IFN-γ gene fragment and use thereof
By inserting a foreign gene at the 3'UTR site of the IFN-γ gene and controlling its expression using the IFN-γ promoter, the problem of uncontrolled foreign gene insertion was solved, enhancing the anti-tumor effect of immune cells and improving safety.
Patent Information
- Application Number
- PCT/CN2024/088711
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-04-19
- Publication Date
- 2025-10-23
AI Technical Summary
In existing technologies, exogenous genes are difficult to insert precisely in immune cell therapy and are subject to regulation by endogenous gene promoters, resulting in uncontrolled expression and affecting the safety and efficacy of immune cells.
By using CRISPR/Cas gene editing technology, a foreign gene is inserted into the 3'UTR site of the IFN-γ gene. The IFN-γ promoter is used to control the expression of the foreign gene, ensuring that it is expressed when the TCR signaling pathway is activated and turned off when there is no antigen stimulation, thus avoiding unnecessary expression.
It achieves the inducible expression of exogenous genes, enhances the anti-tumor activity of immune cells, and improves the safety of immune cells, avoiding potential risks of chronic inflammation or malignant transformation.
Smart Images

Figure CN2024088711_23102025_PF_FP_ABST
Abstract
Description
IFN-gamma gene fragment and application thereof TECHNICAL FIELD
[0001] The present application relates to the field of biological cell preparation, in particular to an IFN-gamma gene fragment with exogenous gene knock-in and application thereof. BACKGROUND
[0002] Immune cell therapy plays an extremely important role in the current medical field. Compared with traditional treatment methods, immune cell therapy has lower toxic side effects and higher specificity, can more effectively kill tumor cells and infectious pathogens, and at the same time reduce damage to healthy tissues. However, after the end of immune cell therapy, their activity can rapidly weaken, leading to recurrence of the disease or re-infection. Therefore, in order to improve the persistence and efficacy of immune cell therapy, it is necessary to genetically edit and modify immune cells, such as inserting exogenous genes (such as cytokines, antibodies, etc.) into the genome of immune cells. Through these methods, the effect of immune cell therapy can be further improved, and patients can have longer disease control and survival advantages.
[0003] Currently, the most commonly used exogenous gene expression system is the Nuclear Factor of Activated T cells (NFAT) synthetic promoter system and the synthetic Notch (synNotch) system. Unfortunately, clinical trials have shown that the NFAT synthetic promoter has a serious "leakage" problem in vivo, and thus caused cases of death in patients participating in clinical trials. The synNotch can also stimulate the expression of downstream genes by target antigen stimulation, and the feature of this system is to depend on antigen stimulation but not on the TCR (T cell receptor) signaling pathway of immune cells. However, this system needs to use viruses to deliver multiple synthetic gene fragments into cells, and the limited delivery efficiency of viruses makes it difficult to industrialize, and potential immunogenicity and in vivo epigenetic regulation factors also affect its clinical safety. Therefore, how to make the expression of exogenous genes occur in the most natural conditions and ensure that the expression of exogenous genes will not appear out of control or unpredictable conditions after immune cells are returned to patients in vivo is the key to cell immunotherapy.
[0004] The TCR signaling pathway of immune cells plays a crucial role in immune responses. When the T cell receptor is stimulated by external antigens, the TCR signaling pathway is activated, triggering a series of signaling events, ultimately leading to the activation and functional enhancement of immune cells. In this process, IFN-γ (interferon-γ) plays a key role as an important cytokine. IFN-γ is known for its ability to broadly regulate immune responses, mainly produced by T cells and natural killer cells (NK cells). The T cell response is characterized by stimulating the differentiation of naive cells into effector cells. One feature of effector T cells is their ability to produce IFN-γ. Due to the central role of IFN-γ in immunity, its expression must be strictly regulated. IFN-γ expression in T cells can be divided into two stages: the differentiation stage and the post-differentiation stage. In naive T cells, the IFN-γ gene is inhibited by DNA methylation. Upon antigen stimulation, the differentiation process will be initiated, and DNA methylation will also be eliminated. Once T cells differentiate into effector cells, the IFN-γ promoter will be accessible to transcriptional activators and repressors. After antigen reactivation, transcriptional activators such as NFAT and activator protein-1 (AP-1) will bind to the IFN-γ promoter region and initiate IFN-γ expression. In addition, enhancer elements within the IFN-γ locus also play a crucial role in regulating IFN-γ expression. These elements include proximal and distal enhancers, which help to strictly control IFN-γ transcription and are involved in the dynamic regulation of IFN-γ expression under immune stimulation.
[0005] Among the multiple TCR signaling pathway immune response genes, the IFN-γ gene promoter is the most sensitive to TCR signaling and has the highest transient expression. It can respond rapidly within half an hour after the cell receives antigen stimulation, transiently and efficiently activate downstream genes, and after the removal of antigen signals, the promoter can also turn off downstream gene expression within half an hour. Therefore, how to utilize the above characteristics of IFN-γ to edit and modify immune cells is crucial for further improving the effectiveness of immune cell therapy.
[0006] SUMMARY TECHNICAL PROBLEM
[0007] In the field of immune cell therapy, using gene editing technology to modify immune cells to enhance their function has become an important research direction. However, there is currently a key problem, that is, how to achieve precise insertion of exogenous genes and ensure that they are regulated by endogenous gene promoters to achieve inducible expression of exogenous genes, while not affecting the normal expression and function of endogenous genes. When using an endogenous promoter for exogenous gene expression, the promoter should meet the following standards: 1) it should be strictly responsive to antigen stimulation; 2) it should be preferentially expressed in effector T cells; 3) its transcription should be sensitive and robust. In view of this problem, the IFN-γ gene and its endogenous promoter are relatively ideal candidate genes. Precise insertion of exogenous genes into the IFN-γ gene can achieve precise insertion and inducible expression of exogenous genes while maintaining the normal expression and function of endogenous genes, thereby improving the function of immune cells and reducing the potential risk of immune cell therapy. Technical solutions
[0008] Based on the above problems, the present application provides a method for precise inducible expression of exogenous cytokine genes. This method can enhance the function of immune cells, such as anti-tumor, through the expression of exogenous genes, and avoid potential hazards caused by continuous expression of exogenous genes, such as chronic, acute inflammation or malignant transformation. Specifically, using gene editing technology, the exogenous target gene is precisely inserted into the 3'UTR site of the endogenous gene. By inserting the exogenous gene into this site, the expression of the exogenous gene will be controlled by the endogenous gene promoter. Therefore, inducible expression of the exogenous gene can be achieved. At the same time, because the insertion site is located in the 3'UTR, the insertion of the gene will not affect the expression of the endogenous gene.
[0009] The technical solutions of the present application are as follows:
[0010] An engineered immune cell prepared by using an IFN-γ promoter to regulate the inducible expression of an exogenous gene, that is, a target exogenous gene is inserted into the 3'UTR site of the TCR responsive gene IFN-γ of the immune cell, and the IFN-γ gene and the exogenous gene are connected by an IRES (Internal Ribosome Entry Site); when the TCR signaling pathway of the immune cell is activated, the TCR responsive gene IFN-γ promoter will simultaneously drive the transcription and expression of IFN-γ and the exogenous gene. The technical solutions of the present application are as follows.
[0011] An IFN-γ gene fragment into which an exogenous gene is knocked in.
[0012] The site where the exogenous gene is knocked into the IFN-γ gene fragment is the 3'UTR site region.
[0013] The exogenous gene is knocked into the IFN-gamma gene fragment by CRISPR / Cas gene editing technology, and the knocking-in mode is homologous recombination.
[0014] The exogenous gene comprises one or more of a CAR, a cytokine and a functional protein; the cytokine comprises one or more of an IL-7 gene, an IL-10 gene, an IL-12 gene, an IL-15 gene, an IL-18 gene and an IL-21 gene; and the functional protein comprises one or more of a fluorescent protein and an antibody.
[0015] The exogenous gene comprises an internal ribosome entry site (IRES) or a self-cleavage (2A) sequence.
[0016] The expression of the exogenous gene is consistent with the expression of IFN-gamma and is controlled by the promoter in the IFN-gamma gene fragment.
