Methods and materials for treating autosomal dominant polycystic kidney disease

Abstract

This document relates to methods and materials for treating mammals having autosomal dominant polycystic kidney disease (ADPKD). For example, this document provides methods and materials for correcting a point mutation in the PKD1 gene that is associated with ADPKD.

Description

[0001] METHODS AND MATERIALS FOR TREATING

[0002] AUTOSOMAL DOMINANT POLYCYSTIC KIDNEY DISEASE

[0003] CROSS-REFERENCE TO RELATED APPLICATIONS

[0004] This application claims benefit of priority from U.S. Provisional Application Serial No. 63 / 634,129, filed April 15, 2024. The disclosure of the prior application is considered part of (and is incorporated by reference in) the disclosure of this application.

[0005] Sequence Listing

[0006] This application contains a Sequence Listing that has been submitted electronically as an XML file named “07039-2314WO1.XML.’7The XML file, created on April 1 , 2025, is 45,066 bytes in size. The material in the XML file is hereby incorporated by reference in its entirety.

[0007] TECHNICAL FIELD

[0008] This document relates to methods and materials for treating mammals having autosomal dominant polycystic kidney disease (ADPKD). For example, this document provides methods and materials for correcting a point mutation in the PKD1 gene that is associated with ADPKD.

[0009] BACKGROUND

[0010] ADPKD is the most common genetic cause of renal failure worldwide, and is largely associated with mutations, including point mutations, truncated mutations, and frameshift mutations in the PKD1 and PKD2 genes, which encode the polycystin 1 (PCI) and poly cystin 2 (PC2) proteins, respectively. ADPKD is a multisystem and progressive disease that results in cyst formation, kidney enlargement, and extrarenal organ complications in, for example, the heart (e.g., hypertrophy), liver and pancreas (e.g., cysts), spleen, and arachnoid membranes.

[0011] Base editing is an emerging class of precision genetic medicines designed to overcome the limitations of existing approaches and expand the potential of genetic medicine. Base editors are designed to rewrite just a single “letter” with high efficiency and precision, and thereby intervene at the most basic level to potentially treat a wide range of diseases. See. e.g., Komor and Liu, Nature (2016), 533:420-424. In general, base editors include two main components: (1) a base editing enzyme, such as a deaminase, which carries out the desired chemical modification of the target DNA base, and (2) a CRISPR-associated (Cas) endonuclease polypeptide bound to a guide RNA that leverages the established DNA-targeting ability of CRISPR, but is modified so it does not cause a double-stranded break. Current base editor technology includes adenine base editors (ABE) that deaminate targeted adenine residues to yield guanine residues, and cytosine base editors (CBE) that deaminate targeted cytosine residues to yield thymine residues.

[0012] SUMMARY

[0013] This document provides methods and materials for using base editing technology to precisely correct point mutations that are associated with ADPKD. Such correction(s) can effectively treat mammals having ADPKD. For example, correction of point mutations in the PKD1 gene can delay cyst growth in mammals with ADPKD.

[0014] As demonstrated herein, a / / -sgRNA-ABE-dual-AAV9 vector can be successfully use for in vivo base editing in a mouse model of ADPKD (PkdlRC RCmice). A one-time “shot” with / W / -sgRNA-ABE-dual-AAV9 particles can delay cyst grow th and normalize heart hypertrophy in the mice. In addition, treatment with the AAV base editor can lead to recovery of PCI in PkdlRC'RCmouse kidneys and hearts, and can lead to recovery oiPkdl mutation-induced memory impairment.

[0015] In a first aspect, this document features a method for targeted modification of the genome of a cell having an autosomal dominant polycystic kidney disease (ADPKD) mutation in a polycystin 1 gene. The method can include, or consist essentially of, introducing, into the cell, one or more nucleic acid constructs that, in combination, include (a) one or more nucleotide sequences that, in combination, encode a fusion polypeptide, wherein the fusion polypeptide comprises a base editor domain and a DNA binding domain, wherein the DNA binding domain comprises a clustered regularly interspaced short palindromic repeats- (CRISPR-) associated (Cas) endonuclease polypeptide, and wherein the Cas endonuclease polypeptide has been modified to lack endonuclease activity, and (b) a nucleotide sequence encoding a guide RNA (gRNA) targeted to the ADPKD mutation, wherein the gRNA targets the fusion polypeptide to the ADPKD mutation, and wherein the base editor corrects the ADPKD mutation in the genome of the cell. The cell can be a somatic cell. The cell can be within a mammal. The mammal can be a human. The one or more nucleic acid constructs can be adeno-associated virus (AAV) constructs. The one or more nucleotide sequences encoding the fusion polypeptide can be operably linked to a kidney-specific promoter. The kidney-specific promoter can be a Ksp promoter or an Aqp2 promoter. The method can include introducing, into the cell, (1) a first nucleic acid construct encoding the fusion polypeptide, wherein the fusion polypeptide includes the base editing domain and an N-terminal portion of the attenuated Cas polypeptide, and (2) a second nucleic acid construct encoding the gRNA and a C- terminal portion of the attenuated Cas polypeptide. The mutation in the poly cystin 1 gene can be at a nucleotide corresponding to the nucleotide at position 117 of SEQ ID NO: 7. The mutation in the poly cystin 1 gene can be at a nucleotide corresponding to the nucleotide at position 52 of SEQ ID NO:25.

[0016] In another aspect, this document features a method for treating ADPKD in a mammal having an ADPKD-associated point mutation in a poly cystin 1 gene. The method can include, or consist essentially of, administering to the mammal one or more nucleic acid constructs that, in combination, contain (a) one or more nucleotide sequences that, in combination, encode a fusion polypeptide, wherein the fusion polypeptide includes a base editor and a clustered regularly interspaced short palindromic repeats- (CRISPR-) associated (Cas) endonuclease, wherein the Cas endonuclease has been modified to lack endonuclease activity, and (b) a nucleotide sequence encoding a guide RNA (gRNA) targeted to the ADPKD mutation, wherein the gRNA targets the fusion polypeptide to the ADPKD mutation, and wherein the base editor corrects the ADPKD mutation in the genome of the mammal. The mammal can be a human. The administering can result in delayed kidney cyst grow th in the mammal. The administering can result in normalized heart hypertrophy in the mammal. The administering can result in increased expression of PC-1 in the mammal. The one or more nucleic acid constructs can be AAV constructs. The one or more nucleotide sequences encoding the fusion polypeptide can be operably linked to a kidney-specific promoter. The kidney-specific promoter can be a Ksp promoter or an Aqp2 promoter. The method can include administering, to the mammal. (1) a first nucleic acid construct encoding the fusion polypeptide, wherein the fusion polypeptide includes the base editing domain and an N-terminal portion of the attenuated Cas polypeptide, and (2) a second nucleic acid construct encoding the gRNA and a C-terminal portion of the attenuated Cas polypeptide. The mutation in the poly cystin 1 gene can be at a nucleotide corresponding to the nucleotide at position 117 of SEQ ID NO:7. The mutation in the polycystin 1 gene can be at a nucleotide corresponding to the nucleotide at position 52 of SEQ ID NO:25.

[0017] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

[0018] The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.

[0019] DESCRIPTION OF DRAWINGS

[0020] FIG. 1A is a diagram of an AB Emax vector (Cbh_V5 AAV-ABEmax N- terminal) containing a nucleotide sequence encoding the N-terminal portion of a Cas9 endonuclease operably linked to a broadly expressed, chicken -actin (Cbh) promoter. FIG. IB is a diagram of an ABEmax vector (Cbh_V5 AAV-ABEmax C-terminal) containing a nucleotide sequence encoding the C-terminal portion of a Cas9 endonuclease operably linked to a Cbh promoter, and a nucleotide sequence encoding a gRNA operably linked to a U6 promoter. The commonly used Streptococcus pyogenes Cas9 nuclease (SpCas9) is encoded by a cDNA sequence that is about 4.2 kb in length, so a single AAV (~5 kb) is not sufficient to contain all the necessary CRISPR components. Thus, the SpCas9 was split into two AAV vectors.

[0021] FIG. 2A is a diagram of an ABEmax vector (Cbh_AAV-ABE9 N-terminal) containing a broadly expressed Cbh promoter operably linked to a nucleotide sequence that encodes ABE9 TadA fused to the N-terminal portion of a Cas9 endonuclease. Adenine base editors (ABEs) were developed by fusing nCas9 to a wild-type TadA or an evolved TadA (eTadA), which originally was a transfer RNA (tRNA) adenine deaminase in Escherichia co / i. to efficiently generate A»T-to-G»C conversions. As wild type TadA is a tRNA adenine deaminase, numerous occurrences of random RNA off- target editing have been reported. However, introduction of an N108Q mutation in TadA resulted in reduction of both adenine and cytosine bystander editing, and introduction of an additional L145T mutation (ABE9) can further refine the editing window to 1 to 2 nucleotides with eliminated cytosine editing. FIG. 2B is a diagram of an ABEmax vector (Cbh_AAV-ABE9 C-terminal) containing a nucleotide sequence encoding the C-terminal portion of a Cas9 endonuclease operably linked to a Cbh promoter, and a nucleotide sequence encoding a gRNA operably linked to a U6 promoter.

