composition is administered to an immunocompromised subject, it is beneficial for the composition to comprise a low level of viable or living bacteria. In embodiments where the postbiotic composition is administered to a non-immunocompromised subject, the composition can comprise viable or non- viable bacteria.

[0103] In some embodiments of any of the aspects, the bacterial content after spray drying is about 0 efu / g of living or viable bacteria. In some embodiments of any of the aspects, the bacterial content after spray drying is greater than 0 efu / g of living or viable bacteria. In some embodiments of any of tire aspects, the bacterial content after spray drying is less than 100,000 efu / g of living or viable bacteria. In some embodiments of any of the aspects, the bacterial content after spray drying is less than 10' efu / g of living or viable bacteria. In some embodiments of any of the aspects, the bacterial content after spray drying is less than 101efu / g, less than 102efu / g, less than 103efu / g. less than 104efu / g, less than 105efu / g. less than I O6efu / g, or less than 107efu / g of living or viable bacteria.

[0104] In some embodiments of any of the aspects, the bacterial content after freeze drying is at most about IO10efu / g. In some embodiments of any of the aspects, the bacterial content after freeze drying is less than 101efu / g, less than 102efu / g, less than 103efu / g. less than 104efu / g, less than 105efu / g, less than 106efu / g. or less than 107efu / g.

[0105] In some embodiments of any of the aspects, the viability7of the bacteria in the postbiotic composition after drying (e.g., spray drying or freeze drying) is at most 10%. In some embodiments of any of the aspects, the viability of the bacteria in the postbiotic composition after dry ing (e.g., spraydrying or freeze drying) is at most 0.01%. at most 0.02%, at most 0.03%. at most 0.04%, at most 0.05%, at most 0.06%. at most 0.07%, at most 0.08%, at most 0.09%, at most 0.1%. at most 0.2%, at most 0.3%, at most 0.4%, at most 0.5%, at most 0.6%, at most 0.7%, at most 0.8%, at most 0.9%, at most 1%, at most 2%, at most 3%, at most 4%, at most 5%, at most 6%, at most 7%. at most 8%, at most 9%, or at most 10%.

[0106] In some embodiments of any of the aspects, the postbiotic composition comprises at least one metabolite selected from Table 2.

[0107] In some embodiments of any of the aspects, the postbiotic composition comprises at least one metabolite selected from the group consisting of 3 -hydroxy butyric acid, quercetin, phloionolic acid, wedelolactone, luteolin, N-[(2S)-2-hydroxypropanoyl]-L-leucine, an indole organic acid or any combination thereof.

[0108] In some embodiments of any of the aspects, the postbiotic composition comprises at least one metabolite selected from the group consisting of 3-hydroxybutyric acid, quercetin, phloionolic acid, wedelolactone, lutcolin, N-[(2S)-2-hydroxypropanoy 1 ]-L-lcucinc, and any combination thereof. The postbiotic composition can also include organic acids produced by the fermentation, including, for example, citric acid, succinic acid, lactic acid, glycerol and acetic acid.

[0109] In some embodiments of any of the aspects, the postbiotic composition comprises each of 3-hydroxybutyric acid, quercetin, phloionolic acid, wedelolactone, luteolin and N-[(2S)-2- hydroxypropanoyl]-L-leucine and an indole organic acid.

[0110] In some embodiments of any of the aspects, the postbiotic composition comprises one or more organic acids produced by the fermentation, selected from citric acid, succinic acid, lactic acid, glycerol and acetic acid.

[0111] In some embodiments of any of the aspects, the postbiotic composition comprises each of citric acid, succinic acid, lactic acid, glycerol and acetic acid.

[0112] Exemplary amounts in the final fermentation broth include 0.5 to 3.0 g / L citric acid. 0.02 to 0.9 g / L succinic acid, 2.0 to 20 g / L lactic acid, 0.1 to 2.5 g / L glycerol, and 1.0 to 20 g / L acetic acid. An exemplary organic acid profile for tire final fermentation broth includes 1.18 g / L citric acid, 0.1 g / L succinic acid, 14.69 g / L lactic acid, 0.55 g / L glycerol, and 7.73 g / L acetic acid. See also an example of organic acid content over fermentation time in Table 1.

[0113] Table 1 : Organic Acid Content

[0114] In some embodiments of any of the aspects, the postbiotic composition comprises one or more components selected from 3 -hydroxybutyric acid, quercetin, phloionolic acid, wedelolactone, luteolin, N-[(2S)-2-hydroxypropanoyl]-L-leucine, and indole organic acids. In some embodiments of any of the aspects, the indole organic acids comprise indole-3-acetate and / or indole -3 -lactate.

[0115] In some embodiments of any of the aspects, the postbiotic composition comprises at least one metabolite selected from Table 2. Hundreds of metabolites exhibited a significant increase in concentration in the postbiotic product. In these increased metabolite categories, the average increase was calculated at 5.6 fold. In some embodiments of any of the aspects, the postbiotic composition comprises at least one metabolite selected from: 3 -Hydroxybutyric acid, 6-Methoxysalicylic acid, trans-caffeic acid, Phloroglucinol carboxylic acid, 1, 6. 8-trimethyl-allantoate, Vitamin C, wedelolactone, 9, 10-Dihydroxy stearic acid. Isorhamnetin, Pseudopurpurin, Quercetin, Luteolin, 2-Ethylglutaric acid, and Phloionolic acid (see e.g., Table 2).

[0116] Table 2: Non-limiting examples of metabolites in the postbiotic composition.

[0117] In some embodiments of any of the aspects, the postbiotic composition comprises a metabolite profile exhibiting elevated levels of one or more metabolites selected from the group consisting of 3 -hydroxy butyric acid, quercetin, phloionolic acid, wedelolactone, luteolin. N-[(2S)-2- hydroxypropanoyl]-L-leucine, indole organic acid(s). and any combination thereof.

[0118] In some embodiments of any of the aspects, the postbiotic composition comprises nucleic acid including sequences selected from: B. lactis, B. breve. B. infantis, L. plantarum, L. acidophilus, L. rhamnosus, L. casei, and / or L. paracasei.

[0119] In some embodiments of any of the aspects, the postbiotic composition comprises at least a portion of the 16S rRNA gene sequence from at least one of the following bacterial species: B. lactis, B. breve, B. infantis, L. plantarum, L. acidophilus, L. rhamnosus. L. casei, and / or L. paracasei. In some embodiments of any of the aspects, the postbiotic composition comprises the V4 and / or V5 region of the 16S rRNA gene sequence from at least one of the following bacterial species: B. lactis, B. breve, B. infantis, L. plantarum, L. acidophilus, L. rhamnosus, L. casei, and / or L. paracasei. In some embodiments, the V4 and / or V5 region is about 250 base pairs long. In some embodiments of any of the aspects, the postbiotic composition comprises nucleic acid, including nucleic acid molecules that can hybridize with primer sequences (e.g., 16S primer) sequences selected from SEQ ID NOs: 1-13 or nucleic acid complementary to at least one of SEQ ID NOs: 1-13: B. lactis TGGAGGGTTCGATTCTGGCTCAGGATGAACGCTG (SEQ ID NO: 1), B. breve:CCGGATGCTCCATCACAC (SEQ ID NO: 2), B. breve: ACAAAGTGCCTTGCTCCCT (SEQ IDNO: 3). B. infantis TTCCAGTTGATCGCATGGTC (SEQ ID NO: 4), B. infantis GGAAACCCCATCTCTGGGAT (SEQ ID NO: 5). L. plantarum-. GCTGGCAATGCCATCGTGCT (SEQ ID NO: 6), L. plantarum-. TCTCAACGGTTGCTGTATCG (SEQ ID NO: 7), L. acidophilus-. CCTTTCTAAGGAAGCGAAGGAT (SEQ ID NO: 8). L. acidophilus-.ACGCTTGGTATTCCAAATCGC (SEQ ID NO: 9), L. rhamnosus : GCCGATCGTTGACGTTAGTTGG (SEQ ID NO: 10), A. rhamnosus-. CAGCGGTTATGCGATGCGAAT (SEQ ID NO: 11), L. paracasei: CAATGCCGTGGTTGTTGGAA (SEQ ID NO: 12), or L. p r casei'. GCCAATCACCGCATTAATCG (SEQ ID NO: 13). In some embodiments, the primer(s) hybridizes specifically under stringent conditions to a DNA fragment having the nucleotide sequence (e.g., at least a portion of the 16S rRNA gene sequence). As herein used, the term “stringent conditions” means hybridization will occur only if there is at least 95% identity in nucleotide sequences. In another embodiment, hybridization under “stringent conditions” occurs when there is at least 97% identity between the sequences.

[0120] In one aspect, described herein is a postbiotic composition comprising 3 -hydroxy butyric acid, quercetin, phloionolic acid, wedelolactone. luteolin, N-[(2S)-2-hydroxypropanoyl]-L-leucine and an indole organic acid.

[0121] In some embodiments of any of the aspects, the postbiotic composition further comprises bacteria of the genera Bifidobacterium and Lactobacillus.

[0122] In some embodiments of any of the aspects, the postbiotic composition further comprises an rRNA (e.g., 16S RNA) having a nucleic acid sequence at least 90% identical to one of SEQ ID NO: 14-16 (B. lactis), SEQ ID NO: 17-20 (B. breve), SEQ ID NO: 21-26 (B. infantis , SEQ ID NO: 27-32 (£. plantarum), SEQ ID NO: 33-39 (L. acidophilus), SEQ ID NO: 40-44 (L. rhamnosus).SEQ ID NO: 45-48 (£. paracasei). or SEQ ID NO: 49-52 (L. casei).

[0123] In some embodiments of any of the aspects, the postbiotic composition further comprises one or more organic acids selected from citric acid, succinic acid, lactic acid, glycerol and acetic acid.

[0124] In some embodiments of any of the aspects, the postbiotic composition comprises each of citric acid, succinic acid, lactic acid, glycerol and acetic acid.