[0017] The IFN-gamma gene fragment provided by the application can be used to construct a nucleic acid molecule, an expression cassette, a gene recombination vector, a recombination cell line and a host cell, etc., which code for the IFN-gamma gene fragment; and the IFN-gamma gene fragment, the nucleic acid molecule, the expression cassette, the gene recombination vector, the recombination cell line and the host cell, etc., can be used as a biological agent or a component thereof; the biological agent can be a reagent for detecting the concentration of human Claudin18.2 protein, or a reagent for detecting the expression degree of human Claudin18.2 protein on the surface of tumor cells, or a reagent for carrying out antibody-mediated complement-dependent or cell-dependent cytotoxicity reaction on human Claudin18.2 positive cells; or the biological agent can be used to prepare a drug for treating or preventing tumors and cancers. Advantages
[0018] When the engineered immune cells containing the exogenous gene bind to the target cells, in addition to the killing effect of the immune cells themselves and the normal secretion of cytokines, the TCR signaling pathway is stimulated, the TCR response gene IFN-g gene is activated, and IFN-g and the exogenous gene are expressed at the same time, because the exogenous gene and IFN-g share the same IFN-g promoter, and there is an IRES between the IFN-g gene and the exogenous gene; in addition, when there is no stimulation of positive target cells, the TCR signaling pathway is not activated, and IFN-g and the exogenous gene are not expressed, so that the expression of the exogenous gene is regulated. Therefore, the inducible expression system is safe and reliable, not only can enhance the killing effect of immune cells when encountering target cells; but also can turn off the expression of the exogenous cytokine gene in time in the absence of target cell stimulation, thereby improving the safety of the application of engineered immune cells. The application can be used for the modification of immune cells (such as T cells, NK cells and other cells expressing IFN-g), especially for improving the anti-tumor performance of chimeric antigen receptor cells. BRIEF DESCRIPTION OF DRAWINGS
[0019] Figure 1 is a diagram showing the data of IFN-g-3'UTR-gRNA gene editing efficiency;
[0020] Figure 2 is a schematic diagram of the homology-directed repair template inserted with the exogenous gene IL-15-GFP;
[0021] Figure 3 is a schematic diagram of the homology-directed repair template inserted with the exogenous gene GFP;
[0022] Figure 4 is a schematic diagram of the left and right homologous arm design of the exogenous gene IL-15-GFP;
[0023] Figure 5 is a schematic diagram of the left and right homologous arm design of the exogenous gene CAR-IL-15-GFP;
[0024] Figure 6 is a schematic diagram of the exogenous gene GFP vector structure corresponding to the 3'UTR site in Examples 1 and 2;
[0025] Figure 7 is a schematic diagram of the exogenous gene GFP vector structure corresponding to the 5'UTR-3'UTR site in Examples 2 and 3;
[0026] Figure 8 is a schematic diagram of the exogenous gene vector structure corresponding to the 3'UTR site in Examples 4 and 5, CAR, GFP, IL-15 or anti-PD1;
[0027] Figure 9 is a flow cytometry detection diagram of the IFN-g gene knockout of T cells by each IFN-g-gRNA nucleotide sequence in 3-CAR-T cells and 4-CAR-T cells of Example 6;
[0028] Figure 10 is a flow cytometry diagram of exogenous gene knock-in of CAR, IL-15 corresponding gene in 3-CAR-T cells and 4-CAR-T cells of Example 6;
[0029] Figure 11 is a cell expansion curve of Example 6;
[0030] Figure 12 is a flow cytometry diagram of cell CAR positive rate of Example 6;
[0031] Figure 13 is a flow cytometry diagram of endogenous gene expression of cells of Example 6;
[0032] Figure 14 is a specific tumor killing rate curve of NT / CLDN18.2-CAR-T / 3-CAR-T cells of Example 6 at an effector to target ratio (E:T = 1:1);
[0033] Figure 15 is a specific tumor killing rate curve of NT / Nectin4-CAR-T / 4-CAR-T cells of Example 6 at an effector to target ratio (E:T = 1:1);
[0034] Figure 16 is a cell growth expansion detection curve of Example 7;
[0035] Figure 17 is a specific tumor killing rate curve of NT / 3-CAR-T cells of Example 7 at an effector to target ratio (E:T = 1:1);
[0036] Figure 18 is a specific tumor killing rate curve of NK / 3-CAR-NK cells of Example 7 at an effector to target ratio (E:T = 1:1);
[0037] Figure 19 is a specific tumor killing rate curve of CIK / 3-CAR-CIK cells of Example 7 at an effector to target ratio (E:T = 1:1);
[0038] Figure 20 is a specific tumor killing rate curve of DC / 3-CAR-DC cells of Example 7 at an effector to target ratio (E:T = 1:1);
[0039] Figure 21 is a specific tumor killing rate curve of M / 3-CAR-M cells of Example 7 at an effector to target ratio (E:T = 1:1). Best Mode for Carrying Out the Invention
[0040] The preferred embodiments of the present application will be further described in conjunction with the accompanying drawings.
[0041] The present application discloses an insertion site of an exogenous gene (IFN-γ-3'UTR), by inserting an exogenous gene into the site, the expression of the exogenous gene will be controlled by the endogenous IFN-γ promoter, because the expression of IFN-γ is induced by signals such as TCR, so the inducible expression of the exogenous gene can be realized; at the same time, because the insertion site is located in the 3'UTR, the insertion of the gene will not affect the expression of IFN-γ, by adjusting the position of the insertion site, the purpose of increasing the expression of IFN-γ can also be achieved. The application can be used for the modification of immune cells (such as T cells, NK cells and other cells expressing IFN-γ), especially for improving the anti-tumor performance of chimeric antigen receptor cells.
[0042] By inserting an exogenous gene into the site, we construct an immune cell with inducible expression of exogenous genes, on the one hand, the anti-tumor activity of the immune cell is increased, on the other hand, the expression of the exogenous gene is controlled by the endogenous IFN-γ promoter, which will not be expressed in the presence of antigen, thereby increasing the safety of the immune cell.
[0043] The exogenous gene can be one or more of CAR, cytokine and functional protein; wherein the cytokine includes one or more of IL-7 gene, IL-10 gene, IL-12 gene, IL-15 gene, IL-18 gene and IL-21 gene; the functional protein includes one or more of fluorescent protein and / or antibody; and the fluorescent protein includes one or more of GFP, RFP, BFP and YFP gene; and the antibody includes one or more of anti-PD1, anti-CTLA4, anti-TIGIT, anti-TIM3 and anti-LAG3.
[0044] The specific combination of the exogenous gene can be any one of CAR, IL-7 gene, IL-10 gene, IL-12 gene, IL-15 gene, IL-18 gene and IL-21, GFP and anti-PD-1; or any one or more combinations of CAR and IL-7 gene, IL-10 gene, IL-12 gene, IL-15 gene, IL-18 gene and IL-21, GFP and anti-PD-1; or any two or more combinations of IL-7 gene, IL-10 gene, IL-12 gene, IL-15 gene, IL-18 gene and IL-21, GFP and anti-PD-1, etc.
[0045] When the exogenous gene is inserted into the 3'UTR of the IFN-γ fragment, an internal ribosome entry site (IRES) or a self-cleavage 2A sequence needs to be added before the transcription initiation codon of the exogenous gene, that is, the exogenous gene also contains an internal ribosome entry site (IRES) or a self-cleavage 2A sequence.
[0046] After the exogenous gene is inserted into the IFN-γ fragment, the expression of the exogenous gene is consistent with the expression of IFN-γ and is controlled by the promoter in the IFN-γ gene fragment, and the expression of the exogenous gene and the expression of IFN-γ can be expressed at the same time and do not affect each other.
[0047] The IFN-γ gene fragment provided by the application can be used to construct nucleic acid molecules, expression cassettes, gene recombination vectors, recombinant cell lines and host cells, etc. containing the IFN-γ gene fragment coding; wherein the IFN-γ gene fragment, nucleic acid molecules, expression cassettes, gene recombination vectors, recombinant cell lines and host cells, etc. can be used as biological agents or components thereof, and the biological agents can be reagents for detecting the concentration of human Claudin18.2 protein, or reagents for detecting the expression degree of human Claudin18.2 protein on the surface of tumor cells, or reagents for antibody-mediated complement-dependent or cell-dependent cytotoxicity reaction on human Claudin18.2 positive cells; or the biological agents are used for preparing drugs for treating or preventing tumors and cancers.