[0022] FIG. 3A is a diagram of an ABE9 vector (Ksp_AAV9-ABE9 N-terminal) containing a kidney-specific promoter (Ksp promoter) operably linked to a nucleotide sequence encoding ABE9 TadA fused to the N-terminal portion of a Cas9 endonuclease. Ksp is the promoter of a kidney cadherin molecule known as cadherin- 16 or Ksp-cadherin (kidney specific). Cadherin-16 is the only member of the cadherin family that is exclusively expressed on the basolateral membranes of both proximal and distal tubules in the kidney. The most prominent expression pattern of cadherin- 16 is seen on distal tubules and collecting ducts. Replacement of the broadly expressed Cbh promoter in the ABEmax vectors with a kidney epithelial cell-specific promoter was done to restrict expression of the modified ABE9 vectors to renal tubular epithelial cells. FIG. 3B is a diagram of an ABE9 vector (Ksp_AAV9-ABE9 C-terminal) containing a Ksp promoter operably linked to a nucleotide sequence encoding the C-terminal portion of a Cas9 endonuclease, and containing a nucleotide sequence encoding a gRNA. FIG. 4A is a diagram of an ABE9 vector (Aqp2_AAV9-ABE9 N-terminal) containing a kidney-specific aquaporin-2 (Aqp2) gene promoter operably linked to a nucleotide sequence encoding ABE9 TadA fused to the N-terminal portion of a Cas9 endonuclease. This gene encodes a water channel protein located in the kidney collecting tubule. FIG. 4B is a diagram of an ABE9 vector (Aqp2_AAV9-ABE9 C- terminal) containing a kidney-specific Aqp2 promoter operably linked to a nucleotide sequence encoding the C-terminal portion of a Cas9 endonuclease, and containing a nucleotide sequence encoding a gRNA.

[0023] FIG. 5A shows representative nucleic acid sequences for wild type (SEQ ID NO:7) and mutant (SEQ ID NO:8) mouse Pkdl exon 29. The codon that is mutated in exon 29 in ADPKD is boxed. The AGA TGC mutation results in an Arg-^Cys substitution, which can be reverted using an ABE as described herein to generate a TGC^CGC mutation, thus replacing the Cys with the wild type Arg. FIG. 5B shows representative nucleic acid sequences for wild type (SEQ ID NO:25) and mutant (SEQ ID NO:26) human PKD1 exon 27. The codon that is mutated in exon 27 in ADPKD is boxed. The CGC- TGC mutation results in an Arg Cys substitution, which can be reverted using an ABE as described herein to generate a TGC'->CGC mutation, thus replacing the Cys with the wild type Arg.

[0024] FIG. 6A shows a representative amino acid sequence for a full length ABE9- Cas fusion polypeptide (SEQ ID NO:9). The amino acid sequence of ABE9 is underlined, and is 198 amino acids in length. The Cas9 amino acid sequence is 1367 amino acids in length. FIG. 6B shows a representative amino acid sequence for a fusion polypeptide containing an ABE9 portion and an N-terminal portion of a Cas polypeptide (SEQ ID NO: 10). The ABE portion is underlined, and is 198 amino acids in length. The Cas9 N-terminal portion is 572 amino acids in length. FIG. 6C shows a representative amino acid sequence for a C-terminal portion of an attenuated Cas polypeptide (SEQ ID NO: 11). The sequence is 795 amino acids in length.

[0025] FIG. 7A shows a representative nucleotide sequence (SEQ ID NO: 12) encoding a targeted base editor polypeptide that includes an adenosine deaminase domain and a full length attenuated Cas polypeptide. The nucleotide sequence encoding the adenosine deaminase 9 is underlined, and is 594 bp in length. The nucleotide sequence encoding the Cas9 polypeptide is 4101 bp in length. FIG. 7B shows a representative nucleotide sequence (SEQ ID NO: 13, which is nt 1 to 594 of SEQ ID NO: 12) encoding an adenosine deaminase enzyme. FIG. 7C shows a representative nucleotide sequence (SEQ ID NO: 14, which is nucleotides 595 to 4695 of SEQ ID NO: 12) encoding an attenuated Cas polypeptide that lacks endonuclease activity7but has nickase activity due to an Asp- Gly mutation at the boxed codon. The Cas9 nucleotide sequence is 4101 nucleotides in length. FIG. 7D shows a representative nucleotide sequence (SEQ ID NO: 15) encoding a fusion polypeptide containing an adenosine deaminase portion fused to an N-terminal portion of an attenuated Cas9 polypeptide. The nucleotide sequence encoding the adenosine deaminase 9 is underlined, and is 594 bp in length. The nucleotide sequence encoding the Cas9 polypeptide is 1716 bp in length. FIG. 7E shows a representative nucleotide sequence (SEQ ID NO: 16) encoding a C-terminal portion of attenuated Cas9. The Cas9 C-terminal portion is 2385 nucleotides in length.

[0026] FIG. 8A includes a diagram of a portion of the mouse Pdkl gene (top), a diagram of a targeting construct (middle) designed to introduce an ADPKD mutation into exon 29 of the mouse Pdkl gene after injection into embryonic stem cells (ESCs), and a diagram showing the lengths of Southern blot fragments for the wild ty pe Pdkl gene and a Pdkl gene having an R3277C mutation as a result of crossing over with the targeting construct (bottom). Restriction sites flanking the targeting construct are represented by Sb (Sbfi) and Mo (Mbol). The Pkdl p.R3277C mutation was introduced using the exact codon found in ADPKD probands (AGA- TGC). Restrictions sites used for introducing the mutation and the loxP -flanked (triangles) puromycin selection cassette (box) are represented by A (Adhl), X (Xhol), and S (<Sb / I). The restriction site used to linearize the targeting construct is represented by P (Pad). Restriction sites and probes used for Southern blotting are represented by Bs (BspHI) and M (Mfd). FIG. 8B shows the wild type (SEQ ID NOs: 1 and 2) and mutated (SEQ ID NOs:3 and 4) nucleotide sequences around the R3277C pathogenic variant within exon 29 of the wild type Pdkl gene. The sgRNA and PAM sequences are underlined. FIG. 8C shows the wild type (SEQ ID NO: 5) and mutated (SEQ ID NO: 6) PKD1 amino acid sequences in the vicinity of the ADPKD mutation. The Pkdl c.9805.9807 AGA>TGC mutation in exon 29 of the Pkdl gene can be converted from TGC to CGC with ABEs, resulting in a conversion of Cys back to Arg. FIG. 8D shows the wild type nucleotide and amino acid PKD1 sequences (SEQ ID NOS:27 and 28, respectively) and mutated nucleotide and amino acid PKD1 sequences (SEQ ID NOS:29 and 30, respectively) in the vicinity of the ADPKD mutation. The PKD1 c.9829.9831 CGOTGC mutation in exon 27 of the PAD 7 gene can be converted from TGC to CGC with ABEs, resulting in a conversion of Cys back to Arg.

[0027] FIGS. 9A-9E show that treatment with Pkdl-sgRNA-ABE-dual-AAV9 particles delayed cyst growth and normalized heart hypertrophy in mice. FIG. 9A is a representative image showing kidneys from PkdlRC / Rmice treated with or without ABE-AAV9. Scale bars, 5 mm. Treatment with Pkdl-sgRNA-ABE-dual-AAV9 particles decreased the cyst index (plotted in FIG. 9B) and kidney weight to body weight (KW / BW) ratios (plotted in FIG. 9C) in PkdlRC / RCmice compared to control mice treated with vehicle. FIG. 9D is a representative image of hearts from PkdlR RCmice treated with or without ABE-AAV9. Scale bars, 5 mm. FIG. 9E is a graph showing that treatment with Pkdl-sgRNA-ABE-dual-AAV9 particles decreased heart weight to body weight (HW / BW) ratios in PkdlRC / RCmice compared to those in control mice treated with vehicle.

[0028] FIG. 10A shows representative images showing immunofluorescent staining to detect the expression of PCI in kidneys of wild type (WT) and PkdlRC RCmice treated with 1 x 1012vg of Cbh-ABE9-dual-AAV9 and vehicle at PN14, co-stained with dolichos biflorus agglutinin (DBA), a marker of the collecting duct. FIG. 10B shows representative images showing immunofluorescent staining to detect the expression of PCI in hearts of wild type (WT) and PkdlRC / RCmice treated with 1 x 1012vg of Cbh-ABE9-dual-AAV9 or vehicle at PN14. Scale bar, 100 pm.

[0029] FIG. 11A includes a series of Y-maze tracking images for wild type mice (top row). PkdlRCRCmice (middle row), and PkdlRC,RCmice treated with an AAV ABE9 vector to correct the PkdlRC / RCmutation (bottom row). FIG. 11B is a graph plotting coping behaving for each group of mice assessed by the Y-maze test.

