Substance treatment method, reaction detection method, substance treatment device, and reaction detection device

Abstract

A flow cell 1, and DEX and PEG having an inherent tendency to phase separate from each other are prepared, the flow cell 1 comprising a chamber array device 11 that has a plurality of chambers 14 and a cover body 21 that defines a flow passage 40. Such phase separation facilitates the positioning of DEX on a side having the chambers 14 and preferential distribution of a substance to DEX. The substance is mixed in PEG. Next, DEX is introduced into the flow passage 40 to fill the chambers 14 and the flow passage 40 with the DEX. Thereafter, the PEG is introduced into the flow passage 40 and brought into contact with the DEX to concentrate the substance in the DEX in the chambers 14. The introduction of DEX and the introduction of PEG are each performed at least once, and after the last introduction, the DEX is encapsulated in the chambers 14 by the PEG remaining in the flow passage.

Description

Material processing method, reaction detection method, material processing device, and reaction detection device

[0001] The present disclosure relates to a material processing method and a reaction detection method, and a material processing device and a reaction detection device.

[0002] Methods and devices for detecting reactions of substances have been developed in various fields, including academic research and medicine. Digital bioassays are a method of binarizing signals from microcompartments containing enzymes or enzyme-labeled molecules and quantifying them with single-molecule detection sensitivity. Digital bioassays use a chip with multiple microscopic spaces (chambers), and these chambers act as reaction sites (reactors) to detect biological reactions.

[0003] The present inventors have previously developed a method for containing and detecting microsubstances in multiple receptacles formed at mutually spaced locations (see, for example, Patent Document 1). This document describes a method for introducing a solvent containing the microsubstance into the space between the lower and upper layers of the receptacle, and then introducing a gas into this space to form droplets of the solvent containing the microsubstance within the receptacle. The receptacle has a bottom diameter of approximately 0.1 μm to 10 μm, a height (depth) of 0.1 μm to 10 μm, and a volume of approximately 1 zeptoliter to 1 attoliter.

[0004] Furthermore, the inventors have developed an on-chip concentration method for digital bioassays using a dextran / polyethylene glycol mixed aqueous two-phase system (DEX / PEG ATPS) (see, for example, Non-Patent Document 1). This document describes an experiment in which an IgY molecule against β-galactosidase was labeled with DBD to prepare Ab-DBD, and this Ab-DBD was loaded into a DEX droplet. β-galactosidase molecules spiked in a PEG solution were injected into the flow cell chamber together with a fluorescent substrate. This document also describes incubating the chip, loading oil to seal the DEX droplet with oil, and then performing a digital bioassay for β-galactosidase.

[0005] WO 2018 / 181488 (Claim 1, paragraph 0022, etc.)

[0006] Yoshihiro Minagawa, et.al.; “On-Chip Enrichment System for DigitalBioassay Based on Aqueous Two-Phase System”. December 29, 2022, ACS Nano 2023,17, 1, 212-220, https: / / doi.org / 10.1021 / acsnano.2c06007

[0007] Conventionally, as in Non-Patent Document 1, oil has been used to seal droplets formed in a chamber of a flow cell. This oil also has the function of preventing droplet evaporation. However, this method requires a step of injecting oil after droplet formation, which is time-consuming. Furthermore, because the sealed droplets are covered with a water-insoluble oil, which is a non-aqueous solvent, once sealed with oil, it is difficult to introduce additional substances, such as water-soluble substances, into the droplets to perform further reactions.

[0008] An object of the present disclosure is to provide a substance processing method and a substance processing device that can seal droplets in a digital bioassay with a simple operation without using a sealing solvent and that can introduce additional substances even after sealing. Another object of the present disclosure is to provide a reaction detection method and a reaction detection device that can detect with high sensitivity the reaction of a substance in such a simply sealed droplet.

[0009] The present disclosure is as follows: [1] A material processing method for retaining and / or concentrating a substance using a flow cell including a chamber array device having a plurality of chambers, each of which is a recess with one end open, and a cover that communicates with the openings of the chambers and defines a flow path provided in common to the plurality of chambers, the method comprising: a mixing step of mixing the substance with a first solvent and / or a second solvent, wherein the first solvent and the second solvent are aqueous and undergo phase separation when left standing at room temperature after mixing, and have the property that when the phase separation occurs in a region of the flow cell surrounded by the chambers and the flow paths, the first solvent separates toward the chamber side, and the substance is preferentially distributed into the first solvent rather than the second solvent; a first inflow step of inflowing one of the first solvent and the second solvent into the flow path to fill the chambers and the flow path with the solvent; a second inflowing step of inflowing the other of the first solvent and the second solvent into the flow path, causing phase separation of the first solvent to the chamber side and the second solvent to the flow path side, and suppressing diffusion of the substance contained in the first solvent in the chamber into the second solvent to be retained in the chamber, and / or transferring the substance contained in the second solvent to the first solvent in the chamber to be concentrated, wherein the inflowing of the first solvent and the inflowing of the second solvent are each performed at least once, and after the final inflow, the first solvent is sealed in the chamber by the second solvent remaining in the flow path, with the substance being retained and / or concentrated in the first solvent in the chamber.

[0010] In this way, the first solvent in the chamber is sealed with the second solvent, eliminating the need for sealing with a sealing solvent such as oil as in the past, and the second solvent can be sealed with a simple operation. Furthermore, by adding a substance to the second solvent and introducing it into the channel, it becomes possible to introduce an additional substance into the first solvent in the chamber even after sealing.

[0011] [2] The material processing method described in [1] above, characterized in that the material contains multiple types of substances, the second solvent is introduced two or more times, and the multiple types of substances are sequentially concentrated and / or retained in the first solvent in the chamber by introducing the second solvent two or more times.

[0012] In this way, by sequentially introducing multiple types of substances into the first solvent in the chamber by injecting the second solvent two or more times, the substances can be concentrated in the chamber in stages, thereby enabling highly scalable assays, such as reacting substances in the chamber in stages.

[0013] [3] The substance processing method according to [2] above, wherein the substance includes at least a target substance to be detected and a reactant that reacts with the target substance to produce a fluorescent substance that emits fluorescence, and is at least one of the following (a) to (c): (a) the reactant has a tag that improves partitionability in the first solvent, (b) the substance further includes a target capture substance that captures the target substance, the target capture substance having a tag that improves partitionability in the first solvent, or (c) the substance further includes a fluorescence capture substance that captures the fluorescent substance, the fluorescence capture substance having a tag that improves partitionability in the first solvent.

[0014] In this way, the reactant, target substance, and fluorescent substance are concentrated and retained in the first solvent by (a) to (c), respectively, and therefore, any one of (a) to (c) makes it easier to detect the reaction between the target substance and the reactant in the first solvent in the chamber.

[0015] [4] The method for processing a substance according to [3] above, wherein the tag is selected from the group consisting of a dextran-binding region derived from the lactic acid bacterium "Leuconostoc mesenteroides", dextran, dextran-like molecular polymers, DNA, RNA and chemically modified molecules thereof, and nucleic acid-like molecular polymers.

[0016] The use of such a tag can improve the partitioning of the substance into the first solvent (especially dextran).

[0017] [5] The material processing method described in [3] above, characterized in that a target material flow-in process of flowing the second solvent containing the target material is carried out after a reactant flow-in process of flowing the second solvent containing the reactant.

[0018] In this way, the reactant is first flowed into the channel, and then the target substance is flowed into the channel, so that after the target substance has flowed in, it is possible to flow in additional substances, etc., thereby improving the scalability of the experiment.

[0019] [6] The material processing method described in [5] above, characterized in that the target substance flow process is performed two or more times, thereby sequentially concentrating and / or retaining the target substance in the first solvent in the chamber multiple times.

[0020] In this way, the target substance can be introduced more than once, making it possible to concentrate and retain the target substance within the chamber multiple times, thereby improving the detection sensitivity of the target substance.

[0021] [7] The material processing method according to [1], wherein the first solvent and the second solvent are selected from the combinations shown in Nos. 1 to 12 in Table 1 below.

[0022] In this way, a solvent can be selected and used from a plurality of combinations of the first solvent and the second solvent.

[0023] [8] The method for processing a substance according to [7] above, wherein the first solvent is an aqueous solution of dextran, and the second solvent is an aqueous solution of polyethylene glycol.

[0024] In this way, by using an aqueous solution of dextran and an aqueous solution of polyethylene glycol, which tend to undergo phase separation, it is possible to retain the first solvent (dextran) within the chamber.

[0025] [9] A reaction detection method for detecting a reaction of the substance retained and / or concentrated by the substance processing method described in [1] above, characterized by comprising a detection step of detecting a reaction of the substance in the first solvent in the chamber while the first solvent in the chamber is sealed with the second solvent.

[0026] According to this embodiment, the reaction of a substance can be detected while the first solvent is sealed with the second solvent, so that the reaction of a substance highly concentrated in a chamber can be detected with high sensitivity through simple operations.

[0027]

[10] The reaction detection method described in [9] above, wherein the substance includes at least: a target RNA; a crRNA containing a sequence complementary to a specific region of the target RNA; Cas13 that forms a complex with the crRNA, and when it binds to the target RNA using the crRNA as a guide RNA, forms an activation complex and cleaves the target RNA; and a fluorescently labeled probe that has a sequence that can be cleaved by the activation complex, is bound to a fluorescent dye, and is cleaved by the activation complex to emit fluorescence; and the detection step comprises measuring a chamber containing the target RNA by detecting the fluorescence.

[0028] According to this embodiment, target RNA having a specific sequence can be detected with high sensitivity using Cas13 and crRNA.

[0029]

[11] The reaction detection method described in

[11] above, wherein the fluorescently labeled probe comprises: an oligonucleic acid; a fluorescent dye that is linked to a first position of the oligonucleic acid and emits fluorescence; and a quencher molecule that is linked to a second position of the oligonucleic acid and absorbs the fluorescence of the fluorescent dye, and the oligonucleic acid has a cleavage sequence between the first position and the second position that is cleaved by the activation complex.

[0030] According to this embodiment, the fluorescence of the fluorescently labeled probe before the activation complex is formed is inhibited by the proximity of the fluorescent dye and the quencher molecule, but when the activation complex is formed, the oligonucleic acid is cleaved at the cleavage sequence, separating the fluorescent dye and the quencher molecule, thereby enabling highly sensitive detection of the target RNA.

[0031]

[12] The reaction detection method described in

[11] above, wherein the oligonucleic acid has a tag that improves partitionability in the first solvent, located closer to the first position than the cleavage sequence.

[0032] According to this embodiment, the oligonucleic acid is equipped with a tag closer to the first position (the position where the fluorescent dye is bound) than the cleavage sequence. Therefore, even when the oligonucleic acid is cleaved by the activation complex, the fluorescent dye remains in the first solvent in the chamber, but the quencher molecule, which does not have a tag attached, diffuses into the second solvent outside the chamber. Therefore, reducing the quencher molecule in the chamber increases the fluorescence intensity of the fluorescent dye in the chamber, enabling highly sensitive detection of the target RNA.