[0048] The nucleic acid molecules can be used to construct expression cassettes, and the nucleic acid molecules or expression cassettes can be used to construct gene recombination vectors; further, the nucleic acid molecules, expression cassettes or gene recombination vectors can also be used to construct recombinant cell lines and host cells, etc.; wherein the gene recombination vectors are preferably adeno-associated viruses, slow diseases, etc., and the recombinant cell lines can be immune cells such as T cells, NK cells, CIK cells, DC cells, macrophages, etc.; that is, the IFN-γ fragment provided by the application is mainly suitable for gene editing in various cells, especially gene editing in immune cells such as T cells, NK cells, CIK cells, DC cells, macrophages, etc.
[0049] Therefore, the key points of the application are:
[0050] 1) Exogenous gene insertion site, i.e. IFN-γ-3'UTR;
[0051] 2) The inserted exogenous gene can be a gene encoding a protein (such as a cytokine, a transcription factor, etc.) or any DNA sequence such as a microRNA, etc.
[0052] 3) The inserted protein-encoding start sequence is an IRES sequence;
[0053] 4) A double-stranded DNA cut is made by ZFN, TALENT, CRISPR / Cas, etc., and then an exogenous DNA fragment is inserted into the 3'UTR site cut by HDR (homologous dependent repair) or NHEJ (non-homologous end-joining), etc.
[0054] The application preferably uses the CRISPR / Cas gene editing technology to make a double-stranded DNA cut at the 3'UTR site of IFN-γ to achieve the insertion of an exogenous gene into IFN-γ; for this purpose, the application needs to be processed as follows.
[0055] I. Design of gRNA nucleic acid sequence
[0056] To make a double-stranded DNA cut at IFN-γ using the CRISPR / Cas gene editing technology, the following processing needs to be done:
[0057] 1) Design multiple gRNA nucleic acid sequences according to the nucleic acid sequence of IFN-γ;
[0058] 2) Knock out the corresponding 3'UTR site of IFN-γ to make a double-stranded DNA cut by CRISPR / Cas gene editing technology and the designed gRNA nucleic acid sequence.
[0059] In order to make a double-stranded DNA cut at the 3'UTR site of IFN-γ, the gRNA sequence designed by CRISPR / Cas gene editing technology is as follows, and any one or more of the following groups is selected when used:
[0060] 1) The nucleic acid sequence of IFN-γ-3'UTR-gRNA1, i.e. gRNA1 is shown as SEQ ID NO. 1:
[0061] CTTTATCTCAGGGGCCAACT; or
[0062] 2) The nucleic acid sequence of IFN-γ-3'UTR-gRNA2, i.e. gRNA2 is shown as SEQ ID NO. 2:
[0063] CCAACCTAAGCAAGATCCCA; or
[0064] 3. The nucleic acid sequence of IFN-γ-3'UTR-gRNA3, i.e. gRNA3 is shown as SEQ ID NO. 3:
[0065] CAACCTAAGCAAGATCCCAT; or
[0066] 4. The nucleic acid sequence of IFN-γ-3'UTR-gRNA4, i.e. gRNA4 is shown as SEQ ID NO. 4:
[0067] CAACTGTGACTGTACCCAAA.
[0068] As shown in Figure 1, the gene editing efficiency data of the above four groups of IFN-γ-3'UTR-gRNA; from Figure 1, the four groups of gRNA gene knockout efficiency for 3'UTR site are all above 50%, especially the gRNA4 gene knockout rate is the best, close to 90%.
[0069] II. Designing a homologous mediated repair template
[0070] As shown in Figures 2 and 3, the homologous mediated repair template design schematic diagram, which includes the upstream homologous sequence (LA) and the downstream homologous sequence (RA) of the target gene IFN-γ and the exogenous DNA fragment respectively. In the present application, the upstream homologous nucleic acid sequence (LA) and the downstream homologous nucleic acid sequence (RA) of the homologous recombination mediated repair template can also be referred to as the left and right homologous arms (LA, RA). The left and right homologous arms (LA, RA) at both ends of each exogenous DNA fragment are respectively the same as the left and right homologous arms (LA, RA) of the corresponding homologous recombination mediated repair template, that is, the corresponding nucleic acid sequences are the same.
[0071] The upstream homologous sequence and the downstream homologous sequence of IFN-γ and the exogenous DNA fragment are as follows, and any one or more groups are selected when used.
[0072] 1. The corresponding LA and RA sequences of IFN-γ-3'UTR-gRNA1 are SEQ ID NO. 21 and SEQ ID NO. 22, respectively;
[0073] The sequence of SEQ ID NO. 21 is:
[0074] The sequence of SEQ ID NO. 22 is:
[0075] 2. The corresponding LA and RA sequences of IFN-γ-3'UTR-gRNA2 are SEQ ID NO. 23 and SEQ ID NO. 24, respectively;
[0076] The sequence of SEQ ID NO. 23 is:
[0077] The sequence of SEQ ID NO. 24 is:
[0078] 3, IFN-γ-3'UTR-gRNA3 corresponding LA, RA sequence is SEQ ID NO. 25 and SEQ ID NO. 26 respectively;
[0079] The sequence of SEQ ID NO. 25 is:
[0080] The sequence of SEQ ID NO. 26 is:
[0081] 4, IFN-γ-3'UTR-gRNA4 corresponding LA, RA sequence is SEQ ID NO. 27 and SEQ ID NO. 28 respectively;
[0082] The sequence of SEQ ID NO. 27 is:
[0083] The sequence of SEQ ID NO. 28 is:
[0084] III. Design of upstream and downstream homologous nucleic acid sequences of exogenous gene (i.e. left and right homologous arms)
[0085] As shown in FIGS. 4 and 5, since the exogenous gene, such as CAR structure, is started by the promoter of the target gene IFN-γ; therefore, a regulatory element is added in front of the exogenous gene, such as T2A regulatory element is added in front of CAR, and IRES regulatory element is added in front of other exogenous gene; and using the principle of homologous recombination, left and right homologous arms (LA, RA) with the same nucleic acid sequence on both sides of 3'UTR of double-stranded cut site are designed at both ends of the exogenous gene, and a exogenous DNA fragment (i.e. multiple exogenous genes can be designed in one exogenous DNA fragment) is inserted into the double-stranded cut site, realizing the gene editing of 3'UTR site simultaneously knocking in the DNA fragment. Therefore, the upstream and downstream homologous nucleic acid sequences of the exogenous gene are the same as the upstream and downstream homologous nucleic acid sequences of the corresponding homologous mediated repair template; in this way, the homologous mediated repair template can realize the tandem insertion of the exogenous gene.
[0086] As shown in FIG. 4, a double-stranded cut insertion of one exogenous gene IL-15-GFP: IFN-γ upstream homologous sequence (LA), exogenous DNA fragment (IL-15-GFP) and IFN-γ downstream homologous sequence (RA);
[0087] As shown in FIG. 5, a cut is inserted into multiple exogenous genes IL-15-GFP and CAR: IFN-g upstream homologous sequences (LA), exogenous DNA fragments (IL-15-GFP, CAR), and IFN-g downstream homologous sequences (RA).
[0088] In each of the following embodiments, the design structure of the upstream and downstream homologous nucleic acid sequences of the exogenous gene is also the same.