[0030] DETAILED DESCRIPTION

[0031] This document provides methods and materials for treating a mammal (e.g., a human) having, or at risk of developing, ADPKD. Generally, people who have ADPKD mutations will be between about 30 and 40 years of age when the cysts grow large enough to affect kidney function. In some cases, the presence of a mutation (e.g., a c.9805 (A>T) single nucleotide variant, which is at position 9805 of the mouse PKD1 cDNA and is illustrated in bold at position 117 of the exon 29 sequence set forth in SEQ ID NO:7 in FIG. 5A and also is illustrated in FIG. 8C, or a c.9829 (C>T) single nucleotide variant, which is at position 9829 of the human PKD1 cDNA and is illustrated in bold at position 52 of the exon 27 sequence set forth in SEQ ID NO:25 in FIG. 5B and also is illustrated in FIG. 8D) in an allele of PKD1 gene present in a mammal (e.g., a human) can be used to identify the mammal as having, or as being at risk of developing, ADPKD. In some cases, the presence of a mutation at a position other than position 52 of exon 27 in an allele of aPKDl gene present in a mammal (e.g., a human) can be used to identify the mammal as having, or as being at risk of developing. ADPKD.

[0032] In some cases, this document provides methods and materials for treating a mammal (e.g., a human) identified as having, or as being at risk of developing, ADPKD. For example, one or more nucleic acid constructs designed to express a targeted base editor polypeptide can be administered to a mammal (e.g., a human) having, or at risk of developing, ADPKD to treat the mammal.

[0033] As described herein, in some cases the presence of a mutation (e.g., a c.9829 (OT) single nucleotide variant) in an allele of aPKDl gene present in a mammal (e.g., a human) can be used to identify that mammal as having, or as being at risk for developing, ADPKD. In some cases, a mammal (e.g., a human) can be identified as having, or at risk of developing, ADPKD based, at least in part, on the presence of a mutation (e.g., a c.9829 (OT) single nucleotide variant) in an allele oiaPKDl gene present in a mammal (e.g., a human) in a sample obtained from the mammal. In some cases, this document provides methods and materials for treating a mammal (e.g., a human) identified as having, or as being at risk of developing, ADPKD. For example, nucleic acid designed to express a targeted base editor polypeptide can be administered to a mammal (e.g., a human) identified as having, or at risk of developing, ADPKD to treat the ADPKD or to reduce the risk of that mammal developing ADPKD.

[0034] In some cases, a mammal (e.g., a human) can be identified as having, or as being at risk of developing, ADPKD based, at least in part, on the presence or absence of a mutation (e.g., a c.9829 (OT) single nucleotide variant) in an allele of aPKDl gene present in a mammal (e.g., a human) in a sample (e.g., a sample containing one or more cells) obtained from the mammal. The term "mutation" as used herein with respect to nucleic acid refers to a modification in the nucleic acid sequence as compared to a wild type nucleic acid for a particular species, where the modification is a substitution of one or more nucleotides (e.g., a single nucleotide variant). In some cases, a mutation can be as compared to a wild type human PKD1 gene. In some cases, a mutation can be as compared to a wild type murine Pkdl gene. In some cases, a mutation can be as compared to a wild type primate Pkdl gene (e.g., a wild type Rhesus monkey Pdkl gene). Examples of wild type PKD1 genes include, without limitation, the human PKD1 gene having a nucleic acid sequence set forth in the National Center for Biotechnology Information (NCBI) database under Gene ID: 5310 (NCBI reference sequence NG_008617 (e.g., version NG_008 17.1); ENSEMBL reference sequence ENSG00000008710; mRNA sequence available at, for example, GENBANK® accession no. NM_000296 (e.g., version NM_000296.4)), and the mouse Pkdl gene having a nucleic acid sequence set forth in the NCBI database under Gene ID: 18763 (NCBI reference sequence NC_000083 (e.g., version NC_000083.7); mRNA sequence available at, for example, GENBANK® accession no. NM_013630 (e.g., version NM_013630.3)). For example, a mutation can be as compared to the nucleic acid sequence set forth in SEQ ID NO:7, which is a representative sequence for exon 29 of a mouse wild type PKD1 gene (see. e.g., FIG. 5A), or a mutation can be as compared to the nucleic acid sequence set forth in SEQ ID NO:25, which is a representative sequence for exon 27 of a human wild type PKD1 gene (see, e.g., FIG. 5B).

[0035] Any appropriate method can be used to detect the presence or absence of one or more mutations (e.g., a c.9805 (A>T) single nucleotide variant or a c.9829 (C>T) single nucleotide variant) in a nucleic acid within a sample (e.g., a sample containing one or more cells) obtained from a mammal (e.g., a human). For example, sequencing (e.g., PCR-based sequencing), DNA hybridization, restriction enzyme digestion methods, and chromosomal microarray can be used to identity the presence or absence of one or more mutations (e.g., a c.9805 (A>T) single nucleotide variant or a c.9829 (OT) single nucleotide variant) in a nucleic acid. Any appropriate mammal can be assessed and treated as described herein. Examples of mammals that can be assessed and treated as described herein include, without limitation, humans, non-human primates, dogs, cats, horses, cows, pigs, sheep, llamas, mice, rats, guinea pigs, rabbits, and hamsters.

[0036] Any appropriate sample from a mammal (e.g., a human) can be assessed as described herein (e.g., for the presence or absence of one or more mutations (e.g., a c.9805 (A>T) single nucleotide variant or a c.9829 (OT) single nucleotide variant) in a nucleic acid. In some cases, a sample can be a biological sample. In some cases, a sample can contain one or more biological molecules (e.g., nucleic acids such as DNA, including genomic DNA, and RNA). Examples of samples that can be assessed as described herein include, without limitation, fluid samples (e.g., whole blood, serum, plasma, urine, saliva, sputum, cerebrospinal fluid, and semen) and tissue samples (e.g., tissue samples obtained by biopsy) such as skin fibroblasts and kidney tissue. A biological sample can be a fresh sample or a fixed sample (e.g., a formaldehyde-fixed sample or a formalin-fixed sample). In some cases, a biological sample can be a processed sample (e.g., to isolate or extract containing one or more biological molecules). For example, a blood (e.g., whole blood, serum, or plasma) sample can be obtained from a mammal (e.g., a human) and can be assessed for the presence or absence of one or more mutations (e.g., a c.9805 (A>T) single nucleotide variant or a c.9829 (C>T) single nucleotide variant) in a nucleic acid to determine if the mammal has. or is at risk of developing. ADPKD based, at least in part, on the presence of a mutation (e g., a c.9805 (A>T) single nucleotide variant or a c.9829 (OT) single nucleotide variant) in an allele of a PKD1 gene in the sample.

[0037] This document also provides methods for treating a mammal (e.g., a human) identified as having, or as being at risk of developing. ADPKD. As described herein, delivering nucleic acid (e.g., one or more nucleic acid constructs) designed to express a targeted base editor polypeptide to kidney cells within a mammal can correct a single nucleotide mutation within the PDK1 gene (e.g., a c.9805 (A>T) single nucleotide variant or a c.9829 (OT) single nucleotide variant), which can allow the kidney cells to express increased levels of PCI as compared to mammals having the single nucleotide mutation that were not treated with the nucleic acid designed to express the targeted base editor polypeptide. In some cases, nucleic acid designed to express a targeted base editor polypeptide can be administered to a mammal (e.g., a human) identified as having, or at risk of developing, ADPKD based, at least in part, on the presence of a mutation (e.g., a c.9805 (A>T) single nucleotide variant or a c.9829 (OT) single nucleotide variant) in an allele of aPKDl gene present in a mammal (e.g., a human) in a sample obtained from the mammal. For example, nucleic acid designed to express a targeted base editor polypeptide can be administered to a mammal (e.g., a human) identified as having, or at risk of developing, ADPKD to treat the ADPKD or to reduce the risk of that mammal developing ADPKD.

[0038] Any appropriate method can be used to deliver nucleic acid (e.g., one or more nucleic acid constructs) designed to express a targeted base editor polypeptide to cells within a living mammal. In some cases, nucleic acid encoding a targeted base editor polypeptide can be administered to a mammal using one or more viral vectors. In some cases, nucleic acid encoding a targeted base editor polypeptide can be administered to a mammal using one or more non-viral vectors. In some cases, vectors for administering nucleic acid (e.g., nucleic acid designed to express a targeted base editor polypeptide) to cells can be used for transient expression of a targeted base editor polypeptide. In some cases, vectors for administering nucleic acid (e.g., nucleic acid designed to express a targeted base editor polypeptide) to cells can be used for stable expression of a targeted base editor polypeptide. In cases where a vector for administering nucleic acid can be used for stable expression of a targeted base editor polypeptide, the vector can be engineered to integrate nucleic acid designed to express a targeted base editor polypeptide into the genome of a cell. In some cases, a vector can be engineered to integrate nucleic acid designed to express a targeted base editor polypeptide into the genome of a cell using any appropriate method. For example, gene therapy techniques can be used to integrate nucleic acid designed to express a targeted base editor polypeptide into the genome of a cell.