[0125] In one aspect, described herein is an oral postbiotic formulation, the formulation comprising a composition as described herein (e.g., a postbiotic composition). In one aspect, described herein is a composition for oral delivery, the composition comprising a postbiotic composition as described herein, formulated for oral delivery.

[0126] In some embodiments of any of the aspects, the oral postbiotic formulation is formulated as a tablet, pill, capsule, or microcapsule.

[0127] In some embodiments of any of the aspects, the oral postbiotic formulation is formulated for buccal, sublabial, or sublingual administration.

[0128] In some embodiments of any of the aspects, the oral postbiotic formulation is a liquid suspension. In some embodiments of any of the aspects, the formulation comprises a liquid suspension.

[0129] In one aspect, described herein is a pharmaceutical composition comprising a composition as described herein (e.g., a postbiotic composition) and a pharmaceutically acceptable carrier.

[0130] In one aspect, described herein is a method of preparing a postbiotic composition, the method comprising: (a) preparing a culture of microorganisms; (b) preparing a fermentation substrate composition as described herein, e.g., an herbal fermentation substrate; (c) inoculating the fermentation substrate composition with the culture of microorganisms to generate an inoculate composition; and (d) fermenting the inoculate composition for a predetermined amount of time to generate a fermented inoculate composition.

[0131] In some embodiments of any of the aspects, the predetermined amount of time is from about 24 hours to about 10 days, or a period therebetween as described herein above.

[0132] In some embodiments of any of the aspects, the culture of microorganisms comprises at least one Bifidobacterium species and at least one Lactobacillus species.

[0133] In some embodiments of any of die aspects, the Bifidobacterium is selected from the group consisting of B. lactis, B. breve, B. infiantis, and any combination thereof. In some embodiments of any of the aspects, the Bifidobacterium is selected from the group consisting of B. lactis, B. breve, B. infiantis, B. longum, and any combination thereof. In some embodiments of any of the aspects, the B. longum is B. longum subspecies infiantis (B. infiantis).

[0134] In some embodiments of any of the aspects, the Lactobacillus is selected from the group consisting of L. plantarum. L. acidophilus, L. rhamnosus, L. paracasei. L. casei, and any combination thereof.

[0135] In some embodiments of any of the aspects, the culture of microorganisms comprises a microorganism concentration from about 1.0 x 108CFU / mL to about 1x1012CFU / mL.

[0136] In some embodiments of any of the aspects, the culture of microorganisms comprises a microorganism concentration from about 1.0 x 109CFU / mL to about IxlO11CFU / mL.

[0137] In some embodiments of any of the aspects, fermenting the inoculate composition comprises sealing the inoculate composition in a fermentation vat under substantially anaerobic conditions.

[0138] In some embodiments of any of the aspects, fermenting the inoculate composition further comprises incubating the inoculate composition at a temperature from about 33°C to about 40°C.

[0139] In some embodiments of any of the aspects, fermenting the inoculate composition further comprises incubating the inoculate composition at a temperature from about 33°C to about 37°C.

[0140] In some embodiments of any of the aspects, fermenting the inoculate composition further comprises purging the fermentation vat with nitrogen gas such that the percentage of oxygen in the fermentation vat is maintained < 1.5%.

[0141] In some embodiments of any of the aspects, the pH of the fermentation is maintained in the range of about 5.0 to about 7.5, about 5.0 to about 7.0, about 5.0 to about 6.8, about 5.0 to about 6.6, about 5.0 to about 6.4, about 5.0 to about 6.2, about 5.0 to about 6.0, about 5.5 to about 7.5, about5.5 to about 7.0, about 5.5 to about 6.8. about 5.5 to about 6.6, about 5.5 to about 6.4, about 5.5 to about 6.2, about 5.5 to about 6.0, about 6.0 to about 7.5, about 6.0 to about 7.0, about 6.0 to about 6.8, about 6.0 to about 6.6, about 6.0 to about 6.4, about 6.0 to about 6.2, about 6.2 to about 7.5, about 6.2 to about 7.0, about 6.2 to about 6.8, about 6.2 to about 6.6, about 6.2 to about 6.4, , about 6.4 to about 7.5, about 6.4 to about 7.0, about 6.4 to about 6.8, about 6.4 to about 6.6, about 6.6 to about 7.5, about6.6 to about 7.0, about 6.6 to about 6.8, about 6.8 to about 7.5, about 6.8 to about 7.0, or about 7.0 to about 7.5. In some embodiments of any of the aspects, the inoculate composition is maintained at a pH from about 6.0 to about 6.8. In some embodiments of any of the aspects, the pH of the fermentation is from about 3.5 to 6.7 (e.g., during the fermentation). In some embodiments of any of die aspects, the pH of the fermentation is from about 3.5 to 4.2 (e.g., end of fermentation). In some embodiments of any of the aspects, the pH of die end product of the fermentation process (e.g., a postbiotic composition) is from 5.0 to 8.0.

[0142] In some embodiments of any of the aspects, the method further comprises lyophilizing the fermented inoculate composition to obtain the postbiotic composition. In some embodiments of any of the aspects, the method further comprises spray -drying the fermented inoculate composition to obtain the postbiotic composition.

[0143] In some embodiments of any of the aspects, the method further comprises formulating the postbiotic composition for oral delivery.

[0144] In some embodiments of any of the aspects, the method further comprises formulating the postbiotic composition as a tablet, pill, capsule, or microcapsule.

[0145] In some embodiments of any of the aspects, the method further comprises formulating the postbiotic composition in a liquid suspension.

[0146] In one aspect, described herein is a pharmaceutical composition comprising a composition (e g., a postbiotic composition) prepared by a method as described herein, and a pharmaceutically acceptable carrier.

[0147] In some embodiments of any of the aspects, administering to the subject comprises oral administration in the form of a tablet, pill, capsule, or microcapsule.

[0148] In some embodiments of any of tire aspects, administering to the subject comprises buccal, sublabial, or sublingual administration.

[0149] In some embodiments of any of tire aspects, administering to the subject comprises oral administration in the form of a liquid suspension.

[0150] According to at least one aspect of the present disclosure, a method of preparing a postbiotic composition is provided. The method can include preparing a culture of microorganisms and herbal fermentation substrate composition as described herein, e.g., an herbal fermentation substrate as described herein, followed by inoculating the herbal substrate composition with the culture of microorganisms to generate an inoculate composition. The method can also include fermenting the inoculate composition for a predetermined amount of time to generate a fermented inoculate composition. The fermented inoculate composition can be lyophilized to obtain the postbiotic composition.

[0151] In some embodiments, the postbiotic composition can further comprise a carrier, e.g., a carrier suitable for spray drying and / or freeze drying (also referred to as lyophilization). In some embodiments, the carrier is resistant starch (e.g.. digestion resistant starch). In some embodiments, the carrier comprises maltodextrin. In some embodiments, the carrier comprises resistant maltodextrin (e.g., FIBERSOL). In some embodiments, the carrier comprises at least one prebiotic fiber co-drying agent. The term “excipient ’ can be used interchangeably with “carrier.”

[0152] The predetermined amount of time can be as described herein above. In at least some instances, the culture of microorganisms comprises at least one microorganism selected from the group consisting of Bifidobacterium and Lactobacillus. In some cases, the culture of microorganisms comprises Bifidobacterium. In some cases, the culture of microorganisms comprises Lactobacillus. The Bifidobacterium can be selected, for example, from the group consisting of B. lactis (also referred to as B. animalis subsp. lactis), B. breve, B. infantis, and any combination thereof. The Lactobacillus can be selected, for example, from the group consisting of L. plantarum, L. acidophilus, L. rhamnosus, L. paracasei, L. casei, and any combination thereof.

[0153] In at least some aspects, the culture of microorganisms can comprise a microorganism concentration from about 1.0 x 108CFU / mL to about IxlO12CFU / mL, or from about 1.0 x 109CFU / mL to about IxlO11CFU / mL. or from about 1.0 x 109CFU / mL to about IxlO10CFU / mL, or from about 1.0 x 108CFU / mL to about IxlO11CFU / mL. In some embodiments, the postbiotic compositions described herein are prepared by spray-drying. In some embodiments, the bacterial content after spray drying is about 0 efu / g. In some embodiments, the postbiotic compositions described herein are prepared by freeze-drying. In some embodiments, the bacterial content after freeze drying is at most about 1010efu / g. The fermentation substrate composition can be as described herein above.

[0154] In some embodiments, the postbiotic composition comprises nucleic acid including sequences from the plant and / or bacterial species described herein. In some embodiments, the postbiotic composition comprises nucleic acid including sequences selected from any of the following bacterial species: B. lactis, B. breve, B. infantis, L. plantarum, L. acidophilus, L. rhamnosus, L. casei, and / or L. paracasei. Such nucleic acids can include DNA or RNA indicative of any one of these bacterial species. In some embodiments, the postbiotic composition comprises nucleic acid includingsequences selected from any of the following plant genera or species: the Astragalus family, the Solanaceae or nightshade family, the Sambucus L. genus, and / or the Lens orientalis or Lens culinaris family. In some embodiments, the postbiotic composition comprises nucleic acid including sequences selected from any of the following plant genera or species: Astragalus membranaceus, Astragalus complanatus. ashwagandha (species Withania somnifera. family Solanaceae), elderberry (species Sambucus nigra) and / or red lentil (species lens culinaris or L. culinaris subsp. orientalis). Such nucleic acids can include DNA or RNA indicative of any one of these plant genera or species.

[0155] In some embodiments, the plant is an Astragalus species, e.g., Astragalus membranaceus or Astragalus complanatus (see e.g., Accession number NC 065024.1). In some embodiments, the plant comprises a nucleic acid sequence (e.g., an 18S sequence) comprising one of SEQ ID NOs: 53- 54 or a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%. at least 97%, at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NOs: 53-54 or a fragment thereof.

