Paper-based all-in-one molecular diagnostic platform which improves isothermal amplification reaction efficiency and rehydration of dry reagent, and molecular diagnostic kit for simultaneous multiplex diagnosis of HIV-1 and HIV-2 using same

The paper-based molecular diagnostic platform addresses the inefficiencies of real-time PCR by providing a structured pad system for uniform rehydration and amplification, enabling efficient HIV-1 and HIV-2 diagnosis in point-of-care settings.

WO2025220778A1PCT designated stage Publication Date: 2025-10-23AITHENUTRIGENE CO
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2024/005359
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-04-18
Filing Date
2024-04-19
Publication Date
2025-10-23

AI Technical Summary

Technical Problem

Molecular diagnostic methods, particularly real-time PCR, require expensive equipment and complex procedures, making them unsuitable for point-of-care settings, and existing lab-on-paper technologies face challenges in uniform rehydration and isothermal amplification efficiency.

Method used

A paper-based molecular diagnostic platform with a structured pad system, including a sample pad, amplification pad, initiator pad, binding pad, and detection pad, facilitates uniform rehydration and isothermal amplification of dried reagents, enabling efficient HIV-1 and HIV-2 diagnosis using a simple equipment setup.

Benefits of technology

The platform allows for rapid, efficient, and reproducible isothermal amplification of nucleic acids, enabling on-site diagnosis of HIV-1 and HIV-2 without specialized equipment, improving sensitivity and reducing procedural complexity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2024005359_23102025_PF_FP_ABST
    Figure KR2024005359_23102025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a paper-based molecular diagnostic platform which improves the re-hydration of a dried reagent and the efficiency of an isothermal amplification reaction, and a molecular diagnostic kit for HIV-1 and HIV-2 using same, the paper-based molecular diagnostic platform using an isothermal amplification reaction enabling a reagent uniformly dried on paper where an isothermal amplification reaction takes place to undergo a uniform amplification reaction in the paper, and enabling a reproducible amplification reaction. In addition, HIV-1 and HIV-2 can be diagnosed in the field using simple equipment by using the above-described paper-based molecular diagnostic platform which improves the re-hydration of a dried reagent and the efficiency of an isothermal amplification reaction.
Need to check novelty before this filing date? Find Prior Art

Description

A paper-based all-in-one molecular diagnostic platform that improves the efficiency of rehydration and isothermal amplification of dried reagents, and a molecular diagnostic kit for simultaneous multiplex diagnosis of HIV-1 and HIV-2 using the platform.

[0001] The present invention relates to a paper-based molecular diagnostic platform that improves the efficiency of rehydration of a dry reagent and isothermal amplification reaction, and a molecular diagnostic kit for HIV-1 and HIV-2 diagnosis using the same.

[0002] As healthcare services improve and diagnostic devices advance, technologies are being developed to quickly and easily measure infectious microorganisms that threaten human health, such as new viruses, superbugs, tuberculosis, and food poisoning bacteria. Molecular diagnostics capable of measuring these pathogens offer excellent sensitivity and specificity, but often require specialized equipment and reagents or involve complex procedures. Immunodiagnostic methods, while easy to reproduce with kits and quick and simple, suffer from low measurement sensitivity.

[0003] Currently, real-time PCR is known as the fastest and most sensitive diagnostic method, and diagnosis can generally be made within 8 hours. Molecular diagnostic methods are rapidly developing along with the advancement of PCR and microchannel technologies, and products such as Alere's AlereTM I and Roche's Cobas Influenza, which can detect the virus within 60 minutes, are commercially available. However, rapid molecular diagnostic methods require expensive analytical equipment or high testing costs, and the entire molecular diagnostic process requires multiple steps, which still limits their use in point-of-care diagnosis.

[0004] The most widely used molecular diagnostic method today is real-time PCR. While this method is the most widespread due to its rapidity, it requires large and expensive equipment, making it difficult to implement in point-of-care settings or primary and secondary medical institutions. Molecular diagnostics requires three main steps: sample preparation, nucleic acid amplification reaction, and detection. While nucleic acid amplification and detection can be simultaneously reproduced using real-time PCR equipment, sample preprocessing remains a challenge.

[0005] Meanwhile, lab-on-paper technology is an integrated system that performs sample pretreatment, isothermal amplification, detection, and analysis steps on a single chip. With a small piece of paper and a chip structure embedded in the paper, all reactions can be automated and performed quickly, offering the advantage of being independent of location, such as the detection site.

[0006] The purpose of the present invention is to provide a paper-based molecular diagnostic platform that improves the efficiency of rehydration of dry reagents and isothermal amplification reaction, and a molecular diagnostic kit for HIV-1 and HIV-2 diagnosis using the same.

[0007] Another object of the present invention is to provide a paper-based molecular diagnostic platform utilizing an isothermal amplification reaction, wherein a reagent that is uniformly dried on a paper where an isothermal amplification reaction occurs can implement a uniform amplification reaction within the paper, and a paper-based molecular diagnostic platform that improves the efficiency of the rehydration of the dried reagent and the isothermal amplification reaction, which can implement a reproducible amplification reaction.

[0008] Another object of the present invention is to provide a molecular diagnostic kit capable of diagnosing HIV-1 and HIV-2 in the field with simple equipment by applying a paper-based molecular diagnostic platform that improves the efficiency of rehydration and isothermal amplification reaction of the above-described dry reagent.

[0009] In order to achieve the above object, the present invention provides a method for producing a biological sample, comprising: a sample pad for accommodating a biological sample; an amplification pad disposed on the lower portion of the sample pad, comprising a primer capable of specifically binding to a target nucleic acid and a reagent for an isothermal amplification reaction (LAMP), wherein an isothermal amplification reaction occurs; an initiator pad disposed on the upper portion of the sample pad, comprising a thermally responsive hydrophobic valve, for transporting an isothermal amplification reaction product to a detection pad when the isothermal amplification reaction is completed; a binding pad disposed on the lower portion of the initiator pad, connecting the initiator pad and the detection pad, and comprising gold nanoparticles; a detection pad disposed on the lower portion of the binding pad, for obtaining an amplified target nucleic acid from the isothermal amplification reaction product; And it includes an absorption pad arranged on the side of the detection pad and absorbing the remaining sample, the amplification pad is arranged below the sample pad so that the sample passing through the sample pad moves vertically to the amplification pad, the sample pad has an asymmetric porous structure so that an amplification reaction inhibitory component in the sample passing through the sample pad can be removed, and the sample from which the amplification reaction inhibitory component is removed through the sample pad moves uniformly in the vertical direction to the amplification pad so that an isothermal amplification reaction occurs within the entire amplification pad, providing a paper-based molecular diagnostic platform.

[0010] In addition, the sample pad is an asymmetric paper including an upper layer and a lower layer, and the upper layer may have an average pore diameter of 15 μm to 25 μm, and the lower layer may have a pore diameter of 1 μm to 5 μm.

[0011] Additionally, the sample pad may be selected from the group consisting of polyester paper, cellulose paper, cotton paper, and polysulfone paper.

[0012] Additionally, the reagents for the isothermal amplification reaction may include 10 mM to 50 mM Tris-HCl, 5 mM to 20 mM (NH4)2SO4, 20 mM to 150 mM KCl, 2 mM to 8 mM MgSO4, and 0.1% Tween-20.

[0013] Additionally, the average diameter of the pores of the amplification pad, initiator pad, binding pad, detection pad, and absorption pad may be 7 μm to 29 μm.

[0014] A molecular diagnostic kit for HIV-1 and HIV-2 diagnosis according to another embodiment of the present invention may include the paper-based molecular diagnostic platform.

[0015] An analysis method for HIV-1 and HIV-2 according to another embodiment of the present invention may include the steps of applying a biological sample to a sample pad of the paper-based branch diagnostic platform, amplifying a target nucleic acid; and detecting the nucleic acid amplicon on a detection pad.

[0016] The present invention is a paper-based molecular diagnostic platform utilizing an isothermal amplification reaction, wherein a reagent uniformly dried on a paper where an isothermal amplification reaction occurs can implement a uniform amplification reaction within the paper, and can implement a reproducible amplification reaction.

[0017] In addition, by applying a paper-based molecular diagnostic platform that improves the efficiency of rehydration and isothermal amplification reaction of the above-described dry reagent, HIV-1 and HIV-2 can be diagnosed on-site with simple equipment.