[0039] Vectors for administering nucleic acids (e.g., nucleic acid encoding a targeted base editor polypeptide) to cells can be prepared using any appropriate materials (e.g., packaging cell lines, helper viruses, and vector constructs). See. for example, Gene Therapy Protocols (Methods in Molecular Medicine), edited by Jeffrey R. Morgan, Humana Press, Totowa, NJ (2002) and Viral Vectors for Gene Therapy: Methods and Protocols, edited by Curtis A. Machida, Humana Press, Totowa, NJ (2003). When a vector used to deliver nucleic acid encoding a targeted base editor polypeptide to cells within a living mammal is a viral vector, any appropriate viral vector can be used. In some cases, a virus-based vector can be derived from a positive-strand RNA virus. In some cases, a virus-based vector can be a chimeric viral vector. Examples of viruses of virus-based vectors that can be used to deliver nucleic acid encoding a targeted base editor polypeptide to cells within a living mammal can be derived from include, without limitation, adenoviruses, adeno-associated viruses (AAVs), Sendai viruses, retroviruses, lentiviruses, and herpes simplex viruses. In some cases, nucleic acid encoding a targeted base editor polypeptide can be delivered to cells using AAV vectors (e.g., an AAV serotype 2 viral vector, an AAV serotype 5 viral vector, an AAV serotype 9 viral vector, or a recombinant AAV serotype viral vector such as an AAV serotype 2 / 5 viral vector), Sendai viral vectors, lentiviral vectors, retroviral vectors, adenoviral vectors, herpes simplex viral vectors, vaccinia viral vectors, baculovirus vector, alphavirus vectors, flavivirus vectors, measles virus vectors, foamy virus vectors, helper-dependent adenoviral vectors, and hybrid adenoviral vectors.

[0040] When a vector used to deliver nucleic acid encoding a targeted base editor polypeptide to cells within a living mammal is a non-viral vector, any appropriate non-viral vector can be used. In some cases, anon-viral vector can be an extracellular vesicle (e.g., exosome). In some cases, a non-viral vector can be a liposome (e.g., nanoscale bilayer lipid vesicles). In some cases, a non-viral vector can be an expression plasmid (e g., a cDNA expression vector).

[0041] In some cases, nucleic acid encoding a targeted base editor polypeptide can be administered to a mammal by direct injection of naked nucleic acid molecules.

[0042] In some cases, nucleic acid encoding a targeted base editor polypeptide can be administered to a mammal by direct injection of nucleic acid molecules complexed with lipids (e.g., nano-liposome complexes), polymers, or nanospheres.

[0043] In addition to nucleic acid encoding a targeted base editor polypeptide, a vector (e.g., a viral vector or a non-viral vector) encoding all or part of a targeted base editor can contain regulatory elements operably linked to the nucleic acid sequence(s) encoding the targeted base editor polypeptide. Such regulatory elements can include, without limitation, promoter sequences, enhancer sequences, response elements, signal peptides, internal ribosome entry sequences, polyadenylation signals, terminators, or inducible elements that modulate expression (e.g., transcription or translation) of a nucleic acid. The choice of element(s) that may be included in a vector depends on several factors, including, without limitation, inducibility, targeting, and the level of expression desired. For example, a promoter can be included in a vector to facilitate transcription of a nucleic acid encoding a targeted base editor polypeptide. A promoter can be constitutive or inducible (e.g., in the presence of tetracycline), and can affect the expression of a nucleic acid encoding a polypeptide in a general or tissue-specific manner (e.g., kidney specific promoters). Examples of promoters that can be used to drive expression of a targeted base editor polypeptide in cells include, without limitation, broadly expressed promoters (e.g., a Cbh promoter, which is a hybrid form of the chicken P-actin promoter), kidney specific promoters (Ksp), E-cadherin (E-Cad) promoters, Aquaporin (e g., Aqp2) promoters, sodium / glucose cotransporter 2 (SGLT2) promoters, Na+ / K72Cl" cotransporter (NKCC2 ) promoters, and polycystic kidney and hepatic disease 1 (PKHD1) promoters. As used herein, "‘operably linked” refers to positioning of a regulatory element in a vector relative to a nucleic acid in such a way as to permit or facilitate expression of the encoded polypeptide. For example, a vector can contain a promoter and nucleic acid encoding a targeted base editor polypeptide. In this case, the promoter is operably linked to a nucleic acid encoding a targeted base editor polypeptide such that it drives transcription in cells.

[0044] Nucleic acid encoding a targeted base editor polypeptide can be produced by any appropriate technique including, without limitation, common molecular cloning, polymerase chain reaction (PCR), chemical nucleic acid synthesis techniques, and combinations of such techniques.

[0045] Nucleic acid designed to express a targeted base editor polypeptide can be delivered to cells within a mammal via direct injection into the kidney, intramuscular injection, intraperitoneal administration, intravenous administration, retro-orbital injection, retrograde infusion into the ureter or retro-ureteral, subcapsular injection through the kidney capsule, or oral delivery in nanoparticles and / or drug tablets, capsules, or pills. For example, a viral vector designed to drive expression of a targeted base editor polypeptide can be administered to a mammal in need of treatment by direct injection into one or both kidneys.

[0046] Examples of targeted base editor polypeptides designed to edit a mutation (e.g., a c.9805 (A>T) single nucleotide variant or a c.9829 (C>T) single nucleotide variant) present in a PKD1 gene as described herein include, without limitation, a targeted base editor that includes a base editor domain (e.g.. an adenosine deaminase or cytosine deaminase domain) and a DNA binding domain (e.g., an attenuated Cas polypeptide that lacks endonuclease activity but has nickase activity but retains the ability to interact with a gRNA, or in some cases, an attenuated Cas polypeptide that lacks endonuclease activity and nickase activity7but retains the ability to interact with a gRNA), as described herein. Any appropriate DNA binding domain and any appropriate base editor domain can be used.

[0047] In some cases, a DNA binding domain can include an attenuated clustered regularly interspaced short palindromic repeat (CRISPR) / CRISPR-associated (Cas) polypeptide, which can be included in a fusion polypeptide encoded by nucleic acid provided herein and used to edit a mutation (e.g., a c.9805 (A>T) single nucleotide variant or a c.9829 (C>T) single nucleotide variant) present in PKDl gene in a cell within a mammal (e.g., a human having, or at risk of developing, ADPKD based, at least in part, on the presence of a mutation (e.g., a c.9805 (A>T) single nucleotide variant or a c.9829 (C>T) single nucleotide variant) in an allele of aPKDl gene present in the human). CRISPR / Cas molecules are components of a prokaryotic adaptive immune system that is functionally analogous to eukaryotic RNA interference, using RNA base pairing to direct nucleic acid cleavage resulting in double stranded breaks (DSBs) (or, in the case of attenuated Cas polypeptides, singlestranded nicks) about 3 to 7 nucleotides upstream of a protospacer adjacent motif (PAM) sequence (e.g., NGG). Directing nucleic acid DSBs with the CRISPR / Cas system involves two components: a Cas endonuclease, and a guide RNA (gRNA) targeting sequence directing the Cas to cleave a target DNA sequence (Makarova et al., Nat Rev Microbiol (2011), 9(6):467-477; and Jinek et al., Science (2012). 337(6096): 816-821 ). The CRISPR / Cas system can be used in bactena, yeast, humans, and zebrafish, as described elsewhere (see, e.g., Jiang et al., Nat Biotechnol, (2013), 31(3):233-239; Dicarlo et al., Nucleic Acids Res (2013), doi: 10.1093 / nar / gktl35; Cong et al., Science (2013), 339(6121):819-823; Mali et al., Science (2013), 339(6121):823-826; Cho et al., Nat Biot echnol, (2013), 31(3):230-232; and Hwang et al., Nat Biotechnol, (2013), 31(3):227-229). See, also. Shalem et al., Science (2014), 343:84-87; and Sanjana et al., Nature Methods (2014), 11 :783-784, for further description of Cas endonucleases. When a Cas polypeptide is included in a fusion polypeptide for use in the methods provided herein, the Cas polypeptide can include one or more mutations to attenuate its endonuclease activity such that it lacks the ability to cleave DNA.

[0048] Moreover, when a Cas polypeptide is included in a fusion polypeptide for use in the methods provided herein, the nucleic acid also can include nucleotide sequence encoding a gRNA that can interact with the Cas polypeptide and direct the Cas polypeptide to the sequence containing the PKD1 base to be edited (e.g., the base at the c.9805 (A>T) single nucleotide variant or the base at the c.9829 (OT) single nucleotide variant). Representative examples of gRNA sequences that can be encoded by the nucleic acids provided herein include, without limitation, CGTAGCCGCTTTACTTGCGT (SEQ ID NO: 17) and TAGCCGCTTTACTTGCGTCC (SEQ ID NO: 18).

