Microorganisms and methods of biosynthesis

Abstract

The present invention relates to halophilic microorganisms. In particular, halophilic microorganisms that expresses citramalate synthase. A plasmid encoding an antitoxin-toxin system, and a halophilic microorganism comprising said plasmid are also described, and methods of producing halophilic organisms are also described herein.

Description

[0001] Microorganisms and methods of biosynthesis

[0002] This application claims priority from GB2405556.8 filed 19 April 2024, the contents and elements of which are herein incorporated by reference for all purposes.

[0003] Field of the Invention

[0004] The present invention relates to the fields of molecular biology and biotechnology and particularly, although not exclusively, to halophilic microorganisms, plasmids, and methods of producing citramalate.

[0005] Background

[0006] Current industrial methods of producing chemicals often utilise large amounts of fossil fuels. There is a need to develop new methods for the production of such products in a renewable way that has less impact on the environment.

[0007] Synthetic biology and industrial biotechnology have huge potential for the production of chemicals and products in a way that has fewer negative impacts on the environment. However, whilst it is possible to produce some high value products through industrial biotechnology, improvements are required to enable the cost-competitive commercial production of lower cost products.

[0008] Plastics are an example of lower cost products which are currently expensive to produce through industrial biotechnology. Acrylic acids and their alkyl esters, in particular, methacrylic acid (MAA) and its methyl ester, methyl methacrylate (MMA) are important monomers in the chemical industry, and typically manufactured from petrochemical feedstocks. Their main application is in the production of polymers for various applications. The most significant polymer application is the casting, moulding or extrusion of polymethyl methacrylate (PMMA).

[0009] Citramalate has been shown to be an intermediate for the biosynthesis of MAA in E. coli (Webb et al., Microbiology (Reading). 164(2): 133-141). However, current methods of biosynthesising citramalate are associated with a number of drawbacks. These drawbacks are addressed by the current disclosure.

[0010] Summary of the Invention

[0011] In one aspect, the present disclosure provides a halophilic microorganism, wherein the halophilic microorganism expresses a heterologous citramalate synthase.

[0012] The present disclosure also provides a plasmid comprising one or more genes encoding a toxin-antitoxin system, and a gene encoding an enzyme.

[0013] The present disclosure also provides a halophilic microorganism comprising a plasmid according to the present disclosure. The present disclosure also provides a method of generating a hybrid plasmid, the method comprising: (i) identifying a plasmid that is endogenous to a halophilic microorganism, wherein the plasmid comprises a toxin-antitoxin system, and (ii) modifying the plasmid to comprise a gene encoding an enzyme, wherein the enzyme is heterologous to the halophilic microorganism.

[0014] The present disclosure also provides a method of modifying a halophilic microorganism, wherein the microorganism comprises an endogenous plasmid, wherein the endogenous plasmid comprises one or more genes encoding a toxin-antitoxin system, the method comprising:

[0015] (i) curing an endogenous plasmid from the microorganism, and

[0016] (ii) modifying the microorganism with a recombinant vector, wherein the recombinant vector comprises one or more genes encoding a toxin-antitoxin system, and a gene encoding an enzyme.

[0017] The present disclosure also provides a method of producing a carbon compound, wherein the method comprises the provision of a halophilic microorganism, a culture medium, and a carbon source, wherein the halophilic microorganism expresses a plasmid, wherein the plasmid comprises one or more genes encoding a toxin-antitoxin system, and a gene encoding an enzyme wherein the microorganism is contacted with the carbon source in the culture medium, and the carbon compound is produced through enzyme activity.

[0018] The present disclosure also provides a method of producing citramalate, wherein the method comprises the provision of a microorganism, a culture medium, and a carbon source, wherein the microorganism is halophilic and expresses a heterologous citramalate synthase, wherein the microorganism is contacted with the carbon source in the culture medium, and citramalate is produced through citramalate synthase activity.

[0019] In some embodiments, the enzyme is a citramalate synthase. In some embodiments, the citramalate synthase is a wild type or mutant citramalate synthase derived from Methanococcus jannaschii (also known as Methanocaldococcus jannaschii).

[0020] In some embodiments, the citramalate synthase comprises an amino acid sequence having at least 70% sequence identity to the amino acid sequence of SEQ ID NO:1 or 2. In some embodiments, the citramalate synthase comprises, or consists, of an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to one or more of the amino acid sequences of SEQ ID NO:1 or SEQ ID NO:2.

[0021] In some embodiments, the citramalate synthase comprises an amino acid sequence having at least 70% sequence identity to the amino acid sequence of SEQ ID NO:1. In some embodiments, the citramalate synthase comprises, or consists, of an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to one or more of the amino acid sequences of SEQ ID NO:1 . In some embodiments, the citramalate synthase comprises an amino acid sequence having at least 70% sequence identity to the amino acid sequence of SEQ ID NO:2. In some embodiments, the citramalate synthase comprises, or consists, of an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to one or more of the amino acid sequences of SEQ ID NO:2.

[0022] In some embodiments, the halophilic microorganism is a recombinant halophilic microorganism.

[0023] In some embodiments, the halophilic microorganism is a halophilic bacterium.

[0024] In some embodiments, the halophilic microorganism is a bacterium from the genus Halomonas or Vibrio.

[0025] In some embodiments, the recombinant microorganism is a recombinant Halomonas bluephagenesis or a recombinant Halomonas rowanensis bacterium. In some embodiments, the recombinant microorganism is a recombinant Halomonas bluephagenesis bacterium. In some embodiments, the recombinant microorganism is a recombinant Halomonas rowanensis bacterium.

[0026] In some embodiments, the microorganism comprises a recombinant plasmid and the heterologous citramalate synthase is expressed from the recombinant plasmid. In some embodiments, the microorganism comprises a recombinant plasmid according to the present disclosure.

[0027] In some embodiments, the plasmid comprises a polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism. In some embodiments, the polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism enhances plasmid stability in a halophilic microorganism.

[0028] In some embodiments, the plasmid is for the expression of a heterologous enzyme in a halophilic microorganism. In some embodiments, the plasmid is suitable for the expression of a heterologous enzyme in a halophilic microorganism. In some embodiments, the toxin-antitoxin system enhances plasmid stability in a halophilic microorganism.

[0029] In some embodiments, the plasmid comprises a polynucleotide which encodes an antitoxin and a polynucleotide which encodes a toxin.

[0030] In some embodiments, the polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism encodes a toxin, encodes an antitoxin, encodes a replication initiation protein, and / or is an origin of replication (on).

[0031] In some embodiments, the polynucleotide which encodes an antitoxin comprises a nucleic acid sequence having at least 40% sequence identity to SEQ ID NO:14. In some embodiments, the polynucleotide which encodes a toxin comprises a nucleic acid sequence having at least 40% sequence identity to SEQ ID NO:24. In some embodiments, the polynucleotide which encodes a replication initiation protein comprises a nucleic acid sequence having at least 40% sequence identity to SEQ ID NO:25. In some embodiments, the ori comprises a nucleic acid sequence having at least 40% sequence identity to SEQ ID NO:26.

[0032] In some embodiments, the expression of the gene encoding an enzyme is controlled by a constitutive promoter. In some embodiments, the gene encoding an enzyme encodes a transferase or a hydrolase. In some embodiments, the gene encoding an enzyme encodes a citramalate producing enzyme or a starch degrading enzyme. In some embodiments, the gene encoding an enzyme encodes a citramalate synthase. In some embodiments, the plasmid comprises a gene which encodes an amylase, a glucosidase, a glucoamylase, a CGTase, or a glucanotransferase.

[0033] In some embodiments, the plasmid comprises an operon comprising a gene encoding a citramalate producing enzyme and a gene encoding a starch degrading enzyme. In some embodiments, the operon is controlled by a constitutive promoter.

[0034] In some embodiments, the plasmid is capable of expressing a heterologous enzyme in a Halomonas bacterium.

[0035] In some embodiments, the vector is a plasmid according to the present disclosure. In some embodiments, the recombinant vector is a plasmid according to the present disclosure. In some embodiments, the recombinant vector is a recombinant plasmid according to the present disclosure. In some embodiments, the plasmid is a plasmid according to the present disclosure. In some embodiments, the plasmid is a recombinant plasmid according to the present disclosure. In some embodiments, the recombinant plasmid is a recombinant plasmid according to the present disclosure.

[0036] In some embodiments, the culture medium comprises at least 0.2 M NaCI. In some embodiments, the culture medium comprises at least 0.5 M NaCI. In some embodiments, the culture medium comprises at least 1.0 M NaCI.

[0037] In some embodiments, the culture medium comprises at least 2% NaCI. In some embodiments, the culture medium comprises at least 5% NaCI. In some embodiments, the culture medium comprises at least 9% NaCI.

[0038] In some embodiments, the culture medium is not sterilised before the culture medium is contacted with the halophilic microorganism. In some embodiments, the culture medium is not autoclaved, filtered, heated, boiled, irradiated, or treated with a gas, before the culture medium is contacted with the halophilic microorganism.

[0039] In some embodiments, the carbon source is a waste carbon source. In some embodiments, the carbon source is glucose, glycerol, starch, sucrose, or carbon dioxide. In some embodiments, the carbon source is derived from agro-industrial waste. In some embodiments, more than one carbon source is provided. In some embodiments, glucose and glycerol are provided as carbon sources. In some embodiments, glucose and starch are provided as carbon sources. In some embodiments, glucose and carbon dioxide are provided as carbon sources. In some embodiments, glycerol and starch are provided as carbon sources. In some embodiments, glycerol and carbon dioxide are provided as carbon sources.

[0040] In some embodiments, the method comprises the fermentation of the halophilic microorganism. In some embodiments, the fermentation comprises fed-batch fermentation or continuous fermentation. In some embodiments, the fermentation comprises fed-batch fermentation. In some embodiments, the fermentation comprises continuous fermentation. In some embodiments, the fermentation comprises a step of fed-batch fermentation followed by continuous fermentation.

[0041] In some embodiments, the method comprises the addition of further halophilic microorganisms into the culture medium, after fermentation has started. This addition increases the total number of cells undergoing fermentation within the vessel. In some embodiments, the cells are added periodically throughout the fermentation process.

[0042] In some embodiments, the method comprises the addition of further cells to the culture medium. In some embodiments, the method comprises the addition of further cells to the culture medium, after fermentation has started. In some embodiments, the further cells are further halophilic microorganism cells, wherein the halophilic microorganism is a halophilic microorganism described herein.

[0043] In some embodiments, the method is performed in the absence of antibiotics. In some embodiments, the method is performed in the absence of an inducer. In some embodiments, the method is performed in the absence of IPTG.

[0044] In some embodiments, the heterologous citramalate synthase is expressed constitutively. In some embodiments, the heterologous citramalate synthase is expressed in the absence of an inducer.

[0045] In some embodiments, the halophilic microorganism is a halophilic microorganism according to an aspect of the current disclosure.

[0046] The present disclosure also provides a plasmid comprising one or more genes encoding a toxin-antitoxin system, and a gene encoding an enzyme, wherein the plasmid comprises a polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism.

[0047] In some embodiments, the toxin-antitoxin system enhances plasmid stability in a halophilic microorganism.

[0048] In some embodiments, the plasmid comprises a polynucleotide which encodes an antitoxin and a polynucleotide which encodes a toxin. In some embodiments, the polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism encodes a toxin, encodes an antitoxin, encodes a replication initiation protein, and / or is an origin of replication (on).

[0049] In some embodiments, the polynucleotide which encodes an antitoxin comprises a nucleic acid sequence having at least 40% sequence identity to SEQ ID NO:14. In some embodiments, the polynucleotide which encodes a toxin comprises a nucleic acid sequence having at least 40% sequence identity to SEQ ID NO:24. In some embodiments, the polynucleotide which encodes a replication initiation protein comprises a nucleic acid sequence having at least 40% sequence identity to SEQ ID NO:25. In some embodiments, the ori comprises a nucleic acid sequence having at least 40% sequence identity to SEQ ID NO:26.

[0050] In some embodiments, expression of the gene encoding an enzyme is controlled by a constitutive promoter. In some embodiments, expression of the gene encoding an enzyme is controlled by an inducible promoter.

[0051] In some embodiments, the gene encoding an enzyme encodes a transferase or a hydrolase.

[0052] In some embodiments, the gene encoding an enzyme encodes a citramalate producing enzyme or a starch degrading enzyme. In some embodiments, the plasmid comprises an operon comprising a gene encoding a citramalate producing enzyme and a gene encoding a starch degrading enzyme. In some embodiments, the operon is controlled by a constitutive promoter.

[0053] In some embodiments, the plasmid is capable of expressing a heterologous enzyme in a Halomonas bacterium.

[0054] The present disclosure also provides a method of producing a hybrid plasmid, the method comprising:

[0055] (i) identifying a plasmid that is endogenous to a halophilic microorganism, wherein the plasmid comprises a toxin-antitoxin system;

[0056] (ii) isolating or synthesising the plasmid identified in step (i);

[0057] (ii) modifying the plasmid to comprise a gene encoding an enzyme, wherein the enzyme is heterologous to the halophilic microorganism of step (i).

[0058] The present disclosure also provides a method of modifying a halophilic microorganism, wherein the microorganism comprises an endogenous plasmid, wherein the endogenous plasmid comprises one or more genes encoding a toxin-antitoxin system, the method comprising:

[0059] (i) curing an endogenous plasmid from the microorganism, and

[0060] (ii) modifying the microorganism to express a recombinant vector, wherein the recombinant vector comprises one or more genes encoding a toxin-antitoxin system, and a gene encoding an enzyme.

[0061] The present disclosure also provides a method of producing a carbon compound, wherein the method comprises the provision of a halophilic microorganism, a culture medium, and a carbon source, wherein the halophilic microorganism expresses a recombinant plasmid, wherein the recombinant plasmid comprises one or more genes encoding a toxin-antitoxin system, and a gene encoding an enzyme. wherein the halophilic microorganism is contacted with the carbon source in the culture medium, and the carbon compound is produced through enzyme activity.

[0062] The present disclosure also provides a method of producing citramalate, wherein the method comprises the culture of a halophilic organism according to the present disclosure.

[0063] In some embodiments, the method comprises the provision of a halophilic microorganism, a culture medium, and a carbon source.

[0064] In some embodiments, the halophilic microorganism expresses a heterologous citramalate synthase.

[0065] In some embodiments, the halophilic microorganism is contacted with the carbon source in the culture medium, and citramalate is produced through citramalate synthase activity.

[0066] In some embodiments, the culture medium comprises at least 0.2 M NaCI. In some embodiments, the culture medium comprises at least 0.5 M NaCI. In some embodiments, the culture medium comprises at least 1.0 M NaCI.

[0067] In some embodiments, the culture medium comprises at least 2% NaCI. In some embodiments, the culture medium comprises at least 5% NaCI. In some embodiments, the culture medium comprises at least 9% NaCI.

[0068] In some embodiments, the culture medium is not sterilised before the culture medium is contacted with the halophilic microorganism. In some embodiments, the culture medium is not autoclaved, filtered, heated, boiled, irradiated, or treated with a gas, before the culture medium is contacted with the halophilic microorganism.

[0069] In some embodiments, the carbon source is a waste carbon source. In some embodiments, the carbon source is glucose, glycerol, sucrose, starch, or carbon dioxide. In some embodiments, the carbon source is derived from agro-industrial waste. In some embodiments, the method comprises the fermentation of the halophilic microorganism.

[0070] In some embodiments, the method is performed in the absence of antibiotics.

[0071] In some embodiments, the heterologous citramalate synthase is expressed constitutively. In some embodiments, the heterologous citramalate synthase is expressed in the absence of an inducer. In some embodiments, the expression of the heterologous citramalate synthase is induced.

[0072] The invention includes the combination of the aspects and preferred features described except where such a combination is clearly impermissible or expressly avoided. Summary of the Figures

[0073] Embodiments and experiments illustrating the principles of the invention will now be discussed with reference to the accompanying figures in which:

[0074] Figure 1A-E: (A) Citramalate chemical structure; (B) citramalic acid chemical structure; (C) Plasmid map of pSEVA434-T7-cimA; (D) Plasmid map of pSEVA434-tac-cimA; (E) Plasmid map of pSEVA434-T7- empty.

[0075] Figure 2A-C: (A) Citramalate standard curve determined by HPLC analysis; (B) Growth of H. bluephagenesis TD1 .0 containing pSEVA434-T7-cimA. Cultures were grown for 72 h in LB60 medium pH 9.0; (C) Citramalate production by H. bluephagenesis TD1.0 containing pSEVA434-T7-cimA. Cultures were grown for 72 h in LB60 medium pH 9.0.

[0076] Figure 3A-D: (A) Effect of nitrogen source on the growth of H. bluephagenesis TD1 .0 containing pSEVA434-T7-cimA; (B) Effect of the IPTG concentration on the growth of H. bluephagenesis TD1.0 containing pSEVA434-T7-cimA; (C) Effect of nitrogen source on citramalate production by H. bluephagenesis TD1 .0 containing pSEVA434-T7-cimA; (D) Effect of IPTG concentration on citramalate production by H. bluephagenesis TD1 .0 containing pSEVA434-T7-cimA.

[0077] Figure 4A-C: (A) Effect of glycerol purity and trace elements on Halomonas growth; (B) Effect of glycerol purity and trace elements on citramalate production of H. bluephagenesis TD1 .0; (C) Effect of IPTG on citramalate production of H. bluephagenesis TD1 .0 cultivated on different glycerol sources.

[0078] Figure 5A-C: (A) Glucose standard curve by HPLC; (B) Growth profile of H. bluephagenesis TD1.0 containing pSEVA434-T7-cimA grown on MM63 medium containing potato starch, sucrose or carboxymethylcellulose (CMC) as the carbon source; (C) Citramalate production by H. bluephagenesis TD1 .0 pSEVA434-T7-cimA cultivated on three different carbon sources (potato starch, sucrose or carboxymethylcellulose (CMC)).

[0079] Figure 6A-B: (A) Effect of IPTG concentration on the growth of H. bluephagenesis TD1 .0 containing pSEVA434-T7-cimA grown on MM63 with glucose as the carbon source; (B) Effect of IPTG concentration on citramalate production of H. bluephagenesis TD1 .0 containing pSEVA434-T7-cimA grown on MM63 with glucose as the carbon source.

[0080] Figure 7A-H: (A) Plasmid map of pQ08; (B) Plasmid map of pSEVA241-phaC-delete; (C) Plasmid map of pSEVA241-donor-HbpB (and pSEVA241-hbpB-antitoxin). The two plasmids differ by the exact sequence of the gRNA, but the overall map description is the same for both; (D) Agarose gel electrophoresis of linearised pSEVA214-phaC-delete PCR products. Lanes: 1 = 1 kb DNA ladder; 2 = PCR with 0.1 pL template, 3 = PCR with 0.25 pL template, 4 = PCR with 0.5 pL template; (E) Agarose gel electrophoresis of amplified hbpB insert PCR products. Lanes: 1 = 1 kb DNA ladder; 2 = PCR with 0.1 pL of template, 3 = PCR with 0.25 pL template, 4 = PCR with 0.5 pL template; (F) Sequence alignment of the pSEVA241- hbpb-antitoxin plasmid and three independent nanopore sequenced plasmids; (G) Agarose gel electrophoresis of amplified pSEVA241_donor PCR products for gRNA mutagenesis. Lanes: 1 = 1 kb DNA ladder; 2 = negative control (without Q5), 3 = PCR annealing temperature of 57 °C, 4 = PCR annealing temperature of 58 °C, 5 = PCR annealing temperature of 59 °C; (H) Sequence alignment between the pSEVA241-hbpb-antitoxin plasmid and five independent nanopore sequenced plasmids after gRNA mutagenesis.

[0081] Figure 8A-D: (A) Plasmid map of pHbPBC-sfGFP; (B) Plasmid map of pHbPBC-T7L-cimA; (C) Plasmid map of pHbPBC-T7L-cimA-amyL-HalGluc1 ; (D) Plasmid map of pHbPBC-J23119-cimA-amyL-HalGluc1 .

[0082] Figure 9: Fermentation monitoring of H. bluephagenesis TD1 .0 containing pSEVA434-T7-cimA in minimal medium with glycerol as the carbon source.

[0083] Figure 10: Fermentation monitoring of H. bluephagensis TD1 .0 containing pSEVA434-T7-cimA in minimal medium with glucose as a carbon source. Data points were taken manually and run on a Hi-Plex H HPLC column.

[0084] Figure 11 : Fermentation monitoring of H. bluephagensis TD1 .0 with pSEVA434-T7-cimA cultivated on commercial sucrose as the carbon source. Data points were taken manually and run on a Hi-Plex H HPLC column.

[0085] Figure 12: Fermentation monitoring of H. bluephagensis TD1 .0 with pSEVA434-T7-cimA cultivated on crude sucrose as the carbon source. Data points were taken manually and run on a Hi-Plex H HPLC column.

[0086] Figure 13: Fermentation monitoring of H. bluephagensis TD1 .0 with pSEVA434-T7-cimA cultivated on crude glycerol as the carbon source. Data points were taken manually and run on a Hi-Plex H HPLC column. The asterisks denote the time points when aliquots of additional cells were added to the culture.

[0087] Figure 14: Fermentation monitoring of H. bluephagensis TD1.0 with pHbPBC_amyL_Halgluc1_cimA cultivated on hydrolysed starch as the carbon source. Data points were taken manually and run on a Hi- Plex H HPLC column. The asterisks denote the time points when aliquots of additional cells were added to the culture.

[0088] Detailed Description of the Invention

[0089] Aspects and embodiments of the present invention will now be discussed with reference to the accompanying figures. Further aspects and embodiments will be apparent to those skilled in the art. All documents mentioned in this text are incorporated herein by reference.

[0090] The present invention is based on the construction of novel plasmids, the development of novel methods of modifying microbial cells, the generation of novel microbial cells, and the development of novel methods of producing citramalate.

[0091] Halophilic microorganisms are known to produce particularly stable endogenous enzymes. Such enzymes are able to function under high concentrations of salt which would normally lead to the precipitation or denaturation of most proteins, including enzymes (Aljohny. Biosci Biotechnol Res Asia 2015;12(3)). Alkaliphilic microorganisms are capable of growth at elevated pH (e.g. pH 9-11), well above the optimal pH of most other ‘standard’ microorganisms (e.g. E. coli). An organism that is both halophilic and alkaliphilic (e.g. Halomonas bluephagenesis cultivated in 6-10% NaCI at pH 9) is capable of growth under conditions where very little other contaminating organisms survive. Therefore, it was surprising that citramalate synthase enzymes from non-halophilic / non- alkaliphilic microorganisms were able to function under high concentrations of salt and high pH.

[0092] Halophilic microorganisms provided by the current disclosure, are particularly useful for the production of citramalate in non-sterile conditions. Their ability to grow in media containing high levels of salt (and often high pH) means that fermentation equipment does not need to be sterilized before production starts, and the risk of contamination during culture is reduced, which is expected to greatly reduce the costs associated with citramalate production. Their ability to grow in media containing high levels of salt also means that culture media does not need to be autoclaved. Autoclaving is another process which is time consuming, adds costs to processes, and can lead to component chemical precipitation. Furthermore, autoclaving media containing some waste carbon sources can lead to caramelisation and / or degradation of the carbon source, reducing the available carbon for growth and target compound production.

[0093] Therefore, removing the need to autoclave media means that a wider range of waste carbon sources can be used.

[0094] Additionally, inventors have shown that the halophilic microorganisms which expresses a heterologous citramalate synthase can grow in media comprising tap water obtained directly from a faucet or tap, that has not been further purified, distilled, or otherwise treated after delivery from the faucet or tap. Additional water sources suitable for halophilic microorganisms include sea water and contaminated municipal / industrial wastewater streams. This is another unexpected finding that is associated with environmental and cost-saving benefits by reducing the requirement for fresh water.

[0095] Halophilic microorganisms provided by the current disclosure have also been shown to be suitable for continuous fermentation, and prolonged cultivation under non-sterile conditions in the absence of antibiotics. Again, these findings associated with environmental and cost-saving benefits.

[0096] Citramalate and citram al ic acid

[0097] Citramalate is a conjugate base of citramalic acid. It is a dicarboxylic acid dianion that is obtained by removal of a proton from both of the carboxylic acid groups of citramalic acid. In biology, citramalate has a role as a metabolite. In industry, citramalate and citramalic acid are useful intermediates for the production of methacrylic acid (MAA) and poly(methyl methacrylate) (PMMA).

[0098] Citramalate is an organic compound with the formula C5H6O5, which is shown in Figure 1A. Citramalic acid is an organic compound with the formula C5H8O5, which is shown in Figure 1 B. Citramalate can be produced as different enantiomers. Several bacteria form (R)-citramalate, whereas yeast and apple form (S)-citramalate. (R)-Citramalate is enzymatically produced by a citramalate synthase in some organisms, such as archaea, plants and yeast from pyruvic acid and acetyl coenzyme A (acetyl-CoA). Citramalate synthases catalyse the condensation of pyruvate and acetyl-CoA to form ( / ?)- citramalate. In some embodiments, the citramalate is (R)-citramalate and / or (S)-citramalate. In some embodiments, the citramalate is (R)-citramalate.

[0099] Acetyl-CoA and pyruvate are intermediates which are involved in many metabolic pathways. Acetyl-CoA is derived from glucose, fatty acid, and amino acid catabolism. The production of acetyl-CoA is described by Shi and Tu (Curr Opin Cell Biol. 2015 Apr; 33: 125-131), which is hereby incorporated by reference in its entirety. Pyruvate is the final product of the glycolysis pathway. The production of pyruvate is described by Yuan et al. (Microorganisms. 2022 Dec; 10(12): 2454), which is hereby incorporated by reference in its entirety.

[0100] Enzymes are biomolecules, usually proteins, which act as biological catalysts by accelerating chemical reactions. Enzymes are vital for metabolism and regulate the biochemical reactions essential for life, such as the citric acid cycle. Additionally, enzymes can be used as biocatalysts in biotechnology for the production of useful biochemicals, such as citramalate. Enzymatic activity, or enzyme activity, is the enzymatic conversion of substrate (s) to product(s).

[0101] The International Union of Biochemistry and Molecular Biology have developed a nomenclature for enzymes, the EC numbers (for "Enzyme Commission"). Each enzyme is described by "EC" followed by a sequence of four numbers which represent the hierarchy of enzymatic activity (from very general to very specific). That is, the first number broadly classifies the enzyme based on its mechanism while the other digits add more and more specificity and order of deposition.

[0102] The top-level classifications are: EC 1 (oxidoreductases), EC 2 (transferases), EC 3 (hydrolases), EC 4 (lyases), EC 5 (isomerases), EC 6 (ligases), and EC 7 (translocases). In some embodiments, the enzymes is an oxidoreductase, a transferase, a hydrolase, a lyase, an isomerase, a ligase, or a translocase.

[0103] In some embodiments, the enzyme is an oxidoreductase. An oxidoreductase is an enzyme that catalyses the transfer of electrons from one molecule to another. In some embodiments, the enzyme is a transferase. A transferase is an enzyme that catalyses the transfer of specific functional groups from one molecule to another. In some embodiments, the enzyme is a hydrolase. A hydrolase is an enzyme that catalyses bond cleavages by a reaction with water. In some embodiments, the enzyme is a lyase. A lyase is an enzyme that catalyses the breaking of a chemical bond by means other than hydrolysis and oxidation. In some embodiments, the enzyme is an isomerase. An isomerase is an enzyme that converts a molecule from one isomer to another. In some embodiments, the enzyme is a translocase. A translocase is an enzyme that assists in moving a specific molecule, often across a cell membrane. Transferases are a class of enzymes that transfer specific functional groups from one molecule (donor) to another (acceptor). One type of transferase is an acyltransferase. Acyltransferases, or transacylases, utilise acyl chains and transfer them to a variety of different substrates or polymerize them.

[0104] Acyltransferases have the classification: EC 2.3. In some embodiments, the enzyme is an acyltransferase.

[0105] Acyltransferases may have a wide range of functions and properties. One subgroup of acyltransferases convert acyl groups to alkyl groups on transfer (EC 2.3.3). In some embodiments, the enzyme is an acyltransferase which catalytically converts acyl groups to alkyl groups on transfer (EC 2.3.3). One specific type of enzyme which catalytically converts acyl groups to alkyl groups on transfer is an (R)- citramalate synthase (or a citramalate synthase). In some embodiments, the enzyme is an (R)-citramalate synthase (or a citramalate synthase).

[0106] In some embodiments, the enzyme is an enzyme which catalyses the production of a metabolite. Citramalate is an example of a metabolite, therefore a citramalate synthase is an enzyme which catalyses the production of a metabolite.

[0107] Citramalate producing enzymes are enzymes capable of converting substrates into citramalate or citramalic acid. In some embodiments, the citramalate producing enzyme is a citramalate synthase.

[0108] A citramalate synthase, or an (R)-citramalate synthase (EC 2.3.3.21), is an acyltransferase which performs the following reaction: acetyl-CoA + pyruvate + H2O = CoA + (2R)-citramalate. Therefore, an enzyme with citramalate synthase activity is an enzyme capable of converting acetyl-CoA + pyruvate + H2O to CoA + (2R)-citramalate. In more simple terms, an enzyme with citramalate synthase activity is an enzyme capable of producing citramalate from acetyl-CoA and pyruvate. Citramalate synthases were previously identified by EC 2.3.1.182. Citramalate synthases are described in Howell et al. (J Bacteriol. 1999 Jan; 181 (1): 331-333), which is hereby incorporated by reference in its entirety.

[0109] Some methods of the present disclosure employ microorganisms which express a citramalate synthase. In some embodiments, the citramalate synthase is (R)-citramalate synthase CimA. The enzyme CimA was initially found in the methanogenic archaeon Methanococcus jannaschii (Howell et al. J Bacteriol. 1999 Jan; 181 (1): 331-333). Citramalate synthases do not exist in most known microbial hosts. In some embodiments, the citramalate synthase is a wild type or mutant CimA derived from a methanogenic archaean. Methanogenic archaeans are microorganisms that produce methane as a metabolic byproduct under hypoxic conditions, they belong to the domain Archaea, and are members of the phylum Euryarchaeota.

[0110] In some embodiments, the citramalate synthase is a wild type or mutant CimA derived from:

[0111] Methanocaldococcus jannaschii (Uniprot: Q58787), Leptospira interrogans (Uniprot: Q8F3Q1), Sulfolobus acidocaldarius (Uniprot: Q4J6H1), Geobacter sulfurreducens (Uniprot: Q74C76), Methanoculleus marisnigri (Uniprot: A3CUF2), Methanosarcina mazei (Uniprot: P58966), Methanothermobacter thermautotrophicus (Uniprot: 026819), Methanosarcina acetivorans (Uniprot: Q8TJJ1), Methanosphaerula palustris (Uniprot: B8GEI1), Methanopyrus kandleri (Uniprot: Q8TYM1), Archaeoglobus fulgidus (Uniprot: 029305), Thermotoga maritima (Uniprot: Q9WZ22), Aquifex aeolicus (Uniprot: 066682), Streptomyces coelicolor (Uniprot: 086511), or Synechocystis sp. (Uniprot: P74269).

[0112] In some embodiments, the citramalate synthase is a Methanocaldococcus jannaschii (Uniprot: Q58787), Leptospira interrogans (Uniprot: Q8F3Q1), Sulfolobus acidocaldarius (Uniprot: Q4J6H1), Geobacter sulfurreducens (Uniprot: Q74C76), Methanoculleus marisnigri (Uniprot: A3CUF2), Methanosarcina mazei (Uniprot: P58966), Methanothermobacter thermautotrophicus (Uniprot: 026819), Methanosarcina acetivorans (Uniprot: Q8TJJ1), Methanosphaerula palustris (Uniprot: B8GEI1), Methanopyrus kandleri (Uniprot: Q8TYM1), Archaeoglobus fulgidus (Uniprot: 029305), Thermotoga maritima (Uniprot: Q9WZ22), Aquifex aeolicus (Uniprot: 066682), Streptomyces coelicolor (Uniprot: 086511), or Synechocystis sp. (Uniprot: P74269) citramalate synthase.

[0113] In some embodiments, the citramalate synthase is a 2-isopropylmalate synthase. In some embodiments, the citramalate synthase is a 2-isopropylmalate synthase which is capable of producing citramalate. In some embodiments, the citramalate synthase is a 2-isopropylmalate synthase which has citramalate synthase activity.

[0114] A number of 2-isopropylmalate synthase enzymes are known to produce citramalate. For example, it has been shown that 2-isopropylmalate synthase TTC0849 is dual functioning and catalyses both 2- isopropylmalate and citramalate production, and TTC0847 catalyses citramalate production (Yoshida, et al., 2018. Biochemical and Biophysical Research Communications, 501 (2) 465-470, hereby incorporated by reference in its entirety). TTC0847 and TTC0849 are specifically shown to produce citramalate from acetyl-CoA and pyruvate. In some embodiments, the citramalate synthase is a wild type or mutant citramalate synthase derived from a 2-isopropylmalate synthase. In some embodiments, the citramalate synthase is a wild type or mutant citramalate synthase derived from TTC0847 (Uniprot: Q72JD1) or TTC0849 (Uniprot: Q72JC9). In some embodiments, the citramalate synthase is TTC0847 (Uniprot: Q72JD1) or TTC0849 (Uniprot: Q72JC9).

[0115] Further evidence for 2-isopropylmalate synthase enzymes producing citramalate is provided in de Kraker at al. (Plant Physiology, 2007, 143, 970-986), Frantom (Arch Biochem Biophys. 2012. 15;519(2):202-9), Xu et al. (Journal of Bacteriology, 2004, 5400-5409), and Wiegel and Schlegel (Arch. Microbiol. 112, 247- 254. 1977), which are hereby incorporated by reference in their entirety.

[0116] In some embodiments, the citramalate synthase is an (R)-citramalate synthase derived from Methanocaldococcus jannaschii (Uniprot: Q58787). In some embodiments, the citramalate synthase comprises an amino acid sequence with at least 40% sequence identity to SEQ ID NO:1 . In some embodiments, the citramalate synthase comprises, or consists, of an amino acid sequence having at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO:1 .

[0117] In some embodiments, the citramalate synthase is a wild type or mutant (R)-citramalate synthase derived from Methanocaldococcus jannaschii (Uniprot: Q58787). In some embodiments, the citramalate synthase comprises an amino acid sequence with at least 40% sequence identity to SEQ ID NO:1 or SEQ ID NO:2. In some embodiments, the citramalate synthase comprises, or consists, of an amino acid sequence having at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to one or more of the amino acid sequences of SEQ ID NO:1 or SEQ ID NO:2.