[0018] FIG. 1 is a diagram of an all-in-one molecular diagnostic platform structure according to one embodiment of the present invention.

[0019] FIG. 2 is a drawing of a molecular diagnostic kit to which an all-in-one molecular diagnostic platform structure according to one embodiment of the present invention is applied.

[0020] Figure 3 is an example of sample flow according to the difference in pore diameter of a sample pad according to one embodiment of the present invention.

[0021] Figure 4 is a drawing for forming a wax barrier layer according to one embodiment of the present invention.

[0022] FIG. 5 is a drawing of a film layer disposed on the lower portion of a pad according to one embodiment of the present invention.

[0023] FIG. 6 is a drawing of a technique for improving the signal sensitivity of a detection pad according to one embodiment of the present invention.

[0024] Figure 7 is a structural example of a test strap according to one embodiment of the present invention.

[0025] Figure 8 shows the test results for the movement of dry dye within an amplification pad according to the positions of the sample pad and amplification pad according to one embodiment of the present invention.

[0026] Figure 9 shows the test results for the progress of the amplification reaction according to the type of paper of the sample pad according to one embodiment of the present invention.

[0027] Figure 10 is a test to confirm the uniformity of movement of a dye solution according to pore symmetry or pore asymmetry of a sample pad according to one embodiment of the present invention.

[0028] Figure 11 shows the results of a diagnostic test for HIV-1 and HIV-2 using a molecular diagnostic kit according to one embodiment of the present invention.

[0029] Figure 12 shows the results of a diagnostic test using a molecular diagnostic kit for simultaneous multiple diagnosis of HIV-1 and HIV-2 according to one embodiment of the present invention.

[0030] The present invention comprises: a sample pad for accommodating a biological sample; an amplification pad disposed on the lower portion of the sample pad, comprising a primer capable of specifically binding to a target nucleic acid and a reagent for an isothermal amplification reaction (LAMP), in which an isothermal amplification reaction occurs; an initiator pad disposed on the upper portion of the sample pad, comprising a heat-responsive hydrophobic valve, for transporting an isothermal amplification reaction product to a detection pad when the isothermal amplification reaction is completed; a binding pad disposed on the lower portion of the initiator pad, connecting the initiator pad and the detection pad, and comprising gold nanoparticles; a detection pad disposed on the lower portion of the binding pad, for obtaining an amplified target nucleic acid from the isothermal amplification reaction product; And it includes an absorption pad which is arranged on the side of the detection pad and absorbs the remaining sample, the amplification pad is arranged below the sample pad so that the sample passing through the sample pad moves vertically to the amplification pad, the sample pad has an asymmetric porous structure so that an amplification reaction inhibitory component in the sample passing through the sample pad can be removed, and the sample from which the amplification reaction inhibitory component is removed through the sample pad moves uniformly in the vertical direction to the amplification pad so that an isothermal amplification reaction occurs within the entire amplification pad.

[0031] Hereinafter, embodiments of the present invention will be described in detail so that those skilled in the art can easily implement them. However, the present invention may be implemented in various different forms and is not limited to the embodiments described herein.

[0032] Hereinafter, a paper-based molecular diagnostic platform according to a preferred embodiment of the present invention will be described with reference to the attached drawings.

[0033] The paper-based molecular diagnostic platform of the present invention is based on lab-on-paper chip technology. By using the paper-based molecular diagnostic platform of the present invention, nucleic acid materials can be purified and directly applied to an amplification reaction while moving to the reaction pad without separate nucleic acid purification, and a plurality of target nucleic acids can be detected simultaneously and related diseases can be diagnosed by applying a single sample. To achieve this, the nucleic acid detection structure of the present invention includes a sample pad (110), an amplification pad (120), an initiator pad (130), a binding pad (140), a detection pad (150), and an absorption pad (160) as components.

[0034] Each component is described in detail below.

[0035] Sample pad (110)

[0036] The sample pad (110) accommodates a sample containing a nucleic acid material. The sample may be isolated from a human body or from food, etc. Specifically, the sample isolated from a human body includes, but is not limited to, blood, serum, plasma, saliva, sweat, urine, cell culture medium, tissue suspension, etc. In addition, the sample isolated from food, etc. may include, but is not limited to, the food itself, food preparation tools, food ingredients before cooking, etc. Specifically, if the food or food ingredient is in a solid state, the food may be ground and mixed with saline solution, etc. for use, and if it is in a liquid state, it may be used as is.

[0037] The above sample may be mixed with a cell lysis buffer, and if necessary, may be further purified by a commonly known method such as centrifugation, filtration, or precipitation after mixing with the cell lysis buffer. Preferably, the sample does not include a step of purifying the sample for application to the sample pad outside of the molecular diagnostic platform structure after mixing with the cell lysis buffer.

[0038] The above cell lysis buffer may contain Tris (tris(hydroxymethyl)aminomethane) at 5 mM to 80 mM, 5 mM to 50 mM, or 10 mM to 50 mM. The Tris may be specifically Tris-HCl, and may reduce rapid pH fluctuations as a buffer in the cell lysis buffer. The cell lysis buffer may have a pH of 8.0 to 9.0. When the pH is lower than 8.0, the stability of the nucleic acid material may be reduced or the migration speed may be reduced.

[0039] The above cell lysis buffer may contain potassium chloride (KCl) at a concentration of 5 mM to 50 mM, 5 mM to 40 mM, or 10 mM to 20 mM. High concentrations of potassium chloride, exceeding 50 mM, aid in cell lysis, but may reduce the water solubility of the eluted nucleic acid material, necessitating the addition of a large amount of additional buffer or increasing the time required for the material to migrate to the reaction pad. On the other hand, if the potassium chloride concentration is less than 5 mM, the cells may not be properly lysed.

[0040] The above cell lysis buffer may contain magnesium sulfate (MgSO4) at 1 mM to 30 mM, 1 mM to 20 mM, or 2 mM to 16 mM. It has been confirmed that when an appropriate amount of magnesium sulfate is included, the stability and migration speed of the nucleic acid material increase, and since it does not affect viscosity, it does not interfere with the flow of fluid, making it advantageous for pretreating samples for paper chip analysis.

[0041] The above cell lysis buffer may contain ammonium sulfate ((NH4)2SO4) at 5 mM to 50 mM, 5 mM to 40 mM, or 10 mM to 20 mM. A high concentration of ammonium sulfate exceeding 50 mM may precipitate the cell lysate, and a concentration of ammonium sulfate less than 5 mM may cause pH instability.

[0042] The above cell lysis buffer may contain a protease at 0.01 mg / ml to 0.1 mg / ml, or 0.03 mg / ml to 0.07 mg / ml. The protease decomposes high-molecular-weight proteins to prevent the high-molecular-weight proteins from blocking the pores of the substrate or paper, which are the migration paths of the nucleic acids, and inhibits RNase and DNase activities to increase the stability of the nucleic acid material. The protease may be proteinase K.

[0043] The surfactant may be TritonX-100 or Tween20 (polysorbate 20), and may be included in an amount of 0.01 w / w% to 0.2 w / w%, preferably 0.05 w / w% to 0.1 w / w%, based on the weight of the cell lysis buffer.

[0044] Additionally, it may include 0.05 mg / mL to 1.5 mg / mL polyvinylsulfonic acid, 4 mM to 10 mM vanadyl ribonucleoside complex, etc.

[0045] The above cell lysis buffer may be used at a ratio of 1:1 to the volume of the sample.

[0046] The above cell lysis buffer may not contain glycerol. Glycerol is sometimes added to prevent protein precipitation, but glycerol increases viscosity, reducing the fluidity of the cell lysate and hindering the movement of nucleic acid materials.

[0047] The above cell lysis buffer may not contain a reducing agent. Reducing agents, such as dithiothreitol (DTT) and mercaptoethanol, help denature proteins and increase the water solubility of cell lysates. However, if present in the solution flowing into the paper chip, they may interfere with fluorescence emission or detection reactions.

[0048] The above sample pad (110) may be selected from the group consisting of polyester paper, cellulose paper, cotton paper, and polysulfone paper, and preferably may be polysulfone paper.