[0156] SEQ ID NO: 53 Astragalus complanatus 18S Accession number NC 065024.1.

[0157] SEQ ID NO: 54 KY316029.1 Astragalus membranaceus.

[0158] In some embodiments, the plant is an Withania species, e.g., Withania somnifera (see e.g., Accession number NC 047245.1). In some embodiments, the plant comprises a nucleic acid sequence (e.g., an 18S sequence) comprising one of SEQ ID NO: 54-58 or a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%, at least 99%, or at least 99.5% or more identical one of SEQ ID NO: 54-58 or a fragment thereof.

[0159] SEQ ID NO: 55 Withania 18S. Accession number NC_047245.1.

[0160] SEQ ID NO: 56 Withania 18S. Accession number NC_047245.1.

[0161] SEQ ID NO: 57 Withania 18S. Accession number NC_047245.1.

[0162] SEQ ID NO: 58 Withania 18S. Accession number NC_047245.1.

[0163] SEQ ID NO: 59 Withania 18S. Accession number NC_047245.1.

[0164] In some embodiments, the postbiotic composition comprises at least one compound produced by any of the following plant genera or species: the Astragalus family, the Solanaceae or nightshade family, the Sambucus L. genus, and / or the Lens orientalis or Lens culinaris family. In some embodiments, the postbiotic composition comprises Withanolides (e g., Withaferin A): the Withanolides can be produced by ashwaganda root. In some embodiments, the postbiotic composition comprises at least one of the following compounds, that can be produced by elderberry: Anthocyanins (e.g., cyanidin-3-glucoside: e.g., measured using a pH-Differential method): Anthocyanins (e.g., cyanidm-3-glucoside; e.g., measured using HPLC); Polyphenols (e.g., catechin; e.g.. measured using Folin-Ciocalteu reagent); and / or Polyphenols (e.g., expressed as gallic acid equivalent; e.g., measured using Folin-Ciocalteu reagent).

[0165] In some embodiments, the microorganism is Bifidobacterium lactis (also referred to as Bifidobacterium animalis subsp. lactis), e.g., strain DSM 10140 (see e.g.. NCBI Reference Sequence: NC 012815.1 for an exemplary B. lactis genome sequence). In some embodiments, the microorganism is B. lactis strain BLC1- (Centro sperimentale del Latte (CSL) / SACCO). In some embodiments, the microorganism is B. lactis strain PBP1418518. In some embodiments, a nucleic acid primer for 16S sequencing of B. lactis comprises TGGAGGGTTCGATTCTGGCTCAGGATGAACGCTG (SEQ ID NO: 1). In some embodiments, the microorganism comprises a nucleic acid sequence (e.g.. 16S sequence) comprising one of SEQ ID NO: 14-16 or a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%. at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NO: 14-16 or a fragment thereof.

[0166] In some embodiments, the microorganism is Bifidobacterium breve, e.g., strain ATCC 15700 (see e.g., RefSeq: NZ CP006712.1 for an exemplar}7B. breve genome sequence). In some embodiments, the microorganism is B. breve strain Bbr8 (CSL / SACCO). In some embodiments, the microorganism is B. breve strain PBP2741300. In some embodiments, a nucleic acid primer for 16S sequencing of A breve comprises CCGGATGCTCCATCACAC (SEQ ID NO: 2) or ACAAAGTGCCTTGCTCCCT (SEQ ID NO: 3). In some embodiments, the microorganism comprises a nucleic acid sequence (e.g.. 16S sequence) comprising one of SEQ ID NO: 17-20 or a nucleic acid sequence that is at least 80%. at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%. at least 99%, or at least 99.5% or more identical to one of SEQ ID NO: 17-20 or a fragment thereof. For further non-limiting examples of 16S rRNA-gene-targeted Bifidobacteria-specific primers, see e.g., Matsuki et al., Appl Environ Microbiol. 2004 Jan; 70(1): 167-173 (see e.g., Table 1 of Matsuki 2004). the contents of which are incorporated herein by reference in their entirety.

[0167] In some embodiments, the microorganism is Bifidobacterium infantis (also referred to as Bifidobacterium longum subsp. infantis) e.g., strain ATCC 15697 (see e.g., RefSeq: NC_015052.1 for an exemplary B. infantis genome sequence). In some embodiments, the microorganism is B. infantis strain SP 37 (CSL / SACCO). In some embodiments, the microorganism is B. infantis strain PBP234451. In some embodiments, a nucleic acid primer for 16S sequencing of B. infantis comprises TTCCAGTTGATCGCATGGTC (SEQ ID NO: 4) or GGAAACCCCATCTCTGGGAT (SEQ ID NO: 5). In some embodiments, the microorganism comprises a nucleic acid sequence (e.g.. 16S sequence) comprising one of SEQ ID NO: 21-26 or a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%. at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NO: 21-26 or a fragment thereof.

[0168] In some embodiments, the microorganism is Lactobacillus plantarum (also referred to as Lactiplantibacillus plantation), e.g., strain Korean Agricultural Culture Collection (KACC) 11451(see e.g., RefSeq: NZ CP030105.1 for an exemplar}’ L. plantarum genome sequence). In some embodiments, a nucleic acid primer for sequencing of L. plantarum comprises GCTGGCAATGCCATCGTGCT (SEQ ID NO: 6) or TCTCAACGGTTGCTGTATCG (SEQ ID NO: 7). In some embodiments, the microorganism comprises a nucleic acid sequence (e.g.. 16S sequence) comprising one of SEQ ID NO: 27-32 or a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%. at least 93%, at least 94%, at least 95%. at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NO: 27-32 or a fragment thereof. For further non-limiting examples of 16S rRNA-gene -targeted Lactobacillus-specific primers, see e.g., Kim et al.. BMC Microbiology volume 20, Article number: 96 (2020) (see e.g., Table 1 of Kim 2020). the contents of which are incorporated herein by reference in their entirety.

[0169] In some embodiments, the microorganism is Lactobacillus acidophilus, e.g.. strain KACC 12419 (see e.g., RefSeq: NC 021181.2 for an exemplary L. acidophilus genome sequence). In some embodiments, a nucleic acid primer for 16S-23S region sequencing of L. acidophilus comprises CCTTTCTAAGGAAGCGAAGGAT (SEQ ID NO: 8) or ACGCTTGGTATTCCAAATCGC (SEQ ID NO: 9) In some embodiments, the microorganism comprises a nucleic acid sequence (e.g., 16S sequence) comprising one of SEQ ID NO: 33-39 or a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NO: 33-39 or a fragment thereof.

[0170] In some embodiments, the microorganism is Lactobacillus rhamnosus (also referred to as Lacticaseibacillus rhamnosus). e.g., strain Korean Collection for Type Cultures (KCTC) 3237 (see e.g., RefSeq: NZ CP086326.1. NZ LR134331.1, or ASM284801vl for an exemplary L. rhamnosus genome sequence). In some embodiments, the microorganism is L. rhamnosus strain CRL1505 (CSL / SACCO). In some embodiments, the microorganism is L. rhamnosus strain PBP4542118. In some embodiments, a nucleic acid primer for 16S-23S region sequencing of L. rhamnosus comprises GCCGATCGTTGACGTTAGTTGG (SEQ ID NO: 10) or CAGCGGTTATGCGATGCGAAT (SEQ ID NO: 11) In some embodiments, the microorganism comprises a nucleic acid sequence (e.g., 16S sequence) comprising one of SEQ ID NO: 40-43 or a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%. at least 93%, at least 94%, at least 95%. at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NO: 40-43 or a fragment thereof.

[0171] In some embodiments, the microorganism is Lactobacillus paracasei (also referred to as Lacticaseibacillus paracasei), e.g., strain KACC 12361 (see e.g., RefSeq: NC_014334.2 for an exemplary’ L. paracasei genome sequence). In some embodiments, the microorganism is L. paracasei strain IMC502 (CSL / SACCO). In some embodiments, the microorganism is L. paracasei strain PBP5197148. In some embodiments, a nucleic acid primer for sequencing of L. paracasei comprisesCAATGCCGTGGTTGTTGGAA (SEQ ID NO: 12) or GCCAATCACCGCATTAATCG (SEQ ID NO: 13). In some embodiments, the microorganism comprises a nucleic acid sequence (e.g.. 16S sequence) comprising one of SEQ ID NO: 45-48 or a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%. at least 99%, or at least 99.5% or more identical to one of SEQ ID NO: 45-48.

[0172] In some embodiments, the microorganism is Lactobacillus easel, e.g., strain BGP 93 (CSL / SACCO) (see e g., RefSeq: NZ AP012544.1 or CP017065 for exemplary L. easel genome sequences; see e.g., Kang et al.. Front Immunol. 2017; 8: 413, the contents of which are incorporated herein by reference in their entirety ). In some embodiments, the microorganism is L. casei strain PBP4157051. In some embodiments, the microorganism is L. casei strain DSM 20011, JCM 1134, ATCC 393, or LC5.In some embodiments, the microorganism comprises a nucleic acid sequence (e.g., 16S sequence) comprising one of SEQ ID NO: 49-52 or a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NO: 49-52

[0173] In some embodiments of any of die aspects, the bacterial strain is selected from Table 3. While specific strains of bacteria are named herein, other strains of these species are contemplated to perform in a similar manner. As a non-limiting example, to determine whether any given strain of a species is effective, the strain can be substituted for another strain of the same species in the fermentation process of the fermentation substrate composition to prepare the postbiotic composition. The postbiotic composition prepared using the substituted strain can be tested for efficacy compared to the postbiotic composition prepared using the original strain. Non-limiting examples of tests for efficacy include cell or animal models or human clinical testing of diseases and disorders such as dysbiosis; a disruption of the gut-brain axis; a neurological disease or disorder; a synucleinopathy; Parkinson’s disease (PD); REM Sleep Behavior Disorder; dementia with Lewy bodies (DLB); pure autonomic failure (PAF); and / or multiple system atrophy (MSA).

