High-spatial-resolution transcriptional profiling through indexed sequencing

The method addresses throughput and cost limitations in spatial transcriptomics by using sender and receiver beads with photocleavable linkers and barcodes for high-resolution, unbiased transcriptional mapping in tissues, enabling detailed spatial gene expression analysis through sequencing.

WO2025222124A1PCT designated stage Publication Date: 2025-10-23THE ROCKEFELLER UNIV
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/025375
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-04-18
Filing Date
2025-04-18
Publication Date
2025-10-23

AI Technical Summary

Technical Problem

Current spatial transcriptomic methods face challenges in throughput and cost, limiting their ability to quantify gene expression alterations across multiple regions, conditions, and independent replicates, and require specialized equipment or imaging techniques.

Method used

A method using sender and receiver beads with photocleavable linkers, barcodes, and unique molecular identifiers for high-throughput spatial mapping by sequencing, which captures and sequences mRNA molecules without prior or posterior indexing processes.

Benefits of technology

Enables high-spatial-resolution, cost-effective, and unbiased transcriptional mapping in intact tissues, providing detailed spatial maps of gene expression without sophisticated imaging, leveraging high-throughput Next Generation Sequencing (NGS).

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025025375_23102025_PF_FP_ABST
    Figure US2025025375_23102025_PF_FP_ABST
Patent Text Reader

Abstract

Provided herein are compositions for producing a spatial transcription map of a biological sample, and corresponding methods therefor, wherein the methods include applying oligonucleotide attached sender beads and receiver beads to a surface or slide.
Need to check novelty before this filing date? Find Prior Art

Description

Attorney Docket No.046531-5035-00WO HIGH-SPATIAL-RESOLUTION TRANSCRIPTIONAL PROFILING THROUGH INDEXED SEQUENCING CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Application No.63 / 635,798, filed April 18, 2024, which is hereby incorporated by reference herein in its entirety. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT

[0002] This invention was made with government support under HG012522, AG076932, HG011014 and GM007739 awarded by the National Institutes of Health. The government has certain rights in the invention. REFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY

[0003] This application contains a Sequence Listing, which is submitted electronically via EFS-Web as an XML Document formatted sequence listing with a file name “046531-5035- 00WO Sequence Listing.xml,” having a creation date of April 8, 2025, and having a size of 19,809 bytes. The sequence listing submitted via EFS-Web is part of the specification and is herein incorporated by reference in its entirety. BACKGROUND OF THE INVENTION

[0004] Understanding the spatial organization of molecules and cells is crucial for studying cellular network dynamics in aging and disease. For example, recent advancements in spatial transcriptomics, by multiplexed in situ hybridization (Chen et al., 2015, Science 348, aaa6090; Eng et al., 2019, Nature 568, 235–239; Wang et al., 2018, Science 361, eaat5691) or indexed oligonucleotide capture arrays (Ståhl et al., 2016, Science 353, 78–82; Rodriques et al., 2019, Science 363, 1463–1467; Liu et al., 2020, Cell 183, 1665–1681.e18; Vickovic et al., 2019, Nat. Methods 16, 987–990; Chen et al., 2022, Cell 185, 1777–1792.e21; Cho et al., 2021, Cell 184, 3559–3572.e22; Fu et al., 2021, Cell 185, 4621–4633.e17), have revolutionized the ability to spatially profile genome-wide RNA expression across diverse anatomical locations. By providing high-resolution, spatially resolved maps of gene expression, these tools allow 1visualization of how individual cells interact within tissues, revealing disruptions in cellular organization that contribute to aging and disease.

[0005] Despite these advances, current spatial transcriptomic methods face significant challenges in throughput and cost, which hinder their ability to quantify the alterations in gene expressions across multiple regions, conditions, and independent replicates. For example, while multiplexed in situ hybridization provides subcellular resolution (Chen et al., 2015, Science 348, aaa6090; Eng et al., 2019, Nature 568, 235–239; Wang et al., 2018, Science 361, eaat5691), it is limited by imaging speed and requires specialized equipment and pre-selected gene probes. On the other hand, oligonucleotide capture arrays face limitations in their throughput and the ability to cover extensive areas: prior indexing methods (e.g., 10X Genomics Visium (Ståhl et al., 2016, Science 353, 78–82), DBiT-seq (Liu et al., 2020, Cell 183, 1665–1681.e18)), use predefined DNA barcodes at specific positions, whereas posterior indexing methods, such as slide-seq (Rodriques et al., 2019, Science 363, 1463–1467; Stickels et al., 2021, Nat. Biotechnol.39, 313– 319), HDST (Vickovic et al., 2019, Nat. Methods 16, 987–990) and Stereo-seq (Chen et al., 2022, Cell 185, 1777–1792.e21), distribute unidentified DNA barcodes on a 2D surface and later identify them through imaging techniques like sequencing. Scaling up these indexing approaches is technically challenging, constrained by issues such as barcode pre-assignment or the reliance on multiple rounds of optical imaging.

[0006] The approach of "spatial mapping by sequencing" offers a promising solution to these challenges by utilizing barcoded DNA sequences to record the spatial proximity of millions of biological molecules (Boulgakov et al., 2020, Trends Biotechnol.38, 154–162). This strategy, previously employed in DNA Hi-C for constructing three-dimensional chromatin structures (Duan et al., 2020, Nature 465, 363–367), is recently being adapted to profile spatial interactions of several targeted mRNA molecules for inferring cellular spatial interactions in cultured cell lines (e.g., DNA microscope (Weinstein et al., 2019, Cell 178, 229–241.e16)) or the spatial distribution of cellular surface proteins (Karlsson et al., 2024, Nat. Methods 21, 1044–1052).

[0007] Despite these innovations and the development of supporting theoretical frameworks (Weinstein et al., 2019, Cell 178, 229–241.e16; Hoffecker et al., 2019, Proc. Natl. Acad. Sci. U. S. A.116, 19282–19287; Greenstreet et al., 2023, Cell Syst 14, 844–859.e4), there remains a need in the art for a robust, high-throughput, and cost-effective "spatial mapping by sequencing" platform for region-specific transcriptomic analysis of complex tissues. The present 2invention addresses this unmet need in the art. SUMMARY OF THE INVENTION

[0008] In some embodiments, the invention relates to a sender bead comprising an acrylamide-based gel bead with a plurality of attached oligonucleotides wherein each attached oligonucleotide comprises: a) a photocleavable linker; b) a primer sequence; c) a barcode sequence; d) a unique molecular identifier sequence; and e) a capture sequence for binding to a receiver bead.

[0009] In some embodiments, the invention relates to a receiver bead comprising an acrylamide-based gel bead with a plurality of attached oligonucleotides wherein each attached oligonucleotide comprises: a) a primer sequence; b) a barcode sequence; c) a unique molecular identifier sequence; and d) a capture sequence for binding to i) a target molecule of interest; ii) an oligonucleotide released upon photocleavage of the photocleavable linker from the sender bead, or iii) a combination of i) and ii).

[0010] In some embodiments, the invention relates to an assay system for generating a spatial map of one or more target molecule across a sample comprising a combination of sender beads and receiver beads.

[0011] In some embodiments, the assay generates a transcriptional map of mRNA molecules across the sample.

[0012] In some embodiments, the capture sequence of the sender bead comprises a poly- A region, and the capture sequence of the receiver bead comprises a poly-T region.