[0033]

[13] A material processing apparatus for retaining and / or concentrating a substance, comprising: a flow cell including a chamber array device having a plurality of chambers, each chamber being a recess with one open end; and a flow path that communicates with the openings of the chambers and is provided commonly to the plurality of chambers; a first solvent and a second solvent that are aqueous and undergo phase separation when left standing at room temperature after mixing, the first solvent and the second solvent having a property that when phase separation occurs in a region surrounded by the chambers and the flow path of the flow cell, the first solvent separates toward the chamber side, and a property that the substance is preferentially distributed into the first solvent rather than the second solvent; a mixing means for mixing the substance into the first solvent and / or the second solvent; and a first inflow means for flowing either the first solvent or the second solvent into the flow path to fill the chambers and the flow path with the solvent. and a second inflow means for inflowing the other of the first solvent and the second solvent into the flow path, causing phase separation of the first solvent toward the chamber side and the second solvent toward the flow path side, and bringing the first solvent into contact with the second solvent, thereby suppressing diffusion of the substance contained in the first solvent in the chamber into the second solvent and retaining it in the chamber, and / or transferring the substance contained in the second solvent into the first solvent in the chamber and concentrating it, wherein the inflow of the first solvent and the inflow of the second solvent are each performed at least once, and after the final inflow, the first solvent is sealed in the chamber by the second solvent remaining in the flow path, with the substance being retained and / or concentrated in the first solvent in the chamber.

[0034] In this way, the first solvent in the chamber is sealed with the second solvent, eliminating the need for sealing with a sealing solvent such as oil as in the past, and the second solvent can be sealed with a simple operation. Furthermore, by adding a substance to the second solvent and introducing it into the channel, it becomes possible to introduce an additional substance into the first solvent in the chamber even after sealing.

[0035]

[14] The material treatment device according to

[13] , characterized in that the material contains a plurality of types of substance, the second solvent is introduced two or more times, and the device has a means for sequentially concentrating and / or retaining the plurality of types of substance in the first solvent in the chamber by introducing the second solvent two or more times.

[0036] In this way, by sequentially introducing multiple types of substances into the first solvent in the chamber by injecting the second solvent two or more times, the substances can be concentrated in the chamber in stages, thereby enabling highly scalable assays, such as reacting substances in the chamber in stages.

[0037]

[15] The material processing device according to

[14] , characterized in that the substance includes at least a target substance to be detected and a reactant that reacts with the target substance to produce a fluorescent substance that emits fluorescence, and is at least one of the following (a) to (c): (a) the reactant has a tag that improves partitionability in the first solvent, (b) the substance further includes a target capture substance that captures the target substance, the target capture substance having a tag that improves partitionability in the first solvent, or (c) the substance further includes a fluorescent capture substance that captures the fluorescent substance, the fluorescent capture substance having a tag that improves partitionability in the first solvent.

[0038] In this way, the reactant, target substance, and fluorescent substance are concentrated and retained in the first solvent by (a) to (c), respectively, and therefore, any one of (a) to (c) makes it easier to detect the reaction between the target substance and the reactant in the first solvent in the chamber.

[0039]

[16] The material processing device according to

[15] above, characterized in that the tag is selected from the group consisting of a dextran binding region derived from the lactic acid bacterium "Leuconostoc mesenteroides", dextran, dextran-like molecular polymers, DNA, RNA and chemically modified molecules thereof, and nucleic acid-like molecular polymers.

[0040] The use of such a tag can improve the partitioning of the substance into the first solvent (especially dextran).

[0041]

[17] A material processing apparatus according to

[15] , characterized in that it is provided with a target material inlet means for inflowing a second solvent containing the target material after a reactant inlet means for inflowing a second solvent containing the reactant.

[0042] In this way, the reactant is first flowed into the channel, and then the target substance is flowed into the channel, so that after the target substance has flowed in, it is possible to flow in additional substances, etc., thereby improving the scalability of the experiment.

[0043]

[18] The material processing device described in

[17] , characterized in that the target substance inflow means is performed two or more times, thereby sequentially concentrating and / or retaining the target substance in the first solvent in the chamber multiple times.

[0044] In this way, the target substance can be introduced more than once, making it possible to concentrate and retain the target substance within the chamber multiple times, thereby improving the detection sensitivity of the target substance.

[0045]

[19] The material processing apparatus according to the above

[13] , wherein the first solvent and the second solvent are selected from the combinations shown in Nos. 1 to 12 in Table 2 below.

[0046] In this way, a solvent can be selected and used from a plurality of combinations of the first solvent and the second solvent.

[0047]

[20] The material processing device according to

[19] above, wherein the first solvent is an aqueous solution of dextran, and the second solvent is an aqueous solution of polyethylene glycol.

[0048] In this way, by using an aqueous solution of dextran and an aqueous solution of polyethylene glycol, which tend to undergo phase separation, it is possible to retain the first solvent (dextran) within the chamber.

[0049]

[21] A reaction detection device for detecting a reaction of the substance retained and / or concentrated by the substance processing device described in

[13] above, characterized in that the reaction detection device further comprises a detection means for detecting a reaction of the substance in the first solvent in the chamber while the first solvent in the chamber is sealed with the second solvent.

[0050] According to the present disclosure, the reaction of a substance can be detected while the first solvent is sealed with the second solvent, thereby enabling highly sensitive detection of the reaction of a substance highly concentrated in a chamber with simple operations.

[0051]

[22] The reaction detection device described in

[22] above, characterized in that it comprises a state detection means for detecting whether the flow cell is maintained in a state suitable for a reaction, and a state notification means for notifying the state based on the state detection means.

[0052] According to the present disclosure, the chamber is maintained in a state suitable for reaction and the reaction detection sensitivity can be improved by detecting whether the state is suitable for reaction when the first solvent is sealed with the second solvent and reporting the state.

[0053] [Other Technical Feature 1] [a-1] A fluorescently labeled probe that is cleaved by a specific enzyme to emit fluorescence, comprising: an oligonucleic acid; a fluorescent dye that is linked to a first position of the oligonucleic acid and emits fluorescence; and a quencher molecule that is linked to a second position of the oligonucleic acid and absorbs the fluorescence of the fluorescent dye, wherein the oligonucleic acid has a cleavage sequence between the first position and the second position that is cleaved by the enzyme.

[0054] [a-2] The reaction detection method described in [a-1] above, characterized in that the oligonucleic acid has a tag that improves its partitionability in a specific solvent, located closer to the first position than the cleavage sequence.

[0055] According to the present disclosure, it is possible to provide a substance processing method and a substance processing device that can seal a droplet in a digital bioassay with a simple operation without using a sealing solvent and that can introduce an additional substance into the chamber even after sealing. Another object of the present disclosure is to provide a reaction detection method and a reaction detection device that can detect the reaction of a substance in such a simply sealed droplet with high sensitivity.

[0056] 1 is a perspective exploded view showing one embodiment of a flow cell. It is a side cross-sectional view of the flow cell. It is a side cross-sectional view showing a procedure for concentrating and retaining a substance in a chamber using the flow cell. It is a conceptual diagram illustrating a system sealed with a sealing solvent and an oil-free system. It is a conceptual diagram illustrating an oil-free system using a dextran-bound fluorescent dye. It is a conceptual diagram illustrating an oil-free system using Cas13. It is a conceptual diagram illustrating a fluorescent probe constructed using avidin-biotin interaction. It is a conceptual diagram illustrating an oil-free system using the fluorescent probe. It is an example of an image obtained by measuring fluorescence of a flow cell in a system using the fluorescent probe. It is a diagram schematically illustrating the solvent inflow process in a system using the fluorescent probe. It is a diagram showing the results of an experiment using the system using the fluorescent probe. It is a result of time lapse observation using a fluorescence microscope in an oil-free system using Cas13. It is a diagram schematically illustrating the solvent inflow process in an experiment using the fluorescent probe and in which a target is finally flowed multiple times. It is a diagram showing the results of an experiment using a system in which a target is finally flowed multiple times. It is a diagram showing an overview and results of an experiment in an oil-free system using β-galactosidase. FIG. 1 shows an outline of an experiment in an oil-free system using β-galactosidase and DBD-Cys4. FIG. 2 shows the results of an experiment verifying the effect of DBD-Cys4. FIG. 3 shows the results of an experiment verifying digital measurement in a system using β-galactosidase. FIG. 4 shows an outline of a system that utilizes a reaction to specifically cleave RNA using Cas13. FIG. 5 is a conceptual diagram explaining a system for concentrating target DNA using DBD-capture DNA. FIG. 6 shows the results of an experiment for concentrating target DNA using the above DBD-capture DNA.

[0057] 1. Substance Processing Method A substance processing method according to one embodiment of the present invention will be described below. This embodiment is a substance processing method for retaining and / or concentrating a substance, and includes a flow cell preparation step, a solvent preparation step, a mixing step, and a first flow-in step. Each step will be described in order below. In this embodiment, the substances are exemplified by enzyme E and substrate S, which are biological substances, but the present invention is not limited to this and can be applied to various substances.

[0058] (1) Substances: In the present disclosure, various substances can be used as targets for retention or retention and concentration, including biological substances such as proteins and nucleic acids, as well as non-biological substances that are not biological substances. Examples of biological substances include nucleic acids such as DNA and RNA, peptides, and proteins. These may be naturally occurring or artificially synthesized. Specific examples of biological substances include the enzymes of this embodiment, as well as substrates, antibodies, antigens, polymerases, receptors, ribosomes, hormones, and cytokines. These biological substances can be derived from various organisms, such as viruses, prokaryotes, and eukaryotes. Non-biological substances include fluorescent substances and quenchers.

[0059] (1) Flow Cell Preparation Step First, a flow cell is prepared that includes multiple chambers and a flow path located above the multiple chambers through which a solvent flows (flow cell preparation step). The flow cell 1 used in this embodiment will be described with reference to Figures 1 and 2. Figure 1 is an exploded perspective view of the flow cell 1, and Figure 2 is a side cross-sectional view of the flow cell 1.

[0060] As shown in Figure 1, the flow cell 1 is a chip composed of a base 10, a cover 20, and a spacer 30. The base 10 is composed of a chamber array device 11, and a plurality of chambers 14, which are minute spaces, are provided on the surface of the chamber array device 11. The chamber array device 11 is a plate-like member (substrate) made of glass, acrylic resin, or the like. The chambers 14 are recesses formed on the surface of the chamber array device 11 and open at one end.

[0061] As shown in FIG. 2 , the chamber 14 is a space defined by a bottom surface 12 and a side surface 13. Each chamber 14 has a volume of 1 nanoliter or less, and as described below, a first solvent is contained therein, and a substance is concentrated in this first solvent. When detecting the reaction of a single molecule of a substance using a digital bioassay, the volume of the chamber 14 is generally 10 picoliters or less, preferably 1 picoliter or less, more preferably 100 femtoliters or less, and particularly preferably 50 femtoliters or less, depending on the molecular weight of the substance. There is no particular lower limit for the chamber 14, but a volume of 1 zeptoliter or more is preferred, and 1 attoliter or more is more preferred. When a substance or the like is reacted inside the chamber, the chamber serves as a reactor, and therefore, the chamber may be referred to herein as a "reactor." Cases in which a substance is not reacted within the chamber 14, such as simply concentrating a substance within the chamber 14 to prevent reaction, or preventing leakage of a substance from the chamber 14, are also included in embodiments of the present invention. Furthermore, when reacting substances in such a reactor, the flow cell 1 can also be referred to as a "reactor chip." In addition, in a flat chip such as that of this embodiment, the chamber 14 can also be referred to as a "well." Furthermore, the chamber 14 is not limited to the shape of a hole as in this embodiment, and may have other shapes such as a groove. Furthermore, anything that separates into two aqueous layers and forms droplets is included within the scope of the concept of "chamber" in this disclosure.

