Non-destructive plasmid delivery to immune cells

Abstract

Provided is a lipid mix composition for forming lipid nanoparticles (LNP) in association with a DNA, for use in transfecting a cell of hematopoietic lineage, the lipid mix composition comprising an ionizable lipid, a phospholipid, a stabilizer, and cholesterol. The LNP, a method of modifying cells of hematopoietic lineage using the LNP, a cell of hematopoietic lineage modified by the method, and a method of treatment for immune deficiency, cancer, autoimmune disease or genetic insufficiency are also provided.

Description

P2023-3389-WO NON-DESTRUCTIVE PLASMID DELIVERY TO IMMUNE CELLS CROSS REFERENCE TO RELATED APPLICATION

[0001] This patent application claims the benefit of U.S. Provisional Patent Application No. 63 / 635,274, filed April 17, 2024, which is incorporated by reference in its entirety herein. FIELD

[0002] The disclosure generally relates to methods and compositions suitable for delivering DNA and plasmids to immune cells. BACKGROUND

[0003] Cell therapy reagents based on nucleic acid-containing lipid nanoparticles offer advantages over electroporation in oncological treatments in terms of safety and efficacy. Primary human T cells are notoriously difficult to transfect without impairing their survival, even with lipid nanoparticles as carriers. While mRNA need only be present in the cytoplasm, DNA including plasmid or circular DNA needs to cross the nuclear membrane to function. This distinction makes DNA transfection using lipid nanoparticles (LNPs) particularly challenging, especially in human primary cells, which are known to be sensitive to foreign DNA.

[0004] In many instances, proteins such as DNases present in the cytoplasm, actively degrade any foreign DNA. However, this degradation process doesn’t apply to mRNA since it is not perceived as mislocated in the context of cellular homeostasis. This difference in cellular response underscores the importance of considering the unique characteristics of mRNA and DNA when developing transfection strategies for various cell types using LNPs, unlike electroporation.

[0005] Cell therapy involves removing a sample of blood from a patient or a healthy volunteer, isolating or enriching desired target cells, transforming or modifying these target cells, and then returning the modified cells back into the body of the donor patient or another patient. The goal of cell therapy is to replace diseased or damaged genetics or augment natural immunity with additional expressed proteins.

[0006] Currently, electroporation is considered the most feasible way to genetically modify T cells. This process physically disrupts the cell membrane to force genetic material into cells, and 1P2023-3389-WO results in some T cells being “irreversibly electroporated” or killed. There is also some risk to the genetic materials being damaged before or during transfer. In addition, electroporated cells can take a long time to proliferate and a recent study showed that the viability of T cells after electroporation was only 37%.

[0007] Viral based T cell transfection is labor intensive, expensive and poses manufacturing and regulatory challenges. Also, virus manufacturing methods are expensive because they are highly regulated, need a lot of equipment, and are labor intensive (one batch for each patient). Viral based transfection also poses the risk that viral genome may randomly insert into the human genome and requires that the patient leave the hospital to have T cells harvested and treated at a specialized viral manufacturing facility. Recently FDA has given out a guidance that cell therapy treated patients are to be monitored for several years following chimeric antigen receptor (CAR)T or TCR therapy due to possible risk of gene integration caused by the viral means of manipulation of cells.

[0008] Examples of cell products available commercially for immune-oncology applications are KymriahTMfor B cell precursor acute lymphoblastic leukemia and YescartaTMfor use in B cell lymphoma. This ex vivo therapy is also called CAR-T therapy wherein modified T cells with CD19-targeted chimeric antigen receptor attacks the CD19-presenting cancer cells of the patient. Leukemia is the leading cause of mortality in pediatric patients. Use of CAR-T therapy was transformative to the patient’s cancer free recovery.

[0009] Lipid nanoparticles (LNPs) generally consist of different lipids, each serving distinct functions. These LNPs can have a lipidic or aqueous core and may contain bilayer structures depending on the abundance or structure of each type of lipids used.

[0010] Recognized challenges to creating successful LNP cell therapy are safety, manufacturability, stability, and efficacy. A better cell therapy delivery agent with both high efficiency and high live cell yield is still required. Furthermore, there remains an urgent need for DNA delivery in human primary T cells using gentle non-viral systems for wider genomic medicine access to contain costs and increase safety. BRIEF SUMMARY

[0011] In accordance with embodiments, the invention provides methods of, and compositions for, transfecting cells of hematopoietic lineage, such as an immune cell, with DNA encapsulated in an LNP. 2P2023-3389-WO

[0012] In embodiments, the methods and compositions provide for successful transfer and expression of a protein of interest encoded by a nucleic acid of interest in plasmid DNA (pDNA) into an immune cell. In embodiments, the methods and compositions provide an improved safety profile by eliminating antibiotic resistant genes that are a part of traditional pDNA.

[0013] In embodiments, the DNA is linear DNA such as single stranded DNA or double stranded DNA, or pDNA such as minicircles, plasmids, self-replicating human episomal plasmids using plasmid as backbone (synthetic), and inducible plasmids to control the gene expression conditions.

[0014] In embodiments, the LNP is formulated in a lipid composition for cell therapy. In embodiments, the LNP encapsulates a nucleic acid of interest, e.g., a gene of interest, encoding a protein of interest. In embodiments, the LNP encapsulates a gene editing element, such as guide and CRISPR elements. In embodiments, the invention comprises compositions comprising a first population of LNPs encapsulating DNA encoding a protein of interest and a second population of LNPs encapsulating a gene editing element, or combinations thereof.

[0015] In embodiments, for ex vivo applications, the compositions are administered to biological samples that have been removed from the organism, then those samples treated, washed and restored to the organism. The organism may be a mammal, and in particular may be human. This process is used for cell reprogramming, genetic restoration, or immunotherapy, for example. The biological samples may include immune cells. In embodiments, the drug product is the modified cell.

[0016] In embodiments, the present invention provides a method of modifying human T cells with chimeric antigen receptor (CAR) encoded mRNA to produce CAR-T cell product to be infused back into the patient, without any viral means of delivery of nucleic acid. Non-viral delivery can be a safer technology for modulating the T cell than a virus for programming the cells.

[0017] In embodiments, the present invention provides a method of modulating the T cell receptors to recognize and destroy neoantigens or tumor antigens present on the surface of the tumor cells of the patient, or to modulate T cell populations to treat cancer. T cells may also be modified in other embodiments to ameliorate autoimmune disorders such as celiac disease, Lupus, and diabetes. 3P2023-3389-WO

[0018] In accordance with one aspect, the present invention provides a lipid nanoparticle (LNP) for transfecting a cell of hematopoietic lineage, the LNP includes a lipid mix composition encapsulating a DNA, the lipid mix composition comprising an ionizable lipid, a phospholipid, a stabilizer, and cholesterol.

[0019] In embodiments, the ionizable lipid includes a cyclopentyl or a tetrahydrofuranyl head group.

[0020] In embodiments, the ionizable lipid comprises PNI 516, PNI 550, PNI 580, PNI 659, PNI 714, PNI 726, PNI 728, PNI 761, PNI 762, PNI 768, PNI 769, PNI 771, or a combination thereof.

[0021] In embodiments, the DNA is in the form of a linear DNA, a closed DNA, or a circular DNA.

[0022] In embodiments, the DNA comprises an UTR is downstream or upstream of a gene of interest. In embodiments, the UTR is one or more of a s / MAR, a MAR and a NF sequence element.

[0023] In embodiments, the DNA is under 5,000 BP in length.

[0024] In embodiments, the DNA is between 2,500 to 4,500 BP in length.

[0025] In embodiments, the DNA further comprises a gene editing element. In embodiments, the gene editing element is a PiggyBac transposon element. In embodiments, the PiggyBac based transposon element comprises an oligonucleotide sequence about 80%, about 85%, about 90%, about 95%, about 98%, or about 100% identical to the oligonucleotide sequence set forth in SEQ ID NO: 17 or SEQ ID NO: 18.

[0026] In embodiments, the lipid nanoparticle further includes an RNA. In embodiments, the RNA is mRNA.

[0027] In embodiments, the DNA does not include an antibiotic resistance gene.

[0028] In embodiments, the cell is a T cell or HSC.

[0029] In embodiments, the phospholipid comprises distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoyl- phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE) and dioleoyl-phosphatidylethanolamine 4- (N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl- 4P2023-3389-WO phosphatidylethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1- stearoyl-2-oleoyl-phosphatidyethanol amine (SOPE), 1,2-dielaidoyl-sn-glycero-3- phophoethanolamine (trans DOPE), 1-stearoyl-2-oleoyl-sn-glycero-3-phosphocholine (SOPC), or any combinations thereof.

[0030] In embodiments, the stabilizer comprises polyoxyethylene (10) stearyl ether (BrijS10), tocopherol polyethelyne glycol succinate (TPGS), PEG-DMG, dodecyl maltoside, sucrose monolaurate, or any combinations thereof.

[0031] In embodiments, the lipid mix composition comprises about 35 - 50 Mol% ionizable lipid, about 10 - 30 Mol% structural lipid, about 15 - 50 Mol% sterol, and about 0.5 - 3 Mol% stabilizer, wherein the total mol% of components in the lipid mix composition is 100 mol%.

[0032] In embodiments, the lipid mix composition comprises about 40 Mol% ionizable lipid, about 20 Mol% distearoylphosphatidylcholine (DSPC), about 37.5 Mol% cholesterol, and about 2.5 Mol% polyoxyethylene (10) stearyl ether (BrijS10).

[0033] In embodiments, the lipid mix composition comprises about 40 Mol% ionizable lipid, about 20 Mol% distearoylphosphatidylcholine (DSPC), about 39 Mol% cholesterol, and about 0.75 Mol% Tocopherol polyethylene glycol 1000 succinate (TPGS).

[0034] In accordance with another aspect, the present invention provides a lipid mix composition for forming lipid particles in association with a DNA, for use in transfecting a cell of hematopoietic lineage, the lipid mix composition comprising an ionizable lipid, a phospholipid, a stabilizer, and cholesterol.

[0035] In embodiments, the ionizable lipid includes a cyclopentyl or a tetrahydrofuranyl head group.

[0036] In embodiments, the ionizable lipid comprises PNI 516, PNI 550, PNI 580, PNI 659, PNI 714, PNI 726, PNI 728, PNI 761, PNI 762, PNI 768, PNI 769, PNI 771, or a combination thereof.

[0037] In embodiments, the stabilizer comprises polyoxyethylene (10) stearyl ether (BrijS10), tocopherol polyethelyne glycol succinate (TPGS), PEG-DMG, dodecyl maltoside, sucrose monolaurate, or any combinations thereof.

[0038] In embodiments, the lipid mix composition comprises about 35 - 50 Mol% ionizable lipid, about 10 - 30 Mol% structural lipid, about 15 - 50 Mol% sterol, and about 0.5 - 3 Mol% stabilizer, wherein the total mol% of components in the lipid mix composition is 100 mol%. 5P2023-3389-WO

[0039] In embodiments, the DNA further comprises a gene editing element. In embodiments, the gene editing element comprises a PiggyBac transposon element. In embodiments, the PiggyBac based transposon element comprises an oligonucleotide sequence about 80%, about 85%, about 90%, about 95%, about 98%, or about 100% identical to the oligonucleotide sequence set forth in SEQ ID NO: 17 or SEQ ID NO: 18.

[0040] In embodiments, the lipid nanoparticle further including an RNA. In embodiments, the RNA is mRNA.

[0041] In accordance with another aspect, the present invention provides a method of modifying a cell of hematopoietic lineage, the method comprising contacting the cell of hematopoietic lineage with the lipid nanoparticle of any of preceding embodiments.

[0042] In embodiments of the method, a coding region is expressed in the cell and progeny of the cell at least 10 days after contacting the cell with the LNP. In embodiments, the coding region expresses an RNA. In embodiments, the RNA is tRNA, rRNA, IncRNA, mRNA, saRNA, sgRNA, guide RNA, trcRNA, PiWiRNA, snRNA, snoRNA, crRNA, or combinations thereof.

[0043] In embodiments, wherein before contacting, the cell has an unmodified genome.

[0044] In embodiments, before contacting, the cell has a modified genome.

[0045] In embodiments, after contacting, the cell contains extrachromosomal DNA.

[0046] In embodiments, after contacting, the cell contains exogenous DNA integrated into a chromosomal loci of the cell.

[0047] In accordance with yet another aspect, the present invention provides a modified cell of hematopoietic lineage modified by the method of preceding embodiments.

[0048] In accordance with still another aspect, the present invention provides a method of treatment for immune deficiency, cancer, autoimmune disease or genetic insufficiency, the method comprising administering to a subject in need thereof an effective amount of a composition comprising the modified cell of preceding embodiments.

[0049] Other aspects and features of the present invention will become apparent to those ordinarily skilled in the art upon review of the following description of specific embodiments of the invention in conjunction with the accompanying figures. 6P2023-3389-WO BRIEF DESCRIPTION OF THE DRAWINGS

[0050] FIGS.1A-1B are bar graphs showing the size (FIG. 1A) and encapsulation efficiency (FIG. 1B) of NP-1, NP-2, NP-3 and NP-4.

[0051] FIG.2A is a line graph showing the viability of T cells treated with 250 ng of NP-1, NP-2, NP-3, and NP-4. FIG. 2B is a line graph showing the viability of T cells treated with 500 ng of NP-1, NP-2, NP-3, and NP-4.

[0052] FIG.3A is a line graph showing the percent expression of GFP in T cells treated with 250 ng of NP-1, NP-2, NP-3, and NP-4, normalized to untreated cells. FIG.3B is a line graph showing the percent expression of GFP in T cells treated with 500 ng of NP-1, NP-2, NP-3, and NP-4, normalized to untreated cells.

[0053] FIG.4A is a line graph showing the mean fluorescence intensity (MFI) in T cells treated with 250 ng of NP-1, NP-2, NP-3, and NP-4, normalized to untreated cells. FIG.4B is a line graph showing the MFI in T cells treated with 500 ng of NP-1, NP-2, NP-3, and NP-4, normalized to untreated cells.

[0054] FIG.5A shows size and PDI of various NP constructs. FIG.5B shows encapsulation efficiency of the same set of NP constructs. Key parameters measured in this evaluation further include, FIG.5C % viability, FIG.5D % GFP positive cells, FIG. 5E MFI, FIG.5F shows %GFP in PNI 762 -LNP_1 composition screen using donor T cells purchased from Stem Cell Tec Technology. FIG.5G PNI 762-LNP_1 composition screen using the same donor T cells used in FIG.5F . FIG.5H shows transfection efficiency (% TE) at 24, 48 and 72 hours post transfection in LNP_2, LNP_3, LNP_4, LNP_5. FIG. 5I shows MFI for the same compositions of FIG.5H at 24, 48 and 72 hours post transfection. FIGS. 5J and 5K show transfection efficiency (% eGFP) and MFI of the protein expression respectively for PNI 659- LNP_1 encapsulating NP-1 or eGFP mRNA for T-cell DNA delivery. FIGS.6A and 6B show %viability for primary T cells post treatment for two different primary T cell donors.

[0055] FIGS.7A and 7B show percent GFP integration for Day 1 and Day 2 primary T cells post treatment for the same donor primary T cells used in FIGS.6A (from Donor 1) and 6B (from Donor 2), respectively.

[0056] FIGS.8A and 8B show the MFI for the same cells used in FIGS.6A-6B with Donor - 1 primary T cells (FIG.8A) and Donor -2 primary T cells (FIG.8B). 7P2023-3389-WO

[0057] FIGS.9A – 9H show MFI and % GFP expression assessed on days 2, 3, 5, 7, and 10 post LNP treatment with PNI 550 as ionizable lipid. FIGS.9A, 9C, 9E, and 9G show % GFP expression with PNI-V_PNI22, PNI-IV_PNI22, PNI-V_PNI23, or PNI-IV_PNI23 as payloads, respectively. FIGS.9B, 9D, 9F, and 9H show corresponding MFI.

[0058] FIGS.10A –10H show MFI and % GFP expression assessed on days 2, 3, 5, 7, and 10 post LNP treatment with PNI 565 as ionizable lipid. FIGS.10A, 10C, 10E, and 10G show % GFP expression with PNI-V_PNI22, PNI-IV_PNI22, PNI-V_PNI23, or PNI-IV_PNI23 as payloads, respectively. FIGS. 10B, 10D, 10F, and 10H show corresponding MFI.

[0059] FIGS.11A – 11H show MFI and % GFP expression assessed on days 2, 3, 5, 7, and 10 post LNP treatment with PNI 728 as ionizable lipid. FIGS.11A, 11C, 11E, and 11G show % GFP expression with PNI-V_PNI22, PNI-IV_PNI22, PNI-V_PNI23, or PNI-IV_PNI23 as payloads, respectively. FIGS. 11B, 11D, 11F, and 11H show corresponding MFI.

[0060] FIGS.12A – 12H show MFI and % GFP expression assessed on days 2, 3, 5, 7, and 10 post LNP treatment with PNI 761 as ionizable lipid. FIGS.12A, 12C, 12E, and 12G show % GFP expression with PNI-V_PNI22, PNI-IV_PNI22, PNI-V_PNI23, or PNI-IV_PNI23 as payloads, respectively. FIGS. 12B, 12D, 12F, and 12H show corresponding MFI.

[0061] FIGS.13A – 13J show MFI and % GFP expression assessed on days 2, 3, 5, 7, and 10 post LNP treatment with PNI 762 as ionizable lipid. FIGS.13A,13C, 13E, 13G and 13I show % GFP expression with GFP-encoding mRNA, PNI-V_PNI22, PNI-IV_PNI22, PNI-V_PNI23, or PNI-IV_PNI23 as payloads, respectively. FIGS.13B, 13D, 13F, 13H and 13J show corresponding MFI. These figures demonstrate that the LNPs of the instant disclosure enable sustained gene expression compared to mRNA (FIG.13A) by delivering the DNA transposons as payloads.

[0062] FIGS.14A – 14H show MFI and % GFP expression assessed on days 2, 3, 5, 7, and 10 post LNP treatment with PNI 769 as ionizable lipid. FIGS.14A, 14C, 14E, and 14G show % GFP expression with PNI-V_PNI22, PNI-IV_PNI22, PNI-V_PNI23, or PNI-IV_PNI23 as payloads, respectively. FIGS. 14B, 14D, 14F, and 14H show corresponding MFI.

[0063] FIGS.15A and 15B show effects of s / MAR, MAR and NF Sequence positioning on protein expression levels (% TE, FIG.15A and MFI, FIG. 15B).

[0064] FIGS.16A-16E show the effects of PNI 768 and PNI 762 LNP_1 and LNP_6 combinations of ionizable lipids and lipid mix compositions on the delivery to human primary T 8P2023-3389-WO cells of CAR pDNA delivery along with CAR mRNA. Data was measured at 24 hrs post T cell transfection.

[0065] FIGS.17A-17E show the effects of PNI 768 and PNI 762 LNP_1 and LNP_6 combinations of ionizable lipids and lipid mix compositions on the delivery to human primary T cells of CAR pDNA delivery along with CAR mRNA. Data was measured at 48 hrs post T cell transfection.

[0066] FIG. 18A shows specific lysis of leukemic B cell line by CD19 CAR T cells generated using mRNA or transposon LNP. Target cells (SUP-B15, CD19+; K562, CD19-) were co-cultured with CD19 CAR T cells at specified Effector:Target ratios.

[0067] FIG.18B shows specific lysis of leukemic B cell line by transposon CD19 CAR T cells 2 or 7 days following LNP addition. Target cells (SUP-B15, CD19+; K562, CD19-) were co-cultured with CD19 CAR T cells at specified Effector:Target ratios. DETAILED DESCRIPTION

[0068] In accordance with an embodiment of the invention, there are provided methods for transforming cells of hematopoietic lineage with DNA without disruptive physical methods such as electroporation. The lipid mix composition described in the disclosure, the lipid nanoparticle including the same, and method for preparation and delivery of DNA to cells in a manner that establishes stable genetic integration, or expression, or both, while preserving the viability and survival of the cells.

[0069] In another aspect, the invention provides lipid mix formulations including ionizable lipid, one or more phospholipid(s), and stabilizing agent.

[0070] In another aspect, the lipid mix formulations according to the invention are provided for modifying a cell ex vivo as cell therapy products, where the modified cell is the drug product.

[0071] In another aspect, the invention provides lipid mix formulations for formulating DNA-containing LNP.

[0072] In embodiments, the invention provides a composition for transfecting a cell of hematopoietic lineage comprising a lipid nanoparticle (LNP) encapsulating DNA. In embodiments, the cell is a T cell.

[0073] In embodiments, the LNP comprises an ionizable lipid, a phospholipid and a stabilizing agent. In embodiments, the ionizable lipid includes a cyclopentyl headgroup or a 9P2023-3389-WO tetrahydrofuranyl headgroup. In embodiments, the LNP comprises an ionizable lipid including PNI 516, PNI 550, PNI 580, PNI 659, PNI 714, PNI 726, PNI 728, PNI 761, PNI 768, PNI 762, PNI 769, PNI 771, or a combination thereof.

[0074] In embodiments, the DNA is in the form of a plasmid, a linear DNA or a circular DNA. In embodiments, the DNA is under 5,000 base pairs (BP). In embodiments, the DNA is over 5,000 BP in length. In embodiments, the DNA is between 2,500 to 4,500 BP in length.

[0075] In embodiments, the DNA is from about 30 to 529, 530 to 1029, 1030 to 1529, 1530 to 2029, 2030 to 2529, 2530 to 3029, 3030 to 3529, 3530 to 4029, 4030 to 4529, or 4530 to 5000 base pairs (BP) in length.

[0076] In other embodiments, the DNA is from about 5500 to 6000, 6000 to 6500, 6500 to 7000, 7000 to 7500, 7500 to 8000, 8000 to 8500, or 8500 to 9000 BP in length. In other embodiments, the DNA is from about 9000 to 10,000, 10,000 to 11,000, 11,000 to 12,000, 12,000 to 13,000, 13,000 to 14,000, 14,000 to 15,000, 15,000 to 16,000, 16,000 to 17,000, 17,000 to 18,000, 18,000 to 19,000, or 19,000 to 20,000 BP in length.

[0077] In embodiments, the DNA comprises an integrating protein encoding nucleic acid of interest. In embodiments, the DNA comprises a gene editing element encoding sequence. In embodiments, the gene editing element is a PiggyBac or CRISPR Cas system element. In embodiments, the DNA does not include an antibiotic resistance gene. In embodiments, the invention provides a composition comprising a combination of the LNP compositions as described herein.

[0078] In embodiments, the invention provides a method of modifying a cell of hematopoietic lineage comprising contacting a cell of hematopoietic lineage with the compositions as described herein. In embodiments, the integrating protein encoding nucleic acid of interest is expressed in the cell and progeny of the cell up to 10 days after contacting the cell with the LNP. In embodiments, before contacting, the cell is unmodified. In embodiments, before contacting, the cell has a modified genome, for example in an ex vivo cell therapy multiple step procedure in which a cell population undergoes multiple modifications. In embodiments, after contacting, the cell contains exogenous chromosomal material. In embodiments, after contacting, the cell contains integrated exogenous chromosomal material.

[0079] In embodiments, the invention provides a modified cell of hematopoietic lineage comprising a cell of hematopoietic lineage modified by the methods described herein. In 10P2023-3389-WO embodiments, the invention provides a method of treatment comprising administering to a subject in need thereof an effective amount of a composition of the modified cells described herein.

[0080] Various further aspects and embodiments of the disclosure are provided by the following description. Before further describing various embodiments of the presently disclosed inventive concepts in more detail by way of exemplary description, examples, and results, it is to be understood that the presently disclosed inventive concepts are not limited in application to the details of methods and compositions as set forth in the following description. The presently disclosed inventive concepts are capable of other embodiments or of being practiced or carried out in various ways. As such, the language used herein is intended to be given the broadest possible scope and meaning; and the embodiments are meant to be exemplary, not exhaustive. Also, it is to be understood that the phraseology and terminology employed herein is for the purpose of description and should not be regarded as limiting unless otherwise indicated as so. Moreover, in the following detailed description, numerous specific details are set forth in order to provide a more thorough understanding of the disclosure. However, it will be apparent to a person having ordinary skill in the art that the presently disclosed inventive concepts may be practiced without these specific details. In other instances, features which are well known to persons of ordinary skill in the art have not been described in detail to avoid unnecessary complication of the description. All of the compositions and methods of production and application and use thereof disclosed herein can be made and executed without undue experimentation in light of the present disclosure.

[0081] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

[0082] Unless defined otherwise, all technical and scientific terms and any acronyms used herein have the same meanings as commonly understood by one of ordinary skill in the art in the field of the invention. Although any methods and materials similar or equivalent to those described herein can be used in the practice of the present invention, the exemplary methods, devices, and materials are described herein. Any reference to standard methods refers to the most recent available version of the method at the time of filing of this disclosure unless otherwise indicated. 11P2023-3389-WO

[0083] The practice of the present invention may employ conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are within the skill of the art. Such techniques are explained fully in the literature and more current editions thereof, such as Molecular Cloning: A Laboratory Manual, second edition (Sambrook et al, 1989) Cold Spring Harbor Press; Oligonucleotide Synthesis (MJ. Gait, ed., 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (J .E. Cellis, ed., 1998) Academic Press; Animal Cell Culture (R.I. Freshney, ed., 1987); Introduction to Cell and Tissue Culture (J.P. Mather and P.E. Roberts, 1998) Plenum Press; Cell and Tissue Culture: Laboratory Procedures (A. Doyle, J.B. Griffiths, and D.G. Newell, eds., 1993- 1998) J. Wiley and Sons; Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (D .M. Weir and CC. Blackwell, eds.); Gene Transfer Vectors for Mammalian Cells (J.M. Miller and M.P. Calos, eds., 1987); Current Protocols in Molecular Biology (F .M. Ausubel et al , eds., 1987); PCR: The Polymerase Chain Reaction, (Mullis et al, eds., 1994); Current Protocols in Immunology (J.E. Coligan et al, eds., 1991); Short Protocols in Molecular Biology (Wiley and Sons, 1999); Immunobiology (CA. Janeway and P. Travers, 1997); and Cancer: Principles and Practice of Oncology (V. T. DeVita et al, eds., J.B. Lippincott Company, 1993). Although any methods and materials similar or equivalent to those described herein can be used in the practice of the present invention, the exemplary methods, devices, and materials are described herein.