[0013] In some embodiments, the invention relates to a method, comprising: 3a) applying a mixture of sender beads and receiver beads to a surface or slide; b) applying a tissue sample to the surface or slide; c) allowing hybridization of the receiver beads to the target molecule of interest; d) applying UV light to the surface or slide to induce photocleavage of the oligonucleotides of the sender beads; e) applying a reverse transcription mixture to the surface or slide; f) performing reverse transcription of the captured target molecules and the captured photocleaved oligonucleotides; g) delivering to the region of interest lysis buffer or denaturation reagents to produce a lysed or denatured tissue sample; and (h) extracting the receiver beads from the lysed or denatured tissue sample.

[0014] In some embodiments, the method further comprises a step of permeabilizing the tissue sample prior to applying the tissue sample to the slide or surface containing the sender and receiver beads.

[0015] In some embodiments, the method further comprises a step of taking an image of the tissue sample.

[0016] In some embodiments, the method further comprises the steps: i) generating a sequencing library from the oligonucleotides attached to the recovered receiver beads; j) sequencing the sequencing library to produce barcoded DNA reads; k) generating a matrix of bead connections based on the UMI sequences and barcodes of the sender beads and receiver beads; l) generating a spatial map of the target molecules using the barcodes on the sequencing reads of the target molecules and the matrix of bead connections.

[0017] In some embodiments, the method further comprises identifying the anatomical location of the target molecules by correlating the spatial map to the sample image. BRIEF DESCRIPTION OF THE DRAWINGS 4

[0018] The following detailed description of preferred embodiments of the invention will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating the invention, there are shown in the drawings embodiments which are presently preferred. It should be understood, however, that the invention is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings.

[0019] Figure 1A and Figure 1B depict an overview of IRIS methodology. Figure 1A depicts the experimental scheme and illustrates how IRIS utilizes barcoded gel beads (receiving beads) to capture nearby mRNA expression. Each receiving bead also captures barcoded oligos from adjacent sending beads. Figure 1B depicts the computational scheme and describes the derivation of two matrices from each IRIS experiment. The gene count matrix identifies gene expression for each bead, while the bead-bead connection matrix aids in inferring bead locations for image reconstruction.

[0020] Figure 2A through Figure 2C depict a validation of IRIS for profiling mouse brain coronal sections. Figure 2A depicts an application of IRIS on a mouse brain coronal section, showcasing a UMAP clustering of receiving beads based on their gene expression, with color coding representing different annotated regions. Figure 2B depicts an image reconstruction of all receiving beads derived from bead-bead connections, with coloring corresponding to the annotated regions based on gene expression shown in Figure 2A. Similar to Figure 2B, Figure 2C depicts an image reconstruction of all receiving beads derived from bead-bead connections, but each bead is colored according to the expression of known region-specific gene markers.

[0021] Figure 3A and Figure 3B depict data demonstrating an IRIS analysis of region- specific gene expression and cellular proportions in aging. Figure 3A depicts a boxplot illustrating changes in region-specific gene expression between adult and aged mouse brains. Gene expression is normalized to total transcript per bead, log-transformed, and scaled. Figure 3B depicts a dot plot displaying the log2-transformed enrichment fold of Disease-Associated Microglia (DAM) across various brain regions.

[0022] Figure 4A through Figure 4L depicts an overview and validation of the IRISeq Platform. Figure 4A depicts a schematic illustrating the IRISeq experimental pipeline utilizing barcoded gel beads (‘receiver beads’) to capture mRNA expression from nearby cells, along with barcoded oligos from adjacent ‘sender beads’ for spatial localization. Figure 4B depicts a pie chart detailing the reagent cost breakdown for profiling a tissue section using a 0.6 cm x 0.6 cm 5bead array. Figure 4C depicts a diagram showing the generation of gene count and bead-bead connection matrices from IRISeq data to identify region-specific gene expression and infer bead spatial locations for image reconstruction. Figure 4D provides a depiction of a small-scale IRISeq experiment using a 0.6 cm x 0.6 cm bead array to profile a mouse brain hemisection. Figure 4E depicts box plots displaying the distribution of unique transcripts and genes detected per receiver bead in the small-scale experiment. Figure 4F depicts a UMAP plot showing the spatial distribution of receiver beads based on interactions with sender beads, colored by the number of unique transcripts per bead. Figure 4G depicts data demonstrating that the gene expression data of receiver beads was integrated with spatial transcriptome data from 10x Visium (Sziraki et al., 2023, Nat. Genet.55, 2104–2116). The UMAP plot shows the integrated gene expression clusters, with each bead colored by annotated brain regions. Figure 4H depicts a UMAP plot visualizing the spatial distribution of receiver beads, with each bead colored by annotated brain regions. Figure 4I provides a depiction of a large-area IRISeq experiment using a 1.5 cm x 1.5 cm bead array to profile two entire brain sections. Figure 4J depicts a UMAP plot of receiver beads from the large-area IRISeq experiment, colored by the number of unique transcripts detected per bead. Figure 4K and Figure 4L depict UMAP plots displaying gene expression clusters (Figure 4K) and reconstructed spatial distributions (Figure 4L) of receiver beads from the large-area experiment, colored by annotated brain regions.

[0023] Figure 5A and Figure 5B depicts bead generation and barcoding in IRISeq. Fiture 5A depicts a schematic illustrating the generation of barcoded hydrogel beads (‘sender beads’ and ‘receiver beads’) through combinatorial indexing. Figure 5B depicts a diagram showing the dual interaction between sender and receiver beads for capturing RNA from tissue samples and indexing spatial locations on the array.

[0024] Figure 6 depicts an exemplary IRISeq computational pipeline. Customized computational pipeline outlining the derivation of two matrices from each IRISeq experiment. The gene count matrix captures gene expression for each bead, while the bead-bead connection counts matrix infers bead locations for image reconstruction.

[0025] Figure 7A through Figure 7F depict data demonstrating the IRISeq quality control and performance comparison. Figure 7A depicts (top panel) the distribution of unique bead-bead interactions per receiver bead. The bottom panel shows the distribution of connected sender beads per receiver bead, with the median indicated by a dashed line in both panels. Figure 7B 6depicts UMAP plots that compare the spatial distribution of receiver beads from a small-scale IRISeq experiment (left) with 10x Visium data (right), colored by the expression of region- specific markers Ttr (ventricle region, top) and Hpca (hippocampus region, bottom). Figure 7C depicts a UMAP plot showing the integrated gene expression profiles from IRISeq receiver beads and 10x Visium spots, colored by assay type. Figure 7D depicts a UMAP plot illustrating spatial distribution colored by annotated brain regions, similar to Figure 4G. Figure 7E depicts a UMAP plot showing the reconstructed spatial distribution of receiver beads from IRISeq, with beads colored according to the number of unique interaction oligos with a selected sender bead, validating the spatial reconstruction pipeline. Figure 7F depicts histograms depicting Euclidean distances (in Figure 7E) between pairs of receiver beads connected to the same sender bead (left) versus distances between randomly selected receiver beads (right).

[0026] Figure 8A through Figure 8F depict data demonstrating the IRISeq enables spatial transcriptomic profilings at high resolution. Figure 8A depicts a comparison of fluorescence intensities of DNA probes on 5 µm dendrimer-coated beads versus 5 µm non-coated beads. Figure 8B depicts a bead recovery comparison between IRISeq and Slide-seq, plotted as bead frequency versus log(nCount_RNA). Figure 8C depicts box plots displaying the distribution of unique transcripts and genes detected per receiver bead in two separate experiments with 10 µm beads (left) and 5 µm beads (right). Figure 8D depicts UMAP plots showing the spatial distribution of 10 µm receiver beads in IRISeq experiment described in Figure 9E–9G, colored by expression of region-specific marker genes. Figure 8E depicts UMAP plots showing the spatial distribution of 10 µm receiver beads in in IRISeq experiment described in Figure 9B–9D, colored by expression of region-specific marker genes. Figure 8F depicts UMI density and detected gene features visualized on the reconstructed 5 µm bead array.