[0089] In the above homology-mediated repair template, the upstream homologous nucleic acid sequence (LA) and the downstream homologous nucleic acid sequence (RA) of the adjacent homologous recombination repair are connected to each other in the mode of “-LA-A1-RA-” or “-LA-A1-A2-RA” and constructed on the same vector; wherein A1 and A2 respectively represent two exogenous genes; “-LA-A1-RA-” and “-LA-A1-A2-RA-” respectively represent two homologous recombination repair templates; in the homologous recombination repair template “-LA-A1-RA-”, one exogenous DNA fragment is designed with one exogenous gene A1; in the homologous recombination repair template “-LA-A1-A2-RA-”, one exogenous DNA fragment is designed with two exogenous genes A1 and A2; for example, A1 can include one exogenous gene CAR or IL-15, or the two exogenous genes can be IL-15 and CAR, etc. That is, one exogenous DNA fragment can be designed with one exogenous gene expression frame, or can be designed with multiple exogenous gene expression frames; however, one homologous recombination repair template can only correspond to one DNA fragment, and one DNA fragment can only be inserted into one double-stranded DNA cut.
[0090] In order to facilitate observation, tracking, and verification of the knock-in rate of the cytokine, a fluorescent protein GFP gene (also one of the exogenous genes) can be inserted after the exogenous gene, such as IL-15-GFP, IL-18-GFP, etc., multiple genes are designed into one DNA fragment, and then directly connected with CAR and inserted into the 3'UTR site cut on IFN-g.
[0091] In the present application, the homology-mediated repair template is delivered into the 3'UTR site cut on IFN-g by using AAV and LNP vector-mediated delivery of one or more exogenous genes through respectively constructing into adeno-associated virus, plasmid, PCR amplicon, or ssDNA vector, and then using DNA fragment delivery by electroporation, virus, or LNP cell method. Embodiment of the present application
[0092] The technical solutions of the present application are further described in detail below by taking T cells as an example.
[0093] I. Gene expression on IFN-g-3'UTR site
[0094] Example 1
[0095] The purpose of this example is to verify the efficiency of inserting a single exogenous gene at the 3'UTR cleavage site by different gRNA nucleic acid sequences.
[0096] 1.1, T cell acquisition and activation
[0097] Mononuclear cells were isolated from donor peripheral blood using ficol separation technology, density gradient centrifugation was performed, and T cells were enriched using a T cell sorting kit (CD3 MicroBeads, human-lyophilized, 130-097-043). The culture and expansion of T cells were activated using magnetic beads coupled with anti-CD3 / anti-CD28. X-VIVO medium was used as the culture medium, containing 10% FBS and 300 IU / ml rh-IL2. All T cells were cultured in a 37°C, 5% CO2 incubator. Activated T cells were obtained and ready for use.
[0098] 1.2, Design of gRNA nucleic acid sequence and GFP structure
[0099] 1.2.1, Design of gRNA nucleic acid sequence corresponding to IFN-γ
[0100] Four groups of T cells were prepared. For each group of T cells, four corresponding gRNA1, gRNA2, gRNA3, and gRNA4 nucleic acid sequences were designed for the 3'UTR site of the IFN-γ gene, as shown in SEQ ID NO. 1-4 above.
[0101] 1.2.2, Design of exogenous GFP vector structure
[0102] As shown in Figure 6, the exogenous GFP structure is initiated by the endogenous IFN-γ gene promoter and inserted at the 3'UTR site. Therefore, an IRES regulatory element is added in front of GFP. Using the principle of homologous recombination, left and right homologous arms (LA, RA) are designed at both ends of the GFP gene fragment, respectively, to obtain an exogenous DNA fragment structure containing the GFP gene, i.e., a GFP homology-mediated repair template. The nucleic acid sequences of the four IFN-γ-3'UTR-gRNA(1-4) nucleic acid sequences corresponding to the designed homology-mediated repair template (LA, RA) are shown in SEQ ID NO. 21-28 above.
[0103] 1.3, Making double-stranded cuts and inserting exogenous GFP gene
[0104] First, the IFN-γ-3'UTR site on the four groups of T cells was subjected to electroporation, as follows:
[0105] 4 groups of T cells, preheat DPBS in 37 ℃ incubator, mix with 4 groups of T cell complete culture medium respectively, then remove magnetic beads from each group of activated T cell suspension;
[0106] After removing the magnetic beads, count each group of cells, centrifuge at 500g for 5 min, discard the supernatant, resuspend each group of T cell precipitate with 1 mL of 2% FBS+DPBS washing solution, obtain cell suspension, and place each group of cell resuspension in a 37 ℃ incubator for standby;
[0107] After incubating the RNP system at room temperature for 15 min, remove each group of T cells from the 37 ℃ incubator and transfer them to a centrifuge tube, centrifuge at 100g for 10 min; after centrifugation, discard the supernatant, and add Lonza electroporation buffer to each group of cell precipitate according to 2×10 6 cells / 20 μL; wherein the components of Lonza electroporation buffer (Supplement 1: P3 cell line solution = 1:4.5) are shown in Table 1.
[0108] Table 1 Components of Lonza electroporation buffer
[0109] Mix 4 groups of 20 μL cells with 4 groups of incubated RNP systems to obtain 4 groups of cell RNP mixtures, then transfer the 4 groups of cell RNP mixtures to 4 groups of 16-hole electroporation holes, and perform electroporation. After electroporation, immediately add 80 μL of preheated DPBS to each electroporation hole, and transfer the 16-hole electroporation plate to a 37 ℃ incubator for incubation for 15 min; achieve IFNγ-3'UTR site knockout and exogenous GFP gene insertion on 4 groups of T cells; wherein the components of the RNP electroporation system are prepared as shown in Table 2; the reagent "IFN-γ-3'UTR-gRNA" in Table 2 is a general term, which can represent IFN-γ-3'UTR-gRNA1, or IFN-γ-3'UTR-gRNA2, or IFN-γ-3'UTR-gRNA3, or IFN-γ-3'UTR-gRNA4, respectively corresponding to Example 1.2.1; therefore, Table 2 actually corresponds to 4 groups of RNP electroporation system components.
[0110] Table 2 Components of RNP electroporation system
[0111] After electroporation, add X-VIVO complete culture medium to the 4 groups of electroporation systems, and place the 4 groups of T cells in a 37 ℃, 5% CO2 constant temperature incubator for overnight culture, i.e. complete insertion of the 4 segments of exogenous GFP fragments into the IFN-γ-3'UTR site of the 4 groups of T cells, and obtain 4 groups of engineering modified T cells, as shown in Table 3.
[0112] The gene expression in T cells (knockout rate and knock-in rate) was verified by flow cytometry, and the results are shown in Table 3.
[0113] Table 3 Gene expression in engineered T cells
[0114] As can be seen from Table 3, by designing 4 groups of gRNA (1-4) nucleic acid sequences corresponding to the 3'UTR of IFN-γ to make double-stranded cuts and using the corresponding homologous recombination templates, the exogenous GFP gene fragment was inserted into the corresponding 3'UTR cut site by electroporation using a plasmid vector, and the exogenous GFP gene fragment could be normally expressed.
[0115] Example 2
[0116] The purpose of this example is to verify the efficiency of different vectors carrying exogenous gene fragments and transduction methods.
[0117] 2.1, T cell acquisition and activation
[0118] The content of step 1.1 in Example 1 is the same.
[0119] 2.2, Design of gRNA nucleic acid sequence and GFP structure
[0120] 2.2.1, Design of gRNA nucleic acid sequence
[0121] Prepare 7 groups of T cells, and design 7 groups of corresponding IFN-γ-3'UTR-gRNA3 nucleic acid sequences according to the 3'UTR site of the IFNγ gene of each group of T cells, as shown in SEQ ID NO. 3.
[0122] 2.2.2, Design of GFP vector structure
[0123] As shown in Figures 6 and 7, since the exogenous inserted GFP structure is started by the promoter of the endogenous IFN-γ gene and inserted at the 3'UTR site, an IRES regulatory element is added in front of the GFP; using the principle of homologous recombination, left and right homologous arms (LA, RA) are designed at both ends of the GFP gene fragment, respectively, to obtain 7 groups of exogenous DNA fragments containing the GFP gene structure, i.e. GFP homologous mediated repair templates. The nucleic acid sequences of the 7 groups of IFN-γ-3'UTR-gRNA3 corresponding homologous mediated repair templates (LA, RA) are SEQ ID NO. 25 and SEQ ID NO. 26, respectively.
[0124] 2.3, Making double-stranded cuts and inserting exogenous GFP gene
[0125] According to different carriers and delivery methods, the insertion of exogenous GFP gene can adopt the following two forms.