[0049] In some cases, a base editor domain of a fusion polypeptide encoded by a nucleic acid construct provided herein can include an adenosine deaminase domain. In some cases, a base editor domain of a fusion polypeptide encoded by a nucleic acid construct provided herein can include a cytosine deaminase domain. The adenosine deaminase domain or the cytosine deaminase domain can be included in a fusion polypeptide encoded by nucleic acid provided herein and used to edit a mutation (e.g., a c.9805 (A>T) single nucleotide variant or a c.9829 (OT) single nucleotide variant) present in a PKD1 gene in a cell within a mammal (e.g., a human having, or at risk of developing, ADPKD based, at least in part, on the presence of a mutation (e.g., a c.9805 (A>T) single nucleotide variant or a c.9829 (OT) single nucleotide variant) in an allele of a PKD1 gene present in the human). Vertebrates encode variable numbers of active polynucleotide cytosine deaminase enzymes that collectively are called apolipoprotein B mRNA-editing complex (APOBEC) proteins (Conticello, Genome Biol (2008), 9:229; and Harris and Dudley, Virology (2015), 479-480C: 131-145). These enzymes catalyze hydrolytic deamination of cytidine or deoxy cytidine in polynucleotides to uridine or deoxyuridine, respectively. All vertebrate species have activation-induced deaminase (AID), which is involved in antibody gene diversification through somatic hypermutation and class switch recombination (Di Noia and Neuberger, Annu Rev Biochem (2007), 76: 1-22; and Robbiani and Nussenzweig, Annu Rev Pathol (2013), 8:79-103). Most vertebrates also have APOBEC 1, which edits cytosine nucleobases in RNA and single-stranded DNA (ssDNA), and functions in regulating the transcriptome and likely also in blocking the spread of endogenous and exogenous mobile elements such as viruses (Fossat and Tam, RNA Biol (2014), 11 : 1233-1237; and Koito and Ikeda, Front Microbiol (2013), 4:28). The APOBEC3 subfamily of enzy mes is specific to mammals, subject to extreme copy number variation, elicits strong preferences for ssDNA, and provides innate immune protection against a wide variety of DNA-based parasites, including, without limitation, common retrotransposons LI and Alu, and retroviruses such as HIV-1 (Harris and Dudley, supra,' Malim and Bieniasz, Cold Spring Harb Per sped Med (2012), 2:a006940; and Simon et al., Nat Immunol (2015), 16:546-553). Human cells have the potential to produce up to seven distinct APOBEC3 enzymes, APOBEC3 A through APOBEC3H (A3 A-A3H, excluding A3E), although most cells express subsets due to differential gene regulation (Refsland et al., Nucleic Acids Res (2010), 38:4274-4284; Koning et al., J Virol (2009), 83:9474-9485; Stenglein et al., Nat Struct Mol Biol (2010), 17:222-229; and Bums et al., Nature (2013), 494:366- 370).

[0050] Adenosine deaminases that act on RNA (ADARs) carry out adenosine (A) to inosine (I) editing reactions with a requirement for duplex RNA (Bass et al., Annu. Rev Biochem. (2002), 71 :817-846). Since I base pairs with cytidine (C), it functions like guanosine (G) in cellular processes such as splicing, translation and reverse transcription (Nishikura et al., Annu. Rev. Biochem. (2010), 79:321-349). The A-to-I modification can alter miRNA recognition sites, redirect splicing and change the meaning of specific codons (Yeo et al., Proc. Natl. Acad. Sci. U.S.A. (2010), 107:20715-20719). Two different enzymes carry’ out this form of RNA editing in humans: AD ARI and ADAR2 (Bass et al., RNA. (1997), 3:947-949). A challenge in the initial development of ABEs w as the lack of known adenosine deaminase enzymes capable of acting on ssDNA. Attempts to force RNA adenosine deaminases to act on DNA by installing them in place of AP0BEC1 in BE3 resulted in no detectable adenine base editing. To overcome this issue, a deoxy adenosine deaminase enzyme was evolved to accept ssDNA. starting from an Escherichia coli tRNA adenosine deaminase enzyme, TadA (Gaudelli et al., Nature (2017), 551, 464-471).

[0051] In some cases, nucleic acid designed to express a targeted base editor polypeptide can express a targeted base editor polypeptide having the amino acid sequence set forth in SEQ ID NO: 9 (FIG. 6A), which includes a first portion having base editing (e.g., adenine deaminase) activity and a second portion that includes an attenuated Cas polypeptide (e.g., Cas9) polypeptide that does not have nuclease activity7and therefore cannot cleave the DNA. For example, nucleic acid designed to express a polypeptide having the amino acid sequence set forth in SEQ ID NO:9 (FIG. 6A). or designed to express a combination of polypeptides having the amino acid sequences set forth in SEQ ID NO: 10 (FIG. 6B) and SEQ ID NO: 1 1 (FIG. 6C) can be administered to a mammal (e.g., a human) having, or at risk of developing, ADPKD as described herein and used to treat the mammal. It is to be noted that the aspartic acid residue acid at position 10 of a wild type Cas9 polypeptide can be mutated (e.g., to alanine as at position 207 of SEQ ID NO:9) as compared to the corresponding amino acids in the wild type sequence, in order to attenuate endonuclease activity'.

[0052] In some cases, the sequence encoding the attenuated Cas polypeptide can be split into two parts, where one part (e.g.. the N-terminal portion) is fused to a sequence encoding a polypeptide having base editing (e.g., adenine deaminase) activity7, and the other part (e.g., the C-terminal portion) is encoded by a separate nucleic acid construct. Examples of such arrangements are shown in FIGS. 1A-1B, 2A-2B, 3A-3B, and 4A-4B. A representative example of a nucleotide sequence encoding an adenosine deaminase-Cas9 targeted base editor polypeptide is provided in SEQ ID NO: 12 (FIG. 7A). A representative example of a nucleotide sequence encoding an adenosine deaminase base editor is provided in nucleotides 1 to 594 of SEQ ID NO: 12 (SEQ ID NO: 13; FIG. 7B). A representative example of a nucleotide sequence encoding an attenuated Cas polypeptide is provided in nucleotides 595 to 4695 of SEQ ID NO: 12 (SEQ ID NO: 14; FIG. 7C). A representative example of a nucleotide sequence encoding an adenosine deaminase fused to an N-terminal portion of an attenuated Cas polypeptide is provided in SEQ ID NO: 15 (FIG. 7D). A representative example of a nucleotide sequence encoding a C-terminal portion of an attenuated Cas polypeptide is provided in SEQ ID NO: 16 (FIG. 7E).

[0053] In some cases, nucleic acid designed to express a targeted base editor polypeptide can encode a targeted base editor polypeptide that is a variant of a targeted base editor polypeptide having the amino acid sequence set forth in SEQ ID NO:9, SEQ ID NO: 10, or SEQ ID NO: 11. For example, nucleic acid designed to express a polypeptide having the amino acid sequence set forth in SEQ ID NO:9, or designed to express polypeptides having the amino acid sequences set forth in SEQ ID NOs: 10 and 11, can be administered to a mammal (e.g., a human) having, or at risk of developing, ADPKD as described herein and used to treat the mammal. For example, a variant of a targeted base editor polypeptide can comprise or consist essentially of an amino acid sequence set forth in SEQ ID NO:9, or can comprise or consist essentially of the amino acid sequences set forth in SEQ ID NOs: 10 and 11, provided that the deaminase portion of the targeted base editor polypeptide maintains adenosine deaminase activity and the endonuclease portion of the targeted base editor polypeptide maintains the ability to interact with a gRNA and does not recover the ability to cleave DNA, with one or more (e.g., one, two, three, four, five, six, seven, eight, nine, ten, or more) amino acid deletions, additions, substitutions, or combinations thereof. For example, nucleic acid designed to express a polypeptide comprising or consisting essentially of the amino acid sequence set forth in SEQ ID NO:9, or comprising or consisting essentially of the amino acid sequences set forth in SEQ ID NOs: 10 and 11, can be administered to a mammal (e.g., a human) having, or at risk of developing, ADPKD as described herein and used to treat the mammal.

[0054] Any appropriate amino acid residue set forth in SEQ ID NO: 9, SEQ ID NO: 10, and / or SEQ ID NO: 11 can be deleted, and any appropriate amino acid residue (e.g., any of the 20 conventional amino acid residues or any other type of amino acid such as ornithine or citrulline) can be added to or substituted within the sequence set forth in SEQ ID NO:9, SEQ ID NO: 10, and / or SEQ ID NO: 11. The majority of naturally occurring amino acids are L-amino acids, and naturally occurring polypeptides are largely comprised of L-amino acids. D-amino acids are the enantiomers of L-amino acids. In some cases, a polypeptide provided herein can contain one or more D-amino acids. In some embodiments, a polypeptide can contain chemical structures such as a-aminohexanoic acid; hydroxylated amino acids such as 3-hydroxyproline, 4-hydroxyproline, (5R)-5-hydroxy-L-lysine, allo-hydroxylysine, and 5-hydroxy-L-norvaline; or glycosylated amino acids such as amino acids containing monosaccharides (e.g., D-glucose, D-galactose, D-mannose, D- glucosamine, and D-galactosamine) or combinations of monosaccharides.