[0049] The above polysulfone paper includes a structure in which two or more layers are laminated, may be asymmetrical, and may be a porous material having pores of 0.5 μm to 1 μm. Specifically, the asymmetric paper may include an upper layer and a lower layer, and the pores included in the upper layer may have an average diameter of 15 μm to 25 μm, and may include pores having various diameters. The plurality of pores included in the upper layer may have a diameter of approximately 7 μm to 29 μm. In addition, the pores included in the lower layer arranged to be in contact with the upper layer may have an average diameter of 1 μm to 5 μm, 1 μm to 4 μm, or 1 μm to 3 μm, and may include pores having various diameters. The plurality of pores included in the upper layer may have a diameter of approximately 1 μm to 9 μm. As described above, it is advantageous for the paper constituting the sample pad to have a relatively large pore diameter in the upper layer. However, many biological samples have viscosity, and in particular, when a cell lysis composition is treated on the sample, the viscosity may significantly increase as nucleic acid substances and proteins are eluted out of the cells. Therefore, it is preferable that the pore size of the sample pad (110) be appropriate for rapid absorption of the sample.

[0050] When a paper including asymmetric pores as shown in Fig. 3 is used as a sample pad, a sample passing through the sample pad can evenly move to the amplification pad while passing through the entire pores of the sample pad.

[0051] As described above, when moving to the amplification pad through the entire surface of the sample pad, it can react with all the isothermal amplification reaction reagents contained in the amplification pad, so that an efficient isothermal amplification reaction can proceed.

[0052] On the other hand, unlike the present invention, when a symmetrical paper is used as a sample pad and there is no difference compared to the pores of the amplification pad, the sample passing through the sample pad does not flow across the entire area of ​​the sample pad, but a narrow flow occurs within the portion where the sample is introduced, and the sample moves to the amplification pad along this narrow flow. At this time, the isothermal amplification reaction reagent fixed within the amplification pad moves to both ends due to the flow of the initial sample. Therefore, even if the sample is completely absorbed into the amplification pad, a problem may arise in which the isothermal amplification reaction does not occur because the isothermal amplification reaction reagent is not contained within the area where the initial sample was absorbed.

[0053] Amplification pad (120)

[0054] The amplification pad (120) is a component corresponding to a paper chip in the lab-on-paper, and isothermal amplification reaction reagents including dNTP, DNA polymerase, reverse transcriptase, fluorescent marker, isothermal amplification reaction buffer, etc. for amplification reaction are fixed thereon. Therefore, a solution containing a nucleic acid material is permeated and wetted into the amplification pad by an additional buffer solution applied to the sample pad, and when the contact material of the isothermal amplification reaction reagent and the sample moves to the amplification pad and is heated to 60 to 70°C by a heating unit at the bottom of the amplification pad, an isothermal amplification reaction or reverse transcription isothermal amplification reaction occurs.

[0055] The above isothermal amplification reaction reagent may specifically include dNTP (0.7 mM to 1.4 mM, dATP, dCTP, dGTP, and dTTP), isothermal amplification buffer (10 mM to 50 mM Tris-HCl, 5 mM to 20 mM (NH4)2SO4, 20 mM to 150 mM KCl, 2 mM to 8 mM MgSO4, and 0.1% Tween-20, pH 8.8), and Bst 3.0 DNA polymerase (0.1 U / uL to 1 U / uL), which may be mixed in an amplification pad and then dried under conditions such as refrigeration, freezing, or room temperature, or may be applied to the surface of the reaction pad in powder form and fixed by heating in an oven at about 35 to 40°C for about 30 minutes, for example.

[0056] A heating unit may be placed under the amplification pad to heat to a temperature at which the above isothermal amplification reaction can occur. The heating unit may include a heating wire or a heating plate for heating. The heating may be performed under conditions of 60 to 70°C, 60 to 65°C, for 10 to 60 minutes, 20 to 40 minutes, or 30 minutes.

[0057] The amplification pad has a plurality of wells, and each well can be immobilized with a primer set for an isothermal amplification reaction, including forward and reverse inner primers (inner primers: FIP and BIP, 0.8 μM to 3.2 μM), loop primers (loop primers: FL and BL, 0.2 μM to 0.8 μM), and outer primers (outer primers: F3 and B3, 0.1 μM to 0.2 μM). The concentration of the primers is a concentration relative to the well volume, and the concentration of the primer set in the well can be changed while maintaining the concentration ratio between each primer. The presence of the well in the amplification pad allows the isothermal amplification reaction to occur more intensively. Specifically, the well may have a hydrogel layer formed on the bottom, and the primer set may be immobilized on the hydrogel layer. For intensive amplification of a specific target nucleic acid, a primer set that specifically binds to a different target nucleic acid may be immobilized in each well.

[0058] The hydrogel layer containing the above primer can be formed, for example, by the following method. Based on the total volume of the hydrogel solution, 20% v / v of poly(ethylene glycol) diacrylate (PEGDA, Sigma-Aldrich, MW700), 40% v / v of poly(ethylene glycol) (PEG, Sigma-Aldrich, MW600), 5% v / v of the photoinitiator 2-hydroxy-2-methylpropiophenone (Sigma-Aldrich), and 35% of a buffer (PBS buffer, pH 7.5) are mixed, and the primer set is mixed therein to prepare a hydrogel solution. The poly(ethylene glycol) is preferably included to increase the porosity of the hydrogel microparticles. Then, the hydrogel solution is applied to the inner surface of each well of the reaction pad and dried to form a hydrogel coating layer. Since the hydrogel layer has pores, the primer within the hydrogel layer can bind and an amplification reaction can occur intensively within the pores.

[0059] In the above primer set, any one of the forward and reverse primers may be labeled with one or more fluorescent markers selected from the group consisting of Cy3, Cy5, TAMRA, TEX, TYE, HEX, FAM, TET, JOE, MAX, ROX, VIC, Cy3.5, Texas Red, Cy5.5, TYE, BHQ, Iowa Black RQ, and IRDye. The fluorescent markers may be labeled differently for each target nucleic acid in order to independently detect the target nucleic acids.

[0060] In the above primer set, either the forward or reverse primer may be biotin-conjugated. Since biotin can bind to streptavidin, it exists in a bound form on the amplified target nucleic acid, and when it passes through the second connection pad, it binds to streptavidin on the surface of the gold particle and is captured by the detection pad, thereby visualizing the detection result. The biotin may be designed to be located opposite the detector on the amplified target nucleic acid. For example, if the detector is conjugated to the 5' end of the forward primer, biotin may be conjugated to the 5' end of the reverse primer.

[0061] The amplification pad may contain 10 mM to 100 mM trehalose, 40 mM to 50 mM sucrose, 0.001 to 0.01% Triton X-100, and 0.1 w / w% to 0.3 w / w% glycerol. This may increase the storage stability of isothermal amplification reaction reagents and primer sets when exposed to moisture or oxygen. The storage stability may mean that the amplification pad can be stored for more than 6 months at 25°C to 30°C without decomposition products or byproducts.

[0062] The amplification pad may use paper having a pore size of 0.001 μm to 0.005 μm, preferably 0.005 μm, so that the nucleic acids can remain and sufficiently undergo an isothermal amplification reaction while allowing the free flow of the sample and additional buffer. Specifically, the amplification pad may be selected from the group consisting of polyester paper, cellulose paper, cotton paper, and polysulfone paper, and preferably polyester paper.

[0063] The above polyester paper has a highly porous structure, which can increase the reactivity of reagents, and the chemical components processed during paper manufacturing do not inhibit the LAMP amplification reaction.

[0064] As described above, the amplification pad of the present invention is placed below the sample pad, so that a sample passing through the sample pad moves vertically to the amplification pad, thereby allowing an isothermal amplification reaction to proceed.

[0065] In conventional molecular diagnostic kits, the sample pad and the amplification pad are arranged in series for lateral movement, so that the sample injected into the sample pad moves laterally to the amplification pad, and an isothermal amplification reaction is performed on the amplification pad. If the sample pad and the amplification pad are connected to each other to form a molecular diagnostic structure, the problem of sample evaporation may occur when the isothermal amplification reaction is performed on the amplification pad. That is, since the isothermal amplification reaction is performed by providing heat by a heating unit located at the bottom of the amplification pad and the reaction is performed by continuously supplying such heat, the problem of sample evaporation in a liquid state may occur according to the isothermal amplification reaction, and to prevent this, a separate blocking pad is required to prevent evaporation of the sample.