[0062] These figures are schematic representations of the flow cell 1, and for ease of explanation, the number of chambers 14 is reduced. In a flow cell 1 actually used in experiments, the number of chambers 14 is approximately 500,000 to 5,000,000, for example, approximately 1,000,000.

[0063] The chambers 14 can be formed on the surface of the chamber array device 11 using photolithographic microfabrication techniques. The photolithographic processing method involves preparing a chamber array device 11 coated with a photoresist such as a fluorine-based resin, placing a photomask on top of the chamber array device 11 with the desired pattern formed thereon, and then irradiating the photomask with ultraviolet light to transfer the pattern of the photomask onto the photoresist. The photoresist is then etched with an etching solution to produce a chamber array device 11 with the desired pattern formed thereon.

[0064] The chamber 14 is preferably cylindrical, as shown in the figure. The diameter of the chamber 14 (the diameter of the bottom surface 12 in the figure) is within the range of 1 to 100 μm, preferably within the range of 5 to 20 μm. The depth of the chamber 14 (the height of the side surface 13) is within the range of 1 to 100 μm, preferably within the range of 5 to 20 μm. From the viewpoint of processing accuracy, the ratio of the diameter (the diameter of the bottom surface 12 in the figure) to the depth (the height of the side surface 13) of the chamber 14 is preferably 5 or less, more preferably 2 or less. From the viewpoint of solvent retention in the chamber 14, this ratio is preferably 1.5 or less. If this ratio is greater than 1.5, the depth of the chamber 14 becomes shallow relative to the diameter, making it difficult to accommodate the solvent (dextran aqueous solution 50). If this ratio is greater than 1.5, the dextran aqueous solution 50 in the chamber 14 will be swept away by the other solvent (polyethylene glycol aqueous solution 60), making it difficult to retain the dextran aqueous solution 50 within the chamber 14. There is no particular lower limit to this ratio, but it is preferably 0.1 or more, and more preferably 0.5 or more.

[0065] 1, the cover 20 is composed of a cover body 21, a solvent inlet 22, and a solvent outlet 23. The cover body 21 is a plate-shaped member made of glass, resin, or the like. A solvent inlet 22 is provided in a part of the cover body 21, penetrating from the top surface to the bottom surface of the cover body 21. A solvent outlet 23 is provided in another part of the cover body 21, penetrating from the top surface to the bottom surface of the cover body 21. These are openings for the inflow and outflow of the solvent, respectively.

[0066] The spacer 30 is disposed between the base 10 and the cover 20 and serves to seal the entire sides of the base 10 and the cover 20. The spacer 30 has a rectangular outer edge in a top view, with an opening formed inside the outer edge. The spacer 30 is made of double-sided tape, rubber, or the like. A flow path 40 is formed in the area surrounded by the upper surface of the chamber array device 11 of the base 10, the lower surface of the cover body 21 of the cover 20, and the inner wall surface of the spacer 30. The flow path 40 is a sealed space that is not connected to the outside except for the solvent inlet 22 and the solvent outlet 23. The flow path 40 is a space that communicates with the openings of the recesses that form the chambers 14, communicates with all of the multiple chambers 14, and is a space that is provided in common to these multiple chambers 14. To prevent adhesion of substances, the surfaces of the base 10 and the cover 20 facing the flow path 40 may be pre-treated with a blocking liquid such as a surfactant.

[0067] The volume of the flow channel 40 can be set appropriately depending on the properties of the solvent and substance, for example, within the range of 1 to 100 μl, preferably within the range of 5 to 50 μl, and more preferably within the range of 7 to 8 μl. The ratio of the total volume of the multiple chambers 14 to the volume of the flow channel 40 can be set appropriately, but is preferably within the range of 1:50 to 1:200, and particularly preferably approximately 1:100. By keeping the volume ratio within this range, droplets can be efficiently formed in the chambers 14.

[0068] (2) Solvent Preparation Step The solvent preparation step involves preparing two aqueous solvents (a first solvent and a second solvent). When these solvents are mixed and allowed to stand at room temperature (30°C), spontaneous phase separation occurs between the first and second solvents if their respective critical concentrations exceed their respective critical concentrations. Furthermore, the first and second solvents possess the property that when the first and second solvents are mixed with a substance, the first and second solvents undergo phase separation, and the substance reaches distribution equilibrium, the concentration of the substance in the first solvent is higher than the concentration of the substance in the second solvent. In other words, the "partition coefficient," defined by the following formula, exceeds 1: Partition coefficient = concentration of substance dissolved in the first solvent at distribution equilibrium / concentration of substance dissolved in the second solvent. Here, the partition coefficient is preferably 10 or greater, and more preferably 50 or greater. The higher the partition coefficient, the easier it is for a substance to preferentially migrate into the first solvent and concentrate in the first solvent when the first and second solvents are phase-separated. In this specification, the property of a substance preferentially distributing into one of two phase-separating solvents is sometimes referred to as "distribution property." Due to such solvent properties, the substance preferentially distributes into the first solvent over the second solvent (i.e., the substance more easily migrates into the first solvent than into the second solvent). When the specific gravity of the first solvent is greater than that of the second solvent, phase separation results in the first solvent becoming the lower layer and the second solvent becoming the upper layer.

[0069] Preferably, the first solvent is a dextran aqueous solution, and the second solvent is a polyethylene glycol aqueous solution. The dextran aqueous solution is obtained by dissolving dextran in a good solvent such as water, methanol, ethanol, benzene, or chloroform. Similarly, the polyethylene glycol aqueous solution is obtained by dissolving polyethylene glycol in a good solvent such as water, methanol, ethanol, benzene, or chloroform. In this embodiment, a dextran (DEX) aqueous solution is used as the first solvent, and a polyethylene glycol (PEG) aqueous solution is used as the second solvent.

[0070] The weight-average molecular weight (MW) of the dextran used in the first solvent can be set as appropriate, but is preferably within the range of 100,000 to 1,000,000, and more preferably within the range of 300,000 to 700,000. When a dextran-binding region derived from the lactic acid bacterium "Leuconostoc mesenteroides," described below, is attached to a substance as a tag, dextran derived from this lactic acid bacterium is preferred. The concentration of dextran contained in the dextran aqueous solution 50 can be set as appropriate, but is preferably within the range of 1 to 10 wt% (w / w), and more preferably within the range of 4 to 6 wt% (w / w).

[0071] The weight-average molecular weight (MW) of the polyethylene glycol used in the second solvent can be set as appropriate, but is, for example, within the range of 10,000 to 100,000, and preferably within the range of 20,000 to 50,000. The concentration of polyethylene glycol contained in the aqueous polyethylene glycol solution 60 can be set as appropriate, but is, for example, within the range of 1 to 10% (w / w), and is particularly preferably within the range of 4 to 6% (w / w). The aqueous dextran solution 50 and the aqueous polyethylene glycol solution 60 of this embodiment exceed the critical concentration.

[0072] The following combinations can also be used as the first solvent and second solvent in this embodiment. In the table below, the solutions from the top to "polyU aqueous solution" are "segregative" (segregated type) LLPS (liquid-liquid phase separation), and the solutions below that are "coaservation" (self-assembling type) LLPS. Such self-assembling type LLPS include not only the nucleic acids and intrinsically denatured proteins exemplified in Nos. 1 to 12 in the table below, but also various polymers.

[0073] (3) Mixing Step In the mixing step, the substance is mixed with the first solvent and / or the second solvent. That is, the substance may be mixed with the first solvent, the second solvent, or both solvents. In the embodiment shown in Figure 3, no substance is mixed with dextran, which is the first solvent, and the substances enzyme E and substrate S are mixed with polyethylene glycol, which is the second solvent.

[0074] (4) First Inflow Step In this step, the first solvent is flowed into the flow path 40 to retain the first solvent within the chamber. The steps following the first inflow step will be described below with reference to FIG. 3. As shown in FIG. 3( a), the tip 24 of a pipette (not shown) is inserted into the solvent inlet 22 of the cover 20, and the dextran aqueous solution 50, which is the first solvent, is first flowed into the flow path 40. This causes the dextran aqueous solution 50 to fill the chamber 14 and the flow path 40. The dextran aqueous solution 50 that overflows from the flow path 40 flows out through the solvent outlet 23 of the cover 20.

[0075] (5) Second Inflow Step In this step, the second solvent is introduced into the flow channel 40, bringing the first solvent held in the chamber 14 into contact with the second solvent. This transfers substances contained in the second solvent to the first solvent in the chamber 14. Furthermore, in this step, if any first solvent remains in the flow channel 40, it is pushed out of the flow channel 40. Note that the concentration of the dextran aqueous solution 50 in the chamber 14 remains almost unchanged upon contact with the polyethylene glycol aqueous solution 60, maintaining the concentration at the first inflow step. Here, "contact" includes mixing the two aqueous solutions and leaving them standing at a constant temperature for a constant period of time (incubation), maintaining a stirred state, and the like. The flow rate at which the second solvent is introduced into the flow channel 40 can be set as appropriate, but can be, for example, 0.1 μl / sec to 10 μl / sec. The temperature at which the second solvent is allowed to flow into the flow path 40 and allowed to stand can be set as appropriate depending on the properties of the solvents and substances, but is typically preferably in the range of 10 to 50°C, and more preferably in the range of 20 to 40°C. The time (contact time) for contacting the second solvent with the first solvent can be set as appropriate depending on the properties of the solvents and substances, but is typically 1 minute or more, preferably 5 minutes or more, and more preferably 10 minutes or more. A contact time of 10 minutes or more makes it easier for the substances in the second solvent to be sufficiently concentrated in the first solvent in the chamber 14. There is no particular upper limit to the contact time, but it is typically 120 minutes or less, and more preferably 60 minutes or less. A contact time of 60 minutes or less makes it difficult for the substances concentrated in the first solvent in the chamber 14 to diffuse into the second solvent.

[0076] To explain this step in accordance with the present embodiment, as shown in FIG. 3( b), a polyethylene glycol aqueous solution 60, which is the second solvent, is introduced into the flow channel 40 through the solvent inlet 22 of the cover 20. As a result, the dextran aqueous solution 50 remaining in the flow channel 40 is pushed out through the solvent outlet 23. Because the dextran and polyethylene glycol concentrations exceed their critical concentrations, the dextran aqueous solution 50 and the polyethylene glycol aqueous solution 60 undergo phase separation. As a result, a layer of dextran with a higher specific gravity is formed in the lower layer (in the chamber 14), and a layer of polyethylene glycol with a lower specific gravity is formed in the upper layer (in the flow channel 40). Thus, compared to conventional methods using a pipette, the method of the present embodiment allows the dextran aqueous solution 50 to be retained in the multiple chambers 14 by the simple operation of introducing the dextran aqueous solution 50 into the flow channel 40.