[0027] Figure 9A through Figure 9G depict data demonstrating the high-resolution spatial transcriptomics profiling enabled by IRISeq Platform. Figure 9A depicts a schematic illustrating the dendrimer-based strategy for generating high-DNA-density beads. Functionalized beads are incubated with fourth- or fifth-generation PAMAM dendrimers, increasing each functional group by 64-fold or 128-fold, respectively. DNA primers are then conjugated to the beads, followed by split-pool bead barcoding. Figure 9B depicts the spatial profiling of the mouse hindbrain region, showing UMI density distributions and anatomical boundaries. Figure 9C depicts gene expression UMAP overlaid on the spatial reconstruction, highlighting clusters 7corresponding to distinct anatomical structures. Figure 9D depicts the visualization of Calb1, a Purkinje cell marker, demonstrating its specificity to the Purkinje cell layer. Figure 9E depicts an analysis of a mouse brain tissue section encompassing the hippocampal region, with UMI density mapped onto the spatially reconstructed array. Figure 9F depicts the fene expression UMAP overlaid on the spatial reconstruction, revealing clusters aligned with known anatomical features. Figure 9G depicts an expression plot of C1ql2, a marker specific to the dentate gyrus.

[0028] Figure 10A through Figure 10J depict data demonstrating the spatial transcriptomic analysis of mouse brain aging using IRISeq. Figure 10A depicts a schematic of IRISeq profiling across various brain regions, including the frontal isocortex, dorsal cortex, hippocampus, thalamus, hypothalamus, and additional associated regions. "Section 1" and "Section 2" are for the frontal and middle part of the cortex and "Section 3" is near the dorsal part of the cortex. Figure 10B depicts a barplot showing the number of spatially barcoded receiver beads recovered per mouse individual. Figure 10C and Figure 10D depict boxplots showing the number of unique transcripts (Figure 10C) and unique bead-bead interactions (Figure 10D) detected per receiver bead, aggregated across all brain sections for each mouse individual. Figure 10E depicts UMAP plots showing the gene expression clusters of receiver beads integrating IRISeq data with published spatial transcriptomics datasets (Langlieb et al., 2023, Nature 624, 333–342; Ortiz et al., 2020, Sci Adv 6, eabb3446), colored by annotated brain regions. Figure 10F depicts an image reconstruction of all receiver beads derived from bead-bead connections, with coloring corresponding to the annotated regions based on gene expression shown in (Figure 10E). Similar to Figure 10F, Figure 10G and Figure 10H depict image reconstructions of all receiver beads derived from bead-bead connections, but each bead is colored according to the expression of region-specific gene markers (Figure 10G) or cell type weight (Figure 10H) representing cell type abundance by RTCD analysis (Cable et al., 2022, Nat. Biotechnol.40, 517–526). Figure 10I depicts a heatmap showing the gene expression specificity across regions, with expression data aggregated, normalized, and scaled for each region. Figure 10J depicts a cell type distribution across regions, showing sub-cluster IDs from the previous single-cell study (Sziraki et al., 2023, Nat. Genet.55, 2104–2116). Cell type weight is calculated using RCTD (Cable et al., 2022, Nat. Biotechnol.40, 517–526), integrating published single-cell data (Sziraki et al., 2023, Nat. Genet.55, 2104–2116) with IRISeq data, and then regional subtype proportions are aggregated, normalized, and scaled. Cell type 8abbreviations: DGN: Dentate Gyrus Neurons. CtxPN1: Cortical Projection Neurons 1. Endo: Endothelial Cells. Astro: Astrocytes. IMN: Interbrain and Midbrain Neurons. VLMC: Vascular Leptomeningeal Cells. Oligo: Oligodendrocytes. OBN: Olfactory Bulb Neurons. StrN: Striatal Neurons. HabN: Habenula Neurons. Epen: Ependymal Cells. ChPec: Choroid Plexus Epithelial Cells. Micro: Microglia.

[0029] Figure 11A and Figure 11B depict data demonstrating the IRISeq region annotation and published datasets comparison. Figure 11A depicts UMAPs by gene expression comparing IRISeq data with published spatial transcriptomics datasets (Ortiz et al., 2020, Sci Adv 6, eabb3446). The left panels show the gene expression profiles colored by techniques (IRISeq, ‘ST’ for spatial transcriptomics, ‘Visium’ for 10X Visium), while the right panels color the beads by gene expression clusters specific to each brain region. Figure 11A depicts (left panels) UMAPs showing the reconstructed spatial distribution of receiver beads from IRISeq, colored by gene expression clusters. The right panels display the spatial distribution of transcriptome profiles from published datasets (Sziraki et al., 2023, Nat. Genet.55, 2104–2116; Ortiz et al., 2020, Sci Adv 6, eabb3446) (‘ST’ for spatial transcriptomics, ‘Visium’ for 10X Visium), with coloring corresponding to the annotated brain regions as identified in the gene expression clustering in (Figure 11A).

[0030] Figure 12A and Figure 12B depict data demonstrating the Comparison of cell subtype distributions between IRISeq and 10X Visium. Figure 12A depicts UMAP plots showing the reconstructed spatial distribution of receiver beads from IRISeq, colored by cell type weight. Each plot highlights specific cell types, including Choroid Plexus Epithelial Cells (Subtype 2), Striatal Neuron 1 (Subtype 6), and Oligodendrocytes (Subtype 10), indicating the abundance of these cell types as determined by RTCD analysis (Cable et al., 2022, Nat. Biotechnol.40, 517–526). Figure 12B depicts corresponding UMAP plots showing the spatial distribution of transcriptomes generated using 10X Visium (Sziraki et al., 2023, Nat. Genet.55, 2104–2116), also colored by cell type weight for the same cell types as in panel (Figure 12A).

[0031] Figure 13A through Figure 13D depict data demonstrating the age-associated changes in region-specific gene expression programs. Figure 13A provides bar charts depicting the number of genes differentially expressed (DE) between adult and aged animals across various brain regions, categorized as upregulated (red) and downregulated (blue). DE genes are defined by more than three-fold changes between the ages with an FDR-adjusted p-value < 0.05. 9Figure 13B depicts a heatmap showing the log2-transformed fold changes in normalized gene expression between aged and adult animals for DE genes across different brain regions, distinguishing shared changes (left) from region-specific changes (right). Figure 13C depicts barplots showing the scaled expression and standard error of gene modules related to interferon response across brain regions in both adult (blue) and aged (red) conditions. Gene inclusion for each module is detailed in panel (Figure 13B). Expression values for each pathway were calculated by aggregating and normalizing pathway-related gene expressions, followed by log transformation and scaling. Figure 13D provides reconstructed spatial maps display the expression levels of gene modules associated with the complement and interferon response pathways in adults (top) and aged animals (bottom) for Sections 2 (left) and 3 (right).