[0066] On the other hand, the present invention positions the amplification pad below the sample pad, so that the amplification pad is positioned perpendicular to the sample pad, and thus the sample pad is positioned during the isothermal amplification reaction, thereby preventing evaporation of the sample, thereby increasing the efficiency of the reaction without a separate structure.

[0067] In addition, due to the vertical structural characteristics of the sample pad and amplification pad described above, since the sample pad is a paper with an asymmetric structure as described above, impurities in the sample can be first removed by the sample pad and then moved to the amplification pad.

[0068] A film layer (121) may be placed under the amplifying pad. The film layer (121) is positioned under the amplifying pad and may be placed symmetrically in the length direction with respect to the center of the amplifying pad. More specifically, it may be placed with respect to the center of the amplifying pad and may be placed so as to have a length of 25% to 75% of the total length of the amplifying pad.

[0069] As the film layer (121) is arranged as described above, a gap is formed between the amplification pad and the film layer, and the gap acts as a path, so that when the isothermal amplification reaction product moves by the initiator pad described later after the isothermal amplification reaction is completed at the amplification pad, it can move at a faster speed.

[0070] However, when the film layer (121) is placed on the amplification pad, it is preferable to place it so as to have a constant interval. For this purpose, a product in which the film layer is adhered to the amplification pad can be purchased and used, or, when placing the film layer on the amplification pad as shown in FIG. 5, a film layer can be additionally laminated on both ends of the film layer so that the interval between the amplification pad and the film layer is constant. At this time, the interval between the amplification pad and the film layer may be 100 µm to 750 µm, 150 µm to 500 µm, or 200 µm to 400 µm in height. If the height of the flow path is too low or too high, a problem may occur in which the flow rate of the isothermal amplification reactant slows down. When a flow path of an appropriate height, such as the above range, is formed by laminating the amplification pad and the film layer, a fast flow rate can be exhibited, thereby facilitating movement through the initiator pad.

[0071] The above film layer (121) can be made of any non-porous film material without limitation. For example, a polyacrylic film can be used, but is not limited to the above material.

[0072] Initiator Pad (130)

[0073] The above initiator pad (130) is placed on top of the sample pad and includes a thermally responsive hydrophobic valve to maintain fluid flow during an isothermal amplification reaction and to transport the isothermal amplification reaction product to the detection pad when the isothermal amplification reaction is completed.

[0074] The initiator pad may include an additional buffer to prevent nonspecific binding of antibodies in the detection signal. For example, the initiator pad may be an isothermal buffer or phosphate buffer (50 mM Na2HPO4, pH 7.2) containing 5 mM to 80 mM Tris-HCl, 20 mM to 70 mM potassium chloride, 0.5 mM to 5 mM magnesium sulfate, 1 mM to 30 mM ammonium sulfate, and 0.01 w / w% to 0.2 w / w% Tween® 20 to TritonX-100 and having an acidity of pH 8.0 to 9.0. The isothermal buffer may more specifically contain 20 mM Tris-HCl, 10 mM (NH4)2SO4, 50 mM KCl, 2 mM MgSO4, and 0.1% Tween® 20 and have an acidity of pH 8.8. The above additional buffer may not contain a proteolytic enzyme, glycerol, or reducing agent.

[0075] The above initiator pad may include a thermally responsive hydrophobic valve (131) and a blocking film layer (132) at one end.

[0076] The above initiator pad includes a thermally responsive hydrophobic valve (131) at one end, and the movement of the sample can be prevented while the isothermal amplification reaction is in progress in the amplification pad by the thermally responsive hydrophobic valve. The above initiator pad may be made of a material composed of a cellulose film and may have pores of 0.005 μm to 0.015 μm. The portion of the initiator pad that comes into contact with the reaction pad may be coated with low-melting-point agarose or wax.

[0077] Conventional thermally responsive hydrophobic valves have formed wax barriers, and in order to completely block the flow of fluid, multiple wax barriers are formed so that the first wax barrier and the second wax barrier can block the flow. When multiple wax barriers are formed as described above, the fluid flow blocking effect by the wax barriers is excellent, but there is a problem that the inconvenience of forming multiple wax barriers and controlling them to an appropriate width must be resolved in the manufacturing process.

[0078] Accordingly, in the present invention, instead of forming a plurality of thermally responsive hydrophobic valves, a wax barrier is formed with a single thermally responsive hydrophobic valve, and at this time, the fluid blocking effect by the wax barrier is increased, and when the isothermal amplification reaction is completely completed in the amplification pad, the wax barrier is opened by heat, and an optimal width is set to enable smooth movement of the fluid.

[0079] FIG. 4 is a diagram illustrating a process for forming a thermally responsive hydrophobic valve according to one embodiment of the present invention, wherein wax film layers are disposed on the upper and lower portions of an initiator pad, and the wax is absorbed into the initiator pad through a lamination process. At this time, the wax is completely absorbed into the initiator pad, so that the wax of the wax film layers disposed on the upper and lower portions of the initiator pad can come into contact with and be bonded to the interior of the initiator pad.

[0080] At this time, the width of the thermally responsive hydrophobic valve is 1.0 mm to 4.0 mm, 2.0 mm to 4.0 mm, and may be 3.0 mm. Within the above width range, the movement of the sample can be prevented by the thermally responsive hydrophobic valve while the isothermal amplification reaction is carried out for 30 minutes under the condition of 60° C. on the amplification pad, and after the isothermal amplification reaction is completely completed, the thermally responsive hydrophobic valve is heated for 2 minutes under the condition of 90° C., and when the thermally responsive hydrophobic valve melts and opens, the isothermal amplification reactant moves through the initiator pad to the binding pad and the detection pad.

[0081] The above initiator pad can be divided into a portion connected to the sample pad (110) and a portion connected to the bonding pad (140) based on the thermal reaction hydrophobic valve (131). In the portion connected to the bonding pad, a blocking film layer (132) may be additionally included to prevent evaporation of the isothermal amplification reactant when it moves.

[0082] The above-mentioned blocking film layer (132) may utilize a polyacrylic film to prevent evaporation of the sample. However, the present invention is not limited to the above example, and any material capable of preventing evaporation of the sample may be used without limitation.

[0083] Additionally, the portion connected to the sample pad may have a film layer (133) placed underneath. It may be placed like the film layer (121) placed underneath the amplification pad (120) described above.

[0084] The above initiator pad is a porous material having pores of 0.5 μm to 1 μm, and may be cotton, fluff, paper, nitrocellulose, cellulose acetate, glass fiber, polysulfone, polyacrylic, polynitrile, polypiperazine, polyamide, polyethersulfone, polyvinylidene fluoride, polyethyleneimine, polydimethylsiloxane, or a mixture thereof.

[0085] Bonding pad (140)

[0086] The binding pad may be positioned above and to the side of the reaction pad, partially in contact with the reaction pad. The binding pad comprises gold nanoparticles, and the gold nanoparticles bind to the nucleic acids amplified on the reaction pad and are transferred to the detection pad. The gold nanoparticles may preferably have streptavidin or a specific antibody immobilized on their surface, but are not limited thereto.

[0087] The above binding pad may be a porous material such as cotton, fluff, paper, nitrocellulose, glass fiber, polysulfone, polyacrylic, polynitrile, polypiperazine, polyamide, polyethersulfone, polyvinylidenefluoride, polyethyleneimine, polydimethylsiloxane or a mixture thereof, having a pore size of 0.01 μm to 0.05 μm, preferably 0.05 μm, so that the amplified nucleic acid can easily move to the detection pad.

[0088] The above binding pad is arranged perpendicular to the initiator pad, and serves to help the isothermal amplification reactant moved from the initiator pad to move to the detection pad, thereby allowing the gold nanoparticles to bind well to the nucleic acid to be detected. However, when the binding pad is laterally bound to the initiator pad and the detection pad, as in the conventional molecular diagnostic kit, the problem of evaporation of the fluid may occur. To prevent this problem, a separate blocking pad had to be included, but in the present invention, by positioning the binding pad perpendicular to the initiator pad, not only does it facilitate the movement of the isothermal amplification reactant from the initiator pad to the binding pad, but it also prevents the problem of the liquid sample evaporating and reducing the detection sensitivity.