[0118] In some embodiments, the citramalate synthase is an (R)-citramalate synthase derived from CimA3.7. In some embodiments, the citramalate synthase comprises an amino acid sequence with at least 40% sequence identity to SEQ ID NO:2. In some embodiments, the citramalate synthase comprises, or consists, of an amino acid sequence having at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO:2. In some embodiments, the citramalate synthase is CimA3.7.

[0119] In some embodiments, the citramalate synthase is a mutant citramalate synthase which lacks a C- terminal domain which is present in the corresponding wild type citramalate synthase from which it is derived. In some embodiments, the citramalate synthase is a mutant citramalate synthase which lacks an L-isoleucine interacting domain. In some embodiments, the citramalate synthase is a mutant citramalate synthase which is insensitive to feedback inhibition by L-isoleucine. In some embodiments, the citramalate synthase is a mutant (R)-citramalate synthase described in Atsumi and Liao (Appl Environ Microbiol. 2008 Dec; 74(24): 7802-7808) or US2010209986A1 , which are hereby incorporated by reference in their entirety.

[0120] The citramalate synthase comprises citramalate synthase activity. Citramalate synthase activity is the enzymatic conversion of acetyl-CoA + pyruvate + H2O to CoA + (2R)-citramalate.

[0121] Citramalate synthase activity may be assayed through any method known in the art. For example, a typical enzymatic assay could be performed by purifying an enzyme, providing substrates, and determining the amount of product made. In this case, citramalate synthase activity may be assayed by monitoring the production of CoA over time, or by monitoring the production of (2R)-citramalate over time. A citramalate synthase activity assay is provided in Atsumi and Liao (Appl Environ Microbiol. 2008 Dec; 74(24): 7802-7808), which is hereby incorporated by reference in its entirety. Alternatively, cellular methods could be performed to determine whether an enzyme has citramalate synthase activity. A microbial cell could be transformed to express a heterologous citramalate synthase, and citramalate production by the cell could be monitored. In some embodiments, citramalate synthase activity may be determined through the methods used in the Examples disclosed herein. Starch

[0122] Starch is a polymeric carbohydrate consisting of multiple glucose units joined by glycosidic bonds. Native starches are composed of amylose and amylopectin. Amylose is a mostly linear molecule containing a-D- glucosyl units that are essentially linked by a-1 ,-4-glycosidic bonds, whereas amylopectin is a highly branched structure composed of large polymers of a-1 , 4-glycosidic bonds linked a-D-glucosyl units with a-1 , 6-linked side chains (Xu et al. Biotechnol. Biofuels 9, 216. 2016).

[0123] Some organisms are unable to digest starch and use the resultant sugars for growth. For example, inventors unexpectedly found that Halomonas bluephagenesis did not demonstrate significant growth in medium containing potato starch as a carbon source. Therefore, starch must undergo hydrolysis to release the glucose before it can be used as a carbon source for some organisms such as H. bluephagenesis.

[0124] In some embodiments, the halophilic microorganism expresses a starch degrading enzyme. In some embodiments, the halophilic microorganism expresses a heterologous starch degrading enzyme. In some embodiments, the plasmid comprises a gene which encodes a starch degrading enzyme.

[0125] Starch-degrading enzymes include glycoside hydrolases (GHs), transglycosidases, glycosyl transferases (GTs) (phosphorylases), lyases, phosphatases and lytic polysaccharide monooxygenases (LPMOs). Amylases and glucosidases are specific types of starch degrading enzymes. Starch-degrading enzymes have been classified as: hydrolases (EC 3) such as a-amylase; p-amylase; glucoamylase; a-glucosidase; p-glucosidase; debranching enzymes, and transferases (EC 2) such as CGTase; 4-a-glucanotransferase; and a branching enzyme. Starch-degrading enzymes are discussed in detail in Moller and Svensson (Current Opinion in Structural Biology, 40, 2016, 33-42), which is hereby incorporated by reference in its entirety.

[0126] In some embodiments, the starch degrading enzyme is an amylase, glucosidase, glucoamylase, a CGTase, or a glucanotransferase. In some embodiments, the starch degrading enzyme is an amylase, or a glucosidase. In some embodiments, the amylase is a a-amylase or a p-amylase. In some embodiments, the glucosidase is an a-glucosidase or a p-glucosidase.

[0127] In some embodiments, the starch degrading enzyme is an a-amylase. An a-amylase is an enzyme which catalyses the cleavage of a-1 , 4-glycosidic bonds of starch and other related polysaccharides to generate oligosaccharides of varying lengths with a-configuration and a-limit dextrins, which constitute the branched oligosaccharides. a-Amylase enzymes are categorised as EC 3.2.1.1.

[0128] In some embodiments, the a-amylase is a microbial a-amylase. The application of microbial a-amylase in industry is reviewed by de Souza and Magalhaes (Braz J Microbiol. 2010 Oct-Dec; 41 (4): 850-861), which is hereby incorporated by reference in its entirety. In some embodiments, the a-amylase is an a- amylase described in de Souza and Magalhaes (Braz J Microbiol. 2010 Oct-Dec; 41 (4): 850-861). In some embodiments, the a-amylase is a bacterial a-amylase. In some embodiments, the a-amylase is derived from the genus Bacillus. In some embodiments, the a-amylase is a wild type or mutant a-amylase derived from the genus Bacillus. In some embodiments, the a-amylase is a wild type or mutant a-amylase derived from Bacillus licheniformis, Bacillus stearothermophilus , and Bacillus amyloliquefaciens.

[0129] In some embodiments, the a-amylase is a wild type or mutant a-amylase derived from Bacillus licheniformis. In some embodiments, the a-amylase is a Bacillus licheniformis a-amylase (Uniprot: Q208A7). The Bacillus licheniformis a-amylase (Uniprot: Q208A7) is a protein comprising 512 amino acids (SEQ ID NO:5). The mature form of Bacillus licheniformis a-amylase, without a signal peptide, is a protein comprising 483 amino acids (SEQ ID NO:38).

[0130] In some embodiments, the a-amylase comprises an amino acid sequence with at least 40% sequence identity to SEQ ID NO:5. In some embodiments, the a-amylase comprises, or consists, of an amino acid sequence having at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO:5.

[0131] In some embodiments, the a-amylase comprises an amino acid sequence with at least 40% sequence identity to SEQ ID NO:38. In some embodiments, the a-amylase comprises, or consists, of an amino acid sequence having at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO:38.

[0132] In some embodiments, the starch degrading enzyme is a glucosidase. In some embodiments, the starch degrading enzyme is p-glucosidase. p-glucosidases are enzymes that can hydrolyze the terminal, nonreducing p-D-glucosyl residues by hydrolyzing the p-1 , 4 glycosidic bond of various glycoconjugates including starch, to form glucose. The p-glucosidases substrates are widely distributed in nature, and the enzyme is present across archaea, bacteria, and eukaryotes, p-glucosidase enzymes are categorised as EC 3.2.1.21.

[0133] The industrial applications of p-glucosidases are discussed in detail in Singh et al. (3 Biotech. 2016 Jun; 6(1): 3), which is hereby incorporated by reference in its entirety. In some embodiments, the p- glucosidase is a p-glucosidase described in Singh etal. (3 Biotech. 2016 Jun; 6(1): 3).

[0134] In some embodiments, the p-glucosidase is a microbial p-glucosidase. In some embodiments, the p- glucosidase is a bacterial p-glucosidase. In some embodiments, the p-glucosidase is a p-glucosidase from the genus Halomonas. In some embodiments, the p-glucosidase is a wild type or mutant a-amylase derived from a microbe. In some embodiments, the p-glucosidase is a wild type or mutant a-amylase derived from a bacterium. In some embodiments, the p-glucosidase is a wild type or mutant bacterial a- amylase derived from a bacterium of the genus Halomonas.

[0135] In some embodiments, the p-glucosidase is a wild type or mutant p-glucosidase derived from H. bluephagenesis. In some embodiments, the p-glucosidase is a H. bluephagenesis p-glucosidase. In some embodiments, the p-glucosidase is a wild type or mutant a-amylase derived from H. bluephagenesis HalGlud . In some embodiments, the p-glucosidase is H. bluephagenesis HalGlucl . In some embodiments, the p-glucosidase is a wild type or mutant a-amylase derived from H. bluephagenesis HalGluc2. In some embodiments, the p-glucosidase is H. bluephagenesis HalGluc2.

[0136] In some embodiments, the p-glucosidase comprises an amino acid sequence with at least 40% sequence identity to SEQ ID NO:6. In some embodiments, the p-glucosidase comprises, or consists, of an amino acid sequence having at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO:6.

[0137] In some embodiments, the p-glucosidase comprises an amino acid sequence with at least 40% sequence identity to SEQ ID NO:27. In some embodiments, the p-glucosidase comprises, or consists, of an amino acid sequence having at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO:27.

[0138] In some embodiments, the glucosidase is an a-glucosidase. An a-glucosidase (EC 3.2.1 .20) is a glucosidase that acts upon a(1-4) bonds. The hydrolysis of terminal, non-reducing (1 -4)-linked a-D- glucose residues by an a-glucosidase leads to the release of D-glucose monomers.

[0139] In some embodiments, the glucosidase is a wild type Bacillus glucosidase, or mutant glucosidase derived from a Bacillus glucosidase. In some embodiments, the glucosidase is a wild type Bacillus glucosidase, or mutant glucosidase derived from a Bacillus a-glucosidase. In some embodiments, the glucosidase is a wild type Bacillus a-glucosidase, or mutant a-glucosidase derived from a Bacillus a-glucosidase.

[0140] In some embodiments, the glucosidase comprises an amino acid sequence with at least 40% sequence identity to SEQ ID NO:28. In some embodiments, the glucosidase comprises, or consists, of an amino acid sequence having at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO:28.

[0141] In some embodiments, the glucosidase comprises an amino acid sequence with at least 40% sequence identity to SEQ ID NO:29. In some embodiments, the glucosidase comprises, or consists, of an amino acid sequence having at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO:29.

[0142] Aspects of the present invention relate to recombinant microorganisms. Further aspects of the present invention relate to methods of modifying a microorganism. Further aspects of the present invention relate to plasmid for the expression of a gene in a microorganism. Further aspects of the present invention relate to methods of producing citramalate, wherein microorganisms are utilised in said methods. Microorganisms may be provided in isolated form and / or in culture. Microorganisms may be provided in vitro.

[0143] A microorganism comprising an enzyme according to the present invention may do so through expression from a nucleic acid / expression vector according to the present invention that has been introduced into the microorganism. Microorganisms contemplated for use with the present invention include prokaryotic and eukaryotic cells. For example, the prokaryotic cell may be a bacteria or archaea, and the eukaryotic microorganism may be a fungi, protist, or microscopic animal or microscopic plant organism.

[0144] In preferred aspects, the microorganism is a bacterium. Any bacterium may be used, such as laboratory strains (such as E. coli or Bacillus subtilis), or field strains. In some embodiments, bacteria are organotrophic, e.g. chemoheterotrophic bacteria, capable of using biomass or compounds derived therefrom as an energy source. In particular embodiments, Escherichia bacteria such as E. coli, Saccharomyces yeast such as S. cerevisiae and cyanobacteria are contemplated for use in the present invention.

[0145] Preferred bacteria are robust bacteria, such as soil bacteria and / or extremophilic bacteria. Especially preferred are halophilic bacteria. These are capable of growing in open non-sterile conditions. As these strains are salt tolerant, and often alkaliphilic, they will not be outcompeted by contaminating bacteria or other microorganisms so long as there is a high enough salt content, and optionally high pH.

[0146] Furthermore, the addition of a high salt buffer (e.g. at least a 3% salt solution) can be used to control competing bacteria. Halophilic bacteria include those of the genus Halomonas.

[0147] Microorganisms commonly used in commercial and industrial processes are contemplated, including microorganisms used for the commercial or industrial production of chemicals, enzymes or other biological molecules. In preferred aspects, the cells are of a bacterium. In some embodiments, the bacterium may be a Gram-positive bacterium. Gram-positive bacteria include bacteria from the genus Bacillus, bacteria from the genus Listeria, Clostridium (e.g. C. difficile), or cocci such as Staphylococcus (e.g. S. aureus), or Streptococcus. In some embodiments the bacterium may be a Gram-negative bacterium. Gram-negative bacteria may be defined as a class of bacteria that do not retain the crystal violet stain used in the Gram staining method of bacterial differentiation, making positive identification possible. Gram-negative bacteria include proteobacteria or bacteria of the family Enterobacteriaceae, such as Escherichia coli, Salmonella sp, Shigella sp, or bacteria selected from the genus Pseudomonas, Helicobacter, Neisseria, Legionella, Halomonas, Klebsiella or Yersinia bacterium.

[0148] In some embodiments, the fungi may be Blastocladiomycota, Chytridiomycota, Glomeromycota, Microsporidia, or Neocallimastigomycota. In some embodiments, the fungi may be Dikarya (including Deuteromycota), such as fungi of the Ascomycota, including Pezizomycotina, Saccharomycotina, and Taphrinomycotina; or Basidiomycota, including Agaricomycotina, Pucciniomycotina, and Ustilaginomycotina. In some embodiments, the fungi may be fungi of the Entomophthoromycotina, Kickxellomycotina, Mucoromycotina, or Zoopagomycotina.

[0149] The microorganism may be modified. The microorganism may be modified through any known genetic engineering methodology. In some embodiments, the microorganism expresses a heterologous gene. In some embodiments, the microorganism is modified to express a heterologous gene. In some embodiments, the microorganism is modified to overexpress a gene. In some embodiments, the microorganism is modified to express a heterologous vector. In some embodiments, the microorganism is modified to express a heterologous plasmid.

[0150] In some embodiments, the microorganism is modified to express a gene which encodes a citramalate synthase. In some embodiments, the microorganism is modified to express a gene which encodes a citramalate synthase described herein. In some embodiments, the citramalate synthase comprises an amino acid sequence with at least 40% sequence identity to SEQ ID NO:1 or SEQ ID NO:2. In some embodiments, the citramalate synthase comprises, or consists, of an amino acid sequence having at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to one or more of the amino acid sequences of SEQ ID NO:1 and / or SEQ ID NO:2.

[0151] In some embodiments, the microorganism is modified to express a gene which encodes a starch degrading enzyme. In some embodiments, the microorganism is modified to express a gene which encodes a starch degrading enzyme described herein. In some embodiments, the starch degrading enzyme comprises an amino acid sequence with at least 40% sequence identity to SEQ ID NO:5 and / or SEQ ID NO:6. In some embodiments, the starch degrading enzyme comprises, or consists, of an amino acid sequence having at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO:5 and / or SEQ ID NO:6.

[0152] In some embodiments, the microorganism is modified to express a plasmid comprising a gene encoding a citramalate synthase. In some embodiments, the microorganism is modified to express a plasmid comprising a gene encoding a citramalate synthase under the control of a constitutive promoter. In some embodiments, the microorganism is modified to express a plasmid comprising a gene encoding a citramalate synthase under the control of an inducible promoter. In some embodiments, the microorganism is modified to express a pSEVA434-T7-cimA, pSEVA434-tac-cimA, or a pHbPBC-T7L- cimA plasmid.

[0153] In some embodiments, the microorganism is modified to express a plasmid comprising a gene encoding a citramalate synthase and a gene encoding a starch degrading enzyme. In some embodiments, the microorganism is modified to express a plasmid comprising a gene encoding a citramalate synthase and a gene encoding a starch degrading enzyme under the control of a constitutive promoter. In some embodiments, the microorganism is modified to express a plasmid comprising a gene encoding a citramalate synthase and a gene encoding a starch degrading enzyme under the control of an inducible promoter. In some embodiments, the microorganism is modified to express a pSEVA434-T7-cimA-amyL, pSEVA434-T7-cimA-HalGluc1 , pSEVA434-T7-cimA-amyL-HalGluc1 , pSEVA434-tac-cimA-amyL, pSEVA434-tac-cimA-HalGluc1 , pSEVA434-tac-cimA-amyL-HalGluc1 , pHbPBC-T7L-cimA-amyL, pHbPBC-T7L-cimA-HalGluc1 , or a pHbPBC-T7L-cimA-amyL-HalGluc1 plasmid.

[0154] The microorganism may be modified through any known methodology. The microorganism may be modified through any known gene silencing methodology. For example, the microorganism may be modified through methodologies involving, siRNA, miRNA, shRNA, TALEN, CRISPR and / or RNAi.

[0155] Small RNA molecules may be employed to regulate gene expression. These include targeted degradation of mRNAs by small interfering RNAs (siRNAs), post transcriptional gene silencing (PTGs), developmentally regulated sequence-specific translational repression of mRNA by micro-RNAs (miRNAs) and targeted transcriptional gene silencing.

[0156] A role for the RNAi machinery and small RNAs in targeting of heterochromatin complexes and epigenetic gene silencing at specific chromosomal loci has also been demonstrated. Double-stranded RNA (dsRNA)-dependent post transcriptional silencing, also known as RNA interference (RNAi), is a phenomenon in which dsRNA complexes can target specific genes of homology for silencing in a short period of time. It acts as a signal to promote degradation of mRNA with sequence identity. A 20-nt siRNA is generally long enough to induce gene-specific silencing, but short enough to evade host response. The decrease in expression of targeted gene products can be extensive with 90% silencing induced by a few molecules of siRNA.

[0157] In the art, these RNA sequences are termed "short or small interfering RNAs" (siRNAs) or "microRNAs" (miRNAs) depending on their origin. Both types of sequence may be used to down-regulate gene expression by binding to complementary RNAs and either triggering mRNA elimination (RNAi) or arresting mRNA translation into protein. siRNAs are derived by processing of long double stranded RNAs and when found in nature are typically of exogenous origin. Micro-interfering RNAs (miRNA) are endogenously encoded small non-coding RNAs, derived by processing of short hairpins. Both siRNA and miRNA can inhibit the translation of mRNAs bearing partially complimentary target sequences without RNA cleavage and degrade mRNAs bearing fully complementary sequences.

[0158] Methods of RNAi are known in the art, and are described in: Hannon, G.J. 2002. RNA interference. Nature. 418:244-51.

[0159] CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR associated) systems are prokaryotic adaptive immune system that bind and cleave foreign nucleic acids. The most frequently used type II CRISPR system is composed of two components: Cas9 nuclease and a guide RNA (gRNA), e.g., an artificial single guide RNA (sgRNA), a fusion of a CRISPR RNA (crRNA) and a trans-activating crRNA (tracrRNA). When the SpCas9-sgRNA complex recognizes an NGG (N = A, T, C, or G) protospacer-adjacent motif (PAM) sequence, the spacer of the sgRNA pairs with the target DNA strand to form an “R-loop” structure. Subsequently, the Cas9 nuclease cleaves the DNA strands and produces a blunt-end DSB 3 bp upstream of the PAM into the protospacer. CRISPR-Cas gene editing tools are flexible, highly efficient, and inexpensive and have been widely applied. Recently, various Cas orthologs and variants with useful additional properties have been identified and harnessed for use in gene editing. Moreover, novel tools for precise gene modification, such as base editors (BEs) and prime editors (PEs), have greatly expanded the applications of gene editing and have been leveraged for use in a variety of fields of research. Methods of CRISPR-Cas gene editing are reviewed in Liu et al. Mol Cell. 2022 Jan 20;82(2):333-347. doi: 10.1016 / j.molcel.2021.12.002, and Kantor et al. Int J Mol Sci. 2020 Aug 28;21 (17):6240. doi: 10.3390 / ijms21176240.

[0160] In some embodiments, the microorganism has been modified to remove / knock-out an endogenous plasmid. In some embodiments, the microorganism has been cured of an endogenous plasmid.

[0161] Halophilic microorganisms are microorganisms represented by archaea, bacteria, and eukarya for which the main characteristic is their salinity requirement, halophilic “salt-loving”. Halophilic microorganisms are discussed in detail in Corral etal. (Mar Drugs. 2020 Jan; 18(1): 33), which is hereby incorporated by reference in its entirety.

[0162] A widely used definition is that of Kushner and Kamekura who classify organisms depending on the salt concentration needed for optimum growth (Kushner DJ, Kamekura M. 1988. Physiology of halophilic eubacteria. In: Rodriguez-Valera F (ed) Halophilic bacteria. CRC, Boca Raton). Thus, non-halophilic microorganisms grow best in media containing less than 0.2 M salts while halophiles grow best in media containing from 0.2 to 5.2 M dissolved salts. Halophiles can be further divided into slightly halophilic (optimum growth between 0.2 and 0.5 M salt), moderately halophilic (0.5-2.5 M salt), and extremely halophilic (above 2.5 M salt). Halophiles require salt for effective growth, in contrast to halotolerant organisms, which do not require salt but can grow under saline conditions.

[0163] In some embodiments, the halophilic microorganism is slightly halophilic, moderately halophilic, or extremely halophilic. In some embodiments, the halophilic microorganism is moderately halophilic, or extremely halophilic. In some embodiments, the halophilic microorganism is slightly halophilic. In some embodiments, the halophilic microorganism is moderately halophilic. In some embodiments, the halophilic microorganism is extremely halophilic.

[0164] In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 0.1 g / L / h in media containing 0.2 M dissolved salts. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 0.2 g / L / h in media containing 0.2 M dissolved salts. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 0.3 g / L / h in media containing 0.2 M dissolved salts. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 0.4 g / L / h in media containing 0.2 M dissolved salts. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 0.5 g / L / h in media containing 0.2 M dissolved salts.

[0165] In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 0.1 g / L / h in media containing 0.5 M dissolved salts. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 0.2 g / L / h in media containing 0.5 M dissolved salts. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 0.3 g / L / h in media containing 0.5 M dissolved salts. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 0.4 g / L / h in media containing 0.5 M dissolved salts. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 0.5 g / L / h in media containing 0.5 M dissolved salts.

[0166] In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 0.1 g / L / h in media containing 1.0 M dissolved salts. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 0.2 g / L / h in media containing 1.0 M dissolved salts. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 0.3 g / L / h in media containing 1 .0 M dissolved salts. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 0.4 g / L / h in media containing 1.0 M dissolved salts. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 0.5 g / L / h in media containing 1.0 M dissolved salts.

[0167] In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 5 g / L / day in media containing 0.2 M dissolved salts. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 6 g / L / day in media containing 0.2 M dissolved salts. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 7 g / L / day in media containing 0.2 M dissolved salts. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 8 g / L / day in media containing 0.2 M dissolved salts. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 9 g / L / day in media containing 0.2 M dissolved salts. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 10 g / L / day in media containing 0.2 M dissolved salts.

[0168] In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 5 g / L / day in media containing 0.5 M dissolved salts. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 6 g / L / day in media containing 0.5 M dissolved salts. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 7 g / L / day in media containing 0.5 M dissolved salts. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 8 g / L / day in media containing 0.5 M dissolved salts. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 9 g / L / day in media containing 0.5 M dissolved salts. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 10 g / L / day in media containing 0.5 M dissolved salts.

[0169] In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 5 g / L / day in media containing 1 .0 M dissolved salts. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 6 g / L / day in media containing 1.0 M dissolved salts. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 7 g / L / day in media containing 1 .0 M dissolved salts. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 8 g / L / day in media containing 1.0 M dissolved salts. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 9 g / L / day in media containing 1 .0 M dissolved salts. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 10 g / L / day in media containing 1 .0 M dissolved salts.

[0170] In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 5 g / L / day in media containing 0.2 M dissolved salts. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 5 g / L / day in media containing 0.3 M, 0.4 M, 0.5 M, 0.6 M, 0.7 M, 0.8 M, 0.9 M, 1.0 M, 1.1 M, 1.2 M, 1.3 M, 1.4 M, 1.5 M, 1.6 M, 1.7 M, 1 .8 M, 1 .9 M, 2.0 M, 2.1 M, 2.2 M, 2.3 M, 2.4 M, or 2.5 M dissolved salts.

[0171] In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 5 g / L / day in media containing 0.5 M dissolved salts. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 5 g / L / day in media containing 0.6 M, 0.7 M, 0.8 M, 0.9 M, 1.0 M, 1.1 M, 1.2 M, 1.3 M, 1.4 M, 1.5 M, 1.6 M, 1.7 M, 1.8 M, 1.9 M, 2.0 M,

[0172] 2.1 M, 2.2 M, 2.3 M, 2.4 M, or 2.5 M dissolved salts.

[0173] In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 5 g / L / day in media containing 1 .0 M dissolved salts. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 5 g / L / day in media containing

[0174] 1.1 M, 1.2 M, 1.3 M, 1.4 M, 1.5 M, 1.6 M, 1.7 M, 1.8 M, 1.9 M, 2.0 M, 2.1 M, 2.2 M, 2.3 M, 2.4 M, or 2.5 M dissolved salts.

[0175] In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 5 g / L / day in media containing between 0.2 M and 1 .5 M dissolved salts. In some embodiments, the halophilic microorganism displays a growth rate of at least 5 g / L / day in media containing between 0.4 M and 1 .5 M, 0.5 M and 1 .5 M, 0.6 M and 1 .5 M, 0.7 M and 1 .5 M, 0.8 M and 1 .5 M, 0.9 M and 1 .5 M, 1 .0 M and 1 .5 M, 1 .1 M and 1 .5 M, 1 .2 M and 1 .5 M, 1 .3 M and 1 .5 M, or 1 .4 M and 1 .5 M dissolved salts.

[0176] In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 5 g / L / day in media containing between 0.5 M and 1 .5 M dissolved salts. In some embodiments, the halophilic microorganism displays a growth rate of at least 5 g / L / day in media containing between 0.6 M and 1 .5 M, 0.7 M and 1 .5 M, 0.8 M and 1 .5 M, 0.9 M and 1 .5 M, 1 .0 M and 1 .5 M, 1 .1 M and 1 .5 M, 1 .2 M and 1 .5 M, 1 .3 M and 1 .5 M, or 1 .4 M and 1 .5 M dissolved salts.

[0177] In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 5 g / L / day in media containing between 1 .0 M and 1 .5 M dissolved salts. In some embodiments, the halophilic microorganism displays a growth rate of at least 5 g / L / day in media containing between 1.1 M and 1 .5 M, 1 .2 M and 1 .5 M, 1 .3 M and 1 .5 M, or 1 .4 M and 1 .5 M dissolved salts.

[0178] In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 5 g / L / day in media containing between 0.2 M and 2.0 M dissolved salts. In some embodiments, the halophilic microorganism displays a growth rate of at least 5 g / L / day in media containing between 0.4 M and 2.0 M, 0.5 M and 2.0 M, 0.6 M and 2.0 M, 0.7 M and 2.0 M, 0.8 M and 2.0 M, 0.9 M and 2.0 M, 1 .0

[0179] M and 2.0 M, 1 .1 M and 2.0 M, 1 .2 M and 2.0 M, 1 .3 M and 2.0 M, 1 .4 M and 2.0 M, 1 .5 M and 2.0 M, 1 .6

[0180] M and 2.0 M, 1 .7 M and 2.0 M, 1 .8 M and 2.0 M, or 1 .9 M and 2.0 M dissolved salts.

[0181] In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 5 g / L / day in media containing between 1 .0 M and 2.0 M dissolved salts. In some embodiments, the halophilic microorganism displays a growth rate of at least 5 g / L / day in media containing between 1.1 M and 2.0 M, 1 .2 M and 2.0 M, 1 .3 M and 2.0 M, 1 .4 M and 2.0 M, 1 .5 M and 2.0 M, 1 .6 M and 2.0 M, 1 .7 M and 2.0 M, 1 .8 M and 2.0 M, or 1 .9 M and 2.0 M dissolved salts.

[0182] In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 5 g / L / day in media containing between 0.2 M and 2.5 M dissolved salts. In some embodiments, the halophilic microorganism displays a growth rate of at least 5 g / L / day in media containing between 0.4 M and 2.5 M, 0.5 M and 2.5 M, 0.6 M and 2.5 M, 0.7 M and 2.5 M, 0.8 M and 2.5 M, 0.9 M and 2.5 M, 1 .0

[0183] M and 2.5 M, 1 .1 M and 2.5 M, 1 .2 M and 2.5 M, 1 .3 M and 2.5 M, 1 .4 M and 2.5 M, 1 .5 M and 2.5 M, 1 .6

[0184] M and 2.5 M, 1 .7 M and 2.5 M, 1 .8 M and 2.5 M, 1 .9 M and 2.5 M, 2.0 M and 2.5 M, 2.1 M and 2.5 M, 2.2

[0185] M and 2.5 M, 2.3 M and 2.5 M, or 2.4 M and 2.5 M dissolved salts.

[0186] In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 5 g / L / day in media containing between 1 .0 M and 2.5 M dissolved salts. In some embodiments, the halophilic microorganism displays a growth rate of at least 5 g / L / day in media containing between 1.1 M and 2.5 M, 1 .2 M and 2.5 M, 1 .3 M and 2.5 M, 1 .4 M and 2.5 M, 1 .5 M and 2.5 M, 1 .6 M and 2.5 M, 1 .7 M and 2.5 M, 1 .8 M and 2.5 M, 1 .9 M and 2.5 M, 2.0 M and 2.5 M, 2.1 M and 2.5 M, 2.2 M and 2.5 M, 2.3 M and 2.5 M, or 2.4 M and 2.5 M dissolved salts.

[0187] In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 5 g / L / day in media containing >0.2 M dissolved salts. In some embodiments, the halophilic microorganism displays a growth rate of at least 5 g / L / day in media containing >0.3 M, >0.4 M, >0.5 M, >0.6 M, >0.7 M, >0.8 M, >0.9 M, >1 .0 M, >1 .1 M, >1 .2 M, >1 .3 M, >1 .4 M, >1 .5 M, >1 .6 M, >1 .7 M, >1 .8 M, >1 .9 M, >2.0 M, >2.1 M, >2.2 M, >2.3 M, >2.4 M, or >2.5 M dissolved salts.

[0188] In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 5 g / L / day in media containing >1 .0 M dissolved salts. In some embodiments, the halophilic microorganism displays a growth rate of at least 5 g / L / day in media containing >1.1 M, >1 .2 M, >1 .3 M, >1 .4 M, >1 .5 M, >1 .6 M, >1 .7 M, >1 .8 M, >1 .9 M, >2.0 M, >2.1 M, >2.2 M, >2.3 M, >2.4 M, or >2.5 M dissolved salts.

[0189] The growth of microorganisms in liquid culture media is often determined by measuring the optical density at 600 nm (OD600). Optical density measures the degree of light scattering caused by the bacteria within a culture; the more bacteria there are, the more the light is scattered. The 600 nm wavelength is specifically chosen for bacterial OD measurements because unlike UV wavelengths, 600 nm is not harmful to the culture. This wavelength is also not usually absorbed by yellow-ish media like TSB (tryptic soy broth) and LB (lysogeny broth). By monitoring the rate of increase in OD600, you can identify the lag, log, and stationary phases of a bacterial culture.

[0190] Methods of measuring the optical density at 600 nm (OD600) are well known to the skilled person. Any method of measuring the optical density at 600 nm known by the skilled person may be employed. One simple exemplary method is provided here: (1) mix cell culture and take a sample, (2) dilute sample to ensure that the sample to be measured has an OD600 <1 .0, (3) add the appropriate volume of diluted sample to a cuvette, (4) add the cuvette to a spectrophotometer, (5) determine optical density at at 600 nm, (6) calculate the OD600 of the undiluted sample. Values recited below relate to the OD600 of the undiluted sample.

[0191] In some embodiments, the halophilic microorganism is capable of reaching a cell density indicated by an OD600 measurement of at least 20 in media containing >0.2 M dissolved salts. In some embodiments, the halophilic microorganism is capable of reaching a cell density indicated by an OD600 measurement of at least 20 in media containing >0.3 M, >0.4 M, >0.5 M, >0.6 M, >0.7 M, >0.8 M, >0.9 M, >1 .0 M, >1 .1 M, >1 .2 M, >1 .3 M, >1 .4 M, >1 .5 M, >1 .6 M, >1 .7 M, >1 .8 M, >1 .9 M, >2.0 M, >2.1 M, >2.2 M, >2.3 M, >2.4 M, or >2.5 M dissolved salts.

[0192] In some embodiments, the halophilic microorganism is capable of reaching a cell density indicated by an OD600 measurement of at least 20 in media containing >1 .0 M dissolved salts. In some embodiments, the halophilic microorganism is capable of reaching a cell density indicated by an OD600 measurement of at least 20 in media containing >1 .1 M, >1 .2 M, >1 .3 M, >1 .4 M, >1 .5 M, >1 .6 M, >1 .7 M, >1 .8 M, >1 .9 M, >2.0 M, >2.1 M, >2.2 M, >2.3 M, >2.4 M, or >2.5 M dissolved salts.

[0193] In some embodiments, the halophilic microorganism is capable of reaching a cell density indicated by an OD600 measurement of at least 50 in media containing >0.2 M dissolved salts. In some embodiments, the halophilic microorganism is capable of reaching a cell density indicated by an OD600 measurement of at least 20 in media containing >0.3 M, >0.4 M, >0.5 M, >0.6 M, >0.7 M, >0.8 M, >0.9 M, >1 .0 M, >1 .1 M, >1 .2 M, >1 .3 M, >1 .4 M, >1 .5 M, >1 .6 M, >1 .7 M, >1 .8 M, >1 .9 M, >2.0 M, >2.1 M, >2.2 M, >2.3 M, >2.4 M, or >2.5 M dissolved salts.

[0194] In some embodiments, the halophilic microorganism is capable of reaching a cell density indicated by an OD600 measurement of at least 50 in media containing >1.0 M dissolved salts. In some embodiments, the halophilic microorganism is capable of reaching a cell density indicated by an OD600 measurement of at least 20 in media containing >1 .1 M, >1 .2 M, >1 .3 M, >1 .4 M, >1 .5 M, >1 .6 M, >1 .7 M, >1 .8 M, >1 .9 M, >2.0 M, >2.1 M, >2.2 M, >2.3 M, >2.4 M, or >2.5 M dissolved salts.

[0195] Some halophilic microorganisms are also alkaliphiles. In some embodiments, the halophilic microorganism is also alkaliphilic. In other words, the microorganism is halophilic and alkaliphilic. Therefore, the halophilic microorganism may in some embodiments be described as a halophilic and alkaliphilic microorganism. In some embodiments, the halophilic microorganism is capable of growth in media which is alkali and contains high levels of salt.

[0196] Alkaliphilic microorganisms, or alkaliphiles, are a class of extremophilic microbes capable of survival in alkaline (pH roughly 8.5-11) environments.