[0032] Figure 14A through Figure 14F depict data demonstrating the region-specific gene expression changes in aging. Figure 14A depicts a barplot displaying the distribution of down-regulated (top) and up-regulated (bottom) DE genes across regions, highlighting genes consistently altered in more than ten brain regions, grouped by pathway. Figure 14B depicts a volcano plot showing differentially expressed genes in the ventricles of Section 3 when comparing aged versus adult samples, with significant changes highlighted in red. Figure 14C depicts scatter plots comparing the alterations in differentially expressed genes between ventricle regions from Sections 2 and 3, including a linear regression line. Only DE genes that are identified in both sections are shown. Figure 14D depicts representative heatmaps of neuronal- related downregulated genes (left) and downregulated genes involved in smooth muscles (right). Figure 14E depicts representative heatmaps of interferon-related upregulated genes (left) and globally upregulated immune-related genes (right). Figure 14F depicts representative aging- associated genes displaying similar upregulation or downregulation patterns in the 10X Visium adult and aging dataset.

[0033] Figure 15 depicts cell type-specific expression patterns of interferon-related genes during aging. Shown are aggregated and normalized counts of interferon pathway-related genes showing enrichment in ependymal cells.

[0034] Figure 16A through Figure 16J depict data demonstrating the age-associated changes in region-specific cell type abundance and cell-cell interactions. Figure 16A depicts an overview of the approach used to identify region-specific cellular depletion or expansion associated with aging, and to analyze cell-cell interaction dynamics. Figure 16B depicts a scatter 10plot illustrating the number of cell types across different brain regions showing differential abundance between adult and aged animals. Increases are shown in orange and decreases in blue. Differentially abundant cells were defined by a 1.5-fold change with an FDR < 1e-5. Figure 16C depicts a heatmap showing the fold change in key aging-associated cell types across different brain regions. Figure 16D depicts an illustration demonstrating both global (Sziraki et al.) and region-specific changes (IRISeq) in various cell populations with aging. Significant changes are highlighted to show how specific cell types respond to aging in different brain regions, providing insights into the cellular dynamics associated with the aging process. Figure 16E depicts spatial plots depicting DAM microglia, and DAM microglia-associated gene localization in the white matter regions of Secion-3. Figure 16F depicts a volcano plot showing significant enrichment and depletion of cell-cell interaction changes in aged versus adult white matter, across two anatomically distinct white matter regions in sections 2 and 3, highlighting significantly changed cell-cell interactions in aging. Figure 16G depicts representative spatial maps depicting white matter regions in two sections from the adult and aged brain. The top panels show representative maps of white matter regions from adult brains and the bottom panels from aged brains. The middle panels display beads indicating colocalization of reactive oligodendrocytes and DAM. The last panels show beads with both reactive oligodendrocytes and activated astrocytes. Figure 16H depicts a histogram illustrating the null distribution of beads with both cell types assuming random distribution, with a dashed line marking the observed number. Figure 16I depicts volcano plots comparing gene expression in beads with or without DAM in the white matter of Section 3, highlighting the top differentially expressed genes.

[0035] Figure 17A through Figure 17F depict data demonstrating the region-specific alterations of cellular abundance in brain aging. Figure 17A depicts RCTD output probability score for DAM microglia (Non-binarized) across different regions. Figure 17B depicts RCTD probability score for DAM microglia and reactive oligodendrocytes (Non-binarized) across two section-3 adult and aging reconstructed spatial sections. Figure 17C depicts a display of the distribution of DAM, reactive oligodendrocytes, and activated astrocytes, colored by their relative abundance from RTCD analysis that integrates Visium data (Sziraki et al., 2023, Nat. Genet.55, 2104–2116) with the single-cell transcriptome atlas, shown for both adult and aged samples. Figure 17D depicts a display of the distribution of interactions among reactive oligodendrocytes and DAM, reactive oligodendrocytes and activated astrocytes, and DAM and 11activated astrocyte utilizing Visium data (Sziraki et al., 2023, Nat. Genet.55, 2104–2116) with the single-cell transcriptome atlas, shown for both adult and aged samples. Figure 17E depicts a histogram illustrating the null distribution of beads with both reactive oligodendrocytes and activated astrocytes assuming random distribution, with a dashed line marking the observed number. Figure 17F depicts a heatmap showing the normalized gene expression in DAM, reactive oligodendrocytes, activated astrocytes, and the corresponding main cell types.

[0036] Figure 18A through Figure 18G depict data demonstrating that IRISeq Reveals Lymphocyte-Dependent Shifts in Aging-Associated Interferon Gene Signatures in Immune- Deficient Brains. Figure 18A and Figure 18B depict the study design and UMAP analysis. Figure 18A depicts a schematic of the study design, showing the number of replicates per genotype, anatomical locations in coronal sections (top panel), and corresponding regional annotations (bottom panel). Figure 18B depicts UMAP visualization of gene expression (top panels) and bead-based expression overlap between mutant and wild-type (WT) mouse brains (bottom panel). Figure 18C depicts spatial reconstruction and clustering: Spatially reconstructed brain sections with clustered regions mapped. Figure 18D depicts differential gene expression analysis: Number of genes upregulated or downregulated across different identified regions (Mutants vs. WT). Figure 18E depicts a volcano plot: Log2 fold-change (Log2FC) of genes, highlighting key upregulated and downregulated genes in both mutants. Red-marked genes indicate shared downregulated genes between both mutants. Figure 18F depicts interferon gene expression patterns: Heatmap showing interferon gene expression levels in mutants compared to WT, alongside a bar plot representing aggregated gene expression levels normalized across different regions. Figure 18G depicts spatial expression of interferon genes: Aggregated interferon gene expression mapped onto spatially reconstructed arrays, with ventricles highlighted to indicate anatomical landmarks.

[0037] Figure 19A through Figure 19C depict data demonstrating an IRISeq immunodeficiency brain quality control analysis. Figure 19A depicts the number of beads across sections, and replicates. Figure 19B depicts the number of UMI’s per receiver bead across replicates. Figure 19C provides a heatmap depicting upregulated genes across both mutants.

[0038] Figure 20A through Figure 20O depict data demonstrating identification of cell- type-specific gene expression and population changes in immune-deficient brains. Figure 20A depicts a scatter plot of the number of cells profiled per sample across brain regions, colored by 12genotype. Figure 20B depicts a UMAP projection of all brain cells, colored by annotated major cell types. Figure 20C depicts a differential expression (DE) analysis identifying cell-type- specific DE genes in each mutant compared to wild-type. The scatter plot demonstrates a strong concordance of DE genes between the two mutants. Figure 20D depicts a dot plot showing significantly enriched pathways among the upregulated and downregulated DE genes shared by both mutants. Figure 20E depicts a scatter plot illustrating the high consistency of immune cell- specific DE genes across both mutants. Figure 20F depicts a UMAP plot of immune cells, colored by annotated immune cell subtypes. Figure 20G depicts a heatmap of the relative expression of cell-type–specific marker genes across immune subtypes. Expression is aggregated for each cell type, normalized by library size, and log-transformed. Figure 20H depicts density plots of mutant-depleted (top) and mutant-enriched (bottom) immune cell states identified by Milo. Figure 20I depicts a UMAP plot, (as in Figure 20F), colored by normalized expression of Dhcr7 (top) and Tmtc2 (bottom). Figure 20J depicts a scatter plot showing the consistent changes in cell populations for both mutants in the hippocampal section (section 3), with top- changed cell types labeled. Figure 20K depicts a box plot illustrating the decreased proportion of ependymal cells using data from a published brain aging atlas. Figure 20L depicts a bar plot showing the deconvoluted proportion of ependymal cells across different brain regions in the IRISeq spatial dataset, with error bars representing standard error. Figure 20M depicts a bar plot of the normalized aggregated expression of interferon response genes (Oasl2, Ifit3b, Ift3, Isg15, Bst2, Rtp4) across genotypes, with error bars representing standard error. Figure 20N depicts a volcano plot highlighting differentially expressed genes in immune-deficient brains. Figure 20O depicts a bar plot showing enriched pathways among the downregulated genes in ependymal cells from immune-deficient brains.