[0084] To facilitate an understanding of the present disclosure, a number of terms and phrases are defined below. Additional definitions are set forth throughout this disclosure.

[0085] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the methods described herein belong. Any reference to standard methods refers to the most recent available version of the method at the time of filing of this disclosure unless otherwise indicated.

[0086] For any method disclosed herein that includes discrete steps, the steps may be conducted in any feasible order. And, as appropriate, any combination of two or more steps may be conducted simultaneously.

[0087] All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified. 12P2023-3389-WO

[0088] The words “preferred” and “preferably” refer to embodiments of the invention that may afford certain benefits, under certain circumstances. However, other embodiments may also be preferred, under the same or other circumstances. Furthermore, the recitation of one or more preferred embodiments does not imply that other embodiments are not useful and is not intended to exclude other embodiments from the scope of the invention.

[0089] The singular form “a”, “an” and “the” include plural referents unless the context clearly dictates otherwise. These articles refer to one or to more than one (i.e., to at least one). Thus, for example, reference to a composition containing “a compound” includes a mixture of two or more compounds. The use of the term “at least one” followed by a list of one or more items (for example, “at least one of A and B”) is to be construed to mean one item selected from the listed items (A or B) or any combination of two or more of the listed items (A and B), unless otherwise indicated herein or clearly contradicted by context. As used herein, the term “or” is generally employed in its usual sense including “and / or” unless the content clearly dictates otherwise. The term “and / or” means any one or more of the items in the list joined by “and / or”. As an example, “x and / or y” means any element of the three-element set {(x), (y), (x, y)}. In other words, “x and / or y” means “one or both of x and y”. As another example, “x, y, and / or z” means any element of the seven-element set {(x), (y), (z), (x, y), (x, z), (y, z), (x, y, z)}. In other words, “x, y and / or z” means “one or more of x, y and z”.

[0090] Where ranges are given, endpoints include all numbers subsumed within that range (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.). Furthermore, unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of the disclosure, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise. Herein, “up to” a number (for example, up to 50) includes the number (for example, 50). The term “in the range” or “within a range” (and similar statements) includes the endpoints of the stated range.

[0091] Reference throughout this specification to “one aspect (or embodiment),” “an aspect (or embodiment),” “certain aspects (or embodiments),” or “some aspects (or embodiments),” etc., means that a particular feature, configuration, composition, or characteristic described in connection with the aspect is included in at least one aspect of the disclosure. Thus, the appearances of such phrases in various places throughout this specification are not necessarily 13P2023-3389-WO referring to the same embodiment of the disclosure. Furthermore, the particular features, configurations, compositions, or characteristics may be combined in any suitable manner in one or more aspects.

[0092] Unless otherwise indicated, all numbers expressing quantities of components, molecular weights, and so forth used in the specification and claims are to be understood as being modified in all instances by the term “about. ” As used herein in connection with a measured quantity, the term “about” refers to that variation in the measured quantity as would be expected by the skilled artisan making the measurement and exercising a level of care commensurate with the objective of the measurement and the precision of the measuring equipment used. The term “about” as used in connection with a numerical value throughout the specification and the claims denotes an interval of accuracy, familiar and acceptable to a person skilled in the art. In general, such interval of accuracy is + / -12.5%. Thus, “about” can be understood to be within 12.5%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1 %, 0.5%, 0.1 %, 0.05%, 0.01 %, or 0.001 % greater or less than the stated value. Accordingly, unless otherwise indicated to the contrary, the numerical parameters set forth in the specification and claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0093] Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. All numerical values, however, inherently contain a range necessarily resulting from the standard deviation found in their respective testing measurements.

[0094] The term “exemplary” means serving as a non-limiting example, instance, or illustration. As utilized herein, the terms “e.g., ” and “for example” set off lists of one or more non-limiting aspects, examples, instances, or illustrations.

[0095] As used herein, the term “substantially” is defined as being 5% plus or minus the recited number. It is used to signify that the desired target concentration might be, for example, 40 Mol%, but that through mixing inconsistencies, the actual percentage might differ by + / - 5 Mol%. 14P2023-3389-WO

[0096] The term “administering” as used herein refers to the physical introduction of an agent to a subject, such as a lipid nanoparticle disclosed herein, using any of the various methods and delivery systems known to those skilled in the art. Exemplary routes of administration for the formulations disclosed herein include intravenous, intramuscular, subcutaneous, intraperitoneal, spinal, or other parenteral routes of administration, for example by injection or infusion. The phrase “parenteral administration” means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intralymphatic, intralesional, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion, as well as in vivo electroporation. In some embodiments, the formulation is administered via a non-parenteral route, e.g., orally. Other non-parenteral routes include a topical, epidermal or mucosal route of administration, for example, intranasally, vaginally, rectally, sublingually or topically. Administering can also be performed, for example, once, a plurality of times, and / or over one or more extended periods.

[0097] The term “cancer” refers to a broad group of various diseases characterized by the uncontrolled growth of abnormal cells in the body. Unregulated cell division and growth results in the formation of malignant tumors that invade neighboring tissues and may also metastasize to distant parts of the body through the lymphatic system or bloodstream. A “cancer” or “cancer tissue” can include a tumor.

[0098] The term “in vitro” refers to events occurring in an artificial environment, e.g., in a test tube, reaction vessel, cell culture, etc., rather than within a multi-cellular organism. The term “in vitro cell” refers to any cell which is cultured ex vivo. In particular, an in vitro cell can include a T cell. The term “in vivo” refers to events that occur within a multi-cellular organism, such as a human or a non-human animal.

[0099] The term “pharmaceutically acceptable” refers to a molecule or composition that, when administered to a recipient, is not deleterious to the recipient thereof, or that any deleterious effect is outweighed by a benefit to the recipient thereof. With respect to a carrier, diluent, or excipient used to formulate a composition as disclosed herein, a pharmaceutically acceptable carrier, diluent, or excipient must be compatible with the other ingredients of the composition and not deleterious to the recipient thereof, or any deleterious effect must be 15P2023-3389-WO outweighed by a benefit to the recipient. The term “pharmaceutically acceptable carrier” means a pharmaceutically- acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, involved in carrying or transporting an agent from one portion of the body to another (e.g., from one organ to another). Each carrier present in a pharmaceutical composition must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not deleterious to the patient, or any deleterious effect must be outweighed by a benefit to the recipient. Some examples of materials which may serve as pharmaceutically acceptable carriers comprise: sugars, such as lactose, glucose and sucrose; starches, such as com starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, com oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer’s solution; ethyl alcohol; pH buffered solutions; polyesters, polycarbonates and / or polyanhydrides; and other non- toxic compatible substances employed in pharmaceutical formulations.

[0100] “Treatment” or “treating” of a subject refers to any type of intervention or process performed on, or the administration of an active agent to, the subject with the objective of reversing, alleviating, ameliorating, inhibiting, slowing down or preventing the onset, progression, development, severity or recurrence of a symptom, complication or condition, or biochemical indicia associated with a disease. In one embodiment, “treatment” or “treating” includes a partial remission. In another embodiment, “treatment” or "treating” includes a complete remission. In some embodiments, treatment may be of a subject who does not exhibit signs of the relevant disease, disorder and / or condition and / or of a subject who exhibits only early signs of the disease, disorder, and / or condition. In some embodiments, such treatment may be of a subject who exhibits one or more established signs of the relevant disease, disorder and / or condition. In some embodiments, treatment may be of a subject who has been diagnosed as suffering from the relevant disease, disorder, and / or condition. In some embodiments, treatment may be of a subject known to have one or more susceptibility factors that are 16P2023-3389-WO statistically correlated with increased risk of development of the relevant disease, disorder, and / or condition.

[0101] A “disease”, as used herein, is a state of health of a subject wherein the subject cannot maintain homeostasis, and wherein if the disease is not ameliorated, the subject’s health continues to deteriorate. In contrast, a “disorder” is a state of health in which the subject is able to maintain homeostasis, but in which the subject's state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the subject's state of health. A disease or disorder is “alleviated” if the severity of a sign or symptom of the disease or disorder, the frequency with which such a sign or symptom is experienced by a subject, or both, is reduced.

[0102] As used herein, the terms “subject”, “individual”, and “patient” are interchangeable, and relate to vertebrates, preferably mammals. For example, mammals in the context of the disclosure are humans, non-human primates, domesticated animals such as dogs, cats, sheep, cattle, goats, pigs, horses, etc., laboratory animals such as mice, rats, rabbits, guinea pigs, etc., as well as animals in captivity such as animals in zoos. The term “animal” as used herein includes humans. The term “subject” may also include a patient, i.e., an animal, having a disease. In exemplary aspects, a subject, individual, or patient refers to a human (e.g., a man, a woman, or a child).

[0103] As used herein, the term “preventing a disease” in a subject means, for example, to stop the development of one or more clinical symptoms of a disease or disorder in a subject before they occur or are detectable. Preferably, the disease or disorder does not develop at all, i.e., no symptoms of the disease or disorder are detectable. In some aspects, it can also mean delaying or slowing of the development of one or more symptoms of the disease or disorder. Alternatively, or in addition, it can mean decreasing the severity of one or more subsequently developed symptoms.

[0104] In this disclosure, the word “comprising” is used in a non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. It will be understood that in embodiments which comprise or may comprise a specified feature or variable or parameter, alternative embodiments may consist, or consist essentially of such features, or variables or parameters. A reference to an element by the indefinite article “a” does 17P2023-3389-WO not exclude the possibility that more than one of the elements is present, unless the context clearly requires that there be one and only one of the elements.

[0105] In this disclosure, “transfection” means the transfer of nucleic acid into cells for the purpose of inducing the expression of a specific gene(s) of interest in both laboratory and clinical settings. It typically includes an ionizable lipid to associate with nucleic acid, and phospholipids. LIPOFECTIN™ and LIPOFECTAMINE™ are established commercial transfecting reagents sold by ThermoFisher Scientific. These research reagents contain permanently cationic lipid(s) and are not suitable for use in vivo or ex vivo.

[0106] In this disclosure “modified” or “genetically modified” or “transfected” are used interchangeably, wherein a cell has been manipulated by means of molecular reprogramming of a genomic sequence (e.g. by insertion, deletion, or substitution). Examples include disabling or "knocking out" a specific gene by introducing genetic modifications that prevent its function. Another example is by introducing extra copies of a specific gene or enhancing its promoter region, increasing the expression of that gene. CRISPR-Cas9 gene editing techniques enable precise modifications in the DNA sequence to introduce targeted changes, such as inserting, deleting, or modifying specific genes or genetic elements. Yet another example is transgene insertion, wherein cells can be genetically modified by introducing new genes or genetic elements from other organisms to confer specific traits or functions onto the cells, such as the production of therapeutic proteins or fluorescent markers. Another example is gene silencing, sometimes via RNA interference (RNAi), wherein specific genes are selectively silenced or "turned off". These examples have applications in various fields, including but not limited to, biomedical research, biotechnology, and medicine.

[0107] Further elaboration appears in discussion of nucleic acid therapeutic and gene of interest infra.

[0108] Said modified cells include the primary transformed cell and progeny derived therefrom without regard to the number of passages. Progeny may not be completely identical in nucleic acid content to a parent cell and may contain mutations. Mutant progeny that have the same function or biological activity as screened or selected in the originally transformed cell are included herein. 18P2023-3389-WO

[0109] “Lipid” refers to a structurally diverse group of organic compounds that are fatty acid derivatives or sterols or could be lipid like materials as in lipidoids (example C12-200) and are characterized by being insoluble in water but soluble in many organic solvents.

[0110] “Lipid mix compositions” refers to the components that can be used to prepare the lipid nanoparticles (LNPs) encapsulating a payload. Typically, lipid mix compositions for the manufacture of lipid nanoparticles for nucleic acid delivery comprise cationic or ionizable lipid and one or more of phospholipid, cholesterol, or a stabilizer. The stabilizer can include polyethylene glycol conjugated lipids. The lipid mix composition, as used in the instant disclosure, are free of the payload.

[0111] “Lipid mix formulations” refers to the types of components, ratios of components, and the ratio of the total components to the nucleic acid payloads (e.g., LNPs encapsulating a payload).

[0112] The lipid mix compositions, which can be used to mix with the DNA, comprise ionizable lipid as described, a neutral lipid or phospholipid or “structural” lipid which helps with the outer bilayer or monolayer of the LNP, optionally cholesterol and optionally a stabilizer as described above. In certain embodiments of the instant disclosure, for each application, certain ratios of these four components may be optimized. For vaccine application, a mole percent ratio of 50 mol% for ionizable lipid has been used successfully in clinical products. However, targeting gene delivery to cells while maintaining viability of the cells requires a different approach than that used for intramuscular injection and immediate release. In some embodiments illustrated below, lipid mix compositions comprise ionizable lipid (iL), cholesterol, structural lipid, and a stabilizer. In some embodiments, the stabilizer includes PEG DMG, TPGS, polyoxyethylene (40) stearate, polyoxyethylene (10) stearyl ether, polyoxyethylene (20) stearyl ether, Tridecyl-D-maltoside, Polysorbate 20, Polysorbate 80, or combinations thereof. Lipid mix compositions may optionally include tryglycerides in some embodiments.Non-limiting examples of lipid mix compositions (or referred to as “lipid compositions” or “lipid nanoparticle compositions” interchangeably in the instant disclosure) include those disclosed in PCT Publications 2020210901 and 2024006863, which are incorporated by reference herein in their entireties.

[0113] “Lipid Particles” or “Lipid Nanoparticles” or “LNP” refers to lipid particles manufactured from the lipid mix compositions described above and illustrated below. A 19P2023-3389-WO therapeutic agent such as a nucleic acid may be encapsulated in the lipid mix composition to provide a nucleic acid-containing lipid nanoparticle or nucleic acid lipid nanoparticle (“NALNP” or “LNP” as used interchangeably in the instant disclosure). The lipid particle represents the physical organization of the lipid mix composition with the therapeutic agent and among the components. In some embodiments, a lipid nanoparticle is a lipid particle under 300 nanometers (nm) in diameter. Lipid particles are generally spherical assemblies of lipids, nucleic acid, cholesterol, and stabilizing agents. Positive and negative charges, ratios, as well as hydrophilicity and hydrophobicity dictate the physical structure of the lipid particles in terms of size and orientation of components. The structural organization of these lipid particles may lead to an aqueous interior with one or more bilayers as in liposomes or it may have a solid interior as in a solid nucleic acid lipid nanoparticle. There may be phospholipid monolayers or bilayers in single or multiple forms. In certain embodiments, lipid particles are between 1 and 1000 nm in diameter.

[0114] “Viability” when referring to cells in vitro, means the ability to continue to grow, divide, and continue to grow and divide, as is normal for the cell type or tissue culture strain. Cell viability is affected by harsh conditions or treatments. Cell viability is important in ex vivo therapy or parenteral administration.

[0115] The compositions of the invention comprise ionizable lipids as a component. As used herein, the term “ionizable lipid” refers to a lipid that is cationic or becomes ionizable (protonated) as the pH is lowered below the pKa of the ionizable group of the lipid but is more neutral at higher pH values. At pH values below the pKa, the lipid is then able to associate with negatively charged nucleic acids (e.g., oligonucleotides). As used herein, the term “ionizable lipid” includes lipids that assume a positive charge on pH decrease from physiological pH, and any of a number of lipid species that carry a net positive charge at a selective pH. Non-limiting examples of suitable ionizable lipids are found in PCT Pub. Nos. WO20252589 and WO21000041, which are incorporated by reference herein in their entireties. The ionizable lipid may be present in the lipid nanoparticle composition in any suitable amount or concentration. In some embodiments, the ionizable lipid is present at a concentration of about 10 to about 90 mol% or about 20 to about 70 mol%, e.g., about 10 mol%, about 15 mol%, about 20 mol%, about 25 mol%, about 30 mol%, about 35 mol%, about 40 mol%, about 45 mol%, about 50 mol%, about 55 mol%, about 60 mol%, about 65 mol%, or about 70 mol%, about 75 mol%, 20P2023-3389-WO about 80 mol%, about 85 mol%, about 90 mol%, or a concentration within a range defined by any two of the foregoing values. In some embodiments, the ionizable lipid is present in lipid compositions preferably in a ratio of about 10 to about 60 Mol%, (“Mol%” means the percentage of the moles that is of a particular component while the total moles of all the components in the lipid compositions is 100 mol%). The term “about” in this paragraph signifies a plus or minus range of 5 Mol% at increments of 0.1. For example, 28.7 Mol %, 40 Mol %, 47.5 Mol%, 50 Mol % ionizable lipid would all be in the claimed range of embodiments. In some embodiments, the ionizable lipid is present at about 35 to 50 Mol% of the lipid mix composition. DODMA, or 1,2- dioleyloxy-3-dimethylaminopropane, is an alternative ionizable lipid, as is DLin-MC3-DMA or O-(Z,Z,Z,Z-heptatriaconta-6,9,26,29-tetraen-19-yl)-4-(N,N-dimethylamino) (“MC3”). LNP may be generated from the lipid mix compositions including the ionizable lipids of the invention. Ionizable lipids of the invention include PNI 516, PNI 550, PNI 580, PNI 659, PNI 714, PNI 728, PNI 761, PNI 762, PNI 768, PNI 769, or any combinations thereof, as described herein. Ionizable lipids of the invention include those containing a cyclopentyl or a tetrahydrofuranyl headgroup.

[0116] Phospholipids, as used herein, also known as “helper lipids,” “structural lipids,” or “neutral lipids” are incorporated into lipid mix compositions and lipid particles of the invention in embodiments. The structural lipid may be present in the lipid nanoparticle composition in any suitable amount. In some embodiments the structural lipid is present in the lipid nanoparticle composition at a concentration of about 1 to about 75 mol% or about 5 to about 60 mol%, e.g., about 1 mol%, about 5 mol%, about 10 mol%, about 15 mol%, about 20 mol%, about 25 mol%, about 30 mol%, about 35 mol%, about 40 mol%, about 45 mol%, about 50 mol%, about 55 mol%, about 60 mol%, about 65 mol%, or about 70 mol%, about 75 mol%, or a value within a range defined by any two of the aforementioned values. In embodiments, the lipid mix compositions and lipid particles of the invention include one or more phospholipids at about 10 to 60 Mol% of the lipid mix composition. In some embodiments, the one or more phospholipids is present at about 25 to 60 Mol% of the lipid mix formulation. In some embodiments, the one or more phospholipids is present at about 10 to 40 Mol% of the lipid mix formulation. Suitable phospholipids support the formation of particles during manufacture. Phospholipids refer to any one of several lipid species that exist in either in an anionic, uncharged, or neutral zwitterionic form at physiological pH. Representative phospholipids include diacylphosphatidylcholines, 21P2023-3389-WO diacylphosphatidylethanolamines, diacylphosphatidylglycerols, and although not strictly “phospholipids” in a technical sense, is intended to include sphingomyelins (SM), dihydrosphingomyelins, cephalins, and cerebrosides.

[0117] Exemplary phospholipids include zwitterionic lipids, for example, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE) and dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidylethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl-phosphatidyethanol amine (SOPE), 1,2-dielaidoyl-sn- glycero-3-phophoethanolamine (trans DOPE), 1-stearoyl-2-oleoyl-sn-glycero-3-phosphocholine (SOPC), or any combinations thereof. In one preferred embodiment, the phospholipid is distearoylphosphatidylcholine (DSPC). In preferred embodiments, the phospholipid is DOPE. In preferred embodiments, the phospholipid is DSPC.

[0118] In another embodiment, the phospholipid is any lipid that is negatively charged at physiological pH. These lipids include phosphatidylglycerols such as dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleyolphosphatidylglycerol (POPG), cardiolipin, phosphatidylinositol, diacylphosphatidylserine, diacylphosphatidic acid, and other anionic modifying groups joined to neutral lipids. Other suitable phospholipids include glycolipids (e.g., monosialoganglioside GM1).

[0119] “Stabilizer” or “stabilizing agent” is a term used to identify the agent that is added to the ionizable lipid, the phospholipid, and the sterol that form the lipid formulation according to the invention. In some embodiments, the stabilizing agent may include a non-ionic stabilizing agent. Non-limiting examples of non-ionic stabilizing agents include: Polyethyleneglycol (PEG), DMG-PEG2000 (1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-200), Polysorbates (Tweens), TPGS (Vitamin E polyethylene glycol succinate), Brij™ S20 (polyoxyethylene (20) stearyl ether), Brij™35 (Polyoxyethylene lauryl ether, Polyethyleneglycol lauryl ether), Brij™S10 (Polyethylene glycol octadecyl ether, Polyoxyethylene (10) stearyl ether), Myrj™52 (polyoxyethylene (40) stearate), or any combinations thereof. Additional non- 22P2023-3389-WO limiting examples of stabilizing agents include those disclosed in PCT applications PCT / EP2024 / 075129, PCT / EP2024 / 075124, PCT / EP2024 / 075128, which are incorporated by reference herein in their entireties.

[0120] In some embodiments, the stabilizing agent includes PEGylated lipids including PEG- DMG 2000 (“PEG-DMG”). Other polyethylene glycol conjugated lipids may also be used. The stabilizing agent may be used alone or in combinations with each other.

[0121] In some embodiments, there is no stabilizing agent. In other embodiments, the stabilizing agent comprises about 0.1 to 5 Mol% of the overall lipid mixture. In some embodiments, the stabilizing agent includes about 0.5 to 2.5 Mol% of the overall lipid mixture. In preferred embodiments, the stabilizing agent is present at greater than 1.0 Mol%. In some embodiments the stabilizing agent is present at 5 Mol%. In some embodiments the stabilizing agent is present at 10 to 15 Mol%. In some embodiments, the stabilizing agent is present at 2.5 to 10 Mol%. In other embodiments, the stabilizing agent is present at greater than 10 Mol% of the lipid mixture. In some embodiments, the stabilizing agent has a mol% of about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4,1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, or a mol% value within a range defined by any two of the aforementioned values.

[0122] Sterols are included in some embodiments lipid mix formulations for certain applications, and lipid particles made therefrom include cholesterol, beta-sitosterol, 20-alpha- hydroxysterol, and / or phytosterol. In the lipid mixes of the invention, sterol is present at about 15 to 50 Mol% of the lipid mix formulation in some embodiments. In some embodiments, sterol is present at about 15 to 25 Mol% of the lipid mix formulation. In some embodiments, a modified sterol or synthetically derived sterol is present.

[0123] In the case of cell therapy, delivery is to a particular cell type or population, commonly Ex Vivo. In the case of vaccines, delivery is localized to the skin or muscle.

[0124] The term “nucleic acid” refers to any polymeric chain of nucleotides. A nucleic acid may be DNA, RNA, or a combination thereof. In some embodiments, a nucleic acid comprises one or more natural nucleic acid residues. In some embodiments, a nucleic acid comprises of one or more nucleic acid analogs. In some embodiments, nucleic acids are prepared by one or more of isolation from a natural source, enzymatic synthesis by polymerization based on a complementary template (in vivo or in vitro), reproduction in a recombinant cell or system, or 23P2023-3389-WO chemical synthesis. In some embodiments, a nucleic acid is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000 or more residues long (e.g., 20 to 100, 20 to 500, 20 to 1000, 20 to 2000, or 20 to 5000 or more residues). In some embodiments, a nucleic acid is partly or wholly single stranded; in some embodiments, a nucleic acid is partly or wholly double stranded. In some embodiments a nucleic acid has a nucleotide sequence comprising at least one element that encodes, or is the complement of a sequence that encodes, a polypeptide. As used herein, the term “nucleic acid” is meant to include any oligonucleotide or polynucleotide whose delivery into a cell causes a desirable effect. The definition includes diagnostic agents and research reagents which follow the same physical principles afforded by the invention. Fragments containing up to 50 nucleotides are generally termed oligonucleotides, and longer nucleotides are called polynucleotides. In particular embodiments, oligonucleotides of the present invention are 20-50 nucleotides in length. In embodiments of the invention, polynucleotides are 996 to 4500 nucleotides in length, as in the case of messenger RNA. In particular embodiments, polynucleotides of the invention include up to 14,000 nucleotides.

[0125] In some embodiments, the term “nucleic acid” refers to ribonucleotides, deoxynucleotides, modified ribonucleotides, modified deoxyribonucleotides, modified phosphate-sugar-backbone oligonucleotides, other nucleotides, nucleotide analogs, or combinations thereof, and can be single stranded, double stranded, or contain portions of both double stranded and single stranded sequence, as appropriate. Messenger RNA (mRNA) can be modified or unmodified, base modified, and may include different type of capping structures, such as Cap1. In some embodiments, nucleic acid refers to self-amplifying RNA (“saRNA”). In some embodiments, nucleic acid refers to a plasmid including self-amplifying RNA.