[0126] 2.3.1 AAV vector, viral delivery of exogenous gene
[0127] Electrotransformation was performed on the IFN-γ-3'UTR site on the 1st group of T cells, and the implementation was as follows:
[0128] The activated T cell suspension was subjected to magnetic bead removal operation after mixing DPBS preheated in the 37°C incubator with the complete culture medium of the 1st group of T cells.
[0129] After magnetic bead removal, the cells were counted, centrifuged at 500g for 5 min, and the supernatant was discarded. The T cell pellet was resuspended in 1 mL of 2% FBS+DPBS wash solution, and the cell suspension was placed in a 37°C incubator for standby.
[0130] After incubating the RNP system at room temperature for 15 min, the T cells removed from the magnetic beads were transferred from the 37°C incubator to a centrifuge tube and centrifuged at 100g for 10 min. After centrifugation, the supernatant was discarded, and 2×10 6 cells / 20μL of Lonza electrotransformation buffer was added to the cell pellet. The components of the Lonza electrotransformation buffer are shown in Table 1.
[0131] The 1st group of 20μL cells was mixed with the incubated RNP system to obtain the 1st group of cell RNP mixture, and the cell RNP mixture was transferred to the 1st group of 16-hole electrotransformation holes for electrotransformation operation. After electrotransformation, 80μL of preheated DPBS was immediately added to each electrotransformation hole, and the 16-hole electrotransformation plate was transferred to a 37°C incubator for incubation for 15 min. The IFN-γ-3'UTR site knockout and insertion of the exogenous GFP gene on the T cells were achieved (as shown in Table 6). The components of the RNP electrotransformation system are shown in Table 4.
[0132] Table 4 Components of RNP electrotransformation system
[0133] The 1st group of T cells was placed in a 37°C, 5% CO2 constant temperature incubator for overnight culture by adding X-VIVO complete medium to the electrotransformation system. The insertion of the exogenous gene GFP fragment into the IFN-γ-3'UTR site in the T cells was completed, and the engineering modified T cells were obtained, as shown in Table 6.
[0134] 2.3.2 Plasmid, PCR amplicon, ssDNA vector mediated insertion of exogenous gene
[0135] 6 groups of T cells, preheat DPBS in 37 ℃ incubator, mix with 6 groups of T cell complete culture medium respectively, then remove magnetic beads from each group of activated T cell suspension;
[0136] After removing magnetic beads, count each group of cells, centrifuge at 500g for 5 min, then discard the supernatant, resuspend each group of T cell precipitate with 1 mL of 2% FBS+DPBS washing solution, and place each group of cell suspension in a 37 ℃ incubator for standby;
[0137] After incubating the RNP system at room temperature for 15 min, remove the magnetic bead-removed 6 groups of T cells from the 37 ℃ incubator and transfer them to centrifuge tubes, centrifuge at 100g for 10 min; after centrifugation, discard the supernatant, and add Lonza electroporation buffer to each group of cell precipitate at 2×10 6 The components of Lonza electroporation buffer are shown in Table 1.
[0138] Mix 6 groups of 20 μL cells with the incubated RNP system to obtain 6 groups of cell RNP mixtures, then transfer each group of cell RNP mixture to 6 groups of 16-hole electroporation holes for electroporation. After electroporation, immediately add 80 μL of preheated DPBS to each electroporation hole, and transfer the 16-hole electroporation plate to a 37 ℃ incubator for incubation for 15 min; achieve IFN-γ-3'UTR site knockout and exogenous GFP gene insertion on 6 groups of T cells (as shown in Table 6); wherein the components of the RNP electroporation system are prepared as shown in Table 5. Table 5 shows the components of the RNP electroporation system: ①, PGA, IFN-γ-gRNA3, plasmid and TrueCut Cas9, a total of 2 groups; ②, PGA, IFN-γ-gRNA3, PCR amplicon and TrueCut Cas9, a total of 2 groups; ③, PGA, IFN-γ-gRNA3, ssDNA and TrueCut Cas9, a total of 2 groups.
[0139] Table 5 Components of RNP electroporation system
[0140] Through electroporation or LNP, 2 groups of plasmids, PCR amplicons, ssDNA vectors, etc. are introduced into 6 groups of cells, respectively, to achieve exogenous GFP gene insertion into specific sites by homologous recombination, as shown in Table 4, 2 groups of plasmids, PCR amplicons, ssDNA, respectively, then place the 6 groups of gene edited T cells in a 37 ℃, 5% CO2 constant temperature incubator for overnight culture, finally achieve the insertion of exogenous gene GFP fragment into the IFN-γ-3'UTR site in T cells by electroporation or LNP method, and obtain the engineered modified T cells, as shown in Table 6.
[0141] The gene expression in T cells (knockout rate and knock-in rate) was verified by flow cytometry, and the results are shown in Table 6.
[0142] Table 6 Gene expression in engineered T cells
[0143] As can be seen from Table 6, the exogenous GFP gene fragment can be inserted into the IFN-γ-3'UTR site cut by different vectors (such as AAV, plasmid, PCR amplicon, ssDNA vector) and different delivery methods, and the GFP gene can be normally expressed after the exogenous gene is inserted.
[0144] Example 3
[0145] The purpose of this example is to verify the expression effect of each of the IFN-γ-3'UTR site and the other sites of IFN-γ after inserting an exogenous single gene respectively.
[0146] 3.1, T cell acquisition and activation
[0147] The content of step 1.1 in Example 1 is the same.
[0148] 3.2, Design of nucleic acid sequence of gRNA and GFP structure
[0149] 3.2.1, Design of nucleic acid sequence of gRNA
[0150] Two groups of T cells were taken, and the nucleic acid sequences of the corresponding gRNAs were designed on the 5'UTR to 3'UTR site and the 3'UTR site of the IFN-γ gene of the T cells respectively; wherein the nucleic acid sequence of gRNA2 corresponding to the 3'UTR site of the IFN-γ gene is SEQ ID NO. 2, and the nucleic acid sequence of gRNA corresponding to the 5'UTR to 3'UTR site of the IFN-γ gene is shown in SEQ ID NO. 5: i.e. gRNA5: TTTCAGCTCTGCATCGTTTTGGG.
[0151] 3.2.2, Design of GFP vector structure
[0152] As shown in FIG. 8, because the exogenous inserted GFP structure is started by the promoter of the endogenous IFN-γ gene, and is inserted at the 5'UTR to 3'UTR site and the 3'UTR site, respectively, T2A and / or IRES regulatory elements are added in front of GFP for different regions; using the principle of homologous recombination, the same left and right homologous arms (LA, RA) are designed at both ends of the GFP gene fragment, respectively, to obtain the exogenous DNA fragment structure containing the GFP gene, i.e. the GFP homologous mediated repair template; the nucleic acid sequence of the IFN-γ-3'UTR-gRNA2 corresponding homologous mediated repair template (LA, RA) is as shown in SEQ ID NO. 23 and SEQ ID NO. 24; the nucleic acid sequence of the IFN-γ-5'~3'UTR-gRNA corresponding designed homologous mediated repair template (LA, RA) is as shown in SEQ ID NO. 29 and 30, respectively, wherein:
[0153] SEQ ID NO. 29:
[0154] SEQ ID NO. 30:
[0155] 3.3, making double-stranded nicks and inserting exogenous GFP gene
[0156] 2 groups of T cells were subjected to electroporation at the 5'UTR to 3'UTR site and the 3'UTR site of the IFNγ gene, respectively, as follows:
[0157] 2 groups of T cells were preheated with a mixture of DPBS and T cell complete medium at 37°C, and the activated T cell suspension of each group was subjected to magnetic bead removal;
[0158] After magnetic bead removal, each group of cells was counted, centrifuged at 500g for 5 min, and the supernatant was discarded. Each group of T cell pellets was resuspended with 1 mL of 2% FBS+DPBS wash solution, and each group of cell resuspension was placed in a 37°C incubator for standby;
[0159] After incubating the RNP system at room temperature for 15 min, each group of T cells was removed from the 37°C incubator and transferred to a centrifuge tube, centrifuged at 100g for 10 min; after centrifugation, the supernatant was discarded, and 2x10 6 cells / 20μL of Lonza electroporation buffer was added to each group of cell pellets; wherein the components of the Lonza electroporation buffer are shown in Table 1;
[0160] Prepare two groups of RNP systems as shown in Table 7, mix 20 μL of cells with the incubated RNP system respectively, and obtain cell RNP mixtures respectively, then transfer the two groups of cell RNP mixtures to two groups of 16-hole electroporation holes respectively, and perform the electroporation operation. After each electroporation, immediately add 80 μL of preheated DPBS to each electroporation hole, and incubate in a 37°C incubator for 15 min; and achieve 5'UTR to 3'UTR site knockout and exogenous GFP gene insertion on the IFN-γ gene of the two groups of T cells respectively.