[0197] In some embodiments, the halophilic microorganism is capable of growth in alkali media. In some embodiments, the halophilic microorganism is capable of growth in pH 7.0 media. In some embodiments, the halophilic microorganism is capable of growth in pH 7.5 media. In some embodiments, the halophilic microorganism is capable of growth in pH 8.0 media. In some embodiments, the halophilic microorganism is capable of growth in pH 8.5 media. In some embodiments, the halophilic microorganism is capable of growth in pH 9.0 media. In some embodiments, the halophilic microorganism is capable of growth in pH 9.5 media. In some embodiments, the halophilic microorganism is capable of growth in pH 10.0 media. In some embodiments, the halophilic microorganism is capable of growth in pH 10.5 media. In some embodiments, the halophilic microorganism is capable of growth in pH 11.0 media.

[0198] In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 5 g / L / day in pH 7.0 media. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 5 g / L / day in pH 7.5 media. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 5 g / L / day in pH 8.0 media. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 5 g / L / day in pH 8.5 media. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 5 g / L / day in pH 9.0 media. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 5 g / L / day in pH 9.5 media. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 5 g / L / day in pH 10.0 media. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 5 g / L / day in pH 10.5 media. In some embodiments, the halophilic microorganism is capable of producing biomass at a productivity of at least 5 g / L / day in pH 1 1 .0 media. In some embodiments, the halophilic microorganism is a recombinant halophilic microorganism. A recombinant halophilic microorganism is a halophilic microorganism comprising heterologous genetic material. Heterologous genetic material refers to the nucleic acids (e.g., a gene or part of a gene) present in a host organism that does not naturally comprise the nucleic acids in question. By way of example, a Halomonas bacterium expressing a citramalate synthase from Methanococcus jannaschii is a recombinant halophilic microorganism, and the gene encoding the citramalate synthase is a heterologous gene. In some embodiments, the recombinant halophilic microorganism is a recombinant halophilic bacterium ( / .e., a halophilic bacterium comprising heterologous genetic material).

[0199] In some embodiments, the halophilic microorganism comprises a recombinant plasmid. In some embodiments, the halophilic microorganism expresses a heterologous enzyme. In some embodiments, the recombinant microorganism expresses a heterologous citramalate synthase.

[0200] In some embodiments, the halophilic microorganism is a halophilic bacterium, yeast, alga, fungus, or archaeon. In some embodiments, the halophilic microorganism is a halophilic bacterium. In some embodiments, the halophilic microorganism is of the family Halomonadaceae or Vibrionaceae.

[0201] Halomonadaceae is a family of halophilic Pseudomonadota. The family Halomonadaceae is the largest family composed of halophilic bacteria, with more than 160 species with validly published names as of July 2023. The family Halomonadaceae is reviewed in detail in de la Haba et al. (Front. Microbiol., 2023. Sec. Extreme Microbiology. Vol 14), which is hereby incorporated by reference in its entirety. In some embodiments, the halophilic microorganism is a bacterium from the genus Halomonas, Aidingimonas, Carnimonas, Chromohalobacter, Cobetia, Deleya, Halotalea, Halovibrio, Kushneria, Modicisalibacter, Salicola, Salinicola, Volcaniella, Zymobacter, or Salinibacteraceae. In some embodiments, the halophilic microorganism is a bacterium from the genus Halomonas. In some embodiments, the halophilic microorganism is H. bluephagenesis or H. rowanensis. In some embodiments, the halophilic microorganism is H. bluephagenesis.

[0202] The Vibrionaceae are a family of Pseudomonadota given their own order, Vibrionales. Vibrionaceae are Gram-negative organisms and facultative anaerobes, capable of fermentation. They contain oxidases and have one or more flagella, which are generally polar. In some embodiments, the halophilic microorganism is a bacterium from the genus Vibrio. Vibrio is a genus of Gram-negative bacteria, possessing a curved- rod (comma) shape. Being highly salt tolerant and unable to survive in fresh water, Vibrio spp. are commonly found in various saltwater environments. In some embodiments, the halophilic microorganism is Vibrio natriegens, Vibrio alginolyticus, or Vibrio fischeri. In some embodiments, the halophilic microorganism is Vibrio natriegens.

[0203] Halomonas

[0204] The term Halomonas relates to the genus of Halomonas, and therefore encompasses all Halomonas species and strains, such as H. bluephagenesis and H. rowanensis. In some embodiments, the halophilic microorganism is H. alimentaria, H. alkaliantarctica, H. alkaliphila, H. almeriensis, H. andesensis, H. anticariensis, H. aquamarina, H. arcis, H. axialensis, H. beimenensis, H. bluephagenesis, H. boliviensis, H. campaniensis, H. campisalis, H. caseinilytica, H. cerina, H. cibimaris, H. cupida, H. daqiaonensis, H. daqingensis, H. denitrificans, H. desiderata, H. elongata, H. eurihalina, H. flava, H. fontilapidosi, H. garicola, H. gomseomensis, H. gudaonensis, H. halmophila, H. halocynthiae, H. halodenitrificans, halophila, H. hamiltonii, H. heilong / jiangensis, H. huangheensis, H. hydrothermalis, H. ilicicola, H. janggokensis, H. jeotgali, H. johnsoniae, H. kenyensis, H. koreensis, H. korlensis, H. kribbensis, H. lutea, H. lutescence, H. magadiensis, H. maura, H. meridian, H. mongoliensis, H. muralis, H. nanhaiensis, H. neptunia, H. nitroreducens, H. olivaria, H. organivorans, H. pacifica, H. pantelleriensis, H. qiaohouensis, H. qijiaojingensis, H. ramblicola, H. rifensis, H. rowanensis, H. sabkhae, H. saccharevitans, H. salicampi, H. salifodinae, H. salina, H. sediminicola, H. shengliensis, H. sinaiensis, H. smyrnensis, H. songnenensis, H. stenophila, H. stevensii, H. subglaciescola, H. subterranean, H. sulfidaeris, H. taeanensis, H. titanicae, H. urumqiensis, H. variabilis, H. ventosae, H. venusta, H. vilamensis, H. xianhensis, H. xinjiangensis, H. zhang / jiangensis, and H. zincidurans. In some embodiments, the halophilic microorganism is H. bluephagenesis or H. rowanensis.

[0205] H. rowanensis as described in WO2024 / 227823 (which is hereby incorporated by reference) was deposited with European Collection of Authenticated Cell Cultures on 10 February 2023 under accession number 23021001 in accordance with the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure (herein referred to as the ‘Budapest Treaty’). H. rowanensis is a chemoautotrophic Halomonas species. It has been shown that H. rowanensis can be genetically modified through the use of existing synthetic biology constructs that are tailored for other Halomonas species (Amer et al., 2020a. Biotechnol. Biofuels 13, 125; Amer et al., 2020b. Energy Environ. Sci. 13, 1818-1831 ; Trisrivirat etal., Synthetic Biology, Volume 5, Issue 1 , 2020, ysaa022). It has been shown that H. rowanensis can be genetically modified for chemoautotropic carbon compound production (e.g. propane production) from CO2.

[0206] In some embodiments, the halophilic microorganism is H. bluephagenesis. Preferred Halomonas strains include H. bluephagenesis st. TQ10, H. bluephagenesis st. TD1 .0 and H. bluephagenesis st. TD01 . Strains (st.) TD1 .0 and TQ10 are genetically modified versions of the native TD01 strain where the gene encoding MmP1 has been chromosomally integrated into the bacterium. The gene MmP1 is a T7-like promoter that enables the IPTG-inducible expression of recombinant proteins in Halomonas (Zhao H et al 2017 Novel T7-like expression systems used for Halomonas. Metabolic Engineering 39: p. 128-140 which is herein incorporated by reference in its entirety). Preferably, the Halomonas strain comprises the MmP1 gene, either chromosomally integrated or on a vector or plasmid. Strain TQ10 additionally has been genetically modified to knock out gene(s) involved in polyhydroxyalkanoate (PHA) biosynthesis.

[0207] H. bluephagenesis has been shown to comprise an endogenous plasmid. An endogenous plasmid may alternatively be described as a native plasmid. A plasmid is a small, extrachromosomal DNA molecule within a cell that is physically separated from chromosomal DNA and can replicate independently. Plasmids are most commonly found as small circular, double-stranded DNA molecules. Endogenous plasmids are plasmids that are found in wild type microorganisms, i.e., plasmids which are present in a microorganism which has not been genetically modified. For example, pHbCP is the endogenous plasmid of H. bluephagenesis, and is found in unmodified H. bluephagenesis cells.

[0208] In some embodiments, an endogenous plasmid comprises a toxin-antitoxin (TA) system. The pHbCP plasmid has been shown to comprise a hbpB / hbpC TA system (Ren et al. ACS Synth. Biol. 2024, 13, 61-67). In some embodiments, the endogenous plasmid comprises a hbpB / hbpC TA system.

[0209] Methods of producing carbon compounds

[0210] In an aspect of the present disclosure, a method of producing citramalate is provided.

[0211] The methods according to the present disclosure may utilise a recombinant microorganism and / or a recombinant plasmid according to the present disclosure.

[0212] Specific methods of producing citramalate according to the present disclosure are disclosed within the examples herein. Additionally, the chemical and biochemical components of the method are further discussed herein.

[0213] In some embodiments, the recombinant microorganism is halophilic. Halophilic microorganisms are known to the skilled person and are described both herein and in the prior art. In some embodiments, the recombinant microorganism is a recombinant halophilic microorganism. A recombinant halophilic microorganism is a halophilic microorganism comprising heterologous genetic material. In some embodiments, the recombinant halophilic microorganism comprises a recombinant plasmid. In some embodiments, the recombinant halophilic microorganism expresses a heterologous enzyme.

[0214] In some embodiments, the recombinant microorganism comprises a plasmid described herein. In some embodiments, the recombinant microorganism expresses a heterologous citramalate synthase which is described herein. In some embodiments, the recombinant microorganism expresses a heterologous starch degrading enzyme which is described herein.

[0215] The method of producing citramalate may comprise fermentation, for example, fermentation of a recombinant microorganism which is described herein.

[0216] Microbial fermentation is a metabolic process in which microorganisms utilise a carbon source to obtain energy for growth and the production of metabolites. Fermentation enables the use of microorganisms to produce biochemicals of commercial importance. Consequently, bacterial fermentation is used in industrial settings for the manufacture of biopharmaceuticals, foods, chemicals, and biofuels. In one aspect, the current disclosure describes the use of fermentation in the production of citramalate. In some embodiments, the method may involve culture or fermentation of a microorganism. The culture or fermentation may be performed in a bioreactor provided with an appropriate supply of nutrients, air / oxygen and / or growth factors. Culture, fermentation and separation techniques are well known to those of skill in the art, and are described, for example, in Green and Sambrook, Molecular Cloning: A Laboratory Manual (4th Edition; incorporated by reference herein), and Doran, Chapter 1 - Bioprocess Development: An Interdisciplinary Challenge, Bioprocess Engineering Principles (Second Edition; incorporated by reference herein) 2013, Pages 3-11.

[0217] In some embodiments, the fermentation is fed-batch fermentation. In some embodiments, a dose of a carbon source (or more than one dose) is provided during microorganism growth. In some embodiments, a dose of a carbon source (or more than one dose) is provided during exponential microorganism growth. In some embodiments, a dose of a carbon source (or more than one dose) is provided during mid-late exponential microorganism growth.

[0218] In some embodiments, the fermentation is continuous fermentation. Continuous fermentation involves ongoing microorganism growth, product isolation, nutrient supply, carbon supply and waste removal during the process.

[0219] In some embodiments, continuous fermentation is performed for a duration of at least 10 hours. In some embodiments, continuous fermentation is performed for a duration of at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900 or at least 2000 hours.

[0220] In some embodiments, continuous fermentation is performed for a maximum duration of 100 hours. In some embodiments, continuous fermentation is performed for a maximum duration of 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 3000, 4000 or 5000 hours.

[0221] In some embodiments, continuous fermentation is performed for a duration of between 10 and 500 hours. In some embodiments, continuous fermentation is performed for a duration of at least 10 and 500, 20 and 500, 30 and 500, 40 and 500, 50 and 500, 60 and 500, 70 and 500, 80 and 500, 90 and 500, 100 and 500, 110 and 500, 120 and 500, 130 and 500, 140 and 500, 150 and 500, 160 and 500, 170 and 500, 180 and 500, 190 and 500, 200 and 500, 210 and 500, 220 and 500, 230 and 500, 240 and 500, 250 and 500,

[0222] 260 and 500, 270 and 500, 280 and 500, 290 and 500, 300 and 500, 310 and 500, 320 and 500, 330 and

[0223] 500, 340 and 500, 350 and 500, 360 and 500, 370, 380 and 500, 390 and 500, 400 and 500, 410 and

[0224] 500, 420 and 500, 430 and 500, 440 and 500, 450 and 500, 460 and 500, 470 and 500, 480 and 500, or

[0225] 490 and 500 hours. In some embodiments, continuous fermentation is performed for a duration of between 10 and 2000 hours. In some embodiments, continuous fermentation is performed for a duration of at least 10 and 2000, 20 and 2000, 30 and 2000, 40 and 2000, 50 and 2000, 60 and 2000, 70 and 2000, 80 and 2000, 90 and 2000, 100 and 2000, 110 and 2000, 120 and 2000, 130 and 2000, 140 and 2000, 150 and 2000, 160 and 2000, 170 and 2000, 180 and 2000, 190 and 2000, 200 and 2000, 210 and

[0226] 2000, 220 and 2000, 230 and 2000, 240 and 2000, 250 and 2000, 260 and 2000, 270 and 2000, 280 and

[0227] 2000, 290 and 2000, 300 and 2000, 310 and 2000, 320 and 2000, 330 and 2000, 340 and 2000, 350 and

[0228] 2000, 360 and 2000, 370 and 2000, 380 and 2000, 390 and 2000, 400 and 2000, 410 and 2000, 420 and

[0229] 2000, 430 and 2000, 440 and 2000, 450 and 2000, 460 and 2000, 470 and 2000, 480 and 2000, 490 and

[0230] 2000, 500 and 2000, 600 and 2000, 700 and 2000, 800 and 2000, 900 and 2000, 1000 and 2000, 1100 and 2000, 1200 and 2000, 1300 and 2000, 1400 and 2000, 1500 and 2000, 1600 and 2000, 1700 and 2000, 1800 and 2000, 1900 and 2000 hours.

[0231] In some embodiments, continuous fermentation is performed for a duration of at least 1 day. In some embodiments, continuous fermentation is performed for a duration of at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 65, 70, 75, 80, 85 or 90 days.

[0232] In some embodiments, continuous fermentation is performed for a maximum duration of 3 days. In some embodiments, continuous fermentation is performed for a duration of at least 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 32, 33, 34, 35, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 55, 56, 58, 60, 62, 64, 65, 66, 68, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140 150, 160, 170, 180, 190, 200, 210, 220, 230, 240 or 250 days.

[0233] In some embodiments, continuous fermentation is performed for a duration of between 1 and 30 days. In some embodiments, continuous fermentation is performed for a duration of between 1 and 30, 2 and 30 days, 3 and 30 days, 4 and 30 days, 5 and 30 days, 6 and 30 days, 7 and 30 days, 8 and 30 days, 9 and 30 days, 10 and 30 days, 11 and 30 days, 12 and 30 days, 13 and 30 days, 14 and 30 days, 15 and 30 days, 16 and 30 days, 17 and 30 days, 18 and 30 days, 19 and 30 days, 20 and 30 days, 21 and 30 days, 22 and 30 days, 23 and 30 days, 24 and 30 days, 25 and 30 days, 26 and 30 days, 27 and 30 days, 28 and 30 days, or 29 and 30 days. In some embodiments, continuous fermentation is performed for a duration of between 1 and 90 days. In some embodiments, continuous fermentation is performed for a duration of between 1 and 90, 2 and 90 days, 3 and 90 days, 4 and 90 days, 5 and 90 days, 6 and 90 days, 7 and 90 days, 8 and 90 days, 9 and 90 days, 10 and 90 days, 11 and 90 days, 12 and 90 days, 13 and 90 days, 14 and 90 days, 15 and 90 days, 16 and 90 days, 17 and 90 days, 18 and 90 days, 19 and 90 days, 20 and 90 days, 21 and 90 days, 22 and 90 days, 23 and 90 days, 24 and 90 days, 25 and 90 days, 26 and 90 days, 27 and 90 days, 28 and 90 days, 29 and 90 days, 30 and 90 days, 31 and 90 days, 32 and 90 days, 33 and 90 days, 34 and 90 days, 35 and 90 days, 36 and 90 days, 37 and 90 days, 38 and 90 days, 39 and 90 days, 40 and 90 days, 41 and 90 days, 42 and 90 days, 43 and 90 days, 44 and 90 days, 45 and 90 days, 46 and 90 days, 47 and 90 days, 48 and 90 days, 49 and 90 days, 50 and 90 days, 51 and 90 days, 52 and 90 days, 53 and 90 days, 54 and 90 days, 55 and 90 days, 56 and 90 days, 57 and 90 days, 58 and 90 days, 59 and 90 days, 60 and 90 days, 65 and 90 days, 70 and 90 days, 75 and 90 days, 80 and 90 days, 85 and 90 days.

[0234] In some embodiments, the fermentation conditions are monitored during the method. In some embodiments, temperature, pH, agitation, airflow, optical density, carbon-source concentration, and / or citramalate concentration are monitored during the method.

[0235] In some embodiments, pH is monitored and maintained within an optimum range during the method. In some embodiments, pH is maintained between pH 7.5 and pH 9.5. In some embodiments, pH is maintained between pH 7 and pH 9. In some embodiments, pH is maintained between pH 8 and pH 9. In some embodiments, pH is maintained between pH 8.1 and pH 8.9. In some embodiments, pH is maintained between pH 8.2 and pH 8.8. In some embodiments, pH is maintained between pH 8.3 and pH 8.7. In some embodiments, pH is maintained between pH 8.4 and pH 8.6. In some embodiments, pH is maintained at pH 8.5. In some embodiments, pH is maintained through the addition of an acid (e.g., HCI) or a base (e.g., NaOH).

[0236] In some embodiments, continuous fermentation is a fermentation process with a constant flow of culture medium into the reactor, with continuous harvesting of the same volume. The volume in a continuous fermentation is typically constant in industrial applications, and is designed to maintain biomass production and product formation at a constant rate. Fermentation initially starts as a batch or a fed-batch process. At a certain point, for example, when the culture reaches the exponential growth phase, or when the culture becomes substrate limited, a feed with fresh growth medium is started, and an equal volume of culture broth is removed. At present, the industrial application of continuous fermentation is limited. Reasons for this limitation include an increased risk for contamination, risk for genetic drift in the culture, and difficulties to control the process. However, continuous fermentation could be extremely useful for industrial biotechnology if these problems can be addressed.

[0237] In some embodiments, the fermentation is open fermentation. Open Fermentation is the name given to fermentations that take place in vessels that are “open” to the environment in which they are situated.

[0238] In some embodiments, the method comprises the addition of further cells (e.g., halophilic microorganisms) into the culture medium. These further (or ‘additional’ or ‘fresh’ cells) may be the same as the cells undergoing fermentation (e.g., the same halophilic microorganism, comprising the same recombinant plasmid). The further cells may be added to supplement the cell population undergoing fermentation. The resulting culture comprises a mixture of further / fresh cells, and cells previously in the culture medium. In some embodiments, the culture medium comprises a mixture of further / fresh cells, and cells previously in the culture medium. In some embodiments, further cells are added to the culture medium when product titres are declining. In some embodiments, further cells are added to the culture medium when product titres are declining within the culture medium. In some embodiments, further cells are added to the culture medium when citramalate production is declining. This decline may be, for example, when citramalate production drops below 50% of the peak citramalate titre. In other words, if a citramalate titre of 14 g / L is recorded, further cells may be added to the culture medium if citramalate titre drops below 7 g / L.

[0239] In some embodiments, further cells are added to the culture medium when the product (e.g., citramalate) titre is less than 50% of the previous highest product titre. In some embodiments, further cells are added to the culture medium when the product (e.g., citramalate) titre is less than 40% of the previous highest product titre. In some embodiments, further cells are added to the culture medium when the product (e.g., citramalate) titre is less than 30% of the previous highest product titre. In some embodiments, further cells are added to the culture medium when the product (e.g., citramalate) titre is less than 20% of the previous highest product titre. In some embodiments, further cells are added to the culture medium when the product (e.g., citramalate) titre is less than 10% of the previous highest product titre.

[0240] In some embodiments, further cells are added to the culture medium when citramalate titre is below 10 g / L. In some embodiments, further cells are added to the culture medium when citramalate titre is below 9 g / L. In some embodiments, further cells are added to the culture medium when citramalate titre is below 8 g / L. In some embodiments, further cells are added to the culture medium when citramalate titre is below 7 g / L. In some embodiments, further cells are added to the culture medium when citramalate titre is below 6 g / L. In some embodiments, further cells are added to the culture medium when citramalate titre is below 5 g / L. In some embodiments, further cells are added to the culture medium when citramalate titre is below 4 g / L. In some embodiments, further cells are added to the culture medium when citramalate titre is below 3 g / L. In some embodiments, further cells are added to the culture medium when citramalate titre is below 2 g / L. In some embodiments, further cells are added to the culture medium when citramalate titre is below 1 g / L. In some embodiments, further cells are added to the culture medium when citramalate titre is below 0.5 g / L.

[0241] In some embodiments, further cells are added to the culture medium at multiple points during fermentation. In some embodiments, further cells are added to the culture medium on day 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35,

[0242] 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63,

[0243] 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 ,

[0244] 92, 93, 94, 95, 96, 97, 98 and / or day 99 of fermentation. In some embodiments, further cells are added to the culture medium on day 8, 15, 22, 40 and / or day 42 of fermentation. In some embodiments, further cells are added to the culture medium one day before the end of fermentation. In some embodiments, further cells are added to the culture medium two days before the end of fermentation. In some embodiments, further cells are added to the culture medium 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98 and / or 99 days before the end of fermentation.

[0245] Further cells may be added in the form of a cell culture ( / .e., cells in culture medium). For example, 500 mL of fresh cell culture comprising fresh cells may be added to 5000 mL of the cell culture that is already present in the culture vessel (e.g., a bioreactor / fermenter). In some embodiments, a volume of cell culture is removed before a volume of fresh cell culture is added to the culture vessel.

[0246] The culture comprising fresh cells may be described as a fresh cell culture. In some embodiments, the fresh cell culture is a batch cell culture. In some embodiments, the fresh cell culture has been cultured for less than 24 hours, for example, less than 20 hours, less than 18 hours, less than 16 hours, less than 14 hours, less than 12 hours, less than 10 hours, or less than 8 hours. In some embodiments, the fresh cell culture was inoculated less than 24 hours before being added to the cell culture already present in the culture vessel, for example, less than 20 hours, less than 18 hours, less than 16 hours, less than 14 hours, less than 12 hours, less than 10 hours, or less than 8 hours before being added to the cell culture already present in the culture vessel.

[0247] The cells may be in an active growth stage. In some embodiments, the fresh cell culture comprises cells in an active growth stage. In some embodiments, the fresh cell culture comprises cells in log phase. In some embodiments, the fresh cell culture comprises cells in early stationary phase of growth. In some embodiments, the fresh cell culture comprises the same media as the culture that is already undergoing fermentation. In some embodiments, the carbon and / or nitrogen source has not been exhausted in the fresh cell culture. In some embodiments, the optical density of the fresh culture is similar to the optical density of the culture that is already undergoing fermentation.

[0248] In some embodiments, the volume of fresh cell culture which is added to the culture vessel is less than 100% of the volume of cell culture already present in the culture vessel, for example, less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, or less than 10% of the volume of cell culture already present in the culture vessel.

[0249] In some embodiments, the volume of fresh cell culture which is added to the culture vessel is approximately the same volume as the cell culture already present in the culture vessel. In some embodiments, the volume of fresh cell culture which is added to the culture vessel is approximately 90% of the volume of cell culture already present in the culture vessel. In some embodiments, the volume of fresh cell culture which is added to the culture vessel is approximately 80% of the volume of cell culture already present in the culture vessel. In some embodiments, the volume of fresh cell culture which is added to the culture vessel is approximately 70% of the volume of cell culture already present in the culture vessel. In some embodiments, the volume of fresh cell culture which is added to the culture vessel is approximately 60% of the volume of cell culture already present in the culture vessel. In some embodiments, the volume of fresh cell culture which is added to the culture vessel is approximately 50% of the volume of cell culture already present in the culture vessel. In some embodiments, the volume of fresh cell culture which is added to the culture vessel is approximately 40% of the volume of cell culture already present in the culture vessel. In some embodiments, the volume of fresh cell culture which is added to the culture vessel is approximately 30% of the volume of cell culture already present in the culture vessel. In some embodiments, the volume of fresh cell culture which is added to the culture vessel is approximately 20% of the volume of cell culture already present in the culture vessel. In some embodiments, the volume of fresh cell culture which is added to the culture vessel is approximately 10% of the volume of cell culture already present in the culture vessel. In some embodiments, the volume of fresh cell culture which is added to the culture vessel is approximately 9% of the volume of cell culture already present in the culture vessel. In some embodiments, the volume of fresh cell culture which is added to the culture vessel is approximately 8% of the volume of cell culture already present in the culture vessel. In some embodiments, the volume of fresh cell culture which is added to the culture vessel is approximately 7% of the volume of cell culture already present in the culture vessel. In some embodiments, the volume of fresh cell culture which is added to the culture vessel is approximately 6% of the volume of cell culture already present in the culture vessel. In some embodiments, the volume of fresh cell culture which is added to the culture vessel is approximately 5% of the volume of cell culture already present in the culture vessel. In some embodiments, the volume of fresh cell culture which is added to the culture vessel is approximately 4% of the volume of cell culture already present in the culture vessel. In some embodiments, the volume of fresh cell culture which is added to the culture vessel is approximately 3% of the volume of cell culture already present in the culture vessel. In some embodiments, the volume of fresh cell culture which is added to the culture vessel is approximately 2% of the volume of cell culture already present in the culture vessel. In some embodiments, the volume of fresh cell culture which is added to the culture vessel is approximately 1% of the volume of cell culture already present in the culture vessel.

[0250] Culture exchange may be performed when fresh cells are added to the culture vessel. For example, a volume of culture ( / .e., cells in culture medium) may be removed from the culture vessel before fresh culture is added to the culture vessel. In some embodiments, a volume of culture ( / .e., cells in culture medium) may be removed from the culture vessel before the same volume of fresh culture is added to the culture vessel. For example, 10% of the culture may be removed from the culture vessel before approximately the same volume of fresh culture is added to the culture vessel, and this may be termed a 10% culture exchange. In some embodiments, 10% of the culture is removed from the culture vessel before fresh culture is added to the culture vessel. In some embodiments, 20% of the culture is removed from the culture vessel before fresh culture is added to the culture vessel. In some embodiments, 30% of the culture is removed from the culture vessel before fresh culture is added to the culture vessel. In some embodiments, 40% of the culture is removed from the culture vessel before fresh culture is added to the culture vessel. In some embodiments, 50% of the culture is removed from the culture vessel before fresh culture is added to the culture vessel.

[0251] In some embodiments, 10% of the culture is exchanged with fresh culture. In some embodiments, 20% of the culture is exchanged with fresh culture. In some embodiments, 30% of the culture is exchanged with fresh culture. In some embodiments, 40% of the culture is exchanged with fresh culture. In some embodiments, 50% of the culture is exchanged with fresh culture.

[0252] In some embodiments, the further cells (e.g., further cells in a fresh culture) are further halophilic microorganisms described herein. In some embodiments, the further cells are further halophilic microorganisms comprising the same recombinant plasmid as the recombinant plasmid expressed by halophilic microorganisms already undergoing fermentation. In some embodiments, the further halophilic microorganisms are the same as the halophilic microorganisms already undergoing fermentation. In some embodiments, the further halophilic microorganisms are the same genotype as the halophilic microorganisms already undergoing fermentation. In some embodiments, the further halophilic microorganisms are the same species and comprise the same recombinant plasmid as the halophilic microorganisms already undergoing fermentation.

[0253] Cultures of a microorganism, or microbial cultures, or cultures or microbiological cultures, fermentations, or microbial fermentations generally comprise a culture vessel, a growth medium, and at least one microorganism (or microbial) cell. In some embodiments, the culture is a lab-scale culture. In some embodiments, the culture is an industrial-scale culture. In some embodiments of the present disclosure, the microorganism cell is a bacterial cell.

[0254] A microbial medium, microbial growth medium, microbial culture medium, or a culture medium is a liquid, semi-solid or solid designed to support the growth and proliferation of microbial cells. Microbial culture media are well known by scientists in the area of cell culture. Microbial cell culture media types and methods are comprehensively reviewed in A Rouf, Varsha Kanojia, HR Naik, Bazilla Naseer and Tahiya Qadri (2017) An overview of microbial cell culture, Journal of Pharmacognosy and Phytochemistry, Vol. 6, Issue 6 p 1923-1928, the contents of which are incorporated by reference.

[0255] Microbial culture media may comprise an appropriate source of energy and compounds which regulate the cell cycle. In addition to nutrients, the medium also helps maintain pH and osmolality. However, in some embodiments, there is no glucose and / or no carbon source present in the media.

[0256] Microbial culture media may be liquid ( / .e. aqueous), semi-solid ( / .e. gelatinous), or completely solid. Semi-solid and solid media may contain agar, silica gel, acrylamide, gellan gum, or other solidification agents. Liquid media generally do not contain solidification agents.

[0257] In some embodiments, the culture media is Luria broth (LB), high salt Luria broth (LB60), minimal media, high salt minimal media, or another suitable media known by the skilled person.

[0258] LB Miller contains 5 g / L yeast extract, 10 g / L tryptone and 10 g / L NaCI pH 7.0, and is widely used and well known to the skilled person. High salt Luria broth (LB60) is identical to LB, but has a higher salt content (60 g / L NaCI). Minimal medium is culture medium for microorganisms that contains the minimal necessities for growth - containing only inorganic salts, water, and optionally a carbon source. High salinity minimal medium contains higher salt content than typical minimal medium. An exemplary high salinity minimal medium is filter sterilised sea water with or without a supplemental carbon source.

[0259] In some embodiments, the microbial culture media is taken directly from the environment, for example from sea water, brackish water, river water, lake water, pond water. In some embodiments the cells are grown directly in the water taken from the environment. In some embodiments, the environmental water is processed (e.g. filtered and / or autoclaved) before use as culture media, lin some embodiments, further additives (e.g. carbon, mineral, additional NaCI and / or amino acids) are added to the water to support growth of the cells. In some embodiments, the water is polluted with excess carbon and / or excess sulfur containing compounds. The sulfur containing compound may be a sulfate, a thiosulfate, and / or a sulfite.

[0260] In some embodiments, NaCI concentration is monitored. In some embodiments, NaCI concentration is maintained within a predefined range. In some embodiments, NaCI concentration is monitored and maintained within a predefined range.

[0261] In some embodiments, the concentration of NaCI provided in the culture media at the start of fermentation is greater than 20 g / L. In some embodiments, the concentration of NaCI at the start of fermentation is greater than 30, 40, 50, 60, 70, 80, 90, 100, 110, or 120 g / L.

[0262] In some embodiments, the concentration of NaCI provided in the culture media at the start of fermentation is less than 70 g / L. In some embodiments, the concentration of NaCI at the start of fermentation is less than 80, 90, 100, 110, or 120 g / L.

[0263] In some embodiments, the concentration of NaCI provided in the culture media at the start of fermentation between 20 g / L and 120 g / L. In some embodiments, the concentration of NaCI provided in the culture media at the start of fermentation between 30 and 120, 40 and 120, 50 and 120, 60 and 120, 70 and 120, 80 and 120, 90 and 120, 100 and 120, or 110 and 120 g / L.

[0264] In some embodiments, the concentration of NaCI provided in the culture media at the start of fermentation is greater than 0.4 M. In some embodiments, the concentration of NaCI provided in the culture media at the start of fermentation is greater than 0.5 M, 0.6 M, 0.7 M, 0.8 M, 0.9 M, 1 .0 M, 1 .1 M, 1 .2 M, 1 .3 M, 1 .4 M, 1.5 M, 1.6 M, 1.7 M, 1.8 M, 1.9 M, 2.0 M, 2.1 M, 2.2 M, 2.3 M, 2.4 M, or 2.5 M.

[0265] In some embodiments, the concentration of NaCI provided in the culture media at the start of fermentation is lower than 1 .0 M. In some embodiments, the concentration of NaCI provided in the culture media at the start of fermentation is lower than 1.1 M, 1.2 M, 1.3 M, 1.4 M, 1.5 M, 1.6 M, 1.7 M, 1.8 M, 1.9 M, 2.0 M, 2.1 M, 2.2 M, 2.3 M, 2.4 M, or 2.5 M.

[0266] In some embodiments, the concentration of NaCI provided in the culture media at the start of fermentation is between 0.4 M and 2.0 M. In some embodiments, the concentration of NaCI provided in the culture media at the start of fermentation is between 0.5 M and 2.0 M, 0.6 M and 2.0 M, 0.7 M and 2.0 M, 0.8 M and 2.0 M, 0.9 M and 2.0 M, 1 .0 M and 2.0 M, 1 .1 M and 2.0 M, 1 .2 M and 2.0 M, 1 .3 M and 2.0 M, 1 .4 M and 2.0 M, 1 .5 M and 2.0 M, 1 .6 M and 2.0 M, 1 .7 M and 2.0 M, 1 .8 M and 2.0 M, or 1 .9 M and 2.0 M.

[0267] In some embodiments, the NaCI concentration within the culture media is maintained at a concentration of at least 20 g / L during fermentation. In some embodiments, NaCI concentration within the culture media is maintained at a concentration of at least 30, 40, 50, 60, 70, 80, 90, 100, 110, or 120 g / L during fermentation.

[0268] In some embodiments, the NaCI concentration within the culture media is maintained at a concentration below 70 g / L during fermentation. In some embodiments, NaCI concentration within the culture media is maintained at a concentration of below 80, 90, 100, 110, or 120 g / L during fermentation.

[0269] In some embodiments, the NaCI concentration within the culture media is maintained at a concentration between 20 g / L and 120 g / L. In some embodiments, the NaCI concentration within the culture media is maintained at a concentration between 30 and 120, 40 and 120, 50 and 120, 60 and 120, 70 and 120, 80 and 120, 90 and 120, 100 and 120, or 110 and 120 g / L.

[0270] In some embodiments, the NaCI concentration within the culture media is maintained at a concentration of at least 0.4 M during fermentation. In some embodiments, NaCI concentration within the culture media is maintained at a concentration of at least 0.5 M, 0.6 M, 0.7 M, 0.8 M, 0.9 M, 1 .0 M, 1 .1 M, 1 .2 M, 1 .3 M, 1 .4 M, 1 .5 M, 1 .6 M, 1 .7 M, 1 .8 M, 1 .9 M, 2.0 M, 2.1 M, 2.2 M, 2.3 M, 2.4 M, or 2.5 M during fermentation.