[0077] The polyethylene glycol aqueous solution 60 contains the substances enzyme E and substrate S. Both enzyme E and substrate S have higher partition coefficients with respect to the dextran aqueous solution 50 than with respect to the polyethylene glycol aqueous solution 60. Therefore, as shown in FIG. 3( c), when the polyethylene glycol aqueous solution 60 comes into contact with the dextran aqueous solution 50 held in the chamber 14, the enzyme E and substrate S migrate into the dextran aqueous solution 50 and are concentrated in the chamber 14. The substances concentrated in the dextran aqueous solution 50 in the chamber 14 are difficult to diffuse into the polyethylene glycol aqueous solution 60 in the flow path 40 due to differences in partitioning properties, and are therefore retained in a concentrated state in the dextran aqueous solution 50. The dextran aqueous solution 50 and the polyethylene glycol aqueous solution 60 are in sufficient contact within the chamber 14 and the flow path 40, so that the substances are concentrated at a high concentration in the dextran aqueous solution 50 in the chamber 14. Note that, in FIG. 3, the substances enzyme E and substrate S are mixed with the polyethylene glycol aqueous solution 60 and then introduced simultaneously into the flow path 40, but this is not limiting. For example, an aqueous polyethylene glycol solution 60 mixed with only the enzyme E may first be introduced into the flow channel 40 and transferred into the aqueous dextran solution 50 in the chamber 14, and then an aqueous polyethylene glycol solution 60 mixed with only the substrate S may be introduced into the flow channel 40, transferring the substrate S into the chamber 14 and causing it to react with the enzyme E. Similarly, the detection reagent may be mixed into the aqueous polyethylene glycol solution 60 together with these substances and introduced into the flow channel 40, or may be mixed into a separate aqueous polyethylene glycol solution 60 from the substances and introduced into the flow channel 40 separately from the substances.

[0078] (6) First Inflow and Second Inflow The inflow of the first solvent and the inflow of the second solvent are each performed at least once. In this embodiment, the process of introducing the dextran aqueous solution 50, which is the first solvent, into the flow channel 40 (hereinafter referred to as "DEX inflow") and the process of introducing the polyethylene glycol aqueous solution 60, which is the second solvent, into the flow channel 40 (hereinafter referred to as "PEG inflow") are performed at least once. For example, DEX inflow can be performed first, followed by PEG inflow. Furthermore, DEX inflow and PEG inflow can each be performed two or more times. For example, the solvents can be inflowed first, followed by PEG inflow (first time), and then PEG inflow (second time).

[0079] When the substance contains multiple types of substances, the substances may be sequentially introduced into the flow channel 40 during multiple DEX and PEG infusions. In this case, PEG infusion is performed two or more times, with different substances mixed into the aqueous polyethylene glycol solution 60 for each infusion. It is preferable that different substances are introduced into the aqueous dextran solution 50 in the chamber 14 by each of the two or more PEG infusions. This allows the reaction of the substances in the chamber 14 to occur in stages, enabling highly scalable assays. For example, in the above example of DEX infusion, PEG infusion (first time), and PEG infusion (second time), the enzyme is mixed with the solvent during the first PEG infusion, and the substrate is mixed with the solvent during the second PEG infusion, and then introduced into the flow channel 40.

[0080] After the final inflow of DEX and PEG, the substance is retained and / or concentrated in the aqueous dextran solution 50 in the chamber 14. In this state, the aqueous dextran solution 50 is sealed within the chamber 14 by the aqueous polyethylene glycol solution 60 remaining in the flow channel 40. The temperature at which the solvent introduced into the flow channel 40 after the final inflow is allowed to stand is typically preferably within a range of 10 to 50°C, more preferably within a range of 20 to 40°C. The time for which the solvent introduced into the flow channel 40 is retained after the final inflow is typically 1 minute or longer, preferably 5 minutes or longer, and more preferably 10 minutes or longer.

[0081] As described above, in the present disclosure, the space 40 above the chamber 14 is sealed with the polyethylene glycol aqueous solution 60, rather than with a sealing solvent such as oil as in the past. This eliminates the need for a step of introducing a sealing solvent, saving time and effort. Furthermore, because the upper side of the dextran aqueous solution 50 in the chamber 14 is covered with the polyethylene glycol aqueous solution 60, drying of the dextran aqueous solution 50 can be prevented. Hereinafter, not using a sealing solvent as in the present disclosure may be referred to as "oil-free."

[0082] Furthermore, since the space 40 is not sealed with a sealing solvent but is sealed with the polyethylene glycol aqueous solution 60, an additional substance can be introduced into the chamber 14 by further inflow of DEX or PEG. This allows for a more scalable assay, such as detecting a substance in the chamber 14 using an additional substance.

[0083] (7) Tags

[0084] DNA and RNA have higher partitionability in the dextran aqueous solution 50 than in the polyethylene glycol aqueous solution 60, and are therefore easily concentrated in the chamber 14. Double-stranded DNA, which is a double helix, has particularly high partitionability in the dextran aqueous solution 50. Proteins have different partitionability in the dextran aqueous solution 50 depending on their properties. For substances with low partitionability in the dextran aqueous solution 50, partitionability in the dextran aqueous solution 50 can be improved by adding a tag or the like.

[0085] In this example, the method further includes a step of adding a tag to the substance that improves its partitionability into the first solvent (tag addition step). When the first solvent is a dextran aqueous solution, an example of such a tag is the dextran-binding region of dextransucrase (EC 2.4.1.5). Here, dextransucrase derived from lactic acid bacteria such as the genus Leuconostoc or Streptococcus can be used, and for example, dextransucrase derived from "Leuconostoc mesenteroides" is preferred. When the substance is a protein, such a tag can be introduced into the substance by genetic recombination or the like. In this case, the tag can be introduced at any location, such as the C-terminus or N-terminus, of the protein.

[0086] Other examples of such tags include nucleic acids such as DNA and RNA, chemically modified molecules obtained by chemically modifying these nucleic acids, nucleic acid-like molecular polymers that are analogs of these nucleic acids or chemically modified molecules, dextran itself, and dextran-like molecular polymers. Examples of nucleic acid-like molecular polymers include natural DNA or RNA in which one or more of the bases, sugars, and phosphates have been modified. Examples of such bases include modified versions of natural adenine, guanine, cytosine, thymine, and uracil, such as N-methyladenine, N-benzoyladenine, 2-methylthioadenine, 2-aminoadenine, 7-methylguanine, N-isobutyrylguanine, 5-fluorocytosine, 5-bromocytosine, 5-methylcytosine, 4-N-methylcytosine, 4-N,N-dimethylcytosine, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, and 5,6-dihydrouracil. Examples of such sugars include modified natural ribose and deoxyribose, such as 2-fluoro-2-deoxyribose, 2-chloro-2-deoxyribose, 2-O-methylribose, 2-O-methoxyethylribose, and morpholino. Furthermore, examples of phosphates include modified natural phosphate groups, such as phosphorothioate, methylphosphonate, and methoxypropylphosphonate. Examples of dextran-like molecular polymers include cationized dextran, carboxymethyldextran, and diethylaminoethyldextran. In this modification, even if a substance has low partitionability in the first solvent, the partitionability of the substance in the first solvent can be improved by introducing such a tag.

[0087] When the material processing method of the present disclosure is used in the reaction detection method described below, examples of the substance include a target substance to be detected, a reactant that reacts with the target substance to produce a fluorescent substance that emits fluorescence, a target capture substance that captures the target substance, and a fluorescent capture substance that captures the fluorescent substance. Note that, while a target substance and a reactant are essential in a target substance detection system, the target capture substance and the fluorescent capture substance are optional. Examples of target substances include DNA, RNA, and antigens. For example, when detecting pathogenic microorganisms (such as bacteria and viruses), target substances include DNA, RNA, and antibodies, such as proteins, derived from the microorganisms. Examples of reactants include proteins that specifically bind to the target substance and nucleic acid (DNA, RNA) probes having sequences complementary to those of the target substance. Furthermore, examples of reactants include other substances that react with such proteins and probes, such as antibodies, enzymes, structural proteins, and signaling proteins. Examples of fluorescent substances include fluorescent dyes, which will be described below. Examples of target capture substances include antibodies that specifically bind to the target substance. Examples of fluorescent capture substances include peptides that bind to fluorescent substances. The above tag is preferably attached to at least one of the target substance, the reactive substance, the target capture substance, and the fluorescent capture substance, and is preferably attached to two or more of them.

[0088] Furthermore, it is preferable to carry out a step of injecting PEG containing a reactant (reactant injecting step) followed by a step of injecting PEG containing a target substance (target substance injecting step). Figure 9 is a schematic diagram showing an outline of an experiment in the examples described below. First, DEX and PEG containing no added substance are injecting into the flow channel 40 in this order ((a) in the figure). Next, PEG containing a reactant "DBD-RNA probe" is injecting into the flow channel 40, and the probe is retained in the chamber 14 (reactant injecting step: (b) in the figure). This "DBD-RNA probe" is an RNA probe bound to a dextran-binding domain, and has a sequence complementary to a specific sequence of the target substance "target RNA." Next, PEG containing the "target RNA" is injecting into the flow channel 40, and the PEG is retained in the chamber 14 (target substance injecting step: (c) in the figure). Finally, PEG containing the reactants Cas13 and crRNA is introduced into the flow channel 40 (reactant inflow step: (d) in the figure).

[0089] In this case, it is preferable to perform the target substance inflow step two or more times, thereby sequentially concentrating and / or retaining the target substance in the DEX in the chamber 14 multiple times. Figure 11 is a schematic diagram illustrating an outline of an experiment in the examples described below. First, DEX and PEG containing no added substance are inflowed into the flow channel 40 in this order ((a) in the figure). Next, PEG containing the reactants "DBD-RNA probe," "Cas13," and "crRNA" is inflowed into the flow channel 40, retaining the probe in the chamber 14 (reactant inflow step: (b) in the figure). Next, PEG containing "target RNA" is inflowed into the flow channel 40, retaining the probe in the chamber 14 (target substance inflow step: (c) in the figure). Finally, PEG containing "target RNA" is again introduced into the flow channel 40 (target substance inflow step: (d) in the figure). In this way, by introducing the target substance into the flow channel 40 multiple times, the target substance can be concentrated in the chamber 14 multiple times. This increases the concentration of the target substance in the chamber 14, improving the detection sensitivity of the target substance. The target substance inflow step is not limited to two times as shown in the figure, but can also be performed three or more times, for example, ten or more times.

[0090] (8) Modification 1 In the above embodiment, the dextran aqueous solution 50, which is the first solvent, is introduced in the first inflow step, followed by the polyethylene glycol aqueous solution 60, which is the second solvent, in the second inflow step. However, the present invention is not limited to this, and the steps may be performed in the reverse order. That is, in this modification, the polyethylene glycol aqueous solution 60, which is the second solvent, is introduced in the first inflow step, followed by the dextran aqueous solution 50, which is the first solvent, in the second inflow step. Even with this order, the first solvent can be retained in the chamber 14 and the substance can be concentrated therein. In this case, the polyethylene glycol aqueous solution 60 in the chamber 14 is replaced by the dextran aqueous solution 50 due to the difference in specific gravity. The substance in the polyethylene glycol aqueous solution 60 is then concentrated and retained in the dextran aqueous solution 50.

[0091] (9) Modification 2 In the above embodiment, after the first solvent is supplied, a fixed amount of the second solvent is supplied into the flow path 40 of the flow cell 1 to concentrate and analyze the substance, but the present invention is not limited to this. For example, the second solvent may be continuously supplied into the flow path 40 of the flow cell 1 by a continuous flow method, and the substance may be concentrated in the chamber 14 for analysis. In this case, taking into consideration that the second solvent may cause the first solvent in the chamber 14 to flow out or diffuse, it is preferable to supply a mixed solvent in which the first solvent is mixed with the second solvent as the second solvent. The ratio of the first solvent to the second solvent in this mixed solvent can be set as appropriate, and may be, for example, 0.1:1 to 1:1 by volume.