[0089] Detection pad (150)

[0090] The detection pad may be positioned on the lower and side of the binding pad, in contact with a portion of the binding pad. A receptor (151) capable of binding to a detector (152) is fixed to the detection pad. The receptor may be an antibody, protein, or fragment thereof capable of specifically binding to the detector.

[0091] The above detection pad includes a plurality of detection zones, and the detection zones can be divided into lines or wells. Each receptor is independently fixed to each detection zone, and after forming a detection zone by stamping with ink containing, for example, polyethylene phthalate, the detection zone is then stamped again with ink containing the receptor, or in the case of a well, a solution containing the receptor is applied, and EDC (1-Ethyl-3-[3-dimethylaminopropyl]carbodiimide) or NHS (N-hydroxysulfosuccinimide) can be applied. Dozens to hundreds or more detection zones are formed on one reaction pad, and target nucleic acids can be detected as many as the number of detection zones formed by applying a sample once.

[0092] The above detection pad may be selected from the group consisting of polyester paper, cellulose paper, cotton paper, and polysulfone paper, and may have a pore size of 0.001 μm to 0.005 μm, preferably 0.005 μm, so that the sample can move laterally to the absorption pad.

[0093] The above detection pad is specially patterned for micro-channel control. Specifically, based on the cross-section of the detection pad, the detection signal can be divided into a visible region and an invisible region as the detector binds to the receptor. In the case of the detector (152)-receptor (151) binding in the invisible region, there is a problem of causing a loss in terms of signal since the color of gold is not visible. Therefore, in the present invention, as shown in FIG. 6, the invisible region of the detection pad is blocked by wax patterning, so that the detector (152) binds to the receptor (151) in the visible region, thereby exhibiting a higher detection signal.

[0094] Specifically, the detection pad of the present invention is characterized by including a hydrophobic blocking layer in a non-visible area using a transfer film. Specifically, the hydrophobic blocking layer may include wax. In order to form the hydrophobic blocking layer as described above, a transfer film including wax is positioned on a surface of the detection pad that comes into contact with the non-visible area, and the wax of the transfer film is moved to the detection pad by lamination to form a hydrophobic blocking layer. The hydrophobic blocking layer may be formed using a method using a transfer film including the above-described wax, but is not limited to the above examples, and any method for including a hydrophobic substance in the non-visible area may be used without limitation.

[0095] When a hydrophobic blocking layer is formed on the cross-section of the detection pad as described above, a liquid sample moves to a porous region where a hydrophobic blocking layer is not formed, and a detector included in the sample binds to a receptor fixed to the detection pad. The thickness of the porous region may be 100 µm to 10 µm, 80 µm to 10 µm, 60 µm to 10 µm, 40 µm to 10 µm, 20 µm to 10 µm, or 20 µm. When a hydrophobic blocking layer is formed on the detection pad so as to have a thickness of the path within the above range, a colorimetric detection enhancement effect can be exhibited without a change in signal intensity.

[0096] Absorbent pad (160)

[0097] The absorbent pad (160) absorbs samples, buffers, etc. to block reverse flow and contribute to inducing lateral flow. The absorbent pad is a porous material and may be cotton, fluff, paper, nitrocellulose, cellulose acetate, glass fiber, polysulfone, polyacrylic, polynitrile, polypiperazine, polyamide, polyethersulfone, polyvinylidene fluoride, polyethyleneimine, polydimethylsiloxane, or a mixture thereof. The absorbent pad may preferably be glass fiber and have a pore size of 0.1 to 0.5 μm.

[0098] The above sample pad (110), amplification pad (120), initiator pad (130), bonding pad (140), detection pad (150), and absorption pad (160) are arranged to be connected to each other, and are in a coupled state so that a sample can move to the absorption pad (160) through the sample pad (110). Specifically, the amplification pad (120) is positioned vertically below the sample pad (110), the initiator pad (130) is arranged on one upper side of the sample pad (110) and is connected laterally, and the bonding pad (140) is arranged on the lower side of the other side of the initiator pad (130) so that they can be vertically coupled, the detection pad (150) can be arranged on one side of the bonding pad (140) below, and the absorption pad (160) can be arranged on one side of the detection pad (150).

[0099] In addition, as described below, the amplification pad (120) may be immobilized with a primer set for amplifying a target nucleic acid. Specifically, primer sets for detecting HIV-1 and HIV-2, respectively, may be immobilized, and each primer set capable of detecting both HIV-1 and HIV-2 may be immobilized on a single amplification pad (120). Using a single molecular diagnostic kit, HIV-1 and HIV-2 may be detected separately, or HIV-1 and HIV-2 may be diagnosed simultaneously with a single molecular diagnostic kit.

[0100] A molecular diagnostic kit according to another embodiment of the present invention may have a shape as shown in FIG. 2. According to FIG. 2, the molecular diagnostic kit of the present invention may include a housing (200, 200'), an internal bracket (300), a molecular diagnostic strap (100), and a PCB substrate (400).

[0101] The above housing is divided into an upper housing (200) and a lower housing (200'), and the upper housing includes a sample receiving portion for receiving a biological sample and a detection area for confirming a search line.

[0102] The above-described internal bracket (300) includes a plurality of push pins for fixing a molecular diagnostic strap (100) located inside the housing and preventing heat from leaking out. Specifically, the push pins are located at the front and rear ends of the thermally responsive hydrophobic valve within the molecular diagnostic strap (100). The above-described push pins surround the thermally responsive hydrophobic valve and press the initiator pad, thereby preventing heat transferred by a heating unit within a PCB substrate (400) described below from leaking out to the outside, thereby melting the thermally responsive hydrophobic valve with minimal heat and heating time, or preventing heat from being released for an amplification reaction within the amplification pad.

[0103] The above molecular diagnostic strap (100) includes the sample pad (110), amplification pad (120), initiator pad (130), binding pad (140), detection pad (150), and absorption pad (160) described above, and is replaced with the above description.

[0104] In addition, the average pore diameter for the sample pad (110) is as described above, and the average diameter of the pores of the amplification pad (120), the initiator pad (130), the binding pad (140), the detection pad (150), and the absorption pad (160) is 7 µm to 29 µm, and more specifically, the pores of the amplification pad (120) may have a diameter of 15 µm to 37 µm, and the average diameter may be 20 µm to 29 µm. In addition, the pores of the initiator pad (130) may have a diameter of 5 µm to 26 µm, and the average diameter may be 15 µm to 19 µm. The binding pad may use paper having the same pore diameter as the amplification pad described above.

[0105] The PCB substrate (400) is connected to an external power source and includes a power button, two heating elements, a temperature sensor, and a control element. The power button can be operated when the power button in the upper housing (200) is pressed, and the temperature sensor is located on the other side of each heating element to precisely control the degree of temperature increase by the heating elements. The heating elements are respectively located in an area corresponding to the amplification pad and an area corresponding to the thermally responsive hydrophobic valve. When the molecular diagnostic kit of the present invention is operated, the heating elements located in the area corresponding to the amplification pad provide heat over time so that an isothermal amplification reaction proceeds in the amplification pad, and when the isothermal amplification reaction is completed, the heating elements stop supplying heat, and the heating elements located in the area corresponding to the thermally responsive hydrophobic valve provide heat so that the wax barrier melts and the isothermal amplification reactants can move. The heating temperature of each heating element may be to satisfy the temperature conditions for the above-described isothermal amplification reaction and the temperature conditions for melting the thermally responsive hydrophobic valve FMF.

[0106] A quantitative analysis method for HIV-1 and HIV-2 according to another embodiment of the present invention may include the steps of applying a biological sample to a sample pad of the all-in-one molecular diagnostic platform structure, amplifying a target nucleic acid; and detecting the nucleic acid amplification product on a detection pad.

[0107] In order to amplify the above target nucleic acid, the present invention uses an isothermal amplification reaction, and in order to proceed with this isothermal amplification reaction, design and securing of primers are required.

[0108] Specifically, while conventional nucleic acid amplification technology uses a pair of primers, nucleic acid isothermal amplification is a technology that amplifies nucleic acids at a constant temperature using two or three pairs of primers. Compared to general nucleic acid amplification technology, it can produce a large number of amplification products in a short period of time. However, due to the large number of primers, there is a high possibility of non-specific amplification, so a technology that can control this and enable rapid amplification is needed. In the present invention, a primer design program developed by applying artificial intelligence technology was used to suppress non-specific amplification and improve amplification reaction efficiency and colorimetric signal in nucleic acid isothermal amplification using four or six primers.