[0174] Table 3: Exemplary Bacterial Strains (sequence GENBANK accession number and location of gene of interest, e.g., rRNA genes, 16S, 23S, 5S)Exemplary B. lactis sequences

[0175] SEQ ID NO: 14, B. lactis rRNA. 1538 nucleotides (nt).

[0176] SEQ ID NO: 15, B. lactis. Accession Number: CP001853.168853.171909 Bifidobacterium; Bifidobacterium animalis subsp. lactis. rRNA Sequence.

[0177] SEQ ID NO: 16, B. lactis, Accession Number: CP001892.1476835.1479961 Bifidobacterium; Bifidobacterium animalis subsp. lactis. rRNA Sequence.Exemplary B. breve sequences

[0178] SEQ ID NO: 17, B. breve rRNA sequence, 1531 nt (see e.g.. NCBI Reference Numbers B7017 RS06345 or B7017_RS09250, rRNA ribosomal RNA, Bifidobacterium breve JCM 7017, NCBI Gene IDs: 56564913 or 56565465).

[0179] SEQ ID NO: 18, B. breve, Accession Number: BCXW01000037.1900.4963 Bifidobacterium; Bifidobacterium breve. rRNA Sequence.

[0180] SEQ ID NO: 19, B. breve, Accession Number: CP021558.1782121.1785182Bifidobacterium; Bifidobacterium breve. rRNA Sequence.

[0181] SEQ ID NO: 20, B. breve. Accession Number: CP021388.2282979.2286039Bifidobacterium; Bifidobacterium breve. rRNA Sequence.Exemplary B. infantis sequences

[0182] SEQ ID NO: 21 , B. infantis rRNA sequence, 1526 nt (see e.g.. NCBI Gene ID: 66505550).

[0183] SEQ ID NO: 22, B. infantis, Accession Number: AP010889.2757707.2760771 Bifidobacterium; Bifidobacterium longum subsp. infantis. rRNA Sequence.

[0184] SEQ ID NO: 23, B. infantis, Accession Number: AP010889.2751543.2754607 Bifidobacterium; Bifidobacterium longum subsp. infantis. rRNA Sequence.

[0185] SEQ ID NO: 24, B. infantis, Accession Number: CP001095.2539820.2542677Bifidobacterium; Bifidobacterium longum subsp. infantis ATCC 15697 = JCM 1222 = DSM 20088. rRNA Sequence.

[0186] SEQ ID NO: 25, B. infantis, Accession Number: BCYG01000038.1.1181Bifidobacterium; Bifidobacterium longum subsp. infantis. rRNA Sequence.

[0187] SEQ ID NO: 26, B. infantis, Accession Number: BCYF01000054.143.3206Bifidobacterium; Bifidobacterium longum subsp. infantis. rRNA Sequence.Exemplary L. plantarum sequences

[0188] SEQ ID NO: 27, L. plantarum rRNA sequence. 1474 nt (see e.g., Lactobacillus plantarum strain NRRL B-14768 16S ribosomal RNA, partial sequence, NCBI Reference Sequence: NR 042394.1).

[0189] SEQ ID NO: 28, L. plantarum. Accession Number: CP026743.575947.578869 Lactiplantibacillus; Lactobacillus plantarum. rRNA Sequence.

[0190] SEQ ID NO: 29, L. plantarum. Accession Number: CP020816.489843.492761 Lactiplantibacillus; Lactobacillus plantarum. rRNA Sequence.

[0191] SEQ ID NO: 30, L. plantarum. Accession Number: CP0254I2.483014.485936 Lactiplantibacillus; Lactobacillus plantarum. rRNA Sequence.

[0192] SEQ ID NO: 31, L. plantarum, Accession Number: CP029349.2063132.2066054 Lactiplantibacillus; Lactobacillus plantarum. rRNA Sequence.

[0193] SEQ ID NO: 32, L. plantarum, Accession Number: LUXF01000016.189.3109 Lactiplantibacillus; Lactobacillus plantarum. rRNA Sequence.Exemplary L. acidophilus sequences

[0194] SEQ ID NO: 33, L. acidophilus rRNA sequence, 1564 nt (see e.g., NCBI Reference Number LA14 RS08025 16S ribosomal RNA Lactobacillus acidophilus La-14, NCBI Gene ID: 56943192).

[0195] SEQ ID NO: 34, L. acidophilus, Accession Number: CP000033.60957.64007 Lactobacillus; Lactobacillus acidophilus. rRNA Sequence.

[0196] SEQ ID NO: 35, L. acidophilus. Accession Number: CP010432.436310.439215 Lactobacillus; Lactobacillus acidophilus. rRNA Sequence.

[0197] SEQ ID NO: 36, L. acidophilus, Accession Number: LWSH01000065.1.1873 Lactobacillus; Lactobacillus acidophilus. rRNA Sequence.

[0198] SEQ ID NO: 37, L. acidophilus, Accession Number: CBLR010000038.101.3004 Lactobacillus; Lactobacillus acidophilus. rRNA Sequence.

[0199] SEQ ID NO: 38, L. acidophilus, Accession Number: KC161284.1.671 Lactobacillus;Lactobacillus acidophilus. rRNA Sequence.

[0200] SEQ ID NO: 39, L. acidophilus, Accession Number: NXEYO 1000033.151.1480 Salmonella; Lactobacillus acidophilus. rRNA Sequence.Exemplary L. rhamnosus sequences

[0201] SEQ ID NO: 40, L. rhamnosus rRNA sequence, 1521 nt (sec c.g., Lactobacillus rhamnosus strain JCM 1136 16S ribosomal RNA, partial sequence NCBI Reference Sequence: NR 043408.1).

[0202] SEQ ID NO: 41, L. rhamnosus, Accession Number: JUPX01000234.110.2909 Lacticaseibacillus; Lactobacillus rhamnosus. rRNA Sequence.

[0203] SEQ ID NO: 42, L. rhamnosus, Accession Number: JTIN01000086.137.3056 Lacticaseibacillus; Lactobacillus rhamnosus. rRNA Sequence.

[0204] SEQ ID NO: 43, L. rhamnosus, Accession Number: CP014201.1702655.1705574 Lacticaseibacillus; Lactobacillus rhamnosus. rRNA Sequence.

[0205] SEQ ID NO: 44, L. rhamnosus, Accession Number: AFYD01000005.110.1639 Lacticaseibacillus; Lactobacillus rhamnosus. rRNA Sequence.Exemplary L. paracasei sequences

[0206] SEQ ID NO: 45, L. paracasei rRNA sequence, 1522 nt (see e.g.. Lactobacillus paracasei strain R094 16S ribosomal RNA gene, partial sequence, NCBI Reference Sequence: NR 025880.1.

[0207] SEQ ID NO: 46, L. paracasei. Accession Number: CP002391.1862810.1865725 Lacticaseibacillus; Lactobacillus paracasei. rRNA Sequence.

[0208] SEQ ID NO: 47, L. paracasei, Accession Number: CP016355.2612922.261 840 Lacticaseibacillus; Lactobacillus paracasei. rRNA Sequence.

[0209] SEQ ID NO: 48, L. paracasei, Accession Number: ANKB01000105.125.3044 Lacticaseibacillus; Lactobacillus paracasei. rRNA Sequence.Exemplary L. casei sequences

[0210] SEQ ID NO: 49, L. casei rRNA, Lacticaseibacillus casei DSM 20011 = JCM 1134 = ATCC 393 16S ribosomal RNA, partial sequence, 1517 nucleotides (nt).

[0211] SEQ ID NO: 50, L. casei, Accession Number: AB092640.223.705 Lacticaseibacillus; Lactobacillus casei. rRNA Sequence.

[0212] SEQ ID NO: 51 , L. casei. Accession Number: AY221478.1.556 Lacticaseibacillus; Lactobacillus casei. rRNA Sequence.

[0213] SEQ ID NO: 52, L. casei. Accession Number: FM177140.909841.912756 Lacticaseibacillus; Lactobacillus casei. rRNA Sequence.

[0214] It has been surprisingly discovered that postbiotic compositions prepared according to the presently disclosed methods have unique metabolite profiles and advantageous properties. In at least some instances, the presently disclosed postbiotic compositions have a metabolite profile exhibiting elevated levels or one or more advantageous metabolites selected from the group consisting of 3- hydroxybutyric acid, quercetin, phloionolic acid, wedelolactone, luteolin, N-[(2S)-2- hydroxypropanoyl]-L-leucine, organic acids including citric acid, succinic acid, lactic acid, glycerol and acetic acid, as well as indole organic acids, vitamin C, and any combination thereof.

[0215] According to another aspect of the present disclosure, oral postbiotic formulations comprising the presently disclosed postbiotic compositions are provided. The oral postbiotic formulations can be formulated as a tablet, pill, capsule, or microcapsule. In other instances, the oral postbiotic formulation can be formulated for buccal, sublabial, or sublingual administration. In still other instances, the oral postbiotic formulation can be a liquid suspension. The oral postbiotic formulations can be useful for the modulation, treatment or prevention of disruption of the gut-brain axis. The oral postbiotic formulations can also be useful for the treatment or prevention of a neurological disease or disorder; a synucleinopathy; Parkinson’s disease (PD); REM Sleep Behavior Disorder; dementia with Lewy bodies (DLB); pure autonomic failure (PAF); and / or multiple system atrophy (MSA).Definitions

[0216] For convenience, the meaning of some terms and phrases used in the specification, examples, and appended claims, are provided below. Unless stated otherwise, or implicit from context, the following terms and phrases include the meanings provided below. The definitions are provided to aid in describing particular embodiments, and are not intended to limit the claimed invention, because the scope of the invention is limited only by the claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. If there is an apparent discrepancy between the usage of a term in the art and its definition provided herein, the definition provided within the specification shall prevail.