[0092] 2. Reaction Detection Method Next, the reaction detection method will be described. The reaction detection method includes a detection step for detecting a reaction of a substance retained and / or concentrated by the above-described substance processing method. In the above embodiment, the enzyme E and substrate S are concentrated in the chamber 14 in the substance processing method, and this enzyme-substrate reaction is detected in the detection step. The detection method used in the detection step can be appropriately selected depending on the type of substance, but detection methods using a confocal microscope, a fluorescence microscope, an image sensor, or the like can be used. In particular, a system using an image sensor can be suitably used in digital bioassays. One example of such a system includes a light source that irradiates the flow cell 1 with light, an image sensor that receives light emitted by a biological reaction in the flow cell 1, and image analysis software that analyzes images obtained by the image sensor and evaluates the reaction for each chamber 14. Then, digital analysis of the biological reaction can be performed by counting the number of chambers 14 in which a biological reaction was observed using the image analysis software. Below, an example of an oil-free system using a fluorescent substrate is described.

[0093] Figure 4 is a schematic diagram showing an overview of an oil-free system. As shown in Figure 4(a), in the second inflow step, the substance enzyme E is concentrated in the DEX held in the well 14, and this reacts with the substrate S (a fluorescent substrate in the figure) to produce a product (a fluorescent substance). Because the product of the enzyme reaction diffuses out of the well 14 (Figure 4(b-1)), the above embodiment required a sealing solvent such as oil to keep the product within the well 14 (Figure 4(b-2)). However, this method requires an oil sealing step, which increases the labor and cost of the oil.

[0094] Therefore, if the substrate S and the product can be concentrated and retained in the dextran aqueous solution 50 in the well 14, sealing with oil becomes unnecessary. For example, by binding a fluorescent substrate to a molecule with a high partition ratio to the dextran aqueous solution 50, such as dextran or a dextran binding domain (DBD), it is possible to prevent the product from diffusing into the polyethylene glycol aqueous solution 60 without oil sealing. This simplifies the process leading up to detection and reduces oil costs. Furthermore, using a molecule with a high partition ratio allows for a higher concentration, thereby improving detection sensitivity.

[0095] 3. Material Processing Apparatus Next, the material processing apparatus will be described. The material processing apparatus is an apparatus for implementing the above-described material processing method. Specifically, it uses a flow cell 1, a first solvent (dextran aqueous solution 50 in this embodiment), and a second solvent (polyethylene glycol aqueous solution 60 in this embodiment). Furthermore, the material processing apparatus includes a liquid supply means for implementing the mixing step, the first inflow step, and the second inflow step. The material processing apparatus may also include a reactant inflow means for performing the reactant inflow step and a target substance inflow means for performing the target substance inflow step after the reactant inflow step. An example of the liquid supply means is a combination of a pipette as a pressurizer and a tip 24 as an introducer (corresponding to the mixing means, first inflow means, and second inflow means). Note that if paper chromatography paper or the like is placed in the flow channel 40 and the first and second solutions are introduced by capillary action, the solvent flows relatively slowly, making it easier for the substances to concentrate in the chamber 14. Furthermore, when a solvent is continuously flowed through the flow path 40, the inlet and outlet of the flow cell 1 may be connected by a tube to circulate the same solvent. When detecting a substance, a target substance (e.g., an antigen) is added to the solvent and the same solvent is circulated repeatedly through the flow cell 1, so that the same sample is introduced into the flow path 40 multiple times, and the target substance is concentrated in the chamber 14 each time. Therefore, even with a small amount of sample or a sample with a low concentration of the target substance, the target substance can be concentrated to a high concentration in the chamber 14, thereby improving the detection sensitivity of reactions, etc.

[0096] 4. Reaction Detection Device Next, the reaction detection device will be described. The reaction detection device is a means (corresponding to the detection means) for implementing the detection step in the reaction detection method described above. Examples of such devices include the confocal microscope, fluorescence microscope, and image sensor described above. In the present disclosure, it is preferable to maintain the state of the flow cell 1 under conditions in which the reaction can proceed and the reaction products can be detected, particularly after the final inflow, when the polyethylene glycol aqueous solution 60 has been introduced into the flow path 40. For example, it is preferable to maintain conditions such as temperature, reaction time, pressure, and vibration appropriate for the reaction. In the reaction detection device of the present disclosure, means for detecting the state of the flow cell (state detection means) include a temperature sensor, a timer, a pressure sensor, and a vibration sensor. Furthermore, it is preferable that the reaction detection device includes means for reporting the state detected by such state detection means (state reporting means). For example, it is preferable to display conditions such as temperature, or to report that the state of the flow cell deviates from the predetermined conditions by displaying an error. Examples of such state reporting means include a display, a speaker, and a lighting device.

[0097] Reactions caused by substances can be detected, for example, by measuring the fluorescence generated by biological reactions. Fluorescent dyes (reporter dyes) used to measure the fluorescence of DNA or RNA probes include FAM, Cy3 (registered trademark), Cy5 (registered trademark), fluorescein, FITC (fluorescein isothiocyanate), TRITC (tetramethylrhodamine B isothiocyanate), Texas Red (registered trademark), rhodamine, and TAMRA. Only one reporter dye may be used, or two or more may be combined. When two or more reporter dyes are used, if they emit fluorescence in response to different reactions caused by the substances, it is possible to detect two or more biological reactions in a single chamber.

[0098] Furthermore, it is preferable to combine a quencher molecule that absorbs light at the fluorescence wavelength of these reporter dyes. In this case, when the reporter dye and quencher molecule are close to each other, the fluorescence of the reporter dye is absorbed by the quencher molecule by fluorescence resonance energy transfer (FRET), but when they are separated, the fluorescence from the reporter dye can be detected. Therefore, by combining a reporter dye and a quencher molecule, reactions such as cleavage of the probe can be detected with higher sensitivity. Examples of such quencher molecules include BHQ (registered trademark) and TAMRA. The reporter dye and quencher molecule can be used by binding to the 5' and 3' ends, respectively, of a DNA or RNA probe.

[0099] The present disclosure can be used for concentrating various substances and detecting reactions, but is preferably used for detecting pathogenic microorganisms such as influenza viruses. An example of a method for detecting pathogenic microorganisms is the method described in JP 2022-031760 A. For example, an enzyme present on the surface or inside of a pathogenic microorganism and its substrate are used as substances, and the product of the enzyme-substrate reaction is detected optically or by other methods using the above-described flow cell 1. As such a combination of enzyme and substrate, the combinations described in Table 1 of JP 2022-031760 A can be preferably used.

[0100] Various detection systems using fluorescence can be used, such as the enzyme-linked immunosorbent assay (ELISA) described in International Publication No. 2016 / 047068. Furthermore, systems that detect pathogenic microorganisms by targeting RNA derived from pathogenic microorganisms are also effective. Below, we will explain the cases where the target substance is an enzyme ( FIG. 5 ), RNA ( FIG. 17 ), or DNA ( FIG. 18 ), as disclosed in the examples below.

[0101] (1) Detection Example 1: When the Target Substance is an Enzyme (Figure 5) Figure 5 is a schematic diagram illustrating an oil-free system in which a fluorescent substrate is bound to dextran. Fluorescent dye S is bound to dextran on the left side of Figure 5(a), and to the dextran-binding domain on the right side. The dextran or dextran-binding domain and the fluorescent substrate can be bound by known methods, such as thiocarbamate binding. As shown in Figure 5(b), the dextran bound to the fluorescent substrate is concentrated and retained in the aqueous dextran solution 50 in the well 14. The target substance, enzyme E, then reacts with the substrate S to produce a fluorescent substance. The reaction caused by the substance can be detected by detecting this fluorescence.

[0102] (2) Detection Example 2: When the Target Substance is RNA (Figure 17) This system utilizes a reaction that specifically cleaves RNA using Cas13. Specifically, as shown in Figure 17(a), the substance includes at least a target RNA ("Target" in the figure), a crRNA for detecting the target RNA, Cas13, and two types of RNA probes (the first and second probes in the figure). The target RNA is RNA having a sequence specific to the pathogenic microorganism to be detected. For example, in the case of SARS-CoV-2, RNA containing the ROF1ab gene, N gene, S gene, etc. can be used. The crRNA contains a sequence complementary to a specific region of the target RNA and forms a complex with Cas13. This complex binds to the target RNA using the crRNA as a guide RNA to form an activated complex that cleaves the target RNA.

[0103] One of the two types of RNA probes (the first RNA probe) has a sequence that can be cleaved by this activation complex, and is bound to a first fluorescent dye ("F" in the figure) and a quencher molecule ("Q" in the figure). When the RNA of the first RNA probe is cleaved, the distance between the first fluorescent dye F and the quencher molecule Q increases, and fluorescence (first fluorescence) due to the fluorescent dye F is generated. On the other hand, the other of the two types of RNA probes (the second RNA probe) does not have a sequence that can be cleaved by the activation complex, and is bound to a second fluorescent dye ("C" in the figure) and a quencher molecule ("Q" in the figure). This second fluorescent dye C emits fluorescence that is distinguishable from the first fluorescent dye F, for example, emitting fluorescence of a different wavelength from the first fluorescent dye F. When the RNA of the second RNA probe is cleaved, the distance between the second fluorescent dye C and the quencher molecule Q increases, and fluorescence (second fluorescence) due to the fluorescent dye C is generated.

[0104] In environments such as samples and chips, sequence-nonspecific ribonucleases, which are ribonucleases (RNases) that cleave RNA independently of sequence, may be present and contaminate the reaction system. As shown on the left side of Figure 17(b), in the presence of RNase, both types of probes (first probe, second probe) are cleaved, and both the first fluorescent dye F and the second fluorescent dye C emit fluorescence (first fluorescence, second fluorescence). On the other hand, as shown on the right side of Figure 17(b), in the presence of an activated complex in which a complex of Cas13 and crRNA binds to target RNA, only the first RNA probe is cleaved, and only the fluorescence (first fluorescence) of the first fluorescent dye F is emitted. Therefore, if only the first fluorescence is detected in one chamber 14, it can be determined that this is a positive signal due to the Cas13 complex. On the other hand, when both the first fluorescence and the second fluorescence are detected in one chamber 14, it can be determined that this is a false positive signal due to sequence non-specific ribonuclease. Note that, although only one type of probe is used to detect false positives in this embodiment, the present invention is not limited to this, and two or more types of probes may be used. Increasing the number of types of probes for detecting false positives can improve the discrimination of false positives and improve the accuracy of target detection.

[0105] A sample (including target RNA) containing these substances (crRNA, Cas13, and two RNA probes) is mixed with a first solvent or a second solvent and introduced into the flow cell 1. In the example described below, the sample is mixed with a second solvent (aqueous polyethylene glycol solution 60) and introduced. Because these substances have a higher partitionability in the first solvent (aqueous dextran solution 50) than in the second solvent (aqueous polyethylene glycol solution 60), they are distributed at a higher concentration in the aqueous dextran solution 50 held in the chamber 14 and concentrated.

[0106] In the chamber 14 where the Cas13 complex is present, only the first RNA probe is cleaved, and a first fluorescence is generated by the first fluorescent dye F. Therefore, by measuring the chamber 14 that emits only the first fluorescence, a positive signal can be measured (positive measurement step, positive measurement means).

[0107] On the other hand, if the sample contains sequence-nonspecific ribonuclease (RNase), it will be retained in some of the chambers 14. In the chambers 14 containing sequence-nonspecific ribonuclease, both the first RNA probe and the second RNA probe are cleaved, resulting in the generation of both a first fluorescence due to the first fluorescent dye F and a second fluorescence due to the second fluorescent dye C. Therefore, by measuring the chambers 14 that emit both types of fluorescence, false positive signals can be measured (false positive measurement step, false positive measurement means). In this way, false positive signals can be eliminated, improving the detection sensitivity of the target RNA.