[0109] To classify the quality of LAMP primer sets for amplification activity and nonspecific amplification inhibition, models for primer set prediction and primer set quality classification are needed. To develop the first primer set prediction model, data were selected from online resources provided by existing LAMP primer design tools. The collected data included entire genome sequences and corresponding LAMP primer sets. The data structure included features such as tm, GC content, length, and ΔG values ​​for mono- and heterodimers for each primer. The target structure for the data was defined by two key elements: the start position of each primer and the distance between the end and start of adjacent primers. These allow for a clear representation of the spatial sequence at which the primers are intended to bind to the target DNA.

[0110] By structuring the data in this way, we trained multi-layer perceptron (MLP) and convolutional neural network (CNN) machine learning models to not only identify potential primers but also preserve the order and spacing required for the LAMP process to function correctly.

[0111] To develop a quality classification model for LAMP primer sets, we quantified the characteristics of primer sets for various indications and the amplification patterns of each primer set. The dataset consisted of various primer attributes along with labels indicating amplification success. For data clustering and classification, a large-scale unlabeled dataset derived from the primer set prediction model was clustered using a multi-model approach. To improve the accuracy of the classification model, class labels were assigned and the clusters were integrated with the labeled data.

[0112] LAMP primer design AI technology uses multi-layer perceptron (MLP) and convolutional neural network (CNN) machine learning models to select data from online resources provided by existing LAMP primer design tools. The AI ​​model learns characteristics such as Tm, GC content, length, ΔG values ​​for mono- and hetero-dimers, and the starting position and inter-primer distances of each primer in the target structure. Furthermore, the AI ​​program was completed by combining a primer-based amplification product size prediction model, which predicts the size of the amplification product based on the LAMP amplification reaction principle. Furthermore, this program developed an algorithm to predict the optimal LAMP master mix for various infectious diseases and emerging infectious diseases, thereby completing a technology for reconstituting LAMP amplification reagents for new pathogens. Through this method, we confirmed rapid amplification (within 15 cycles) without nonspecific amplification in single or simultaneous multiplex LAMP amplification for 16 infectious diseases. Furthermore, we confirmed that the colorimetric signal was improved by approximately 1.5 times through primer design that allows for size adjustment of the amplification product.

[0113] Specifically, the isothermal amplification reaction uses 4 to 6 primers to generate amplified products of various structures and sizes through a complex amplification reaction as the nucleic acid isothermal amplification reaction occurs, and amplified products of various sizes ranging from 100 bp to 10,000 bp are created. In a LOP system such as the present invention, the size of the nucleic acid, which is the amplified product, is one of the main factors affecting the sensitivity of the colorimetric signal in order for the antibody of the detection pad and the nucleic acid, which is the amplified product, to bind according to the microfluidic flow.

[0114] Accordingly, as a result of confirming through electrophoresis the amplification product bound to the test line of the detection pad to which the molecular diagnostic platform technology of the present invention is applied and the pure amplification product not bound to the detection pad, the size of the amplification product bound to the detection line was 500 bp or less, and it tended not to bind well at sizes greater than that.

[0115] Taking advantage of this trend, a technology capable of maximizing the production of amplicons smaller than 500 bp is needed to improve detection signal, as amplicons larger than 500 bp do not affect the detection signal. To this end, a primer-based mathematical model was developed that predicts the size of amplicons based on the principle of isothermal amplification:

[0116] [Formula 1]

[0117] LAMP structure size (bp) = (B2+B space ) + (B1)(x) + T(x) + (F1)(x +1) + (F2+ F space )

[0118] Here,

[0119] B2: B2 base sequence size (bp)

[0120] B space : Base sequence size (bp) between B1 and B2

[0121] B1: B1 base sequence size (bp)

[0122] T: Base sequence size (bp) between B1 and F1

[0123] F1: F1 base sequence size (bp)

[0124] F2: F2 base sequence size (bp)

[0125] F space : Base sequence size (bp) between F1 and F2

[0126] x: Value for each component according to the number of loops formed in the amplified product

[0127] Based on this technology, the time required to design and secure primers for various new diseases can be significantly shortened.

[0128] The sequence information of the primers designed and secured through the technology of the present invention is as shown in Table 1 below:

[0129] 적응증genePrimerSequenceHIV-1GagpolF3GCCAAAGTGATCCCAB3ATCTGCCTGGTCAATAFIPCCACTTGTTAGCATGGTGTTGTTTTCACATTATCAGAAGABIPGACATCAAGCGCCATGCAAGGATGCATCTATCCATTCLBAGACCTCATGAGGAGCTGCHIV-2GagpolF3CTCCTCTTGAAAGAGGAAB3CCCTGTGGTATCTGAATGGATFIPGCCCACACAATTGTTTTAACCTTGCAGACGAATTAGGAAAGTTAGGBIPAGCGAATGAAGAAGGATAAATTGGACTAAAACTCGAGATCTTTGGCLFTTTCCGAAGGATCGTAALBTTGGCAGGGAGGCTGGTGGACOVID-19ORFF3GGCCAAGTCTGCGGTCAAB3TCTTTGGTTAATCTAGCCCAFIPTCAGTGCTGCATGTTTGTAGCTTAGTTCCTGTCACTACGBIPAATGCGTTAGCTTACTACACATTTTCAAATCCTGTATAATCGGATATLFTACTCGGCAGTCACATAGACLBCAATAGGGAGGTAGGATTTAGTACTTZIKANS5F3GCAGAAGCAATGAGATGGGATAB3CCCAATCCATTGAGGATACAGCTFIPACCTAGAGGGCAATGTGCAAACCGACGGTCAAGTGGAGATGACTBIPACACACAAGGAGATGGAACCCTCGGAGCAAGAACGGGACTTCTLFTCATCGAATTGGCTTACACAAACGCLBGACTGAGATGGAGGCTAATTGGGASalmonella typhimuriumProtease2F3ACCCTGGTTTAACCGTACTGGTTB3GTAATCTGGCGGTCGTTCATTGAFIPGGCGATGCCAATATCACTTCACGTTTGGTCGAAGAGCGTCAACBIPGACGATCCGGAATACGTGACCAGAATAGCCGTAACGCAGCLFTTTTACGGAATTTGCCATAGGLBGCTTGCTATAGTCTTGAACCTGSalmonellaEnteritidissefAF3GGCTTCTGGTGGATGAGTB3GGCTTAGGGATTTGACCCCAAAFIPCTCAACTGAATACGCCCGTTAGATAGCCAGTTCGTTCGBIPCTGGAATTGAGGGCTTTGCAGGTGGGGACAGAGACATTTAGCGLFCAGGCTTCCTTGATCAATCAALBGCTTTGCCAGCTCTCAAGAAAEscherichia coliO157:H7stx1AF3GTAACTGGAGCCCTTTGTAGB3CTACGTTGCTTCTCATCTTGFIPTCCCAGAAAATTGCATCCTAATCGTCCTTTGCCTGAATTATCATGTGBIPGCGTGTAGGGCATTAATACTGATAGAAGGAATGAAACCCTCATCAGATLFCTTTTCCTACACTAGACGTACTTGTLBATGCAATCTTGATGTTGCCGVibrio choleraehlyAF3GGGATCATTCTGTATTCACAB3ACCATTTCAAGAGCAATTAGFIPGGATCCGGGTCATCGATGCCTGCCCGAAACCTACATBIPAGCCAATATGGCGGCCCATACCTTCGCACTCACATACGACALFTACATCGAAGTTTAAATGCTGTTCLBAGCAAAGTCAGGCGCAATGATTTCATCVibrio parahaemolyticustoxRF3GAACTTGTACGGCTAGGAAGCB3GGATTAGTTTTAACCGCTCTGFIPGCTCGTTTAAGGTTAAAACTTCGAGGGAAAGGGCATACTCCBIPTTGTTTGGTTAAGCAAGGTCTTCGGGATCTTACGCAGAGLFTTGGGCCCTCTCCGCTTACATCLBTGACAAAGCCTGAAGCAAGVibriovulnificuspilFF3GACTTCCGGTCACGGAGTB3AGTTTAGCCATGGAAGGAGCTGFIPAGGAAGCAATGCGATGAGATTCTGCCATCAATAAGGCCAATCACAGBIPTGGCTATCTCGGGAATGGCGCGTCAATAGCGTCAGTCAGGLFGCCACCATGGGTCGCGGAATCTLBATCAGGCCCATCCGACACACTTACCAACDengue virus_type 1NS5F3CACCATTGCATCAATTTGAAGB3AACGTAGCTGGAACAGATATGTAGCFIPCACCTTGTGATAACTCTAGCCTACGGAGTAGGAGATAGTGTAGTGCTABIPAGTGAGAGAACATGCGTCTCTGGCATCTCTCAACACTTGGLFCAAGTTCAAATCTTTTGGTTACCGLBCACAGATGGTGCAGCTGAAGTDengue virus_type 2C, PrMF3TGACCACACGACGCCAGACAB3GGACATCACGTACGTGCTTGFIPCGATCATAAGTGGTTCTCCGTTCGGTATGCTGATAACACAGTGABIPTGTTCGCCACAGGGGATGACGTCACACACGCCACCAAGGTCLFCGTGCCGTTAAATGCCTCGCCALBGACTATGTGTACAATCATGGCCDengue virus_type 3UTRF3CCTTAAGCCATAGGTTTGAGB3GGAACTCTCCTGGCAACTCFIPTCCAATATTTGCAGCCTGATAAACCGTTTACCCTGTABIPACATCGGTTAGACCAGTCCCCCACAGCAACCCGCAGTGCTLFTTACCGTCCCGCACGAGCGGGAGLBCCCAGTGAGCACAGACGCAGGCAGDengue virus_type4UTRF3GGGCATGATTGGACGTAGCGGGTTB3TGCGCTGGATTGGATGTGTGGCAFIPGGAGGTACAGGCTTCCTCGCTAGACCGCCTCCGCATCAGCTGBIPAGAGGAAAGAGGAGACCCTCACAGGATCTCTGGTCAAGTCCCALFGCGGAACTTTGGCTGAGTLBCAACACTTGGAAACAGCATATGACGCInfluenza APAF3GGAACGGAGCCGTCGCGGB3GCCTACAGAATGTACGTCATGCFIPCAGGTGGGCTGAGGATCGGGTCAAGCTTATCGAAATGTCABIPGGACCTATTGCCATCAGCGTATTCCTTGGCCTTCGTGALFGTCGAATTCAAGAATGCATGCAALBGTATTCTGCTGACAGTATGCTCInfluenza BPAF3GACACTTGATGTTGAAGTGGGB3CTTGTACAAGAGGATAATGATCFIPCCACAACAAATAGGGAACCAATTTTAGAGTACAGAACCAGABIPATTAAAGAGTGAATGACACAATGTTGCACTGATTGCAGCAGACLFATTTCTTCACCACTGGACTGAGTCLBTGGCCAATGGAAGCTCCAAGA