[0055] Amino acid substitutions can be made, in some cases, by selecting substitutions that do not differ significantly in their effect on maintaining (a) the structure of the peptide backbone in the area of the substitution, (b) the charge or hydrophobicity7of the molecule at particular sites, or (c) the bulk of the side chain. For example, naturally occurring residues can be divided into groups based on side-chain properties: (1) hydrophobic amino acids (norleucine, methionine, alanine, valine, leucine, and isoleucine); (2) neutral hydrophilic amino acids (cysteine, serine, and threonine); (3) acidic amino acids (aspartic acid and glutamic acid); (4) basic amino acids (asparagine, glutamine, histidine, lysine, and arginine); (5) amino acids that influence chain orientation (glycine and proline); and (6) aromatic amino acids (tryptophan, tyrosine, and phenylalanine). Substitutions made within these groups can be considered conservative substitutions. Non-limiting examples of substitutions that can be used herein for SEQ ID N0:9, SEQ ID NO: 10, and / or SEQ ID NO: 11 include, without limitation, substitution of valine for alanine, lysine for arginine, glutamine for asparagine, glutamic acid for aspartic acid, serine for cysteine, asparagine for glutamine, aspartic acid for glutamic acid, proline for glycine, arginine for histidine, leucine for isoleucine, isoleucine for leucine, arginine for lysine, leucine for methionine, leucine for phenyalanine, glycine for proline, threonine for serine, serine for threonine, tyrosine for tryptophan, phenylalanine for tyrosine, and / or leucine for valine. Further examples of conservative substitutions that can be made at any appropriate position within SEQ ID NO:9, SEQ ID NO: 10, and / or SEQ ID NO: 11 are set forth in the Table below. Examples of conservative amino acid substitutions.

[0056] In some embodiments, polypeptides can be designed to include the amino acid sequence set forth in SEQ ID NO:9, SEQ ID NO: 10, and / or SEQ ID NO: 11 with the proviso that they include one or more non-conservative substitutions. Nonconservative substitutions typically entail exchanging a member of one of the classes described above for a member of another class. Whether an amino acid change results in a functional polypeptide can be determined by assaying the specific activity of the polypeptide using, for example, the methods described herein. In some cases, a polypeptide having an amino acid sequence with at least 85%

[0057] (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99.0%) sequence identity to the amino acid sequence set forth in SEQ ID NO:9, SEQ ID NO: 10. and / or SEQ ID NO: 11, provided that it includes at least one difference (e.g., at least one amino acid addition, deletion, or substitution) with respect to SEQ ID NO:9, SEQ ID NO: 10, and / or SEQ ID NO: 11, can be used. For example, nucleic acid designed to express a polypeptide containing an amino acid sequence with between 90% and 99% sequence identity to the amino acid sequence set forth in SEQ ID NO:9, SEQ ID NO: 10, and / or SEQ ID NO: 11 can be designed and administered to a human having, or at risk of developing, ADPKD, to treat the mammal.

[0058] Percent sequence identity is calculated by determining the number of matched positions in aligned amino acid sequences, dividing the number of matched positions by the length of an aligned amino acid sequence, and multiplying by 100. A matched position refers to a position in which identical amino acids occur at the same position in aligned amino acid sequences. Percent sequence identity also can be determined for any nucleic acid sequence.

[0059] The percent sequence identity between a particular nucleic acid or amino acid sequence and a sequence referenced by a particular sequence identification number (e.g., SEQ ID NO:9) is determined as follows. First, a nucleic acid or amino acid sequence is compared to the sequence set forth in a particular sequence identification number using the BLAST 2 Sequences (B12seq) program from the stand-alone version of BLASTZ containing BLASTN version 2.0. 14 and BLASTP version 2.0. 14. This stand-alone version of BLASTZ can be obtained online at fr.com / blast or at ncbi.nlm.nih.gov. Instructions explaining how to use the B12seq program can be found in the readme file accompanying BLASTZ. B12seq performs a comparison between two sequences using either the BLASTN or BLASTP algorithm. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. To compare two nucleic acid sequences, the options are set as follows: -i is set to a file containing the first nucleic acid sequence to be compared (e.g., C:\seql .txt); -j is set to a file containing the second nucleic acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastn; -o is set to any desired file name (e.g., C:\output.txt); -q is set to -1; -r is set to 2; and all other options are left at their default setting. For example, the following command can be used to generate an output file containing a comparison between two sequences: C:\B12seq -i c:\seql.txt -j c:\seq2.txt -p blastn -o c:\output.txt -q -1 -r 2. To compare two amino acid sequences, the options of B12seq are set as follows: -i is set to a file containing the first amino acid sequence to be compared (e.g., C:\seql.txt); -j is set to a file containing the second amino acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastp; -o is set to any desired file name (e.g., C:\output.txt); and all other options are left at their default setting. For example, the following command can be used to generate an output file containing a comparison between two amino acid sequences: C:\B12seq -i c:\seql.txt -j c:\seq2.txt -p blastp -o c:\output.txt. If the two compared sequences share homology; then the designated output file will present those regions of homology as aligned sequences. If the two compared sequences do not share homology’, then the designated output file will not present aligned sequences.

[0060] Once aligned, the number of matches is determined by counting the number of positions where an identical nucleotide or amino acid residue is presented in both sequences. The percent sequence identity is determined by dividing the number of matches by the length of the sequence set forth in the identified sequence (e.g.. SEQ ID NO:9), followed by multiplying the resulting value by 100. For example, an amino acid sequence that has 1545 matches when aligned with the sequence set forth in SEQ ID NO:9 is 98.7 percent identical to the sequence set forth in SEQ ID NO:9 (i.e., 1545 1565 x 100 = 98.7). It is noted that the percent sequence identity value is rounded to the nearest tenth. For example, 75.11, 75.12, 75.13, and 75.14 is rounded down to 75.1, while 75. 15, 75.16, 75.17, 75.18, and 75.19 is rounded up to 75.2. It also is noted that the length value will always be an integer.

[0061] In some cases, a gene editing technique can be administered to a mammal (e.g.. a human) identified as having, or at risk of developing, ADPKD based, at least in part, on the presence of a mutation (e.g., a c.9805 (A>T) single nucleotide variant or a c.9829 (OT) single nucleotide variant) in an allele of aPKDl gene present in a mammal (e.g., a human) to treat the mammal. For example, gene therapy components (e.g., gene editing components) designed to edit a c.9805 (A>T) single nucleotide variant or a c.9829 (OT) single nucleotide variant present in aPKDl gene can be delivered to a cell within a mammal (e.g., a mouse or a human) having a c.9805 (A>T) single nucleotide variant or a c.9829 (OT) single nucleotide variant in one allele of a.PKDl gene to convert the variant to a cytosine at nucleotide position 9805 or position 9829.

[0062] In some cases, the methods and materials described herein can be used as the sole active agent used to treat a mammal having, or at risk of developing, ADPKD (e.g., a human having, or at risk of developing, ADPKD based, at least in part, on the presence of a mutation (e.g., a c.9829 (OT) single nucleotide variant) in an allele of a PKD1 gene present in the human). For example, nucleic acid encoding a targeted base editor polypeptide can be used as the sole active agent used to treat a mammal having, or at risk of developing, ADPKD (e.g., a human having, or at risk of developing, ADPKD based, at least in part, on the presence of a mutation (e.g., a c.9829 (C>T) single nucleotide variant) in an allele of a PKD1 gene present in the human).

[0063] In some cases, the methods and materials described herein can include one or more (e.g., one, two, three, four, five or more) additional therapeutic agents used to treat a mammal having, or at risk of developing, ADPKD (e.g., a human having, or at risk of developing, ADPKD based, at least in part, on the presence of a mutation (e.g., a c.9829 (OT) single nucleotide variant) in an allele of a PKDl gene present in the human). In some cases, a therapeutic agent used to treat polycystic kidney disease can be an agent that can reduce the grow th of renal cyst formation (e.g., tolvaptan). In some cases, a therapeutic agent used to treat polycystic kidney disease can be a high blood pressure medication (e.g., an angiotensin-converting enzyme inhibitor and / or an angiotensin II receptor blocker). In some cases, the one or more additional therapeutic agents can be administered independent of the nucleic acid encoding a targeted base editor polypeptide. When the one or more additional therapeutic agents are administered independent of the nucleic acid encoding a targeted base editor polypeptide, the nucleic acid encoding a targeted base editor polypeptide can be administered first, and the one or more additional therapeutic agents administered second, or vice versa.

[0064] In some cases, the methods and materials described herein can be used to slow, delay, or reverse ADPKD (e.g., slow; delay, or reverse the development of renal cysts) in a mammal (e.g., a human having, or at risk of developing, ADPKD based, at least in part, on the presence of a mutation (e.g., a c.9829 (OT) single nucleotide variant) in an allele of aPKDl gene present in the human). For example, the methods and materials described herein can be used to reduce or eliminate one or more symptoms of ADPKD. Examples of symptoms of ADPKD that can be reduced or eliminated using the methods and materials described herein include, without limitation, renal cysts, renal hypertrophy, cardiac hypertrophy, memory impairment, high blood pressure, back or side pain, blood in the urine, a feeling of fullness in the abdomen, headaches, kidney stones, kidney failure, and urinary tract or kidney infections. For example, the methods and materials described herein can be effective to reduce the severity of one or more symptoms of ADPKD within a mammal (e.g., a human) having, or at risk of developing, ADPKD based, at least in part, on the presence of a mutation (e.g., a c.9805 (A>T) single nucleotide variant or a c.9829 (OT) single nucleotide variant) by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent.