[0108] (3) Detection Example 3: When the Target Substance is DNA (Figure 18) By binding capture DNA to dextran or a dextran-binding domain (DBD), complementary DNA can be bound to the capture DNA and concentrated in an aqueous dextran solution 50. Figure 18(a) is a schematic diagram showing the state in which capture DNA is bound to DBD. As shown in (b) of the figure, the DBD-capture DNA is concentrated in an aqueous dextran solution 50. In this figure, target DNA-FAM, which is bound to the fluorescent dye FAM, is used as the target DNA. Since the capture DNA has a sequence complementary to the target DNA and binds to it, the target DNA-FAM is also concentrated in the aqueous dextran solution 50, and the target DNA can be detected by detecting the fluorescence from FAM.

[0109] The present invention will be described in detail below based on examples, but the object of the present invention is not limited thereto. In the following examples, "%" is based on mass (mass percent) unless otherwise specified.

[0110] Because aqueous two-phase systems (ATPS) of dextran (DEX) and polyethylene glycol (PEG) can preferentially partition nucleic acid polymers such as DNA into the DEX-rich phase, we focused on this system for experiments. First, we developed a system based on a femtoliter chamber array device (FRAD) developed for conventional digital bioassays, in which uniformly shaped DEX-rich droplets (hereinafter simply referred to as DEX droplets) were arranged. We also developed a tagging system that can partition proteins that are difficult to concentrate in the DEX-rich layer into DEX droplets. Subsequently, we concentrated tagged enzymes such as Cas13 on-chip and performed digital bioassays. This is described in detail below.

[0111] 1. Experiment in an Oil-Free System Using Cas13 (Experiment 1) (1) Objective and Overview In order to detect biological materials in an oil-free system using Cas13, the probe must be concentrated in a dextran aqueous solution 50. Figure 6 is a conceptual diagram illustrating the concentration of biological materials in DEX in a Cas13-based system. As shown in Figure 6(a), in the above-described Cas13-based system, DBD-tagged Cas13 ("Cas13-DBD x 2" in the figure) is concentrated in a dextran aqueous solution 50. Furthermore, the larger the molecular weight (longer the chain) of RNA, the higher its partitionability into the dextran aqueous solution 50. Therefore, as shown in Figure 6(b), if the target RNA is long, it will be concentrated in the dextran aqueous solution 50. On the other hand, because RNA probes are short-chain nucleic acids, they are difficult to concentrate in the dextran aqueous solution 50 and easily diffuse into the polyethylene glycol aqueous solution 60.

[0112] Therefore, to concentrate and retain the fluorescent substrate and its product in a dextran aqueous solution 50, we constructed the following oil-free system utilizing the avidin-biotin interaction (Figure 7A). First, biotinylated dextran (biotin-DEX in the figure) is conjugated to dextran, streptavidin (Strept-Avidin in the figure), biotinylated oligo-DNA (biotin Oligo in the figure), and a fluorescently labeled probe are prepared. Biotinylated dextran (biotin-DEX) can be produced by known methods, such as introducing an aldehyde group into dextran and then conjugating biotin. Biotinylated oligo-DNA (biotin Oligo) can be produced by conjugating biotin to DNA. The fluorescently labeled probe comprises a complementary strand DNA (oligonucleic acid) having a sequence complementary to a portion of the DNA constituting the biotinylated oligo DNA, a fluorescent dye F as a fluorescent substrate, and a quencher molecule Q. The complementary strand DNA has an "AU" sequence between the fluorescent dye F and the quencher molecule Q that is preferentially cleaved by Cas13 (LwaCas13a in this embodiment). The biotinylated oligo DNA and the fluorescently labeled probe form a double strand through hydrogen bonds in the complementary sequence portions.

[0113] Through biotin-avidin binding, streptavidin binds to the biotinylated dextran, and biotinylated oligo-DNA binds to the streptavidin. Furthermore, a fluorescently labeled probe is hydrogen-bonded to the biotinylated oligo-DNA via their complementary strands. These conjugates are concentrated in an aqueous dextran solution 50 (labeled "DEX" in the figure) as shown in Figure 7B (a). The activated complex of Cas13 cleaves the AU sequence of the fluorescently labeled probe. At this time, the fluorescent dye F remains immobilized in the aqueous dextran solution 50 via streptavidin and thus remains there, while the quencher molecule Q is not immobilized and dissociates, diffusing into the aqueous polyethylene glycol solution 60 (labeled "PEG" in the figure) (Figure (b)). In this way, the quencher molecules Q diffuse without being retained in the dextran aqueous solution 50, so that the fluorescence of the fluorescent dye F is less likely to be attenuated by the quencher molecules Q, and the fluorescence can be detected with high sensitivity. Details of the experiment will be described below.

[0114] (2) Materials (a) Chemicals Polyethylene glycol (MW: 35 kDa), dextran derived from the genus Leuconostoc (MW: 450-650 kDa), TRITC-DEX (dextran (DEX: MW: 500 kDa) labeled with tetramethylrhodamine B isothiocyanate (TRITC)), and DBCO-NHS (dibenzocyclooctyne-N-hydroxysuccinimidyl) ester were obtained from Merck (formerly Sigma-Aldrich) (Germany).

[0115] NH ２ -biotin (biotin-PEG-NH ２ ) was obtained from Sigma-Aldrich (now Merck). CM-dextran, EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide), and NHS (N-hydroxysuccinimide) were obtained from Sigma-Aldrich (now Merck). Streptavidin was obtained from PROSPEC. Biotin-DEX was prepared as follows: CM-dextran was reacted with EDC and NHS to prepare NHS-dextran. Next, NH ２-biotin (biotin-PEG-NH ２ Biotinylated dextran was prepared by reacting dextran with NHS-dextran and purifying the resulting product by liquid chromatography. Biotinylated oligo DNA (Biotin-GTGAGGGTTGAATTCTCGTTGGGCTCTTCCGACACGAACCTCAGTTAGCCTACATCCTACCAGAGGTCTGTGCCCCGGTGGTGAGAAGTGCGGATTTCGTATTGCAGCTCGTCAGTACTTTCAGAATCATGGCCTGCACGGCAAAATGACGCTTATAATGGACTTCGACATGGCAATAACGCCTCGTTTCTACGTCAGA: SEQ ID NO: 1) was obtained from FASMAC (JAPAN). Fluorescently labeled RNA 5'-BHQ1-taAUgct(Fluorescein)tctgacgtagaaacgaggc-3' (SEQ ID NO: 2: uppercase letters are RNA, lowercase letters are DNA), which serves as a probe for Cas13, was obtained from FASMAC (Japan).

[0116] Cas13a from Leptotrichia wadei (hereinafter sometimes referred to as "LwaCas13a") was used as Cas13. Cas13 protein was purified with some modifications according to the report in the following paper (Kellner, M.J.; Koob, J.G.; Gootenberg, J.S.; Abudayyeh, O.O.; Zhang, F., SHERLOCK: nuclear acid detection with CRISPR nucleases. Nat Protoc 2019, 14(10), 2986-3012.). Because DBD obtained from dextransucrase may adhere to a size exclusion chromatography (SEC) column, size exclusion chromatography was omitted in the purification process.

[0117] The target RNA encoded the S gene fragment of SERS-CoV-2 and was designed to be 3000 nt long to enable efficient enrichment with DEX-rich phase. DNA encoding the designed RNA was synthesized by SYNTHGO (USA). RNA was prepared from the synthesized DNA using a ScriptMax Thermo T7 Transcription Kit (TOYOBO, Japan) and a NucleoSpin RNA clean-up Kit (Macherey-Nagel). CrRNA synthesis was performed using a Synthgo device.

[0118]

[0119] The sequence of the crRNA (SEQ ID NO: 4) is as follows: GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACGCAGCACCAGCUGUCCAACCUGAAGAAG (Note: The underlined portions of the target RNA and crRNA indicate complementary sequences.)

[0120] (b) Femtoliter chamber array device (FRAD) A FRAD with an array of multiple chambers was fabricated by photolithographic microfabrication according to the paper report (Ueno, H.; Kato, M.; Minagawa, Y.; Hirose, Y.; Noji, H., Elucidation and control of low and high active populations of alkaline phosphatase molecules for quantitative digital bioassay. Protein Sci 2021, 30(8), 1628-1639.). The flow cell was assembled using a chamber array device (FRAD), a top glass with inlet and outlet holes (cover), and double-sided tape (~80 μm) as a spacer. The top glass of the flow cell chamber was precoated with CYTOP 809M to prevent nonspecific binding of biomolecules.

[0121] (c) Microscopic Imaging Epifluorescence images were obtained using an epifluorescence microscope (ECLIPSE Ti2, Nikon or Olympus IX83, Olympus) equipped with an sCMOS camera (Andor neo, Andor Technology) and an LED light source (X-Cite TURBO or X-Cite XYLIS, Excelitas technologies).

[0122] (3) Introduction of Solutions into the Flow Cell Various solutions were introduced into the flow cell using the following procedure. (a) 40 μL of a solution containing 1% (w / w) biotin-DEX, 5.5% (w / w) dextran, and 0.1% (w / w) TRITC-DEX was injected into the chamber (flow path) of the flow cell. Then, 100 μL of a 5% (w / w) PEG solution was injected to flush out excess dextran from the flow path, forming a dextran reactor within the chamber. (b) 40 μL of a polyethylene glycol solution containing 1 μM streptavidin, 2 μM capture biotinylated oligos, and 5% (w / w) PEG was flowed into the flow cell and allowed to stand at room temperature for 30 minutes. (c) Then, 40 μL of an oligo-tagged fluorescent probe that forms a complementary strand with the capture biotinylated oligos was adjusted to 1 μM and flowed into the flow cell. The reactor was then left to stand at room temperature for 30 minutes. At this time, the structure shown in Figure 7A, in which the fluorescent probe was immobilized on DEX, was formed within the DEX reactor. (d) 40 μL of a solution containing 45 nM Cas13-DBDx2, 22.5 nM crRNA, and target RNA was then poured into the reactor. Four target RNA concentrations were prepared: 0 pM, 3 pM, 10 pM, and 1 nM. Cas13 was concentrated in the DEX reactor by the DBD, and the target RNA was also concentrated within the DEX in the DEX / PEG liquid-liquid phase separation system, so the reaction is expected to proceed oil-free. (e) The reactor after the reaction was observed using a time lapse microscope. The above-mentioned epifluorescence microscope was used for observation.

[0123] (4) Results The results are shown in Figure 8. Fluorescence was observed at target RNA concentrations of 0 pM, 3 pM, 10 pM, and 1 nM. Bright spots were observed when target RNA was present, demonstrating that sufficient fluorescence could be observed even in an oil-free system.

[0124] 2. Experiment in an oil-free system in which a fluorescent probe is bound to DBD (Experiment 2) (1) Objective and overview Rather than capturing the fluorescent probe in DEX as in Experiment 1, an experiment was conducted in which a DBD-fluorescent probe, in which DBD and a fluorescent probe were bound, was concentrated in DEX. An overview of the experimental system is shown in Figure 9.