[0217] As used herein, the term “dysbiosis” (also referred to as “dysbacteriosis” or “disruption of gut microbiota”) refers to a disruption to tire microbiota homeostasis caused by an imbalance in the microflora, changes in their functional composition and metabolic activities, or a shift in their localdistribution. It is a term for a microbial imbalance or maladaptation on or inside the body, such as an impaired microbiota. For example, a part of the human microbiota, such as the skin flora, gut flora, or vaginal flora, can become deranged, with normally dominating species underrepresented and normally outcompeted or contained species increasing to fill the void. Dysbiosis is most commonly reported as a condition in the gastrointestinal tract, but applies to other niches as well.

[0218] The terms “decrease”, “reduced”, “reduction”, or “inhibit” are all used herein to mean a decrease by a statistically significant amount. In some embodiments, “reduce.” “reduction" or “decrease" or “inhibit” typically means a decrease by at least 10% as compared to a reference level (e.g. the absence of a given treatment or agent) and can include, for example, a decrease by at least about 10%, at least about 20%, at least about 25%. at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%. at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%. at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%. at least about 99% , or more. As used herein,“reduction” or “inhibition” docs not encompass a complete inhibition or reduction as compared to a reference level. “Complete inhibition” is a 100% inhibition as compared to a reference level. A decrease can be preferably down to a level accepted as within the range of normal, e.g., for an individual without a given disorder.

[0219] The terms “increased”, “increase", “enhance”, or “activate” are all used herein to mean an increase by a statistically significant amount, fn some embodiments, the terms “increased”, “increase”, “enhance”, or “activate” can mean an increase of at least 10% as compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%. or at least about 50%. or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, or at least about a 2-fold, or at least about a 3 -fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater as compared to a reference level. In the context of a marker or symptom, an “increase” is a statistically significant increase in such level.

[0220] As used herein, a "subject" means a human or animal. Usually the animal is a vertebrate such as a primate, rodent, domestic animal or game animal. Primates include chimpanzees, cynomolgus monkeys, spider monkeys, and macaques, e.g., Rhesus. Rodents include mice, rats, woodchucks, ferrets, rabbits and hamsters. Domestic and game animals include cows, horses, pigs, deer, bison, buffalo, feline species, e.g., domestic cat, canine species, e.g.. dog, fox, wolf, avian species, e.g.. chicken, emu, ostrich, and fish, e.g., trout, catfish and salmon. In some embodiments, the subject is a mammal, e.g.. a primate, e.g., a human. The terms, “individual,” “patient” and “subject” are used interchangeably herein.

[0221] Preferably, the subject is a mammal. The mammal can be a human, non-human primate, mouse, rat, dog, cat, horse, or cow, but is not limited to these examples. Mammals other thanhumans can be advantageously used as subjects that represent animal models of dysbiosis; a disruption of the gut-brain axis; a neurological disease or disorder; a synucleinopathy; Parkinson’s disease (PD); REM Sleep Behavior Disorder; dementia with Lewy bodies (DLB); pure autonomic failure (PAF); and / or multiple system atrophy (MSA). A subject can be male or female.

[0222] A subject can be one who has been previously diagnosed with or identified as suffering from or having a condition in need of treatment (e g. dysbiosis; a disruption of the gut-brain axis; a neurological disease or disorder; a synucleinopathy; Parkinson’s disease (PD); REM Sleep Behavior Disorder; dementia with Lewy bodies (DLB); pure autonomic failure (PAF); and / or multiple system atrophy (MSA)) or one or more complications related to such a condition, and optionally, have already undergone treatment for dysbiosis or the one or more complications related to dysbiosis. Alternatively, a subject can also be one who has not been previously diagnosed as having dysbiosis or one or more complications related to dysbiosis. For example, a subject can be one who exhibits one or more risk factors for dysbiosis or one or more complications related to dysbiosis or a subject who docs not exhibit risk factors. In some embodiments of any of the aspects, the subject is immunocompromised.

[0223] A “subject in need’’ of treatment for a particular condition can be a subject having that condition, diagnosed as having that condition, or at risk of developing that condition.

[0224] A variant amino acid or DNA sequence can be at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%. or more, identical to a native or reference sequence. The degree of homology (percent identity) between a native and a mutant sequence can be determined, for example, by comparing the two sequences using freely available computer programs commonly employed for this purpose on the world wide web (e.g. BLASTp or BLASTn with default settings).

[0225] A variant amino acid sequence can be at least 50%, at least 60%, at least 70%. at least 80%, at least 90%. at least 91%, at least 92%. at least 93%, at least 94%, at least 95%. at least 96%, at least 97%, at least 98%, at least 99%. or more, similar to a native or reference sequence. As used herein, “similarity” refers to an identical amino acid or a conservatively substituted amino acid, as described herein. Accordingly, the percentage of “sequence similarity” is the percentage of amino acids which is either identical or conservatively changed; e.g., “sequence similarity” = (% sequence identity)+(% conservative changes). It should be understood that a sequence that has a specified percent similarity to a reference sequence necessarily encompasses a sequence with the same specified percent identity to that reference sequence. The skilled person will be aware of various computer programs, using different mathematical algorithms, that are available to determine the identity or similarity between two sequences. For instance, use can be made of a computer program employing the Needleman and Wunsch algorithm (Needleman et al. (1970)); the GAP program in the Accelrys GCG software package (Accelerys Inc., San Diego U.S.A.); the algorithm of E. Meyers and W. Miller (Meyers et al. (1989)) which has been incorporated into the ALIGN program (version 2.0);or more preferably the BLAST (Basic Local Alignment Tool using default parameters); see e.g.. US Patent 10.023.890. the content of which is incorporated by reference herein in its entirety.

[0226] In some embodiments, sequencing comprises 16S rRNA gene sequencing, which can also be referred to as “ 16S ribosomal RNA sequencing”, “ 16S rDNA sequencing” or “16s rRNA sequencing”. Sequencing of the 16S rRNA gene can be used for genetic studies as it is highly conserved between different species of bacteria, but it is not present in eukaryotic species. In addition to highly conserved regions, the 16S rRNA gene also comprises nine hypervariable regions (V1-V9) that vary by species. 16S rRNA gene sequencing typically comprises using a plurality of universal primers that bind to conserved regions of the 16S rRNA gene, PCR amplifying the bacterial 16S rRNA gene regions (including hypervariable regions), and sequencing the amplified 16S rRNA genes with a next-generation sequencing technology as described herein (see also e.g., US Patents 5,654.418; 6,344,316; and 8,889,358; and US Patent Application Numbers US 2013 / 0157265 and US 2018 / 0195111, which are incorporated by reference in their entireties).

[0227] As used herein, the terms "treat,” "treatment," "treating,” or “amelioration” refer to therapeutic treatments, wherein the object is to reverse, alleviate, ameliorate, inhibit, slow down or stop the progression or severity of a condition associated with a disease or disorder, e.g. dysbiosis that includes a disruption of the gut-brain axis; a neurological disease or disorder; a synucleinopathy; Parkinson’s disease (PD); REM Sleep Behavior Disorder; dementia with Lewy bodies (DLB); pure autonomic failure (PAF); and / or multiple system atrophy (MSA). The tenn “treating" includes reducing or alleviating at least one adverse effect or symptom of a condition, disease or disorder associated with dysbiosis drat includes a disruption of the gut-brain axis. Treatment is generally “effective" if one or more symptoms or clinical markers are reduced. Alternatively, treatment is “effective" if the progression of a disease is reduced or halted. That is, “treatment" includes not just the improvement of symptoms or markers, but also a cessation of, or at least slowing of. progress or worsening of symptoms compared to what would be expected in the absence of treatment. Beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptom(s), diminishment of extent of disease, stabilized (z.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, remission (whether partial or total), and / or decreased mortality, whether detectable or undetectable. The term "treatment" of a disease also includes providing relief from the symptoms or side-effects of the disease (including palliative treatment).

[0228] As used herein, the term “pharmaceutical composition” refers to the active agent in combination with a pharmaceutically acceptable carrier e.g. a carrier commonly used in the pharmaceutical industry. The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate witha reasonable benefit / risk ratio. In some embodiments of any of the aspects, a pharmaceutically acceptable carrier can be a carrier other than water. In some embodiments of any of the aspects, a pharmaceutically acceptable carrier can be a cream, emulsion, gel, liposome, nanoparticle, and / or ointment. In some embodiments of any of the aspects, a pharmaceutically acceptable carrier can be an artificial or engineered carrier, e.g., a carrier that the active ingredient would not be found to occur in or within nature.

[0229] As used herein, the term "administering," refers to the placement of a compound as disclosed herein into a subject by a method or route which results in at least partial delivery of the agent at a desired site. Pharmaceutical compositions comprising the compounds disclosed herein can be administered by any appropriate route which results in an effective treatment in the subject. In some embodiments, administration comprises physical human activity, e.g., an injection, act of ingestion, an act of application, and / or manipulation of a delivery device or machine. Such activity can be performed, e.g., by a medical professional and / or the subject being treated. In some embodiments, administration can be one or more doses and / or treatments daily over a period of weeks or months. Examples of dosing and / or treatment schedules are administration daily, twice daily, three times daily or four or more times daily over a period of 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months, or more. In some embodiments, administration can be 1 capsule or 2 capsules a day. In some embodiments, administration can be up to 2 capsules a day, twice a day.

[0230] As used herein, “contacting" refers to any suitable means for delivering, or exposing, an agent to at least one cell. Exemplary delivery methods include, but are not limited to, direct delivery to cell culture medium, transfection, transduction, perfusion, injection, or other delivery method known to one skilled in the art. In some embodiments, contacting comprises physical human activity, e.g., an injection; an act of dispensing, mixing, and / or decanting; and / or manipulation of a delivery device or machine.

[0231] In some embodiments of any of the aspects, the cells (e.g., bacterial cells) can be maintained in culture. As used herein, “maintaining” refers to continuing the viability of a cell or population of cells. A maintained population of cells will have at least a subpopulation of metabolically active cells.