[0126] As used herein, the terms “polynucleotide” and “oligonucleotide” are used interchangeably and mean single-stranded and double-stranded polymers of nucleotide monomers, including 2'-deoxyribonucleotides (DNA) and ribonucleotides (RNA) linked by internucleotide phosphodiester bond linkages, e.g., 3'-5' and 2'-5', inverted linkages, e.g., 3'-3' and 5'-5', branched structures, or internucleotide analogs. Polynucleotides have associated counter ions, such as H+, NH4+, trialkylammonium, Mg2+, Na+, and the like. A polynucleotide 24P2023-3389-WO may be composed entirely of deoxyribonucleotides (DNA), entirely of ribonucleotides (RNA), or chimeric mixtures thereof.

[0127] Transposon clinical trials including SuperPiggybac are disclosed in a 2020 paper Magnani CF, et al. Transposon-Based CAR T Cells in Acute Leukemias: Where are We Going? Cells.2020 May 27;9(6):1337. Other examples appear in Table 1. PiggyBac is a type of transposon, a mobile genetic element that can insert and remove DNA sequences in the genome. PiggyBac works by excising itself from one location in the genome and integrating into another, which allows it to be used for gene transfer and integration. PiggyBac insertions are typically stable and can be passed on to the next generation in organisms, making it suitable for long-term genetic modifications.

[0128] Examples of suitable DNA vectors include those listed in Table 1. Transposons are mobile genetic elements that can move within a genome. Researchers choose the transposon system that best suits their experimental needs, taking into consideration factors such as ease of use, efficiency, and target organism. Table 1. DNA Vector Types for Use in the Method25P2023-3389-WO26P2023-3389-WO

[0129] Plasmids are a form of stable nucleic acid that can coexist with an organism’s genome.

[0130] “Cell therapeutics,” as defined herein, encompass a diverse array of medical treatments utilizing living cells for therapeutic purposes. This definition broadly includes, but is not limited to: Immunotherapies, such as Chimeric Antigen Receptor T-cell (CAR-T) therapy, T Cell Receptor (TCR) therapy, and Tumor-Infiltrating Lymphocytes (TIL) therapy, which modify and reinfuse immune cells to target neoplastic diseases; Hematopoietic cell therapies, involving the transplantation and manipulation of hematopoietic stem cells (HSCs) for treating hematological disorders, including leukemia and lymphoma, and especially genetic disorders, using either autologous or allogeneic stem cells; Natural Killer (NK) Cell Therapies: These therapies utilize NK cells, a type of cytotoxic lymphocyte critical to the innate immune system, for targeting tumor cells and cells infected by pathogens; and Mesenchymal Stem Cell (MSC) Therapies and Others: Covering treatments with MSCs, applicable in regenerative medicine and autoimmune diseases. This last category also includes therapies using neural stem cells, induced Pluripotent Stem Cells (iPSCs), and other cell types for diverse therapeutic applications.

[0131] As used herein, the term “nucleic acid therapeutic” is defined as a substance intended to have a direct effect in the mitigation or prevention of disease, or to act as a research reagent. In embodiments, the nucleic acid cargo is an mRNA or saRNA. In embodiments, the therapeutic agent is a nucleic acid therapeutic, such as a double stranded circular DNA (plasmid), a linearized plasmid DNA, minicircles or msDNA (multicopy single stranded DNA). Currently, nucleic acid cargoes include deoxyribonucleic acid, complementary deoxyribonucleic acid, complete genes for gene therapies targeting a variety of diseases, such as cancer, infectious diseases, genetic disorders and neurodegenerative diseases. As described herein, the nucleic acid therapeutic (NAT), or nucleotide of interest, is incorporated into the lipid particle during its formation with compounds of the invention. More than one nucleic acid therapeutic may be incorporated in this way. They may be derived from natural sources, or more commonly, synthesized or grown in culture.

[0132] Examples of nucleic acid payload that can be encapsulated in the lipid mix composition of the instant disclosure include but are not limited to an antisense oligonucleotide (ASO), a ribozyme, a microRNA (miRNA), a messenger RNA (mRNA), a transfer RNA (tRNA), a trans-activating CRISPR RNA (tracrRNA), a guide RNA, a sgRNA, a self-amplifying 27P2023-3389-WO RNA (SAM or saRNA), a small nuclear RNA (snRNA), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), a circular RNA (circRNA), a non-coding RNA (ncRNA), a self- replicating DNA, an LNA, a DNA, a replicon, a pre-condensed DNA, a transposon, a single gene, a vector, a plasmid or a pDNA, an aptamer, or a combination thereof. In embodiments, nucleic acid payloads or reagents are used to silence genes (with for example siRNA), express genes (with for example mRNA), edit genomes (with for example CRISPR / Cas9), or reprogram cells for return to the originating organism (for example ex vivo cell therapy to reprogram immune cells for cancer therapy; autologous transfer or allogenic transfer). In some embodiments, the nucleic acid is an antigen encoded mRNA for prophylactic or therapeutic vaccine, a nucleic acid for gene therapy, or a nucleic acid for immunogenic cell incorporation, wherein the immunogenic cell is a T cell, natural killer cell, dendritic cell, macrophage, or tumor-infiltrating leukocyte. In some embodiments, the incorporation is performed in vitro, ex vivo, or in vivo.

[0133] The nucleic acid that is present in a lipid particle according to this invention may include any form of nucleic acid that is currently known or later developed. The nucleic acids used herein can be single-stranded DNA or RNA, or double-stranded DNA or RNA, or DNA- RNA hybrids. Circular and closed DNA are nucleic acid payloads in some embodiments. Examples of double-stranded DNA include structural genes, genes including control and termination regions, and self-replicating systems such as viral or plasmid DNA. Examples of double-stranded RNA include siRNA and other RNA interference reagents. Single-stranded nucleic acids include antisense oligonucleotides, guide RNA, including CRISPR-Cas9 gRNA, ribozymes, microRNA, mRNA, and triplex-forming oligonucleotides. More than one nucleic acid may be incorporated into the lipid particle, for example mRNA and guide RNA together, or different types of each, or in combination with protein.

[0134] In some cases, a nucleic acid encodes a genetically engineered receptor that specifically binds to a ligand, such as a recombinant receptor, and a molecule involved in a metabolic pathway, or functional portion thereof. Alternately, the molecule involved in a metabolic pathway is a recombinant molecule, including an exogenous entity. A genetically engineered receptor and the molecule involved in a metabolic pathway may be encoded by one nucleic acid or two or more different nucleic acids. In some examples, a first nucleic acid might 28P2023-3389-WO encode a genetically engineered receptor that specifically binds to a ligand and a second nucleic acid might encode the molecule involved in a metabolic pathway.

[0135] Gene of Interest (“GOI”) is the nucleic acid molecule intended to be integrated and expressed, or exist on an exosome and be expressed, in the cell or in a bioreactor. Genes of Interest include those encoding insulin, human growth hormone, CFTR, β globin, δ globin, γ globin, BCL11A, KLF1, CCR5, CXCR4, PPP1R12C (AAVS1), HPRT, albumin, Factor VIII, Factor IX, LRRK2, Htt, SOD1, C9orf72, TARDBP, FUS, RHO, CFTR, SFTPB, TRAC, TRBC, PD1, CTLA-4, HLA A, HLA B, HLA C, HLA-DP, HLA-DQ, HLA-DR, LMP7, TAP 1, TAP2, TAPBP, CIITA, DMD, GR, IL2RG, Rag-1, RFX5, FAD2, FAD3, ZP15, KASII, MDH, EPSPS, or a fragment thereof.

[0136] Gene of Interest may encode a bispecific T cell engager (BiTE) molecule; a hormone; a cytokine (e.g., IL-2, insulin, IFN-γ, IL-7, IL-21, IL-10, IL-12, IL-15, and TNF-α), a chemokine (e.g., MIP-1α, MIP-1β, MCP-1, MCP-3, and RANTES), a cytotoxin (e.g., Perforin, Granzyme A, and Granzyme B), a cytokine receptor (e.g., an IL-2 receptor, an IL-7 receptor, an IL-12 receptor, an IL-15 receptor, and an IL-21 receptor), or an engineered antigen receptor.

[0137] Nucleic acid payloads may include both coding and non-coding genes of interest. Coding regions are the instructions for building proteins, which are essential molecules for the structure, function, and regulation of the body's cells and tissues. Coding regions, also known as exons, are the segments of DNA that directly encode the amino acid sequence of a protein. These regions are transcribed into messenger RNA (mRNA), which serves as a template for protein synthesis during translation. Mutations in coding regions can lead to changes in the amino acid sequence of the resulting protein, which may affect its structure or function. Coding regions are highly conserved across species and are crucial for understanding the genetic basis of inherited diseases and the development of therapeutic interventions.

[0138] Noncoding regions, also known as introns and regulatory sequences, are segments of DNA that do not code for proteins. Introns are spliced out during mRNA processing, and only the exons are retained in the mature mRNA. Regulatory sequences, such as promoters, enhancers, and silencers, play critical roles in controlling gene expression by influencing the transcriptional activity of genes. Noncoding regions are involved in various cellular processes, including gene regulation, chromatin structure, and RNA processing. Mutations in noncoding regions can impact gene expression levels or patterns, leading to phenotypic changes or disease 29P2023-3389-WO susceptibility. Noncoding regions also contain regions of repetitive DNA, such as transposable elements, which can contribute to genome instability and genetic diversity.

[0139] Noncoding regions of the genome do not directly encode proteins but can code for noncoding RNAs (ncRNAs). Noncoding RNAs are RNA molecules that are transcribed from DNA but are not translated into proteins. Instead, they perform various regulatory and structural functions within the cell. Examples of noncoding RNAs include: tRNA molecules are involved in translating the genetic code from mRNA into amino acid sequences during protein synthesis, rRNA molecules are components of ribosomes, the cellular machinery responsible for protein synthesis. They help catalyze the assembly of amino acids into proteins, miRNAs are small RNA molecules that regulate gene expression by binding to specific mRNA molecules and either inhibiting their translation or promoting their degradation, Long non-coding RNA (lncRNAs) are RNA molecules longer than 200 nucleotides that do not encode proteins. They play diverse roles in gene regulation, chromatin organization, and other cellular processes, Small nuclear RNAs (snRNAs) are involved in the processing of pre-mRNA transcripts, including splicing and other RNA modification processes, Small Nucleolar RNAs (snoRNAs) guide the chemical modification of ribosomal RNA and other RNAs, and PiWi- interacting RNAs (piRNAs) are involved in silencing the activity of transposable elements in the genome, thereby maintaining genomic stability.

[0140] Nucleic acid payload of the instant disclosure may encode an engineered T cell receptor (TCR), a chimeric antigen receptor (CAR), a Daric receptor or components thereof, or a chimeric cytokine receptor.

[0141] DNA delivery can be used for various CAR T-cell therapy applications (chimeric antigen receptor T-cell therapy, is a type of immunotherapy) that involves genetically modifying a patient’s T cells to recognize and attack cancer cells. Here are some examples of CAR T-cell therapy disorders and available treatments:

[0142] B-cell Acute Lymphoblastic Leukemia (B-ALL): CAR T-cell therapy targeting CD19 has shown significant efficacy in treating relapsed or refractory B-ALL. Approved CAR T-cell therapies for B-ALL include tisagenlecleucel (Kymriah) and axicabtagene ciloleucel (Yescarta).

[0143] Diffuse Large B-cell Lymphoma (DLBCL): DLBCL is a type of non-Hodgkin lymphoma that has also been targeted with CAR T-cell therapy. Axicabtagene ciloleucel 30P2023-3389-WO (Yescarta) and tisagenlecleucel (Kymriah) have been approved for treating certain patients with DLBCL who have failed other treatments.

[0144] Multiple Myeloma: CAR T-cell therapy is being investigated as a potential treatment for multiple myeloma, a cancer of plasma cells.

[0145] Solid Tumors: CAR T-cell therapies could effectively target solid tumors, such as ovarian cancer, pancreatic cancer, and glioblastoma.

[0146] Autoimmune Diseases: CAR T-cell therapy can be engineered to target autoreactive T cells that are responsible for attacking the body’s own tissues in autoimmune diseases such as rheumatoid arthritis, lupus, celiac disease and multiple sclerosis. Research is ongoing to develop CAR T-cell therapies that selectively target and eliminate autoreactive T cells while sparing healthy immune cells.

[0147] Organ Transplantation: By targeting and suppressing the immune response against the transplanted organ, these therapies could potentially reduce the need for lifelong immunosuppressive drugs, which carry risks of infections and other complications.

[0148] Allergic Diseases: CAR T-cell therapy has been investigated as a potential treatment for allergic diseases, such as asthma and allergic rhinitis. By targeting specific immune cells involved in allergic reactions, CAR T-cell therapy could potentially modulate the immune response and alleviate symptoms associated with allergic diseases.

[0149] Immunodeficiency Disorders:

[0150] CAR T-cell therapy and gene editing technologies, such as CRISPR-Cas9, are being explored as potential treatments for primary immunodeficiency disorders, where the immune system is deficient or dysfunctional.

[0151] These approaches aim to correct genetic mutations responsible for immunodeficiency and restore normal immune function.

[0152] Inflammatory Bowel Disease (IBD):

[0153] CAR T-cell therapy and other immunomodulatory strategies are being investigated as potential treatments for inflammatory bowel diseases, such as Crohn's disease and ulcerative colitis.

[0154] By targeting and modulating the dysregulated immune response in the gut, these therapies could help reduce inflammation and improve symptoms in patients with IBD.

[0155] Type 1 Diabetes: 31P2023-3389-WO

[0156] CAR T-cell therapy and other immunotherapies are being explored as potential treatments for type 1 diabetes, an autoimmune disease characterized by the destruction of insulin-producing beta cells in the pancreas.

[0157] These approaches aim to target and eliminate autoreactive immune cells responsible for attacking beta cells, thereby preserving or restoring insulin production.

[0158] “Therapeutic agents” as used herein include nucleic acids as herein described, or nucleic acid therapeutics (“NAT”), proteins, peptides, polypeptides, and small molecules.

[0159] The term “polypeptides” herein encompasses “oligopeptides” and “proteins” and tertiary and quaternary structures thereof, that are therapeutic agents in some embodiments. An oligopeptide generally consists of from two to twenty amino acids. A polypeptide is a single linear chain of many amino acids of any length held together by amide bonds. A protein consists of one or more and may include structural proteins, energy catalysts, albumin, hemoglobin, immunoglobulins, and enzymes.

[0160] The lipid particles of the invention can be assessed for size using devices that size particles in solution, such as the Malvern™ Zetasizer™. The particles generally have a mean particle diameter of from 15 nm to 1000 nm. A subgroup of lipid particles is “lipid nanoparticles” or LNP with a mean diameter of from about 15 to about 300 nm. In some embodiments, the mean particle diameter is greater than 300 nm. In some embodiments, the lipid particle has a diameter of about 300 nm or less, 250 nm or less, 200 nm or less, 150 nm or less, 100 nm or less, or 50 nm or less. In one embodiment, the lipid particle has a diameter of from about 50 to about 150 nm. Smaller particles generally exhibit increased circulatory lifetime in vivo compared to larger particles. Smaller particles have an increased ability to reach tumor sites than larger nanoparticles. In one embodiment, the lipid particle has a diameter from about 15 to about 50 nm.

[0161] The lipid particles according to embodiments of the invention can be prepared by standard T-tube mixing techniques, turbulent mixing, trituration mixing, agitation promoting orders self-assembly, or passive mixing of all the elements with self-assembly of elements into nanoparticles. A variety of methods have been developed to formulate lipid nanoparticles (LNP) containing genetic drugs. Suitable methods are disclosed in U.S. Pat. No.5,753,613, U.S. Pat. No.6,734,171, and U.S. Pat. No.7,901,708, by way of example. These methods include mixing preformed lipid particles with nucleic acid therapeutic (NAT) in the presence of ethanol or 32P2023-3389-WO mixing lipid dissolved in ethanol with an aqueous media containing NAT and result in lipid particles with NAT encapsulation efficiencies of 65-99%. All of these methods rely on the presence of ionizable lipid to achieve encapsulation of NAT and a stabilizing agent to inhibit aggregation and the formation of large structures. The properties of the lipid particle systems produced, including size and NAT encapsulation efficiency, are sensitive to a variety of lipid mix formulation parameters such as ionic strength, lipid and ethanol concentration, pH, NAT concentration and mixing rates.

[0162] Microfluidic two-phase droplet techniques have been applied to produce monodisperse polymeric microparticles for drug delivery or to produce large vesicles for the encapsulation of cells, proteins, or other biomolecules. The use of hydrodynamic flow focusing to create monodisperse liposomes of controlled size has also been demonstrated.

[0163] Parameters such as the relative lipid and NAT concentrations at the time of mixing, as well as the mixing rates are difficult to control using existing formulation procedures, resulting in variability in the characteristics of NAT produced, both within and between preparations. The new formulation of the disclosure is unique in that the ratio of ionizable lipid to phospholipid is surprisingly low. Automated micro-mixing instruments such as the NanoAssemblr™ instruments (Cytiva, USA) enable the rapid and controlled manufacture of nanomedicines (liposomes, lipid nanoparticles, and polymeric nanoparticles). NanoAssemblr™ instruments accomplish controlled molecular self-assembly of nanoparticles via microfluidic mixing cartridges that allow millisecond mixing of nanoparticle components at the nanoliter, microliter, or larger scale with customization or parallelization. Rapid mixing on a small scale allows reproducible control over particle synthesis and quality that is not possible in larger instruments.

[0164] Preferred methods incorporate instruments such as the microfluidic mixing devices like the NanoAssemblr™ series including Spark™, Ignite™, Blaze™, GMP system or commercial formulation system, in order to achieve nearly 100% of the nucleic acid used in the formation process is encapsulated in the particles in one step. In preferred embodiments, the lipid particles are prepared by a process by which from about 75 to about 100% of the nucleic acid used in the formation process is encapsulated in the particles.

[0165] U.S. Pat. Nos.9,758,795 and 9,943,846 describe methods of using small volume mixing technology and novel formulations derived thereby. U.S. Pat. No. 10,159,652 describes more advanced methods of using small volume mixing technology and products to formulate 33P2023-3389-WO different materials. U.S. Pat. No.9,943,846 discloses microfluidic mixers with different paths and wells to elements to be mixed. PCT Pub. No. WO 2017117647 discloses microfluidic mixers with disposable sterile paths. U.S. Pat. No.10,076,730 discloses bifurcating toroidal micromixing geometries and their application to microfluidic mixing. PCT Pub. No. WO2018006166 discloses a programmable automated micromixer and mixing chips, therefore. U.S. Design Nos. D771834, D771833, D772427, D803416, D800335, D800336 and D812242 disclose mixing cartridges having microchannels and mixing geometries for mixer instruments sold by Cytiva, USA.

[0166] In embodiments of the invention, devices for biological microfluidic mixing are used to prepare the lipid particles according to embodiments of the invention. The devices include a first and second stream of reagents, which feed into the microfluidic mixer, and lipid particles are collected from the outlet, or emerge into a sterile environment.

[0167] The first stream includes a therapeutic agent in a first solvent. Suitable first solvents include solvents in which the therapeutic agents are soluble and that are miscible with the second solvent. Non-limiting examples of suitable first solvents include aqueous buffers. Representative first solvents include citrate and acetate buffers, or optionally other low pH buffers.

[0168] The second stream includes lipid mix materials in a second solvent. Suitable second solvents include solvents in which the ionizable lipids according to embodiments of the invention are soluble, and that are miscible with the first solvent. Non-limiting examples of suitable second solvents include 1,4-dioxane, tetrahydrofuran, acetone, acetonitrile, dimethyl sulfoxide, dimethylformamide, acids, and alcohols. Representative second solvents include aqueous ethanol 90%, or anhydrous ethanol.

[0169] In one embodiment of the invention, a suitable device includes one or more microchannels (i.e., a channel having its greatest dimension less than 2 millimeters). In one example, the microchannel has a diameter from about 20 to about 300 μm. In another example, the microchannel has a diameter from about 300 to about 1000 μm. In examples, at least one region of the microchannel has a principal flow direction and one or more surfaces having at least one groove or protrusion defined therein, the groove or protrusion having an orientation that forms an angle with the principal direction (e.g., a staggered herringbone mixer), as described in U.S. Pat. No.9,943,846, or a bifurcating toroidal flow as described in U.S. Pat. No.10,076,730. 34P2023-3389-WO To achieve maximal mixing rates, it is advantageous to avoid undue fluidic resistance prior to the mixing region. Thus, one example of a device has non-microfluidic channels having dimensions greater than 1000 μm, to deliver the fluids to a single mixing channel.

[0170] Less complex mixing methods and instruments such as those disclosed in, for example, U.S. Published Patent Application No.20040262223, are also useful in creating lipid particle formulations of the invention.

[0171] The lipid mixes of the present invention may be used to deliver a therapeutic agent to a cell, in vitro, ex vivo, or in vivo. In particular embodiments, the therapeutic agent is a nucleic acid, which is delivered to a cell using lipid particles of the present invention with the nucleic acid encapsulated therein. The nucleic acid may include, but not limited to, an antisense oligonucleotide (ASO), a ribozyme, a microRNA (miRNA), a messenger RNA (mRNA), a transfer RNA (tRNA), a trans-activating CRISPR RNA (tracrRNA), a guide RNA, a single guide RNA, a self-amplifying RNA (SAM or saRNA), a small nuclear RNA (snRNA), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), a circular RNA (circRNA), a non- coding RNA (ncRNA), a self-replicating DNA, a locked nucleic acid (LNA), a DNA, a replicon, a pre-condensed DNA, a transposon, a single gene, a vector, a plasmid or a pDNA, an aptamer, or a combination thereof.

[0172] In other embodiments, the nucleic acid cargo of the LNP includes an oligopeptide, polypeptide, or protein which is delivered to a cell using lipid particles of the present invention with the peptide encapsulated therein. In other embodiments, the payload or therapeutic agent is a mixture of nucleic acid and protein components, such as Cas9. The methods and lipid mix compositions may be readily adapted for the delivery of any suitable therapeutic agent for the treatment of any disease or disorder that would benefit from such treatment.

[0173] In certain embodiments, the present invention provides methods for introducing a nucleic acid payload or cargo into a cell (i.e., transfection). Transfection is a technique commonly used in molecular biology for the introduction of nucleic acid cargo (or NATs) from the extracellular to the intracellular space for the purpose of transcription, translation and expression of the delivered nucleic acid or nucleic acid therapeutic (NAT) for production of some gene product or for down regulating the expression of a disease-related gene. Transfection efficiency is commonly defined as either the i) percentage of cells in the total treated population showing positive expression of the delivered gene, as measured by live or fixed cell imaging (for 35P2023-3389-WO detection of fluorescent protein), and flow cytometry or ii) the intensity or amount of protein expressed by treated cell(s) as analyzed by live or fixed cell imaging or flow cytometry or iii) using protein quantification techniques such as ELISA, or western blot. These methods may be carried out by contacting the lipid particles or lipid mix formulations of the present invention with the cells for a period of time sufficient for intracellular delivery to occur.

[0174] Integration of the nucleic acid or nucleic acid therapeutic into the nucleus and chromosomes can be assayed by studying the survival of the gene expression through cell divisions.

[0175] Typical applications include using well known procedures to provide intracellular delivery of siRNA to knock down or silence specific cellular targets in vitro and in vivo. Alternatively, applications include delivery of DNA or mRNA sequences that code for therapeutically useful polypeptides. In this manner, therapy is provided for genetic diseases by supplying deficient or absent gene products. Methods of the present invention may be practiced in vitro, ex vivo, or in vivo. For example, the lipid mix formulations of the present invention can also be used for delivery of nucleic acids to cells in vivo, using methods which are known to those of skill in the art. In another example, the lipid mix formulations of the invention can be used for delivery of nucleic acids to a sample of patient cells that are ex vivo, then are returned to the patient.

[0176] The delivery of nucleic acid cargo by a lipid particle of the invention is described below.

[0177] For in vivo administration, the pharmaceutical compositions are preferably administered parenterally (e.g., intraarticularly, intravenously, intraperitoneally, subcutaneously, intrathecally, intradermally, intratracheally, intraosseous, intramuscularly or intratumorally). In particular embodiments, the pharmaceutical compositions are administered intravenously, intramuscularly, intrathecally, or intraperitoneally by a bolus injection. Other routes of administration include topical (skin, eyes, mucus membranes), oral, pulmonary, intranasal, sublingual, rectal, and vaginal.

[0178] For ex vivo applications, the pharmaceutical compositions are preferably administered to biological samples that have been removed from the organism, then the cells are washed and restored to the organism. The organism may be a mammal, and in particular may be human. This process is used for cell reprogramming, genetic restoration, or immunotherapy, for example. 36P2023-3389-WO

[0179] In one embodiment, the present invention provides a method of modulating the expression of a target polynucleotide or polypeptide. These methods generally comprise contacting a cell with a lipid particle of the present invention that is associated with a nucleic acid capable of modulating the expression of a target polynucleotide or polypeptide. As used herein, the term “modulating” refers to altering the expression of a target polynucleotide or polypeptide. Modulating can mean increasing or enhancing, or it can mean decreasing or reducing.

[0180] “Cells of the hematopoeitic lineage” includes hematopoietic stem cells, precursor immune cells such as T cells and B cells, macrophages, and natural killer cells. The term is intended to encompass cells of both the innate and adaptive immune system.