[0130] ※ F3, forward primer; B3, backward primer; FIP, forward inner primer; BIP, backward inner primer; FL, forward loop primer; BL, backward loop primer

[0131] In the present invention, primers related to HIV-1 and HIV-2 among the primers in Table 1 above can be used for isothermal amplification reaction, and a diagnosis method for HIV-1 and HIV-2 or an analysis method for HIV-1 and HIV-2 can be provided.

[0132] As described above, the present invention allows for isothermal amplification of HIV-1 and HIV-2 from a sample on an amplification pad without requiring a separate pretreatment, and for this to be confirmed on a detection pad.

[0133] Manufacturing example

[0134] The sample pad was prepared with polysulfone paper of an asymmetrical structure, the amplification pad was prepared with polyester paper, the initiator pad was prepared with cellulose paper, the binding pad was prepared with polyester paper, the detection pad was prepared with nitrocellulose paper, and the absorption pad was prepared with cellulose paper.

[0135] The above amplification pad was prepared by soaking polyester paper in a solution containing 45 mM sucrose, 0.005 w / w% TritonX-100, and 0.2 w / w% glycerol, and then drying.

[0136] Then, dNTPs (0.7–1.4 mM, dATP, dCTP, dGTP, and dTTP), isothermal amplification buffer (10–50 mM Tris-HCl, 5–20 mM (NH4)2SO4, 20–150 mM KCl, 2–8 mM MgSO4, and 0.1% Tween-20, pH 8.8), and Bst 3.0 DNA polymerase (0.1–1 U / uL) were applied to the surface of the amplification pad, and dried for 2 hours in a frozen or refrigerated state.

[0137] A transfer film containing wax was positioned on both sides of the initiator pad, and a thermally responsive hydrophobic valve with a width of 3 mm was formed by lamination.

[0138] 89.3 wt% of 40 nm AuNPs solution (OD 1) and 8.9 wt% of 100 mM borate buffer solution were mixed and reacted at room temperature (20-25°C). 0.9 wt% of streptavidin solution (STP-AP) with a concentration of 17 U / mL was additionally mixed and reacted at room temperature. 0.9 wt% of 10% BSA solution was added and reacted at room temperature for more than 30 minutes to block the gold reaction sites. Afterwards, the supernatant was removed by centrifugation and washed three times with 10 mM borate buffer solution (centrifugation). The final pellet was dissolved in 10 mM borate buffer solution to an OD450 value of 10 and stored, which was then used as gold nanoparticles for immobilizing on the binding pad.

[0139] The above bonding pad was prepared by cutting polyester paper, immersing it in a solution prepared by mixing 0.4 M Tris (pH 6.5), 0.2% Tween-20, 1% sodium caseinate, 0.1% sodium azide, and 0.05% Proclin 300, and then drying to perform a first pretreatment. Thereafter, the prepared gold nanoparticles were applied to the polyester paper and dried to prepare a bonding pad.

[0140] The detection pad formed a hydrophobic layer by wax transfer on the non-visible area below the detection zone, and was then re-dispensed with a solution containing antibodies that can bind to fluorescent markers such as FAM, HEX, and Cy5 to immobilize the antibodies.

[0141] The sample pad, reaction pad, initiator pad, binding pad, detection pad, and absorption pad manufactured as described above were arranged as shown in FIGS. 1 and 2, and a PCB substrate, housing, and internal bracket including a heating unit as shown in FIG. 8 were applied to manufacture a molecular diagnostic kit.

[0142] Review of the rehydration characteristics of dried reagents within the amplification pad

[0143] A test strap was manufactured by arranging the sample pad, amplification pad, initiator pad, binding pad, detection pad, and absorption pad prepared in the above manufacturing example in types a and b as shown in Fig. 8.

[0144] For the test straps of type A and type B, in order to analyze the rehydration characteristics of the dried reagent in the amplification pad, a blue dye was dried on the amplification pad instead of the dried reagent.

[0145] Afterwards, 200 uL of water was dropped at the center of the sample pad and the movement of the dried dye within the amplification pad was observed.

[0146] Specifically, 20 uL of a mixture of amplified product and loading dye was added to each well of a 1.5% agarose gel, electrophoresis was performed at 100 V for 25 minutes, and images were captured using a gel-dot device.

[0147] The test results are shown in Fig. 8. In the case of type a, where the sample pad and amplification pad are of a lateral structure, the sample injection zone and the amplification reaction zone are separated by a lateral structure, so that when the sample is injected, the dried reagent is concentrated to one side according to the movement of water, causing non-uniformity of the reagent, which acts as a factor inhibiting the amplification reaction (Fig. 9, 1, 2). In contrast, it was confirmed that the paper chip of the vertical (b) structure was able to ensure uniform rehydration of the reagent in the amplification pad, so that the amplification reaction occurred smoothly. As described above, it was confirmed that when an asymmetric sample pad exists in the vertical structure, the dried reagent is uniformly distributed after sample injection, so that the amplification reaction can occur smoothly (Fig. 9, 3, 4).

[0148] Evaluation of isothermal amplification reaction efficiency according to the type of sample pad

[0149] When a sample solution is directly injected into an amplification pad, the reagents that are uniformly dried within the amplification pad may exhibit an uneven distribution. Since the pad has a porous well structure, if an uneven distribution of the reagent occurs, the composition of the amplification reagents varies across different parts of the amplification pad, hindering proper amplification. Furthermore, sample solutions such as saliva, nasal mucus, and blood contain various inhibitors of the amplification reaction, requiring their removal. Therefore, we identified the type of paper that can be used as an optimal sample pad to prevent unevenness in isothermal amplification reagents and ensure reproducible amplification reactions.