[0232] The term “statistically significant" or “significantly" refers to statistical significance and generally means a two standard deviation (2SD) or greater difference.

[0233] Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood as modified in all instances by the term “about.” The term “about” when used in connection with percentages can mean ±1%.

[0234] As used herein, the term “comprising” means that other elements can also be present in addition to the defined elements presented. The use of “comprising” indicates inclusion rather than limitation.

[0235] The term "consisting of refers to compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.

[0236] As used herein the term "consisting essentially of refers to those elements required for a given embodiment. The term permits the presence of additional elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment of the invention.

[0237] The singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described below. The abbreviation, "c.g." is derived from the Latin exempli gratia, and is used herein to indicate a non-limiting example. Thus, the abbreviation "e.g." is synonymous with the term "for example."

[0238] Groupings of alternative elements or embodiments of the invention disclosed herein are not to be construed as limitations. Each group member can be referred to and claimed individually or in any combination with other members of tire group or other elements found herein. One or more members of a group can be included in, or deleted from, a group for reasons of convenience and / or patentability. When any such inclusion or deletion occurs, the specification is herein deemed to contain the group as modified thus fulfilling the written description of all Markush groups used in the appended claims.

[0239] Unless otherwise defined herein, scientific and technical terms used in connection with the present application shall have the meanings that are commonly understood by those of ordinary skill in the art to which this disclosure belongs. It should be understood that this invention is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such can vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims. Definitions of common terms in cell biology, immunology, and molecular biology can be found in The Merck Manual of Diagnosis and Therapy. 20th Edition, published by Merck Sharp & Dohme Corp.. 2018 (ISBN 0911910190, 978-0911910421); Robert S. Porter et al. (eds.), The Encyclopedia of Molecular Cell Biology and Molecular Medicine, published by Blackwell Science Ltd., 1999-2012 (ISBN 9783527600908); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8); Immunology by Werner Luttmann, published by Elsevier, 2006; Janeway's Immunobiology, Kenneth Murphy, Allan Mowat. Casey Weaver (eds.), W. W. Norton & Company, 2016 (ISBN 0815345054, 978-0815345053); Lewin's Genes XI, published by Jones & Bartlett Publishers, 2014 (ISBN-1449659055); Michael Richard Green and Joseph Sambrook, Molecular Cloning: A Laboratory Manual, 4th ed.. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (2012) (ISBN 1936113414); Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (2012) (ISBN 044460149X); Laboratory Methods in Enzymology: DNA, Jon Lorsch (ed.) Elsevier, 2013 (ISBN 0124199542); Current Protocols in Molecular Biology (CPMB), Frederick M. Ausubel (ed.), John Wiley and Sons. 2014 (ISBN 047150338X, 9780471503385), Current Protocols in Protein Science (CPPS), John E. Coligan (ed ). John Wiley and Sons, Inc.. 2005; and Current Protocols in Immunology' (CPI) (John E. Coligan, ADA M Kruisbeek. David H Margulies, Ethan M Shevach, Warren Strobe, (eds.) John Wiley and Sons, Inc., 2003 (ISBN 0471142735, 9780471142737), the contents of which are all incorporated by reference herein in their entireties.

[0240] Other terms are defined herein within the description of the various aspects of the invention.

[0241] All patents and other publications; including literature references, issued patents, published patent applications, and co-pcnding patent applications; cited throughout this application are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the technology described herein. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.

[0242] The description of embodiments of the disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While specific embodiments of, and examples for. the disclosure are described herein for illustrative purposes, various equivalent modifications are possible within the scope of the disclosure, as those skilled in the relevant art will recognize. For example, while method steps or functions are presented in a given order, alternative embodiments may perform functions in a different order, or functions may be performed substantially concurrently. The teachings of the disclosure provided herein can be applied to other procedures or methods as appropriate. The various embodiments described herein can be combined to provide further embodiments. Aspects of the disclosure can be modified, if necessary, to employ the compositions, functions and concepts of the above references and application to provide yet further embodiments of the disclosure. These and other changes can be made to the disclosure in light of the detailed description. All such modifications are intended to be included within the scope of the appended claims.

[0243] Specific elements of any of the foregoing embodiments can be combined or substituted for elements in other embodiments. Furthermore, while advantages associated with certainembodiments of the disclosure have been described in the context of these embodiments, other embodiments may also exhibit such advantages, and not all embodiments need necessarily exhibit such advantages to fall within the scope of the disclosure.

[0244] Some embodiments of the technology described herein can be defined according to any of the following numbered paragraphs:1 . A method of treating or preventing a disease or disorder associated with a disruption in the gutbrain axis, the method comprising administering to a subject in need thereof an effective amount of a postbiotic composition.2. A method of treating or preventing a neurological disease or disorder, the method comprising administering to a subject in need thereof an effective amount of a postbiotic composition.3. A method of treating or preventing a synucleinopathy, the method comprising administering to a subject in need thereof an effective amount of a postbiotic composition.4. The method of any one of paragraphs 1-3, wherein the disease or disorder is selected from the group consisting of: Parkinson's disease (PD); REM Sleep Behavior Disorder; dementia with Lewy bodies (DLB); pure autonomic failure (PAF); and multiple system atrophy (MSA).5. The method of any one of paragraphs 1-4, wherein the disease or disorder is Parkinson’s disease.6. The method of any one of paragraphs 1-5, wherein the disease or disorder is REM Sleep Behavior Disorder.7. The method of any one of paragraphs 1-6. wherein administering the postbiotic composition is associated with at least one of the following outcomes, as compared to a negative control such as a subject not receiving the postbiotic composition or the treated subject prior to being administered the postbiotic composition: higher diversity in microbiome; higher abundance of beneficial microbiome species (e.g., Faecalibacterium, Akkertnansia. and / or Ruminococcus)', decreased abundance of pathogenic or non-beneficial microbiome species (e.g., Scardovia, Escherichia-Shigella, and / or Streptococcus)', decreased alpha-synuclein accumulates or inclusions (e.g., in samples from the stool, colon, gut, skin, and / or CSF); decreased inflammatory cytokines (e.g., tumor necrosis factor-alpha (TNFa), interleukin- ip (IL- 1 ), and / or interleukin-6 (IL-6)); decreased immune activation; decreased constipation; decreased stool hardness; decreased bowel movement frequency; decreased incidence or severity of sleep behavior disorders; decreased incidence or severity of Parkinson’s symptoms (e g., tremor in hands, arms, legs, jaw, or head; muscle stiffness; slowness of movement; impaired balance and coordination); increased cognitive function; decreased depression; decreased anxiety; and / or increased quality of life.8. The method of any one of paragraphs 1-7, wherein the postbiotic comprises the products of fermentation of herbal material comprising an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus, with at least one Bifidobacterium species and at least one Lactobacillus species.The method of any one of paragraphs 1-8. wherein the postbiotic comprises the products of fermentation of herbal material comprising ashwagandha root and elderberry, with at least one Bifidobacterium species and at least one Lactobacillus species. The method of any one of paragraphs 9, wherein the postbiotic composition is prepared according to a process comprising:(a) preparing a culture of microorganisms;(b) preparing a fermentation substrate composition;(c) inoculating the fermentation substrate composition with the culture of microorganisms to generate an inoculate composition;(d) fermenting the inoculate composition for a predetermined amount of time to generate a fermented inoculate composition; and(e) lyophilizing or spray -drying tire fermented inoculate composition to obtain the postbiotic composition. The method of paragraph 10, wherein the fermentation substrate composition comprises: herbal material comprising an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus, in combination with at least one Bifidobacterium species and at least one Lactobacillus species, and liquid water sufficient to suspend or submerge the herbal material. The method of paragraph 10 or 11, wherein the fermentation substrate composition comprises: herbal material comprising ashwagandha root and elderberry. in combination with at least one Bifidobacterium species and at least one Lactobacillus species, and liquid water sufficient to suspend or submerge the herbal material. The method of any one of paragraphs 10-12, wherein the fermentation substrate composition further comprises one or more of glucose, sucrose, fructose, honey, and molasses. The method of any one of paragraphs 8-13, wherein the herbal material further comprises an herb of the Astragalus family and / or a legume of the Lens orientalis or Lens culinaris family. The method of any one of paragraphs 8-14, wherein the herbal material further comprises Astragalus membranaceus root and / or and red lentil. The fermentation substrate of any one of paragraphs 10-15. wherein the fermentation substrate comprises: about 2% by weight to about 10% by weight ashwagandha; about 2% by weight to about 10% by weight elderberry; about 2% by weight to about 10% by weight Astragalus membranaceus root; about 0.5% by weight to about 3% by weight red lentil;about 2% by weight to about 10% by weight glucose, sucrose, fructose, honey, or molasses; and / or about 70% by weight to about 95% by weight water. The method of any one of paragraphs 10-16, wherein the predetermined amount of time is about 24 hours to about 10 days. The method of any one of paragraphs 10-17. wherein the culture of microorganisms comprises at least one Bifidobacterium species and at least one Lactobacillus species. The method of any one of paragraphs 8, 9. 11, 12, or 18, wherein the Bifidobacterium is selected from the group consisting of B. lactis, B. breve, B. infantis, B. longum, and any combination thereof. The method of any one of paragraphs 8, 9, 11, 12, or 18, wherein the Lactobacillus is selected from the group consisting of L. plantarum, L. acidophilus, L. rhamnosus, L. paracasei, L. casei, and any combination thereof. The method of any one of paragraphs 10-20, wherein the culture of microorganisms comprises a microorganism concentration from about 1.0 x 108CFU / mL to about IxlO12CFU / mL. The method of any one of paragraphs 1-21, wherein administering the postbiotic composition in combination with a synucleinopathy treatment is associated with an improvement in intestinal mucositis, as compared to a negative control such as a subject not receiving the composition or the treated subject prior to being administered the composition. A method of treating a synucleinopathy, the method comprising administering an effective amount of a postbiotic composition to a subject in need thereof, wherein the administering is effective to treat the synucleinopathy. wherein the postbiotic composition comprises the products of fermentation of herbal material comprising an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus, with at least one Bifidobacterium species and at least one Lactobacillus species. A method of treating a synucleinopathy, tire method comprising administering an effective amount of a postbiotic composition to a subject in need thereof, wherein the administering is effective to treat the synucleinopathy, wherein the postbiotic composition is prepared according to a process comprising:(a) preparing a culture of microorganisms comprising B. lactis, B. infantis. B. breve, L. paracasei, L. rhamnosus. and / or L. casei;(b) preparing a fermentation substrate composition comprising herbal material comprising ashwagandha root and elderberry in combination with liquid water sufficient to suspend or submerge the herbal material:(c) inoculating the fermentation substrate composition with the culture of microorganisms to generate an inoculate composition;(d) fermenting the inoculate composition for a predetermined amount of time to generate a fermented inoculate composition; and(e) lyophilizing or spray -drying the fermented inoculate composition to obtain the postbiotic composition.