[0161] Table 7 RNP electroporation system component table
[0162] In Table 7, the preparation of two groups of RNP electroporation system components is given: ① group: PGA, IFN-γ-gRNA2-5' ~ 3'UTR, AAV and TrueCut Cas9; ② group: PGA, IFN-γ-gRNA2-3'UTR, AAV and TrueCut Cas9.
[0163] After the electroporation is completed, add X-VIVO complete medium to the two groups of electroporation systems, and place the two groups of T cells in a 37°C, 5% CO2 constant temperature incubator for overnight culture, that is, the GFP gene fragment is inserted into the 5'UTR to 3'UTR site and the 3'UTR site on the IFN-γ gene of the two groups of T cells respectively, and the corresponding engineering modified T cells are obtained respectively, as shown in Table 8.
[0164] The gene expression (knockout rate and knock-in rate) in the T cells is verified by flow cytometry, and the results are shown in Table 8.
[0165] Table 8 Gene expression in engineering modified T cells
[0166] As can be seen from Table 8, the knockout of different sites (such as 5'UTR to 3'UTR site and 3'UTR site) can respectively make 5'UTR to 3'UTR site and 3'UTR site corresponding DNA cut; at the same time, after the exogenous GFP gene fragment is inserted into the corresponding DNA cut site, the exogenous GPF gene and the IFN-γ gene can be normally expressed, and the knockout rate and expression rate of the 3'UTR site are better than those of the 5'UTR to 3'UTR site.
[0167] Example 4
[0168] The purpose of this example is to verify whether each single gene is expressed after the IFN-γ-3'UTR site is inserted into different types of multiple exogenous single genes.
[0169] 4.1, T cell acquisition and activation
[0170] The same as the content of step 1.1 in Example 1.
[0171] 4.2, design of nucleic acid sequence of gRNA and exogenous gene structure
[0172] 4.2.1, design of nucleic acid sequence of gRNA
[0173] According to the 3'UTR site on the IFN-γ gene of T cells, the nucleic acid sequence of the corresponding gRNA3 is designed as SEQ ID NO. 3.
[0174] 4.2.2, design of exogenous gene structure
[0175] As shown in Figure 9, since the structure of the exogenous inserted gene (such as CAR, GFP, IL-15 or anti-PD1) is started by the promoter of the endogenous IFN-γ gene and inserted at the 3'UTR site; therefore, T2A and / or IRES regulatory elements are added in front of GFP for different regions; using the principle of homologous recombination, left and right homologous arms (LA, RA) are designed at both ends of the DNA fragment containing multiple gene fragments of GFP / IL-15 / CAR / anti-PD1, which are the same as the corresponding site, to obtain the DNA fragment structure containing multiple exogenous genes (such as GFP / IL-15 / CAR / anti-PD1 gene), i.e. the exogenous gene homologous mediated repair template, the nucleic acid sequence of the IFN-γ-3'UTR-gRNA3 corresponding homologous mediated repair template (LA, RA) is shown in SEQ ID NO. 25 and SEQ ID NO. 26.
[0176] 4.3, making double-strand cut and inserting exogenous gene
[0177] To be electrotransformed at the IFN-γ-3'UTR site on the T cells in group 1, respectively, as follows:
[0178] After preheating DPBS and T cell complete culture medium in a 37℃ incubator, the activated T cell suspension is subjected to magnetic bead removal operation;
[0179] After magnetic bead removal, the cells are counted, centrifuged at 500g for 5min, and the supernatant is discarded, and the T cell precipitate is resuspended with 1mL of 2% FBS+DPBS washing solution, and the cell resuspension is placed in a 37℃ incubator for standby;
[0180] After incubating the RNP system at room temperature for 15min, the T cells removed from the magnetic beads are taken out from the 37℃ incubator and transferred to a centrifuge tube, centrifuged at 100g for 10min; after centrifugation, the supernatant is discarded, and 2×10 6 cells / 20μL of electrotransformation buffer; wherein the composition of Lonza electrotransformation buffer is shown in Table 1;
[0181] Mix 20 μL of cells with the incubated RNP system to obtain a cell RNP mixture, and then transfer the cell RNP mixture to a 16-well electroporation hole for electroporation. After electroporation, immediately add 80 μL of preheated DPBS to each electroporation hole, and then transfer the 16-well electroporation plate to a 37°C incubator for incubation for 15 min; achieve the IFNγ-3'UTR site knockout and the insertion of the exogenous gene (GFP / IL-15 / CAR / anti-PD1) on the T cells; wherein the RNP electroporation system component is prepared as shown in Table 4.
[0182] After the end of electroporation, add X-VIVO complete medium to the electroporation system, and then place the T cells in a 37°C, 5% CO2 constant temperature incubator for overnight culture, that is, complete the insertion of the DNA fragment containing the GFP, IL-15, CAR and anti-PD1 genes into the 3'UTR site cut on the IFN-γ gene of the T cells, and obtain the corresponding engineering modified T cells, as shown in Table 9.
[0183] Verify the gene expression (knockout rate and knock-in rate) in the T cells by flow cytometry detection, and the results are shown in Table 9.
[0184] Table 9 Gene expression in engineering modified T cells
[0185] As can be seen from Table 9, after the DNA fragment containing multiple exogenous genes (such as the GFP gene, the CAR gene, the IL-15 gene and the anti-PD1) is inserted into the 3'UTR site cut, each exogenous single gene (such as GFP, IL-15, CAR and anti-PD1) and the IFN-γ gene can be normally expressed.
[0186] Example 5
[0187] The purpose of the present application is to verify whether the IFN-γ-3'UTR site is expressed after being inserted into different exogenous DNA fragments.
[0188] 5.1, T cell acquisition and activation
[0189] The technical content is consistent with the first step in Example 1.
[0190] 5.2, design of nucleic acid sequence of gRNA and structure of exogenous gene
[0191] 5.2.1, design of nucleic acid sequence of gRNA
[0192] Prepare 7 groups of T cells, and design 7 groups of corresponding nucleic acid sequences of gRNA3 according to the 3'UTR site on the IFN-γ gene of the T cells, as shown in SEQ ID NO. 3.
[0193] 5.2.2, design of exogenous gene structure
[0194] As shown in FIG. 8, since the structure of the exogenous inserted gene (such as GFP gene, YFP gene, BFP gene, Nectin4-CAR gene, CLDN18.2-CAR gene, anti-PD1 antibody protein, anti-CTLA4, IL-7 gene, IL-10 gene, IL-12 gene and IL-18 gene) is started by the promoter of the endogenous IFN-γ gene and inserted at the 3'UTR site; therefore, T2A and / or IRES regulatory elements are added in front of the exogenous gene for different regions; using the principle of homologous recombination, the same left and right homologous arms (LA, RA) are designed at both ends of the exogenous fragment, respectively, to obtain 7 groups of exogenous gene structures, i.e. exogenous gene homologous mediated repair templates. The nucleic acid sequences of the 7 groups of IFN-γ-3'UTR-gRNA3 corresponding homologous mediated repair templates (LA, RA) are shown in SEQ ID NO. 25 and SEQ ID NO. 26.