[0181] B cells can be isolated from whole blood by cells sorting or magnetic activated bead cell sorting. Moore DK, Motaung B, du Plessis N, Shabangu AN, Loxton AG; SU-IRG Consortium. Isolation of B-cells using Miltenyi MACS bead isolation kits. PLoS One.2019 Mar 20;14(3). White cells in general can be separated from whole blood using density. Immune cell isolation includes methods that enable the enrichment of immune cell subsets using antibody- mediated recognition of specific cell surface antigens, followed by sorting or separation with techniques such as flow cytometry, density centrifugation or magnetic isolation.

[0182] A T cell, or T lymphocyte, is a lymphocyte subtype that has the lead role in cell- mediated immunity. T cells can be distinguished from other white blood cells, (for example, B cells or natural killer cells), by the existence of a T cell receptor on the cell surface. The main categories of T cells include Helper (CD4+), Cytotoxic (CD8+), Memory and Regulatory T cells.

[0183] The log phase of growth with reference to T cell cultures means, for example, the time that the cells undergo a rapid expansion, around day 5 or day 6 post activation. Log phase can be observed through a sudden increase in cell count, this rapid expansion can be used as a time point to begin preparing LNPs for T cell treatment. In embodiments of the invention, T cells may be activated in different ways. The triple activation method using anti- CD3 / CD28 / CD2 antibodies is exemplified below, but dual activation was also effective in our studies. Dual activation is performed using anti CD3 / CD28 antibodies. Current clinically used protocols employ the dual activation protocol.

[0184] T cells may in some cases be derived from differentiated from induced pluripotent stem cells (iPSC) or Embryonic Stem Cells (ESC). 37P2023-3389-WO

[0185] Preparation of T cells for transformation by methods of the invention includes one or more culture and / or preparation steps. The T cells are usually isolated from biological tissue (such as peripheral blood or arterial blood) derived from a mammalian subject. In some embodiments, the subject from which the cell is isolated has a disease or condition or in need of a cell therapy or to which cell therapy will be administered. In some embodiments, the subject from which the cell is isolated is a healthy donor or volunteer.

[0186] The cells in some embodiments are primary cells, such as primary human cells. The tissue sources include blood, tissue, lymph, and other tissue sources taken directly from the subject, and samples resulting from one or more processing steps, such as separation, centrifugation, washing, and / or incubation.

[0187] The tissue source from which the T cells are derived may be a blood or a blood- derived tissue source, or an apheresis or leukapheresis product. Exemplary tissue sources include whole blood, peripheral blood mononuclear cells (PBMCs), leukocytes, bone marrow, thymus, tissue biopsy, tumor, lymph node, spleen, or other lymphoid tissues. The cells in some embodiments are obtained from a different species than the eventual subject needing therapy.

[0188] Isolation of the cells may include more preparation or non-affinity-based cell separation. In some cases, cells are washed, centrifuged, and / or incubated in the presence of one or more reagents, for example, to remove or enrich for certain components.

[0189] In some cases, cells from the circulating blood of a subject are obtained by apheresis or leukapheresis. The blood cells may be washed to remove the plasma fraction, and an appropriate buffer or media is used for subsequent processing steps. In some embodiments, the cells are washed with phosphate buffered saline (PBS). In some aspects, a washing step is performed by tangential flow filtration (TFF) according to the manufacturer's instructions (Spectrum Krosflo, GE Äkta Flux, for example). In some embodiments, the cells are resuspended in a variety of biocompatible buffers after washing, such as, for example, Ca++ / Mg++free PBS.

[0190] Unmodified cells mean cells that have not been treated to any structural or genetic changes after removal from a living body. Modified cells mean cells that have been augmented or changed in some way during or after removal from a living body.

[0191] Separating the T cells from tissue sources may involve density-based cell separation methods, including the preparation of white blood cells from peripheral blood by lysing the red 38P2023-3389-WO blood cells and centrifugation, for example, through a Percoll™ or Ficoll™ gradient. Other methods include the separation of different cell types based on the expression or presence in the cell of one or more specific surface markers.

[0192] Specific subpopulations of T cells, such as cells positive or expressing high levels of one or more surface markers, e.g., CD28+, CD62L+, CCR7+, CD27+, CD127+, CD4+, CD8+, CD45RA+, and / or CD45RO+T cells, can be isolated by positive or negative selection techniques. As one example, CD3+, CD28+T cells can be positively selected using CD3 / CD28 conjugated magnetic beads (e.g., DYNABEADS® M-450 CD3 / CD28 T Cell Expander). A CD4+or CD8+selection step can be used to separate CD4+helper and CD8+cytotoxic T cells. Memory T cells are present in both CD62L+and CD62L- subsets of CD8+peripheral blood lymphocytes. Alternatively, a selection for CD4+helper cells may be undertaken. In some cases, naive CD4+T lymphocytes are CD45RO-, CD45RA+, CD62L+, CD4+T cells. In others, central memory CD4+cells are CD62L+and CD45RO+. In still other cases, effector CD4+cells are CD62L- and CD45RO.

[0193] Cell populations can also be isolated using affinity magnetic separation techniques. The cells to be separated are incubated with magnetically responsive particles or microparticles, such as paramagnetic beads (e.g., Dynabeads™ (Clontech) or MACS™ (Miltenyi) beads). The magnetically responsive material is attached to a binding partner that specifically binds to a surface marker, present on the cell, cells, or population of cells that it is desired to separate. T cells may be isolated by positive or negative selection processes from tissue sources depending on preference. Kits for both are available, for example, from StemCell Technologies in Vancouver, Canada.

[0194] For therapeutic purposes, isolation or separation is carried out using an apparatus that carries out one or more of the isolation, cell preparation, separation, processing, and incubation, as required to transform the T cells. In some aspects, the system is used to carry out each of these steps in a closed or sterile environment. In one example, the system is a system as described in United States Patent Pub. No.20110003380 A1. Separation and / or other steps may be accomplished using the CliniMACS system (Miltenyi Biotec). See, e.g., Klebanoff et al. (2012) J Immunother. 35(9): 651-660, Terakura et al. (2012) Blood.1:72-82, and Wang et al. (2012) J Immunother. 35(9):689-701. A desired cell population can be collected and enriched via flow cytometry, in which cells stained for multiple cell surface markers are carried in a fluid 39P2023-3389-WO stream. Other methods include FACS or microelectromechanical systems (MEMS) chips in combination with a FACS-based detection system (see, e.g., WO 2010 / 033140).

[0195] T cell incubation and treatment may be carried out in a culture vessel, such as a chamber, well, column, tube, tubing set, valve, vial, culture dish, bag, tank, or other container for culture or cultivating cells. Stimulating conditions or agents include one or more agent, such as a ligand, capable of activating an intracellular signaling domain of a TCR complex. Incubation may be carried out as described in U.S. Pat. No.6,040,177 to Riddell et al. T cell cultures can be expanded by adding non-dividing peripheral blood mononuclear cells (PBMC), (e.g., such that the resulting population of cells contains at least about 5, 10, 20, or 40 or more PBMC feeder cells for each T lymphocyte in the initial population to be expanded); and incubating the culture.

[0196] T cell stimulating conditions include temperatures suitable for the growth of human T lymphocytes, for example, from 25 to 37 degrees Celsius. Optionally, the incubation may further include a supportive population of non-dividing EBV-transformed lymphoblastoid cells (LCL) as feeder cells, at a ratio to initial T cells of 10 to 1.

[0197] In other embodiments, the present invention provides a method of treating a disease or disorder characterized by overexpression of a polypeptide in a subject, comprising providing to the subject a pharmaceutical composition of the present invention, wherein the therapeutic agent is selected from a DNA, linear DNA, circular DNA, plasmid DNA, siRNA, a microRNA, an antisense oligonucleotide, and a plasmid capable of expressing an siRNA, a microRNA, or an antisense oligonucleotide, and wherein the siRNA, microRNA, or antisense RNA includes a polynucleotide that specifically binds to a polynucleotide that encodes the polypeptide, or a complement thereof.

[0198] In still other embodiments, the present invention provides a method of treating a disease or disorder characterized by under-expression of a polypeptide in a subject, comprising providing to the subject a pharmaceutical composition of the present invention, wherein the therapeutic agent is selected from a plasmid or DNA which includes a nucleic acid therapeutic that specifically encodes or expresses the under-expressed polypeptide, or a complement thereof. In certain embodiments, the therapeutic agent is selected from an mRNA, a self-amplifying RNA (saRNA), or an ssODNA, includes a nucleic acid therapeutic that specifically encodes or expresses the under-expressed polypeptide, or a complement thereof. Examples include RNA vaccines, and more particularly self-amplifying mRNA vaccines. 40P2023-3389-WO

[0199] For delivery of a biologically active agent (e.g., DNA encoding an immunogen) to cells of the immune system (e.g., antigen-presenting cells, including professional antigen presenting cells), in one embodiment formulation of the invention is delivered intramuscularly, after which immune cells can infiltrate the delivery site and process delivered DNA and / or process encoded antigen produced by non-immune cells, such as muscle cells. Such immune cells can include macrophages (e.g., bone marrow derived macrophages), dendritic cells (e.g., bone marrow derived plasmacytoid dendritic cells and / or bone marrow derived myeloid dendritic cells), T-cells, and monocytes (e.g., human peripheral blood monocytes), etc. (for example, see WO2012 / 006372).

[0200] The DNA is delivered with a lipid formulation of the invention (e.g., formulated as a liposome or LNP). In some embodiments, the invention utilizes LNPs within which immunogen- encoding DNA is encapsulated. Encapsulation within LNPs can protect DNA from DNAse digestion. The encapsulation efficiency does not have to be 100%. Presence of external DNA molecules (e.g., on the exterior surface of a liposome or LNP) or “naked” DNA molecules (DNA molecules not associated with a liposome or LNP) is acceptable. Preferably, for a formulation comprising lipids and DNA molecules, at least half of the DNA molecules (e.g., at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least about 96%, at least about 97%, at least about 98%, or at least 99% of the DNA molecules) are encapsulated in LNPs or complexed with LNPs.

[0201] Some lipid nanoparticles may comprise a lipid core (e.g., the formulation may comprise a mixture of LNPs and nanoparticles with a lipid core). In such cases, the DNA molecules may be encapsulated by LNPs that have an aqueous core or cores, and complexed with the LNPs that have a lipid core by noncovalent interactions (e.g., ionic interactions between negatively charged DNA and cationic lipid). Encapsulation and complexation with LNPs (whether with a lipid or aqueous core) can protect DNA from DNase digestion. The encapsulation / complexation efficiency does not have to be 100%. Presence of “naked” DNA molecules (DNA molecules not associated with the LNP) is acceptable. Preferably, for a formulation comprising a population of LNPs and a population of DNA molecules, at least half of the population of DNA molecules (e.g., at least e.g., at least 50 %, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the DNA molecules) are either encapsulated in LNPs or complexed with LNPs. 41P2023-3389-WO

[0202] Some lipid nanoparticles have multilamellar components such as phospholipid bilayers and aqueous pockets.

[0203] For delivery of immunogen-coding DNA, the preferred range of LNP diameters is in the range of 60-180 nm, and in more particular embodiments, in the range of 80-160 nm. An LNP can be part of a composition comprising a population of LNPS, and the LNPS within the population can have a range of diameters. For a composition comprising a population of LNPs with different diameters, it is preferred that (i) at least 80% by number of the LNP have diameters in the range of 60-180 nm, e.g., in the range of 80-160 nm, (ii) the average diameter (by intensity, e.g., Z-average) of the population is ideally in the range of 60-180 nm, e.g., in the range of 80-160 nm; and / or the diameters within the plurality have a polydispersity index <0.2. To obtain LNPs with the desired diameter(s), mixing can be performed using a process in which two feed streams of aqueous DNA solution are combined in a single mixing zone with one stream of an ethanolic lipid solution, all at the same flow rate e.g., in a microfluidic channel. See other description relating to NanoAssemblr® microfluidic mixers sold by Cytiva, USA.

[0204] DNA molecules can conveniently be prepared by in vitro transcription (IVT). IVT can use a (cDNA) template created and propagated in plasmid form in bacteria or created synthetically (for example by gene synthesis and / or polymerase chain-reaction (PCR) engineering methods). The invention includes embodiments in which multiple species of RNAs are formulated with a lipid formulation provided by the invention, such as two, three, four or more species of RNA, including different classes of RNA (such as mRNA, siRNA, self- replicating RNAs, and combinations thereof).

[0205] In some embodiments, the DNA codes specific neoantigens in cancer cells or solid tumours. In some embodiments, the RNA is an mRNA to a tumor antigen selected from: (a) cancer-testis antigens such as NY-ESO-I, SSX2, SCPI as well as RAGE, BAGE, GAGE and MAGE family polypeptides, for example, GAGE-1, GAGE-2, MAGE-1, MAGE-2, MAGE-3, MAGE-4, MAGE-5, MAGE-6, and MAGE-12 (which can be used, for example, to address melanoma, lung, head and neck, NSCLC, breast, gastrointestinal, and bladder tumors; (b) mutated antigens, for example, p53 (associated with various solid tumors, e.g., colorectal, lung, head and neck cancer), p21 / Ras (associated with, e.g., melanoma, pancreatic cancer and colorectal cancer), CDK4 (associated with, e.g., melanoma), MUMI (associated with, e.g., melanoma), caspase-8 (associated with, e.g., head and neck cancer), CIA 0205 (associated with, 42P2023-3389-WO e.g., bladder cancer), HLA-A2-R1701, beta catenin (associated with, e.g., melanoma), TCR (associated with, e.g., T-cell non-Hodgkins Lymphoma), BCR-abl (associated with, e.g., chronic myelogenous leukemia), triosephosphate isomerase, KIA 0205, CDC-27, and LDLRFUT; (c) over-expressed antigens, for example, Galectin 4 (associated with, e.g., colorectal cancer), Galectin 9 (associated with, e.g., Hodgkin's disease), proteinase 3 (associated with, e.g., chronic myelogenous leukemia), WT I (associated with, e.g., various Leukemias), carbonic anhydrase (associated with, e.g., renal cancer), aldolase A (associated with, e.g., lung cancer), PRAME (associated with, e.g., melanoma), HER-2 / neu (associated with, e.g., breast, colon, lung and ovarian cancer), mammaglobin, alpha-fetoprotein (associated with, e.g., hepatoma), KSA (associated with, e.g., colorectal cancer), gastrin (associated with, e.g., pancreatic and gastric cancer), telomerase catalytic protein, MUC-I (associated with, e.g., breast and ovarian cancer), G-250 (associated with, e.g., renal cell carcinoma), p53 (associated with, e.g., breast, colon cancer), and carcinoembryonic antigen (associated with, e.g., breast cancer, lung cancer, and cancers of the gastrointestinal tract such as colorectal cancer); (d) shared antigens, for example, melanoma-melanocyte antigens such as MART-1 / Melan A, gp100, MCIR, melanocyte- stimulating hormone receptor, tyrosinase, tyrosinase related protein-I / TRPI and tyrosinase related protein-2 / TRP2 (associated with, e.g., melanoma); (e) prostate associated antigens such as PAP, PSA, PSMA, PSH-PI, PSM-PI, PSM-P2, associated with e.g., prostate cancer; (f) immunoglobulin idiotypes (associated with myeloma and B cell lymphomas, for example). In certain embodiments, tumor immunogens include, but are not limited to, p15, Hom / Mel-40, H- Ras, E2A-PRL, H4-RET, IGH-IGK, MYL-RAR, Epstein Barr virus antigens, EBNA, human papillomavirus (HPV) antigens, including E6 and E7, hepatitis B and C virus antigens, human T- cell lymphotropic virus antigens, TSP-180, p185erbB2, p180erbB-3, c-met, mn-23HI, TAG-72- 4, CA 19-9, CA 72-4, CAM 17.1, NuMa, K-ras, p16, TAGE, PSCA, CT7, 43-9F, 5T4, 791 Tgp72, beta-HCG, BCA225, BTAA, CA 125, CA 15-3 (CA 27.29&BCAA), CA 195, CA 242, CA-50, CAM43, CD68&KPI, CO-029, FGF-5, Ga733 (EpCAM), HTgp-175, M344, MA-50, MG7-Ag, MOV18, NB / 70K, NY-CO-I, RCASI, SDCCAG16, TA-90 (Mac-2 binding protein / cyclophilin C-associated protein), TAAL6, TAG72, TLP, TPS, and the like.

[0206] Compositions in accordance with the present disclosure comprise an effective amount of the lipid formulations described herein (e.g., LNP), as well as any other components, as needed. In embodiments, the pharmaceutical compositions described herein may be prepared by 43P2023-3389-WO any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of associating the active ingredient with an excipient and / or one or more other accessory ingredients.

[0207] A pharmaceutical composition in accordance with the present disclosure may be prepared, packaged, and / or sold in bulk, as a single unit dose, and / or as a plurality of single unit doses. As used herein, a “unit dose” refers to a discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient may generally be equal to the dosage of the active ingredient which would be administered to a subject and / or a convenient fraction of such a dosage including, but not limited to, one-half or one-third of such a dosage.

[0208] Relative amounts of the active ingredient, the pharmaceutically acceptable excipient, and / or any additional ingredients in a pharmaceutical composition in accordance with the present disclosure may vary, depending upon the identity, size, and / or condition of the subject being treated and further depending upon the route by which the composition is to be administered. For example, the composition may comprise between 0.1 percent and 99 percent (w / w) of the active ingredient.

[0209] Pharmaceutical formulations may additionally comprise a pharmaceutically acceptable excipient, which, as used herein, includes, but is not limited to, any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, and the like, as suited to the particular dosage form desired. Various excipients for formulating pharmaceutical compositions and techniques for preparing the composition are known in the art (see Remington: The Science and Practice of Pharmacy, 21st Edition, A. R. Gennaro, Lippincott, Williams and Wilkins, Baltimore, MD, 2006). The use of a conventional excipient medium is contemplated herein, except insofar as any conventional excipient medium may be incompatible with a substance or its derivatives, such as by producing any undesirable biological effect or otherwise interacting in a deleterious manner with any other component(s) of the pharmaceutical composition.

[0210] In some embodiments, the particle size of the lipid particles may be increased and / or decreased. The change in particle size may be able to help counter biological reaction such as, but not limited to, inflammation or may increase the biological effect of the NAT delivered to 44P2023-3389-WO mammals by changing biodistribution. Size may also be used to determine target tissue, with larger particles being cleared quickly and smaller one reaching different organ systems. The following is a description of representative lipid particles prepared with nucleic acid (LNP), how they are made, evidence of their advantages, and methods for using them to deliver therapeutic benefits. EXAMPLES

[0211] General considerations: All solvents and reagents were commercial products and used as such unless noted otherwise. Temperatures are given in degrees Celsius. ABBREVIATIONS

[0212] EPO = erythropoietin

[0213] GFP = green fluorescent protein

[0214] ug = microgram

[0215] pg = picogram

[0216] PBT-1 (or PB-1) and PBT-2 (or PB-2) are piggyBac based transposons designed in- house

[0217] ng = nanogram

[0218] g = gram

[0219] h = hour(s)

[0220] HPLC = High performance liquid chromatography

[0221] MFI = Mean Fluorescence Intensity

[0222] min = minute(s)

[0223] mL = milliliter(s)

[0224] mmol = millimole(s)

[0225] N / P ratio = the ratio of positively chargeable lipid amine (N = nitrogen) groups to negatively charged nucleic acid phosphate (P) groups

[0226] PBS = phosphate buffered solution

[0227] wt = weight

[0228] Deg. C = Degree Celsius

[0229] “Gene of interest” (GOI) signifies a genetic element or elements intended for expression to achieve a therapeutic goal, including immunization. Chimeric antigens, cancer- 45P2023-3389-WO associated antigens, autoimmune associated antigens, epidermal growth factor (EPO), eGFP are examples of a GOI, but GOI is not limited to these examples.

[0230] iL = ionizable lipid, a lipid that is cationic at lower pH, and converts to uncharged at higher pH. iLs are commonly used in formulations of nucleic acid cargo.

[0231] UT = untreated

[0232] MAR stands for “Matrix Attachment Region.” MARs are specific DNA sequences found within the genome that have the ability to bind to the nuclear matrix or scaffold proteins. They affect gene expression by promoting the accessibility of genes to transcription factors and other regulatory elements. S / MAR, or Scaffold / Matrix Attachment Region, refers to a specific type of MARS that serves as a binding site for nuclear scaffold or matrix proteins. S / MARs help tie the chromatin to the nuclear scaffold or matrix, contributing to the formation of chromatin loops and the establishment of functional domains within the nucleus.

[0233] In embodiments, the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) increases the transgene (GOI) expression. It is a sequence derived from the Woodchuck Hepatitis Virus (WHV). In the field of genetic engineering, the WPRE element is often used as a tool to enhance gene expression in various systems, including mammalian cells. The WPRE element functions by increasing the stability and efficiency of mRNA, which ultimately leads to higher levels of gene expression. It does this by facilitating nuclear export of the mRNA, preventing its degradation, and increasing its translation efficiency. These properties make the WPRE element a valuable tool for researchers who want to optimize gene expression in their experiments.

[0234] MAR seq (Ref: MAR characteristic motifs mediate episomal vector in CHO cells, Yan Lin, Zhaoxi Li, TianyunWanga, XiaoyinWang, Li Wang, Weihua Dong, Changqin Jing, Xianjun Yang (dx.doi.org / 10.1016 / j.gene.2015.01.032).) This example uses a 400 BP sequence of s / MARs, which was previously reported to have the ability to maintain the plasmid episomally. Moreover, the methods adds a T2A, amino acid sequence downstream to the reporter gene to avoid translation into the s / MARs, as the s / MARs sequence was reported to not promote nuclear integration if it was part of gene transcription. Further Beta globulin (BGA) poly-A signal was added downstream to the s / MARs. In this current pDNA, a human Ef1alpha promoter is used as it is one of the strong promoters and the 3NF (κB motifs) sequences located both upstream of the promoter and downstream of the reporter gene to enhance the localization 46P2023-3389-WO of DNA into the nucleus. Moreover, the examples use a unique RNA out system to avoid using bacterial antibiotic resistance genes. This RNAout mini vector backbone is from NTC. Episomally means a segment of DNA that can exist either autonomously in the cell or as part of a chromosome.

[0235] NF seq (Ref: An optimized extended DNA kappa B site that enhances plasmid DNA nuclear import and gene expression. (DOI: 10.1002 / jgm.1312)) Description: This non-viral vector is based on two key features apart from using RNA out bacterial minicircle vectors. First, adding DNA localization signal sequence (DLS) to plasmid DNA (pDNA) will allow intracellular nuclear targeting of pDNA and increase the nuclear import of the pDNA. Using the 3NF DLS sequence will be recognized by the nuclear factor kappa B (NFκB) transcription factor, which shuttles between the cytoplasm and the nucleus under specific conditions of T -cell activation.

[0236] The S / Mar, MAR, NF, and WPRE elements are collectively referred as UTRs (Untranslated regions).

[0237] In some embodiments, stabilizing agents include polyethylene glycol derivatives, including PEG-DMG 2000, TPGS (tocopherol polyethylene glycol succinate, e.g., TPGS 1000, TPGS 2000), maltoside, polysorbate 20, polysorbate 80, BRIJ S10 (polyoxyethylene alkyl ether), polyoxyethylene stearyl ether, Myrj52, or other suitable polymers, which have the purpose of extending circulation life, among other things.

[0238] Components of the lipid mixes may include the ionizable lipid, phospholipid, cholesterol, and stabilizing agent. Low pH formulation buffers (3-6) may be used in formulating the lipid nanoparticle. For ionizable lipids, the pH of the formulation buffer is typically below the pKa of the lipid. Table 2. Non-limiting examples of PNI ionizable lipids47P2023-3389-WO

[0239] The ionizable lipids of the present disclosure have asymmetric centers. It is to be understood that while specific configurations of non-limiting examples of ionizable lipids were shown in Table 2, in some embodiments, the ionizable lipids may occur as racemates, racemic mixtures, individual enantiomers, enantiomeric mixtures, individual diastereomers, or as diastereomeric mixtures, with all possible isomers like tautomers and mixtures thereof. Methods Isolation of T cells 48P2023-3389-WO

[0240] T cells were isolated from whole human blood, buffy coats, leukapheresis products, or other sources obtained from healthy or patient donors. Blood or apheresis material was treated with anticoagulants such as ACDA, EDTA, or heparin. Purification was performed using immunomagnetic selection methods (e.g., positive selection for CD3 or CD4 / CD8 cells or negative selection of non-T-cell populations), such that the resulting fraction typically contained CD4+ and CD8+ T cells. T Cell Cryopreservation and Recovery

[0241] Isolated T cells were cryopreserved in a cryoprotectant solution (for example, 10% DMSO or a proprietary commercial formulation such as the CryoStor® CS10 medium by STEMCELL Technologies) and stored in liquid or vapor-phase nitrogen. On the day of use, cryovials were thawed at about 37 °C. Thawed cells were transferred to a basal medium and washed at least once (by centrifugation) to remove residual cryoprotectant. Cell count was performed by automated fluorescent cell counter using acridine orange / propidium iodide solution to obtain live cell count. Primary T Cell Preparation

[0242] T cells must be activated to proliferate and differentiate into effector cells. In the lab, activation can be mimicked by a specific set of cytokines (signalling proteins) such as IL-2 and other proteins like CD2, CD3, CD28. Upon expansion, T cells will grow rapidly. Unless otherwise noted, all reagents were purchased from STEMCELL Technologies, Vancouver, Canada. Also, unless otherwise noted, all biologicals are human derived or human specific. Materials

[0243] Pan T cells (CD3+), primary, human, Stemcell Technologies, Cat.70024, ImmunoCult-XF™ T Cell Expansion Medium (Stemcell Technologies, Cat. No.10981), recombinant human IL-2 (Stemcell Technologies, Cat. No Cat. No 78036), ImmunoCult™ Human CD3 / CD28 / CD2 T Cell Activator (Stemcell Technologies, Cat. No.10970), recombinant human ApoE4 (Peprotech Cat. No.350-04), lyophilized human IL-2 (“IL-2”) (Peprotech Inc., Montreal, Canada). Transposon and Transposase

[0244] PB-1 and PB-2 were designed based on piggyBac DNA Vector. Transposases were required for efficient transposition of GOI between PB-vectors and chromosomes through a “cut- 49P2023-3389-WO and-paste” mechanism. Two versions of transposase mRNA were designed, PNI-IV (2128nt) and PNI-V (2128nt).