[0125] (2) Materials: Azido-fluorescent probe (BHQ1-taAUgct(Fluorescein)tctgacgtagaaacgaggc-N) covalently bound to DBD. ３ The DBD and fluorescent probe were obtained from FASMAC (Japan). ２ DBD bound to DBCO-NHS via N ３ This was prepared by reacting DBD with a fluorescent probe modified at the 3' end. DBD:DBCO-NHS were mixed at a molar ratio of 1:10 and reacted for 2 hours to prepare DBCO-DBD. DBCO-DBD and the fluorescent probe were then mixed at a molar ratio of 1:3 and reacted for 4 hours to prepare the DBD-fluorescent probe.

[0126] (3) Introduction of Solutions into the Flow Cell Various solutions were introduced into the flow cell using the following procedure. (a) 20 μL of a solution containing 5.5% (w / w) dextran and 0.01% (w / w) TRITC-DEX was injected into the chamber (flow path) of the flow cell. Then, 60 μL of a 6% (w / w) PEG solution was injected, flushing out excess dextran from the flow path and forming a dextran reactor in the chamber. (b) 20 μL of 6% (w / w) PEG containing 4 μM DBD-fluorescent probe was flowed into the flow cell and allowed to stand at room temperature for 30 minutes. (c) Then, a 6% (w / w) PEG solution containing target RNA was flowed and allowed to stand at room temperature for 10 minutes. Finally, a 6% (w / w) PEG solution containing 45 nM Cas13-DBDx2 and 22.5 nM crRNA was flowed. (d) The reactor after the reaction was observed using a time lapse microscope, the same as in Experiment 1.

[0127] (4) Results The results are shown in Figure 10. The left side of the fluorescence microscope image is the image immediately after the final injection of the PEG solution, and the right side is the image 30 minutes later. As shown in this figure, oil-free digital measurement was successful at target RNA concentrations of 3 pM, 1 pM, and 300 fM.

[0128] 3. Experiment using an oil-free system with multiple target runs (Experiment 3) (1) Objective and Overview In this experiment, we verified the concentration of samples by running target RNA multiple times to demonstrate the advantages of an oil-free system. An overview of the experimental system is shown in Figure 11.

[0129] (2) Materials The materials used in Experiments 1 and 2 were used.

[0130] (3) Introduction of Solutions into the Flow Cell Various solutions were introduced into the flow cell using the following procedure. (a) As in Experiment 1, 20 μL of a solution containing 5.5% (w / w) dextran and 0.01% (w / w) TRITC-DEX was injected into the chamber (flow path) of the flow cell. Then, 60 μL of a 6% (w / w) PEG solution was injected, flushing out excess dextran from the flow path and forming a dextran reactor within the chamber. (b) Next, 20 μL of a PEG solution containing 45 nM Cas13, 22.5 nM crRNA, and 4 μM DBD-fluorescent probe was injected and allowed to stand for 10 minutes. (c) The reaction was initiated by injecting 20 μL of 6% (w / w) PEG containing target RNA. (d) After 10 minutes, the 6% PEG solution containing target RNA was again injected. Here, the target RNA was encapsulated in the reactor so that the average number of molecules (λ) encapsulated in the reactor was 0.003. (e) The reactor after the reaction was observed. The same fluorescence microscope as in Experiment 1 was used for observation.

[0131] (4) Results The results are shown in Figure 12. The top row of this figure shows a fluorescence microscope image, and the bottom row shows a graph comparing the conventional method (Experiment 2: Old protocol above) with this method (Experiment 3: New protocol). In the New protocol, "1-3" shows the results of running PEG containing target RNA three times, and "1-4" shows the results of running it four times. As shown in this figure, in the oil-free case, running the solution containing target RNA multiple times can increase the number of bright spots, allowing the sample to be used without waste.

[0132] 4. Experiments in an Oil-Free System Using β-Galactosidase (Experiment 4) An experiment was conducted in which the product of the enzymatic reaction was concentrated or immobilized on a DEX phase, eliminating the need for oil sealing. To achieve this, a flow cell prepared using the above-mentioned "(2) Femtoliter Chamber Array Device (FRAD)" was used, and an experiment was conducted in an oil-free system. In this experiment, an anti-β-galactosidase IgY antibody (hereinafter simply referred to as "anti-β-gal antibody") conjugated to a DBD (hereinafter sometimes referred to as "Ab-DBD") was used to concentrate and retain β-galactosidase (hereinafter sometimes referred to as "β-gal") within the reactor. Furthermore, DBD-Cys4 (a protein with four cysteines bound to the C-terminus of DBD) was used to capture the fluorescent substance, which is the product of the reaction between the fluorescent substrate and β-gal, within the reactor. The following Experiment 4-1 examined the effect of Ab-DBD, Experiment 4-2 examined the effect of DBD-Cys4, and Experiment 4-3 examined the effect of both.

[0133] 4-1. Immobilization of β-gal (Experiment 4-1) (1) Objective and Overview First, an experiment was conducted to concentrate and retain β-gal in a reactor. The outline and results of the experiment are shown in Figure 13. (a) in the figure is a schematic diagram showing the outline of the experiment in an oil-free system. The experiment was conducted as follows: (2) Materials β-galactosidase (Wako, Japan) and anti-β-galactosidase IgY antibody (Abcam, England) were purchased from their respective suppliers. SURFLON S-386 (AGC Seimi Chemical, Japan), BSA (bovine serum albumin: NEW ENGLAND Biolabs, USA), fluorescein di-β-galactopyranoside (FDG) (Abcam, England), and SPiDER-βgal (Dojindo Research Institute: product code SG02) were supplied by their respective suppliers. Anti-βgal antibody-DBD (referred to as "Ab-DBD conjugate" in the figure, hereafter simply referred to as "Ab-DBD") was prepared as follows: First, the anti-βgal antibody was reacted with NHS-TCO at a molar ratio of 1:40, and then DBD was reacted with NHS-Tz at a molar ratio of 1:2. Ab-DBD was prepared by mixing anti-βgal antibody-TCO and DBD-Tz at a molar ratio of 1:5 and incubating at room temperature for 2 hours. Other materials were the same as those used in Experiments 1 to 3.

[0134] (3) Introduction of solutions into the flow cell Various solutions were introduced into the flow cell in the following manner. (a) The immobilization of β-gal was verified using the prepared Ab-DBD. First, a blocking solution (S-386 0.01%, BSA 0.5 mg / mL) was injected into the flow cell. (b) Then, a DEX solution (5.5 wt% DEX, 41 mM Na ２ HPO ４ , 0.74 mM KH ２ P.O. ４ , 68.5 mM NaCl, 0.01% (w / w) S-386, 0.01 wt% TRITC-DEX) was injected into the flow cell, and 60 μL of PEG solution (5.0 wt% PEG, 41 mM Na ２ HPO ４ , 0.74 mM KH ２ P.O. ４(c) Finally, an aqueous PEG solution containing 33 fM β-galactosidase and 1 mM FDG was injected. (d) The reactor after the reaction was observed using a time lapse. The same fluorescence microscope as in Experiment 1 was used for observation.

[0135] (4) Results The results are shown in Figure 13. The right side of the figure (b) is a fluorescent image of the digital bioassay. The "+" in "DEX droplets" indicates the presence of DEX droplets, the "-" indicates the absence of DEX droplets, and the "+" in "Ab-DBD" indicates the presence of anti-βgal antibody-DBD and the "-" indicates the absence of anti-βgal antibody-DBD. From this image, many bright spots were observed when both DEX droplets and anti-βgal antibody-DBD were present. The left side of the figure shows the frequency of positive reactors (P ｐｏｓｉｔｉｖｅ ) and enrichment factor (Enrichment Factor). These results show that β-gal can be enriched with a high enrichment factor when both DEX droplets and anti-β-gal antibody-DBD are present. The above results demonstrate that β-gal is strongly enriched only when a DEX reactor is formed and Ab-DBD is concentrated.

[0136] 4-2. Immobilization of enzyme reaction products by β-gal (Experiment 4-2) (1) Objective and overview Next, an experiment was conducted to confirm the fluorescent substance capture effect of DBD-Cys4 (a protein with four cysteines bound to the C-terminus of DBD). When SPiDER-β-gal is decomposed by β-gal, a reactive quinone methide derivative is generated. This quinone methide derivative undergoes nucleophilic attack on the protein, forming a covalent bond and emitting fluorescence. The strength of the nucleophilic attack of the quinone methide derivative differs depending on the type of functional group targeted for attack, and the strength of the nucleophilic attack varies depending on the type of functional group targeted for attack. － >SH － >I － >OH －Therefore, it is thought that by introducing multiple cysteines with SH groups into the C-terminus of DBD, it is possible to bind to quinone methide derivatives and concentrate them in aqueous dextran solutions. The concentration effect of DBD-Cys4 was verified. An outline of the experiment is shown in Figure 14.

[0137] (2) Materials DBD-Cys4 was prepared by genetic engineering to add the amino acid sequence "PCPSSCPPCPSC" (SEQ ID NO: 6; hereafter referred to as "Cys4") to the C-terminus of DBD, and a plasmid carrying the gene for the modified DBD (DBD-Cys4) was constructed using this engineering. DBD-Cys4 was prepared from the resulting plasmid by expression and purification using standard methods using Escherichia coli. Other materials used were those used in Experiments 1 to 3 and Experiment 4-1.

[0138] (3) Introduction of Solutions into the Flow Cell Various solutions were introduced into the flow cell in the following manner: (a) 15 μL of blocking solution was injected into the flow cell. Then, DEX solution (5.5 wt% DEX, 41 mM Na ２ HPO ４ , 0.74 mM KH ２ P.O. ４ 40 μL of a solution containing 68.5 mM NaCl, 0.01% (w / w) S-386, and 0.01 wt% TRITC-DEX was injected into the flow cell, and DBD-Cys4 was flushed with 60 μL of a PEG solution containing 5 μM. (b) After standing at room temperature for 10 minutes, 40 μL of a PEG solution containing 1 nM β-gal and 100 μM SPiDER-βgal was poured into the flow channel. (c) After an additional 10 minutes, 40 μL of the PEG solution was poured to wash away excess β-gal and the unbound SPiDER-βgal reaction product. (d) The reactor after the reaction was observed using a time lapse. We observed whether the degradation products of SPiDER-βgal were actually immobilized on DBD-Cys4 when DBD-Cys4 mixed in a PEG solution was concentrated (w / ) or not (w / o). The same fluorescence microscope as in Experiment 1 was used for observation.

[0139] (4) Results The results are shown in Figure 15. As shown in this figure, when DBD-Cys4 was concentrated, a signal (red fluorescence) of SPiDER-βgal was observed inside DEX, indicating that it was immobilized within DEX.

[0140] 4-3. Oil-free (Experiment 4-3) (1) Objective and Overview The effectiveness of both Ab-DBD and DBD-Cys4 was verified. After DBD-Cys4 was concentrated in DEX, β-gal was digitally immobilized in a DEX reactor using an anti-β-gal antibody, and the substrate SPiDER-β-gal was then passed through the reactor.

[0141] (2) Materials The materials used were the same as those used in Experiments 1 to 3, 4-1, and 4-2.