[0271] In some embodiments, the NaCI concentration within the culture media is maintained at a concentration below 1.0 M during fermentation. In some embodiments, NaCI concentration within the culture media is maintained at a concentration of below 1 .1 M, 1 .2 M, 1 .3 M, 1 .4 M, 1 .5 M, 1 .6 M, 1 .7 M, 1 .8 M, 1 .9 M, 2.0 M, 2.1 M, 2.2 M, 2.3 M, 2.4 M, or 2.5 M during fermentation.

[0272] In some embodiments, the NaCI concentration within the culture media is maintained at a concentration between 0.4 M and 2.0 M. In some embodiments, the NaCI concentration within the culture media is maintained at a concentration between 0.5 M and 2.0 M, 0.6 M and 2.0 M, 0.7 M and 2.0 M, 0.8 M and 2.0 M, 0.9 M and 2.0 M, 1 .0 M and 2.0 M, 1 .1 M and 2.0 M, 1 .2 M and 2.0 M, 1 .3 M and 2.0 M, 1 .4 M and 2.0 M, 1 .5 M and 2.0 M, 1 .6 M and 2.0 M, 1 .7 M and 2.0 M, 1 .8 M and 2.0 M, or 1 .9 M and 2.0 M.

[0273] In some embodiments, the microbial culture media is taken directly from the environment or comprises water taken from the environment, for example from sea water, brackish water, river water, lake water, pond water. In some embodiments the cells are grown directly in the water taken from the environment. In some embodiments, the environmental water is processed (e.g. filtered and / or autoclaved) before use as culture media. In some embodiments, further additives (e.g. carbon, mineral, additional NaCI, and / or amino acids) are added to the water to support growth of the cells. In some embodiments, the water is polluted with excess carbon and / or excess sulfur containing compounds. The sulfur containing compound may be a sulfate, a thiosulfate, and / or a sulfite. In some embodiments, the culture media comprises tap water. Tap water is water that is obtained directly from a faucet or tap, that has not been further purified, distilled, or otherwise treated after delivery from the faucet or tap.

[0274] In some embodiments, the culture media comprises grey water. Greywater (or grey water, sullage) refers to domestic wastewater generated in households or office buildings from streams without faecal contamination, i.e., all streams except for the wastewater from toilets. Sources of greywater include sinks, showers, baths, washing machines or dishwashers.

[0275] Typically, culture media, culture vessels, and other equipment used in the culture of microorganisms is sterilized before it is used in methods of culturing microorganisms (e.g., fermentation). Sterilisation may comprise autoclaving, filtering, heating, boiling, irradiating, and / or treating with a gas. Additionally, other measures can be put in place to prevent subsequent contamination of cultures and equipment. Some methods employ the use of antibiotics, flow cabinets, flow chambers. This is to prevent contamination of subsequent cultures. Contamination could lead to reduced efficiency of a method involving the culture of microorganisms, and could lead to contaminating microorganisms outcompeting recombinant microorganisms which are important to said method. Such methods of culture are known as sterile culture, or culture under sterile conditions.

[0276] The methods described herein may comprise the use of a culture medium. In some embodiments, culture medium is non-sterile. In some embodiments, culture medium is not sterile. In some embodiments, culture medium is not sterilised. In some embodiments, culture medium is not sterilised before it is inoculated. In some embodiments, culture medium is not sterilised before the it is contacted with a halophilic microorganism. In some embodiments, the culture medium is not autoclaved. In some embodiments, the culture medium is not filtered. In some embodiments, the culture medium is not autoclaved, filtered, heated, boiled, irradiated, and / or treated with a gas, before the culture medium is contacted with the halophilic microorganism.

[0277] The culture medium is prepared using a solvent. In some embodiments, the solvent is water. In some embodiments, the water is tap water. In some embodiments, the water is non-sterile. In some embodiments, a solvent is not sterilised before culture medium preparation. In some embodiments, the culture medium comprises a non-sterile solvent. In some embodiments, the culture medium is prepared using a non-sterile solvent. In some embodiments, the culture medium is prepared using a non-sterile solvent, and the culture medium is not subsequently sterilized.

[0278] In some embodiments, methods described herein do not comprise the use of aseptic technique. Aseptic technique is designed to provide a barrier between the microorganisms in the environment and the cell culture (and microorganisms intentionally included in the cell culture). Aseptic technique depends upon a set of procedures to reduce the probability of contamination from environmental sources. The elements of aseptic technique are a sterile work area, good personal hygiene, sterile reagents and media, and sterile handling.

[0279] Key to the development of a commercially viable microbial bioprocess is the sourcing of cost effective renewable and sustainable feed stocks, and the demonstration of the scalability of the process. The culture (e.g., fermentation) of a microorganism requires a carbon source. In some embodiments, the carbon source is glucose, glycerol, starch, sucrose, or carbon dioxide. The carbon source may be utilised by the microorganism for metabolism. In some embodiments, the carbon source is utilised by the microorganism to synthesise biomass. In some embodiments, the carbon source is utilised by the microorganism to produce acetyl-CoA and / or pyruvate. In some embodiments, the carbon source is utilised by the microorganism to produce citramalate.

[0280] In some embodiments, the carbon source is a waste carbon source. In some embodiments, the carbon source is derived from agro-industrial waste. In some embodiments, the agro-industrial waste is biodiesel waste, or food production waste. In some embodiments, the food production waste is potato waste, lignocellulosic waste, or sugar beet waste (e.g., sugar beet pulp).

[0281] Raw biodiesel waste is a cost-effective carbon source, a low value product composed primarily of glycerol (60-70%), salts, methanol and residual vegetable oils. In some embodiments, the carbon source is raw biodiesel waste. In some embodiments, the carbon source is derived from biodiesel waste.

[0282] Glycerol, also called glycerine or glycerin, is a simple triol compound with three carbons. The glycerol backbone is found in lipids known as glycerides (e.g., triglycerides). Due to its availability and low cost, glycerol represents an attractive feedstock for largescale fermentative production of fuels and chemicals. However, not all organisms are able to utilise glycerol as a carbon source as the catabolism of one molecule of glycerol generates double the amount of reducing equivalents (NADH) produced by the catabolism of one molecule of glucose. Consequently, efficient glycerol catabolism condition requires an additional electron acceptor to re-oxidize the resulting excess reducing equivalents.

[0283] Food wastes, such as vegetable wastes are also readily available. For example, potato waste (e.g., potato peel waste) is a starchy by-product generated in great amounts during the industrial processing of potatoes. It can be used as a low-cost carbon source. In some embodiments, the food waste comprises starch. In some embodiments, the food waste comprising starch is potato waste (e.g., potato peel waste, or waste from potato crisp production), bakery waste, cereal flour waste (e.g., wheat flour waste).

[0284] Starch (or amylum) is a polymeric carbohydrate consisting of numerous glucose units joined by glycosidic bonds. This polysaccharide is produced by most green plants for energy storage. In industry, starch is often converted into sugars (e.g., by pre-treatment processes such as malting), and the resulting sugars are used as a carbon source for fermentation of microorganisms. This is due to the fact that not all microorganisms are capable of directly utilising starch as a carbon source. In some embodiments, the microorganism expresses a recombinant starch degrading enzyme to enable the use of starch as a carbon source.

[0285] In some embodiments, a starch degrading enzyme is excreted by a microorganism. In some embodiments, a starch degrading enzyme is excreted by a halophilic microorganism. In some embodiments, a microorganism is lysed to release a starch degrading enzyme into the media. In some embodiments, a halophilic microorganism is lysed to release a starch degrading enzyme into the media. In some embodiments, a starch degrading enzyme is added to the media. In some embodiments, starch is digested by a first microorganism which expresses a starch degrading enzyme, and the digestion product ( / .e., glucose) is utilised as a carbon source by a second microorganism.

[0286] Lignocellulosic waste is abundantly available and a low-cost carbon source option. Sources of lignocellulosic waste includes waste generated from forestry resources, agricultural resources, and byproducts of agricultural-based industry. The waste from forestry resources is generated from forest cutting, reforestation, forest processing, and forest protection. Waste generated from agricultural resources includes crop straws, agricultural crops, and by-products from crop harvest.

[0287] In some embodiments, the carbon source is a direct carbon source or an indirect carbon source. In some embodiments, the carbon source is a direct carbon source. In some embodiments, the carbon source is an indirect carbon source. A direct carbon source is a carbon source that can be immediately utilised by a microorganism. In some embodiments, the direct carbon source is glucose, glycerol, sucrose, and / or carbon dioxide. An indirect carbon source is a carbon source that is processed by a microorganism before it is utilised as a carbon source. For example, starch is an indirect carbon source. Starch comprises two polymers: amylose and amylopectin, which may be digested by starch degrading enzymes to generate glucose for utilisation by a microorganism. In some embodiments, the indirect carbon source is starch. In some embodiments, the indirect carbon source is a waste carbon source.

[0288] In some embodiments, the method comprises the use of more than one carbon source. In some embodiments, method comprises the use of glucose and glycerol as dual carbon sources.

[0289] In some embodiments, the culture (e.g., fermentation) of a microorganism requires nitrogen, salts, minerals, and vitamins. Seawater is a cost-effective natural mineral and salt broth (3.5%), while clarified wastewater streams provide an abundant alternative for inland sites. Additional salt can be added in the form of crude sea salt. Provision of vitamins, where necessary, can be achieved from autolysed spent brewery yeast, an abundant waste product.

[0290] In some embodiments, the medium comprises a nitrogen source. In some embodiments, the nitrogen source is yeast extract, urea, ammonium sulphate, ammonium chloride, ammonia, and / or potassium nitrate. In some embodiments of this invention, microorganisms (e.g. Halomonas) utilise atmospheric carbon dioxide as a carbon source. In some embodiments a carbon supply is provided in addition to atmospheric carbon dioxide. Suitable additional carbon supplies may be provided by the addition of sugar, NaHCOs, KHCO3, Na2CO3, waste glycerol, pre-treated food waste, pre-treated plant waste, pre-treated seaweed, or supplemental gaseous CO2 to the culture. In some embodiments the microorganism utilises carbon dioxide as a carbon source and also uses another carbon source (e.g. sugar, NaHCOs, waste glycerol, pre-treated food waste, pre-treated plant waste, or pre-treated seaweed).

[0291] The additional carbon may be supplied as a gas, liquid (including a solution in water) or a solid.

[0292] The additional carbon supply may be added continuously or at selected times during the culture or growth cycle of the chemoautotrophic microorganism.

[0293] In some embodiments, gaseous carbon dioxide (CO2) is provided to the culture. In some embodiments, atmospheric CO2 is provided to the culture. In some embodiments, further carbon dioxide is provided in addition to atmospheric carbon dioxide.

[0294] Carbon dioxide (CO2) is produced as a by-product of many industrial processes such as oil and gas production, cement production, iron and steel production, and electricity generation, as well as many others. This carbon dioxide is typically released into the environment through the combustion of fuels. However, it can be captured, separated, isolated and stored. This disclosure provides methods of utilising this waste carbon dioxide in a process of chemoautotrophic carbon fixation producing products of value and industrial application. In some embodiments, the culture is grown in a CO2 incubator.

[0295] In some embodiments, additional carbon dioxide is provided to the atmosphere surrounding the culture. In some embodiments, carbon dioxide is provided directly to the culture media.

[0296] Carbon dioxide may be provided at a concentration of about 420 parts per million (ppm) which is a typical average concentration of atmospheric carbon dioxide.

[0297] In some embodiments, gaseous CO2 is provided at one of about 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, or 1200 ppm. In some embodiments, gaseous CO2 is provided at a concentration of at least one of 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1 150, or 1200 ppm.

[0298] In some embodiments, gaseous CO2 is provided at a concentration between 300 ppm and 2000 ppm, 350 ppm and 2000 ppm, 400 ppm and 2000 ppm, 450 ppm and 2000 ppm, 500 ppm and 2000 ppm, 550 ppm and 2000 ppm, 600 ppm and 2000 ppm, 650 ppm and 2000 ppm, 700 ppm and 2000 ppm, 750 ppm and 2000 ppm, 800 ppm and 2000 ppm, 850 ppm and 2000 ppm, 900 ppm and 2000 ppm, 950 ppm and 2000 ppm, or 1000 ppm and 2000 ppm. In some embodiments, gaseous CO2 is provided at a concentration between 300 ppm and 1000 ppm, 350 ppm and 1000 ppm, 400 ppm and 1000 ppm, 450 ppm and 1000 ppm, 500 ppm and 1000 ppm, 550 ppm and 1000 ppm, 600 ppm and 1000 ppm, 650 ppm and 1000 ppm, 700 ppm and 1000 ppm, 750 ppm and 1000 ppm, 800 ppm and 1000 ppm, 850 ppm and 1000 ppm, 900 ppm and 1000 ppm, or 950 ppm and 1000 ppm.

[0299] In some embodiments, gaseous CO2 is provided to the culture at a volume concentration of about one of 0.1 %, 0.5.%, 1 %, 1.5%, 2%, 2.5%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11 %, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20% volume / volume (v / v). In some embodiments, gaseous CO2 is provided to the culture at a volume concentration of at least one of 0.1 %, 0.5.%, 1 %, 1.5%, 2%, 2.5%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11 %, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20% volume / volume (v / v). In some embodiments, gaseous CO2 is provided to the culture at a volume concentration of at most one of 0.1 %, 0.5.%, 1 %, 1 .5%, 2%, 2.5%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 1 1 %, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% volume / volume (v / v).

[0300] In some embodiments, gaseous CO2 is provided to the culture at a volume concentration of between 0.1 % and 100%, 0.1 % and 90%, 0.1 % and 80%, 0.1 % and 70%, 0.1 % and 60%, 0.1 % and 50%, 0.1 % and 40%, 0.1 % and 30%, 0.1 % and 20%, 0.1 % and 10%, 0.1 % and 5%, 0.1 % and 2.5%, or 0.1 % and 1 % volume / volume (v / v). In some embodiments, gaseous CO2 is provided to the culture at a volume concentration of between 0.5% and 100%, 0.5% and 90%, 0.5% and 80%, 0.5% and 70%, 0.5% and 60%, 0.5% and 50%, 0.5% and 40%, 0.1 % and 30%, 0.5% and 20%, 0.5% and 10%, 0.5% and 5%, 0.5% and 2.5%, or 0.5% and 1 % volume / volume (v / v).

[0301] In some embodiments, NaHCOs is provided to the culture. In some embodiments, NaHCOs is provided to the culture to supplement CO2.

[0302] In some embodiments, NaHCOs, or an equimolar mixture of NaHCOs with KHCO3, is provided to the culture at a concentration of at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 mM. In some embodiments, NaHCOs, or an equimolar mixture of NaHCOs with KHCO3, is provided to the culture at a concentration of at most 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 mM.

[0303] In some embodiments, NaHCOs, or an equimolar mixture of NaHCOs with KHCO3, is provided to the culture at a concentration between 1 mM and 10 mM, 1 mM and 20 mM, 1 mM and 30 mM, 1 mM and 40 mM, 1 mM and 50 mM, 1 mM and 60 mM, 1 mM and 70 mM, 1 mM and 80 mM, 1 mM and 90 mM, 1 mM and 100 mM, 1 mM and 110 mM, 1 mM and 120 mM, 1 mM and 130 mM, 1 mM and 140 mM, 1 mM and 150 mM, 1 mM and 160 mM, 1 mM and 170 mM, 1 mM and 180 mM, 1 mM and 190 mM, or 1 mM and 200 mM. In some embodiments, NaHCOs, or an equimolar mixture of NaHCOs with KHCO3, is provided to the culture at a concentration between 5 mM and 10 mM, 5 mM and 20 mM, 5 mM and 30 mM, 5 mM and 40 mM, 5 mM and 50 mM, 5 mM and 60 mM, 5 mM and 70 mM, 5 mM and 80 mM, 5 mM and 90 mM, 5 mM and 100 mM, 5 mM and 110 mM, 5 mM and 120 mM, 5 mM and 130 mM, 5 mM and 140 mM, 5 mM and 150 mM, 5 mM and 160 mM, 5 mM and 170 mM, 5 mM and 180 mM, 5 mM and 190 mM, or 5 mM and 200 mM.

[0304] Antibiotics are often used in the culture or fermentation of microorganisms. Antibiotics are used to prevent contamination or select for cells containing genetic modifications ( / .e., recombinant microorganisms). If antibiotics are not used to maintain the majority of microorganisms expressing recombinant plasmids carrying antibiotic resistance, the stability of the plasmid is greatly reduced. However, the use of antibiotics to maintain plasmids carrying antibiotic resistance genes escalates the costs of fermentation and heightens the risk of environmental pollution. In some embodiments, the method comprises the use of antibiotics. In some embodiments, the method does not comprise the use of antibiotics. In some embodiments, the method of microbial culture or fermentation of a microorganism does not comprise the use of an antibiotic. In some embodiments, the fermentation does not comprise the use of an antibiotic. In some embodiments, the fermentation comprises the use of an antibiotic.

[0305] Inducers and inducible promoters are frequently employed in method which use recombinant microorganisms. In some embodiments, the method comprises the use of an inducer (e.g., IPTG). In some embodiments, the method comprises the use of a microorganism comprising a recombinant plasmid with an inducible promoter. In some embodiments, the method comprises the use of a microorganism comprising a recombinant inducible promoter.

[0306] In some embodiments, the method comprises the use of a recombinant microorganism which expresses a heterologous gene under the control of an inducible promoter. In some embodiments, the method comprises the use of a recombinant microorganism which expresses a heterologous citramalate synthase under the control of an inducible promoter. In some embodiments, the method comprises the use of a recombinant microorganism which expresses a heterologous plasmid comprising a heterologous gene under the control of an inducible promoter. In some embodiments, the method comprises the use of a recombinant microorganism which expresses a heterologous plasmid comprising a heterologous citramalate synthase under the control of an inducible promoter.

[0307] The use of inducers and inducible promoters in the culture / fermentation of recombinant microorganisms enables the tight control of gene expression, and can also reduce plasmid loss. However, the use of inducers to maintain plasmids carrying antibiotic resistance genes increases the costs and complexity of methods involving recombinant microorganisms. IPTG is one example of an inducer which is frequently used in methods involving recombinant microorganisms. In some embodiments, the method does not comprise the use of inducers. In some embodiments, the method does not comprise the use of a microorganism comprising a recombinant plasmid with an inducible promoter. In some embodiments, the method does not comprise the use of a microorganism comprising a recombinant inducible promoter. In some embodiments, the method does not comprise the use of inducers or a microorganism comprising recombinant inducible promoters.

[0308] In some embodiments, the method comprises the use of a recombinant microorganism which expresses a heterologous gene under the control of a constitutive promoter. In some embodiments, the method comprises the use of a recombinant microorganism which expresses a heterologous citramalate synthase under the control of a constitutive promoter. In some embodiments, the method comprises the use of a recombinant microorganism which expresses a heterologous plasmid comprising a heterologous gene under the control of a constitutive promoter. In some embodiments, the method comprises the use of a recombinant microorganism which expresses a heterologous plasmid comprising a heterologous citramalate synthase under the control of a constitutive promoter.

[0309] Any suitable container or culture vessel may be used to propagate a microorganism according to the methods and compositions described here. In some embodiments, the container or culture vessel is a natural body, such as a lake or pond.

[0310] The skilled person is aware of many different types of culture vessels. Exemplary culture vessels include: plates, dishes, flasks, bottles, bioreactors, or fermenters. Also known as culture plates, culture dishes, culture flasks, culture bottles, culture bioreactors, or culture fermenters. Culture vessels can be constructed from a number of materials such as metal, glass, plastics and polymers such as polystyrene and polyester.

[0311] Culture plates are low flat-bottomed laboratory containers for growing cells on a thin layer of nutrient medium. Plates and dishes can be used with liquid and solid media. Culture dishes are similar to culture plates. The most common types of culture plates and dishes are the Petri dish and the multiwell plate. Multiwell plates are available in many sizes, for example as a 2-well plate, 4-well plate, a 6-well plate, a 12-well plate, a 24-well plate, a 48-well plate, a 96-well plate, or a 384 well plate. Petri dishes and multiwell plates are available from many manufacturers (e.g. Thermo Fisher Scientific) with different specifications. Plates are available in different colours (e.g. clear, black and white), and are usually made from polystyrene or glass.

[0312] Culture flasks are generally used with liquid cultures and typically resemble bottles. Flasks are generally constructed from glass, polycarbonate or polystyrene. It is possible to reuse and sterilise glass culture flasks, whereas disposable polycarbonate or polystyrene flasks are widely available (e.g. Thermo Fisher Scientific Nunc EasYFIasks). Culture flasks are available in many sizes, such as T25, T75, T175, T225, T300, T1000 and T2000. Different size flasks have different volumes and different surface areas.

[0313] In some embodiments, the culture vessel has a volume of at least 0.5, 0.6, 0.7, 0.8, 0.9, 1 .0, 1 .5, 2.0, 3.0, 4.0, 5.0, 10.0, 15.0, 20.0, 25.0, 30.0, 35.0, 40.0, 45.0, 50.0, 60.0, 70.0, 80.0, 90.0, 100.0, 125.0, 150.0, 175.0, 200.0, 300.0, 400.0, 500.0, 600.0, 700.0, 800.0, 900.0, or 1000.0 mL. In some embodiments, the culture vessel has a volume of at least 0.5, 0.6, 0.7, 0.8, 0.9, 1 .0, 1 .5, 2.0, 3.0, 4.0, 5.0, 10.0, 15.0, 20.0, 25.0, 30.0, 35.0, 40.0, 45.0, 50.0, 60.0, 70.0, 80.0, 90.0, 100.0, 125.0, 150.0, 175.0, 200.0, 225.0, or 250.0 litres (L).

[0314] A bioreactor may comprise a regulated bioreactor, in which one or more conditions may be controlled or monitored, for example, oxygen partial pressure. Devices for measuring and regulating these conditions are known in the art. For example, dissolved oxygen electrodes may be used for oxygen partial pressure and / or monitoring dissolved oxygen concentration (dO2). The oxygen partial pressure can be regulated via the amount and the composition of the selected gas mixture (e.g., air or a mixture of air and / or oxygen and / or nitrogen and / or carbon dioxide) and / or by adjusting the agitation rate. Suitable devices for measuring and regulating the oxygen partial pressure are described by Bailey, J E. (Bailey, J E., Biochemical Engineering Fundamentals, second edition, McGraw-Hill, Inc. ISBN 0-07-003212-2 Higher Education, (1986)) or Jackson A T. Jackson A T., Verfahrenstechnik in der Biotechnologie, Springer, ISBN 3540561900 (1993)). A bioreactor may comprise a photobioreactor. A photobioreactor is a bioreactor which provides an artificial light source to the cultured organism. For example, the photobioreactor may comprise an integral LED system for the provision of light. A bioreactor may comprise a Continuous Stirred Tank Reactor (CSTR) system. A bioreactor may comprise a flat bed photobioreactor system.

[0315] Alternatively, a culture may be static, i.e. where active agitation of the culture / culture media is not employed, optionally wherein mixing is performed via gas bubbling.

[0316] The yield, (also referred to as titre, or reaction yield) is the amount of product obtained in a reaction or enzymatic process. The absolute yield can be given as the weight in grams or in moles (molar yield). The yield of the present reaction is given in g / L according to the conditions described herein, however such yield values can be converted to moles or any other appropriate unit using standard methods known by one skilled in the art. The present methods have been shown to produce a citramalate yield of over 14.0 g / L.

[0317] In some embodiments, the method produces citramalate at a yield of greater than 1 g / L, for example, a yield of greater than 1 g / L, 2 g / L, 3 g / L, 4 g / L, 5 g / L, 6 g / L, 7 g / L, 8 g / L, 9 g / L, 10 g / L, 11 g / L, 12 g / L, 13 g / L, or greater than 14 g / L. In some embodiments, the method produces citramalate at a yield of greater than 5 g / L. In some embodiments, the method produces citramalate at a yield of greater than 10 g / L. In some embodiments, the method produces citramalate at a yield of greater than 14 g / L.

[0318] In some embodiments, the method is capable of producing citramalate at a yield of greater than 1 g / L, for example, a yield of greater than 1 g / L, 2 g / L, 3 g / L, 4 g / L, 5 g / L, 6 g / L, 7 g / L, 8 g / L, 9 g / L, 10 g / L, 11 g / L, 12 g / L, 13 g / L, or greater than 14 g / L. In some embodiments, the method is capable of producing citramalate at a yield of greater than 5 g / L. In some embodiments, the method is capable of producing citramalate at a yield of greater than 10 g / L. In some embodiments, the method is capable of producing citramalate at a yield of greater than 14 g / L In some embodiments, the yield of citramalate is greater than 1 g / L, for example, a yield of greater than 1 g / L, 2 g / L, 3 g / L, 4 g / L, 5 g / L, 6 g / L, 7 g / L, 8 g / L, 9 g / L, 10 g / L, 11 g / L, 12 g / L, 13 g / L, or greater than 14 g / L. In some embodiments, the yield of citramalate is greater than 5 g / L. In some embodiments, the yield of citramalate is greater than 10 g / L. In some embodiments, the yield of citramalate is greater than 14 g / L.

[0319] Vectors and plasmids

[0320] The microorganism according to the present disclosure may be genetically modified to express a heterologous gene, which may optionally result in additional enzymatic activity. For example, a microorganism ( / .e., a microbial cell) may be genetically modified to express a heterologous citramalate synthase.

[0321] Vectors may be used to introduce heterologous genes into a microorganism. The vector may be an expression vector for expression of foreign genetic material in the cell. Such vectors may include a promoter and / or a ribosome binding site (RBS) sequence operably linked to the nucleotide sequence encoding the sequence to be expressed. A vector may also include a termination codon and expression enhancers. Such expression vectors are routinely constructed in the art of molecular biology and may for example involve the use of plasmid DNA and appropriate initiators, promoters, RBS, enhancers and other elements, such as for example polyadenylation signals, which may be necessary, and which are positioned in the correct orientation in order to allow for recombinant protein expression.

[0322] The vector may be used to replicate the nucleic acid in a compatible host cell. Therefore, nucleic acids according to the present invention can be produced by introducing a polynucleotide into a replicable vector, introducing the vector into a compatible host cell and growing the host cell under conditions that bring about replication of the vector.

[0323] Vectors may include a promoter sequence operably linked to the nucleotide sequence encoding the gene sequence to be expressed. A vector may also include a termination codon and expression enhancers. Any suitable vectors, promoters, enhancers and termination codons known in the art may be used to express the enzymes from a vector according to the invention. Suitable vectors include plasmids, binary vectors, viral vectors, cosmids, and artificial chromosomes (e.g. yeast artificial chromosomes).

[0324] A construct or vector comprising a nucleic acid as described above need not include a promoter or other regulatory sequence, particularly if the vector is to be used to introduce the nucleic acid into cells for recombination into the genome.

[0325] Constructs and vectors may further comprise selectable genetic markers consisting of genes that confer selectable phenotypes such as resistance to antibiotics such as kanamycin, hygromycin, phosphinotricin, chlorsulfuron, methotrexate, gentamycin, spectinomycin, chloramphenicol, ampicillin, tetracycline etc. In some embodiments, the vector does not comprise a gene that confers resistance to an antibiotic. Those skilled in the art can construct vectors and design protocols for recombinant gene expression, for example in a microbial cell. Suitable vectors can be chosen or constructed, containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate. For further details see, for example, Molecular Cloning: a Laboratory Manual: 3rdedition, Sambrook et al, 2001 , Cold Spring Harbor Laboratory Press and Protocols in Molecular Biology, Second Edition, Ausubel et al. eds. John Wiley & Sons, 1992.

[0326] Any suitable vectors, promoters, enhancers and termination codons known in the art may be used to express a polypeptide from a vector according to the invention. In some embodiments, the vector may be a plasmid, phage, cosmid, MAC, virus, etc.

[0327] Other suitable vectors would be apparent to persons skilled in the art. By way of further example in this regard we refer to Sambrook et al., 2001 , Molecular Cloning: a laboratory manual, 3rdedition, Cold Harbour Laboratory Press.

[0328] The term “operably linked” may include the situation where a selected nucleotide sequence and regulatory nucleotide sequence (e.g. promoter and / or enhancer) are covalently linked in such a way as to place the expression of the nucleotide sequence under the influence or control of the regulatory sequence (thereby forming an expression cassette). Thus a regulatory sequence is operably linked to the selected nucleotide sequence if the regulatory sequence is capable of effecting transcription of the nucleotide sequence. The resulting transcript may then be translated into a desired peptide or polypeptide. The promoter may be a T7-like promoter.

[0329] In some embodiments, the vector may comprise an element for facilitating translation of encoded protein from mRNA transcribed from the construct. For example, the construct may comprise a ribosomal binding site (RBS) such as a Shine-Delgarno (SD) sequence upstream of the start codon. In some embodiments, RBS sequences may be designed to provide for different levels of expression of the encoded proteins. In some embodiments, the vector may encode one or more regulatory elements for modulating expression of the encoded protein(s). In some embodiments, the response element is an element that causes upregulation of gene or protein expression in response to treatment with a particular agent. For example, the agent may induce transcription of DNA encoding the protein(s) from a vector including a response element for the agent. In some embodiments the agent may be isopropyl p-D-1- thiogalactopyranoside (IPTG), and the vector may comprise a lac operator. Other induction agent / response element combinations are known in the art.

[0330] In some embodiments, the vector may encode one or more response elements for constitutive expression of the encoded protein(s), such that no induction is necessary. In some embodiments, the vector comprises a constitutive promoter. In some embodiments, the vector comprises an inducible promoter. Constitutive promoters are defined as promoters active in vivo in all circumstances, and, on the other hand, inducible promoters are switched ON and OFF by transcription factors depending on the in vivo conditions.

[0331] In some embodiments the vector may comprise a transcription terminator sequence downstream of the sequences encoding to the protein or proteins of interest. In some embodiments the terminator may be a T7 terminator sequence. In some embodiments the vector may comprise a sequence encoding a detectable marker in-frame with the sequence encoding the protein of interest to facilitate detection of expression of the protein, and / or purification or isolation of the protein (e.g. a His, (e.g. 6XHis), Myc, GST, MBP, FLAG, HA, E, or Biotin tag, optionally at the N- or C- terminus).

[0332] In some embodiments, the vector comprises a signal sequence which encodes a signal peptide. A signal sequence is a short sequence (e.g. 16-30 amino acids in length) at the beginning of the protein (N- terminus) that is usually cleaved off to form the mature (active) protein. Signal sequences are well known by the skilled person, and are described in detail in the art (e.g., Owji et al. European Journal of Cell Biology. Volume 97, Issue 6, August 2018, Pages 422-441 , which is hereby incorporated by reference in its entirety). Exemplary signal sequences are used in the plasmids described herein, e.g., in pHbPBC- T7L-cimA-amyL-HalGluc1 , where the thermotolerant a-amylase (SEQ ID NO:21) contains a 30 amino acid N-terminal signal peptide to target it for extracellular expression.

[0333] In some embodiments, the vector comprises a signal sequence at the N-terminus of a gene. In some embodiments, the vector may comprise a signal sequence at the N-terminus of a gene which encodes a starch degrading enzyme. In some embodiments, the signal sequence targets a protein for extracellular secretion. In some embodiments, the signal sequence targets an enzyme for extracellular secretion. In some embodiments, the signal sequence targets a starch degrading enzyme for extracellular secretion.

[0334] In some embodiments, the signal sequence is a signal sequence which is native to a gene. In some embodiments, the signal sequence is a non-native / artificial signal sequence.

[0335] In some embodiments, the signal sequence comprises a polynucleotide sequence with at least 40% sequence identity to SEQ ID NO:30. In some embodiments, the signal sequence comprises, or consists, of a polynucleotide sequence having at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NQ:30.

[0336] In some embodiments, the signal peptide comprises a polynucleotide sequence with at least 40% sequence identity to SEQ ID NO:31. In some embodiments, the citramalate synthase comprises, or consists, of a polynucleotide sequence having at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO:31. The nucleic acids / expression vectors can be introduced into a cell by any suitable means, which are well known to the skilled person. In some embodiments the nucleic acids / expression vectors are introduced into a cell by transformation, transduction, conjugation, transfection or electroporation. T7-like promoter systems may be preferred. T7 RNA polymerase is well known in the art. It is a very active enzyme, synthesising RNA at a high rate several times that of E. coli RNA polymerase. Furthermore, it has a lower frequency of termination, and its transcription can circumnavigate a plasmid, resulting in RNA several times the plasmid length in size. T7 RNA polymerase is also highly selective for initiation at its own promoter sequences and is resistant to antibiotics such as rifampicin that inhibit E. coli RNA polymerase.

[0337] “T7-like” promoter systems are IPTG-inducible system that work like the viral polymerase T7 (IPTG- inducible). They are a compatible system in other bacterial species, e.g. Halomonas, when traditional T7 promoters (e.g. in PET vectors) do not function. The gene MmP1 is a T7-like promoter that enables the IPTG-inducible expression of recombinant proteins in Halomonas when the organism contains a genomic copy of the MMP1 RNA polymerase (Zhao H et al 2017 Novel T7-like expression systems used for Halomonas. Metabolic Engineering 39: p. 128-140 which is herein incorporated by reference in its entirety). Preferably, the Halomonas strain comprises the MmP1 gene, either chromosomally integrated or on a vector or plasmid. Alternative IPTG-inducible vectors may be preferred. These include non-T7-like IPTG inducible promoters Ptac, Piacuvs and Pjrc.

[0338] In some embodiments, the vector is a plasmid. In some embodiments, the plasmid comprises a polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism.

[0339] Endogenous plasmids are plasmids that are found in wild type microorganisms, i.e., plasmids which are present in a microorganism which has not been genetically modified. For example, pHbCP is the endogenous plasmid of Halomonas bluephagenesis, and is found in unmodified Halomonas bluephagenesis cells.

[0340] In some embodiments, the plasmid comprises a polynucleotide derived from a plasmid that is endogenous to a Halomonas bacterium. In some embodiments, the plasmid comprises a polynucleotide derived from a plasmid that is endogenous to Halomonas bluephagenesis. In some embodiments, plasmid that is endogenous to Halomonas bluephagenesis is pHbCP.

[0341] In some embodiments, the polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism comprises at least 40% sequence identity to a nucleic acid sequence of a polynucleotide found on a plasmid that is endogenous to a halophilic microorganism. In some embodiments, the polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism comprises at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to a nucleic acid sequence of a polynucleotide found on a plasmid that is endogenous to a halophilic microorganism.