[0245] The transposases were both Clean Capped and include N1 methyl pseudouridine or unmodified uridine. Ten mg batches were analyzed using the TapeStation instrument (Agilent). Briefly, the PiggyBac and Super PiggyBac transposase genes were cloned in PUC19 vector containing poly-A, then the plasmid was subjected to Nde-1 restriction to prepare liner DNA template for IVT. The IVT reaction was carried out using Tris, MgCl2, spermidine, and NaCl containing buffer, T7 polymerase from NEB (Cat: M0251L), NTPs from ThermoFisher (Cat: R0481), CleanCap AG from Trilink (Cat: N-7113-100), N1-Methylpseudouridine-5'- Triphosphate from Trilink (Cat: N-1081) and iPPase from Sigma (Cat: I1643-500UN) for 3 hours. After that, the batches were subjected to one hour DNase digestion followed by RNA purification. Treatment

[0246] Cell density prior to LNP exposure was 25,000 cells / 100µL / well, 96 well plate, or 62,500 cells / 250µL / well in a 48 well plate. LNPs were added to wells at 250 ng dose / 625,00 cells (in n=4) or 4 µg / million cells containing 1 μg / mL of ApoE. Cell confluence was confirmed by counting cells under the microscope.

[0247] LNP with payload as well as control were added to the T cells typically on day three after thaw and activation but other timing strategy may be used. Viability Staining

[0248] On day of detection, the cells are transferred to 96-well plate and centrifuged at 300xg for 5 minutes at room temperature. Cells were the resuspended in 200 uL of 1:1000 FVS660v in PBS, except for unstained and GFP only wells. The cells were incubated at RT in the dark for 10 minutes. Centrifugation at 300xg for 5 minutes was then performed, supernatant removed, and the stain buffer was added. The cells were then centrifuged again, then washed with stain buffer again, and supernatant was removed, and the cells were resuspended by placing the pellet in the stain buffer and performing flow cytometry. CAR staining

[0249] Centrifuge the cells at 500 x g, 5 min remove supernatant or media add 200 uL viability stain to needed wells. Add 200 uL PBS to all others. Incubate 10 min in dark followed by centrifuge 500 x g, 5 min and remove supernatant, wash the cells with the stain buffer (BSA) 50P2023-3389-WO Centrifuge 500 x g, 5 min, repeat wash with the stain buffer. Add the anti-CAR(CD19) ~Biotin in the stain buffer to the CAR treated wells and to the untreated wells. Incubate for 10 min in the dark at room temperature, followed by harvesting and washing the cells with the stain buffer (BSA), and add the anti-Biotin~APC in the stain buffer to the CAR treated wells and to the untreated wells, Incubate 10 min in the dark. Top up wells with the stain buffer then centrifuge, remove supernatant, wash cells with stain buffer (BSA), Repeat wash with the stain buffer (BSA), Remove supernatant, add stain buffer (BSA), and performing flow cytometry. EXAMPLE 1 Microfluidic Mixing of Nucleic Acid into Lipid Nanoparticles (LNP) to form Lipid Nucleic Acid Particles (LNAP)

[0250] Lipid mix composition solutions were prepared in an organic phase including an organic solvent (e.g., ethanol) by combining prescribed amounts of lipids, including PNI ionizable lipids (e.g., non-limiting examples in Table 2), from individual lipid stocks in the organic solvent (e.g., ethanol).

[0251] For ionizable lipids, the pH of the formulation buffer in formulating lipid nanoparticles is typically below the pKa of the lipid. Once formulated, the nanoparticles can be suspended in any physiologically relevant buffer such as PBS, Dextrose, etc.

[0252] Messenger RNA or plasmid nucleic acid (pDNA) as described below, was diluted using a formulation buffer such as a low pH aqueous buffer (e.g., sodium acetate buffer) to the required concentration. DNA was prepared as described below.

[0253] All the DNA molecules were cloned and synthesized at Aldevron and dissolved in nuclease free water (1 mg / mL), while making LNPs the desired conc. of DNA solution was made.

[0254] Lipid nucleic acid particle (LNAP, or interchangeably referred to as “nucleic acid- containing lipid nanoparticles” (NA-LNP) or “lipid nanoparticles” (LNP)) samples were then prepared by running both fluids using mixing instruments such as the NanoAssemblr™ series including Spark™, Ignite™, or Ignite Plus™ mixing instrument. The lipid nucleic acid particles (LNAP) made in the instrument were immediately diluted down with Ca++ and Mg++ free 1X PBS at pH 7.4 in the aqueous output well. These LNAP were immediately collected into microcentrifuge tubes containing the same buffer at pH 7.4. Encapsulation efficiency was 51P2023-3389-WO measured by a modified Ribogreen™ assay (Quanti-iT RiboGreen™ RNA assay kit, Thermo Fisher Scientific). This information was used to establish the desired dosage.

[0255] In a non-limiting example, for preparing the nucleic acid-including LNP, an aqueous phase of nucleic acids in a low pH buffer (e.g., 100 mM sodium acetate buffer) was mixed with an organic phase of lipid mx composition in an organic solvent (e.g., lipid mx composition in ethanol) in a predefined N / P ratio (e.g., N / P of 2, 4, 6, 8, 10, 12, 14, 16, 18 or 20). The lipid nucleic acid particles (LNAP) formed were kept at room temperature for a predefined time (e.g., 3 min) and diluted down with Ca++ and Mg++ free 1X PBS at pH 7.4 . These LNAP were kept at 4 deg. C for a predefined time (e.g., 30-60 min) and subjected to a downstream processing such as one using Amicon™ centrifugal filters (Millipore, USA) or using TFF systems. Later, the encapsulation efficiency (EE) was measured by a modified PicoGreen / Ribogreen™ assay (Quanti-iT Picogram / RiboGreen™ RNA assay kit, Thermo Fisher Scientific).

[0256] Lipid nanoparticles encapsulating the nucleic acid payload were generated by rapidly mixing the organic phase including the lipid mix composition-ethanol solution with the aqueous buffer including the payload inside a microfluidic mixer designed to induce chaotic advection and provide a controlled mixing environment at intermediate Reynolds number (24 < Re < 1000). Non-limiting examples of the microfluidic channels include, but are not limited to, the channels describes in PCT Pub. No. WO2017117647, U.S. Patent Nos.10,835,878, .

[0257] In a non-limiting example, 350 μL of 1 mg / mL mRNA or pDNA was diluted using 100 mM sodium acetate buffer (pH 4) to the required concentration of 0.05 to 0.3 mg / mL depending on N / P ratio of 12, 10, 8, 6 or 4. Lipid nanoparticle samples were then prepared by running both fluids, namely, nucleic acids in aqueous buffer and lipid mix composition in ethanol at a predefined flow ratio and total flow rate (e.g., flow ratio of 3:1 and at a total flow rate of 12 mL / minute). Following mixing in the microfluidic device, the post cartridge lipid nucleic acid particle sample was diluted into RNAse free tubes containing three to 40 volumes of phosphate buffered saline (PBS) buffer, pH 7.4. Ethanol was finally removed using Amicon™ centrifugal filters (Millipore, USA) at 3000 RPM, or using TFF systems. Once the desired concentration was achieved, the lipid nucleic acid particles were filter sterilized using 200 μm filters in aseptic conditions. Final encapsulation efficiency was measured by a modified Ribogreen™ assay by using Quant-iT™ RiboGreen® RNA Reagent and Kit (Invitrogen) following manufacturer directions. mRNA and pDNA preparation is described below. Observed 52P2023-3389-WO particle attributes were generally sized from 50 – 200 nm for mRNA, depending on lipid composition.

[0258] After the lipid particles were made as described in above, particle size (hydrodynamic diameter of the particles) was determined by dynamic light scattering (DLS) using a ZetaSizer Nano ZS™, Malvern Instruments, UK). He / Ne laser of 633 nm wavelength was used as the light source. Data were measured from the scattered intensity data conducted in backscattering detection mode (measurement angle = 173). Measurements were an average of 10 runs of two cycles each per sample. Z-Average size was reported as the particle size and defined as the harmonic intensity averaged particle diameter. Particle size measurements were also done using Zetasizer Ultra (Malvern Instruments, UK) using multi angle dynamic Particle sizes and “polydispersity index” (PDI) of the lipid particle were measured by dynamic light scattering (DLS). PDI indicates the width of the particle distribution. This is a parameter calculated from a cumulative analysis of the (DLS)-measured intensity autocorrelation function assuming a single particle size mode and a single exponential fit to the autocorrelation function. From a biophysical point of view, a PDI below 0.1 indicates that the sample is monodisperse. A lower PDI indicates a more homogenous population of lipid particles. Table 3: Non-limiting examples of lipid mix compositions as defined by ionizable lipid / structural lipid / sterol / stabilizing agent mol% ratio, with the total mol% of the components in the lipid mix composition being 100 mol%.53P2023-3389-WO54P2023-3389-WO55P2023-3389-WO

[0259] The nucleic acid reagents or payloads used in the following experiments were: Trilink Cleancap eGFP mRNA: Cat. L-7601 (Trilink Biotechnologies, San Diego, CA); Trilink Cleancap PB mRNA (“PB mRNA”), Trilink Cleancap SPB mRNA (“SPB mRNA”), Trilink 56P2023-3389-WO Cleancap CD19 CAR mRNA, were made in-house using IVT plasmids. CD19 CAR Plasmid and in-house custom plasmids were synthesized in house, and off-the shelf plasmids were purchased from Aldevron, Fargo, ND (NTC9385R (3xCpG)-CMV-EGFP CpG free). The total size of these custom and off-the shelf plasmids range from 1600-4600 base pair (BP).

[0260] All T cell reagents were from StemCell Technologies unless otherwise stated. T cells were isolated from whole human peripheral blood using a negative selection isolation procedure (EasySepTMHuman T Cell Isolation Kit). T cell activation and expansion was carried out using Immunocult™ Human CD3 / CD28 / CD2 Activator in ImmunoCult™ Human T Cell Expansion Media supplemented with recombinant human IL-2 (Stemcell). Ap0E4 was purchased from Peprotech Inc., Rocky Hill USA. T cells typically enter a logarithmic phase of growth 48-96 hours after activation, which phase is characterized by a period of rapid proliferation and metabolic activity for 24-72 hours followed by a plateau in the growth curve as the cells start to return to a quiescent state. T cells may be exposed to lipid nucleic acid particle before or during the log phase of growth (e.g., day 0, day 1, day2, day 3, day 4 or day 5).

[0261] For mRNA testing, a CLEANCAPTMEGFP mRNA (Trilink Biotechnologies, Cat. No. L-7601) was used. EXAMPLE 2: DNA preparation

[0262] Plasmid DNA was purchased from Aldevron / Nature Technology, while the “PNI” plasmids were designed in house and cloned at Aldevron using NP-1 as the parental molecule or with plasmid as the parental backbone. All plasmid sequences were confirmed using Sanger sequencing and the plasmids stored in Nuclease (DNase / RNase) free water. Moreover, all the plasmids passed the endotoxin test and the amount of endotoxin present in the sample was between of 2 – 200 EU / mg. All of the plasmids were sized from 1600 - 4400 BP including the 500 BP plasmid backbone as mentioned in the following table. The ApoB 3′ S / MAR sequence was obtained from NCBI accession number- NG_042877.1 and MAR sequences was derived from human beta-interferon MAR (GenBank M83137.1). Table 4: Plasmid Genetic Elements 57P2023-3389-WO58P2023-3389-WOEXAMPLE 3 Plasmid delivery in T cells using LNPs

[0263] Plasmid DNA NP-1, NP-2, NP-3, or NP-4, was prepared via the NanoAssemblr™ Spark™ instrument formulation process and Composition LNP 1. The measurements conducted using Malvern DLS were as follows: The size of all formulated samples was within the range of 85-100 nm, as depicted in FIG. 1. Additionally, the Polydispersity Index (PDI) was consistently recorded at approximately 0.2. For Encapsulation Efficiency or EE: The results indicate an impressive encapsulation efficiency of approximately 95-100%. This finding highlights the successful encapsulation of plasmid DNA, mirroring the efficiency observed with mRNA.

[0264] The viability of cells treated with the Plasmid DNA NP-1, NP-2, NP-3, NP-4 and control mRNA was examined. Viability was normalized to untreated primary T cell viability following the transfection of plasmid DNA in combination with Trilink mRNA via lipid nanoparticles (LNPs). Flow cytometry experiments were conducted at 24, 48, 72, and 96 hours to examine T cell viability subsequent to pDNA transfection. Two different conditions were examined, namely transfection with 200 ng or 500 ng of plasmid DNA (FIG.2A and FIG.2B, respectively). The results indicate that the use of LNPs for plasmid DNA transfection is not detrimental to the primary T cells’ viability, as shown in FGIS.2A and 2B. Even at the higher concentration of 500 ng, the T cells exhibited good tolerance to the plasmid DNA. This is in contrast to prior studies involving electroporation, where different data trends were observed.

[0265] The expression of green fluorescent protein was used to visualize the ability of the plasmids in LNP to accomplish the goal of genetic expression. The plasmid transfection efficiency in primary T cells was assessed after introducing plasmid DNA via lipid nanoparticles 59P2023-3389-WO (LNPs) at different time points (24, 48, 72, and 96 hours). Two distinct conditions were investigated, transfection with 250 ng of plasmid DNA, and transfection with 500 ng of plasmid DNA. Percent GFP expression are shown in FIG. 3A for 250 ng and in FIG. 3B for 500 ng, respectively. MFI is shown in FIG.4A and 4B respectively. The findings demonstrate that the utilization of LNPs for plasmid DNA transfection can yield approximately 80% transfection efficiency for NP-1, while NP-2 to NP-4 can exhibit 55-60% transfection efficacy. In contrast, the control mRNA transfection (using 125 ng control mRNA) displayed a range of 80-85% efficiency. Interestingly, increasing the concentration of plasmid DNA from 250 to 500 ng did not lead to an improvement in transfection efficiency beyond 80%. In other words, the highest achievable transfection rate using these plasmids was approximately 80% at 48 hours and around 60-65% at 24 hours.

[0266] Similarly, the MFI results demonstrate that increasing concentration of plasmid DNA did not increase expression of eGFP when compared with dose regime with 250ng. EXAMPLE 4 Screening of various custom pDNA against mRNA

[0267] Several PNI plasmids were screened along with NP-1. The experiment was carried out using 250 ng of plasmid DNA and 250 ng of mRNA. The majority of these plasmids were engineered to facilitate prolonged expression of eGFP (or the gene of interest, GOI) beyond 48 hours using MAR and sMAR elements to maintain the pDNA even after cell division.

[0268] Transfection efficiency in terms of % transfection and MFI was tracked for up to two days.

[0269] Size and PDI are shown in FIG. 5A. Encapsulation Efficiency is shown in FIG. 5B. Key parameters measured in this evaluation include % Viability (FIG.5C), % GFP positive cells (FIG. 5D) and % transfection MFI or the expression level of GFP (FIG.5E). FIGS.5F and 5G illustrates MFI of PNI 762 -LNP_1 composition screen, respectively, using donor T cells purchased from Stem Cell Technologies. FIG.5H shows Transfection Efficiency (% TE) at 24, 48 and 72 hours post transfection in LNP_2, LNP_3, LNP_4, LNP_5 with NP1 plasmid DNA or eGFP mRNA encapsulated. FIG.5I shows MFI for the same compositions of FIG.5H at 24, 48 and 72 hours post transfection. FIGS. 5J and 5K show transfection efficiency (% eGFP) and MFI of the protein expression respectively for PNI 659- LNP_1 encapsulating NP-1 or eGFP mRNA in transfecting T-cells. In FIG.5J, LNP-1 composition with PNI 659 lipid showed around 80% TE for both pDNA (“NP-1”) and mRNA-eGFP in T cells using LNPs. FIG.5K 60P2023-3389-WO shows that pDNA (“NP-1”) showed higher expression of eGFP compared with eGFP-mRNA expression.

[0270] Key parameters measured in this evaluation include A) % cell viability post treatment, B) % GFP positive cells or % transfection, and C) MFI or the expression level of GFP. EXAMPLE 5 PiggyBac insertion of eGFP cassette in primary T-Cells using LNP as delivery carrier

[0271] The PiggyBac Transposon includes an ITR, gene of interest or GOI or cargo, another ITR, and is accompanied by PiggyBac Transposase which enables cut and paste into the genomic DNA. Two versions of PiggyBac cassette pDNA capable of delivering up to 200 kb were designed, “PB-1” and “PB-2”. Two transposases were also designed, PNI-IV (2128 nt) and PNI- V (2128 nt) for efficient transposition of GOI between PB-vectors and chromosomes through a “cut-and-paste” mechanism. Both RNAs were clean capped and modified with N1 methyl pseudouridine in quantity of 10 mg each, and quality tested using the TapeStation™ automated electrophoresis instrument (Agilent, Santa Clara, CA).

[0272] T cells were thawed and activated, and mRNA and pDNA LNPs were added together to transfect the T cells. Detection was performed at 48 h, 72 h, and days 5, 7, 10 and 15 post transfection. Fresh media was also added to the main culture at 48 h, 72 h, days 5, 7 and 9.

[0273] Co-dosing of 250 ng of pDNA and 250 ng mRNA was used. The lipid nanoparticle formulation was PNI-550 in LNP 1. The viability was around 80-85% at day 1 and it reached 95% at day 2, which confirms that LNP delivery of pDNA was better than electroporation for cell health. (For reference, the current industry standard is electroporation at 2400V, with 50 ug / mL Transposase doses needed. Resulting donor specific CAR expression is generally 10 to 45 percent in the electroporation method, and cell recovery is 20 to 60 percent.)

[0274] In the method of the instant disclosure, PiggyBac insertion of eGFP cassette are delivered to primary T cells using LNPs as delivery mode. SPB / PB mRNA was modified with N1 methyl pseudouridine. Viability for primary T cells post LNP treatment / transfection are shown in FIGS.6A and 6B for two different primary T cell donors (FIG.6A, donor-1; FIG.6B, donor-2). Percent GFP integration is shown for Day 1 and Day 2 post LNP treatment for the same cells in FIGS. 7A and 7B. 61P2023-3389-WO

[0275] In this experiment we tested two donors (Donor-1 and 2), and the SPB / PB mRNAs were modified with N1 methyl pseudouridine. PiggyBac insertion of eGFP cassette in primary T cells using LNPs as delivery mode, PNI 550-LNP 1. The MFI is shown for Donor -1 primary T cells in FIG.8A, and for Donor -2 primary T cells in FIG.8B. UT is untreated T cells used as a control. In the examples (of FIGS.8A-B and as similarly described throughout the current disclosure), payload encoding mRNA was either added alone (e.g., PNI-IV) or in combination with pDNA (e.g., PNI-IV_PNI22). EXAMPLE 6 Effects of ionizable lipid on gene insertion

[0276] Four different combinations of genetic elements were tested for each lipid. LNP 1 composition was used for LNP preparation in all cases while the ionizable lipid was varied. MFI and %GFP expression were assessed on days 2, 3, 5, 7, and 10 post LNP treatment. Results are shown in FIGS.9A – 14H for PNI 550 (FIGS.9A-9H), PNI 565 (FIGS.10A-10H), PNI 728 (FIGS. 11A-11H), PNI 761 (FIGS.12A-12H), PNI 762 (FIGS. 13A-13J), and PNI 769 (FIGS. 14A-14H), respectively.

[0277] The cell line used was a human PB Pan-T, Stemcell Catalog Number 70024. Table 5: Summary of Results for Different Combinations of Lipid and Genetic Payloads. Results are based on the ranges of % eGFP integration during days 2, 3, 5, and 7 post LNP treatment, as illustrated in corresponding figures in FIGS.9A – 14H.62P2023-3389-WO

[0278] For all combinations, T cell viability was high, at 100% by day 10 for all lipids (results not shown), and the non-limiting examples of the lipid compositions including various ionizable lipids were effective as non-viral delivery of PiggyBac transposons with around 80% gene integration. Both PB and SPB mRNAs showed around 60-80% DNA insertions using PB1 and PB2 pDNA. PNI 762 showed around 70-80% eGFP over period of 10 days with highest MFI at given combinations. Other lipids PNI 761, PNI 565, PNI 728 and PNI 769 showed around 50-60% eGFP positive cells. PNI-lipids successfully delivered both pDNA and mRNA into primary T cells without any toxicity. Example 7

[0279] The influence of s / MAR, MAR, and NF sequence positioning in protein expression is illustrated in FIGS.15A-15B, with certain combinations of positions significantly affecting protein expression levels. As illustrated in FIG.15A, certain plasmids with combinations where s / MAR precedes the poly-A signal were less effective than others (e.g., as observed in NP-12 and NP-20 plasmids). Conversely, positioning s / MAR after the poly-A signal did not detrimentally affect expression; in fact, a significant increase in eGFP expression was observed comparatively in plasmids NP-7, NP-9, NP-18, and NP-21 compared to that of plasmids NP-12 and NP-20.

[0280] Furthermore, the placement of MAR sequences after the Poly A signal, either in combination with NF or independently, led to a notable increase in the percentage of %TE (FIG. 15A) and eGFP protein expression levels (FIG.15B) in plasmids NP-10 and NP-11. This suggests that MAR sequences are particularly advantageous for protein expression (FIG. 15B). Example 8

[0281] LNPs for the delivery of CD19 chimeric antigen receptor (CAR) expression pDNA PNI-24 (a plasmid made to order by Aldevron) or transposon insertions of CD19-CAR cassette in human primary cells using LNPs.

[0282] In primary T cells we transfected CD19-CAR DNA encapsulated in lipid nanoparticles and measured % viability, quantified % transfection efficacy (% CAR TE) using flow cytometry, and analyzed the CAR expression profile (e.g., MFI) towards CAR – T cell 63P2023-3389-WO therapy applications. FIGS. 16A-16E and FIGS.17A-17E illustrated the effects of PNI 768 and PNI 762 LNP_1 and LNP_6 combinations of ionizable lipids and lipid mix formulations on the delivery to human primary T cells of CAR pDNA delivery along with CAR mRNA, at 24 hrs (FIGS.16A-16E) and 48 hrs (FIGS.17A-17E) post T cell transfection, respectively. Above 90% cell viability and transfection efficiency in both 250 ng and 500 ng doses were achieved, as shown in FIGS. 16A-17E. Due to gentle nature of lipid nanoparticle mediated delivery, we achieved transfection efficiency (94% TE) higher than what can be achieved with electroporation.

[0283] These findings suggest that LNPs offer an enhanced platform for the delivery of large DNA like CD19 CAR into primary T cells. The increased transfection efficiency, % viability and cell yield highlight the potential advantages of LNPs for cell-based therapeutics development for various diseases including cancer, HIV, autoimmune disorders and so on. Example 9 Cell killing assay Effector Cell Preparation

[0284] Primary human T cells expressing CD19 CAR were prepared and transfection efficiency was determined using flow cytometry. CAR-T cells and untreated (UT) cells were washed and resuspended in RPMI 1640 media (ThermoFisher Scientific, catalog # 11875093) supplemented with 2% fetal bovine serum (FBS). Target Cell Preparation

[0285] SUP-B15 cells were obtained from ATCC (Manassas, Virginia, USA ). K562 was obtained from ATCC (Manassas, Virginia, USA) . On the day of co-culture, CD19+ target SUP- B15 cells and CD19- control K562 cells were stained with VPD450 dye (BD Biosciences, catalog # 562158). Cells were washed with PBS, incubated with a 1:1000 dilution of VPD450 dye in PBS for 10 minutes at 37°C, protected from light. After incubation, cells were washed with PBS and complete media containing 10% FBS, then resuspended in RPMI 1640 media supplemented with 10% FBS to achieve a final cell concentration of 1 x 10⁶ cells / mL. Uniform staining of VPD450 dye was confirmed using flow cytometry. Co-culture Set-up 64P2023-3389-WO

[0286] Effector CAR-T cells and target B cells were co-cultured in 96-well plates at varying effector-to-target (E:T) ratios based on cell numbers (0.25:1, 0.5:1, 1:1, 2:1, 5:1) for 18-24 hours in RPMI 1640 media supplemented with 2% FBS. Detection of CD19-specific killing of B Cells

[0287] Following co-culture, the plate was centrifuged at 300 x g for 5 minutes at room temperature (RT), and the supernatant was removed. A fixable viability dye eFluor™ 660, FVS660 (ThermoFisher, catalog # 65086414), diluted 1:1000 in PBS, was added in a volume of 200 µL to the treated, untreated, and various fluorescence minus one (FMO) wells. For all other wells, 200 µL of PBS was added. The plate was incubated for 10 minutes in the dark at RT, then centrifuged again at 300 x g for 5 minutes, and the supernatant was discarded. Each well received 200 µL of BSA stain buffer (BD Biosciences, Cat# 554657). The plate underwent two wash cycles, each involving centrifugation at 300 x g for 5 minutes at RT and removal of the supernatant. Data acquisition was performed using CytoFLEXTM(Beckman Coulter) and analyzed using FlowJo V10.10.0 software. Specific Lysis Calculation

[0288] Specific lysis was determined by normalizing cell viability in anti-CD19 CAR-T cell co-culture (CAR) to untreated T cell-target cell co-culture control (UT) according to the following equation (I):

[0289] FIG. 18A shows specific lysis of leukemic B cell line by CD19 CAR T cells generated using mRNA or transposon LNP. Effector cells were created by expressing CD19 CAR in primary human T cells via mRNA LNP transfection or LNP-mediated co-delivery of CD19 CAR encoded PB2 transposon vector and SPB transposase. Target cells (SUP-B15, CD19+; K562, CD19-) were stained with VPD450 before co-culture with CD19 CAR T cells at specified Effector:Target ratios. After 24 hours, co-culture wells were stained with FVS660 viability dye and analyzed by flow cytometry. Specific lysis was determined by quantifying VPD450+FVS660+ cells.