[0142] (3) Introduction of Solutions into the Flow Cell Various solutions were introduced into the flow cell using the following procedure. (a) After 15 μL of blocking solution was injected into the flow cell, 40 μL of DEX solution (5.5%) was injected into the flow cell chamber (flow path), followed by 80 μL of PEG solution (5%) into the flow path. (b) 25 μL of β-gal-containing PEG solution was introduced into the flow path of the flow cell, and β-gal was bound to the anti-β-gal antibody-DBD. (c) 25 μL of PEG solution containing 5 μM DBD-Cys4 was introduced into the flow path. (d) A fluorescent substance (SPiDER-β-gal) was mixed with the PEG solution to a final concentration of 200 μM. The SPiDER-β-gal-containing PEG was introduced into the flow path. (e) The reactor after the reaction was observed using a time lapse microscope. The same fluorescence microscope as in Experiment 1 was used for observation.

[0143] The results are shown in Figure 16. The first column on the left side of this figure shows the results for experiments without the enzyme β-gal, while the second and third columns on the right side show the results for experiments with a predetermined concentration of β-gal. The top row of this figure shows the results immediately after (0 minutes) the SPiDER-β-gal-containing PEG was introduced into the flow channel, while the bottom row shows the results after 360 minutes. As shown in these figures, even in an oil-free system, a reactor was observed in which fluorescence was generated from a single β-gal molecule. The bright spots were clearly visible, and there was no leakage of fluorescence into the surrounding reactor, indicating that diffusion of the enzyme and fluorescent dye was suppressed even without oil encapsulation. As a result, the decomposed SPiDER-β-gal bound to DBD-Cys4 and did not diffuse into the PEG phase, allowing for digital fluorescence observation.

[0144] 5. Experiments in an oil-free system using capture DNA (Experiment 5) (1) Objective and Overview We investigated a system that can capture any target DNA by binding capture DNA to DBD. Figure 18 is a schematic diagram showing the overview.

[0145] (2) Materials Target DNA-FAM (5'-CTTTGTGTTCCCCGGACATAGTCCA-FAM-3': SEQ ID NO: 7) and capture oligo DNA (5'-ATGTCCGGGAACACAAAGAAAA-Azide-3': SEQ ID NO: 8) were obtained from FASMAC (JAPAN). Other materials were the same as those used in Experiments 1 to 4. DBD-capture DNA was prepared by reacting DBD with DBCO-NHS at a ratio of 1:20 to prepare DBD-DBCO, which was then reacted with Azide-capture oligo DNA at a ratio of 1:10.

[0146] (3) Introduction of Solutions into the Flow Cell Various solutions were introduced into the flow cell using the following procedure. (a) In the DNA capture experiment, 15 μL of blocking solution was injected into the flow cell. Then, 40 μL of DEX solution (5.5 wt% DEX) was added, followed by 60 μL of PEG solution containing 1 μM DBD-capture DNA. (b) After flushing excess DBD-capture DNA with 60 μL of PEG solution, 40 μL of PEG solution containing fluorescently modified DNA that forms a complementary strand to the capture DNA was injected. (c) Next, 60 μL of PEG solution was injected to wash away excess fluorescently modified DNA. (d) The reactor after the reaction was observed using a time lapse microscope. The same fluorescence microscope as in Experiment 1 was used for observation.

[0147] (4) Results The results are shown in Figure 19. As shown in this figure, fluorescently modified DNA was strongly concentrated only in the presence of DBD-capture oligos. This indicates the possibility that DNA of any sequence can be captured by DBD-capture oligos.

[0148] 1 flow cell, 10 base, 11 chamber array device, 12 bottom surface, 13 side surface, 14 chamber, 20 cover, 21 cover body, 22 solvent inlet, 23 solvent outlet, 24 chip, 30 spacer, 40 flow channel, 50 dextran aqueous solution (first solvent), 60 polyethylene glycol aqueous solution (second solvent), E enzyme, S substrate, P product

Claims

1. A method for processing a substance to retain and / or concentrate using a flow cell comprising a chamber array device having a plurality of chambers, each chamber being a recess with one end open, and a cover communicating with the openings of the chambers and defining a flow path provided in common to the plurality of chambers, the method comprising: a mixing step of mixing the substance with a first solvent and / or a second solvent, wherein the first solvent and the second solvent are aqueous and undergo phase separation when left standing at room temperature after mixing, and have the property that when phase separation occurs in the region of the flow cell surrounded by the chamber and the flow path, the first solvent separates to the chamber side, and the property that the substance is preferentially distributed into the first solvent rather than the second solvent; a first inflow step of inflowing either the first solvent or the second solvent into the flow path to fill the chamber and the flow path with the solvent; a second inflowing step of inflowing the other of the first solvent and the second solvent into the flow path, causing phase separation of the first solvent to the chamber side and the second solvent to the flow path side, and suppressing diffusion of the substance contained in the first solvent in the chamber into the second solvent to be retained in the chamber, and / or transferring the substance contained in the second solvent to the first solvent in the chamber to be concentrated, wherein the inflowing of the first solvent and the inflowing of the second solvent are each performed at least once, and after the final inflow, the first solvent is sealed in the chamber by the second solvent remaining in the flow path, with the substance being retained and / or concentrated in the first solvent in the chamber.

2. The material processing method described in claim 1, characterized in that the material contains multiple types of material, the second solvent is introduced two or more times, and the multiple types of material are sequentially concentrated and / or retained in the first solvent in the chamber by introducing the second solvent two or more times.

3. The substance processing method according to claim 2, characterized in that the substance includes at least a target substance to be detected and a reactant that reacts with the target substance to produce a fluorescent substance that emits fluorescence, and is at least one of the following (a) to (c): (a) the reactant has a tag that improves partitionability in the first solvent, (b) the substance further includes a target capture substance that captures the target substance, the target capture substance having a tag that improves partitionability in the first solvent, or (c) the substance further includes a fluorescent capture substance that captures the fluorescent substance, the fluorescent capture substance having a tag that improves partitionability in the first solvent.

4. The method for processing materials according to claim 3, wherein the tag is selected from the group consisting of a dextran binding region derived from the lactic acid bacterium "Leuconostoc mesenteroides", dextran, dextran-like molecular polymers, DNA, RNA and chemically modified molecules thereof, and nucleic acid-like molecular polymers.

5. A material processing method as described in claim 3, characterized in that a target material flow-in process of flowing the second solvent containing the target material is performed after a reactant flow-in process of flowing the second solvent containing the reactant.

6. The material processing method described in claim 5, characterized in that the target substance flow process is performed two or more times, thereby sequentially concentrating and / or retaining the target substance in the first solvent in the chamber multiple times.

7. The method for processing a substance according to claim 1, wherein the first solvent and the second solvent are selected from the combinations shown in Nos. 1 to 12 in Table 1 below.

8. The method for processing a substance according to claim 7, wherein the first solvent is an aqueous solution of dextran, and the second solvent is an aqueous solution of polyethylene glycol.

9. A reaction detection method for detecting a reaction of the substance retained and / or concentrated by the substance processing method described in claim 1, characterized in that the reaction detection method comprises a detection step of detecting a reaction of the substance in the first solvent in the chamber while the first solvent in the chamber is sealed with the second solvent.

10. The reaction detection method described in claim 9, characterized in that the substance includes at least: a target RNA; a crRNA containing a sequence complementary to a specific region of the target RNA; Cas13 that forms a complex with the crRNA, and that when Cas13 binds to the target RNA using the crRNA as a guide RNA, forms an activation complex and cleaves the target RNA; and a fluorescently labeled probe that has a sequence that can be cleaved by the activation complex, is bound to a fluorescent dye, and is cleaved by the activation complex to emit fluorescence; and the detection step measures a chamber containing the target RNA by detecting the fluorescence.

11. The reaction detection method described in claim 10, characterized in that the fluorescently labeled probe comprises an oligonucleic acid, a fluorescent dye that is linked to a first position of the oligonucleic acid and emits fluorescence, and a quencher molecule that is linked to a second position of the oligonucleic acid and absorbs the fluorescence of the fluorescent dye, and the oligonucleic acid has a cleavage sequence between the first position and the second position that is cleaved by the activation complex.

12. The reaction detection method described in claim 11, characterized in that the oligonucleic acid has a tag that improves partitionability in the first solvent, located closer to the first position than the cleavage sequence.

13. A material processing apparatus for retaining and / or concentrating a substance, comprising: a chamber array device having a plurality of chambers, each of which is a recess having an opening at one end; and a flow cell having a flow path that communicates with the openings of the chambers and is provided in common to the plurality of chambers; a first solvent and a second solvent that are aqueous and undergo phase separation when allowed to stand at room temperature after mixing, the first solvent and the second solvent having the property that when phase separation occurs in an area surrounded by the chambers and the flow path of the flow cell, the first solvent separates toward the chamber side and the property that the substance is preferentially distributed into the first solvent rather than the second solvent; mixing means for mixing the substance with the first solvent and / or the second solvent; and first inflow means for inflowing either the first solvent or the second solvent into the flow path to fill the chambers and the flow path with the solvent. and a second inflow means for inflowing the other of the first solvent and the second solvent into the flow path, causing phase separation of the first solvent toward the chamber side and the second solvent toward the flow path side, and bringing the first solvent into contact with the second solvent, thereby suppressing diffusion of the substance contained in the first solvent in the chamber into the second solvent and retaining it in the chamber, and / or transferring the substance contained in the second solvent into the first solvent in the chamber and concentrating it, wherein the inflow of the first solvent and the inflow of the second solvent are each performed at least once, and after the final inflow, the first solvent is sealed in the chamber by the second solvent remaining in the flow path, with the substance being retained and / or concentrated in the first solvent in the chamber.

14. The material processing device described in claim 13, characterized in that the material contains multiple types of material, the second solvent is introduced two or more times, and the device has means for sequentially concentrating and / or retaining the multiple types of material in the first solvent in the chamber by introducing the second solvent two or more times.

15. The material processing device according to claim 14, characterized in that the material includes at least a target substance to be detected and a reactant that reacts with the target substance to produce a fluorescent substance that emits fluorescence, and is at least one of the following (a) to (c): (a) the reactant has a tag that improves partitionability in the first solvent, (b) the material further includes a target capture substance that captures the target substance, the target capture substance having a tag that improves partitionability in the first solvent, or (c) the material further includes a fluorescent capture substance that captures the fluorescent substance, the fluorescent capture substance having a tag that improves partitionability in the first solvent.

16. The material processing device according to claim 15, wherein the tag is selected from the group consisting of a dextran binding region derived from the lactic acid bacterium "Leuconostoc mesenteroides", dextran, dextran-like molecular polymers, DNA, RNA and chemically modified molecules thereof, and nucleic acid-like molecular polymers.

17. The material processing apparatus according to claim 15, further comprising a target material inlet means for inletting a second solvent containing the target material, after the reactant inlet means for inletting a second solvent containing the reactant.

18. The material processing apparatus according to claim 17, wherein the target material inflow means is performed two or more times, thereby sequentially concentrating and / or retaining the target material in the first solvent in the chamber multiple times.

19. The material processing apparatus of claim 13, wherein the first solvent and the second solvent are selected from the combinations shown in Nos. 1 to 12 in Table 2 below.

20. The material processing apparatus of claim 19, wherein said first solvent is an aqueous solution of dextran and said second solvent is an aqueous solution of polyethylene glycol.

21. A reaction detection device for detecting a reaction of the substance retained and / or concentrated by the substance processing device described in claim 13, characterized in that the reaction detection device is provided with a detection means for detecting a reaction of the substance in the first solvent in the chamber while the first solvent in the chamber is sealed with the second solvent.

22. The reaction detection device according to claim 21, characterized in that it comprises a state detection means for detecting whether the flow cell is maintained in a state suitable for a reaction, and a state notification means for notifying the state based on the state detection means.

Images