[0039] Figure 21A and Figure 21B depict data demonstrating the quality metrics for single-cell analysis of immune-deficient mouse brains. Figure 21A depicts box plots illustrating the distribution of unique molecular identifiers (UMIs) per cell in each sampled brain region (Section-1, Section-2, Section-3, and other regions). Figure 21B depicts UMAP projections of single-cell transcriptomes, as in Figure 20B, with cells colored by genotype (WT, Rag1, Prkdc) on the left and by sampled brain regions on the right.

[0040] Figure 22 depicts data demonstrating the cross-reference of cell type annotations from this study with predicted cell classes from the Allen Brain Atlas. Each column represents a 13cell type annotated in the dataset, and each row corresponds to a major cell class defined in the Allen Brain Atlas. The heatmap color scale (ranging from 0 to 1) indicates the fraction of cells in each annotated type that were predicted to belong to each Allen cell class. Rows and columns are hierarchically clustered to highlight similarities across annotations.

[0041] Figure 23 depicts data demonstrating the cross-reference of cell type annotations from this study with predicted cell types from the Allen Brain Atlas. Each column represents a cell type annotated in the dataset, and each row corresponds to a cell type defined in the Allen Brain Atlas. The heatmap color scale (ranging from 0 to 1) indicates the fraction of cells in each annotated type that were predicted to belong to each Allen cell type. Rows and columns are hierarchically clustered to highlight similarities across annotations.

[0042] Figure 24 depicts data demonstrating the cross-reference of cell type annotations from this study with predicted cell types from the Brain aging atlas. Each column represents a cell type annotated in the dataset, and each row corresponds to a cell type defined in the brain aging atlas. The heatmap color scale (ranging from 0 to 1) indicates the fraction of cells in each annotated type that were predicted to belong to each cell type in the brain aging atlas. Rows and columns are hierarchically clustered to highlight similarities across annotations.

[0043] Figure 25A and Figure 25B depict data demonstrating ependymal cell state and population changes in immune-deficient brains. Figure 25A depicts a box plot comparing the proportion of ependymal cells in the hippocampal section (Section-3) of wild-type and immune- deficient (Rag1, Prkdc) brains, colored by genotype. Figure 25B depicts bar plots showing normalized expression levels of Sspo, C3, and Ube2w in ependymal cells (Section-3) across genotypes. Error bars represent standard error.

[0044] Figure 26 shows an example of a photocleavable linker that can be incorporated into the oligonucleotides of the sender beads. DETAILED DESCRIPTION

[0045] The present invention relates generally to a novel method, IRIS (Imaging Reconstruction using Indexed Sequencing), that enables spatial reconstruction solely through sequencing and without the need for a priori or a posteriori indexing processes. The core principle of IRIS is that neighboring beads in physical space exhibit the same connection 14barcodes, reflecting their spatial coherence. Definitions

[0046] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described.

[0047] As used herein, each of the following terms has the meaning associated with it in this section.

[0048] The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.

[0049] “About” as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20% or ±10%, more preferably ±5%, even more preferably ±1%, and still more preferably ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods.

[0050] Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range. Description

[0051] In some embodiments, the invention provides new methods for high-spatial- resolution, unbiased, transcriptional mapping in intact tissues, which does not require sophisticated imaging but can instead capitalize on the power of high-throughput Next 15Generation Sequencing (NGS). The present invention relates to compositions and methods for performing IRIS.

[0052] In some embodiments, the optimized IRIS (Imaging Reconstruction using Indexed Sequencing) protocol follows the steps outlined in Figure 1A: (i) Bead Preparation: Oligo-barcoded beads are prepared in two types - 'receiver beads' coated with PolyT sequences to capture nearby cellular mRNA and 'sender beads' with a photocleavable linker, a unique barcode, and a PolyA sequence. (ii) Tissue Transfer and mRNA Capture: These beads are mixed together on a glass slide to form a monolayer. Frozen tissue sections are transferred onto the semi wet beads with hybridization buffer surface via cryosectioning. The mRNA from the tissue is then captured by the receiver beads through hybridization. (iii) Photocleavage and Oligo Capture: Photocleavage is then performed allowing the oligo attached to the sender beads to diffuse and be captured in a manner akin to tissue mRNA by the receiver beads. (iv) Reverse Transcription and Sequencing: Captured oligos undergo reverse transcription and PCR, followed by sequencing to retrieve transcriptome data and bead connection details. In one embodiment these barcoded beads are created through split-pool ligation. Sender Beads

[0053] In some embodiments, the composition comprises at least one set of barcoded sender beads, wherein each sender bead comprises a plurality of nucleic acid molecules comprising a) a photocleavable linker, b) a primer sequence between the photocleavable linker sequence and the barcode sequence for sequencing library preparation, c) a bead-specific barcode sequence, d) a unique molecular identifier sequence (or UMI), and e) a capture sequence for binding to a receiver bead, wherein the photocleavable linker is positioned between the bead and the primer sequence such that cleavage of the linker results in the separation of the fragment of the nucleic acid molecule comprising the primer / barcode sequence / UMI / capture sequence from the sender bead. In some embodiments, the capture sequence comprises a poly-A sequence.

[0054] A barcode sequence is a unique sequence that can be used to distinguish a barcoded polynucleotide in a biological sample from other barcoded polynucleotides in the same biological sample. The concept of “barcodes” and appending barcodes to nucleic acids and other proteinaceous and non-proteinaceous materials is known to one of ordinary skill in the art (see, e.g., Liszczak G et al. Angew Chem Int Ed Engl.2019 Mar 22;58(13):4144-4162). 16

[0055] The length of a barcode sequence may vary. For example, a barcode sequence may have a length of 5 to 50 nucleotides (e.g., 5 to 40, 5 to 30, 5 to 20, 5 to 10, 10 to 50, 10 to 40, 10 to 30, or 10 to 20 nucleotides). In some embodiments, a barcode sequence may have a length of 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides. Longer barcode sequences are also contemplated herein.

[0056] In some embodiments, the polynucleotides of the sender bead set are coded with a specific set of barcode sequences and UMIs, while the polynucleotides of the receiver beads are coded with a different set of barcode sequences and UMIs. Photocleavage of the sender bead set and capture of the released fragments by receiver beads in close proximity to the sender beads, and subsequent amplification, library preparation and sequencing of captured target molecules in combination with the amplification products generated from the sender / receiver capture provides proximity data for the receiver beads which can be used to generate a spatial map of the captured target molecules.

[0057] The length of a UMI may vary. For example, a UMI sequence may have a length of 5 to 50 nucleotides (e.g., 5 to 40, 5 to 30, 5 to 20, 5 to 10, 10 to 50, 10 to 40, 10 to 30, or 10 to 20 nucleotides). In some embodiments, a UMI sequence may have a length of 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides. Longer UMI sequences are also contemplated herein.