[0195] 5.3, making double-strand nicks and inserting exogenous genes
[0196] To perform electroporation on the IFN-γ-3'UTR site on the 7 groups of T cells, respectively, as follows:
[0197] After preheating DPBS and complete medium for each group of T cells in a 37°C incubator, the activated T cell suspension of each group was subjected to magnetic bead removal operation;
[0198] After magnetic bead removal, each group of cells was counted, centrifuged at 500g for 5 min, and the supernatant was discarded. The T cell pellet was resuspended with 1 mL of 2% FBS+DPBS wash solution. The resuspension of each group of cells was placed in a 37°C incubator for standby;
[0199] After incubating the RNP system at room temperature for 15 min, each group of T cells after magnetic bead removal was taken out from the 37°C incubator and transferred to a centrifuge tube, centrifuged at 100g for 10 min; after centrifugation, the supernatant was discarded, and 2x10 6 cells / 20μL of electroporation buffer were added to each group of cell pellets; wherein the components of Lonza electroporation buffer are shown in Table 1;
[0200] Seven groups of 20 μL of cells were mixed with seven groups of incubated RNP systems to obtain seven groups of cell-RNP mixtures. These mixtures were then transferred to seven groups of 16-well electroporation wells for electroporation. Immediately after electroporation, 80 μL of preheated DPBS was added to each well, and the plates were transferred to a 37°C incubator and incubated for 15 minutes. IFNγ-3'UTR site knockout and exogenous gene insertion were achieved in seven groups of T cells (as shown in Table 10). The composition of the RNP electroporation system is shown in Table 4.
[0201] After electroporation, X-VIVO complete medium was added to the 7 groups of electroporation systems, and the 7 groups of T cells were placed in a 37°C, 5% CO2 constant temperature incubator for overnight culture. This completed the insertion of the 7 exogenous DNA fragments into the 3'UTR site of the IFN-γ gene in the T cells, and the corresponding engineered T cells were obtained, as shown in Table 10.
[0202] The gene expression (knockout rate and knock-in rate) in T cells was verified by flow cytometry, and the results are shown in Table 10.
[0203] Table 10 Gene expression in engineered T cells
[0204] As can be seen from Table 10, after multiple DNA fragments composed of different exogenous genes were inserted into the 3'UTR site of the IFN-γ gene, the IFN-γ gene and each exogenous gene could be expressed normally, and the expression effects were not much different.
[0205] 2. Functional Verification of Gene-Edited T Cells
[0206] Example
[0207] The third and fourth groups of gene-edited T cells were prepared using Example 5. For example, in CAR-T cells, the function of the exogenous gene inserted into the IFN-γ-3'UTR site of the edited cells was verified; wherein, in this example, the third group of CAR-T cells prepared in Example 5 was labeled and numbered 3#, corresponding to the IFN-γ-gRNA4 nucleic acid sequence, corresponding to CAR-T cells, referred to as 3-CAR-T cells; the fourth group of CAR-T cells prepared in Example 5 was labeled and numbered 4#, corresponding to CAR-T cells, referred to as 4-CAR-T cells, corresponding to the IFN-γ-gRNA3 nucleic acid sequence.
[0208] 6.1. Detection of knockout and knockin rates in CAR-T cells
[0209] After knocking out the IFN-γ gene on the CAR-T cells, sequencing was performed, and the sequencing results are shown in FIG9 .
[0210] From the gene sequencing results shown in FIG. 9, in the above-mentioned No. 3# and No. 4#, the IFN-γ gene knockout efficiency of each IFN-γ-gRNA nucleotide sequence on T cells is 99.72% and 97.84% respectively, indicating that the gene knockout efficiency is relatively high.
[0211] After knocking in the exogenous gene corresponding to the nucleotide sequence of No. 3# and No. 4# respectively into the IFN-γ gene knocked out in the human immune T cells, the exogenous gene knocked into the 3# T cells is CAR and IL-15, and the exogenous gene knocked into the 4# T cells is CAR and IL-21. The test results of the exogenous gene knockout efficiency are shown in FIG. 10. FIG. 10 shows that the exogenous gene knockout rates of 3-CAR-T cells for CAR and IL-15 corresponding genes are 52.82% and 53.13% respectively, and the exogenous gene knockout rates of 4-CAR-T cells for CAR and IL-21 corresponding genes are 51.60% and 65.21% respectively. That is, the T cells can knock in the exogenous gene and the exogenous gene can be normally expressed after being knocked in.
[0212] 6.2, Growth and expansion test of CAR-T cells after inserting exogenous genes
[0213] The 3-CAR-T and 4-CAR-T cells were transferred to a 24-well plate and cultured in a 37°C, 5% CO2 constant temperature incubator for standby.
[0214] Five kinds of T cells, including NT cells (blank control sample), Nectin4-CAR-T and CLDN18.2-CAR-T cells (positive control cells), 3-CAR-T and 4-CAR-T cells, were cultured respectively, and the cell number was detected by sampling at 5th, 7th, 9th, 11th and 13th day respectively. The CAR positive rate, the expression of exogenous gene and the expression of inserted endogenous gene of T cells were also detected by sampling. During the T cell culture process, the culture medium was supplemented and subcultured every 1-2 days. This part is prior art and will not be described here.
[0215] The growth and expansion detection results of the five kinds of T cells are shown in FIG. 11. As shown in FIG. 11, the expansion of NT cells (blank control sample), Nectin4-CAR-T and CLDN18.2-CAR-T cells has little difference, while the expansion of 3-CAR-T and 4-CAR-T cells will be affected to a certain extent after being electroporated, but the overall expansion of the cells can meet the subsequent experimental requirements.
[0216] 6.3, Detection of CAR positive rate of T cells
[0217] The positive rate, the expression of exogenous gene and the expression of inserted endogenous gene of the five kinds of T cells are shown in FIG. 12, 13 and Table 11.
[0218] Table 11 Exogenous gene expression of cells
[0219] As can be seen from Figures 12, 13 and Table 11, the CAR positive rate detection results of NT cells (blank control), Nectin4-CAR-T and CLDN18.2-CAR-T cells, 3-CAR-T and 4-CAR-T cells are 61.48%, 51.6%, 44.41% and 47.23%, respectively; therefore, the expression of the CAR gene knocked in by electroporation is lower than that of normal CAR-T cells, but its function will not be lost due to the expression of electroporation. The detection results of Nectin4-CAR-T and CLDN18.2-CAR-T cells are both 0 because no exogenous cytokine is inserted; while the detection results of 3-CAR-T and 4-CAR-T cells are 58.1 and 59.2%, respectively, because IL-15 and IL-21 are inserted, respectively. In addition, the endogenous gene expression rates of the 5 groups of cells are all close to 100%, indicating that editing at the 3'UTR site on the IFN-γ gene does not affect the normal expression of IFN-γ.
[0220] 6.4, Detection of tumor killing rate of CAR-T cells
[0221] The specific tumor killing rate of 5 T cells in the effector-target ratio (E:T = 1:1) is shown in Figures 14 and 15. As can be seen from Figures 14 and 15, the 3-CAR-T and 4-CAR-T cells after gene editing are significantly better than the NT cells, Nectin4-CAR-T and CLDN18.2-CAR-T cells that have not been edited in terms of killing efficiency or tumor killing rate. The reason is that the exogenous GFP gene knocked in at the 3'UTR site of the IFN-γ gene of immune cells is induced to express after being stimulated by the target antigen, which has a positive effect on CAR-T cells, so the killing efficiency is better than that of T cells without gene editing.
[0222] Three, functional verification of exogenous genes on different immune cells
[0223] Examples
[0224] 7.1, Detection of knockout rate and knockin rate in each immune cell
[0225] In this example, the third group of gene edited cells prepared in Example 5 are taken as an example, identified as 3#, corresponding to the IFN-γ-gRNA3 nucleic acid sequence. The gene edited cells are immune cells, such as T cells, NK cells, CIK cells, DC cells, macrophages (M); wherein the corresponding CAR- immune cells are simply referred to as 3-CAR-T, 3-CAR-NK, 3-CAR-CIK, 3-CAR-DC, 3-CAR-M, respectively.
[0226] The IFN-γ gene knockout of T cells, NK cells, CIK cells, DC cells, and macrophages was sequenced, and the sequencing results are shown in Table 12.