[0065] In some cases, the methods and materials described herein can be used to delay the onset of one or more symptoms of ADPKD in a mammal (e.g., a human having, or at risk of developing, ADPKD based, at least in part, on the presence of a mutation (e.g., a c.9829 (OT) single nucleotide variant) in an allele o aPKDl gene present in the human). For example, the onset of one or more symptoms of ADPKD in a mammal having a c.9829 (OT) single nucleotide variant in an allele of a PKD1 gene present in the mammal can be delayed by about 1 years to about 20 years (e.g., as compared to a mammal with a c.9829 (OT) single nucleotide variant in an allele oiaPKDl gene that is not treated as described herein). In some cases, the onset of one or more symptoms of ADPKD in a mammal having a c.9829 (OT) single nucleotide variant in an allele of a PKD1 gene present in the mammal can be delayed by about 10 years (e.g., 10 renal cyst free years) as compared to a mammal with a c.9829 (OT) single nucleotide variant in an allele of a PKD1 gene that is not treated as described herein.

[0066] In some cases, the methods and materials described herein can be used to extend the life expectancy of a mammal (e g., a human having, or at risk of developing, ADPKD based, at least in part, on the presence of a mutation (e.g., a c.9829 (OT) single nucleotide variant) in an allele of aPKDl gene present in the human). For example, the life expectancy of a mammal having a c.9829 (OT) single nucleotide variant in an allele of a PKD1 gene present in the mammal can be extended by about 2 years to about 20 years or longer (e.g., as compared to the life expectancy of a mammal with a c.9829 (OT) single nucleotide variant in an allele of a PKD1 gene that is not treated as described herein). For example, the life expectancy of a mammal having a c.9829 (OT) single nucleotide variant in an allele of a PKD1 gene present in the mammal can be extended by about 10 years as compared to the life expectancy of a mammal with a c.9829 (C>T) single nucleotide variant in an allele of aPKDl gene that is not treated as described herein.

[0067] Exemplary Embodiments

[0068] Embodiment 1 is a method for targeted modification of the genome of a cell having an autosomal dominant polycystic kidney disease (ADPKD) mutation in a polycystin 1 gene, wherein the method comprises introducing, into the cell, one or more nucleic acid constructs that, in combination, comprise: (a) one or more nucleotide sequences that, in combination, encode a fusion polypeptide, wherein the fusion polypeptide comprises a base editor domain and a DNA binding domain, wherein the DNA binding domain comprises a clustered regularly interspaced short palindromic repeats- (CRISPR-) associated (Cas) endonuclease polypeptide, and wherein the Cas endonuclease polypeptide has been modified to lack endonuclease activity, and (b) a nucleotide sequence encoding a guide RNA (gRNA) targeted to the ADPKD mutation, wherein the gRNA targets the fusion polypeptide to the ADPKD mutation, and wherein the base editor corrects the ADPKD mutation in the genome of the cell.

[0069] Embodiment 2 is the method of embodiment 1, wherein the cell is a somatic cell.

[0070] Embodiment 3 is the method of embodiment 1 or embodiment 2, wherein the cell is within a mammal.

[0071] Embodiment 4 is the method of embodiment 3, wherein the mammal is a human.

[0072] Embodiment 5 is the method of any one of embodiments 1 to 4, wherein the one or more nucleic acid constructs are adeno-associated virus (AAV) constructs.

[0073] Embodiment 6 is the method of any one of embodiments 1 to 5. wherein the one or more nucleotide sequences encoding the fusion polypeptide are operably linked to a kidney-specific promoter.

[0074] Embodiment 7 is the method of embodiment 6, wherein the kidney-specific promoter is a Ksp promoter or an Aqp2 promoter.

[0075] Embodiment 8 is the method of any one of embodiments 1 to 7, wherein the method comprises introducing, into the cell, (1) a first nucleic acid construct encoding the fusion polypeptide, wherein the fusion polypeptide comprises the base editing domain and an N-terminal portion of the attenuated Cas polypeptide, and (2) a second nucleic acid construct encoding the gRNA and a C-terminal portion of the attenuated Cas polypeptide.

[0076] Embodiment 9 is the method of any one of embodiments 1 to 8, wherein the mutation in the poly cystin 1 gene is at a nucleotide corresponding to the nucleotide at position 52 of SEQ ID NO:25.

[0077] Embodiment 10 is a method for treating autosomal dominant polycystic kidney disease (ADPKD) in a mammal having an ADPKD-associated point mutation in a poly cystin 1 gene, wherein the method comprises administering to the mammal one or more nucleic acid constructs that, in combination, comprise: (a) one or more nucleotide sequences that, in combination, encode a fusion polypeptide, wherein the fusion polypeptide comprises a base editor and a clustered regularly interspaced short palindromic repeats- (CRTSPR-) associated (Cas) endonuclease, wherein the Cas endonuclease has been modified to lack endonuclease activity, and (b) a nucleotide sequence encoding a guide RNA (gRNA) targeted to the ADPKD mutation, wherein the gRNA targets the fusion polypeptide to the ADPKD mutation, and wherein the base editor corrects the ADPKD mutation in the genome of the mammal.

[0078] Embodiment 11 is the method of embodiment 10, wherein the mammal is a human.

[0079] Embodiment 12 is the method of embodiment 10 or embodiment 11, wherein the administering results in delayed kidney cyst growth in the mammal.

[0080] Embodiment 13 is the method of any one of embodiments 10 to 12, wherein the administering results in normalized heart hypertrophy in the mammal.

[0081] Embodiment 14 is the method of any one of embodiments 10 to 13, wherein the administering results in increased expression of PC-1 in the mammal.

[0082] Embodiment 15 is the method of any one of embodiments 10 to 14, wherein the one or more nucleic acid constructs are adeno-associated virus (AAV) constructs.

[0083] Embodiment 16 is the method of any one of embodiments 10 to 15, wherein the one or more nucleotide sequences encoding the fusion polypeptide are operably linked to a kidney-specific promoter.

[0084] Embodiment 17 is the method of embodiment 16, wherein the kidney-specific promoter is a Ksp promoter or an Aqp2 promoter. Embodiment 18 is the method of any one of embodiments 10 to 17, wherein the method comprises administering, to the mammal: (1) a first nucleic acid construct encoding the fusion polypeptide, wherein the fusion polypeptide comprises the base editing domain and an N-terminal portion of the attenuated Cas polypeptide, and (2) a second nucleic acid construct encoding the gRNA and a C-terminal portion of the attenuated Cas polypeptide.

[0085] Embodiment 19 is the method of any one of embodiments 10 to 18, wherein the mutation in the poly cystin 1 gene is at a nucleotide corresponding to the nucleotide at position 52 of SEQ ID NO: 25.

[0086] The invention will be further described in the following example, which does not limit the scope of the invention described in the claims.

[0087] EXAMPLE

[0088] Studies were conducted to demonstrate that base editing technology' can be used to precisely modify a single base in the mouse Pkdl gene. First, a mouse model of ADPKD was generated by replacing exon 29 of the mouse Pkdl gene with a modified exon (FIGS. 8A and 8B) in which an arginine (R) codon (AGA) was changed to a cysteine (C) codon (TGC) (c.9805.9807 AGA>TGC, p.R3269C), which mimics the p.R3277C mutation in human ADPKD patients (see, Hopp et al., J. Clin. Invest., 122(11):4257-4273, 2012). Homozygous PkdlRC / RCmice were generated. The PkdlRCRCmice mimicked the exact codon usage seen in patients (Pkdl c.9805.9807 AGA>TGC). In order to convert the encoded arginine back to cytosine, ABEs that can efficiently and irreversibly convert A*T base pairs to G«C base pairs were used.

[0089] The vectors in FIGS. 1A-1B (Addgene plasmids 137176 and 137177) were obtained from Addgene (Watertown, MA) and digested with Pstl and Agel. A PCR amplicon containing an ABE9 fragment, generated using Addgene plasmid 194208 as a template, forward primer ATACCGGTGCCACCATGAAACGGACAG (SEQ ID NO: 19), and reverse primer TACTGCAGTTTGGCATCCTCGG (SEQ ID NO 20), was combined with the digested vectors using isothermal assembly in NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs (NEB), E2621S) to generate the vectors shown in FIGS. 2A-2B. R3277C-targeted sgRNA was installed by digesting the vectors shown in FIGS. 2A-2B with BsmBY and gel extracting the resulting cleaved backbone. DNA oligonucleotides encoding the sgRNA were obtained commercially to match the overhangs generated by BsmBl digestion.

[0090] To generate the Ksp-ABE9-AAV9 plasmids, the Ksp promoter was amplified by PCR from mouse genomic DNA using forward primer ATGGTACCAGCTTGCTCTGCCATG (SEQ ID NO:21) and reverse primer CGACCGGTGCAAATTTGGCTTAGG (SEQ ID NO:22). The vectors shown in FIGS. 2A-2B were digested with Agel and Kpnl and then combined with the PCT product using isothermal assembly to generate the vectors shown in FIGS. 3A-3B.