[0342] The polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism may be an open reading frame (ORF) or a coding sequence (CDS). In some embodiments, the polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism is derived from an ORF or CDS present on a plasmid that is endogenous to a halophilic microorganism.

[0343] An ORF is a polynucleotide sequence that starts with a start codon and ends with a stop codon. A CDS is the actual region of DNA that is translated to form proteins. A signal sequence is the N-terminal of a protein coding sequence that determines the final localisation of the protein, e.g. export of starch degrading enzymes into the culture medium. A signal sequence is a short sequence (e.g. 16-30 amino acids) at the beginning of the protein that is usually cleaved off to form the mature (active) protein. While the ORF may contain introns as well, the CDS refers to those nucleotides (concatenated exons) that can be divided into codons which are actually translated into amino acids by the ribosomal translation machinery. In Prokaryotes the ORF and the CDS are the same.

[0344] The polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism may be a ORF or CDS present on pHbCP. In some embodiments, the polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism is derived from an ORF or CDS present on pHbCP.

[0345] In some embodiments, the polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism comprises at least 40% sequence identity to the nucleic acid sequence of an ORF found on a plasmid that is endogenous to a halophilic microorganism. In some embodiments, the polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism comprises at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to the nucleic acid sequence of on ORF found on a plasmid that is endogenous to a halophilic microorganism.

[0346] In some embodiments, the polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism comprises at least 40% sequence identity to the nucleic acid sequence of an ORF found on pHbCP. In some embodiments, the polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism comprises at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to the nucleic acid sequence of on ORF found on pHbCP.

[0347] In some embodiments, the polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism encodes a toxin, and antitoxin, and / or a replication initiation protein. In some embodiments, the ORF found on pHbCP encodes a toxin, antitoxin, and / or a replication initiation protein.

[0348] A toxin is a naturally occurring poison produced by metabolic activities of living cells (e.g., microorganisms). An antitoxin is a molecule such as an RNA or protein which inhibits activity of a toxin. A toxin-antitoxin (TA) system comprises a toxin and an antitoxin, wherein the toxin is active against the cell that produces the toxin in the absence of the antitoxin, and the antitoxin is effective at inhibiting the activity of the toxin.

[0349] A toxin as defined herein is a functional toxin. Therefore, a polynucleotide which encodes a toxin as defined herein is a polynucleotide which encodes a functional toxin. An antitoxin as defined herein is a functional antitoxin. Therefore, a polynucleotide which encodes an antitoxin as defined herein is a polynucleotide which encodes a functional antitoxin. Furthermore, a TA system as defined herein is a functional TA system.

[0350] A replication initiation protein is a protein that initiates plasmid rolling-circle replication by binding to an origin of replication of a plasmid. A replication initiation protein as defined herein is a functional replication initiation protein. Therefore, a polynucleotide which encodes a replication initiation protein as defined herein is a polynucleotide which encodes a functional replication initiation protein.

[0351] In some embodiments, the polynucleotide which encodes a toxin comprises a nucleic acid sequence having at least 40% sequence identity to SEQ ID NO:14. In some embodiments, the polynucleotide which encodes a toxin comprises a nucleic acid sequence having at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to the nucleic acid sequence of SEQ ID NO:14.

[0352] In some embodiments, the polynucleotide which encodes an antitoxin comprises a nucleic acid sequence having at least 40% sequence identity to SEQ ID NO:24. In some embodiments, the polynucleotide which encodes an antitoxin comprises a nucleic acid sequence having at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to the nucleic acid sequence of SEQ ID NO:24.

[0353] In some embodiments, the polynucleotide which encodes a replication initiation protein comprises a nucleic acid sequence having at least 40% sequence identity to SEQ ID NO:25. In some embodiments, the polynucleotide which encodes an replication initiation protein comprises a nucleic acid sequence having at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to the nucleic acid sequence of SEQ ID NO:25.

[0354] In some embodiments, the polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism comprises the nucleic acid sequence of SEQ ID NO:14, SEQ ID NO:24, SEQ ID NO:25, and / or SEQ ID NO:26. In some embodiments, the polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism comprises the nucleic acid sequence of SEQ ID NO:14. In some embodiments, the polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism comprises the nucleic acid sequence of SEQ ID NO:24. In some embodiments, the polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism comprises the nucleic acid sequence of SEQ ID NO:25. In some embodiments, the polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism comprises the nucleic acid sequence of SEQ ID NO:26.

[0355] In some embodiments, the ORF found on pHbCP comprises the nucleic acid sequence of SEQ ID NO:14, SEQ ID NO:24 and / or SEQ ID NO:25. Plasmids contain a replication origin (on), i.e., a location within a plasmid where DNA replication begins. An or / is a polynucleotide which is typically rich in adenine and thymine nucleotides. In some embodiments, the ori is derived from a bacterium. In some embodiments, the ori is derived from a gramnegative bacterium. In some embodiments, the ori is derived from a gram-positive bacterium.

[0356] The polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism may be a replication origin (or / ). In some embodiments, the polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism is a Halomonas replication origin (or / ). In some embodiments, the polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism is a putative Halomonas replication origin (or / ). In some embodiments, the polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism is a putative Halomonas bluephagenesis replication origin (or / ). In some embodiments, the polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism is the pHbCP replication origin (or / ). In some embodiments, the polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism comprises the nucleic acid sequence of SEQ ID NO:26.

[0357] In some embodiments, the polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism is derived from a Halomonas replication origin (or / ). In some embodiments, the polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism is derived from a putative Halomonas replication origin (or / ). In some embodiments, the polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism is derived from a Halomonas bluephagenesis replication origin (or / ). In some embodiments, the polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism is derived from a putative Halomonas bluephagenesis replication origin (or / ). In some embodiments, the polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism is derived from the pHbCP replication origin (or / ).

[0358] In some embodiments, the polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism comprises a nucleic acid sequence having at least 40% sequence identity to SEQ ID NO:26. In some embodiments, the polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism comprises a nucleic acid sequence having at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to the nucleic acid sequence of SEQ ID NO:26.

[0359] In some embodiments, the vector is a pSEVA, pHALP, or a pHbPBC vector. In some embodiments, the vector is a pSEVA434, pSEVA241 , pHALP7, pHALPI 02, or a pHbPBC vector.

[0360] Vectors containing hybrid promoters may be preferred. This may contain native Halomonas Pporin or other promoters that have been engineered to convert them to inducible or constitutive promoters. Hybrid vectors may contain randomised variable region sequences that confer different expression levels of recombinant proteins, e.g. constitutive promoters found in vectors pHALP7 and pHALPI 02. In some embodiments, the vector is a pHALP7 or pHALP102 vector. Full details of these vectors can be found in Trisrivirat et al. (Synthetic Biology, Volume 5, Issue 1 , 2020, ysaa022), which is hereby incorporated by reference. The p7 promoter is a weak constitutive promoter, and the p102 promoter is a strong constitutive promoter.

[0361] In some embodiments, the vector is a pSEVA vector. Further details of pSEVA vectors is provided by Silva-Rocha et al. (Nucleic Acids Res. 2013 Jan; 41. Database issue: D666-D675), which is hereby incorporated by reference in its entirety. In some embodiments, the vector is a pSEVA vector comprising an inducible promoter. In some embodiments, the vector is a pSEVA vector comprising a constitutive promoter. In some embodiments, the vector is a pSEVA434 or pSEVA241 vector. In some embodiments, the vector is a pSEVA434 vector. The Examples provided herein utilise a pSEVA434 vector, with plasmid maps shown in Figure 1 . In some embodiments, the vector is a pSEVA241 vector. The Examples provided herein utilise a pSEVA241 vector, with plasmid maps shown in Figure 7.

[0362] In some embodiments, the vector is a pHbPBC vector. In some embodiments, the vector is a pHbPBC- T7L or a pHbPBC-J23119 vector. In some embodiments, the vector is a pHbPBC vector comprising an inducible promoter. In some embodiments, the pHbPBC vector comprising an inducible promoter is a pHbPBC-T7L vector. In some embodiments, the vector is a pHbPBC vector comprising a constitutive promoter. In some embodiments, the pHbPBC vector comprising a constitutive promoter is a pHbPBC- J23119 vector.

[0363] In some embodiments, the vector is a recombinant hybrid plasmid derived from a plasmid that is endogenous to the intended host microorganism. For example, the vector may be a hybrid plasmid derived from a Halomonas bacterium when the intended host microorganism is a Halomonas bacterium. The development of a hybrid plasmid is described in Example 9 herein, where a Halomonas bluephagenesis TD1 .0 native plasmid is modified to generate a hybrid plasmid for citramalate production. pHbPBC vectors may comprise a toxin-antitoxin (TA) system. TA systems are composed of two elements: a toxin and an antitoxin. They are generally composed of two genes organized in an operon, encoding a toxin and a labile antitoxin. When carried by mobile genetic elements, these small modules contribute to their stability by a phenomenon denoted as addiction. In type I to type VII TA modules, the toxins are generally proteins, whereas, in type VIII TA modules, it is a small RNA. In the case of type I, type III and type VIII TA modules, antitoxins are small noncoding RNAs while in type II, type IV, type V, type VI and type VII TA modules are small proteins.

[0364] In some embodiments, the toxin-antitoxin system enhances plasmid stability. In some embodiments, the toxin-antitoxin system enhances plasmid stability in a halophilic microorganism. In this context plasmid stability may alternatively be described as plasmid persistence, plasmid maintenance or plasmid retention. Therefore, in some embodiments, the toxin-antitoxin system enhances plasmid sta bi lity / pe rsiste n ce / rete nti o n . Plasmid stability relates to the retention of plasmids in a population of microorganisms. Plasmids with high stability therefore show low levels of plasmid loss. Naturally occurring plasmids employ systems to increase their stability / retention and reduce plasmid loss. Plasmid maintenance systems include replication, copy number control, multimer resolution, partitioning / segregation, post-segregational killing, and direct horizontal transfer (such as conjugation) systems. Recombinant plasmids often comprise antibiotic resistance genes to increase plasmid stability. However, the use of antibiotics is subject to drawbacks such as increased cost and negative environmental implications.

[0365] Plasmid stability can be assayed through any method known in the art. For example, assays for the direct and convenient measurement of plasmid stability are provided by Chen et al. (Scientific Reports volume 7, Article number: 4788. 2017), and quantitative methods for measuring plasmid loss are provided by Lau et al. (Plasmid. 2013 Nov; 70(3): 353-361).

[0366] In some embodiments, the toxin-antitoxin system enhances plasmid stability in a microorganism grown in the absence of antibiotics. In some embodiments, the toxin-antitoxin system enhances plasmid stability within microorganisms cultured using continuous fermentation for over 7 days. In some embodiments, the toxin-antitoxin system enhances plasmid stability within microorganisms cultured using continuous fermentation for over 7 days. In some embodiments, the toxin-antitoxin system enhances plasmid stability within microorganisms cultured using continuous fermentation for over 7 days in the absence of antibiotics.

[0367] TA systems are reviewed by Guglielmini and Van Melderen (Mob Genet Elements. 2011 Nov 1 ; 1 (4): 283-290) Singh et al. (Curr Res Microb Sci. 2021 Dec; 2: 100047), and Qiu et al. (Microbiological Research 264. 2022. 127159), which are hereby incorporated in their entirety.

[0368] TA modules were initially discovered to be present on plasmids exhibiting plasmid maintenance through post-segregational killing (PSK) and were described as “addiction modules” because, after cell division, they confirm the death of cells that do not inherit such plasmids. Therefore, the modification of such plasmids to express recombinant genes could be beneficial to biotechnology and the reduction of recombinant gene / plasmid loss in antibiotic-free environments. Such systems could therefore be particularly useful in methods of culture / fermentation employing the use of non-sterile media.

[0369] Halomonas bluephagenesis comprises a circular plasmid with a size of 6,009 bp and containing 10 open reading frames (ORFs), which is known as as pHbCP. The pHbCP plasmid has been shown to comprise a hbpB / hbpC TA system. Ren et al. (ACS Synth. Biol. 2024, 13, 61-67), which is hereby incorporated in its entirety, modified the pHbCP plasmid to generate pHbPBC-sfGFP. The recombinant plasmid was shown to result in high levels of GFP expression in the absence of antibiotics.

[0370] Hybrid plasmids generated through the modification of the pHbCP plasmid have not been shown to be suitable for a number of important applications: (i) the expression of a gene encoding a heterologous enzyme for the production of a commercially useful biochemical, (ii) continuous fermentation for over 7 days, (iii) compatibility with constitutive promoters, (iv) expression in halophilic microorganisms other than Halomonas bluephagenesis.

[0371] Toxin-antitoxin systems may be employed in methods described herein, and plasmids described herein may comprise one or more genes encoding a toxin-antitoxin system. In some embodiments, the vector is a plasmid comprising a toxin-antitoxin system. In some embodiments, the plasmid comprises one or more genes encoding a toxin-antitoxin system. In some embodiments, the plasmid comprises two genes encoding a toxin-antitoxin system.

[0372] In some embodiments, the toxin-antitoxin system is a toxin-antitoxin system utilised by the intended host microorganism. In some embodiments, the genes encoding a toxin-antitoxin system are the genes encoding a toxin-antitoxin system present on an endogenous plasmid of the intended host microorganism. In some embodiments, the genes encoding a toxin-antitoxin system are the genes encoding a toxin-antitoxin system present on an endogenous Halomonas plasmid.

[0373] In one aspect of the present disclosure, a plasmid is provided for the expression of a gene encoding a heterologous enzyme in a halophilic microorganism. A plasmid for the expression of a gene encoding a heterologous enzyme in a halophilic microorganism may alternatively be described as: a plasmid suitable for the expression of a gene encoding a heterologous enzyme in a halophilic microorganism, or plasmid which is capable of expressing a gene encoding a heterologous enzyme in a halophilic microorganism. In this context, the plasmid is a hybrid plasmid. A hybrid plasmid is a plasmid that contains an inserted piece of foreign DNA. In some embodiments, the plasmid is a Halomonas plasmid that contains an inserted piece of foreign DNA. Therefore, in some embodiments, the plasmid is a recombinant plasmid.

[0374] In some embodiments, the plasmid comprises one or more genes encoding a toxin-antitoxin system which is described herein. In some embodiments, the plasmid comprises a hbpB / hbpC TA system ( / .e., comprises a hbpB gene and a hbpC gene).

[0375] In some embodiments, the gene which encodes an antitoxin comprises a nucleic acid sequence having at least 70% sequence identity to SEQ ID NO:14. In some embodiments, the gene which encodes an antitoxin comprises a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to SEQ ID NO:14.

[0376] In some embodiments, the gene which encodes a toxin comprises a nucleic acid sequence having at least 70% sequence identity to SEQ ID NO:24. In some embodiments, the gene which encodes a toxin comprises a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to SEQ ID NO:24.

[0377] In some embodiments, the plasmid comprises a gene encoding an enzyme. In some embodiments, the plasmid comprises one or more genes encoding a toxin-antitoxin system, and a gene encoding an enzyme. In some embodiments, the plasmid comprises two genes encoding a toxin-antitoxin system, and a further gene encoding an enzyme. In some embodiments, the plasmid comprises two genes encoding a toxin-antitoxin system, and two further genes encoding different enzymes.

[0378] In some embodiments, the gene encodes a metabolic enzyme. In some embodiments, the gene encodes a transferase. In some embodiments, the gene encodes an acyltransferase. In some embodiments, the gene encodes a citramalate producing enzyme. In some embodiments, the gene encodes a citramalate synthase. In some embodiments, the gene encodes a citramalate synthase described herein.

[0379] In some embodiments, the gene which encodes a citramalate synthase comprises a nucleic acid sequence having at least 70% sequence identity to SEQ ID NO:3 or SEQ ID NO:4. In some embodiments, the gene comprises a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to SEQ ID NO:3 or SEQ ID NO:4.

[0380] In some embodiments, the gene encodes a starch degrading enzyme. In some embodiments, the gene encodes an a-amylase. In some embodiments, the gene encodes a p-glucosidase.

[0381] In some embodiments, the gene which encodes an a-amylase comprises a nucleic acid sequence having at least 70% sequence identity to SEQ ID NO:7. In some embodiments, the gene comprises a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to SEQ ID NO:7.

[0382] In some embodiments, the gene which encodes a p-glucosidase comprises a nucleic acid sequence having at least 70% sequence identity to SEQ ID NO:8. In some embodiments, the gene comprises a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to SEQ ID NO:8.

[0383] In some embodiments, the plasmid comprises an operon. An operon is a functioning unit of DNA containing a cluster of genes under the control of a single promoter. The genes are transcribed together into an mRNA strand and either translated together in the cytoplasm, or undergo splicing to create monocistronic mRNAs that are translated separately.

[0384] In some embodiments, the operon is a two-gene operon. In some embodiments, the operon is a three- gene operon. In some embodiments, the operon comprises two different genes that encode enzymes. In some embodiments, the operon comprises a gene which encodes a citramalate producing enzyme and a gene which encodes a starch degrading enzyme. In some embodiments, the operon comprises a gene which encodes a citramalate producing enzyme and two genes which encode starch degrading enzymes. In some embodiments, the operon comprises genes encoding a citramalate synthase, an a-amylase, and / or a p-glucosidase. In some embodiments, the operon comprises genes encoding a citramalate synthase, an a-amylase, and a p-glucosidase. In some embodiments, the plasmid is a hybrid plasmid derived from an endogenous plasmid from a halophilic microorganism. In some embodiments, the plasmid is a hybrid plasmid derived from a Halomonas bacterium. In some embodiments, the plasmid is a hybrid plasmid derived from Halomonas bluephagenesis. In some embodiments, the plasmid is a hybrid plasmid derived from a pHbCP plasmid.

[0385] In some embodiments, the plasmid comprises elements from the endogenous plasmid of H. bluephagenesis (pHbCP). In some embodiments, the plasmid comprises the pHbCP ori. In some embodiments, the plasmid comprises the pHbCP hbpB / hbpC TA system.

[0386] In some embodiments, the plasmid comprises a nucleic acid sequence having at least 40% sequence identity to a nucleic acid sequence of the endogenous plasmid of H. bluephagenesis (pHbCP). In some embodiments, the plasmid comprises a nucleic acid sequence having at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to a nucleic acid sequence of the endogenous plasmid of H. bluephagenesis (pHbCP).

[0387] Nucleic acids, expression vectors, cells and compositions

[0388] The present invention also provides a nucleic acid, or a plurality of nucleic acids, encoding an enzyme such as a citramalate synthase.

[0389] In some embodiments the nucleic acid is DNA. In some embodiments the nucleic acid is RNA. The nucleic acid may be single-stranded or double-stranded. The nucleic acid may be provided in isolated / purified form, or within a host cell.

[0390] In general, polynucleotides can be produced by synthetic means, involving a stepwise manufacture of the desired nucleic acid sequence one nucleotide at a time. Techniques for accomplishing this using automated techniques are readily available in the art. Longer polynucleotides will generally be produced using recombinant means, for example using PCR (polymerase chain reaction) cloning techniques. In some embodiments this will involve making a pair of primers (e.g. of about 15-30 nucleotides) to a region of the gene which it is desired to clone, bringing the primers into contact with DNA, performing a polymerase chain reaction under conditions which bring about amplification of the desired region, isolating the amplified fragment (e.g. by separating the reaction mixture on an agarose gel) and recovering and purifying the amplified DNA.

[0391] The primers may be designed to contain suitable restriction enzyme recognition sites so that the amplified DNA can be cloned into a suitable cloning vector. Although in general the techniques mentioned herein are well known in the art, reference may be made in particular to Sambrook et al., 2001 , Molecular Cloning: a laboratory manual, 3rd edition, Cold Harbour Laboratory Press. Alternatively, InFusion cloning (described e.g. in Throop and LaBear, Curr Protoc Mol Biol. (2015) 110: 3.20.1-3.20.23) or other cloning techniques may be used, such as Gibson Assembly (Gibson etal., Nat. Methods 2009; 6, 343-345), CRISPR / Cas9-based methods (Wang et al., (2015) BioTechniques 58:161-170), Sequence and Ligation Independent Cloning (SLIC; Nucleic Acids Res. 2012, 40: e55) and Modular Overlap-Directed Assembly with Linkers (MODAL; Nucleic Acids Res. (2014) 42.1 : el-el).

[0392] The present invention further provides a vector, particularly an expression vector, comprising a nucleic acid or plurality of nucleic acids according to the present invention. The vector may be used to replicate the nucleic acid in a compatible host cell. Therefore, nucleic acids according to the present invention can be produced by introducing a polynucleotide into a replicable vector, introducing the vector into a compatible host cell and growing the host cell under conditions that bring about replication of the vector. A “vector” as used herein is an oligonucleotide molecule (DNA or RNA) used as a vehicle to transfer foreign genetic material into a cell. The vector may be an expression vector for expression of the foreign genetic material in the cell. Such vectors may include a promoter and / or a ribosome binding site (RBS) sequence operably linked to the nucleotide sequence encoding the sequence to be expressed. A vector may also include a termination codon and expression enhancers. Such expression vectors are routinely constructed in the art of molecular biology and may, for example, involve the use of plasmid DNA and appropriate initiators, promoters, RBS, enhancers and other elements, such as polyadenylation signals, which may be necessary, and which are positioned in the correct orientation in order to allow for protein expression.

[0393] Any suitable vectors, promoters, enhancers and termination codons known in the art may be used to express a polypeptide from a vector according to the invention. In some embodiments, the vector may be a plasmid, phage, MAC, virus, etc.

[0394] In some embodiments the vector may be a prokaryotic expression vector, e.g. a bacterial expression vector. In some embodiments the vector is a pBbE2c vector or a pBbA1 k vector.

[0395] In some embodiments, the vector may be a eukaryotic expression vector. In some embodiments, the vector may be a eukaryotic expression vector, e.g. a vector comprising the elements necessary for expression of protein from the vector in a eukaryotic cell. In some embodiments, the vector may be a mammalian expression vector, e.g. comprising a cytomegalovirus (CMV) or SV40 promoter to drive protein expression.

[0396] Other suitable vectors would be apparent to persons skilled in the art. By way of further example in this regard we refer to Sambrook et al., 2001 , Molecular Cloning: a laboratory manual, 3rd edition, Cold Harbour Laboratory Press.

[0397] The term “operably linked” may include the situation where a selected nucleotide sequence and regulatory nucleotide sequence (e.g. promoter and / or enhancer) are covalently linked in such a way as to place the expression of the nucleotide sequence under the influence or control of the regulatory sequence (thereby forming an expression cassette). Thus, a regulatory sequence is operably linked to the selected nucleotide sequence if the regulatory sequence is capable of effecting transcription of the nucleotide sequence. The resulting transcript may then be translated into a desired peptide or polypeptide. The promoter may be a T7 promoter.

[0398] In some embodiments, the vector may comprise element for facilitating translation of encoded protein from mRNA transcribed from the construct. For example, the construct may comprise a ribosomal binding site (RBS) such as a Shine-Dalgarno (SD) sequence upstream of the start codon.

[0399] In some embodiments, the vector may encode one or more response elements for modulating expression of the encoded protein(s). In some embodiments, the response element is an element that causes upregulation of gene or protein expression in response to treatment with a particular agent. For example, the agent may induce transcription of DNA encoding the protein(s) from a vector including a response element for the agent. In some embodiments the agent may be isopropyl p-D-1 -thiogalactopyranoside (IPTG), and the vector may comprise a lac operator. Other induction agent / response element combinations are known in the art.

[0400] In some embodiments, the vector may encode one or more response elements for constitutive expression of the encoded protein(s), such that no induction is necessary.

[0401] In some embodiments the vector may comprise a transcription terminator sequence downstream of the sequences encoding the protein or proteins of interest. In some embodiments the terminator may be a T7 terminator sequence. In some embodiments the vector may comprise a sequence encoding a detectable marker in-frame with the sequence encoding the protein(s) of interest to facilitate detection of expression of the protein(s), and / or purification or isolation of the protein(s) (e.g. a His, (e.g. 6XHis), Myc, GST, MBP, FLAG, HA, E, or Biotin tag, optionally at the N- or C- terminus).

[0402] Also provided by the present invention is a microorganism which expresses: a heterologous citramalate synthase, a nucleic acid or plurality of nucleic acids, or an expression vector according to the present invention.

[0403] The nucleic acids / expression vectors can be introduced into a cell by any suitable means, which are well known to the skilled person. In some embodiments the nucleic acids / expression vectors are introduced into a cell by transformation, transduction, conjugation, transfection or electroporation.

[0404] A microorganism which expresses a heterologous citramalate synthase according to the present invention may do so through expression from a nucleic acid / expression vector according to the present invention that has been introduced into the cell. Cells and microorganisms contemplated for use with the present invention include prokaryotic and eukaryotic cells. For example, the prokaryotic cell may be a bacteria or archaea, and the eukaryotic microorganism may be a fungi, protist, or microscopic animal or microscopic plant organism. In some embodiments, the cells are isolated cells from a multicellular organism.

[0405] The present invention also provides compositions comprising the cells, nucleic acids, expression vectors, and enzymes / combinations of enzymes according to the present invention. The compositions find use e.g. in methods for citramalate production according to the present invention.

[0406] Any halophilic bacterium may be used, such as laboratory strains or field strains. Preferred bacteria are robust bacteria, such as soil bacteria and / or extremophilic bacteria. Extremophilic bacteria include slight halophiles (able to grow in 1 .7 to 4.8% NaCI), moderate halophiles (able to grow in 4.7 to 20% NaCI), extreme halophiles (able to grow in 20 to 30% NaCI), acidophiles (able to grow in conditions of low pH, such as below pH 5.0, e.g. pH 2 or below), alkaliphiles (able to grow in conditions of pH 8.5 or above), metallotolerant bacteria (able to survive in environments containing high concentrations of dissolved heavy metals), thermophiles or hyperthermophiles (with an optimal growth temperature between about 41 and 122°C, e.g. strains of Caldicellulosiruptor, Thermotoga, Thermoanaerobacterium, Pyrococcus, and AeropyrunT), or polyextremophiles (bacterial possessing two or more extremophilic characteristics).

[0407] Especially preferred are halophilic bacteria. Halophilic bacteria are capable of growing in open non-sterile conditions. As these strains are salt tolerant, they will not be outcompeted so long as there is a high enough salt content. Furthermore, the addition of a high salt buffer (e.g. at least a 3% salt solution) can be used to control competing bacteria. Halophilic bacteria include those of the genus Halomonas. Exemplary species of Halomonas have been described, including H. alimentaria, H. alkaliantarctica, H. alkaliphila, H. almeriensis, H. andesensis, H. anticariensis, H. aquamarina, H. arcis, H. axialensis, H. beimenensis, H. bluephagenesis, H. boliviensis, H. campaniensis, H. campisalis, H. caseinilytica, H. cerina, H. cibimaris, H. cupida, H. daqiaonensis, H. daqingensis, H. denitrificans, H. desiderata, H. elongata, H. eurihalina, H. flava, H. fontilapidosi, H. garicola, H. gomseomensis, H. gudaonensis, H. halmophila, H. halocynthiae, H. halodenitrificans, halophila, H. hamiltonii, H. heilong / jiangensis, H. huangheensis, H. hydrothermalis, H. ilicicola, H. janggokensis, H. jeotgali, H. johnsoniae, H. kenyensis, H. koreensis, H. korlensis, H. kribbensis, H. lutea, H. lutescence, H. magadiensis, H. maura, H. meridian, H. mongoliensis, H. muralis, H. nanhaiensis, H. neptunia, H. nitroreducens, H. olivaria, H. organivorans, H. pacifica, H. pantelleriensis, H. qiaohouensis, H. qijiaojingensis, H. ramblicola, H. rifensis, H. rowanensis, H. sabkhae, H. saccharevitans, H. salicampi, H. salifodinae, H. salina, H. sediminicola, H. shengliensis, H. sinaiensis, H. smyrnensis, H. songnenensis, H. stenophila, H. stevensii, H. subglaciescola, H. subterranean, H. sulfidaeris, H. taeanensis, H. titanicae, H. urumqiensis, H. variabilis, H. ventosae, H. venusta, H. vilamensis, H. xianhensis, H. xinjiangensis, H. zhang / jiangensis, and H. zincidurans. Preferred Halomonas strains include H. bluephagenesis st. TQ10, H. bluephagenesis st. TD1 .0 and H. bluephagenesis st. TD01 . Strains (st.) TD1 .0 and TQ10 are genetically modified versions of the native TD01 strain where the gene encoding MmP1 has been chromosomally integrated into the bacterium. The gene MmP1 is a T7-like promoter that enables the IPTG-inducible expression of recombinant proteins in Halomonas (Zhao H et al 2017 Novel T7-like expression systems used for Halomonas. Metabolic Engineering 39: p. 128-140, which is herein incorporated by reference in its entirety).

[0408] Methods of modifying a microorganism

[0409] The microorganism according to some aspects of the present disclosure may be genetically modified to express a heterologous gene and / or a recombinant plasmid, which may optionally result in additional enzymatic activity. For example, a Halomonas cell may be genetically modified to express a citramalate synthase.

[0410] Vectors may be used to introduce heterologous genes into a halophilic microorganism (e.g., a Halomonas microorganism). Such vectors are routinely constructed in the art of molecular biology and may for example involve the use of plasmid DNA and appropriate initiators, promoters, RBS, enhancers and other elements, such as for example polyadenylation signals, which may be necessary, and which are positioned in the correct orientation in order to allow for recombinant protein expression. The vector may be a plasmid.

[0411] In one aspect of the present disclosure, a method is provided for modifying a halophilic microorganism comprising an endogenous plasmid. In some embodiments, the method comprises: (i) curing an endogenous plasmid from the microorganism, and (ii) modification of the microorganism to express a recombinant plasmid.

[0412] Endogenous plasmids are plasmids that are found in wild type microorganisms, i.e., plasmids which are present in a microorganism which has not been genetically modified. In some embodiments, the endogenous plasmid comprises one or more genes encoding a toxin-antitoxin system. In some embodiments, the toxin-antitoxin system is a toxin-antitoxin system described herein.

[0413] Curing an endogenous plasmid can be performed through any method known in the art. An exemplary method of curing an endogenous plasmid is outlined in Example 8. Curing an endogenous plasmid may alternatively be described as removing an endogenous plasmid or knocking out an endogenous plasmid.

[0414] The classic strategy to cure a strain of its resident plasmid is to stress the bacteria in some way, for example by growth at high temperature, or in the presence of a detergent, mutagens or some other DNA modulating agents, such as intercalating agents. An alternative approach for curing a host cell of its endogenous plasmid is to use the property of "plasmid incompatibility" to displace the resident plasmid. Highly specific methods of curing an endogenous plasmid are now possible through the use of gene editing techniques, such as site-specific nuclease (SSN) systems (e.g., CRISPR, TALEN, meganuclease, and Zinc Finger Nuclease systems).

[0415] In some embodiments the methods employ target nucleic acid editing using SSNs. Gene editing using SSNs is reviewed e.g. in Eid and Mahfouz, Exp Mol Med. 2016 Oct; 48(10): e265, which is hereby incorporated by reference in its entirety. Enzymes capable of creating site-specific double strand breaks (DSBs) can be engineered to introduce DSBs to target nucleic acid sequence(s) of interest. DSBs may be repaired by either error-prone non-homologous end-joining (NHEJ), in which the two ends of the break are rejoined, often with insertion or deletion of nucleotides. Alternatively, DSBs may be repaired by highly homology-directed repair (HDR), in which a DNA template with ends homologous to the break site is supplied and introduced at the site of the DSB.

[0416] SSNs capable of being engineered to generate target nucleic acid sequence-specific DSBs include zinc- finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and clustered regularly interspaced palindromic repeats / CRISPR-associated (CRISPR / Cas) systems.

[0417] ZFN systems are reviewed e.g. in Umov et al., Nat Rev Genet. (2010) 11 (9):636-46, which is hereby incorporated by reference in its entirety. ZFNs comprise a programmable Zinc Finger DNA-binding domain and a DNA-cleaving domain (e.g. a Fokl endonuclease domain). The DNA-binding domain may be identified by screening a Zinc Finger array capable of binding to the target nucleic acid sequence.

[0418] TALEN systems are reviewed e.g. in Mahfouz et al., Plant Biotechnol J. (2014) 12(8):1006-14, which is hereby incorporated by reference in its entirety. TALENs comprise a programmable DNA-binding TALE domain and a DNA-cleaving domain (e.g. a Fokl endonuclease domain). TALEs comprise repeat domains consisting of repeats of 33-39 amino acids, which are identical except for two residues at positions 12 and 13 of each repeat which are repeat variable di-residues (RVDs). Each RVD determines binding of the repeat to a nucleotide in the target DNA sequence according to the following relationship: “HD” binds to C, “Nl” binds to A, “NG” binds to T and “NN” or “NK” binds to G (Moscou and Bogdanove, Science (2009) 326(5959):1501 .).

[0419] CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR associated) systems are prokaryotic adaptive immune system that bind and cleave foreign nucleic acids. In some embodiments, the CRISPR nuclease is selected from Cas9, Cpf1 , Cas12b (C2c1), Cas13a (C2c2), Cas13b (C2c6), and C2c3. CRISPR / Cas9 and related systems e.g. CRISPR / Cpf1 , CRISPR / C2c1 , CRISPR / C2c2 and CRISPR / C2c3 are reviewed e.g. in Nakade et al., Bioengineered (2017) 8(3):265-273, which is hereby incorporated by reference in its entirety. These systems comprise an endonuclease (e.g. Cas9, Cpf1 etc.) and the single-guide RNA (sgRNA) molecule. The sgRNA can be engineered to target endonuclease activity to nucleic acid sequences of interest. The step of curing an endogenous plasmid may comprise: (i) modifying the microorganism to express an antitoxin, and (ii) modifying an endogenous plasmid in the microorganism. In some embodiments, the step of curing an endogenous plasmid comprises the use of a dual plasmid system described herein.

[0420] In some embodiments, modifying an endogenous plasmid in the microorganism comprises knocking out the endogenous plasmid. In some embodiments, modifying an endogenous plasmid in the microorganism comprises the cleavage of the endogenous plasmid. In some embodiments, modifying an endogenous plasmid in the microorganism results in degradation of the endogenous plasmid.

[0421] Modifying an endogenous plasmid in the microorganism may comprise the activity of an SSN (sequencespecific nuclease). In some embodiments, modifying an endogenous plasmid in the microorganism comprises the activity of a CRISPR / Cas, ZFN, and / or TALEN system. In some embodiments, modifying an endogenous plasmid in the microorganism comprises the activity of CRISPR / Cas9.