[0058] In some embodiments, the photocleavable linker is a photo-sensitive chemical bond (e.g., a chemical bond that dissociates when exposed to light such as ultraviolet light). Cleaving capture probes in an area on the array that is outside of a biological sample (e.g., not covered by the biological sample) can increase the sensitivity and / or efficiency of an assay by preventing analytes and / or probes from being captured on an area of the array outside of where the biological sample is disposed (e.g., not covered by the biological sample). When a photocleavable linker is present, the cleavage reaction is triggered by light, and can be highly selective to the linker and consequently biorthogonal. Typically, wavelength absorption for the photocleavable linker is located in the near-UV range of the spectrum. In some embodiments, the absorption wavelength of the photocleavable linker is from about 100 nm to about 600 nm, from about 250 nm to about 400 nm, from about 300 nm to about 350 nm, or from about 310 nm to about 365 nm. In some embodiments, the absorption wavelength of the photocleavable linker is about 100 nm, about 150 nm, about 200 nm, about 225 nm, about 250 nm, about 275 nm, about 300 nm, about 312 nm, about 325 nm, about 330 nm, about 340 nm, about 345 nm, about 17355 nm, about 365 nm, about 400 nm, about 450 nm, about 500 nm, about 550 nm, or about 600 nm.

[0059] Non-limiting examples of a photo-sensitive chemical bond that can be used in a photocleavable linker include those described in Leriche et al. Bioorg Med Chem.2012 Jan 15;20(2):571-82, US Publication No.2017 / 0275669, WO 2020 / 123305, WO 2020 / 123311, WO 2020 / 123309, WO 2020 / 123317, WO 2020 / 198071, US 20200277663 Al, WO 2020 / 047007, WO 2020 / 047004, WO 2020 / 047002, WO 2020 / 047005, WO 2020 / 047010, WO 2020 / 123318, WO 2020 / 190509, WO 2020 / 123301, WO 2020 / 176788, WO 2020 / 123320, and WO 2020 / 123319, each of which are incorporated by reference herein in their entireties. For example, photocleavable linkers that comprise photosensitive chemical bonds include, but are not limited to, bromodeoxyuridine (BrdU), 3-amino-3-(2-nitrophenyl)propionic acid (ANP), orthonitrobenzyl (ONB), phenacyl ester derivatives, 8-quinolinyl benzenesulfonate, dicoumarin, 6-bromo-7-alkixycoumarin-4-ylmethoxy carbonyl, a bimane-based linker, and a bis- arylhydrazone based linker. In some embodiments, the photocleavable linker comprises the structure shown in Figure 26. Receiver Beads

[0060] In some embodiments, the composition comprises at least one set of barcoded receiver beads, wherein each receiver bead comprises a plurality of nucleic acid molecules comprising a) a primer sequence between the bead and the barcode sequence for sequencing library preparation, b) a bead-specific barcode sequence, c) a unique molecular identifier sequence (or UMI), and d) a capture sequence for binding to a target molecule of interest (e.g. DNA, RNA, mRNA, miR, etc.). In some embodiments, the capture sequence for binding to a target molecule of interest is also used to capture nucleic acid molecule fragments released from the sender beads following cleavage of the linker. In some embodiments, the receiver bead further comprises an additional capture sequence for binding to nucleic acid molecule fragments released from the sender beads following cleavage of the linker. In some embodiments, the capture sequence comprises a poly-T sequence. In some embodiments, the capture sequence comprises a plurality of random nucleotide sequences. 18Solid Supports

[0061] In some embodiments, the present disclosure provides a method for generating and using a set of sender and receiver microbeads to perform expression profiling of tissue samples, with high resolution. The method can include the steps of (a) attaching different nucleic acid probes to beads that are then captured upon a solid support to produce randomly located probe-possessing sender and receiver beads on the solid support, wherein the different nucleic acid probes each includes a barcode sequence, a UMI sequence or a combination thereof, and wherein each of the randomly located beads includes a different barcode sequence, UMI sequence or combination thereof from other randomly located beads on the solid support; (b) contacting a biological specimen with the solid support that has the randomly located sender and receiver beads; (c) hybridizing the probes presented by the randomly located receiver beads to (i) target nucleic acids from portions of the biological specimen that are proximal to the randomly located receiver beads and (ii) to probes presented by any randomly located sender beads that are proximal to the randomly located receiver beads; (d) releasing the probes from the randomly located sender beads by photocleavage of a photocleavable linker, (e) collecting the receiver beads and preparing a library of nucleic acid molecules for sequencing and (f) generating a gene expression matrix and a bead cluster matrix, using the barcodes and UMI from the hybridization of probes from proximal sender and receiver beads, which are combined to generate a spatial map of the target nucleic acids.

[0062] Any of a variety of solid supports can be used in a method, composition or apparatus of the present disclosure. Particularly useful solid supports are those used for nucleic acid arrays. Examples include glass, modified glass, functionalized glass, inorganic glasses, microspheres (e.g. inert and / or magnetic particles), plastics, polysaccharides, nylon, nitrocellulose, ceramics, resins, silica, silica-based materials, carbon, metals, an optical fiber or optical fiber bundles, polymers and multiwell (e.g. microtiter) plates. Exemplary plastics include acrylics, polystyrene, copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes and Teflon™. Exemplary silica-based materials include silicon and various forms of modified silicon.

[0063] In particular embodiments, a solid support can be within or part of a vessel such as a well, tube, channel, cuvette, Petri plate, bottle or the like. Optionally, the vessel is a well in a multiwell plate or microtiter plate. 19

[0064] In certain embodiments, a solid support can include a gel coating. Attachment, e.g., of nucleic acids to a solid support via a gel is exemplified by flow cells available commercially from Illumina Inc. (San Diego, Calif.) or described in US Pat. App. Pub. Nos. 2011 / 0059865 A1, 2014 / 0079923 A1, or 2015 / 0005447 A1; or PCT Publ. No. WO 2008 / 093098, each of which is incorporated herein by reference. Exemplary gels that can be used in the methods and apparatus set forth herein include, but are not limited to, those having a colloidal structure, such as agarose; polymer mesh structure, such as gelatin; or cross-linked polymer structure, such as polyacrylamide, SFA (see, for example, US Pat. App. Pub. No. 2011 / 0059865 A1, which is incorporated herein by reference) or PAZAM (see, for example, US Pat. App. Publ. Nos.2014 / 0079923 A1, or 2015 / 0005447 A1, each of which is incorporated herein by reference).

[0065] In some embodiments, a solid support can be configured as an array of features to which beads can be attached. The features can be present in any of a variety of desired formats. For example, the features can be wells, pits, channels, ridges, raised regions, pegs, posts or the like. In some embodiments, wells of a substrate can include gel material (with or without beads) as set forth in US Pat. App. Publ. No.2014 / 0243224 A1, which is incorporated herein by reference.

[0066] Features can appear on a solid support as a grid of spots or patches. The features can be located in a repeating pattern or in an irregular, non-repeating pattern. Optionally, repeating patterns can include hexagonal patterns, rectilinear patterns, grid patterns, patterns having reflective symmetry, patterns having rotational symmetry, or the like. Asymmetric patterns can also be useful. The pitch of an array can be the same between different pairs of nearest neighbor features or the pitch can vary between different pairs of nearest neighbor features.