[0091] To generate the AQP2-ABE9-AAV9 plasmids, the Aqp2 promoter was amplified by PCR from mouse genomic DNA using forward primer GCGGTACCACATAGCACTGAGCAATAGC (SEQ ID NO:23) and reverse primer ATACCGGTACTCACAGCAGGGTTGA (SEQ ID NO:24). The vectors shown in FIGS. 2A-2B were digested with Age\ and Kpn\. and then combined with the PCR product using isothermal assembly with an NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs (NEB), E2621S) to generate the vectors shown in FIGS. 4A-4B

[0092] After packaging the N- and C-terminal vectors together with AdDeltaF6 and pAAV2 / 9n plasmids (Addgene) in HEK293T / 17 cells, the Pkdl -sgRNA- AB E9-dual- AAV9 particles were harvested and administered to day 14 PkdlRC RCmice (n = 10) via intravenous (IV) injection at a dosage of 5 x io11vg of each AAV, 1 x 1012vg total.

[0093] Next, the arginine to cysteine mutation was corrected back to arginine in the PkdlRC / RCmice, using a Pkdl -sgRNA- ABE-dual-AAV9 construct to edit the thymine in the cysteine codon (TGC) to adenine (AGC, encoding arginine) (FIG. 8C). The mice were evaluated at 3 months of age to determine if reverting the mutation would reduce the effects of ADPKD. ADPKD is associated with multiple cardiovascular abnormalities, and cardiovascular dysfunction is evident even earlier than the appearance of renal cysts in ADPKD patients. Cardiovascular abnormalities in ADPKD include, without limitation, cardia hypertrophy, reduced contractility of cardiomyocytes, and diastolic dysfunction. Diminished renal function also can occur. These abnormalities can result from, for example, reduced expression of PCI in cardiomyocytes, which in turn is associated with reduced expression of calcium and potassium channels, reduced action potential duration, and reduced calcium release; reduced expression of PCT in cardiomyocytes, which in turn is associated with reduced calcium uptake, reduced calcium release, and reduced autophagy; and other manifestations such as increased vascular resistance, insulin resistance, increased levels of plasma endothelin-1, increased sympathetic nerve activity, arterial hypertension, and increased activation of the renin-angiotensin-aldosterone system (RAAS).

[0094] As shown in FIGS. 9A-9E, treating PkdlRC / RCmice with P Z-sgRN A-ABE- dual-AAV9 particles resulted in delayed cyst growth and normalized heart hypertrophy vciPkdlRC,RCmice. For example,pkdlRC / RCmice treated with Pdkl- sgRNA-ABE-dual-AAV9 particles had kidneys that were similar in size to those of wild type mice (FIG. 9A). and had lower cystic indices (FIG. 9B) and kidney weight to body weight (KW / BW) ratios (FIG. 9C) than PkdlRC / RCmice that did not receive the / WA / -sgRNA-ABE-dual-AAV9 treatment. The treated mice also had hearts of normalized size (FIG. 9D), and had lower heart weight to body w eight (HW / BW) ratios (FIG. 9E) than PkdlRC / RCmice that did not receive the / Vft / -sgRNA-ABE- dual-AAV9 treatment.

[0095] Further studies demonstrated that treatment of PkdlRCRCmice with the AAV base editor led to recovery of PCI levels in the kidney (FIG. 10A) and in the heart (FIG. 10B). In addition, treatment of PkdlRC / RCmice with the AAV base editor led to recovery from Pkdl mutation-induced memory impairment, as determined using a Y - maze test to evaluate the spatial memory and exploration of the animals. The test utilized a maze w ith three arms at 120 degrees to each other (FIG. 11 A). The test protocol included two phases - a trial phase and a test phase. One arm of the maze was named as “novel” and the other two were “known” arms. During the trial phase, the novel arm was blocked and mice were placed at the end of one of the other arms and allowed to explore the known arms for 5 minutes. In test phase (four hours after the trial phase), animals were given 5 minutes to explore all the three arms. The time spent by the animals in the novel arm of the Y-maze was considered as coping behavior. A reduction in coping behavior indicated anxiety, as the animals w ere less likely to explore the novel environment due to anxiety’. Coping behavior, defined as (time spent in novel arm / total time) x 100, was normalized in the PkdlRC / RCmice with the AAV base editor to reverse the ADPKD mutation (FIG. 11B).

[0096] Taken together, these studies demonstrated that a / / -sgRN A-ABE-dual- AAV9 vector was successfully used for in vivo base editing in PkdlRC / RCmice. A one- time “shot” with Pkdl-sgRNA-ABE-dual-AAV9 particles delayed cyst growth and normalized heart hypertrophy in the PkdlRCRCmice. Treatment with the AAV base editor also led to recovery of PCI expression m PkdlRC,RCkidneys and hearts, as well as recovery of Pkdl mutation-induced memory impairment. OTHER EMBODIMENTS

[0097] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, w hich is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

WHAT IS CLAIMED IS:

1. A method for targeted modification of the genome of a cell having an autosomal dominant polycystic kidney disease (ADPKD) mutation in a poly cystin 1 gene, wherein said method comprises introducing, into said cell, one or more nucleic acid constructs that, in combination, comprise:(a) one or more nucleotide sequences that, in combination, encode a fusion polypeptide, wherein said fusion polypeptide comprises a base editor domain and a DNA binding domain, wherein said DNA binding domain comprises a clustered regularly interspaced short palindromic repeats- (CRISPR-) associated (Cas) endonuclease polypeptide, and wherein said Cas endonuclease polypeptide has been modified to lack endonuclease activity, and(b) a nucleotide sequence encoding a guide RNA (gRNA) targeted to said ADPKD mutation, wherein said gRNA targets said fusion polypeptide to said ADPKD mutation, and wherein said base editor corrects said ADPKD mutation in the genome of said cell.

2. The method of claim 1, wherein said cell is a somatic cell.

3. The method of claim 1 or claim 2, wherein said cell is within a mammal.

4. The method of claim 3, wherein said mammal is a human.

5. The method of claim 1, wherein said one or more nucleic acid constructs are adeno-associated virus (AAV) constructs.

6. The method of claim 1. wherein said one or more nucleotide sequences encoding said fusion polypeptide are operably linked to a kidney -specific promoter.

7. The method of claim 6, wherein said kidney-specific promoter is a Ksp promoter or an Aqp2 promoter.

8. The method of claim 1, w herein said method comprises introducing, into said cell, (1) a first nucleic acid construct encoding said fusion polypeptide, wherein saidfusion polypeptide comprises said base editing domain and an N-terminal portion of said attenuated Cas polypeptide, and (2) a second nucleic acid construct encoding said gRNA and a C-terminal portion of said attenuated Cas polypeptide.

9. The method of claim 1, wherein said mutation in said poly cystin 1 gene is at a nucleotide corresponding to the nucleotide at position 52 of SEQ ID NO:25.

10. A method for treating autosomal dominant polycystic kidney disease (ADPKD) in a mammal having an ADPKD-associated point mutation in a polycystin 1 gene, wherein said method comprises administering to said mammal one or more nucleic acid constructs that, in combination, comprise:(a) one or more nucleotide sequences that, in combination, encode a fusion polypeptide, wherein said fusion polypeptide comprises a base editor and a clustered regularly interspaced short palindromic repeats- (CRISPR-) associated (Cas) endonuclease, wherein said Cas endonuclease has been modified to lack endonuclease activity, and(b) a nucleotide sequence encoding a guide RNA (gRNA) targeted to said ADPKD mutation, wherein said gRNA targets said fusion polypeptide to said ADPKD mutation, and wherein said base editor corrects said ADPKD mutation in the genome of said mammal.

11. The method of claim 10, wherein said mammal is a human.

12. The method of claim 10 or claim 1 1, wherein said administering results in delayed kidney cyst grow th in said mammal.

13. The method of claim 10, wherein said administering results in normalized heart hypertrophy in said mammal.

14. The method of claim 10, wherein said administering results in increased expression of PC-1 in said mammal.

15. The method of claim 10, wherein said one or more nucleic acid constructs are adeno-associated virus (AAV) constructs.

16. The method of claim 10, wherein said one or more nucleotide sequences encoding said fusion polypeptide are operably linked to a kidney -specific promoter.

17. The method of claim 16, wherein said kidney-specific promoter is a Ksp promoter or an Aqp2 promoter.

18. The method of claim 10, wherein said method comprises administering, to said mammal:(1) a first nucleic acid construct encoding said fusion polypeptide, wherein said fusion polypeptide comprises said base editing domain and an N-terminal portion of said attenuated Cas polypeptide, and(2) a second nucleic acid construct encoding said gRNA and a C-terminal portion of said attenuated Cas polypeptide.

19. The method of claim 10, wherein said mutation in said poly cystin 1 gene is at a nucleotide corresponding to the nucleotide at position 52 of SEQ ID NO:25.

Images