[0422] A dual plasmid system may be utilised in the curing of an endogenous plasmid. A dual plasmid system comprises a first plasmid and a second plasmid, wherein the first and second plasmids are not identical.

[0423] In some embodiments, the dual plasmid system comprises a first plasmid comprising a polynucleotide which encodes a nuclease. In some embodiments, the nuclease is an endonuclease. In some embodiments, the nuclease is an SSN. In some embodiments, the nuclease is a Cas protein. In some embodiments, the nuclease is a Cas9 protein.

[0424] In some embodiments, the dual plasmid system comprises a second plasmid comprising a polynucleotide which guides the nuclease of the first plasmid. In some embodiments, the dual plasmid system comprises a second plasmid comprising a polynucleotide which encodes an antitoxin, and a polynucleotide which guides the nuclease of the first plasmid. In some embodiments, the polynucleotide which guides the nuclease of the first plasmid encodes a guide RNA (gRNA). In some embodiments, the gRNA is a Cas gRNA. In some embodiments, the gRNA is a Cas9 gRNA.

[0425] In some embodiments, the dual plasmid system comprises a plasmid comprising a polynucleotide which encodes an antitoxin. In some embodiments, the dual plasmid system comprises a first plasmid comprising a polynucleotide which encodes an antitoxin. In some embodiments, the dual plasmid system comprises a second plasmid comprising a polynucleotide which encodes an antitoxin.

[0426] In some embodiments, the first plasmid comprises a nucleic acid sequence having at least 40% sequence identity to SEQ ID NO:12. In some embodiments, the first plasmid comprises a nucleic acid sequence having at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to the nucleic acid sequence of SEQ ID NO:12.

[0427] In some embodiments, the second plasmid comprises a nucleic acid sequence having at least 40% sequence identity to SEQ ID NO:17. In some embodiments, the second plasmid comprises a nucleic acid sequence having at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to the nucleic acid sequence of SEQ ID NO:17.

[0428] In some embodiments, the first plasmid is pQ08. In some embodiments, the second plasmid is pSEVA241-hbpB-antitoxin. In some embodiments, the first plasmid is pQ08 and the second plasmid is pSEVA241-hbpB-antitoxin.

[0429] In some embodiments, the dual plasmid system is subsequently cured in the conventional way. Conventional methods of curing plasmids are well known by the skilled person. In some embodiments, the dual plasmid system is cured after the endogenous plasmid has been cured.

[0430] As noted above, a method is provided for modifying a halophilic microorganism comprising an endogenous plasmid. In some embodiments, the method comprises: (i) curing an endogenous plasmid from the microorganism, and (ii) modification of the microorganism to express a recombinant plasmid. The recombinant plasmid of step (ii) may comprise one or more genes encoding a toxin-antitoxin system, and a gene encoding an enzyme. In some embodiments, the toxin-antitoxin system is a toxin-antitoxin system described herein. In some embodiments, the enzyme is an enzyme described herein. In some embodiments, the recombinant plasmid is a plasmid described herein or a plasmid derived from a plasmid described herein.

[0431] Methods of modifying a halophilic microorganism may comprise the introduction of a nucleic acid and / or vector according to the present disclosure into halophilic microorganism. In some embodiments, introducing a nucleic acid or vector according to the present disclosure into a cell comprises transformation, transfection, electroporation, conjugation, or transduction. In some embodiments, the nucleic acid or vector is a heterologous nucleic acid or a heterologous vector. In some embodiments, the nucleic acid or vector is a recombinant nucleic acid or a recombinant vector.

[0432] A nucleic acid and / or vector (e.g., a recombinant plasmid) may be introduced into the halophilic microorganism through any method known in the art. In some embodiments, a nucleic acid is introduced into the halophilic microorganism through a method of transformation. In some embodiments, a recombinant plasmid according to the present disclosure is introduced into the halophilic microorganism through a method of transformation.

[0433] A nucleic acid and / or vector (e.g., a recombinant plasmid) may be introduced into the halophilic microorganism through any method known in the art. In some embodiments, a nucleic acid is introduced into the halophilic microorganism through a method of conjugation. In some embodiments, a recombinant plasmid according to the present disclosure is introduced into the halophilic microorganism through a method of conjugation. Numerous types of conjugation and transformation are well-known to the skilled person. In some embodiments, method comprises the transfer of nucleic acids through conjugation. Conjugation has been widely used for plasmid-based transformation of halophilic microorganisms such as Halomonas.

[0434] General definitions

[0435] As used herein, a “fragment”, “variant” or “homologue” of a protein may optionally be characterised as having at least 50%, preferably one of 60%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity to the amino acid sequence of the reference protein. Fragments, variants, isoforms and homologues of a reference protein may be characterised by the ability to perform a function performed by the reference protein.

[0436] As used herein, a polynucleotide / protein / plasmid derived from a polynucleotide / protein / plasmid may optionally be characterised as having at least 50%, preferably one of 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the nucleic acid or amino acid sequence of the reference polynucleotide / protein / plasmid from which is derived.

[0437] Pairwise and multiple sequence alignment for the purpose of determining percent identity between two or more amino acid or nucleic acid sequences can be achieved in various ways known to a person of skill in the art, for instance, using publicly available computer software such as ClustalOmega (Soding, J. 2005, Bioinformatics 21 , 951-960), T-coffee (Notredame et al. 2000, J. Mol. Biol. (2000) 302, 205-217), Kalign (Lassmann and Sonnhammer 2005, BMC Bioinformatics, 6(298)) and MAFFT (Katoh and Standley 2013, Molecular Biology and Evolution, 30(4) 772-780 software. When using such software, the default parameters, e.g. for gap penalty and extension penalty, are preferably used.

[0438] A “fragment” generally refers to a fraction of the reference protein. A “variant” generally refers to a protein having an amino acid sequence comprising one or more amino acid substitutions, insertions, deletions or other modifications relative to the amino acid sequence of the reference protein, but retaining a considerable degree of sequence identity (e.g. at least 60%) to the amino acid sequence of the reference protein. An “isoform” generally refers to a variant of the reference protein expressed by the same species as the species of the reference protein. A “homologue” generally refers to a variant of the reference protein produced by a different species as compared to the species of the reference protein.

[0439] A “fragment” of a reference protein may be of any length (by number of amino acids), although may optionally be at least 25% of the length of the reference protein (that is, the protein from which the fragment is derived) and may have a maximum length of one of 50%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the length of the reference protein.

[0440] A fragment of a polypeptide may have a minimum length of one of 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 amino acids, and may have a maximum length of one of 15, 20, 25, 30, 40, 50, 100, 110, 120 or 130 amino acids. Sequence identity

[0441] Pairwise and multiple sequence alignment for the purpose of determining percent identity between two or more amino acid or nucleic acid sequences can be achieved in various ways known to a person of skill in the art, for instance, using publicly available computer software such as ClustalOmega (Soding, J. 2005, Bioinformatics 21 , 951-960), T-coffee (Notredame et al. 2000, J. Mol. Biol. (2000) 302, 205-217), Kalign (Lassmann and Sonnhammer 2005, BMC Bioinformatics, 6(298)) and MAFFT (Katoh and Standley 2013, Molecular Biology and Evolution, 30(4) 772-780 software. When using such software, the default parameters, e.g. for gap penalty and extension penalty, are preferably used. The presentation of plasmid sequences herein may denote gene sequences as upper case letters, and other plasmid components are represented by lower case letters.

[0442] Sequences

[0443] The features disclosed in the foregoing description, or in the following claims, or in the accompanying drawings, expressed in their specific forms or in terms of a means for performing the disclosed function, or a method or process for obtaining the disclosed results, as appropriate, may, separately, or in any combination of such features, be utilised for realising the invention in diverse forms thereof.

[0444] While the invention has been described in conjunction with the exemplary embodiments described above, many equivalent modifications and variations will be apparent to those skilled in the art when given this disclosure. Accordingly, the exemplary embodiments of the invention set forth above are considered to be illustrative and not limiting. Various changes to the described embodiments may be made without departing from the spirit and scope of the invention.

[0445] For the avoidance of any doubt, any theoretical explanations provided herein are provided for the purposes of improving the understanding of a reader. The inventors do not wish to be bound by any of these theoretical explanations.

[0446] Any section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

[0447] Throughout this specification, including the claims which follow, unless the context requires otherwise, the word “comprise” and “include”, and variations such as “comprises”, “comprising”, and “including” will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

[0448] It must be noted that, as used in the specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Ranges may be expressed herein as from “about” one particular value, and / or to “about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by the use of the antecedent “about,” it will be understood that the particular value forms another embodiment. The term “about” in relation to a numerical value is optional and means for example + / - 10%. Examples

[0449] Example 1 - Citramalate clones

[0450] Three plasmids were generated: pSEVA434-tac-cimA (SEQ ID N0:9), pSEVA434-T7-cimA (SEQ ID NO:10), and pSEVA434-T7-empty (SEQ ID N0:11). Plasmid maps are shown in Figure 1.

[0451] The plasmid backbone of pSEVA434 includes the machinery required for bacterial conjugation. The pSEVA434-T7-empty plasmid is a base vector. Both pSEVA434-tac-cimA and pSEVA434-T7-cimA plasmids include the CimA 3.7 citramalate synthase gene (SEQ ID NO:4), described by Atsumi and Liao (Appl Environ Microbiol. 2008 Dec; 74(24): 7802-7808). The gene was cloned with the IPTG-inducible / - / a / omonas-specific T7-like MMP1 or the tac promoter.

[0452] Transformations were performed to introduce the plasmids into host cells - pSEVA434-tac-cimA, pSEVA434-T7-cimA, and pSEVA434-T7-empty were separately introduced into E. coli SM10. pSEVA434- T7-cimA was introduced into H. bluephagenesis TD1 .0. Appropriate expression was confirmed, and glycerol stocks were generated for later use.

[0453] Culture growth

[0454] The clones retrieved from the glycerol stocks and plasmid stocks are listed in Table 1.1 below:

[0455] Table 1.1 Citramalate strains and plasmids retrieved from glycerol stock.

[0456] Plasmid Strain Comments pSEVA434-tac-cimA E. coli SM10 IPTG-inducible pSEVA434-T7-cimA E. coli SM10 IPTG-inducible pSEVA434-T7-empty E. coli SM10 Base vector - no insert pSEVA434-T7-cimA Halomonas TD1 .0 IPTG-inducible pSEVA434-T7-cimA - Plasmid only

[0457] Culture medium: LB agar pH 7.0: Tryptone 10 g / L; yeast extract 5 g / L; NaCI 10 g / L; agar 15 g / L.

[0458] LB60 agar pH 9.0: Tryptone 10 g / L; yeast extract 5 g / L; NaCI 60 g / L; agar 15 g / L.

[0459] Antibiotic: 50 pg / mL spectinomycin (final concentration)

[0460] A loopful of each glycerol stock in Table 1 .1 was streaked onto spectinomycin-containing agar plates specific for E. coli (LB pH 7) and H. bluephagenesis TD1 .0 (LB60 pH 9), respectively. The plates were incubated for up to 2 days at 37 °C.

[0461] Sub-culturing for plasmid preparation

[0462] Culture medium: LB pH 7.0: Tryptone 10 g / L; yeast extract 5 g / L; NaCI 10 g / L.

[0463] LB60 pH 9.0: Tryptone 10 g / L; yeast extract 5 g / L; NaCI 60 g / L.

[0464] Antibiotic: 50 pg / mL spectinomycin (final concentration) Cultures of each E. coli and H. bluephagenesis clone in Table 1.1 were generated and inoculated from the respective agar plate. The plates were cultivated overnight at 37 ° C.

[0465] Results

[0466] Both the E. coli SM10 and H. bluephagenesis TD1 .0 versions of pSEVA434-T7-cimA and pSEVA434-tac- cimA were retrieved from glycerol stocks and cultivated. After overnight cultivation of the three E. coli clones on LB agar all three cultures had grown, and plasmids were purified. Each plasmid sample was then sequenced for confirmation, and further glycerol stocks were produced.

[0467] Example 2 - Growth of H. bluephagenesis pSEVA434-T7-cimA

[0468] Culture growth

[0469] Culture medium: LB60 pH 9.0: Tryptone 10 g / L; yeast extract 5 g / L; NaCI 60 g / L.

[0470] Antibiotic: 50 pg / mL spectinomycin (final concentration)

[0471] Glycerol stocks of H. bluephagenesis TD 1 .0 containing pSEVA434-T7-cimA plasmid were scraped with a pipette tip and the cell mass was resuspended in 5 mL LB60 pH 9.0 containing 100 pg / mL spectinomycin. The cultures were incubated at 30 °C with 180 rpm agitation. These cultures were used as inoculums for 100 mL LB60 pH 9 containing 100 pg / mL spectinomycin. The starting inoculum CD600 nm was set to -0.05 by varying how much inoculum was added.

[0472] Cultures were incubated at 30 °C with 180 rpm agitation for 72 h. CimA production was induced after 24 h by the addition of 0.01 mM IPTG, as suggested by prior studies (results not shown). Periodic culture sampling was performed and the GD600 nm was recorded.

[0473] Citramalate quantitation

[0474] Culture samples were taken periodically and microcentrifuged at 13,000 rpm for 1 min to retain the supernatant. The citramalate content of the supernatants was determined by HPLC using an Agilent 1260 Infinity HPLC with a 1260 ALS autosampler, a TCC SL column heater and a 1260 refractive index detector. Culture supernatant aliquots (20 pL) were injected into an Agilent Hi-Plex H column (7.7 x 300 mm, 8 pm) using 0.0025 M H2SO4 as the mobile phase (0.5 mL / min). The run was performed at 60 °C for 40 min with the Rl detector set to 55 °C (retention time of 10 min). Analyte concentrations were calculated by comparing the peak areas to a standard curve (Figure 2A) generated from analytical standards of known concentrations.

[0475] Results and Discussion

[0476] A total of four individual cultures were cultivated from glycerol stocks. Each culture grew at 30 °C in a very similar manner, reaching a maximal CD600 of -6 after 72 h without feeding or pH control (Figure 2B).

[0477] Periodic culture sampling was performed and the citramalate concentration was determined. The titres of citramalate varied throughout the fermentation and between flask culture, even though the growth was very similar in each flask. The highest citramalate titre detected was around 1 .4 g / L after 72 h (Figure 2C). Example 3 - Citramalate production from glycerol by Halomonas

[0478] Prior to H. bluephagenesis TD1.0 fermentative citramalate production, inventors aimed to identify more optimal growth conditions. Flask culture experiments were performed. In this experiment, the culture pH, temperature and incubation time remained constant. Variables included the composition of the mineral medium base, carbon and nitrogen sources and the IPTG concentration.

[0479] An additional consideration was to consider cultivations using tap water instead of Reverse Osmosis (RO) purified water to reduce the cost of subsequent processes. However, the impacts of tap water on cell culture and media preparation was unknown and potentially problematic.

[0480] Culture medium composition

[0481] Culture medium: LB60 pH 9.0: Tryptone 10 g / L; yeast extract 5 g / L; NaCI 60 g / L.

[0482] A modified MM63 culture medium was designed that utilised with glycerol as the sole carbon source (Table 3.1). Table 3.1 below shows the actual concentrations used in the culture medium.

[0483] Table 3.1 Modified mineral-based medium pH 8.5 for H. bluephagenesis TD1.0 cultivation.

[0484] Chemical g / L Stock Volume per L

[0485] NaCI 60

[0486] KH2PO413.6

[0487] KOH 4.21

[0488] Nitrogen Source * 1 .98

[0489] Fe(NH4)2(SO4)2.6H2O 0.0019607 5 mM 1000 uL

[0490] MgSO4.7H2O 0.12037 1 M 1000 uL

[0491] CaCI2.6H2O 0.00055 5 mM 1000 uL

[0492] Glycerol 4

[0493] *Three nitrogen sources were trialled here: (NH4)2SO4, urea or yeast extract, all at 1.98 g / L.

[0494] The pH of the medium was adjusted to 8.5 with 5 M NaOH, not 9.0 as prior studies showed that precipitation occurred at pH >8.5 (results not shown).

[0495] Three different nitrogen sources were trialled at 1 .98 g / L: (NH4)2SO4, urea, and yeast extract.

[0496] In some experiments, the following 1000 x stock solution of trace element solution was added.

[0497] Table 3.2 1000 x stock solution of trace element

[0498] Chemical Concentration (g / L) Final concentration (mM)

[0499] Boric acid H3BO3 2.86 46

[0500] MnCI2.4H2O 1.81 9

[0501] ZnSO4.7H2O 0.22 0.77 Na2MoO4.2H2O 0.39 1.6

[0502] CuSO4.5H2O 0.079 0.3

[0503] CO(NO3)2.6H2O 0.0494 0.17

[0504] The following IPTG concentrations were trialled to induce the production of cimA: 0 mM, 0.001 mM, 0.01 mM, 0.1 mM and 1 mM.

[0505] Medium preparation trials

[0506] Standard MM63-based medium

[0507] MM63-based medium was prepared as indicated in Table 3.1 using RO water, in the absence of any nitrogen source. In this case, 1 .2 L base medium was prepared without the nitrogen source and adjusted to pH 8.5. Two aliquots of 170 mL each were added to 2 x 250 mL duran bottles. One bottle was supplemented with alternative nitrogen sources 1 .98 g / L (NH4)2SO4and the other with 1 .98 g / L yeast extract. The remaining 860 mL base medium was supplemented with urea (1 .98 g / L). All three culture media were autoclaved.

[0508] Tap MM63-based medium

[0509] Tap-water-based MM63 medium (Table 3.1) was prepared as described above for the standard RO-water based medium. In this case, the urea-containing MM63 medium was prepared and autoclaved without the urea present. The urea stock solution was filter sterilised and added after autoclaving.

[0510] Standard MM63-based medium with filter sterilising

[0511] A third set of media were prepared using the MM63 recipe (Table 3.1) in RO water. In this case, filter sterilised stocks of the following components were made: Fe(NH4)2(SO4)2, MgSO4, CaCI2, M63 trace elements and (NH4)2SO4or urea or yeast extract. These were added after autoclaving of the remaining ingredients in RO water.

[0512] All media was supplemented with 100 pg / mL streptomycin prior to cultivations.

[0513] Cultivations

[0514] Glycerol stocks of H. bluephagenesis TD 1 .0 containing pSEVA434-T7-cimA plasmid were scraped with a pipette tip and the cell mass was resuspended in 5 mL LB60 pH 9.0 containing 100 pg / mL spectinomycin. The cultures were incubated at 30 °C with 180 rpm agitation. These cultures were used as inoculums for 100 mL LB60 pH 9 containing 100 pg / mL spectinomycin. In total, eleven 5 mL starter cultures were inoculated.

[0515] The main flask cultures contained 50 mL MM63-based medium with 100 pg / mL streptomycin made up in RO water with some chemicals added after autoclaving. Each flask was inoculated with 2 mL of overnight starter culture. Flasks were set up in triplicate for each growth condition. Cultures were incubated at 37 °C for 88 h with 180 rpm agitation. No feeding or pH control was implemented. Each culture was induced (unless otherwise indicated) at the concentrations indicated in Table 3.3 at 22 h. Periodic culture sampling was performed and the OD 600 nm was recorded.

[0516] The following Table 3.3 shows the growth and induction conditions of the flasks:

[0517] Table 3.3 Differences in the nitrogen source and IPTG concentration between cultures.

[0518] Sample name Nitrogen source IPTG concentration (mM)

[0519] CMHal0004.1 (NH4)2SO4 0.1

[0520] CMHal0004.2 Yeast extract 0.1

[0521] CMHal0004.3 Urea 0.1

[0522] CMHal0004.4 Urea 0

[0523] CMHal0004.5 Urea 0.001

[0524] CMHal0004.6 Urea 0.01

[0525] CMHal0004.8 Urea 1

[0526] Citramalate quantitation

[0527] Culture samples were taken periodically and microcentrifuged at 13,000 rpm for 10 min to retain the supernatant. The citramalate content of the supernatants was determined by HPLC using an Agilent 1260 Infinity HPLC as described previously (Example 2). Analyte concentrations were calculated by comparing the peak areas to a standard curve (Figure 2A) generated from analytical standards of known concentrations.

[0528] Results and Discussion

[0529] Culture medium precipitation

[0530] Initial MM63 medium preparation attempts resulted in salt precipitation, even in RO water. The degree of precipitation / crystallisation depended on the water source (RO or tap water) and the nitrogen source. Further trials showed that eliminating the nitrogen source from the base medium prevented precipitation during autoclaving when making up media in RO water.

[0531] Culture medium made up in tap water showed further precipitation, even under conditions that didn’t precipitate in RO water growth medium. This suggests water contaminants are reacting with medium components leading to precipitation during autoclaving. To minimise this happening, further chemicals with a tendency to precipitate were eliminated from the base medium and added as a filter sterilised stock after autoclaving (Fe(NH4)2(SO4)2, MgSO4,CaCl2, M63 trace elements and nitrogen sources). The medium chosen for cultivation in flasks was based on RO water, with the nitrogen source added after autoclaving.

[0532] Optimal growth conditions

[0533] Results are shown in Table 3.4. The presence of different nitrogen sources showed an impact on the growth of H. bluephagenesis (Figure 3A). The highest growth was seen in cultures containing yeast extract. This is likely due to the fact that yeast extract is also a supplementary carbon source for H. bluephagenesis. In each case, after ~24 h the biomass density declined, likely due to the culture running out of glycerol. The steepest decline in growth after 88 h was for cultures grown in urea.

[0534] Each of the cultures shown in Figure 3B were induced with 0.1 mM IPTG. Further cultivations were performed using urea as the nitrogen source and IPTG concentrations ranging from 0 to 1 mM. The cultures showed a remarkably similar growth profile no matter what the IPTG concentration was (Figure 3B).

[0535] It was noted that the cultures containing urea showed significant precipitation at the 88 h time point. This may be pulling down cells, affecting the OD 600 nm readings.

[0536] Citram alate production

[0537] Each sample taken during cultivation was also tested for citramalate production by HPLC analysis (Table 3.5). The analysis was complicated by the presence of large contaminating peaks, one of which overlaps partially with the citramalate peak. Therefore, the citramalate production data is an approximation of the actual titres achieved (Table 3.5).

[0538] Table 3.4 Citramalate peak areas of 21 flask cultures in 7 different media over 88 h cultivation. Table 3.5 Citramalate production of 21 flask cultures in 7 different media over 88 h cultivation.

[0539] Cultures containing (NH4)2SO4 and yeast extract showed similar citramalate production profiles (Figure 3C). Production apparently peaked around 66 h, followed by a slight decline afterwards. In contrast, citramalate production continued until the end of cultivation in cultures containing urea as the carbon source (and 0.1 mM IPTG). This is in spite of the higher drop in optical density of these cultures compared to those with alternative nitrogen sources. Therefore, urea appears to be the best nitrogen source for citramalate production.

[0540] Further cultures were compared that all contained urea as the nitrogen source, but the IPTG concentration varied from 0 to 1 mM. This data showed similar citramalate production titres up to around 66 h, independent on the IPTG concentration (Figure 3D). Surprisingly, citramalate production increased for some cultures beyond this time, even in uninduced cells. This suggests that cultures grown with glycerol as a sole carbon source enable significant leaky expression of the T7-like promoter, so IPTG is not needed to switch on gene production.

[0541] These citramalate titres are not a reflection of the cell density as the OD 600 nm profile of each culture showed they all grew in a similar manner throughout the cultivations (Figure 3B). The differences between the citramalate titres from uninduced (1 .38) to 1 mM IPTG (0.67) show high levels of IPTG actually decrease citramalate production to around half that of uninduced cultures.

[0542] Other differences between the two sets of experiments is shown in Table 3.6. There was a 5-fold difference between the total carbon loadings. This could explain the lower citramalate yields in this experiment, as carbon source supply was exhausted early in the cultivation. There were also differences in the antibiotic and nitrogen source concentrations.

[0543] Table 3.6 Differences between two citramalate experiments

[0544] Conditions Previous experiment Current experiment

[0545] Spectinomycin concentration 50 ug / mL 100 ug / mL

[0546] Substrate Glucose (20 g / L) Glycerol (4 g / L)

[0547] IPTG induction 4.5 h 22 h

[0548] Nitrogen source Yeast (1 g / L) Urea (2g / L) Working with complex mineral media and tap water can lead to component precipitation issues. This affects the estimate of cell density, but more importantly it can negatively impact scaled fermentations due to salt residue blocking or interfering with the functioning of valves in the scaled fermenters. This can also impact on the cleaning of fermenters. Precipitation of key components could also potentially affect growth and citramalate production titres by making key chemicals unavailable to the bacteria. Our studies showed precipitation was a problem when autoclaving all the components together, especially when using contaminated tap water. The solution was to eliminate the chemicals causing this precipitation from the base medium prior to autoclaving, and add them back as filter sterilised stocks after sterilisation. An alternative is to fully filter sterilise the culture medium all together, or in the case of Halomonas, not to sterilise at all.

[0549] Studies varying the nitrogen source and IPTG concentration with glycerol as a carbon source showed that growth in urea led to the highest citramalate titres. The culture was relatively insensitive to the IPTG concentration, suggesting scaled cultivations could be performed without IPTG if laboratory grade glycerol is used as the carbon source instead of glucose. Further optimisation is needed to determine the optimal feeding rates for the cultures, to prevent carbon source starvation at the later stages of growth.

[0550] Example 4 - Effect of tap water on MM63 medium solubility

[0551] The systematic elimination of 4 of the major chemicals in MM63 medium identified KH2PO4 as a key component triggering precipitation of salts during autoclaving. This is likely due to the formation of insoluble calcium and / or magnesium salts. This is more apparent when using tap water, as Manchester UK region water contains added phosphate from water treatment plants.

[0552] In this experiment, different components were excluded from the base medium prior to autoclaving to identify which component(s) are contributing to the medium precipitation.

[0553] Medium preparation

[0554] The following is the partial composition of the base MM63 medium (no nitrogen source or trace elements:

[0555] • 60 g NaCI

[0556] 13.6 g KH2PO4

[0557] • 4.21 g KOH (plus additional for pH adjustment)

[0558] 1 mL 1M MgSO4.7H2O

[0559] • 1 mL 5 mM Fe(NH4)2(SO4)2.6H2O solution

[0560] 1 mL 5 mM CaCI2.6H2O

[0561] • 4 g carbon source

[0562] • 1.98 g Urea

[0563] • 1 mL 1000x Trace elements solution

[0564] A set of culture medium was set up with each missing one element as follows (Table 4.1): Table 4.1 Medium components in the modified MM63 base medium tests.

[0565] Medium NaCI KH2PO4 KOH Glycerol

[0566] CMHal0005.1 Yes Yes Yes No

[0567] CMHal0005.2aYes Yes No Yes

[0568] CMHal0005.3bYes No Yes Yes

[0569] CMHal0005.4cNo Yes Yes Yes aUsed NaOH to adjust the pH to 8.5 as KOH was absent. bEssentially unbuffered with variable pH due to the lack of KH2PO4. cMade up in ROwater. Aseptic additions were performed afterwards with sterile stocks of MM63 trace elements, nitrogen source, Fe(NH4)2(SO4)2.6H2O, MgSO4.7H2O and CaCh H2O. This was performed to mimic standard MM63 medium.

[0570] Each culture medium was dissolved, pH adjusted to 8.5 and autoclaved.

[0571] Results and Discussion

[0572] After autoclaving, the only medium that had not precipitated was the one which excluded KH2PO (CMHal0005.3). The precipitation of phosphate salts during autoclaving is a common problem encountered when making up minimal medium. Phosphate buffers form insoluble salts when heated in the presence of calcium or magnesium ions. Culture medium usually contains one or both of these compounds, as does tap water. Therefore, phosphate buffer must not be present in the medium during autoclaving. This component should be added aseptically to the medium as a sterile stock after autoclaving. However, Manchester water contains added phosphate at water treatment plants to precipitate out lead (Pb) or copper (Cu), so this may not be enough to prevent all precipitation.

[0573] Example 5 - Fermentative citramalate production from pure glycerol and crude glycerol

[0574] Culture medium

[0575] LB60 pH 9 - 10 g / L tryptone, 5 g / L yeast extract and 60 g / L NaCI.

[0576] MM63 medium

[0577] • 60 g NaCI

[0578] 13.6 g KH2PO4

[0579] • 4.21 g KOH (plus additional for pH adjustment)

[0580] 1 mL 1 M MgSO4.7H2O

[0581] • 1 mL 5 mM Fe(NH )2(SO )2.6H2O solution

[0582] 1 mL 5 mM CaCI2.6H2O

[0583] • 4 g carbon source

[0584] • 1.98 g Urea

[0585] • 1 mL 1000x Trace elements solution

[0586] MM63 media was prepared using tap water without KH2PO4 and urea and autoclaved. A 10x stock solution of KH2PO was set up and pH adjusted to 8.5. This stock solution was filter sterilised and added with the sterile urea after autoclaving the base medium.

[0587] Culture growth The glycerol stocks were from the C3 -80 °C freezer (C2 vial from TD1 .0 Stocks box - Rack 2 Row 1 : pSEVA434-T7-cimA - H. bluephagenesis - TD 1 .0). Glycerol stocks (six aliquots) were scraped with a pipette tip and the cell mass was resuspended in 5 mL LB60 pH 9.0 containing 50 pg / mL spectinomycin. The cultures were incubated overnight at 37 °C with 180 rpm agitation.

[0588] The main flask cultures contained 50 mL MM63-based medium containing 50 pg / mL streptomycin made up in tap water. Each flask was inoculated with 2 mL of overnight starter culture. Flasks were set up in triplicate for each growth condition. Cultures were incubated at 37 °C for 72 h with 180 rpm agitation. No feeding or pH control was implemented. Two flasks (CMHal0006.3.3 and CMHal0006.4.3) were induced with 0.1 mM IPTG after 18 hours of inoculation (Table 5.1). Periodic culture sampling was performed and the OD 600 nm was recorded.

[0589] The following Table 5.1 shows the growth and induction conditions of the flasks:

[0590] Table 5.1 Differences in the carbon source and presence of trace elements between cultures.

[0591] Sample name Carbon source Trace elements

[0592] CMHal0006.1 Laboratory grade glycerol Yes

[0593] CMHal0006.2 Laboratory grade glycerol No

[0594] CMHal0006.3aBiodiesel waste glycerin Yes

[0595] CMHal0006.4aBiodiesel waste glycerin No aOne of the three replicates of these growth conditions was induced with IPTG after 18 h induction (CMHal0006.3.3 and CMHal0006.4.3).

[0596] Results and Discussion

[0597] Culture growth

[0598] Cultures containing trace elements were more yellowish in colour than those that did not. They also showed a lower CD600 (Table 5.2; Figure 5A). Samples with crude glycerol reached higher CD600 than samples with commercial glycerol. Glycerol content in the crude mix was determined previously by HPLC as 43.5%. Therefore, samples with commercial glycerol were loaded with 9.2 g / L of crude glycerol to have the same concentration of glycerol (4 g / L). However, HPLC results indicate the amount of glycerol present in the samples with crude glycerol at time 0 h was almost 2x higher than samples with pure glycerol. OD 600 nm readings also suggest that there was more glycerol in the crude glycerol than anticipated as the cultures grew better than those with purified glycerol.

[0599] Two of the cultures containing crude glycerol were induced with IPTG. These cultures showed a reduction in growth, as is commonly seen when cultures are induced. Samples without trace elements exhibited higher growth than samples with trace elements (Figure 4A). A possible explanation is that tap water already had enough concentration of the trace elements required and adding more trace elements may results in too high concentrations of these trace elements.

[0600] Citram alate production The majority of cultures were not induced with IPTG, so the citramalate formed is due to leaky expression. The most significant observation from the data (Table 5.2; Figure 4B-4C) was that the presence of trace elements significantly affected the citramalate titres. This is in spite of using tap water that contains many minerals already. There was not much difference in citramalate production between the cultures whether crude or pure glycerol was used, the main difference was whether trace elements were present.

[0601] Table 5.2 Effect of glycerol purity, trace elements and IPTG on citramalate production by H. bluephagenesis TD1 .0.

[0602] Prior experiments (see Example 3) with purified glycerol showed citramalate production was independent of the presence or absence of IPTG. A couple of cultures containing crude glycerol were induced with IPTG to see if a similar effect would occur. In contrast, IPTG significantly increased citramalate production when crude glycerol was present. It is possible that one or more of the contaminants in the biodiesel glycerin has a similar effect as glucose of repressing the production of cimA.

[0603] The combination of crude glycerol, trace elements and IPTG in tap water led to the highest titre of 3.30 g / L in flask cultures. This contrasts with 1 .34 g / L using clean glycerol, no IPTG and trace elements in RO water.

[0604] This Example has shown that both laboratory grade and biodiesel waste glycerin are suitable carbon sources for citramalate production by H. bluephagenesis TD1 .0. Surprisingly, citramalate production is relatively insensitive to IPTG when Halomonas is cultivated with purified glycerol. In contrast, higher titres of citramalate can be obtained when IPTG is added when crude glycerol is obtained.

[0605] Example 6 - Halomonas citramalate production with starch, sucrose and CMC

[0606] Prior to working with starchy food waste, inventors assessed the ability of Halomonas to grow on starch without the need for enzymatic hydrolysis steps. Therefore, growth and citramalate production was assessed using commercially available starch powders made from potato, rice, corn and wheat. Culture medium

[0607] LB60 pH 9 - 10 g / L tryptone, 5 g / L yeast extract and 60 g / L NaCI.

[0608] MM63 media

[0609] 60 g NaCI

[0610] 13.6 g KH2PO4

[0611] 4.21 g KOH (plus additional for pH adjustment)

[0612] 1 mL 1M MgSO4.7H2O

[0613] 1 mL 5 mM Fe(NH4)2(SO4)2.6H2O solution

[0614] 1 mL 5 mM CaCI2.6H2O

[0615] 4 g carbon source

[0616] 1.98 g Urea

[0617] 1 mL 1000x Trace elements solution

[0618] MM63 media (1 L) was prepared using tap water without KH2PO4 and urea, pH adjusted to 8.5 and autoclaved. A 10x stock solution of KH2PO4 was set up and pH adjusted to 8.5. This stock solution was filter sterilised and added with the sterile urea after autoclaving the base medium.

[0619] The carbon sources used in this experiment were:

[0620] • CMHal0007.1 - Potato starch

[0621] • CMHal0007.5 - Sucrose

[0622] • CMHal0007.6 - CMC (carboxymethylcellulose)

[0623] After autoclaving, the medium containing sucrose, CMC and potato starch were fully soluble. Medium containing the three other starch sources contained powdery starch.