[0067] In particular embodiments, features on a solid support can each have an area that is larger than about 100 nm2, 250 nm2, 500 nm2, 1 μm2, 2.5 μm2, 5 μm2, 10 μm2or 50 μm2. Alternatively or additionally, features can each have an area that is smaller than about 50 μm2, 25 μm2, 10 μm2, 5 μm2, 1 μm2, 500 nm2, or 100 nm2. The preceding ranges can describe the apparent area of a bead or other particle on a solid support when viewed or imaged from above. 20Beads

[0068] Certain aspects of the instant disclosure employ a collection of beads or other particles, to which oligonucleotides are attached. Suitable bead compositions include those used in peptide, nucleic acid and organic moiety synthesis, including, but not limited to, plastics, ceramics, glass, polystyrene, methylstyrene, acrylic polymers, paramagnetic materials, thoriasol, carbon graphite, titanium dioxide, latex or cross-linked dextrans such as Sepharose, cellulose, nylon, cross-linked micelles and Teflon may all be used. “Microsphere Detection Guide” from Bangs Laboratories, Fishers Ind. is a helpful guide, which is incorporated herein by reference in its entirety. The beads need not be spherical; irregular particles may be used. In addition, the beads may be porous, thus increasing the surface area of the bead available for either capture probe attachment or tag attachment. The bead sizes can range from nanometers, for example, 100 nm, to millimeters, for example, 1 mm, with beads from about 0.2 μm to about 200 μm commonly employed, and from about 5 to about 20 μm being within the range currently exemplified, although in some embodiments smaller or larger beads may be used.

[0069] The particles can be randomly arrayed upon the surface of a solid support (e.g., a glass slide). Art-recognized examples of arrays having beads located on a surface include those wherein beads are located in wells such as a BeadChip array (Illumina Inc., San Diego Calif.), substrates used in sequencing platforms from 454 LifeSciences (a subsidiary of Roche, Basel Switzerland) or substrates used in sequencing platforms from Ion Torrent (a subsidiary of Life Technologies, Carlsbad Calif.). Other solid supports having beads located on a surface are described in U.S. Pat. Nos.6,266,459; 6,355,431; 6,770,441; 6,859,570; 6,210,891; 6,258,568; or 6,274,320; US Pat. App. Publ. Nos.2009 / 0026082 A1; 2009 / 0127589 A1; 2010 / 0137143 A1; or 2010 / 0282617 A1 or PCT Publication No. WO 00 / 63437, each of which is incorporated herein by reference. Several of the above references describe methods for attaching nucleic acid probes to beads prior to loading the beads in or on a solid support. As such, the collection of beads can include different beads each having a unique (or sufficiently unique and / or near- unique) probe attached. It will however, be understood that the beads can be made to include universal primers. and the beads can then be loaded onto an array for use in a method set forth herein. The solid supports typically used for bead arrays can be used without beads. For example, nucleic acids, such as probes or primers can be attached directly to the wells or to gel material in wells. Thus, the above references are illustrative of materials, compositions or apparatus that can 21be modified for use in the methods and compositions set forth herein.

[0070] Accordingly, the instant methods can employ an array of beads, wherein different nucleic acid probes are attached to different beads in the array. In this embodiment, each bead can be attached to a different nucleic acid probe and the beads can be randomly distributed on the solid support in order to effectively attach the different nucleic acid probes to the solid support. Optionally, the solid support can include wells having dimensions that accommodate no more than a single bead. In such a configuration, the beads may be attached to the wells due to forces resulting from the fit of the beads in the wells. As described elsewhere herein, it is also possible to use attachment chemistries or capture materials (e.g., liquid electrical tape) to adhere or otherwise stably associate the beads with a solid support, optionally including holding the beads in wells that may or may not be present on a solid support.

[0071] Nucleic acid probes that are attached to beads can include barcode sequences. A population of the beads can be configured such that each bead is attached to a barcode and many different beads each with a different barcode are present in the population. In this embodiment, randomly distributing the beads to a solid support will result in randomly locating the nucleic acid probe-presenting beads (and their respective barcode sequences) on the solid support. In some cases, there can be multiple beads with the same barcode sequence such that there is redundancy in the population. However, randomly distributing a redundancy-comprising population of beads on a solid support—especially one that has a capacity that is greater than the number of unique barcodes in the bead population—will tend to result in redundancy of barcodes on the solid support, which will tend to reduce image resolution in the context of the instant disclosure (i.e., where the precise location of a barcoded bead cannot be resolved due to redundancy of barcode use within an arrayed population of beads, it is contemplated that such redundant locations will simply be eliminated during data analysis. Alternatively, the number of different barcodes in a population of beads can exceed the capacity of the solid support in order to produce an array that is not redundant with respect to the population of barcodes on the solid support. The capacity of the solid support will be determined in some embodiments by the number of features (e.g. single-bead occupancy wells) that attach or otherwise accommodate a bead.

[0072] A bead or other nucleic acid-presenting solid support of the instant disclosure can include, or can be made by the methods set forth herein to attach, a plurality of different nucleic 22acid probes. For example, a bead or other nucleic acid-presenting solid support can include at least 10, 100, 1×103, 1×104, 1×105, 1×106, 1×107, 1×108, 1×109or more different probes. Alternatively or additionally, a bead or other nucleic acid-presenting solid support can include at most 1×109, 1×10 , 1×10 , 1×10 , 1×10 , 1×10 , 1×10 , 100, or fewer different probes. It will be understood that each of the different probes can be present in several copies, for example, when the probes have been amplified to form a cluster. Thus, the above ranges can describe the number of different nucleic acid clusters on a bead or other nucleic acid-presenting solid support of the instant disclosure. It will also be understood that the above ranges can describe the number of different barcodes, target capture sequences, or other sequence elements set forth herein as being unique (or sufficiently unique) to particular nucleic acid probes. Alternatively or additionally, the ranges can describe the number of extended probes or modified probes created on a bead or other nucleic acid-presenting solid support of the instant disclosure using a method set forth herein.

[0073] Features may be present on a bead or other solid support of the instant disclosure prior to contacting the bead or other solid support with nucleic acid probes. For example, in embodiments where probes are attached to a bead or other solid support via hybridization to primers, the primers can be attached at the features, whereas interstitial areas outside of the features substantially lack any of the primers. Nucleic acid probes can be captured at preformed features on a bead or other solid support, and optionally amplified on the bead or other solid support, e.g., using methods set forth in U.S. Pat. Nos.8,895,249 and 8,778,849 and / or U.S. Patent Publication No.2014 / 0243224 A1, each of which is incorporated herein by reference. Alternatively, a bead or other solid support may have a lawn of primers or may otherwise lack features. In this case, a feature can be formed by virtue of attachment of a nucleic acid probe on the bead or other solid support. Optionally, the captured nucleic acid probe can be amplified on the bead or other solid support such that the resulting cluster becomes a feature. Although attachment is exemplified above as capture between a primer and a complementary portion of a probe, it will be understood that capture moieties other than primers can be present at pre-formed features or as a lawn. Other exemplary capture moieties include, but are not limited to, chemical moieties capable of reacting with a nucleic acid probe to create a covalent bond or receptors capable of binding non-covalently to a ligand on a nucleic acid probe.

[0074] A step of attaching nucleic acid probes to a bead or other solid support can be 23carried out by providing a fluid that contains a mixture of different nucleic acid probes and contacting this fluidic mixture with the bead or other solid support. The contact can result in the fluidic mixture being in contact with a surface to which many different nucleic acid probes from the fluidic mixture will attach. Thus, the probes have random access to the surface (whether the surface has pre-formed features configured to attach the probes or a uniform surface configured for attachment). Accordingly, the probes can be randomly located on the bead or other solid support.

[0075] The total number and variety of different probes that end up attached to a surface can be selected for a particular application or use. For example, in embodiments where a fluidic mixture of different nucleic acid probes is contacted with a bead or other solid support for purposes of attaching the probes to the support, the number of different probe species can exceed the occupancy of the bead or other solid support for probes. Thus, the number and variety of different probes that attach to the bead or other solid support can be equivalent to the probe occupancy of the bead or other solid support.