[0245] The technology described herein is further illustrated by the following examples which in no way should be construed as being further limiting.EXAMPLESExample 1 - Preparation of Bifidobacterium Cultures

[0246] A IL flask was washed with soap and rinsed with hot water and sanitized. 500mL of MRS broth was prepared and stirred without autoclaving. The 500 mL aliquot of MRS broth was inoculated with Bifidobacterium culture powder comprising B. laclis, B. breve, and B. infanlis such that a target concentration of 1.00E+10 CFU / mL was achieved.Example 2 - Preparation of Lactobacillus Cultures

[0247] A IL flask was washed with soap and rinsed with hot water and sanitized. 500mL of MRS broth was prepared and stirred without autoclaving. The 500 mL aliquot of MRS broth was inoculated with Lactobacillus culture powder comprising L. plantarum, L. acidophilus, L. rhamnosus, and L. paracasei such that a target concentration of 1.00E+10 CFU / mL was achieved.Example 3 - Preparation of Herbal Substrate Composition

[0248] A blender was w ashed with soap, rinsed wdth hot water, and sanitized. The herbal substrate components listed in Table 4 were introduced into a blender and blended until smooth. The pH of the of herbal substrate composition w as adjusted to 6.5 with IM NaOH.

[0249] Table 4 - Exemplary Herbal Substrate Components

[0250] An alternative formulation can comprise the components shown in Table 5 below. In some embodiments, up to two capsules a day are administered, twice a day.

[0251] Table 5: Exemplary Components of Fermentation Substrate

[0252] An alternative formulation can comprise the following: ashwagandha powder, 3.5% by weight; elderberry' powder, 3.5% by weight; sucrose, 3.5% by weight, admixed with water. The term “ Withania Somnifera Extract” can be used interchangeably with “ashwagandha” or “ashwagandha powder.” In some embodiments of any of the aspects, the elderberry’ powder comprises Elderberry Juice Extract. In some embodiments, the formulation can comprise the following: Withania Somnifera Extract, 3.5% by weight; Elderberry' Juice Extract, 3.5% by weight; sucrose, 3.5% by weight, admixed with water.Example 4 - Fermentation Process to Prepare Postbiotic Composition

[0253] One example of fermentation to produce a postbiotic composition is described below. A fermentation vat was washed with soap, rinsed with hot water, and sanitized. The herbal substrate composition was transferred to the fermentation vat. The vat containing the herbal substrate composition was inoculated by pipette with the Bifidobacterium cultures from Example 1 (the starter concentration was 3.00E+10 CFU / mL for Bifidobacterium) and with the Lactobacillus culture from Example 2 (the starter concentration was 4.00E+10 CFU / mL for Lactobacillus). The target concentration was 2.00E+06 CFU / mL. During fermentation, the fennentation vat was sealed and purged with nitrogen gas (99.99% purity) so that an oxygen concentration of < 1% was achieved. The fermentation vat was incubated at 37°C. The pH of the fermentation volume was adjusted to 6.5 with IM NaOH, as needed. On day 5, the fermented composition was lyophilized to produce the postbiotic composition.

[0254] For more information about production of the postbiotic compositions described herein, see e.g., international publication WO2023137418A2, the contents of which are incorporated herein by reference in their entirety.Example 5 - Evaluation of the effects of postbiotic products on Parkinson ’s Disease markers

[0255] Described herein is use of microbiome modulation methodology in PD patients to study its effect on disease pathogenesis and clinical symptoms, which would answer the scientific question of whether the microbiome differences in PD are cause or consequence of the disease. The former conclusion can lead to a target for therapeutic intervention. Altering the gut microbiome by fecal microbiome transplant to a more ’‘healthy” state can improve disease measures in animal models and human subjects. Described herein is administration of postbiotics, an approach for altering the gut microbial community, to modify the gut microbiome in PD patients to promote a microbial composition that is more associated with health, to measure the alleviation of gastrointestinal (GI) symptoms associated with PD, and to ultimately delay or prevent PD progression.

[0256] Altering the microbiome with live bacteria using fecal microbiota transplants or probiotics has been explored in PD (see e.g., Xue et al. Medicine (Baltimore) 2020, 99(35): e22035; DuPont et al. Front Neurol 2023, 14: 1104759), though these approaches pose potential safety concerns or have reported conflicting data on efficacy. Postbiotics are an alternative to therapeutics with live bacteria. Postbiotics is an umbrella term that encompasses complex mixtures of metabolites produced by bacteria, such as during fermentation, as well as cell wall and other dead cell components. Consumption of postbiotics can alter the microbial community' by providing an environment that favors the colonization of beneficial species. The manufacturing process of postbiotic compositions can impact the final metabolite composition and thereby influence the gut microbiota. Described herein is use of a formulation (e.g., a postbiotic composition as described herein) that results from a fennentation process by indicated species of Lactobacillus and Bifidobacterium, major taxa present during infant microbiome assembly. Without wishing to be bound by theory, it is hypothesized that the metabolites of these species, their products of secondary metabolism and signaling molecules support or elicit competitive responses within resident members of the commensal adult microbiome that have evolved to ecologically succeed early colonizers of the gut microbiome and increases their resilience to external perturbations. This formulation has been shown to improve GI microbial diversity following treatment with oral antibiotics (see e.g., WO2023137418A2).

[0257] Described herein is testing of the role of the gut microbiome in synucleinopathies using the disease modifying therapy of postbiotics. Prodromal synucleinopathy subjects (e.g., n=10 including those with REM Sleep Behavior Disorder [RBD], which is characterized by complex motor enactment of dreams and is a potential prodromal marker of Parkinson's disease (PD)). Parkinson’s Disease (PD) (n=10). and control (n=10) subjects) consume a postbiotic composition as described herein; the postbiotic ’s effect on their gut microbiome is measured by longitudinal assessment of fecal microbial composition, systemic markers of inflammation (circulating immune cells), measures of GI and autonomic function, and / or clinical measures of PD. Without wishing to be bound by theory , it is hypothesized that the postbiotic composition can modify the GI microbial composition in ways consistent with the hypothesized ecological progression from pathological to normal and thiscan atenuate synuclein abnormalities detected in the gut, alter immune system function, and improve autonomic symptoms including constipation. The sample size and duration of the study of 8 weeks are based on a previous postbiotic study showing restoration of 2 fold microbiome diversity during antibiotic treatment with n=32 sample size (see e.g., WO2023137418A2).

[0258] This study can provide information on the effect of the postbiotic composition in a synucleinopathy cohort. Disease modification can also be assessed using PD-relevant clinical parameters. Postbiotic compositions as described herein can also be used to treat or prevent other synucleinopathies such as DLB as well as pure autonomic failure (PAF) and MSA. Postbiotic compositions as described herein can be used to modulate central neurological pathogenesis and symptoms consequent to measurable peripheral changes and can be broadly relevant to treating or preventing many other neurological disorders.

[0259] Table 6: Study design, Subjects: (n=10 each, n=30 total)

[0260] Table 6: Outcome measures. *These invasive procedures will be optional for this phase of the study.| Quality of life (QoL)

[0261] It is contemplated herein that administration of the postbiotic composition to a PD subject or to a RBD subject will be associated with at least one of the following outcomes, as compared to a negative control such as a subject receiving a placebo, a subject not receiving die postbiotic composition or the treated subject prior to being administered the postbiotic composition: higher diversity in microbiome; higher abundance of beneficial microbiome species (e.g., populations of beneficial microbes associated with immune system support; e g., Faecalibacterium, Akkermansia, and / or Ruminococcus; see e.g., Fig. 8A of WO2023137418A2); decreased abundance of pathogenic or non-beneficial microbiome species (e.g., Scardovia. Escherichia-Shigella, and / or Streptococcus', see e.g.. Fig. 8A of WO2023137418A2); decreased alpha-synuclein accumulates or inclusions (e.g., in samples from the stool, colon, gut, skin, and / or CSF); decreased inflammatory cytokines (e.g.. tumor necrosis factor-alpha (TNFa), interleukin- 10 (IL-10), and / or interleukin-6 (IL-6)); decreased immune activation; decreased constipation; decreased stool hardness; decreased bowel movement frequency; decreased incidence or severity of sleep behavior disorders; decreased incidence or severity of Parkinson’s symptoms (e.g.. tremor in hands, arms, legs, jaw, or head; muscle stiffness; slowness of movement; impaired balance and coordination); increased cognitive function; decreased depression; decreased anxiety; and / or increased quality of life.References:

[0262] 1. Wallen ZD, Demirkan A. Twa G, et al. Metagenomics of Parkinson's disease implicates the gut microbiome in multiple disease mechanisms. Nat Commun 2022; 13(1 ):6958.

[0263] 2. Boktor IC. Sharon G, Verhagen Metinan LA, et al. Integrated Multi-Cohort Analysis of the Parkinson's Disease Gut Metagenome. Mov Disord 2023.