[0624] Culture growth

[0625] Glycerol stocks were scraped with a pipette tip and the cell mass was resuspended in 5 mL LB60 pH 9.0 containing 50 pg / mL spectinomycin. The cultures were incubated overnight at 37 °C with 180 rpm agitation.

[0626] The main flask cultures contained 50 mL MM63-based medium containing 50 pg / mL streptomycin made up in tap water. Each flask was inoculated with 2 mL of overnight starter culture. Flasks were set up in triplicate for each growth condition. Cultures were incubated at 37 °C for 72 h with 180 rpm agitation. No feeding or pH control was implemented. Samples of each culture were taken every 24 h for 3 days and the CD 600 nm was measured to monitor culture growth (only an approximation for medium containing insoluble starch).

[0627] Citramalate quantitation

[0628] Culture samples were taken periodically and micro-centrifuged at 13,000 rpm for 10 min to retain the supernatant. The citramalate and glucose content of the supernatants were determined by HPLC using an Agilent 1260 Infinity HPLC as described previously (Example 2). Analyte concentrations were calculated by comparing the peak areas to standard curves generated from analytical standards of known concentrations. The standard curves for citramalate and glucose are shown in Figure 2A and Figure 5A, respectively.

[0629] Results and Discussion

[0630] Culture growth

[0631] The cultures containing soluble sucrose grew very well, reaching an OD 600 nm of over 3 after 47 h, before declining to around 2 after 66 h (Table 6.1 ; Figure 5B). Samples supplemented with potato starch and CMC showed only poor growth during the first 18 hours, with no further growth thereafter. As Halomonas is not expected to grow on these carbon sources, this initial poor growth may be due to the presence of residual carbon source in the LB60 starter culture.

[0632] Table 6.1 Optical density of culture samples.

[0633] OD 600 nm

[0634] Carbon source O h 18 h 47 h 66 h

[0635] Potato starch 1 0.0493 0.392 0.317 0.376

[0636] Potato starch 2 0.0462 0.398 0.337 0.321

[0637] Potato starch 3 0.0476 0.406 0.327 0.329

[0638] Sucrose 1 0.0447 2.116 3.28 2.55

[0639] Sucrose 2 0.0452 2.050 3.11 2.424

[0640] Sucrose 3 0.0418 1.952 3.28 2.43

[0641] CMC 1 0.0602 0.324 0.3 0.329

[0642] CMC 2 0.0600 0.361 0.2777 0.355

[0643] CMC 3 0.0574 0.324 0.272 0.326

[0644] Optical densities for cultures containing insoluble carbon sources are estimations only.

[0645] This shows that sucrose is an excellent carbon source for H. bluephagenesis, while polymeric glucose sources (starch and cellulose) are not significantly degraded. Therefore, when utilising the latter two carbon sources they must first be degraded to their monomeric glucose before they can support significant growth of Halomonas.

[0646] Citramalate production

[0647] Citramalate production was detected only in cultures grown on sucrose (Table 6.2; Figure 5C). The maximum citramalate titres were around 1 .6 g / L, which is similar to growth on glucose and glycerol.

[0648] Table 6.2 Citramalate production by H. bluephagenesis TD1 .0 pSEVA434-T7-cimA cultivated on three different carbon sources.

[0649] Citramalate (g / L)

[0650] Carbon source O h 18 h 47 h 66 h

[0651] Potato starch 1 0 0 0 0 Potato starch 2 0 0 0 0

[0652] Potato starch 3 0 0 0 0

[0653] Sucrose 1 0 0.74 1.55 1.55

[0654] Sucrose 2 0 0.73 1.63 1.66

[0655] Sucrose 3 0 0.66 1.61 1.54

[0656] CMC 1 0 0 0 0

[0657] CMC 2 0 0 0 0

[0658] CMC 3 0 0 0 0

[0659] These results show that there is potential to use whole sugar beet as a carbon source, rather than just trying to recover glucose from sugar beet pulp cellulose. This will depend on the efficiency of extraction of the sucrose (and potentially also the molasses syrup residue) from the fibrous peak. The data also confirmed that polymeric glucose (starch and cellulose) require pre-treatment steps to release the glucose before Halomonas can use it as an efficient carbon source.

[0660] Citramalate production was only seen in cultures that grew well. Sucrose was found to be an excellent carbon source for H. bluephagenesis TD1 .0, but it could not grow significantly on starch and cellulose derivative CMC. Data provide a benchmark for later starch / cellulose hydrolysis experiments, and opens the possibility of utilising the whole sugar beet root as a carbon source rather than just the sugar beet pulp cellulose component. Prior studies showed H. bluephagenesis TD1 .0 can grow on fructose (Zhang etal. 2020. J Biotechnol. 316:1-5). Therefore, Halomonas is believed to contain the genes necessary to hydrolyse sucrose into glucose and fructose, followed by degradation to release energy and carbon for cellular growth.

[0661] Example 7 - Halomonas citramalate production from glucose

[0662] It was shown in Example 3 that recombinant Halomonas is capable of citramalate production when grown on with a glycerol carbon source, in some cases without requiring IPTG for cimA production. Example 3 also investigated modifications to traditional Halomonas growth medium, such as using tap water, the requirement for trace elements, and the impact of alternative nitrogen sources. In this Example, similar cultivations were performed in flasks using glucose as the carbon source instead of glycerol.

[0663] Glucose is a known inhibitor of one promoter used in the current study (MMP1 T7-like system), so the optimal IPTG concentration needs to be determined. The culture medium was standardised to be made up in tap water and to include urea as the nitrogen source.

[0664] Growth medium

[0665] LB60 pH 9.0: Tryptone 10 g / L; yeast extract 5 g / L; NaCI 60 g / L.

[0666] Fortified MM63 medium

[0667] 60 g NaCI

[0668] 13.6 g KH2PO4 • 4.21 g KOH (plus additional for pH adjustment)

[0669] • 1 mL Trace Element Solution (1000x)

[0670] 1 mL 1M MgSO4.7H2O

[0671] • 0.5 mL 50mM Fe(NH4)2(SO4)2.6H2O solution

[0672] 0.5 mL 50mM CaCI2.6H2O

[0673] • 4g Glucose

[0674] • 1.98 g Urea

[0675] The medium was made up in tap water to 1 L and the pH was adjusted to 9 with 5M KOH.

[0676] Culture growth

[0677] Glycerol stocks were scraped with a pipette tip and the cell mass was resuspended in 10 mL LB60 pH 9.0 containing 100 pg / mL spectinomycin. The cultures were incubated overnight at 37 °C with 180 rpm agitation.

[0678] The main flask cultures contained 50 mL MM63-based medium containing 100 pg / mL streptomycin made up in tap water. Each flask was inoculated with 2 mL of overnight starter culture. Flasks were set up in triplicate for each growth condition. Cultures were incubated at 37 °C for 72 h with 180 rpm agitation. Cultures were induced with IPTG after 22 h growth. The range of IPTG concentration used was: 0 mM, 0.001 mM, 0.01 mM, 0.1 mM and 1 mM. No feeding or pH control was implemented. Samples of each culture were taken every 24 h for 114 h (~4.5 days) and the CD 600 nm was measured to monitor culture growth.

[0679] Citramalate quantitation

[0680] Culture samples were taken periodically and micro-centrifuged at 13,000 rpm for 10 min to retain the supernatant. The citramalate and glucose content of the supernatants were determined by HPLC using an Agilent 1260 Infinity HPLC as described previously (Example 2). Analyte concentrations were calculated by comparing the peak areas to standard curves generated from analytical standards of known concentrations. The standard curves for citramalate and glucose are shown in Figure 2A and Figure 5A, respectively.

[0681] Results and Discussion

[0682] Culture growth

[0683] The effect of IPTG concentration on growth was minor. Each culture showed the typical growth profile for cultures grown with urea as the carbon source over prolonged time periods (Table 7.1 ; Figure 6A). The highest optical density achieved was around 4, which was similar to growth on crude glycerol in the absence of trace elements (Figure 4A).

[0684] Table 7.1 Effect of IPTG concentration on the growth of H. bluephagenesis TD1 .0 containing pSEVA434- T7-cimA.

[0685] OD 600 nm

[0686] Citram alate production

[0687] Citramalate production occurred with all cultures. The highest levels (0.8-0.9 g / L) occurred when the IPTG concentration was between 0.01-1 mM (Figure 6B). Citramalate titres were reduced around fourfold when no IPTG was present. This is in contrast to cultures grown on laboratory grade glycerol, which did not require IPTG to generate citramalate.

[0688] IPTG concentration shows only a minimal impact on the growth of H. bluephagenesis TD1 .0 in MM63 media with glucose as the carbon source. Citramalate production was optimal when the IPTG concentration was at least 0.01 mM. This is in contrast with growth on glycerol, where the highest citramalate titres were obtained when no IPTG was present.

[0689] Halomonas bluephagenesis TD1 .0 has a native plasmid that is maintained without any antibiotic selection. This is due to the presence of a toxin-antitoxin system on the plasmid. The genes, hbpB / hbpC (antitoxin and toxin respectively), have a single promotor driving the synthesis of their respective proteins. The key to this system is the inability of the antitoxin to suppress the toxin without continual expression, due to the antitoxin having a shorter life span than the toxin. Therefore, residual toxin left after plasmid elimination can kill the cell.

[0690] Inventors have modified this Halomonas bluephagenesis TD1 .0 native plasmid to generate a hybrid plasmid for citramalate production in the absence of antibiotic selection. Prior to inserting a hybrid plasmid, H. bluephagenesis TD1 .0 needs to be ‘cured’ of its native plasmid. Inventors designed a dual plasmid CRISPR-Cas9 system to cure the H. bluephagenesis TD1 .0 of its native plasmid, which utilises CRISPR-Cas9 plasmid pQ08 and pSEVA241-hbpB-antitoxin. This Example provides details of pQ08 and the design and construction of the pSEVA241-hbpB-antitoxin plasmid.

[0691] Two changes were made to a donor plasmid to arrive at pSEVA241-hbpB-antitoxin. This involved inserting the antitoxin gene hbpB with its constitutive promoter and changing the gRNA so the target DNA cleavage site was the endogenous plasmid instead of H. bluephagenesis genomic DNA. This newly constructed pSEVA241-hbpB-antitoxin plasmid suitable for use in H. bluephagenesis endogenous plasmid curing.

[0692] Plasmid design

[0693] CRISPR-Cas9 plasmid pQ08

[0694] A plasmid map for pQ08 is shown in Figure 7A, and the plasmid has a DNA sequence of SEQ ID NO:12. This plasmid contains the genes for the Cas9 protein and chloramphenicol resistance. It is a modified plasmid allowing it to enter into H. bluephagenesis by conjugation via E. coli S17-1 strain. This plasmid was previously assembled, and does not require any modifications.

[0695] Donor plasmid: pSEVA241-phaC-delete

[0696] An existing pSEVA241-phaC-delete plasmid was chosen as a donor plasmid for the construction of pSEVA241-hbpB-antitoxin. The pSEVA241-phaC-delete plasmid was designed to contain the genomic phaC gene homology arms without any insert present, to enable the excision of the phaC gene from the genome of H. bluephagenesis TD1 .0. It also contains two antibiotic resistances for kanamycin and spectinomycin, which is needed for plasmid selection and maintenance in E. coli S17-1 donor strain and H. bluephagenesis TD1 .0, respectively. It contains the sequence for a guide RNA required for Cas9 function.

[0697] A plasmid map for pSEVA241-phaC-delete is shown in Figure 7B, and the plasmid has a DNA sequence of SEQ ID NO:13.

[0698] This pSEVA241-phaC-delete plasmid needed to be modified so that the target DNA to be cleaved is within the endogenous plasmid, not the genomic phaC gene of H. bluephagenesis TD1 .0. This process requires a single cut, without the insertion or deletion of any DNA. Therefore, no homology arms are required. In addition, the antitoxin gene hbpB needs to be inserted with its native constitutive promoter to allow H. bluephagenesis TD1 .0 to survive double strand cleavage and subsequent loss of the endogenous plasmid. pSEVA241-donor-HbpB design a) HbpB insertion:

[0699] The existing donor plasmid (pSEVA241-phaC-delete) does not contain the antitoxin gene. This gene (SEQ ID NO:14) and its constitutive promoter (SEQ ID NO:15) were inserted into the pSEVA241-phaC- delete plasmid. This was completed by InFusion cloning, where the promoter-hbpB gene insertion occurred in place of the existing homology arms (HL-QQ).

[0700] PCR primers pSEVA241_forward and pSEVA241_reverse (Table 8.1) were designed to flank the HL-QQ homology arms of the pSEVA241-phaC-delete plasmid. PCR amplification enables the generation of a linear sequence without the presence of the homology arms. A second set of PCR primers pSEVA241- HbpB_forward and pSEVA241-HbpB_reverse (Table 8.1) were designed to amplify the promoter-hbpB gene from the native plasmid pHbCP. These primers contain 15 bp overhangs (in italics) for annealing to the linearised pSEVA241-phaC-delete plasmid during InFusion cloning.

[0701] Table 8.1 PCR primers used for constructing plasmid pSEVA241-donor-HbpB.

[0702] Name Sequence

[0703] Linearisation of pSEVA241-phaC delet plasmid pSEVA241_forward GTCGTGACTGGGAAAACCCT (SEQ ID NO:32) pSEVA241_reverse GGTACCCCGGGTTCAAAA (SEQ ID NO:33)

[0704] Amplification of hbpB and its promotor from the endogenous plasmid pHbPBC pSEVA241-HbpB_forward TGAACCCGGGGTACC7TAAAAACTCAAGATAATGAGGATAAT (SEQ ID NO:34) pSEVA241-HbpB_reverse TTTCCCAGTCACGACTTACAGATATTCCTCTGTGATCAAC (SEQ ID NO:35)

[0705] Linearisation of pSEVA241-phaC delet plasmid and addition ofgRNA mutations pSEVA241_guide_forward tcaataccgatgtatgcgtaGTTTTAGAGCTAGAAATAGCAAG (SEQ ID NO:36) pSEVA241_guide_reverse acgcatacatcggtattgaACTAGTATTATACCTAGGACTGAGC (SEQ ID NO:37)

[0706] Italics = 15 bp overlap for In-Fusion cloning.

[0707] This first stage of the cloning will generate plasmid pSEVA241-donor-HbpB (Figure 7C; SEQ ID NO:16), containing the hbpB gene, but without the targeting sequence for the endogenous plasmid pHbCP. gRNA modification to generate pSEVA241-hbpB-antitoxin

[0708] The gRNA sequence will be modified to be specific for plasmid pHbCP, rather than the current sequence which anneals to a specific loci within the genome of H. bluephagenesis TD1 .0 (SEQ ID NO:17). The gRNA will be modified by overlap extension PCR using primers listed in Table 8.1 .

[0709] Experimental pSEVA241 -phaC-delete linearisation

[0710] A miniprep of pSEVA241-phaC-delete plasmid was used as the template for PCR amplification / linearisation, which also eliminates the HL_QQ and HR_QQ homology regions (Figure 8B). High fidelity Q5 polymerase was used for PCR amplification.

[0711] HbpB gene amplification

[0712] To prepare the PCR template, an aliquot of H. bluephagenesis TD1 .0 glycerol stock was used to inoculate 5 mL of LB60 medium. The culture was incubated at 37 °C overnight with 180 rpm agitation. The endogenous plasmid from this culture was extracted and purified using the NEB Monarch® Plasmid Miniprep kit miniprep kit. High fidelity Q5 polymerase was used for PCR amplification. gRNA mutagenesis by overlap extension PCR

[0713] The PCR reaction set up for Q5 polymerase was set up as described above for pSEVA241-phaC-delete plasmid linearisation. The primers used for PCR are shown in Table 8.1 , using 0.5 pL pSEVA241-donor- HbpB miniprep as the template. Three PCR reactions were set up, differing by the annealing temperature for each reaction of template used.

[0714] PCR product analysis by agarose gel electrophoresis

[0715] Each PCR product was analysed by 1% agarose gel electrophoresis. The expected PCR product band sizes were as follows: linearised pSEVA241-phaC-delete plasmid = 5.22 kb and hbpB insert = 369 bp. The expected sized bands were cut from the gel, followed by extraction and purification using the NEB Monarch® gel extraction kit.

[0716] In-Fusion cloning

[0717] In-Fusion cloning was performed to ligate together the hbpB insert with the linearised pSEVA241-phaC- delete plasmid to generate pSEVA241-donor-HbpB. The correct orientation of the two fragments is determined by the 15 bp overhangs on the PCR oligos (Table 8.1). For circularisation of pSEVA241- hbpB-antitoxin plasmid after PCR editing of the gRNA, the In-Fusion was carried out as above, except the DNA content was only 100 ng of the PCR product (no insert).

[0718] Transformation of InFusion reaction product into chemically competent E. coli DH5a

[0719] A frozen aliquot (100 pL) of E. coli DH5a was defrosted on ice. The InFusion mix DNA (4 pL) was added and mixed gently. The cells were incubated on ice for 30 minutes, followed by heat shock at 42 °C for 30 seconds. The cells were cooled on ice for 5 minutes before adding 1 mL of SOC liquid medium. The cells were recovered by incubating at 37 °C for 1 hour with 180 rpm shaking. Culture aliquots (25 pL) were plated onto LB plates containing 50 pg / mL kanamycin. The plates were incubated at 37 °C for 24 hours. Colonies were picked and used to inoculate 5 mL LB medium containing 50 pg / mL kanamycin. Cultures were incubated overnight at 37 °C with 180 rpm agitation. The plasmid from each culture was extracted and purified using the NEB Monarch® Plasmid Miniprep kit. Samples were sent for Nanopore whole plasmid sequencing (Source Bioscience).

[0720] Results and Discussion

[0721] Agarose gel electrophoresis of linearised and truncated pSEVA241-phaC-delete plasmid showed the presence of a band between 5 and 6 kb, in line with the expected 5.22 kb PCR product (Figure 7D). The cleanest PCR product bands (lanes 2-3) were gel extracted and purified.

[0722] Agarose gel electrophoresis of amplified hbpB insert showed the presence of a band less than 0.5 kb, consistent with the expected 369 bp PCR product (Figure 7E). The cleanest PCR product bands were gel extracted and purified. InFusion cloning was successful, and four colonies of E. coli DH5a containing pSEVA241-donor-HbpB plasmid were picked, cultivated and minipreps were made of each. An alignment is provided (Figure 7F) of the Nanopore sequence results of each pSEVA241-donor-HbpB plasmid clones around the region of the HbpB insert with its constitutive promoter.

[0723] Overlap extension PCR was used to linearise the new plasmid with overhangs which aligned with the new guide sequence (Figure 7G). Once ligated by In-Fusion mutagenesis, the recirculated plasmid would have the correct guide sequence specific for the endogenous plasmid. Of the 6 plasmids extracted, 5 were suitable for sequencing. Sequencing results (Figure 7H) showed that 3 plasmids contained the correct new guide RNA sequence.

[0724] Sequence confirmed plasmids were transformed into E. coli S17-1 chemically competent cells to allow for later conjugation with H. bluephagenesis TD1 .0.

[0725] Two changes were successfully made to pSEVA241-phaC-delete in order to generate pSEVA241-hbpb- antitoxin, one of the two plasmids required to excise the endogenous plasmid. The antitoxin gene hbpB was inserted to enable the continued deactivation of the endogenous toxin while the endogenous plasmid was being excised. The second change meant that the target DNA cleavage site was within the endogenous plasmid instead of the genomic DNA.

[0726] Inventors have modified this Halomonas bluephagenesis TD1 .0 native plasmid to generate a hybrid plasmid for citramalate production in the absence of antibiotic selection. The design of three plasmids for citramalate production based on the antibiotic-free hbpB / hbpC antitoxin / toxin system is described in this Example. The plasmids vary according to the promoter controlling citramalate production and the presence / absence of additional amylase genes required for growth on starch.

[0727] Plasmid design pHbPBC-sfGFP

[0728] This plasmid was designed as a starting point for the development of new citramalate production plasmids with toxin-antitoxin system. The pHbPBC-sfGFP plasmid consists of the pHbCP ori, ColE1 ori, oriT conjugative transfer origin, kanamycin resistance (KanR) and spectinomycin resistance SpeR with hbpB / hbpC as stability elements. It also contains a superfolder gfp expression gene, used as the marker to demonstrate the plasmid is being maintained. The pHbPBC-sfGFP plasmid map is provided as Figure 8A, and the DNA sequence of the plasmid is provided as SEQ ID NO:18. pHbPBC-T7L-cimA

[0729] This plasmid was designed by inventors, and is similar to pHbPBC-sfGFP, except the sfGFP gene and its promoter is substituted for the citramalate cimA gene (cimA 3.7; SEQ ID NO:4) with the MMP1 T7-like promoter. This base plasmid will allow for citramalate production via IPTG expression in the absence of antibiotic selection. The plasmid retains both the kanamycin and spectinomycin resistant genes to allow for selection of the correct clones when the plasmid is transformed / conjugated into E. coli and H. bluephagenesis TD1 .0, respectively.

[0730] The pHbPBC-T7L-cimA plasmid map is provided as Figure 8B, and the DNA sequence of the plasmid is provided as SEQ ID NO:19. pHbPBC-T7L-cimA-amyL-HalGluc1

[0731] This plasmid is similar to pHbPBC-T7L-cimA, except two additional genes are present after the cimA gene. These form a 3-gene operon controlled by one MMP1 T7-like promoter (SEQ ID NO:20). The first gene is a modified version of the thermotolerant a-amylase from Bacillus licheniformis (Uniprot: Q208A7; SEQ ID NO:5). This gene has been modified by codon optimisation to increase the expression in Halomonas (SEQ ID NO:21). It contains a 30 amino acid N-terminal signal peptide to target it for extracellular expression. The third gene in the operon is a p-glucosidase HalGlud native to H. bluephagenesis (SEQ ID NO:6). These two starch degrading genes were added downstream of cimA, separated by Shine Dalgarno sequences. The sequence of the inserts are provided as SEQ ID NO:4, SEQ ID NO:21 , and SEQ ID NO:8.

[0732] The pHbPBC-T7L-cimA-amyL-HalGluc1 plasmid map is provided as Figure 8C, and the DNA sequence of the plasmid is provided as SEQ ID NO:22. pHbPBC-J23119-cimA-amyL-HalGuc1

[0733] This plasmid is similar to pHbPBC-T7L-cimA-amyL-HalGluc1 , except the promoter controlling the 3-gene operon is substituted for the constitutive J23119 promoter. This will allow citramalate production and starch degradation in the absence of IPTG induction.

[0734] The pHbPBC-J23119-cimA-amyL-HalGluc1 plasmid map is provided as Figure 8D, and the DNA sequence of the plasmid is provided as SEQ ID NO:23.

[0735] Plasmid synthesis

[0736] The three DNA constructs were submitted to Eurofins for full plasmid synthesis, including recirculation to form functional plasmids. Each plasmid was sequence confirmed by Eurofins.

[0737] Plasmid pHbPBC-T7L-cimA was synthesised by Eurofins, who confirmed the DNA sequence matches the designed sequence (SEQ ID NO:19). The DNA was delivered as freeze-dried material and was reconstituted and transformed into E. coli for archiving and sequence confirmation.

[0738] Plasmid pHbPBC-T7L-cimA-amyL-HalGluc1 was synthesised by Eurofins, who confirmed the DNA sequence matches the designed sequence (SEQ ID NO:22). The DNA will be delivered as freeze-dried material and later reconstituted and transformed into E. co / / for archiving and sequence confirmation. Plasmid pHbPBC-J23119-cimA-amyL-HalGluc1 is being synthesised by Eurofins, who will confirm the DNA sequence matches the designed sequence (SEQ ID NO:23). The DNA will be delivered as freeze- dried material and later reconstituted and transformed into E. coli for archiving and sequence confirmation.

[0739] A fermentation of H. bluephagenesis TD 1.0 containing pSEVA434-T7-cimA was performed on MM63 minimal media for citramalate production. Cultivation was performed initially in a fed batch mode with glucose to obtain a high cell density. This was followed by a mixed glycerol:glucose feed under continuous feeding mode, with only a low glucose content to maintain the growth rate. A glycerol only feed stops growth, likely due to high citramalate production. The cultivation was performed for 26 days.

[0740] Introduction

[0741] A continuous fermentation of H. bluephagenesis TD1 .0 containing the pSEVA434-T7-cimA plasmid was performed to determine if prolonged fermentations are possible for citramalate production. Earlier studies by inventors showed growth with glycerol as a sole carbon source in a fermenter was stunted, with significant citramalate production.

[0742] In this fermentation, a high-density culture will be generated with a high concentration glucose only feed (20 g / L) under fed batch conditions. This will be followed by changing to continuous mode feeding for optical density maintenance (OD 600 nm ~ 15-20) with continuous feeding and culture harvesting. This secondary feed will contain mostly biodiesel waste glycerol (20 g / L crude glycerol), with a small proportion of glucose to enable the culture to continue growing.

[0743] LB60 pH 9.0: Tryptone 10 g / L; yeast extract 5 g / L; NaCI 60 g / L.

[0744] Fortified MM63 medium per 1 L:

[0745] • 60 g NaCI

[0746] • 13.6 g KH2PO4

[0747] • 4.21 g KOH (plus additional for pH adjustment)

[0748] • 1 mL Trace Element Solution (1000x; Table 3.2)

[0749] • 1 mL 1 M MgSO4.7H2O

[0750] • 1 mL 5 mM Fe(NH4)2(SO4)2.6H2O solution

[0751] • 1 mL 5 mM CaCI2.6H2O

[0752] 20g glucose

[0753] 1.98 g Urea The chemicals were dissolved in tap water and pH adjusted to 8.5 with KOH. The solution was made up to 4 L and split in 3.5 L (fermenter culture) and 0.5 L (starter culture).

[0754] Feed medium per 1 L: Same as the Fortified MM63 medium, with variable glycerol and glucose concentrations as stated below.

[0755] Starter cultures

[0756] Glycerol stocks of H. bluephagenesis TD1 .0 containing pSEVA434-T7-cimA plasmid were used to inoculate 10 mL of LB60 pH 9 containing 50 pg / mL spectinomycin. Cultures were grown overnight at 37 °C with 180 rpm agitation. Two flasks (1 L flasks) of 250 mL of fortified non-sterile MM63 media containing 50 pg / mL spectinomycin were inoculated with 5 mL overnight culture. Cultures were incubated overnight at 37 °C with 180 rpm agitation.

[0757] Fermentation set up

[0758] A 5 L Eppendorf BioFlo 120 bioreactor was set up with 3.5 L of mineral medium, supplemented with 2% (20 g / L) glucose and 50 mg / mL spectinomycin. The fermenter and media were not sterilised / autoclaved. Following media addition, the monitoring equipment was stabilised and calibrated (pH and dO2 probes). The initial fermenter conditions were set with the following parameters:

[0759] • Temperature: 37 °C maintained and monitored throughout.

[0760] • pH: 8.5 with pH maintenance and monitoring.

[0761] • pH control: Acid = 6 M HCI; Base =10 M NaOH.

[0762] • Agitation: Cascade 200 - 800 rpm

[0763] • Airflow: Cascade 0.1 - 2 SLPM

[0764] Fermentation parameters were maintained throughout the fermentation.

[0765] Batch, fed-batch and continuous fermentation feeding regimes

[0766] 1 . 0 to 20 h: batch (no feeding).

[0767] 2. 20 to 48 h: fed-batch: 500 mL 20g / L glucose feed.

[0768] 3. 48 to 73 h: batch mode.

[0769] 4. 73 to 90 h: fed-batch: 500 mL 50 g / L glucose feed.

[0770] 5. 73 h: continuous fermentation 20 g / L glucose.

[0771] 6. 99 h: continuous crude glycerol feed 400 mL / day.

[0772] 7. 142 h: spiked with 10 g / L glucose.

[0773] 8. 166 h: Added 2 g / L yeast extract.

[0774] 9. 195 h: Set up 125 g / L feed at 400 mL / day

[0775] 10. 196h: Added 10mL of 5% antifoam

[0776] 11. Every day on the morning: Added 8 mL 5% antifoam

[0777] 12. 338h: Feed ran out. A new feed containing 90 g / L crude glycerol and 30 g / L glucose was added (1 .25L). Flow rate close to 0.5 L / day.

[0778] Sampling and analytics Optical density: Culture sampling was performed periodically throughout the fermentation, and at the end only for the starter culture. Samples were diluted with deionised water to be within an OD 600 nm of 0.1- 0.3 and readings were performed using a spectrophotometer. Final data is adjusted for the dilution factors.

[0779] Citramalate, glucose and glycerol quantitation: Culture samples were taken periodically and microcentrifuged at 13,000 rpm for 10 min to retain the supernatant. The citramalate content of the supernatants was determined by HPLC using an Agilent 1260 Infinity HPLC as described previously (Example 2). Analyte concentrations were calculated by comparing the peak areas to standard curves generated from analytical standards of known concentrations.

[0780] Results and discussion

[0781] Culture growth and citramalate production

[0782] Growth under fed batch conditions with glucose led to rapid growth, achieving an optical density of around 34. The fermentation was set to continuous mode by performing a continuous feeding with an identical culture harvesting rate. Once the culture was in continuous mode, the feeding was switched to culture medium containing crude glycerol as the bulk carbon source (e.g. 90 g / L). In addition, glucose was added (e.g. 30 g / L) to enable the culture to maintain growth. The latter is thought to provide some inhibition of cimA expression, improving the growth rate of the culture.

[0783] The initial feeding rate during continuous mode was too high, leading to a washing out of the culture over the next ~70 h. The feed rate was changed, and the culture density slowly recovered.

[0784] In spite of the drop in biomass density, citramalate production continued to increase throughout the fermentation, achieving titres of 16 g / L (Figure 9). The fermentation was continued for around 26 days, with citramalate continuing to be produced. As the fermentation was in continuous mode with continuous harvesting, this suggests the actively growing culture is still producing citramalate, even after ~26 days. This shows the stability of the pSEVA434-T7-cimA plasmid, as recombinant plasmids are often lost within 1-2 days cultivation. There is a slow decline in productivity, suggesting some of the culture is losing the plasmid, or mutations are occurring in the plasmid leading to lower production titres. The citramalate titre within the harvested culture mimics the levels detected in the growing culture, as expected (e.g. 7.98 g / L citramalate after 573 h).

[0785] Growth after 300 h showed an increase in glycerol concentration. This is likely due to the spike addition of glucose (142 h) to improve growth. This led to a switch from glycerol to primarily glucose utilisation and subsequent glycerol accumulation. These levels dropped after the majority of the glucose was either consumed or washed out. Only low concentrations of acetate were seen to accumulate, likely due to the major carbon source being glycerol instead of glucose.

[0786] Fermentative production of citramalate production by Halomonas has been shown to be a stable process by showing only gradual loss in citramalate titre over 26 days. This suggests citramalate is not a toxic product for Halomonas, as plasmid maintenance appeared to be sustained over a prolonged period of time.

[0787] A fermentation of H. bluephagenesis TD 1.0 containing pSEVA434-T7-cimA was performed on MM63 minimal media for citramalate production. Cultivation was performed initially in a fed batch mode with glucose to obtain a high cell density. This was followed by a glucose feed under continuous feeding mode. The cultivation was performed for 61 days. This demonstrates the longevity of the citramalate production by halophilic microorganisms under non-sterile conditions. Around 150 g citramalate was produced over 61 days.

[0788] LB60 pH 9.0: Tryptone 10 g / L; yeast extract 5 g / L; NaCI 60 g / L.

[0789] Fortified MM63 medium per 1 L:

[0790] • 60 g NaCI

[0791] • 13.6 g KH2PO4

[0792] • 4.21 g KOH (plus additional for pH adjustment)

[0793] • 1 mL Trace Element Solution (1000x; Table 3.2)

[0794] • 1 mL 1 M MgSO4.7H2O

[0795] • 1 mL 5 mM Fe(NH4)2(SO4)2.6H2O solution

[0796] • 1 mL 5 mM CaCI2.6H2O

[0797] • 20 g glucose

[0798] • 1 .98 g Yeast extract (starter culture) or 1 .98 g Urea

[0799] Feed medium per 1 L: Same as the Fortified MM63 medium, with variable glucose concentrations.

[0800] Starter cultures

[0801] Glycerol stocks of H. bluephagenesis TD1 .0 containing pSEVA434-T7-cimA plasmid were used to inoculate 10 mL of LB60 pH 9 containing 50 mg / mL spectinomycin. Cultures were grown overnight at 37 °C with 180 rpm agitation. Two flasks (1 L flasks) containing 250 mL of fortified non-sterile MM63 media containing 50 mg / mL spectinomycin were inoculated with 5 mL overnight culture. Cultures were incubated at 37 °C with 180 rpm agitation.

[0802] Fermentation set up

[0803] A 5 L Eppendorf BioFlo 120 bioreactor was set up with 2.5 L of mineral medium, supplemented with 2% (20 g / L) glucose and 50 mg / mL spectinomycin. The fermenter and media were not autoclaved due to the high salt content. Following media addition, the monitoring equipment was stabilised and calibrated (pH and dO2probes). The initial fermenter conditions were set with the following parameters: • Temperature: 37 °C maintained and monitored throughout.

[0804] • pH: 8.5 with pH maintenance and monitoring.

[0805] • pH control: Acid = 5 M HCI; Base = 5 M NaOH.

[0806] • Agitation: Cascade 200 - 1000 rpm

[0807] • Airflow: Cascade 0.1 - 10 SLPM

[0808] • Feed rate: 500 mL / day initially,

[0809] The culture was inoculated with 1 L starter culture. Fermentation parameters were maintained throughout the fermentation. The culture was run in a fed-batch mode until 5 L was reached, then the cultivation was switched to a continuous feeding / harvesting mode for the remainder of the cultivation.

[0810] Batch, fed-batch and continuous fermentation feeding regimes

[0811] 6.1 d: Added 0.5 mL 1M IPTG (induction with 0.1 mM IPTG)

[0812] 7 d: Continuous fermentation with glucose feed was started.

[0813] Sampling and analytics

[0814] Optical density: Culture sampling was performed periodically throughout the fermentation, and at the end only for the starter culture. Samples were diluted with deionised water to be within an OD 600 nm of 0.1- 0.3 and readings were performed using a spectrophotometer. Final data is adjusted for the dilution factors.

[0815] Citramalate, glucose and glycerol quantitation: Culture samples were taken periodically and microcentrifuged at 13,000 rpm for 10 min to retain the supernatant. The citramalate content of the supernatants was determined by HPLC using an Agilent 1260 Infinity HPLC as described previously (Example 2). Analyte concentrations were calculated by comparing the peak areas to standard curves generated from analytical standards of known concentrations.