[0227] Table 12 Detection results of IFN-γ gene knockout rate of immune cells
[0228] From the gene sequencing results shown in Table 12, it can be seen that the IFN-γ-gRNA3 corresponding to the nucleotide sequence in the above numbered 3# has a knockout efficiency of 95%, 92%, 94%, 91%, and 92% for the IFN-γ gene of T cells, NK cells, CIK cells, DC cells, and macrophages, respectively. The gene knockout efficiency is relatively high.
[0229] After knocking out the IFN-γ gene in human immune T cells, NK cells, CIK cells, DC cells, and macrophages, the exogenous DNA gene fragment (such as Nectin4-CAR and IL-15) corresponding to the nucleotide sequence shown in numbered 3# was knocked in, and the exogenous gene knock-in efficiency of the nucleotide sequence was shown in Table 13.
[0230] Table 13 Detection results of exogenous gene knock-in rate of IFN-γ in immune cells
[0231] As shown in Table 13, after knocking out the IFN-γ gene in human immune T cells, NK cells, CIK cells, DC cells, and macrophages, and then knocking in two exogenous genes such as Nectin4-CAR and IL-15, the knock-in rate is relatively high, up to 70%.
[0232] 7.2. Growth and expansion detection of each immune cell
[0233] The CAR corresponding T cells, NK cells, CIK cells, DC cells, and macrophages obtained in the above numbered 3# are respectively referred to as 3-CAR-T, 3-CAR-NK, 3-CAR-CIK, 3-CAR-DC, and 3-CAR-M cells.
[0234] The 3-CAR-T, 3-CAR-NK, 3-CAR-CIK, 3-CAR-DC, and 3-CAR-M cells were transferred to a 24-well plate and cultured in a 37°C, 5% CO2 constant temperature incubator for standby.
[0235] The NT cells, NK cells, CIK cells, DC cells, macrophages (blank control), 3-CAR-T, 3-CAR-NK, 3-CAR-CIK, 3-CAR-DC and 3-CAR-M cells, etc. were respectively cultured, and the cell number was detected on the 5th, 7th, 9th, 11th and 13th day, and the CAR positive rate, the expression of exogenous genes and the expression of inserted endogenous genes were respectively detected. During the cell culture process, the culture medium was supplemented and subcultured every 1-2 days. This part is prior art and will not be described here.
[0236] The expansion detection results of cell growth are shown in FIG. 16. As shown in FIG. 16, the T cells, NK cells, CIK cells, DC cells and macrophages (blank control) proliferate relatively quickly, and the 3-CAR-T, 3-CAR-NK, 3-CAR-CIK, 3-CAR-DC and 3-CAR-M cells have a certain influence on cell expansion after electroporation, but the overall expansion of cells can meet the subsequent experimental requirements.
[0237] 7.3, CAR positive rate detection of each immune cell
[0238] The positive rate of cells, the expression of exogenous genes and the expression of inserted endogenous genes are shown in Table 14.
[0239] Table 14 Expression of exogenous genes of cells
[0240] As shown in Table 14, the CAR positive rate, the expression of exogenous genes and the expression of inserted endogenous genes of T cells, NK cells, CIK cells, DC cells, macrophages (blank control), 3-CAR-T, 3-CAR-NK, 3-CAR-CIK, 3-CAR-DC and 3-CAR-M cells are shown in Table 14.
[0241] The specific tumor killing rate of each cell in the effector target ratio (E:T=1:1) is shown in FIGS. 17-21. The 3-CAR-T, 3-CAR-NK, 3-CAR-CIK, 3-CAR-DC and 3-CAR-M after gene editing are obviously better than the NT / NK / CIK / DC / macrophages (M) without gene editing in killing efficiency or tumor killing rate. It is proved that the gene editing technology in the patent can be applied to various immune cells. Industrial applicability
[0242] When the engineered immune cells containing the exogenous gene bind to the target cells, in addition to the killing effect of the immune cells themselves and the normal secretion of cytokines, the IFN-gamma gene is activated, thereby simultaneously expressing IFN-gamma and the exogenous gene, because the exogenous gene and IFN-gamma share the same IFN-gamma promoter, and there is an IRES between the IFN-gamma gene and the exogenous gene; therefore, the induced expression system is safe and reliable, not only can enhance the killing effect of the immune cells when encountering target cells; but also can timely close the expression of the exogenous cytokine gene in the absence of target cell stimulation, thereby improving the safety of the application of the engineered immune cells; the application can be used for the modification of immune cells (such as T cells, NK cells and other any cells expressing IFN-gamma), especially the improvement of the anti-tumor performance of chimeric antigen receptor cells.
Claims
1. An IFN-γ gene fragment, characterized in that, The IFN-γ gene fragment is knocked in with an exogenous gene.
2. The IFN-γ gene fragment according to claim 1, characterized in that, The site of the exogenous gene knocked in the IFN-γ gene fragment is the 3'UTR site region.
3. The IFN-γ gene fragment according to claim 1, characterized in that, The exogenous gene is knocked in the IFN-γ gene fragment by CRISPR / Cas gene editing technology.
4. The IFN-γ gene fragment according to claim 1, characterized in that, The exogenous gene is knocked in the IFN-γ gene fragment by homologous recombination.
5. The IFN-γ gene fragment according to claim 1, wherein The exogenous gene comprises one or more of CAR, cytokine and functional protein.
6. The IFN-γ gene fragment according to claim 5, characterized in that, The cytokine comprises one or more of IL-7 gene, IL-10 gene, IL-12 gene, IL-15 gene, IL-18 gene and IL-21 gene.
7. The IFN-γ gene fragment according to claim 4, characterized in that, The functional protein comprises fluorescent protein and / or antibody.
8. The IFN-γ gene fragment according to claim 7, characterized in that, The fluorescent protein comprises one or more of GFP, RFP, BFP and YFP gene; the antibody comprises one or more of anti-PD1, anti-CTLA4, anti-TIGIT, anti-TIM3 and anti-LAG3.
9. The IFN-γ gene fragment of claim 1, wherein, The exogenous gene comprises a start sequence internal ribosome entry site or a self-cleavage polypeptide sequence.
10. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the IFN-γ gene fragment of any one of claims 1 to 9.
11. An expression cassette comprising, The expression cassette comprises the IFN-γ gene fragment of any one of claims 1 to 9, or the nucleic acid molecule of claim 10.
12. A recombinant vector, characterized in that, The recombinant vector comprises the IFN-γ gene fragment of any one of claims 1 to 10, or the nucleic acid molecule of claim 11; or the expression cassette of claim 12.
13. A recombinant cell line, characterized in that, The recombinant cell line comprises the IFN-γ gene fragment of any one of claims 1 to 10, or the nucleic acid molecule of claim 11; or the expression cassette of claim 12, or the recombinant vector of claim 13.
14. A host cell, characterized in that, The host cell comprises the IFN-γ gene fragment of any one of claims 1 to 10, or the nucleic acid molecule of claim 11; or the expression cassette of claim 12, or the recombinant vector of claim 13.
15. A biological agent, characterized in that, The biological agent comprises the IFN-γ gene fragment of any one of claims 1 to 10, or the nucleic acid molecule of claim 11; or the expression cassette of claim 12, or the recombinant vector of claim 13, the recombinant cell line of claim 14, or the host cell of claim 15.
16. The biological preparation of claim 15, wherein the biological preparation is a vaccine. The biological agent is a reagent for detecting the concentration of human Claudin18.2 protein, or a reagent for detecting the expression degree of human Claudin18.2 protein on the surface of tumor cells, or a reagent for antibody-mediated complement-dependent or cell-dependent cytotoxic reaction on human Claudin18.2 positive cells.
17. The biological preparation according to claim 15 or 16, characterized in that, The biological agent is used for preparing a medicament for treating or preventing tumors and cancers.
Citation Information
Patent Citations
General CAR-T cell and preparation method and application thereof
CN109777782A
Engineered immune cell with adjustable target gene as well as preparation method and application of engineered immune cell
CN114574446A
Genetically modified immune cell and application thereof
CN116478932A
Genetic engineering of endogenous proteins
US20210207174A1
Efficient TCR gene editing in t lymphocytes
WO2022204443A1