[0264] 3. Toh TS, Chong CW, Lim SY, et al. Gut microbiome in Parkinson's disease: New insights from meta-analysis. Parkinsonism Relat Disord 2021;94: 1-9.

[0265] 4. Shen T, Yue Y, He T, et al. The Association Between the Gut Microbiota andParkinson's Disease, a Meta-Analysis. Front Aging Neurosci 2021;13:636545.

[0266] 5. Xue LJ, Yang XZ, Tong Q, et al. Fecal microbiota transplantation therapy forParkinson's disease: A preliminary’ study. Medicine (Baltimore) 2020;99(35):c22035.

[0267] 6. DuPont HL, Suescun J, Jiang ZD, et al. Fecal microbiota transplantation in Parkinson's disease-A randomized repeat-dose, placebo-controlled clinical pilot study. Front Neurol 2023;14: 1104759.

[0268] 7. Salminen S, Collado MC, Endo A, et al. The International Scientific Association ofProbiotics and Prebiotics (ISAPP) consensus statement on the definition and scope of postbiotics. Nat Rev Gastroenterol Hepatol 2021;18(9):649-667.

[0269] 8. Mosca A, Abreu YAAT, Gwee KA, et al. The clinical evidence for postbiotics as microbial therapeutics. Gut Microbes 2022;14(l):2117508.

[0270] 9. Wastvk HC. Fragiadakis GK, Perelman D, et al. Gut-microbiota-targeted diets modulate human immune status. Cell 2021;184(16):4137-4153 e4114.

[0271] 10. Zhou X. Qi W, Hong T, et al. Exopolysaccharides from Lactobacillus plantarumNCU116 Regulate Intestinal Barrier Function via STAT3 Signaling Pathway. J Agric Food Chem 2018;66(37):9719-9727.

[0272] 11 . Schaffrath A. Schleyken S, Seger A, et al. Patients with isolated REM-sleep behavior disorder have elevated levels of alpha-synuclein aggregates in stool. NPJ Parkinsons Dis 2023;9(l):14.

[0273] 12. Houser MC, Chang J, Factor SA, et al. Stool Immune Profiles Evince GastrointestinalInflammation in Parkinson's Disease. Mov Disord 2018;33(5):793-804.

[0274] 13. Fenyi A, Leclair-Visonneau L, Clairembault T, et al. Detection of alpha-synuclein aggregates in gastrointestinal biopsies by protein misfolding cyclic amplification. Neurobiol Dis 2019;129:38-43.

[0275] 14. Martinez-Valbuena I, Visanji NP, Olszcwska DA, et al. Combining Skin alpha-Synuclein Real-Time Quaking-Induced Conversion and Circulating Neurofilament Light Chain to Distinguish Multiple System Atrophy and Parkinson's Disease. Mov Disord 2022;37(3):648-650.

[0276] 15. Kuzkina A, Panzer C, Seger A, et al. Dermal Real-Time Quaking-Induced ConversionIs a Sensitive Marker to Confinn Isolated Rapid Eye Movement Sleep Behavior Disorder as an Early alpha-Synucleinopathy. Mov Disord 2023.

[0277] 16. Russo MJ, Orru CD, Concha-Marambio L. et al. High diagnostic performance of independent alpha-synuclein seed amplification assays for detection of early Parkinson's disease. Acta Neuropathol Coinmun 2021;9(l):179.

Claims

CLAIMSWhat is claimed is:

1. A method of treating or preventing a disease or disorder associated with a disruption in the gutbrain axis, the method comprising administering to a subject in need thereof an effective amount of a postbiotic composition.

2. A method of treating or preventing a neurological disease or disorder, the method comprising administering to a subject in need thereof an effective amount of a postbiotic composition.

3. A method of treating or preventing a synucleinopathy. the method comprising administering to a subject in need thereof an effective amount of a postbiotic composition.

4. The method of any one of claims 1-3, wherein the disease or disorder is selected from the group consisting of: Parkinson’s disease (PD); REM Sleep Behavior Disorder; dementia with Lewy bodies (DLB); pure autonomic failure (PAF); and multiple system atrophy (MSA).

5. The method of any one of claims 1-4. wherein the disease or disorder is Parkinson’s disease.

6. The method of any one of claims 1-5, wherein the disease or disorder is REM Sleep Behavior Disorder.

7. The method of any one of claims 1-6, wherein administering the postbiotic composition is associated with at least one of the following outcomes, as compared to a negative control such as a subject not receiving the postbiotic composition or the treated subject prior to being administered the postbiotic composition: higher diversity in microbiome; higher abundance of beneficial microbiome species (e.g., aecalibacterium, Akkermansia. and / or Riimii'iococcus) decreased abundance of pathogenic or non-beneficial microbiome species (e.g.. Scardovia, Escherichia-Shigella, and / or Streptococcus^ decreased alpha-synuclein accumulates or inclusions (e.g., in samples from the stool, colon, gut. skin, and / or CSF); decreased inflammatory cytokines (e.g.. tumor necrosis factor-alpha (TNFa), interleukin- ip (IL-1 ), and / or interleukin-6 (IL-6)); decreased immune activation; decreased constipation; decreased stool hardness; decreased bowel movement frequency; decreased incidence or severity of sleep behavior disorders; decreased incidence or severity of Parkinson’s symptoms (e g., tremor in hands, arms, legs, jaw, or head; muscle stiffness; slowness of movement; impaired balance and coordination); increased cognitive function; decreased depression; decreased anxiety; and / or increased quality of life.

8. The method of any one of claims 1-7. wherein the postbiotic comprises the products of fermentation of herbal material comprising an herb of the Solanaceae or nightshade family and aberry of the Sambucus L. genus, with at least one Bifidobacterium species and at least one Lactobacillus species.

9. The method of any one of claims 1-8, wherein the postbiotic comprises the products of fermentation of herbal material comprising ashwagandha root and elderberry, with at least one Bifidobacterium species and at least one Lactobacillus species.

10. The method of any one of claims 9. wherein the postbiotic composition is prepared according to a process comprising:(a) preparing a culture of microorganisms;(b) preparing a fermentation substrate composition;(c) inoculating the fermentation substrate composition with the culture of microorganisms to generate an inoculate composition;(d) fermenting the inoculate composition for a predetermined amount of time to generate a fermented inoculate composition; and(e) lyophilizing or spray -dry ing tire fermented inoculate composition to obtain the postbiotic composition.

11. The method of claim 10, wherein the fermentation substrate composition comprises: herbal material comprising an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus, in combination with at least one Bifidobacterium species and at least one Lactobacillus species, and liquid water sufficient to suspend or submerge the herbal material.

12. The method of claim 10 or 11, wherein the fermentation substrate composition comprises: herbal material comprising ashwagandha root and elderberry, in combination with at least one Bifidobacterium species and at least one Lactobacillus species, and liquid water sufficient to suspend or submerge the herbal material.

13. The method of any one of claims 10-12, wherein the fermentation substrate composition further comprises one or more of glucose, sucrose, fructose, honey, and molasses.

14. The method of any one of claims 8-13, wherein the herbal material further comprises an herb of the Astragalus family and / or a legume of the Lens orientalis or Lens culinaris family.

15. The method of any one of claims 8-14, wherein the herbal material further comprises Astragalus membranaceus root and / or and red lentil.

16. The fermentation substrate of any one of claims 10-15, wherein the fermentation substrate comprises: about 2% by weight to about 10% by weight ashwagandha: about 2% by weight to about 10% by weight elderberry; about 2% by weight to about 10% by weight Astragalus membranaceus root; about 0.5% by weight to about 3% by weight red lentil; about 2% by weight to about 10% by weight glucose, sucrose, fructose, honey, or molasses; and / or about 70% by weight to about 95% by weight water.

17. The method of any one of claims 10-16, wherein the predetermined amount of time is about 24 hours to about 10 days.

18. The method of any one of claims 10-17, wherein the culture of microorganisms comprises at least one Bifidobacterium species and at least one Lactobacillus species.

19. The method of any one of claims 8, 9, 11, 12, or 18, wherein the Bifidobacterium is selected from the group consisting of B. lactis, B. breve. B. infantis, B. longum, and any combination thereof.

20. The method of any one of claims 8. 9, 11. 12, or 18, wherein the Lactobacillus is selected from the group consisting of L. plantarum, L. acidophilus, L. rhamnosus, L. paracasei, L. casei. and any combination thereof.

21. The method of any one of claims 10-20, wherein the culture of microorganisms comprises a microorganism concentration from about 1.0 x 108CFU / mL to about IxlO12CFU / mL.

22. The method of any one of claims 1-21, wherein administering the postbiotic composition in combination with a synucleinopathy treatment is associated with an improvement in intestinal mucositis, as compared to a negative control such as a subject not receiving the composition or the treated subject prior to being administered the composition.

23. A method of treating a synucleinopathy, tire method comprising administering an effective amount of a postbiotic composition to a subject in need thereof, wherein the administering is effective to treat the synucleinopathy. wherein the postbiotic composition comprises the products of fermentation of herbal material comprising an herb of the Solanaceae or nightshade family anda berry of the Sambucus L. genus, with at least one Bifidobacterium species and at least one Lactobacillus species.

24. A method of treating a synucleinopathy, the method comprising administering an effective amount of a postbiotic composition to a subject in need thereof, wherein the administering is effective to treat the synucleinopathy, wherein the postbiotic composition is prepared according to a process comprising:(a) preparing a culture of microorganisms comprising B. lactis, B. infantis. B. breve, L. paracasei, L. rhamnosus. and / or L. casei;(b) preparing a fermentation substrate composition comprising herbal material comprising ashwagandha root and elderberry in combination with liquid water sufficient to suspend or submerge the herbal material;(c) inoculating the fermentation substrate composition with the culture of microorganisms to generate an inoculate composition;(d) fermenting the inoculate composition for a predetermined amount of time to generate a fermented inoculate composition; and(e) lyophilizing or spray -drying the fermented inoculate composition to obtain the postbiotic composition.

Images