[0290] FIG. 18B shows specific lysis of leukemic B cell line by transposon CD19 CAR T cells 2 or 7 days following LNP addition / transfection of cells. Effector cells were generated by 65P2023-3389-WO expressing CD19 CAR in primary human T cells via LNP-mediated co-delivery of CD19 CAR encoded PB2 transposon vector and SPB transposase. Target cells (SUP-B15, CD19+; K562, CD19-) were stained with VPD450 before co-culture with CD19 CAR T cells at specified Effector:Target ratios. Specific lysis of transposon CD19 CAR-T cells was tested 2 days and 7 days after LNP addition. After 24 hours, co-culture wells were stained with FVS660 viability dye and analyzed by flow cytometry. Specific lysis was determined by quantifying VPD450+FVS660+ cells. SEQUENCES

[0291] The sequence information of the expression cassette for all DNA is given below.

[0292] The S / Mar, MAR, NF, and WPRE elements are collectively referred as UTRs (Untranslated regions).

[0293] Bolded residues is promoter with GOI (eGFP) and poly A signal

[0294] S / Mar is non bold letters seq. The ApoB 3′ S / MAR (NG_042877.1)

[0295] WPRE element is Italic – Woodchuck Hepatitis Virus Postranslational Regulatory Element woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) known to increase the transgene (GOI) ex

[0296] MAR seq is non bold Underline text (Ref: MAR characteristic motifs mediate episomal vector in CHO cells, Yan Lin a,c, Zhaoxi Li b, TianyunWanga,^, XiaoyinWang a, Li Wanga, Weihua Dong a, Changqin Jing b, Xianjun Yang (dx.doi.org / 10.1016 / j.gene.2015.01.032).)

[0297] NF seq is bold dashed underline (Ref: An optimized extended DNA kappa B site that enhances plasmid DNA nuclear import and gene expression. (DOI: 10.1002 / jgm.1312)) The consensus κB site has a partial palindromic sequence, where R is any purine (A or G), N is any nucleotide, W is A or T, and Y is any pyrimidine (C or T). SEQ ID NO: 1

[0298] ggtaccccggctctagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttac ataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaac gccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgcca agtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggc agtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacg 66P2023-3389-WO gggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaac tccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgc ctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccgcggctcgcatctctccttcacgcg cccgccgccctacctgaggccgccatccacgccggttgagtcgcgttctgccgcctcccgcctgtggtgcctcctgaactgcgtccgc cgtctaggtaagtttaaagctcaggtcgagaccgggcctttgtccggcgctcccttggagcctacctagactcagccggctctccac gctttgcctgaccctgcttgctcaactctagttctctcgttaacttaatgagacagatagaaactggtcttgtagaaacagagtagtcg cctgcttttctgccaggtgctgacttctctcccctgggcttttttctttttctcaggttgaaaagaagaagacgaagaagacgaagaag acaaaccgtcgtcgtagaCTGGGGACTTTCCAGCTGGGGACTTTCCAGCTGGGGACTTTC CAGGCTGGGGACTTTCCAGCTGGGGACTTTCCAGCTGGGGACTTTCCAGGggatc cgtcgtcgacgccgccaccatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgac gtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcacca ccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatg aagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactaca agacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggc aacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaag gtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgac ggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatg gtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagGGTAGCGGTgagggcagag gaagtctgctaacatgcggtgacgtcgaggagaaccctgggcccgtgagtgcgcCTTCTCCACTCCTGGCAGGCT GAGTGAAATAAAGGACTTGTTATTTCATCTCGAGGCCTACCGGAGAGCCTTGCCTTG CAAAGGCAGACAGTCAGTGAGGAAGACTATGTGGCACATGAAGACACCAGAGGTGT TCCTCAGGATCAAAGTATGTACAAGCCTTTGTGAATATTTTTTCCTTCTCACTTGGCA AATACAATTCCTGAGATCAATAACCTCGTCTTTTTAATTTTTTCCTCGTCTTTTTAACT ATTTATAAAATATTGAATTATAAAATATGTAATTATAAATACTTTAATTATAAAATA TGTAATTATAAATACTTTAATTATAAAATATGTAATTATAAATACTTTATAAAATATG TAATTATAAAATATGTAATTATAAACATTTTAATTATAAAATATGTAATTATAAACA TTTTAATTATAAAATATGTAATTATAAACctgggcctaggccagaATTTTAATTATAAAATAT GTAATTATAAACATTTTAATTATAAAATATGTAATTATAAACATTTTAATTATAAAAT ATTTAATTATAAACATTTTAATTATAAAATATTTAATTATAAATATTTTAATTATAAA ATATTTAATTATAAATATTTTAATTATAAAATATTTAATTATAAATATTTTAATTATA AAATATTTAATTATAAATACTTTAATTATAAAATATTTAATTATAAATATTTTAATTA 67P2023-3389-WO TAAAATATTTAATTATAAATATTTTAATTATAAATATTTTAATTATAAAATATTTAAT TATAAAAACACAATTACCTCATCTTTTTAAATATTTTTGCAAAATATTTCCCTCCATA ATTTCTCCGTTTCCATTTTTATTCTGTTACTTAAATTAAtgtcttacaggttgaaaagaagaagacga agaagacgaagaagacccgcgaattcctgcagccagggggatcagcctctactgtgccttctagttgccagccatctgttgtttgcc cctcccccttgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcacattgtctgagt aggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggat gcagtgggctctatgggCTGGGGACTTTCCAGCTGGGGACTTTCCAGCTGGGGACTTTCC AGGCTGGGGACTTTCCAGCTGGGGACTTTCCAGCTGGGGACTTTCCAGGCTGGGACTTTCCAGCTGGGGACTTTCCAGCTGGGGACTTTCCAGG SEQ ID NO: 2

[0299] ggtaccccggctctagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttac ataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaac gccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgcca agtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggc agtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacg gggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaac tccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgc ctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccgcggctcgcatctctccttcacgcg cccgccgccctacctgaggccgccatccacgccggttgagtcgcgttctgccgcctcccgcctgtggtgcctcctgaactgcgtccgc cgtctaggtaagtttaaagctcaggtcgagaccgggcctttgtccggcgctcccttggagcctacctagactcagccggctctccac gctttgcctgaccctgcttgctcaactctagttctctcgttaacttaatgagacagatagaaactggtcttgtagaaacagagtagtcg cctgcttttctgccaggtgctgacttctctcccctgggcttttttctttttctcaggttgaaaagaagaagacgaagaagacgaagaag acaaaccgtcgtcgacgccgccaccatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggac ggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatct gcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgac cacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggca actacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggagg acggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggca tcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcg gcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatc 68P2023-3389-WO acatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagGGTAGCGGTgagggc agaggaagtctgctaacatgcggtgacgtcgaggagaaccctgggcccgtgagtgcgcCTTCTCCACTCCTGGCAG GCTGAGTGAAATAAAGGACTTGTTATTTCATCTCGAGGCCTACCGGAGAGCCTTGCC TTGCAAAGGCAGACAGTCAGTGAGGAAGACTATGTGGCACATGAAGACACCAGAGG TGTTCCTCAGGATCAAAGTATGTACAAGCCTTTGTGAATATTTTTTCCTTCTCACTTG GCAAATACAATTCCTGAGATCAATAACCTCGTCTTTTTAATTTTTTCCTCGTCTTTTTA ACTATTTATAAAATATTGAATTATAAAATATGTAATTATAAATACTTTAATTATAAA ATATGTAATTATAAATACTTTAATTATAAAATATGTAATTATAAATACTTTATAAAAT ATGTAATTATAAAATATGTAATTATAAACATTTTAATTATAAAATATGTAATTATAA ACATTTTAATTATAAAATATGTAATTATAAACctgggcctaggccagaATTTTAATTATAAAA TATGTAATTATAAACATTTTAATTATAAAATATGTAATTATAAACATTTTAATTATAA AATATTTAATTATAAACATTTTAATTATAAAATATTTAATTATAAATATTTTAATTAT AAAATATTTAATTATAAATATTTTAATTATAAAATATTTAATTATAAATATTTTAATT ATAAAATATTTAATTATAAATACTTTAATTATAAAATATTTAATTATAAATATTTTAA TTATAAAATATTTAATTATAAATATTTTAATTATAAATATTTTAATTATAAAATATTT AATTATAAAAACACAATTACCTCATCTTTTTAAATATTTTTGCAAAATATTTCCCTCC ATAATTTCTCCGTTTCCATTTTTATTCTGTTACTTAAATTAAtgtcttacaggttgaaaagaagaag acgaagaagacgaagaagacccgcgaattcctgcagccagggggatcagcctctactgtgccttctagttgccagccatctgttgtt tgcccctcccccttgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcacattgtctg agtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggg gatgcagtgggctctatgggCTGGGGACTTTCCAGCTGGGGACTTTCCAGCTGGGGACTTT CCAGGCTGGGGACTTTCCAGCTGGGGACTTTCCAGCTGGGGACTTTCCAGGCT GGGGACTTTCCAGCTGGGGACTTTCCAGCTGGGGACTTTCCAGG SEQ ID NO: 3

[0300] ggtaccccggctctagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttac ataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaac gccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgcca agtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggc agtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacg gggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaac 69P2023-3389-WO tccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgc ctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccgcggctcgcatctctccttcacgcg cccgccgccctacctgaggccgccatccacgccggttgagtcgcgttctgccgcctcccgcctgtggtgcctcctgaactgcgtccgc cgtctaggtaagtttaaagctcaggtcgagaccgggcctttgtccggcgctcccttggagcctacctagactcagccggctctccac gctttgcctgaccctgcttgctcaactctagttctctcgttaacttaatgagacagatagaaactggtcttgtagaaacagagtagtcg cctgcttttctgccaggtgctgacttctctcccctgggcttttttctttttctcaggttgaaaagaagaagacgaagaagacgaagaag acaaaccgtcgtcgacgccgccaccatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggac ggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatct gcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgac cacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggca actacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggagg acggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggca tcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcg gcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatc acatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaaccgcgaattcctgcagcc agggggatcagcctctactgtgccttctagttgccagccatctgttgtttgcccctcccccttgccttccttgaccctggaaggtgccac tcccactgtcctttcctaataaaatgaggaaattgcatcacattgtctgagtaggtgtcattctattctggggggtggggtggggcag gacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcagtgggctctatgggCTTCTCCACTCCT GGCAGGCTGAGTGAAATAAAGGACTTGTTATTTCATCTCGAGGCCTACCGGAGAGC CTTGCCTTGCAAAGGCAGACAGTCAGTGAGGAAGACTATGTGGCACATGAAGACAC CAGAGGTGTTCCTCAGGATCAAAGTATGTACAAGCCTTTGTGAATATTTTTTCCTTCT CACTTGGCAAATACAATTCCTGAGATCAATAACCTCGTCTTTTTAATTTTTTCCTCGT CTTTTTAACTATTTATAAAATATTGAATTATAAAATATGTAATTATAAATACTTTAAT TATAAAATATGTAATTATAAATACTTTAATTATAAAATATGTAATTATAAATACTTTA TAAAATATGTAATTATAAAATATGTAATTATAAACATTTTAATTATAAAATATGTAA TTATAAACATTTTAATTATAAAATATGTAATTATAAACATTTTAATTATAAAATATGT AATTATAAACATTTTAATTATAAAATATGTAATTATAAACATTTTAATTATAAAATAT TTAATTATAAACATTTTAATTATAAAATATTTAATTATAAATATTTTAATTATAAAAT ATTTAATTATAAATATTTTAATTATAAAATATTTAATTATAAATATTTTAATTATAAA ATATTTAATTATAAATACTTTAATTATAAAATATTTAATTATAAATATTTTAATTATA AAATATTTAATTATAAATATTTTAATTATAAATATTTTAATTATAAAATATTTAATTA 70P2023-3389-WO TAAAAACACAATTACCTCATCTTTTTAAATATTTTTGCAAAATATTTCCCTCCATAAT TTCTCCGTTTCCATTTTTATTCTGTTACTTAAATG SEQ ID NO: 4

[0301] ggctctagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataactta cggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaata gggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgc cccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacat ctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttc caagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgcccc attgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgcctggagac gccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccgcggctcgcatctctccttcacgcgcccgccgc cctacctgaggccgccatccacgccggttgagtcgcgttctgccgcctcccgcctgtggtgcctcctgaactgcgtccgccgtctagg taagtttaaagctcaggtcgagaccgggcctttgtccggcgctcccttggagcctacctagactcagccggctctccacgctttgcct gaccctgcttgctcaactctagttctctcgttaacttaatgagacagatagaaactggtcttgtagaaacagagtagtcgcctgctttt ctgccaggtgctgacttctctcccctgggcttttttctttttctcaggttgaaaagaagaagacgaagaagacgaagaagacaaacc gtcgtcgacatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggcc acaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagct gcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacg acttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgcc gaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctgggg cacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaag atccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctg ctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagtCAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATA CGCTGCTTTAATGCCTTTGTATCATGCGTTctgcagccagggggatcagcctctactgtgccttctagttgccagc catctgttgtttgcccctcccccttgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcat cacattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcag gcatgctggggatgcagtgggctctatggg 71P2023-3389-WO SEQ ID NO: 5

[0302] ggctctagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataactta cggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaata gggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgc cccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacat ctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttc caagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgcccc attgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgcctggagac gccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccgcggctcgcatctctccttcacgcgcccgccgc cctacctgaggccgccatccacgccggttgagtcgcgttctgccgcctcccgcctgtggtgcctcctgaactgcgtccgccgtctagg taagtttaaagctcaggtcgagaccgggcctttgtccggcgctcccttggagcctacctagactcagccggctctccacgctttgcct gaccctgcttgctcaactctagttctctcgttaacttaatgagacagatagaaactggtcttgtagaaacagagtagtcgcctgctttt ctgccaggtgctgacttctctcccctgggcttttttctttttctcaggttgaaaagaagaagacgaagaagacgaagaagacaaacc gtcgtcgacatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggcc acaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagct gcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacg acttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgcc gaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctgggg cacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaag atccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctg ctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagtCAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATA CGCTGCTTTAATGCCTTTGTATCATGCGTTctgcagccagggggatcagcctctactgtgccttctagttgccagc catctgttgtttgcccctcccccttgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcat cacattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcag gcatgctggggatgcagtgggctctatgggCTTCTCCACTCCTGGCAGGCTGAGTGAAATAAAGGAC TTGTTATTTCATCTCGAGGCCTACCGGAGAGCCTTGCCTTGCAAAGGCAGACAGTCA GTGAGGAAGACTATGTGGCACATGAAGACACCAGAGGTGTTCCTCAGGATCAAAGT ATGTACAAGCCTTTGTGAATATTTTTTCCTTCTCACTTGGCAAATACAATTCCTGAGA TCAATAACCTCGTCTTTTTAATTTTTTCCTCGTCTTTTTAACTATTTATAAAATATTGA 72P2023-3389-WO ATTATAAAATATGTAATTATAAATACTTTAATTATAAAATATGTAATTATAAATACTT TAATTATAAAATATGTAATTATAAATACTTTATAAAATATGTAATTATAAAATATGT AATTATAAACATTTTAATTATAAAATATGTAATTATAAACATTTTAATTATAAAATAT GTAATTATAAACATTTTAATTATAAAATATGTAATTATAAACATTTTAATTATAAAAT ATGTAATTATAAACATTTTAATTATAAAATATTTAATTATAAACATTTTAATTATAAA ATATTTAATTATAAATATTTTAATTATAAAATATTTAATTATAAATATTTTAATTATA AAATATTTAATTATAAATATTTTAATTATAAAATATTTAATTATAAATACTTTAATTA TAAAATATTTAATTATAAATATTTTAATTATAAAATATTTAATTATAAATATTTTAAT TATAAATATTTTAATTATAAAATATTTAATTATAAAAACACAATTACCTCATCTTTTT AAATATTTTTGCAAAATATTTCCCTCCATAATTTCTCCGTTTCCATTTTTATTCTGTTA CTTAAATG SEQ ID NO: 6

[0303] ggtaccccggctctagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttac ataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaac gccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgcca agtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggc agtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacg gggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaac tccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgc ctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccgcggctcgcatctctccttcacgcg cccgccgccctacctgaggccgccatccacgccggttgagtcgcgttctgccgcctcccgcctgtggtgcctcctgaactgcgtccgc cgtctaggtaagtttaaagctcaggtcgagaccgggcctttgtccggcgctcccttggagcctacctagactcagccggctctccac gctttgcctgaccctgcttgctcaactctagttctctcgttaacttaatgagacagatagaaactggtcttgtagaaacagagtagtcg cctgcttttctgccaggtgctgacttctctcccctgggcttttttctttttctcaggttgaaaagaagaagacgaagaagacgaagaag acaaaccgtcgtcgacatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgta aacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccg gcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaag cagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagac ccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacat cctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaa 73P2023-3389-WO cttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccc cgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGT GGATACGCTGCTTTAATGCCTTTGTATCATGCGTTctgcagccagggggatcagcctctactgtgccttctag ttgccagccatctgttgtttgcccctcccccttgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgagga aattgcatcacattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagac aatagcaggcatgctggggatgcagtgggctctatggGGTACCAATATATTTAATATATTTAGTTTATAT ACATCTACAGATAAATACATATCATATATTTGAATTCTAATCTCCCTCTCAACCCTAC AGTCACCCATTTGGTATATTAAAGATGTGTTGTCTACTGTCTAGTATCCCTCAAGCAG TGTCAGGAATTAGTCATTTAAATAGTCTGCAAGCCAGGAGTGGTGGCTCATGTCTGT AATTCCAGCACTTGAGAGGTAGAAGTGGGAGGACTGCTTGAGCTCAAGAGTTTGAT ATTATCCTGGACAACATAGCAAGACCTCGTCTCTACTTAAAAAAAAAAAATTAGCCA GGCATGTGATGTACACCTGTAGTCCCAGCTACTCAGGAGGCCGAAATGGGAGGATC AGATCTGGATCCCTGGGGACTTTCCAGCTGGGGACTTTCCAGCTGGGGACTTTC CAGGCTGGGGACTTTCCAGCTGGGGACTTTCCAGCTGGGGACTTTCCAGGCTG GGGACTTTCCAGCTGGGGACTTTCSEQ ID NO: 7

[0304] ggtaccccggctctagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttac ataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaac gccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgcca agtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggc agtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacg gggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaac tccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgc ctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccgcggctcgcatctctccttcacgcg cccgccgccctacctgaggccgccatccacgccggttgagtcgcgttctgccgcctcccgcctgtggtgcctcctgaactgcgtccgc cgtctaggtaagtttaaagctcaggtcgagaccgggcctttgtccggcgctcccttggagcctacctagactcagccggctctccac gctttgcctgaccctgcttgctcaactctagttctctcgttaacttaatgagacagatagaaactggtcttgtagaaacagagtagtcg cctgcttttctgccaggtgctgacttctctcccctgggcttttttctttttctcaggttgaaaagaagaagacgaagaagacgaagaag 74P2023-3389-WO acaaaccgtcgtcgacatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgta aacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccg gcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaag cagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagac ccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacat cctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaa cttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccc cgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGT GGATACGCTGCTTTAATGCCTTTGTATCATGCGTTctgcagccagggggatcagcctctactgtgccttctag ttgccagccatctgttgtttgcccctcccccttgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgagga aattgcatcacattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagac aatagcaggcatgctggggatgcagtgggctctatggGGTACCAATATATTTAATATATTTAGTTTATAT ACATCTACAGATAAATACATATCATATATTTGAATTCTAATCTCCCTCTCAACCCTAC AGTCACCCATTTGGTATATTAAAGATGTGTTGTCTACTGTCTAGTATCCCTCAAGCAG TGTCAGGAATTAGTCATTTAAATAGTCTGCAAGCCAGGAGTGGTGGCTCATGTCTGT AATTCCAGCACTTGAGAGGTAGAAGTGGGAGGACTGCTTGAGCTCAAGAGTTTGAT ATTATCCTGGACAACATAGCAAGACCTCGTCTCTACTTAAAAAAAAAAAATTAGCCA GGCATGTGATGTACACCTGTAGTCCCAGCTACTCAGGAGGCCGAAATGGGAGGATC AGATCTGGATC SEQ ID NO: 8

[0305] tactatcaacaggttgaactgctgatctgtacagtagaattggtaaagagagttgtgtaaaatattgagttcgcacat cttgttgtctgattattgatttttggcgaaaccatttgatcatatgacaagatgtgtatctaccttaacttaatgattttgataaaaatcat taggtaccgagctcggatccactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttaca taacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacg ccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaa gtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggca gtacatctacgtattagtcatcgctattaccatggtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacc cccaattttgtatttatttattttttaattattttgtgcagcgatgggggcggggggggggggggcgcgcgccaggcggggcggggc 75P2023-3389-WO ggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatg gcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgcgctgccttcgccccgtgccc cgctccgccgccgcctcgcgccgcccgccccggctctgactgaccgcgttactcccacaggtgagcgggcgggacggcccttctcc tccgggctgtaattagcgcttggtttaatgacggcttgtttcttttctgtggctgcgtgaaagccttgaggggctccgggagggcccttt gtgcggggggagcggctcggggggtgcgtgcgtgtgtgtgtgcgtggggagcgccgcgtgcggctccgcgctgcccggcggctgt gagcgctgcgggcgcggcgcggggctttgtgcgctccgcagtgtgcgcgaggggagcgcggccgggggcggtgccccgcggtgc ggggggggctgcgaggggaacaaaggctgcgtgcggggtgtgtgcgtgggggggtgagcagggggtgtgggcgcgtcggtcgg gctgcaaccccccctgcacccccctccccgagttgctgagcacggcccggcttcgggtgcggggctccgtacggggcgtggcgcgg ggctcgccgtgccgggcggggggtggcggcaggtgggggtgccgggcggggcggggccgcctcgggccggggagggctcggg ggaggggcgcggcggcccccggagcgccggcggctgtcgaggcgcggcgagccgcagccattgccttttatggtaatcgtgcga gagggcgcagggacttcctttgtcccaaatctgtgcggagccgaaatctgggaggcgccgccgcaccccctctagcgggcgcggg gcgaagcggtgcggcgccggcaggaaggaaatgggcggggagggccttcgtgcgtcgccgcgccgccgtccccttctccctctcc agcctcggggctgtccgcggggggacggctgccttcgggggggacggggcagggcggggttcggcttctggcgtgtgaccggcg gctctagagcctctgctaaccatgttcatgccttcttctttttcctacagctcctgggcaacgtgctggttattgtgctgtctcatcatttt ggcaaagaattcgtctagaCTGGGGACTTTCCAGCTGGGGACTTTCCAGCTGGGGACTTT CCAGGCTGGGGACTTTCCAGCTGGGGACTTTCCAGCTGGGGACTTTCCAGGgga tccgtcgtcgacgccgccaccatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcg acgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcac caccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccaca tgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactac aagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacgg caacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaa ggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcga cggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacat ggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagGGTAGCGGTgagggcaga ggaagtctgctaacatgcggtgacgtcgaggagaaccctgggcccgtgagtgcgcCTTCTCCACTCCTGGCAGGC TGAGTGAAATAAAGGACTTGTTATTTCATCTCGAGGCCTACCGGAGAGCCTTGCCTT GCAAAGGCAGACAGTCAGTGAGGAAGACTATGTGGCACATGAAGACACCAGAGGT GTTCCTCAGGATCAAAGTATGTACAAGCCTTTGTGAATATTTTTTCCTTCTCACTTGG CAAATACAATTCCTGAGATCAATAACCTCGTCTTTTTAATTTTTTCCTCGTCTTTTTAA CTATTTATAAAATATTGAATTATAAAATATGTAATTATAAATACTTTAATTATAAAAT 76P2023-3389-WO ATGTAATTATAAATACTTTAATTATAAAATATGTAATTATAAATACTTTATAAAATAT GTAATTATAAAATATGTAATTATAAACATTTTAATTATAAAATATGTAATTATAAAC ATTTTAATTATAAAATATGTAATTATAAACctgggcctaggccagaATTTTAATTATAAAATA TGTAATTATAAACATTTTAATTATAAAATATGTAATTATAAACATTTTAATTATAAAA TATTTAATTATAAACATTTTAATTATAAAATATTTAATTATAAATATTTTAATTATAA AATATTTAATTATAAATATTTTAATTATAAAATATTTAATTATAAATATTTTAATTAT AAAATATTTAATTATAAATACTTTAATTATAAAATATTTAATTATAAATATTTTAATT ATAAAATATTTAATTATAAATATTTTAATTATAAATATTTTAATTATAAAATATTTAA TTATAAAAACACAATTACCTCATCTTTTTAAATATTTTTGCAAAATATTTCCCTCCAT AATTTCTCCGTTTCCATTTTTATTCTGTTACTTAAATTAAtgtcttacaggttgaaaagaagaagacg aagaagacgaagaagacccgcgaattcctgcagccagggggatcagcctctactgtgccttctagttgccagccatctgttgtttgc ccctcccccttgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcacattgtctgagt aggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggat gcagtgggctctatgggCTGGGGACTTTCCAGCTGGGGACTTTCCAGCTGGGGACTTTCC AGGCTGGGGACTTTCCAGCTGGGGACTTTCCAGCTGGGGACTTTCCAGGCTGGGACTTTCCAGCTGGGGACTTTCCAGCTGGGGACTTTCCAGG SEQ ID NO: 9