[0816] Results and discussion

[0817] Culture growth and citramalate production

[0818] Growth under fed batch conditions with glucose led to rapid growth, achieving an optical density of around 39 (Figure 10). The fermentation was set to continuous mode around 168 h by performing a continuous feeding with an identical culture harvesting rate. Once the culture was in continuous mode, the feeding was performed with the same culture medium. IPTG induction was performed at a high biomass density to maximise cimA production in the presence of glucose.

[0819] The initial feeding rate during continuous mode was too high, leading to a washing out of the culture down to OD 600 nm around 10 (Figure 10). Thereafter, the culture optical density stabilised. The glucose levels became undetectable after 45 h, and did not reappear until the culture density stabilised around 275 h (11 .5 days). This suggests the growth rate had slowed down, leading to glucose remaining in the culture. Potentially the concentration of glucose prior to this was too low to support the high cell density, which led to no surplus glucose being detected in the culture. Once the glucose levels became detectable again there was a significant increase in acetate production, generating up to 5.8 g / L.

[0820] In spite of the drop in biomass density, citramalate production continued to increase throughout the fermentation, achieving titres of ~14 g / L after around 380 h (15.8 days).

[0821] Interestingly, the rate of citramalate increased significantly once the fermentation switched from batch to continuous fermentation. The titres then remained relatively constant after ~9 days when the culture biomass density was declining. The fermentation was continued for around 60 days (Figure 10).

[0822] Citramalate titres remained above 10 g / L for 13 days, while showing a slow decline from day 16 to day 47.

[0823] There was a secondary increase in citramalate titres around 51-57 days during a decline in culture growth. This increase in titre was also seen around 7-10 days when the culture optical density was declining due to depleting glucose levels. At the completion of 61 days cultivation Halomonas was still producing citramalate at a titre of ~ 3 g / L.

[0824] The cumulative harvested citramalate production over 61 days was calculated based on the daily titres and the feeding / harvesting rate. In total, around 150 g citramalate was produced over 61 days continuous cultivation, with the citramalate titre never falling below 1 g / L. This shows the high genetic stability of the standard pSEVA434-T7-cimA plasmid in Halomonas. The slow steady decline in citramalate production over most of the cultivation suggests some loss of plasmid stability and / or plasmid maintenance. However, as citramalate production is still occurring at good titres (> 1 g / L) after 61 days, this shows glucose is an excellent carbon source to support citramalate production by Halomonas.

[0825] In conclusion, data show that fermentative production of citramalate production by Halomonas with a glucose carbon source is a stable process showing citramalate production over a prolonged fermentation of 61 days. This suggests citramalate is not a toxic product for Halomonas, as plasmid maintenance appeared to be sustained after the biomass concentration had stabilised during continuous mode of operation.

[0826] Introduction

[0827] Existing experiments to test the longevity of citramalate production by H. bluephagenesis TD1 .0 were performed using the pSEVA434-T7-cimA plasmid construct. Three newly synthesised plasmids were designed to replace the pSEVA434-T7-cimA plasmid by eliminating the need for antibiotic maintenance by the incorporation of a toxin / antitoxin system in place of antibiotic resistance genes. Removal of the existing endogenous plasmid, which also contains the same toxin / antitoxin system, will also be performed. Once this competing plasmid is eliminated, the new plasmids could be conjugated into the new H. bluephagenesis TD1.0v2 and citramalate production studies can be performed. Plasmids

[0828] 1 . pSEVA241-hbpB-antitoxin - CRISPR-Cas9 donor plasmid specific for cleaving the endogenous plasmid pHbCP (SEQ ID NO:17).

[0829] 2. pQ08 - CRISPR-Cas9 plasmid (SEQ ID NO:12).

[0830] Culture medium

[0831] LB / LB agar pH 7.0: Tryptone 10 g / L; yeast extract 5 g / L; NaCI 10 g / L. LB agar additionally contains 15 g / L agar.

[0832] LB60 / LB60 agar pH 9.0: Tryptone 10 g / L; yeast extract 5 g / L; NaCI 60 g / L. LB agar additionally contains 15 g / L agar.

[0833] Transformation, conjugation and plasmid curing

[0834] Both plasmids pQ08 and pSEVA241-hbpB-antitoxin will be co-transformed into E. coli strain S17-1 using standard heat shock protocols. The culture will be incubated on LB agar pH 7.0 containing 25 pg / mL kanamycin and 34 pg / mL chloramphenicol to select for colonies that contain both plasmids pSEVA241- hbpB-antitoxin and pQ08, respectively.

[0835] Conjugation will be employed to introduce both plasmids pQ08 and pSEVA241-hbpB-antitoxin into H. bluephagenesis TD1 .0 according to previously published protocols. Transconjugates will be cultivated on LB60 agar pH 9.0 containing 50 pg / mL spectinomycin and 34 pg / mL chloramphenicol to select for colonies that contain both plasmids pSEVA241-hbpB-antitoxin and pQ08, respectively. Verification of the obtained colonies will be performed using colony PCR with two sets of primers specific for the different plasmids.

[0836] CRISPR / Cas9-based methods will be used for the elimination of the endogenous plasmid pHbCP. IPTG- induction will express the recombinant enzyme necessary for site specific double strand DNA cleavage of the pHbCP as directed by the gRNA sequence in plasmid pSEVA241-hbpB-antitoxin. Following cleavage, the culture will be cultivated on LB60 agar pH 9.0 without antibiotic selection to passively eliminate both plasmids pQ08 and pSEVA241-hbpB-antitoxin from H. bluephagenesis. Multiple colonies (-100-200) will be replica plated on LB60 agar pH 9.0 and screened for the absence of the endogenous plasmid by colony pick PCR using primers specific for this plasmid. Following the identification of successful ‘empty’ clones ( / . bluephagenesis TD1 .0v2), these strains will be replica plated onto two LB60 agar pH 9.0 containing either 50 pg / mL spectinomycin and 34 pg / mL chloramphenicol to select for colonies that retain plasmids pSEVA241-hbpB-antitoxin or pQ08, respectively. Colonies that fail to grow on either antibiotic plate will be deemed H. bluephagenesis TD1 .0v2 strains and the absence of all 3 of the plasmids will be confirmed by colony pick PCR and miniprep / digest analysis.

[0837] Results and Discussion The co-transformation and co-conjugation of both plasmids pQ08 and pSEVA241-hbpB-antitoxin are expected to be successful. For plasmid pSEVA241-hbpB-antitoxin, the antibiotics used will be kanamycin and spectinomycin for E. coli and H. bluephagenesis, respectively, as H. bluephagenesis has a natural resistance to kanamycin.

[0838] Induction of double strand DNA cleavage of the endogenous plasmid is likely to be inefficient, as DNA repair enzymes are present in the cell. There is no way to selectively enrich for cells without the endogenous plasmid as the donor plasmid pSEVA241-hbpB-antitoxin contains the antitoxin gene to mop up any remaining toxin left in the cell after endogenous plasmid degradation. Therefore, it is expected that around 100-200 individual colonies may need to be screened to find a strain that does not contain the endogenous plasmid.

[0839] Later steps require the removal of the two plasmids pQ08 and pSEVA241-hbpB-antitoxin from the cell. This is most likely achieved via repeated cultivations in the absence of the selective antibiotics. This step may also require screening around 50-100 colonies to find a completely empty Halomonas strain ( / . bluephagenesis TD1 .0v2).

[0840] Following the successful isolation of H. bluephagenesis TD1 .0v2, this strain will be subcultured in LB60 pH 9.0 and glycerol archive stocks will be generated for use as a base strain for the incorporation of the citramalate producing plasmids pHbPBC-T7L-cimA, pHbPBC-T7L-cimA-amyL-HalGluc1 and pHbPBC- J23119-cimA-amyL-HalGluc1 . It could also be used for other projects where a plasmid needs to be incorporated and maintained without using antibiotics.

[0841] Introduction

[0842] A new strain of H. bluephagenesis TD1 .0 will be generated (strain TD1 .0v2) that was cured of its endogenous plasmid pHbCP (Example 12). This ‘empty’ strain will now be transformed with three new citramalate producing plasmids to develop new strains for prolonged citramalate production in the absence of antibiotic or any other selection chemical requirement. These new clones will be screened for citramalate production in flasks to see how the titres compare to strains containing the original plasmid pSEVA434-T7-cimA. They will be cultivated on glucose and starch to see if the starch hydrolysing genes are being expressed, secreted and remain functional under Halomonas growth conditions of high salt and high pH.

[0843] Plasmids

[0844] 1 . pHbPBC-T7L-cimA - contains the toxin / antitoxin system and cimA under an IPTG-inducible T7- like promoter control (SEQ ID NO:19). 2. pHbPBC-T7L-cimA-amyL-HalGluc1 - contains the toxin / antitoxin system, cimA and starch degrading genes amyL and HalGlud under an IPTG-inducible T7-like promoter control (SEQ ID NO:22).

[0845] 3. pHbPBC-J23119-cimA-amyL-HalGluc1 - contains the toxin / antitoxin system, cimA and starch degrading genes amyL and HalGlud under an IPTG-inducible T7-like promoter control (SEQ ID NO:23).

[0846] Culture medium

[0847] LB / LB agar pH 7.0: Tryptone 10 g / L; yeast extract 5 g / L; NaCI 10 g / L. LB agar additionally contains 15 g / L agar.

[0848] LB60 / LB60 agar pH 9.0: Tryptone 10 g / L; yeast extract 5 g / L; NaCI 60 g / L.

[0849] Fortified MM63 medium per 1 L:

[0850] • 60 g NaCI

[0851] • 13.6 g KH2PO4

[0852] • 4.21 g KOH (plus additional for pH adjustment)

[0853] • 1 mL Trace Element Solution (1000x; Table 3.2)

[0854] • 1 mL 1 M MgSO4.7H2O

[0855] • 1 mL 5 mM Fe(NH4)2(SO4)2.6H2O solution

[0856] • 1 mL 5 mM CaCI2.6H2O

[0857] • 20g glucose

[0858] • 1 .98 g Urea

[0859] The chemicals were dissolved in tap water and pH adjusted to 8.5 with KOH.

[0860] Transformations and conjugations

[0861] Plasmids pHbPBC-T7L-cimA, pHbPBC-T7L-cimA-amyL-HalGluc1 and pHbPBC- J23119-cimA-amyL- HalGlud will be separately transformed into E. coli strain S17-1 using standard heat shock protocols. The culture will be incubated on LB agar pH 7.0 containing 25 pg / mL kanamycin to select for colonies that contain their respective plasmid.

[0862] Conjugation will be employed to introduce the plasmids into separate strains of H. bluephagenesis TD1.0v2 according to previously published protocols. Transconjugates will be cultivated on LB60 agar pH 9.0 containing 50 pg / mL spectinomycin to select for colonies that contain the cimA-containing plasmids. Verification of the obtained colonies will be performed using colony PCR with primers to distinguish between each plasmid. Successful colonies will be cultivated in LB60 containing 50 pg / mL spectinomycin and stored as archive glycerol stocks at -80 °C.

[0863] Cultures

[0864] Glycerol stocks of H. bluephagenesis TD1 .0v2 containing pHbPBC-T7L-cimA, pHbPBC-T7L-cimA-amyL- HalGlud or pHbPBC-J23119-cimA-amyL-HalGluc1 plasmids will be used to inoculate 10 mL of LB60 pH 9 without antibiotics. Cultures will be grown overnight at 37 °C with 180 rpm agitation. Three flasks (2 L flasks) of 1 L of fortified non-sterile MM63 media with glucose as the carbon source will be inoculated for each strain with 5 mL overnight culture. Cultures will be incubated for 2 days at 37 °C with 180 rpm agitation without feeding, pH control or antibiotics. A second set of 1 L cultures will be set up as above, with 2% starch powder as the sole carbon source. This will be used to test whether the starch degrading genes are being expressed and secreted into the culture medium to allow Halomonas to grow on starch. Cultures will be induced with 0.1 mM IPTG when the culture CD 600 nm reaches 2 (approximately 16-24 h). No induction will be performed with cultures containing plasmid pHbPBC-J23119-cimA-amyL- HalGlud as recombinant enzyme production is controlled by a constitutive promoter.

[0865] Analytics

[0866] Optical density: Samples (10 mL) will be taken twice daily of each culture. Samples will be diluted with deionised water to be within an OD 600 nm of 0.1 -0.3 and readings were performed using a spectrophotometer. The final data will be adjusted for the dilution factors.

[0867] Citramalate, citraconate, glucose and acetate quantitation: Culture samples will be taken periodically and micro-centrifuged at 13,000 rpm for 10 min to retain the supernatant. The citramalate content of the supernatants will be determined by HPLC using an Agilent 1260 Infinity HPLC as described previously (Example 2). Analyte concentrations will be calculated by comparing the peak areas to standard curves generated from analytical standards of known concentrations.

[0868] Samples of culture will be analysed for the recombinant plasmid presence by PCR using primers specific for each plasmid. PCR products will be analysed by agarose gel electrophoresis to look for positive PCR products of the correct size to assess for likely plasmid presence and / or recombinations.

[0869] Results and discussion

[0870] It is expected that all three plasmids will be successfully transformed into E. coli then conjugated into H. bluephagenesis TD1 .0v2. Halomonas cultures containing these plasmids will be tested for longevity of the plasmid in the absence of any antibiotics over 2 days under flask culture conditions. The endogenous plasmid was tightly retained due to the presence of the toxin / antitoxin system. As these three plasmids have the same system under the same promoter, it is expected that the plasmids will be retained without needing to supply spectinomycin to retain them.

[0871] Growth with cultures containing plasmid pHbPBC-J23119-cimA-amyL-HalGluc1 are expected to be slower as recombinant enzyme production is controlled by a constitutive promoter. High level expression tends to slow down growth significantly, so achieving a high biomass density may be difficult for this culture. If this is the case, the plasmid may need to be modified to substitute the Halomonas specific constitutive promoter for a variety of others of varying yet lower strength to find one that supports both high growth and high citramalate titres.

[0872] Citramalate production titres are expected to be similar or better than experiments performed with the pSEVA434-T7-cimA plasmid under the same growth conditions. This is because the citramalate gene and promoter are the same between the two plasmids and the new plasmids should be maintained more stably that pSEVA based ones.

[0873] Cultures grown in starch containing medium will be assessed to see how their growth compares to cultures grown with glucose. This will enable an assessment as to how well the starch degrading genes are performing at digesting starch to generate glucose for Halomonas growth. The effect of this carbon source on citramalate titres will also be assessed.

[0874] Gel electrophoresis of colony pick PCR reactions will be used to see if full length plasmid is retained throughout the cultivation or if there is any evidence of mutations / recombination events that could indicate a stability issue with the new plasmids.

[0875] Introduction

[0876] A new strain of H. bluephagenesis TD1 .0 will be generated (strain TD1 .0v2) that was cured of its endogenous plasmid pHbCP (Example 12). This ‘empty’ strain will be conjugated with three new citramalate producing plasmids that contain a toxin / antitoxin system for plasmid maintenance without the need for antibiotics. Each strain will be cultivated under continuous fermentation conditions for a prolonged time period (up to 60 days) using glucose as a carbon source. This will assess whether these plasmids are stable enough for prolonged citramalate production during extended fermentations without any antibiotic presence.

[0877] Plasmids / Strains

[0878] 1 . pHbPBC-T7L-cimA - contains the toxin / antitoxin system and cimA under an IPTG-inducible T7- like promoter control (SEQ ID NO:19).

[0879] 2. pHbPBC-T7L-cimA-amyL-HalGluc1 - contains the toxin / antitoxin system, cimA and starch degrading genes amyL and HalGlud under an IPTG-inducible T7-like promoter control (SEQ ID NO:22).

[0880] 3. pHbPBC- J23119-cimA-amyL-HalGluc1 - contains the toxin / antitoxin system, cimA and starch degrading genes amyL and HalGlud under an IPTG-inducible T7-like promoter control (SEQ ID NO:23).

[0881] Each plasmid will be conjugated into H. bluephagenesis TD1.0v2 as described in Example 13.

[0882] Culture medium

[0883] LB / LB agar pH 7.0: Tryptone 10 g / L; yeast extract 5 g / L; NaCI 10 g / L. LB agar additionally contains 15 g / L agar.

[0884] LB60 / LB60 agar pH 9.0: Tryptone 10 g / L; yeast extract 5 g / L; NaCI 60 g / L.

[0885] Fortified MM63 medium per 1 L: • 60 g NaCI

[0886] • 13.6 g KH2PO4

[0887] • 4.21 g KOH (plus additional for pH adjustment)

[0888] • 1 mL Trace Element Solution (1000x; Table 3.2)

[0889] • 1 mL 1 M MgSO4.7H2O

[0890] • 1 mL 5 mM Fe(NH4)2(SO4)2.6H2O solution

[0891] • 1 mL 5 mM CaCI2.6H2O

[0892] • 20 g glucose

[0893] • 1 .98 g Urea

[0894] The chemicals were dissolved in tap water and pH adjusted to 8.5 with KOH.

[0895] Feed medium per 1 L - Same as the Fortified MM63 medium, with variable glucose concentrations.

[0896] Cultures

[0897] Glycerol stocks of H. bluephagenesis TD1 .0v2 containing pHbPBC-T7L-cimA, pHbPBC-T7L-cimA-amyL- HalGlud or pHbPBC- J23119-cimA-amyL-HalGluc1 plasmids will be used to inoculate 10 mL of LB60 pH 9 without antibiotics. Cultures will be grown overnight at 37 °C with 180 rpm agitation. Three flasks (1 L flasks) of 250 mL of fortified non-sterile MM63 media with glucose as the carbon source will be inoculated for each strain with 5 mL overnight culture. Cultures will be incubated overnight at 37 °C with 180 rpm agitation without feeding, pH control or antibiotics.

[0898] Fermentation set up

[0899] A 5 L Eppendorf BioFlo 120 bioreactor will be set up with non-sterile 3.5 L of mineral medium, supplemented with 2% (20 g / L) glucose. The monitoring equipment will be stabilised and calibrated (pH and dO2probes). The initial fermenter conditions will be set with the following parameters:

[0900] • Temperature: 37 °C maintained and monitored throughout.

[0901] • pH: 8.5 with pH maintenance and monitoring.

[0902] • pH control: Acid = 6 M HCI; Base =10 M NaOH.

[0903] • Agitation: Cascade 200 - 800 rpm

[0904] • Airflow: Cascade 0.1 - 2 SLPM

[0905] Fermentation parameters will be maintained throughout the fermentation.

[0906] Once an OD 600 nm of around 30 is achieved, the cultures will be induced with 0.1 mM IPTG to increase citramalate production over the normal leaky level. No induction will be performed with cultures containing plasmid pHbPBC- J23119-cimA-amyL-HalGluc1 as recombinant enzyme production is controlled by a constitutive promoter.

[0907] Analytics

[0908] Optical density: Samples (10 mL) will be taken twice daily of each culture. Samples will be diluted with deionised water to be within an OD 600 nm of 0.1 -0.3 and readings were performed using a spectrophotometer. The final data will be adjusted for the dilution factors. Citramalate, citraconate, glucose and acetate quantitation: Culture samples will be taken periodically and micro-centrifuged at 13,000 rpm for 10 min to retain the supernatant. The citramalate content of the supernatants will be determined by HPLC using an Agilent 1260 Infinity HPLC as described previously (Example 2). Analyte concentrations will be calculated by comparing the peak areas to standard curves generated from analytical standards of known concentrations.

[0909] Samples of culture will be analysed for the recombinant plasmid presence by PCR using primers specific for each plasmid. PCR products will be analysed by agarose gel electrophoresis to look for positive PCR products of the correct size to assess for likely plasmid presence and / or recombinations.

[0910] Results and discussion

[0911] These initial fermentations will be performed with glucose as the sole carbon source to test the ability of the plasmids to generate citramalate and maintain titres over a prolonged period of time without the need for antibiotics. This data will be compared to fermentations performed with the pSEVA434-T7-cimA plasmid in the presence of spectinomycin. This will also provide a base case example for each of the plasmids containing starch containing genes.

[0912] It is expected that there will be a slow decline in citramalate productivity after at least 20 days cultivation. This may be due to an accumulation of mutations or recombination of the recombinant plasmids leading to reduced citramalate production. This is thought to occur during fermentations with the pSEVA434-T7- cimA, which may also be subject to loss of titre from some plasmid loss.

[0913] Growth with cultures containing plasmid pHbPBC- J23119-cimA-amyL-HalGluc1 are expected to be slower as recombinant enzyme production is controlled by a constitutive promoter. High level expression tends to slow down growth significantly, so achieving a high biomass density may be difficult for this culture. If this is the case, the plasmid may need to be modified to substitute the Halomonas specific constitutive promoter for a variety of others of varying yet lower strength to find one that supports both high growth and high citramalate titres.

[0914] Later fermentations will be performed with starch as the sole carbon source to test the efficiency of the pHbPBC-T7L-cimA-amyL-HalGluc1 or pHbPBC- J23119-cimA-amyL-HalGluc1 plasmids to provide fast enough starch degradation to support a high growth rate and citramalate production of H. bluephagenesis compared to fermentations in glucose.

[0915] The ability of Halomonas cells expressing a citramalate production plasmids with toxin-antitoxin system (according to Example 9) is determined.

[0916] Fermentative production of citramalate production by Halomonas expressing pHbPBC-T7L-cimA is shown to be a stable process for the production of citramalate. Fermentative production of citramalate production by Halomonas expressing pHbPBC-T7L-cimA-amyL-HalGluc1 is shown to be a stable process for the production of citramalate. Fermentative production of citramalate production by Halomonas expressing pHbPBC-J23119-cimA-amyL-HalGluc1 is shown to be a stable process for the production of citramalate.

[0917] Halomonas expressing pHbPBC-T7L-cimA is shown to produce citramalate in the absence of antibiotics, through continuous fermentation, with citramalate being produced throughout the fermentation (over a number of days). This indicates that the citramalate production plasmids with toxin-antitoxin system are stable without the need to use antibiotics.

[0918] Halomonas expressing pHbPBC-T7L-cimA-amyL-HalGluc1 is shown to produce citramalate in the absence of antibiotics, through continuous fermentation, with citramalate being produced throughout the fermentation (over a number of days). This indicates that the citramalate production plasmids with toxinantitoxin system are stable without the need to use antibiotics.

[0919] Halomonas expressing pHbPBC-J23119-cimA-amyL-HalGluc1 is shown to produce citramalate in the absence of antibiotics, through continuous fermentation, with citramalate being produced throughout the fermentation (over a number of days). This indicates that the citramalate production plasmids with toxinantitoxin system are stable without the need to use antibiotics, and further demonstrates that such plasmids are suitable for constitutive expression of heterologous enzymes.

[0920] Example 15 - Continuous fermentation with sucrose feed

[0921] A fermentation of H. bluephagenesis TD 1.0 containing pSEVA434-T7-cimA was performed on MM63 minimal media for citramalate production. Cultivation was performed initially in a fed batch mode with glucose to obtain a high cell density. This was followed by the addition of a feed containing commercially sourced sucrose as the carbon source under continuous feeding mode. The cultivation was performed for 60 days.

[0922] LB60 pH 9.0: Tryptone 10 g / L; yeast extract 5 g / L; NaCI 60 g / L.

[0923] Fortified MM63 medium per 1 L

[0924] • 60 g NaCI

[0925] • 13.6 g KH2PO4

[0926] • 5 g KOH (plus additional for pH adjustment)

[0927] • 1 mL Trace Element Solution (1000x; Table 3.2)

[0928] • 1 mL 1 M MgSO4.7H2O

[0929] • 1 mL 5 mM Fe(NH4)2(SO4)2.6H2O solution

[0930] • 0.1 mL 5 mM CaCI2.6H2O

[0931] • 30 g sucrose

[0932] • 2 g Yeast extract (starter culture) or 2 g urea (main cultivation) Feed medium per 1 L: Same as the Fortified MM63 medium, with 80 g / L sucrose.

[0933] Starter cultures

[0934] Glycerol stocks of H. bluephagenesis TD1 .0 containing pSEVA434-T7-cimA plasmid were used to inoculate 10 mL of LB60 pH 9 containing 50 pg / mL spectinomycin. Cultures were grown overnight at 37 °C with 180 rpm agitation. Flasks (1 L flasks) containing 250 mL of fortified non-sterile MM63 media containing 50 pg / mL spectinomycin were inoculated with 5 mL overnight culture. Cultures were incubated at 37 °C with 180 rpm agitation.

[0935] Fermentation set up

[0936] A 5 L Eppendorf BioFlo 120 bioreactor was set up with 2 L of mineral medium, supplemented with 30 g / L sucrose and 50 pg / mL spectinomycin. The fermenter and media were not autoclaved due to the high salt content. Following media addition, the monitoring equipment was stabilised and calibrated (pH and dO2 probes). The initial fermenter conditions were set with the following parameters:

[0937] Temperature: 37 °C maintained and monitored throughout. pH: 8.5 with pH maintenance and monitoring. pH control: Acid = 5 M HCI; Base = 5 M NaOH.

[0938] Agitation: Cascade 200 - 1000 rpm

[0939] Airflow: Cascade 0.1 - 10 SLPM

[0940] Feed rate: 500 mL / day initially

[0941] The culture was inoculated with 1 L starter culture. Fermentation parameters were maintained throughout the fermentation. The culture was run in a fed-batch mode until 5 L was reached, then the cultivation was switched to a continuous feeding / harvesting mode for the remainder of the cultivation.

[0942] Batch, fed batch and continuous fermentation feeding regimes

[0943] 2 d: Added 10 mL of 5% antifoam

[0944] 20 d: Added 10 mL of 5% antifoam

[0945] In addition, there was a temporary decrease in temperature due to equipment failure at 36 days.

[0946] Sampling and analytics

[0947] Optical density: Culture sampling was performed periodically throughout the fermentation, and at the end only for the starter culture. Samples were diluted with deionised water to be within an OD 600 nm of 0.1- 0.3 and readings were performed using a spectrophotometer. Final data is adjusted for the dilution factors.

[0948] Citramalate, glucose and glycerol quantitation: Culture samples were taken periodically and microcentrifuged at 13,000 rpm for 10 min to retain the supernatant. The citramalate content of the supernatants was determined by HPLC using an Agilent 1260 Infinity HPLC as described previously (Example 2). Analyte concentrations were calculated by comparing the peak areas to standard curves generated from analytical standards of known concentrations.

[0949] Results and discussion

[0950] Culture growth and citramalate production

[0951] A standard cultivation of Halomonas after 2 days on commercially available sucrose reached an optical cell density of around 18 (Figure 11). This shows that sucrose is an excellent carbon source and does not require an initial dosing with glucose to reach high optical density. After reaching continuous growth conditions an optical density at 600 nm of 8-12 was maintained throughout the remainder of the 62-day cultivation (14-21 g / L wet weight). Some variation in growth rate was observed at different time periods of the continuous fermentation. This was seen to coincide with metabolite / substrate differences: accumulation of acetate (high growth rate) followed by acetate depletion and sucrose accumulation (lower growth rate).

[0952] The initial feeding rate during continuous mode was too high, leading to a washing out of the culture down to OD 600 nm around 10. Thereafter, the culture optical density stabilised. The sucrose levels became undetectable after 8 days, but the feed rate was changed to ensure carbon source was available throughout the cultivation. The variability in sucrose concentration throughout the cultivation is a reflection on some peristaltic pump fluctuations and changes in the metabolic state of the culture.

[0953] Overall, the citramalate titre production remained relatively steady throughout the continuous growth phase. The average titre (around 5 g / L citramalate) was lower than cultivations with the mixed glucose / glycerol feeding, however there was consistent production during the non-sterile cultivation for around 54 days, before production stopped. This shows the stability of the pSEVA434-T7-cimA plasmid. It also shows that the average citramalate ...

Claims

Claims1 . A halophilic microorganism, optionally isolated, wherein the halophilic microorganism expresses a heterologous citramalate synthase.

2. The halophilic microorganism according to claim 1 , wherein the citramalate synthase comprises an amino acid sequence having at least 70% sequence identity to the amino acid sequence of SEQ ID NO:1 or 2.

3. The halophilic microorganism according to claim 1 or claim 2, wherein the citramalate synthase comprises an amino acid sequence having at least 90% sequence identity to the amino acid sequence of SEQ ID NO:1 or 2.

4. The halophilic microorganism according to any one of claims 1 to 3, wherein the citramalate synthase is a wild type or mutant citramalate synthase derived from Methanococcus jannaschii.

5. The halophilic microorganism according to any one of claims 1 to 4, wherein the halophilic microorganism is a halophilic bacterium.

6. The halophilic microorganism according to any one of claims 1 to 5, wherein the halophilic microorganism is a bacterium from the genus Halomonas or Vibrio.

7. The halophilic microorganism according to any one of claims 1 to 6, wherein the microorganism is a Halomonas bluephagenesis or a Halomonas rowanensis bacterium.

8. The halophilic microorganism according to any one of claims 1 to 7, wherein the microorganism comprises a recombinant plasmid comprising a gene encoding the heterologous citramalate synthase.

9. A plasmid comprising one or more genes encoding a toxin-antitoxin system, and a gene encoding an enzyme, wherein the plasmid comprises a polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism.

10. The plasmid according to claim 9, wherein the toxin-antitoxin system enhances plasmid stability in a halophilic microorganism.

11. The plasmid according to claim 9 or 10, wherein the plasmid comprises a polynucleotide which encodes an antitoxin and a polynucleotide which encodes a toxin.

12. The plasmid according to claim 11 , wherein the polynucleotide derived from a plasmid that is endogenous to a halophilic microorganism encodes a toxin, encodes an antitoxin, encodes a replication initiation protein, and / or is an origin of replication (on).

13. The plasmid according to claim 11 or 12, wherein the polynucleotide which encodes an antitoxin comprises a nucleic acid sequence having at least 40% sequence identity to SEQ ID NO:14.

14. The plasmid according any one of claims 11 to 13, wherein the polynucleotide which encodes a toxin comprises a nucleic acid sequence having at least 40% sequence identity to SEQ ID NO:24.

15. The plasmid according to any one of claims 11 to 14, wherein the polynucleotide which encodes a replication initiation protein comprises a nucleic acid sequence having at least 40% sequence identity to SEQ ID NO:25.

16. The plasmid according to any one of claims 11 to 15, wherein the ori comprises a nucleic acid sequence having at least 40% sequence identity to SEQ ID NO:26.

17. The plasmid according to any one of claims 11 to 16, wherein expression of the gene encoding an enzyme is controlled by a constitutive promoter.

18. The plasmid according to any one of claims 11 to 17, wherein the gene encoding an enzyme encodes a transferase or a hydrolase.

19. The plasmid according to any one of claims 11 to 18, wherein the gene encoding an enzyme encodes a citramalate producing enzyme or a starch degrading enzyme.

20. The plasmid according to any one of claims 11 to 19, wherein the plasmid comprises an operon comprising a gene encoding a citramalate producing enzyme and a gene encoding a starch degrading enzyme.

21. The plasmid according to claim 20, wherein the operon is controlled by a constitutive promoter.

22. The plasmid according to any one of claims 11 to 21 , wherein the plasmid is capable of expressing a heterologous enzyme in a Halomonas bacterium.

23. A halophilic microorganism comprising a plasmid according to any one of claims 11 to 22.

24. A method of producing a hybrid plasmid, the method comprising:(i) identifying a plasmid that is endogenous to a halophilic microorganism, wherein the plasmid comprises a toxin-antitoxin system;(ii) isolating or synthesising the plasmid identified in step (i);(ii) modifying the plasmid to comprise a gene encoding an enzyme, wherein the enzyme is heterologous to the halophilic microorganism of step (i).

25. The method of generating a hybrid plasmid according to claim 24, wherein the hybrid plasmid is a plasmid according to any one of claims 11 to 22.

26. A method of modifying a halophilic microorganism, wherein the microorganism comprises an endogenous plasmid, wherein the endogenous plasmid comprises one or more genes encoding a toxinantitoxin system, the method comprising:(i) curing an endogenous plasmid from the microorganism, and(ii) modifying the microorganism to express a recombinant vector, wherein the recombinant vector comprises one or more genes encoding a toxin-antitoxin system, and a gene encoding an enzyme.

27. The method according to claim 26, wherein the recombinant vector is a plasmid according to any one of claims 9 to 25.

28. A method of producing a carbon compound, wherein the method comprises the provision of a halophilic microorganism, a culture medium, and a carbon source, wherein the halophilic microorganism expresses a recombinant plasmid, wherein the recombinant plasmid comprises one or more genes encoding a toxin-antitoxin system, and a gene encoding an enzyme. wherein the halophilic microorganism is contacted with the carbon source in the culture medium, and the carbon compound is produced through enzyme activity.

29. The method according to according to any one of claims 26 to 28, wherein the recombinant plasmid is a recombinant plasmid according to any one of claims 11 to 24.

30. A method of producing citramalate, wherein the method comprises the culture of a halophilic microorganism according to any one of claims 1 to 8.

31. A method of producing citramalate, wherein the method comprises the provision of a halophilic microorganism, a culture medium, and a carbon source, wherein the halophilic microorganism expresses a heterologous citramalate synthase,wherein the halophilic microorganism is contacted with the carbon source in the culture medium, and citramalate is produced through citramalate synthase activity.

32. The method according to any one of claims 28 to 31 , wherein the culture medium comprises at least 0.2 M NaCI.

33. The method according to any one of claims 28 to 32, wherein the culture medium comprises at least 0.5 M NaCI.

34. The method according to any one of claims 28 to 33, wherein the culture medium is not sterilised before the culture medium is contacted with the halophilic microorganism.

35. The method according to any one of claims 28 to 34, wherein the culture medium is not autoclaved, filtered, heated, boiled, irradiated, or treated with a gas, before the culture medium is contacted with the halophilic microorganism.

36. The method according to any one of claims 28 to 35, wherein the carbon source is a waste carbon source.

37. The method according to any one of claims 28 to 36, wherein the carbon source is glucose, glycerol, starch, sucrose, and / or carbon dioxide.

38. The method according to any one of claims 28 to 37, wherein the carbon source is derived from agro-industrial waste.39 The method according to any one of claims 28 to 38, wherein the method comprises the fermentation of the halophilic microorganism.

40. The method according to claim 39, wherein the method comprises the addition of further halophilic microorganisms to the culture medium, after fermentation has started.

41. The method according to any one of claims 28 to 40, wherein the method is performed in the absence of antibiotics.

42. The method according to any one of claims 28 to 41 , wherein the heterologous citramalate synthase is expressed constitutively.

43. The method according to any one of claims 28 to 42, wherein the heterologous citramalate synthase is expressed in the absence of an inducer.

44. The method according to any one of claims 31 to 43, wherein the halophilic microorganism is the halophilic organism according to any one of claims 1 to 8.

Images