[0150] Under the test conditions described above, a test strap was manufactured with a structure as shown in (b) of Fig. 7, and polyester paper, asymmetric polysulfone paper, and cotton paper were used as sample pads.

[0151] Specifically, polyester paper has an average pore diameter of 20 µm to 29 µm, cotton paper has an average pore diameter of 15 µm to 19 µm, and asymmetric polysulfone paper has an average pore diameter of 15 µm to 25 µm in the upper layer, and an average pore diameter of 1 µm to 5 µm in the lower layer arranged in contact with the upper layer.

[0152] First, to confirm that there were no factors inhibiting the amplification reaction in each candidate sample pad, each sample pad was placed on top of the amplification pad, and the amplification reaction pattern was observed. As shown in Figure 9, the amplification reaction occurred weakly under the cotton paper condition of No. 6, but the remaining paper conditions (each polyester paper and the asymmetric polysulfone paper condition) showed amplification patterns similar to the control, confirming that they can be used as sample pads.

[0153] Additionally, when symmetrical polyester paper and asymmetrical polysulfone paper were used as sample pads using a blue dye solution, it was confirmed whether the dye solution moved uniformly within the amplification pad.

[0154] The test results are as shown in Fig. 10. 1 and 2 of Fig. 10 show the extent of movement of a blue dye solution after using a symmetrical polyester paper as a sample pad and applying a symmetrical polyester paper as an amplification pad, and 3 and 4 of Fig. 11 show the extent of movement of a blue dye solution after using an asymmetrical polysulfone paper as a sample pad and applying a symmetrical polyester paper as an amplification pad.

[0155] According to Fig. 10, in 1 and 2, the blue dye solution is not distributed in the center, whereas in 3 and 4, the blue dye solution is distributed evenly throughout the entire area. According to these test results, it was confirmed that when an asymmetric polysulfone paper is used as the sample pad, the sample solution can be uniformly moved to the amplification pad.

[0156] Analytical performance evaluation for HIV-1 and HIV-2

[0157] The molecular diagnostic kit manufactured according to the above manufacturing example was evaluated for its analytical performance against HIV-1 and HIV-2. The primer set for identifying HIV-1 and HIV-2 used the base sequence set in Table 1 described above. Specifically, a hydrogel solution was prepared by mixing dNTPs (1.4 mM, dATP, dCTP, dGTP, and dTTP), isothermal amplification buffer (1X, 20 mM Tris-HCl, 10 mM (NH4)2SO4, 50 mM KCl, 2 mM MgSO4, and 0.1% Tween-20, pH 8.8), and Bst 3.0 DNA polymerase (1 U / uL) on the surface of the amplification pad, and then mixing 1 μl each of the forward and backward outer primers (Outer primer: F3 and B3, 0.2 μM), 1 μl each of the inner primers (Inner primer: FIP and BIP, 1.6 μM), and 1 μl each of the loop primers (Loop primer: LF and LB, 0.4 μM) of the primer sets for HIV-1 and HIV-2 in Table 1, and then adding the above. The hydrogel solution was applied to the surface of the amplification pad and dried for 2 hours in a frozen or refrigerated state.

[0158] For the positive group, 200 uL of a solution containing 0.1% Tx, 20 mM Tris-HCl, 6 mM MgSO4, 500 mM Betaine, 50 mM KCl, and 10 mM (NH4)2SO4 was injected into the molecular diagnostic kit with sample solutions containing each of HIV-1 and HIV-2 viruses. For the negative group, the same sample solution as the positive group or a solution not containing HIV-1 and HIV-2 viruses was used.

[0159] The above sample solution was injected into a molecular diagnostic kit, and the results of evaluating the analytical performance are as shown in Figure 11.

[0160] According to Fig. 11, in the Positive group including HIV-1 (Fig. 12 (c)) and HIV-2 (Fig. 12 (d)) viruses, clear lines are confirmed in the C line and the T line, whereas in the Negative group, clear lines are confirmed only in the C line.

[0161] Figure 12 shows the results of applying a hydrogel solution containing a primer set for HIV-1 and HIV-2 to the surface of an amplification pad, injecting a solution containing both HIV-1 and HIV-2 viruses into a molecular diagnostic kit, and evaluating the analytical performance.

[0162] According to Fig. 12, it was confirmed that simultaneous multiple diagnosis of HIV-1 and HIV-2 is possible when using the molecular diagnostic kit of the present invention, as clear lines are confirmed in two T lines.

[0163] Although the preferred embodiments of the present invention have been described in detail above, the scope of the present invention is not limited thereto, and various modifications and improvements made by those skilled in the art using the basic concept of the present invention defined in the following claims also fall within the scope of the present invention.

[0164] The present invention relates to a paper-based molecular diagnostic platform that improves the efficiency of rehydration of a dry reagent and isothermal amplification reaction, and a molecular diagnostic kit for HIV-1 and HIV-2 diagnosis using the same.

Claims

1. Sample pad for receiving biological samples; An amplification pad, which is placed at the bottom of the sample pad and includes a primer that can specifically bind to a target nucleic acid and a reagent for an isothermal amplification reaction (LAMP), and in which an isothermal amplification reaction occurs; An initiator pad, which is placed on top of the sample pad and includes a thermally responsive hydrophobic valve, for transporting the isothermal amplification reaction product to the detection pad when the isothermal amplification reaction is completed; A bonding pad disposed below the initiator pad, connecting the initiator pad and the detection pad, and including gold nanoparticles; A detection pad positioned at the bottom of the above-mentioned binding pad and obtaining a target nucleic acid amplified from the above-mentioned isothermal amplification reaction product; and An absorbent pad is disposed on the side of the above detection pad and absorbs the remaining sample, The above amplification pad is placed below the sample pad so that the sample passing through the sample pad moves vertically to the amplification pad. The above sample pad has an asymmetric porous structure, which can remove components that inhibit amplification reactions in a sample that has passed through the sample pad, and the sample from which the components that inhibit amplification reactions have been removed through the sample pad moves uniformly in the vertical direction to the amplification pad, so that an isothermal amplification reaction occurs within the entire amplification pad. Paper-based molecular diagnostic platform.

2. In paragraph 1, The above sample pad is an asymmetric paper including an upper layer and a lower layer, The above upper layer has an average pore diameter of 15㎛ to 25㎛, The above lower layer has pore diameters of 1㎛ to 5㎛. Paper-based molecular diagnostic platform.

3. In paragraph 1, The above sample pad is selected from the group consisting of polyester paper, cellulose paper, cotton paper and polysulfone paper. Paper-based molecular diagnostic platform.

4. In paragraph 1, The reagents for the above isothermal amplification reaction include 10 mM to 50 mM Tris-HCl, 5 mM to 20 mM (NH4)2SO4, 20 mM to 150 mM KCl, 2 mM to 8 mM MgSO4 and 0.1% Tween-20. Paper-based molecular diagnostic platform.

5. In paragraph 1, The average diameter of the pores of the above amplification pad, initiator pad, binding pad, detection pad and absorption pad is 7 ㎛ to 29 ㎛. Paper-based molecular diagnostic platform.

6. Including a paper-based molecular diagnostic platform according to any one of clauses 1 to 5. Molecular diagnostic kit for HIV-1 and HIV-2 diagnosis.

7. A step of applying a biological sample to a sample pad of a paper-based branch diagnostic platform according to Article 1 and amplifying a target nucleic acid; and A step of detecting the nucleic acid amplification product on a detection pad is included. Analytical methods for HIV-1 and HIV-2.

Citation Information

Patent Citations

  • Anchoring and non-occluding intravascular device for use during clot removal via aspiration and / or mechanical extraction device

    KR1020220107938A

  • Apparatus and method for learning body shape

    KR1020240122192A

  • Group management system of data processing by using blockchain-based electronic document of agreement

    KR102351050B1

  • Method and device for automatically identifying false real estate for sale using an artificial intelligence model and a computer-readable recording medium recording a program for executing the method

    KR102636474B1

  • Chip structure for multiple molecular diagnoses

    US20190022639A1