[0306] tactatcaacaggttgaactgctgatctgtacagtagaattggtaaagagagttgtgtaaaatattgagttcgcacatcttgttgt ctgattattgatttttggcgaaaccatttgatcatatgacaagatgtgtatctaccttaacttaatgattttgataaaaatcattaggtaccgagctcg gatccactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgc ctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaat gggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaat ggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtcgag gtgagccccacgttctgcttcactctccccatctcccccccctccccacccccaattttgtatttatttattttttaattattttgtgcagcgatgggg gcggggggggggggggcgcgcgccaggcggggcggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcgg cagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcg ggcgggagtcgctgcgcgctgccttcgccccgtgccccgctccgccgccgcctcgcgccgcccgccccggctctgactgaccgcgttac tcccacaggtgagcgggcgggacggcccttctcctccgggctgtaattagcgcttggtttaatgacggcttgtttcttttctgtggctgcgtga aagccttgaggggctccgggagggccctttgtgcggggggagcggctcggggggtgcgtgcgtgtgtgtgtgcgtggggagcgccgc gtgcggctccgcgctgcccggcggctgtgagcgctgcgggcgcggcgcggggctttgtgcgctccgcagtgtgcgcgaggggagcgc 77P2023-3389-WO ggccgggggcggtgccccgcggtgcggggggggctgcgaggggaacaaaggctgcgtgcggggtgtgtgcgtgggggggtgagca gggggtgtgggcgcgtcggtcgggctgcaaccccccctgcacccccctccccgagttgctgagcacggcccggcttcgggtgcggggc tccgtacggggcgtggcgcggggctcgccgtgccgggcggggggtggcggcaggtgggggtgccgggcggggcggggccgcctc gggccggggagggctcgggggaggggcgcggcggcccccggagcgccggcggctgtcgaggcgcggcgagccgcagccattgcc ttttatggtaatcgtgcgagagggcgcagggacttcctttgtcccaaatctgtgcggagccgaaatctgggaggcgccgccgcaccccctct agcgggcgcggggcgaagcggtgcggcgccggcaggaaggaaatgggcggggagggccttcgtgcgtcgccgcgccgccgtcccc ttctccctctccagcctcggggctgtccgcggggggacggctgccttcgggggggacggggcagggcggggttcggcttctggcgtgtg accggcggctctagagcctctgctaaccatgttcatgccttcttctttttcctacagctcctgggcaacgtgctggttattgtgctgtctcatcattt tggcaaagaattcgtcgacgccgccaccatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacg gcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcacc accggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaa gcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccg cgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctgggg cacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgc cacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgac aaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgc cgggatcactctcggcatggacgagctgtacaagtaaccgcgaattcctgcagccagggggatcagcctctactgtgccttctagttgccag ccatctgttgtttgcccctcccccttgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcacatt gtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggg gatgcagtgggctctatgggCTTCTCCACTCCTGGCAGGCTGAGTGAAATAAAGGACTTGTTATT TCATCTCGAGGCCTACCGGAGAGCCTTGCCTTGCAAAGGCAGACAGTCAGTGAGGA AGACTATGTGGCACATGAAGACACCAGAGGTGTTCCTCAGGATCAAAGTATGTACA AGCCTTTGTGAATATTTTTTCCTTCTCACTTGGCAAATACAATTCCTGAGATCAATAA CCTCGTCTTTTTAATTTTTTCCTCGTCTTTTTAACTATTTATAAAATATTGAATTATAA AATATGTAATTATAAATACTTTAATTATAAAATATGTAATTATAAATACTTTAATTAT AAAATATGTAATTATAAATACTTTATAAAATATGTAATTATAAAATATGTAATTATA AACATTTTAATTATAAAATATGTAATTATAAACATTTTAATTATAAAATATGTAATTA TAAACATTTTAATTATAAAATATGTAATTATAAACATTTTAATTATAAAATATGTAAT TATAAACATTTTAATTATAAAATATTTAATTATAAACATTTTAATTATAAAATATTTA ATTATAAATATTTTAATTATAAAATATTTAATTATAAATATTTTAATTATAAAATATT TAATTATAAATATTTTAATTATAAAATATTTAATTATAAATACTTTAATTATAAAATA 78P2023-3389-WO TTTAATTATAAATATTTTAATTATAAAATATTTAATTATAAATATTTTAATTATAAAT ATTTTAATTATAAAATATTTAATTATAAAAACACAATTACCTCATCTTTTTAAATATT TTTGCAAAATATTTCCCTCCATAATTTCTCCGTTTCCATTTTTATTCTGTTACTTAAAT G SEQ ID NO: 10

[0307] CCTGCAGGGCCCACTAGTTCCCCAACTTTCCCGCCTCTCAGCCTTTGAAAG AAAGAAAGGGGAGGGGGCAGGCCGCGTGCAGTCGCGAGCGGTGCTGGGCTCCGGC TCCAATTCCCCATCTCAGTCGCTCCCAAAGTCCTTCTGTTTCATCCAAGCGTGTAAGG GTCCCCGTCCTTGACTCCCTAGTGTCCTGCTGCCCACAGTCCAGTCCTGGGAACCAG CACCGATCACCTCCCATCGGGCCAATCTCAGTCCCTTCCCCCCTACGTCGGGGCCCA CACGCTCGGTGCGTGCCCAGTTGAACCAGGCGGCTGCGGAAAAAAAAAAGCGGGG AGAAAGTAGGGCCCGGCTACTAGCGGTTTTACGGGCGCACGTAGCTCAGGCCTCAA GACCTTGGGCTGGGACTGGCTGAGCCTGGCGGGAGGCGGGGTCCGAGTCACCGCCT GCCGCCGCGCCCCCGGTTTCTATAAATTGAGCCCGCAGCCTCCCGCTTCGCTCTCTG CTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGgtgaagacgggcggagag aaacccgggaggctagggacggcctgaaggcggcaggggcgggcgcaggccggatgtgttcgcgccgctgcggggtgggcccg ggcggcctccgcattgcaggggcgggcggaggacgtgatgcggcgcgggctgggcatggaggcctggtgggggaggggaggg gaggcgtgggtgtcggccggggccactaggcgctcactgttctctccctccgcgcagCCGAGCCACATCGCTGAGA CACaaaccgtcgtcgacatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgac gtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcacca ccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatg aagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactaca agacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggc aacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaag gtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgac ggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatg gtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaaccgcgAATTGAATCAACC TCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCT ATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCGTTctgcagccagggggatcagcctctactgtgcc ttctagttgccagccatctgttgtttgcccctcccccttgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaat 79P2023-3389-WO gaggaaattgcatcacattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattggg aagacaatagcaggcatgctggggatgcagtgggctctatggg SEQ ID NO: 11

[0308] CCTGCAGGGCCCACTAGTTCCCCAACTTTCCCGCCTCTCAGCCTTTGAAAG AAAGAAAGGGGAGGGGGCAGGCCGCGTGCAGTCGCGAGCGGTGCTGGGCTCCGGC TCCAATTCCCCATCTCAGTCGCTCCCAAAGTCCTTCTGTTTCATCCAAGCGTGTAAGG GTCCCCGTCCTTGACTCCCTAGTGTCCTGCTGCCCACAGTCCAGTCCTGGGAACCAG CACCGATCACCTCCCATCGGGCCAATCTCAGTCCCTTCCCCCCTACGTCGGGGCCCA CACGCTCGGTGCGTGCCCAGTTGAACCAGGCGGCTGCGGAAAAAAAAAAGCGGGG AGAAAGTAGGGCCCGGCTACTAGCGGTTTTACGGGCGCACGTAGCTCAGGCCTCAA GACCTTGGGCTGGGACTGGCTGAGCCTGGCGGGAGGCGGGGTCCGAGTCACCGCCT GCCGCCGCGCCCCCGGTTTCTATAAATTGAGCCCGCAGCCTCCCGCTTCGCTCTCTG CTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGgtgaagacgggcggagag aaacccgggaggctagggacggcctgaaggcggcaggggcgggcgcaggccggatgtgttcgcgccgctgcggggtgggcccg ggcggcctccgcattgcaggggcgggcggaggacgtgatgcggcgcgggctgggcatggaggcctggtgggggaggggaggg gaggcgtgggtgtcggccggggccactaggcgctcactgttctctccctccgcgcagCCGAGCCACATCGCTGAGA CACaaaccgtcgtcgacatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgac gtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcacca ccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatg aagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactaca agacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggc aacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaag gtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgac ggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatg gtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaaccgcgAATTGAATCAACC TCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCT ATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCGTTctgcagccagggggatcagcctctactgtgcc ttctagttgccagccatctgttgtttgcccctcccccttgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaat gaggaaattgcatcacattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattggg aagacaatagcaggcatgctggggatgcagtgggctctatgggCTTCTCCACTCCTGGCAGGCTGAGTGAA 80P2023-3389-WO ATAAAGGACTTGTTATTTCATCTCGAGGCCTACCGGAGAGCCTTGCCTTGCAAAGGC AGACAGTCAGTGAGGAAGACTATGTGGCACATGAAGACACCAGAGGTGTTCCTCAG GATCAAAGTATGTACAAGCCTTTGTGAATATTTTTTCCTTCTCACTTGGCAAATACAA TTCCTGAGATCAATAACCTCGTCTTTTTAATTTTTTCCTCGTCTTTTTAACTATTTATA AAATATTGAATTATAAAATATGTAATTATAAATACTTTAATTATAAAATATGTAATT ATAAATACTTTAATTATAAAATATGTAATTATAAATACTTTATAAAATATGTAATTAT AAAATATGTAATTATAAACATTTTAATTATAAAATATGTAATTATAAACATTTTAATT ATAAAATATGTAATTATAAACATTTTAATTATAAAATATGTAATTATAAACATTTTA ATTATAAAATATGTAATTATAAACATTTTAATTATAAAATATTTAATTATAAACATTT TAATTATAAAATATTTAATTATAAATATTTTAATTATAAAATATTTAATTATAAATAT TTTAATTATAAAATATTTAATTATAAATATTTTAATTATAAAATATTTAATTATAAAT ACTTTAATTATAAAATATTTAATTATAAATATTTTAATTATAAAATATTTAATTATAA ATATTTTAATTATAAATATTTTAATTATAAAATATTTAATTATAAAAACACAATTACC TCATCTTTTTAAATATTTTTGCAAAATATTTCCCTCCATAATTTCTCCGTTTCCATTTT TATTCTGTTACTTAAATG SEQ ID NO: 12

[0309] CCTGCAGGGCCCACTAGTTCCCCAACTTTCCCGCCTCTCAGCCTTTGAAAG AAAGAAAGGGGAGGGGGCAGGCCGCGTGCAGTCGCGAGCGGTGCTGGGCTCCGGC TCCAATTCCCCATCTCAGTCGCTCCCAAAGTCCTTCTGTTTCATCCAAGCGTGTAAGG GTCCCCGTCCTTGACTCCCTAGTGTCCTGCTGCCCACAGTCCAGTCCTGGGAACCAG CACCGATCACCTCCCATCGGGCCAATCTCAGTCCCTTCCCCCCTACGTCGGGGCCCA CACGCTCGGTGCGTGCCCAGTTGAACCAGGCGGCTGCGGAAAAAAAAAAGCGGGG AGAAAGTAGGGCCCGGCTACTAGCGGTTTTACGGGCGCACGTAGCTCAGGCCTCAA GACCTTGGGCTGGGACTGGCTGAGCCTGGCGGGAGGCGGGGTCCGAGTCACCGCCT GCCGCCGCGCCCCCGGTTTCTATAAATTGAGCCCGCAGCCTCCCGCTTCGCTCTCTG CTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGgtgaagacgggcggagag aaacccgggaggctagggacggcctgaaggcggcaggggcgggcgcaggccggatgtgttcgcgccgctgcggggtgggcccg ggcggcctccgcattgcaggggcgggcggaggacgtgatgcggcgcgggctgggcatggaggcctggtgggggaggggaggg gaggcgtgggtgtcggccggggccactaggcgctcactgttctctccctccgcgcagCCGAGCCACATCGCTGAGA CACaaaccgtcgtcgacatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgac 81P2023-3389-WO gtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcacca ccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatg aagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactaca agacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggc aacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaag gtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgac ggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatg gtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaaccgcgAATTGAATCAACC TCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCT ATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCGTTctgcagccagggggatcagcctctactgtgcc ttctagttgccagccatctgttgtttgcccctcccccttgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaat gaggaaattgcatcacattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattggg aagacaatagcaggcatgctggggatgcagtgggctctatggGGTACCAATATATTTAATATATTTAGTTT ATATACATCTACAGATAAATACATATCATATATTTGAATTCTAATCTCCCTCTCAACC CTACAGTCACCCATTTGGTATATTAAAGATGTGTTGTCTACTGTCTAGTATCCCTCAA GCAGTGTCAGGAATTAGTCATTTAAATAGTCTGCAAGCCAGGAGTGGTGGCTCATGT CTGTAATTCCAGCACTTGAGAGGTAGAAGTGGGAGGACTGCTTGAGCTCAAGAGTTT GATATTATCCTGGACAACATAGCAAGACCTCGTCTCTACTTAAAAAAAAAAAATTAG CCAGGCATGTGATGTACACCTGTAGTCCCAGCTACTCAGGAGGCCGAAATGGGAGG ATCAGATCTGGATC SEQ ID NO: 13

[0310] TGATTTCCTTCATCCCTGGCACACGTCCAGGCAGTGTCGAATCCATCTCTG CTACAGGGGAAAACAAATAACATTTGAGTCCAGTGGAGACCGGGAGCAGAAGTAA AGGGAAGTGATAACCCCCAGAGCCCGGAAGCCTCTGGAGGCTGAGACCTCGCCCCC CTTGCGTGATAGGGCCTACGGAGCCACATGACCAAGGCACTGTCGCCTCCGCACGT GTGAGAGTGCAGGGCCCCAAGATGGCTGCCAGGCCTCGAGGCCTGACTCTTCTATGT CACTTCCGTACCGGCGAGAAAGGCGGGCCCTCCAGCCAATGAGGCTGCGGGGCGGG CCTTCACCTTGATAGGCACTCGAGTTATCCAATGGTGCCTGCGGGCCGGAGCGACTA GGAACTAACGTCATGCCGAGTTGCTGAGCGCCGGCAGGCGGGGCCGGGGCGGCCAA ACCAATGCGATGGCCGGGGCGGAGTCGGGCGCTCTATAAGTTGTCGATAGGCGGGC 82P2023-3389-WO ACTCCGCCCTAGTTTCTAAGGACCatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggt cgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccct gaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccg ctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaagg acgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgact tcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcaga agaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaaca cccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgaga agcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaaccgcgAAT TGAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCT CCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCGTTctgcagccagggggat cagcctctactgtgccttctagttgccagccatctgttgtttgcccctcccccttgccttccttgaccctggaaggtgccactcccactgt cctttcctaataaaatgaggaaattgcatcacattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaa gggggaggattgggaagacaatagcaggcatgctggggatgcagtgggctctatggg SEQ ID NO: 14

[0311] ggtaccccggctctagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttac ataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaac gccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgcca agtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggc agtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacg gggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaac tccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgc ctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccgcggctcgcatctctccttcacgcg cccgccgccctacctgaggccgccatccacgccggttgagtcgcgttctgccgcctcccgcctgtggtgcctcctgaactgcgtccgc cgtctaggtaagtttaaagctcaggtcgagaccgggcctttgtccggcgctcccttggagcctacctagactcagccggctctccac gctttgcctgaccctgcttgctcaactctagttctctcgttaacttaatgagacagatagaaactggtcttgtagaaacagagtagtcg cctgcttttctgccaggtgctgacttctctcccctgggcttttttctttttctcaggttgaaaagaagaagacgaagaagacgaagaag acaaaccgtcgtcgacgccgccaccatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggac ggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatct gcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgac 83P2023-3389-WO cacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggca actacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggagg acggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggca tcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcg gcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatc acatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaaccgcgaattcctgcagcc agggggatcagcctctactgtgccttctagttgccagccatctgttgtttgcccctcccccttgccttccttgaccctggaaggtgccac tcccactgtcctttcctaataaaatgaggaaattgcatcacattgtctgagtaggtgtcattctattctggggggtggggtggggcag gacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcagtgggctctatgggCTTCTCCACTCCT GGCAGGCTGAGTGAAATAAAGGACTTGTTATTTCATCTCGAGGCCTACCGGAGAGC CTTGCCTTGCAAAGGCAGACAGTCAGTGAGGAAGACTATGTGGCACATGAAGACAC CAGAGGTGTTCCTCAGGATCAAAGTATGTACAAGCCTTTGTGAATATTTTTTCCTTCT CACTTGGCAAATACAATTCCTGAGATCAATAACCTCGTCTTTTTAATTTTTTCCTCGT CTTTTTAACTATTTATAAAATATTGAATTATAAAATATGTAATTATAAATACTTTAAT TATAAAATATGTAATTATAAATACTTTAATTATAAAATATGTAATTATAAATACTTTA TAAAATATGTAATTATAAAATATGTAATTATAAACATTTTAATTATAAAATATGTAA TTATAAACATTTTAATTATAAAATATGTAATTATAAACATTTTAATTATAAAATATGT AATTATAAACATTTTAATTATAAAATATGTAATTATAAACATTTTAATTATAAAATAT TTAATTATAAACATTTTAATTATAAAATATTTAATTATAAATATTTTAATTATAAAAT ATTTAATTATAAATATTTTAATTATAAAATATTTAATTATAAATATTTTAATTATAAA ATATTTAATTATAAATACTTTAATTATAAAATATTTAATTATAAATATTTTAATTATA AAATATTTAATTATAAATATTTTAATTATAAATATTTTAATTATAAAATATTTAATTA TAAAAACACAATTACCTCATCTTTTTAAATATTTTTGCAAAATATTTCCCTCCATAAT TTCTCCGTTTCCATTTTTATTCTGTTACTTAAATCTGGGGACTTTCCAGCTGGGGAC TTTCCAGCTGGGGACTTTCCAGGCTGGGGACTTTCCAGCTGGGGACTTTCCAG CTGGGGACTTTCCAGGCTGGGGACTTTCCAGCTGGGGACTTTCCAGCTGGGGA CTTTCCAGG SEQ ID NO: 15

[0312] tactatcaacaggttgaactgctgatctgtacagtagaattggtaaagagagttgtgtaaaatattgagttcgcacat cttgttgtctgattattgatttttggcgaaaccatttgatcatatgacaagatgtgtatctaccttaacttaatgattttgataaaaatcat 84P2023-3389-WO taggtaccgagctcggatccactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttaca taacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacg ccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaa gtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggca gtacatctacgtattagtcatcgctattaccatggtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacc cccaattttgtatttatttattttttaattattttgtgcagcgatgggggcggggggggggggggcgcgcgccaggcggggcggggc ggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatg gcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgcgctgccttcgccccgtgccc cgctccgccgccgcctcgcgccgcccgccccggctctgactgaccgcgttactcccacaggtgagcgggcgggacggcccttctcc tccgggctgtaattagcgcttggtttaatgacggcttgtttcttttctgtggctgcgtgaaagccttgaggggctccgggagggcccttt gtgcggggggagcggctcggggggtgcgtgcgtgtgtgtgtgcgtggggagcgccgcgtgcggctccgcgctgcccggcggctgt gagcgctgcgggcgcggcgcggggctttgtgcgctccgcagtgtgcgcgaggggagcgcggccgggggcggtgccccgcggtgc ggggggggctgcgaggggaacaaaggctgcgtgcggggtgtgtgcgtgggggggtgagcagggggtgtgggcgcgtcggtcgg gctgcaaccccccctgcacccccctccccgagttgctgagcacggcccggcttcgggtgcggggctccgtacggggcgtggcgcgg ggctcgccgtgccgggcggggggtggcggcaggtgggggtgccgggcggggcggggccgcctcgggccggggagggctcggg ggaggggcgcggcggcccccggagcgccggcggctgtcgaggcgcggcgagccgcagccattgccttttatggtaatcgtgcga gagggcgcagggacttcctttgtcccaaatctgtgcggagccgaaatctgggaggcgccgccgcaccccctctagcgggcgcggg gcgaagcggtgcggcgccggcaggaaggaaatgggcggggagggccttcgtgcgtcgccgcgccgccgtccccttctccctctcc agcctcggggctgtccgcggggggacggctgccttcgggggggacggggcagggcggggttcggcttctggcgtgtgaccggcg gctctagagcctctgctaaccatgttcatgccttcttctttttcctacagctcctgggcaacgtgctggttattgtgctgtctcatcatttt ggcaaagaattcgtcgacgccgccaccatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctgg acggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttca tctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccg accacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggc aactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggag gacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggc atcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatc ggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgat cacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagGGTAGCGGTgaggg cagaggaagtctgctaacatgcggtgacgtcgaggagaaccctgggcccgtgagtgcgcCTTCTCCACTCCTGGCA GGCTGAGTGAAATAAAGGACTTGTTATTTCATCTCGAGGCCTACCGGAGAGCCTTGC 85P2023-3389-WO CTTGCAAAGGCAGACAGTCAGTGAGGAAGACTATGTGGCACATGAAGACACCAGAG GTGTTCCTCAGGATCAAAGTATGTACAAGCCTTTGTGAATATTTTTTCCTTCTCACTT GGCAAATACAATTCCTGAGATCAATAACCTCGTCTTTTTAATTTTTTCCTCGTCTTTTT AACTATTTATAAAATATTGAATTATAAAATATGTAATTATAAATACTTTAATTATAA AATATGTAATTATAAATACTTTAATTATAAAATATGTAATTATAAATACTTTATAAA ATATGTAATTATAAAATATGTAATTATAAACATTTTAATTATAAAATATGTAATTAT AAACATTTTAATTATAAAATATGTAATTATAAACctgggcctaggccagaATTTTAATTATAA AATATGTAATTATAAACATTTTAATTATAAAATATGTAATTATAAACATTTTAATTAT AAAATATTTAATTATAAACATTTTAATTATAAAATATTTAATTATAAATATTTTAATT ATAAAATATTTAATTATAAATATTTTAATTATAAAATATTTAATTATAAATATTTTAA TTATAAAATATTTAATTATAAATACTTTAATTATAAAATATTTAATTATAAATATTTT AATTATAAAATATTTAATTATAAATATTTTAATTATAAATATTTTAATTATAAAATAT TTAATTATAAAAACACAATTACCTCATCTTTTTAAATATTTTTGCAAAATATTTCCCT CCATAATTTCTCCGTTTCCATTTTTATTCTGTTACTTAAATTAAtgtcttacaggttgaaaagaag aagacgaagaagacgaagaagacccgcgaattcctgcagccagggggatcagcctctactgtgccttctagttgccagccatctgt tgtttgcccctcccccttgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcacattg tctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgct ggggatgcagtgggctctatgggCTGGGGACTTTCCAGCTGGGGACTTTCCAGCTGGGGACTCTGGGGACTTTCCAGCTGGGGACTTTCCAGCTGGGGACTTTCCAGG SEQ ID NO: 16

[0313] actatcaacaggttgaactgctgatctgtacagtagaattggtaaagagagttgtgtaaaatattgagttcgcacat cttgttgtctgattattgatttttggcgaaaccatttgatcatatgacaagatgtgtatctaccttaacttaatgattttgataaaaatcat taggtaccgagctcggatccactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttaca taacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacg ccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaa gtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggca gtacatctacgtattagtcatcgctattaccatggtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacc cccaattttgtatttatttattttttaattattttgtgcagcgatgggggcggggggggggggggcgcgcgccaggcggggcggggc ggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatg 86P2023-3389-WO gcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgcgctgccttcgccccgtgccc cgctccgccgccgcctcgcgccgcccgccccggctctgactgaccgcgttactcccacaggtgagcgggcgggacggcccttctcc tccgggctgtaattagcgcttggtttaatgacggcttgtttcttttctgtggctgcgtgaaagccttgaggggctccgggagggcccttt gtgcggggggagcggctcggggggtgcgtgcgtgtgtgtgtgcgtggggagcgccgcgtgcggctccgcgctgcccggcggctgt gagcgctgcgggcgcggcgcggggctttgtgcgctccgcagtgtgcgcgaggggagcgcggccgggggcggtgccccgcggtgc ggggggggctgcgaggggaacaaaggctgcgtgcggggtgtgtgcgtgggggggtgagcagggggtgtgggcgcgtcggtcgg gctgcaaccccccctgcacccccctccccgagttgctgagcacggcccggcttcgggtgcggggctccgtacggggcgtggcgcgg ggctcgccgtgccgggcggggggtggcggcaggtgggggtgccgggcggggcggggccgcctcgggccggggagggctcggg ggaggggcgcggcggcccccggagcgccggcggctgtcgaggcgcggcgagccgcagccattgccttttatggtaatcgtgcga gagggcgcagggacttcctttgtcccaaatctgtgcggagccgaaatctgggaggcgccgccgcaccccctctagcgggcgcggg gcgaagcggtgcggcgccggcaggaaggaaatgggcggggagggccttcgtgcgtcgccgcgccgccgtccccttctccctctcc agcctcggggctgtccgcggggggacggctgccttcgggggggacggggcagggcggggttcggcttctggcgtgtgaccggcg gctctagagcctctgctaaccatgttcatgccttcttctttttcctacagctcctgggcaacgtgctggttattgtgctgtctcatcatttt ggcaaagaattcgtcgacgccgccaccatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctgg acggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttca tctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccg accacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggc aactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggag gacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggc atcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatc ggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgat cacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaaccgcgaattcctgcagc cagggggatcagcctctactgtgccttctagttgccagccatctgttgtttgcccctcccccttgccttccttgaccctggaaggtgcca ctcccactgtcctttcctaataaaatgaggaaattgcatcacattgtctgagtaggtgtcattctattctggggggtggggtggggca ggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcagtgggctctatgggCTTCTCCACTCC TGGCAGGCTGAGTGAAATAAAGGACTTGTTATTTCATCTCGAGGCCTACCGGAGAGC CTTGCCTTGCAAAGGCAGACAGTCAGTGAGGAAGACTATGTGGCACATGAAGACAC CAGAGGTGTTCCTCAGGATCAAAGTATGTACAAGCCTTTGTGAATATTTTTTCCTTCT CACTTGGCAAATACAATTCCTGAGATCAATAACCTCGTCTTTTTAATTTTTTCCTCGT CTTTTTAACTATTTATAAAATATTGAATTATAAAATATGTAATTATAAATACTTTAAT TATAAAATATGTAATTATAAATACTTTAATTATAAAATATGTAATTATAAATACTTTA 87P2023-3389-WO TAAAATATGTAATTATAAAATATGTAATTATAAACATTTTAATTATAAAATATGTAA TTATAAACATTTTAATTATAAAATATGTAATTATAAACATTTTAATTATAAAATATGT AATTATAAACATTTTAATTATAAAATATGTAATTATAAACATTTTAATTATAAAATAT TTAATTATAAACATTTTAATTATAAAATATTTAATTATAAATATTTTAATTATAAAAT ATTTAATTATAAATATTTTAATTATAAAATATTTAATTATAAATATTTTAATTATAAA ATATTTAATTATAAATACTTTAATTATAAAATATTTAATTATAAATATTTTAATTATA AAATATTTAATTATAAATATTTTAATTATAAATATTTTAATTATAAAATATTTAATTA TAAAAACACAATTACCTCATCTTTTTAAATATTTTTGCAAAATATTTCCCTCCATAAT TTCTCCGTTTCCATTTTTATTCTGTTACTTAAATCTGGGGACTTTCCAGCTGGGGAC TTTCCAGCTGGGGACTTTCCAGGCTGGGGACTTTCCAGCTGGGGACTTTCCAG CTGGGGACTTTCCAGGCTGGGGACTTTCCAGCTGGGGACTTTCCAGCTGGGGA CTTTCCAGG SEQ ID NO: 17

[0314] PB terminal repeats is Italic dashed underline

[0315] Promoter and GOI is Bold black

[0316] WPRE is Italicttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctg gctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtc aatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatg acggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgct attaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattg acgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcg 88P2023-3389-WO gtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttg acctccatagaagacaccgggaccgatccagcctccgcggctcgcatctctccttcacgcgcccgccgccctacctgaggccgcca tccacgccggttgagtcgcgttctgccgcctcccgcctgtggtgcctcctgaactgcgtccgccgtctaggtaagtttaaagctcaggt cgagaccgggcctttgtccggcgctcccttggagcctacctagactcagccggctctccacgctttgcctgaccctgcttgctcaactc tagttctctcgttaacttaatgagacagatagaaactggtcttgtagaaacagagtagtcgcctgcttttctgccaggtgctgacttct ctcccctgggcttttttctttttctcaggttgaaaagaagaagacgaagaagacgaagaagacaaaccgtcgtcgacatggtgagc aagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccg gcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccac cctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccat gcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgaggg cgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaa ctacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcga ggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccacta cctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccggg atcactctcggcatggacgagctgtacaagtaatgagaattcctgcaGGAATCAACCTCTGGATTACAAAATTTG TGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTT TAATGCCTTTGTATCATGCGTTtcctgcagccagggggatcagcctctactgtgccttctagttgccagccatctgttgt ttgcccctcccccttgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcacattgtct gagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctgg ggatgcagtgggctctatggTTTTCCCCGTATCCCCCCAGGTGTCTGCAGGCTCAAAGAGCAGCGACTATCTTTCTAGGGTTAA SEQ ID NO: 18 89P2023-3389-WO

[0318] PB terminal repeats Italic dashed underline

[0319] Promoter and GOI Bold blackttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctg gctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtc aatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatg acggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgct attaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattg acgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcg gtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttg acctccatagaagacaccgggaccgatccagcctccgcggctcgcatctctccttcacgcgcccgccgccctacctgaggccgcca tccacgccggttgagtcgcgttctgccgcctcccgcctgtggtgcctcctgaactgcgtccgccgtctaggtaagtttaaagctcaggt cgagaccgggcctttgtccggcgctcccttggagcctacctagactcagccggctctccacgctttgcctgaccctgcttgctcaactc tagttctctcgttaacttaatgagacagatagaaactggtcttgtagaaacagagtagtcgcctgcttttctgccaggtgctgacttct ctcccctgggcttttttctttttctcaggttgaaaagaagaagacgaagaagacgaagaagacaaaccgtcgtcgacatggtgagc aagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccg gcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccac cctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccat gcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgaggg cgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaa ctacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcga ggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccacta cctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccggg atcactctcggcatggacgagctgtacaagtaaccgcgaattcctgcagccagggggatcagcctctactgtgccttctagttgcca 90P2023-3389-WO gccatctgttgtttgcccctcccccttgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgc atcacattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagc aggcatgctggggatgcagtgggctctatggTTTTCCCCGTATCCCCCCAGGTGTCTGCAGGCTCAAAGSEQ ID NO: 19

[0321] PNI-IV- -mRNA

[0322] T7 promoter: Bold black

[0323] 5’UTR: Bold dashed underline

[0324] PB ORF from (academic.oup.com / nar / article-pdf / 35 / 12 / e87 / 18778323 / gkm446.pdf) Italic dashed underline

[0325] SV40 NLS seq: Double underline

[0326] 3’UTR Underline text

[0327] Poly-A followed by Nde1 site Italic

[0328] TAATACGACTCACTATAaGGGAAATAAGAGAGAAAAGAAGAGTAAGA AGAAATATAAGAGCCACCatgggcagcagcctggacgacgagcacatcctgagcgccctgctgcagagcgacga cgagctggtcggcgaggacagcgacagcgagatcagcgaccacgtgagcgaggacgacgtgcagtccgacaccgaggaggcctt catcgacgaggtgcacgaggtgcagcctaccagcagcggctccgagatcctggacgagcagaacgtgatcgagcagcccggcagc tccctggccagcaacaggatcctgaccctgccccagaggaccatcaggggcaagaacaagcactgctggtccacctccaagagcac caggcggagcagggtgtccgccctgaacatcgtgagaagccagaggggccccaccaggatgtgcaggaacatctacgaccccctg ctgtgcttcaagctgttcttcaccgacgagatcatcagcgagatcgtgaagtggaccaacgccgagatcagcctgaagaggcgggag agcatgaccggcgccaccttcagggacaccaacgaggacgagatctacgccttcttcggcatcctggtgatgaccgccgtgaggaag gacaaccacatgagcaccgacgacctgttcgacagatccctgagcatggtgtacgtgagcgtgatgagcagggacagattcgacttc 91P2023-3389-WO ctgatcagatgcctgaggatggacgacaagagcatcaggcccaccctgcgggagaacgacgtgttcacccccgtgagaaagatctg ggacctgttcatccaccagtgcatccagaactacacccctggcgcccacctgaccatcgacgagcagctgctgggcttcaggggcag gtgccccttcaggatgtatatccccaacaagcccagcaagtacggcatcaagatcctgatgatgtgcgacagcggcaccaagtacatg atcaacggcatgccctacctgggcaggggcacccagaccaacggcgtgcccctgggcgagtactacgtgaaggagctgtccaagcc cgtccacggcagctgcagaaacatcacctgcgacaactggttcaccagcatccccctggccaagaacctgctgcaggagccctacaa gctgaccatcgtgggcaccgtgagaagcaacaagagagagatccccgaggtcctgaagaacagcaggtccaggcccgtgggcac cagcatgttctgcttcgacggccccctgaccctggtgtcctacaagcccaagcccgccaagatggtgtacctgctgtccagctgcgacg aggacgccagcatcaacgagagcaccggcaagccccagatggtgatgtactacaaccagaccaagggcggcgtggacaccctgg accagatgtgcagcgtgatgacctgcagcagaaagaccaacaggtggcccatggccctgctgtacggcatgatcaacatcgcctgca tcaacagcttcatcatctacagccacaacgtgagcagcaagggcgagaaggtgcagagccggaaaaagttcatgcggaacctgtac atgagcctgacctccagcttcatgaggaagaggctggaggcccccaccctgaagagatacctgagggacaacatcagcaacatcct gcccaacgaggtgcccggcaccagcgacgacagcaccgaggagcccgtgatgaagaagaggacctactgcacctactgtcccag caagatcagaagaaaggccaacgccagctgcaagaagtgtaagaaggtcatctgccgggagcacaacatcgacatgtgccagag ctgtttcCCCAAGAAGAAGAGGAAAGTCTAATAAGCTCGCTTTCTTGCTGTCCAATTTCT ATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGG GCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCgaattcAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAcata SEQ ID NO: 20

[0329] PNI-V- -mRNA

[0330] T7 promoter: Bold black

[0331] 5’UTR: Bold dashed underline

[0332] SPB ORF (dashed underline italic) from (novoprolabs.com / vector / Vgezdqmbq)

[0333] SV40 NLS seq: Double underline

[0334] 3’UTR: Underline text

[0335] Poly-A followed by Nde1 site represented in Italic fontAGAAATATAAGAGCCACCatgggctctagcctggacgacgagcacatcctgagcgccctgctgcagagcgacgac gaactggtgggcgaggacagcgacagcgaggtcagcgaccacgtgtccgaggacgacgtgcagtccgacaccgaggaagccttc atcgacgaggtgcacgaagtgcagcctaccagcagcggctccgagatcctggacgagcagaacgtgatcgagcagcctggcagct 92P2023-3389-WO ccctggccagcaacagaatcctgaccctgccccagagaaccatcagaggcaagaacaagcactgctggtccacctccaagagcac caggcggagcagagtgtccgccctgaacatcgtgcggagccagaggggccccaccagaatgtgcagaaacatctacgaccccctg ctgtgcttcaagctgttcttcaccgacgagatcatcagcgagatcgtgaagtggaccaacgccgagatcagcctgaagaggcgggag agcatgaccagcgccaccttcagagacaccaacgaggacgagatctacgccttcttcggcatcctggtgatgaccgccgtgagaaag gacaaccacatgagcaccgacgacctgttcgacagatccctgagcatggtgtacgtgtccgtgatgagcagagacagattcgacttcc tgatcagatgcctgagaatggacgacaagagcatcagacccaccctgcgggagaacgacgtgttcacccccgtgcggaagatctgg gacctgttcatccaccagtgcatccagaactacacccctggcgcccacctgaccatcgatgagcagctgctgggcttcagaggcagat gccccttcagagtgtacatccccaacaagcccagcaagtacggcatcaagatcctgatgatgtgcgacagcggcaccaagtacatga tcaacggcatgccctacctgggcagaggcacccagacaaacggcgtgcccctgggcgagtactacgtgaaagaactgagcaagcc tgtgcatggcagctgcaggaacatcacctgcgacaactggttcaccagcatccccctggccaagaacctgctgcaggaaccctacaa gctgaccatcgtgggcaccgtgcggagcaacaagcgggagatcccagaggtgctgaagaacagcagatccagacctgtgggaac aagcatgttctgcttcgacggccccctgaccctggtgtcctacaagcccaagcccgccaagatggtgtacctgctgtccagctgcgacg aggacgccagcatcaacgagagcaccggcaagccccagatggtgatgtactacaaccagaccaagggcggcgtggacaccctgg accagatgtgcagcgtgatgacctgcagcagaaagaccaacagatggcccatggccctgctgtacggcatgatcaatatcgcctgca tcaacagcttcatcatctacagccacaacgtgtccagcaagggcgagaaggtgcagagccggaagaaattcatgcggaacctgtac atgagcctgacctccagcttcatgagaaagagactggaagcccccaccctgaagagatacctgcgggacaacatcagcaacatcct gcccaaggaagtgccaggaacaagcgacgacagcaccgaggaacccgtgatgaagaagaggacctactgcacctactgtcccag caagatcagaagaaaggccaacgccagctgcaagaaatgcaaaaaagtgatctgccgggagcacaacatcgacatgtgccagag ctgtttcCCCAAGAAGAAGAGGAAAGTCTAATAAGCTCGCTTTCTTGCTGTCCAATTTCTATT AAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGASEQ. ID NO: 21

[0337] ctagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggt aaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaataggga ctttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccc tattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctac gtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaa gtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccatt 93P2023-3389-WO gacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgcctggagacgc catccacgctgttttgacctccatagaagacaccgggaccgatccagcctccgcggctcgcatctctccttcacgcgcccgccgccct acctgaggccgccatccacgccggttgagtcgcgttctgccgcctcccgcctgtggtgcctcctgaactgcgtccgccgtctaggtaa gtttaaagctcaggtcgagaccgggcctttgtccggcgctcccttggagcctacctagactcagccggctctccacgctttgcctgac cctgcttgctcaactctagttctctcgttaacttaatgagacagatagaaactggtcttgtagaaacagagtagtcgcctgcttttctgc caggtgctgacttctctcccctgggcttttttctttttctcaggttgaaaagaagaagacgaagaagacgaagaagacaaaccgtcg tcgacatggccttaccagtgaccgccttgctcctgccgctggccttgctgctccacgccgccaggccgGACATCCAGATG ACCCAGACCACAAGCAGCCTGTCTGCCAGCCTGGGCGATAGAGTGACCATCAG CTGTAGAGCCAGCCAGGACATCAGCAAGTACCTGAACTGGTATCAGCAGAAAC CCGACGGCACCGTGAAGCTGCTGATCTACCACACCAGCAGACTGCACAGCGGC GTGCCAAGCAGATTTTCTGGCAGCGGCTCTGGCACCGACTACAGCCTGACAAT CAGCAACCTGGAACAAGAGGATATCGCTACCTACTTCTGCCAGCAAGGCAACA CCCTGCCTTACACCTTTGGCGGAGGCACCAAGCTGGAAATCACCGGCTCTACA AGCGGCAGCGGCAAACCTGGATCTGGCGAGGGATCTACCAAGGGCGAAGTGA AACTGCAAGAGTCTGGCCCTGGACTGGTGGCCCCATCTCAGTCTCTGAGCGTG ACCTGTACAGTCAGCGGAGTGTCCCTGCCTGATTACGGCGTGTCCTGGATCAG ACAGCCTCCTCGGAAAGGCCTGGAATGGCTGGGAGTGATCTGGGGCAGCGAG ACAACCTACTACAACAGCGCCCTGAAGTCCCGGCTGACCATCATCAAGGACAA CTCCAAGAGCCAGGTGTTCCTGAAGATGAACAGCCTGCAGACCGACGACACCG CCATCTACTATTGCGCCAAGCACTACTACTACGGCGGCAGCTACGCCATGGATT ATTGGGGCCAGGGCACCAGCGTGACCGTTTCTTCTACCACTACCCCAGCACCG AGGCCACCCACCCCGGCTCCTACCATCGCCTCCCAGCCTCTGTCCCTGCGTCC GGAGGCATGTAGACCCGCAGCTGGTGGGGCCGTGCATACCCGGGGTCTTGACT TCGCCTGCGATATCTACATTTGGGCCCCTCTGGCTGGTACTTGCGGGGTCCTG CTGCTTTCACTCGTGATCACTCTTTACTGTAAGCGCGGTCGGAAGAAGCTGCTG TACATCTTTAAGCAACCCTTCATGAGGCCTGTGCAGACTACTCAAGAGGAGGA CGGCTGTTCATGCCGGTTCCCAGAGGAGGAGGAAGGCGGCTGCGAACTGCGC GTGAAATTCAGCCGCAGCGCAGATGCTCCAGCCTACAAGCAGGGGCAGAACCA GCTCTACAACGAACTCAATCTTGGTCGGAGAGAGGAGTACGACGTGCTGGACA AGCGGAGAGGACGGGACCCAGAAATGGGCGGGAAGCCGCGCAGAAAGAATCC CCAAGAGGGCCTGTACAACGAGCTCCAAAAGGATAAGATGGCAGAAGCCTATA 94P2023-3389-WO GCGAGATTGGTATGAAAGGGGAACGCAGAAGAGGCAAAGGCCACGACGGACT GTACCAGGGACTCAGCACCGCCACCAAGGACACCTATGACGCTCTTCACATGC AGGCCCTGCCGCCTCGGtaaccgcgaattcctgcagccagggggatcagcctctactgtgccttctagttgccagc catctgttgtttgcccctcccccttgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcat cacattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcag gcatgctggggatgcagtgggctctatggg

[0338] While specific embodiments of the invention have been described and illustrated, such embodiments should be considered illustrative of the invention only and not as limiting the invention as construed in accordance with the accompanying claims. 95

Claims

P2023-3389-WO CLAIMS:

1. A lipid nanoparticle (LNP) for transfecting a cell of hematopoietic lineage, the LNP includes a lipid mix composition encapsulating a DNA, the lipid mix composition comprising an ionizable lipid, a phospholipid, a stabilizer, and cholesterol.

2. The lipid nanoparticle of claim 1, wherein the ionizable lipid includes a cyclopentyl or a tetrahydrofuranyl head group.

3. The lipid nanoparticle of claim 1 or 2, wherein the ionizable lipid comprises PNI 516, PNI 550, PNI 580, PNI 659, PNI 714, PNI 726, PNI 728, PNI 761, PNI 762, PNI 768, PNI 769, PNI 771, or a combination thereof.

4. The lipid nanoparticle of any one of claims 1 to 3, wherein the DNA is in the form of a linear DNA, a closed DNA, or a circular DNA.

5. The lipid nanoparticle of any one of claims 1 to 4, wherein the DNA comprises an UTR is downstream or upstream of a gene of interest.

6. The lipid nanoparticle of claim 5, wherein the UTR is one or more of a s / MAR, a MAR and a NF sequence element.

7. The lipid nanoparticle of any one of claims 1 to 6, wherein the DNA is under 5,000 BP in length.

8. The lipid nanoparticle of any one of claims 1 to 6, wherein the DNA is between 2,500 to 4,500 BP in length.

9. The lipid nanoparticle of any one of claims 1 to 8, wherein the DNA further comprises a gene editing element.

10. The lipid nanoparticle of claim 9, wherein the gene editing element is a PiggyBac transposon element.

11. The lipid nanoparticle of claim 10, wherein the PiggyBac based transposon element comprises an oligonucleotide sequence about 80%, about 85%, about 90%, about 95%, about 98%, or about 100% identical to the oligonucleotide sequence set forth in SEQ ID NO: 17 or SEQ ID NO:

18.

12. The lipid nanoparticle of any one of claims 1 to 11, further including an RNA.

13. The lipid nanoparticle of claim 12, wherein the RNA is mRNA.

14. The lipid nanoparticle of any one of claims 1 to 13, wherein the DNA does not include an antibiotic resistance gene. 96P2023-3389-WO 15. The lipid nanoparticle of any one of claims 1 to 14, wherein the cell is a T cell or HSC.

16. The lipid nanoparticle of any one of claims 1 to 15, wherein the phospholipid comprises distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE) and dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidylethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl-phosphatidyethanol amine (SOPE), 1,2-dielaidoyl-sn- glycero-3-phophoethanolamine (trans DOPE), 1-stearoyl-2-oleoyl-sn-glycero-3-phosphocholine (SOPC), or any combinations thereof.

17. The lipid nanoparticle of any one of claims 1 to 16, wherein the stabilizer comprises polyoxyethylene (10) stearyl ether (BrijS10), tocopherol polyethelyne glycol succinate (TPGS), PEG-DMG, dodecyl maltoside, sucrose monolaurate, or any combinations thereof.

18. The lipid nanoparticle of any one of claims 1 to 17, wherein the lipid mix composition comprises about 35 - 50 Mol% ionizable lipid, about 10 - 30 Mol% structural lipid, about 15 - 50 Mol% sterol, and about 0.5 - 3 Mol% stabilizer, wherein the total mol% of components in the lipid mix composition is 100 mol%.

19. The lipid nanoparticle of any one of claims 1 to 17, wherein the lipid mix composition comprises about 40 Mol% ionizable lipid, about 20 Mol% distearoylphosphatidylcholine (DSPC), about 37.5 Mol% cholesterol, and about 2.5 Mol% polyoxyethylene (10) stearyl ether (BrijS10).

20. The lipid nanoparticle of any one of claims 1 to 17, wherein the lipid mix composition comprises about 40 Mol% ionizable lipid, about 20 Mol% distearoylphosphatidylcholine (DSPC), about 39 Mol% cholesterol, and about 0.75 Mol% Tocopherol polyethylene glycol 1000 succinate (TPGS).

21. A lipid mix composition for forming lipid particles in association with a DNA, for use in transfecting a cell of hematopoietic lineage, the lipid mix composition comprising an ionizable lipid, a phospholipid, a stabilizer, and cholesterol. 97P2023-3389-WO 22. The lipid mix composition of claim 21, wherein the ionizable lipid includes a cyclopentyl or a tetrahydrofuranyl head group.

23. The lipid mix composition of claim 21 or 22, wherein the ionizable lipid comprises PNI 516, PNI 550, PNI 580, PNI 659, PNI 714, PNI 726, PNI 728, PNI 761, PNI 762, PNI 768, PNI 769, PNI 771, or a combination thereof.

24. The lipid mix composition of any one of claims 21 to 23, wherein the stabilizer comprises polyoxyethylene (10) stearyl ether (BrijS10), tocopherol polyethelyne glycol succinate (TPGS), PEG-DMG, dodecyl maltoside, sucrose monolaurate, or any combinations thereof.

25. The lipid mix composition of any one of claims 21 to 24, wherein the lipid mix composition comprises about 35 - 50 Mol% ionizable lipid, about 10 - 30 Mol% structural lipid, about 15 - 50 Mol% sterol, and about 0.5 - 3 Mol% stabilizer, wherein the total mol% of components in the lipid mix composition is 100 mol%.

26. The lipid mix composition of any one of claims 21 to 26, the DNA further comprises a gene editing element.

27. The lipid mix composition of any one of claims 21 to 27, wherein the gene editing element comprises a PiggyBac transposon element.

28. The lipid mix composition of claim 27, wherein the PiggyBac based transposon element comprises an oligonucleotide sequence about 80%, about 85%, about 90%, about 95%, about 98%, or about 100% identical to the oligonucleotide sequence set forth in SEQ ID NO: 17 or SEQ ID NO:

18.

29. The lipid mix composition of any one of claims 21 to 28, further including an RNA.

30. The lipid mix composition of claim 30, wherein the RNA is mRNA.

31. A method of modifying a cell of hematopoietic lineage, the method comprising contacting the cell of hematopoietic lineage with the lipid nanoparticle of any of claims 1- 20.

32. The method of claim 31, wherein a coding region is expressed in the cell and progeny of the cell at least 10 days after contacting the cell with the LNP.

33. The method of claim 32, wherein the coding region expresses an RNA.

34. The method of claim 33, wherein the RNA is tRNA, rRNA, IncRNA, mRNA, saRNA, sgRNA, guide RNA, trcRNA, PiWiRNA, snRNA, snoRNA, crRNA, or combinations thereof. 98P2023-3389-WO 35. The method of any one of claims 31 to 34, wherein before contacting, the cell has an unmodified genome.

36. The method of any one of claims 31 to 34, wherein before contacting, the cell has a modified genome.

37. The method of any one of claims 31 to 36, wherein after contacting, the cell contains extrachromosomal DNA.

38. The method of any one of claims 31 to 36, wherein after contacting, the cell contains exogenous DNA integrated into a chromosomal loci of the cell.

39. A modified cell of hematopoietic lineage modified by the method of any of claims 31 to 38.

40. A method of treatment for immune deficiency, cancer, autoimmune disease or genetic insufficiency, the method comprising administering to a subject in need thereof an effective amount of a composition comprising the modified cell of claim 39. 99

Images