[0076] Alternatively, the number and variety of different probe species on the bead or other solid support can be less than the occupancy (i.e. there will be redundancy of probe species such that the bead or other solid support may contain multiple features having the same probe species). Such redundancy can be achieved, for example, by contacting the bead or other solid support with a fluidic mixture that contains a number and variety of probe species that is substantially lower than the probe occupancy of the bead or other solid support.

[0077] Attachment of the nucleic acid probes can be mediated by hybridization of the nucleic acid probes to complementary primers that are attached to the bead or other solid support, chemical bond formation between a reactive moiety on the nucleic acid probe and the bead or other solid support (examples are set forth in U.S. Pat. Nos.8,895,249 and 8,778,849, and in U.S. Patent Publication No.2014 / 0243224 A1, each of which is incorporated herein by reference), affinity interactions of a moiety on the nucleic acid probe with a bead- or other solid support-bound moiety (e.g. between known receptor-ligand pairs such as streptavidin-biotin, antibody-epitope, lectin-carbohydrate and the like), physical interactions of the nucleic acid probes with the bead or other solid support (e.g. hydrogen bonding, ionic forces, van der Waals forces and the like), or other interactions known in the art to attach nucleic acids to surfaces.

[0078] In some embodiments, attachment of a nucleic acid probe is non-specific with 24regard to any sequence differences between the nucleic acid probe and other nucleic acid probes that are or will be attached to the bead or other solid support. For example, different probes can have a universal sequence that complements surface-attached primers or the different probes can have a common moiety that mediates attachment to the surface. Alternatively, each of the different probes (or a subpopulation of different probes) can have a unique (or sufficiently unique) sequence that complements a unique (or sufficiently unique) primer on the bead or other solid support or they can have a unique (or sufficiently unique) moiety that interacts with one or more different reactive moiety on the bead or other solid support. In such cases, the unique (or sufficiently unique) primers or unique (or sufficiently unique) moieties can, optionally, be attached at predefined locations in order to selectively capture particular probes, or particular types of probes, at the respective predefined locations.

[0079] One or more features on a bead or other solid support can each include a single molecule of a particular probe. The features can be configured, in some embodiments, to accommodate no more than a single nucleic acid probe molecule. However, whether or not the feature can accommodate more than one nucleic acid probe molecule, the feature may nonetheless include no more than a single nucleic acid probe molecule. Alternatively, an individual feature can include a plurality of nucleic acid probe molecules, for example, an ensemble of nucleic acid probe molecules having the same sequence as each other. In particular embodiments, the ensemble can be produced by amplification from a single nucleic acid probe template to produce amplicons, for example, as a cluster attached to the surface.

[0080] A method set forth herein can use any of a variety of amplification techniques. Exemplary techniques that can be used include, but are not limited to, polymerase chain reaction (PCR), rolling circle amplification (RCA), multiple displacement amplification (MDA), or random prime amplification (RPA). In some embodiments the amplification can be carried out in solution, for example, when features of an array are capable of containing amplicons in a volume having a desired capacity. In certain embodiments, an amplification technique used in a method of the present disclosure will be carried out on solid phase. For example, one or more primer species (e.g. universal primers for one or more universal primer binding site present in a nucleic acid probe) can be attached to a bead or other solid support. In PCR embodiments, one or both of the primers used for amplification can be attached to a bead or other solid support (e.g. via a gel). Formats that utilize two species of primers attached to a bead or other solid support are often 25referred to as bridge amplification because double stranded amplicons form a bridge-like structure between the two surface attached primers that flank the template sequence that has been copied. Exemplary reagents and conditions that can be used for bridge amplification are described, for example, in U.S. Pat. Nos.5,641,658; 7,115,400; and 8,895,249; and / or U.S. Patent Publication Nos.2002 / 0055100 A1, 2004 / 0096853 A1, 2004 / 0002090 A1, 2007 / 0128624 A1 and 2008 / 0009420 A1, each of which is incorporated herein by reference. Solid-phase PCR amplification can also be carried out with one of the amplification primers attached to a bead or other solid support and the second primer in solution. An exemplary format that uses a combination of a surface attached primer and soluble primer is the format used in emulsion PCR as described, for example, in Dressman et al., Proc. Natl. Acad. Sci. USA 100:8817-8822 (2003), WO 05 / 010145, or U.S. Patent Publication Nos.2005 / 0130173 A1 or 2005 / 0064460 A1, each of which is incorporated herein by reference.

[0081] Nucleic acid probes that are used in a method set forth herein or present in an apparatus or composition of the present disclosure can include barcode sequences, and for embodiments that include a plurality of different nucleic acid probes, each of the probes can include a different barcode sequence from other probes in the plurality. Barcode sequences can be any of a variety of lengths.

[0082] Longer sequences can generally accommodate a larger number and variety of barcodes for a population. Generally, all probes in a plurality will have the same length barcode (albeit with different sequences), but it is also possible to use different length barcodes for different probes. A barcode sequence can be at least 2, 4, 6, 8, 10, 12, 15, 20 or more nucleotides in length. Alternatively or additionally, the length of the barcode sequence can be at most 20, 15, 12, 10, 8, 6, 4 or fewer nucleotides. Examples of barcode sequences that can be used are set forth, for example in, U.S. Patent Publication No.2014 / 0342921 A1 and U.S. Pat. No. 8,460,865, each of which is incorporated herein by reference.

[0083] A method of the present disclosure can include a step of performing a nucleic acid detection reaction on a bead or other solid support to determine barcode sequences of nucleic acid probes that are located on the bead or other solid support. In many embodiments the probes are randomly located on the bead or other solid support and the nucleic acid detection reaction provides information to locate each of the different probes. Exemplary nucleic acid detection methods include, but are not limited to nucleic acid sequencing of a probe, hybridization of 26nucleic acids to a probe, ligation of nucleic acids that are hybridized to a probe, extension of nucleic acids that are hybridized to a probe, extension of a first nucleic acid that is hybridized to a probe followed by ligation of the extended nucleic acid to a second nucleic acid that is hybridized to the probe, or other methods known in the art such as those set forth in U.S. Pat. No. 8,288,103 or 8,486,625, each of which is incorporated herein by reference.

[0084] A method of the present disclosure can include a step of contacting a biological specimen (e.g., a tissue sample) with a bead or other solid support that has nucleic acid probes attached thereto. In some embodiments, the nucleic acid probes are randomly located on the bead or other solid support. Bead-Attached Oligonucleotides

[0085] Certain aspects of the instant disclosure employ a nucleotide- or oligonucleotide- adorned bead, where the bead-attached oligonucleotide includes one or more of the following: a linker; an identical sequence for use as a sequencing priming site; a uniform or near-uniform nucleotide or oligonucleotide sequence; a Unique Molecular Identifier which differs for each priming site; an oligonucleotide redundant sequence for capturing polyadenylated mRNAs and priming reverse transcription (i.e., a poly-T sequence); and at least one oligonucleotide barcode which provides an substrate for spatial identification of an individual bead's position within a bead array. Exemplified bead-attached oligonucleotides of the instant disclosure include an oligonucleotide spatial barcode designed to be unique to each bead within a bead array (or at least wherein the majority of such barcodes are unique to a bead within a bead array—e.g., it is expressly contemplated here and elsewhere herein that a bead array possessing only a small fraction of beads (e.g., even up to 10%, 20%, 30% or 40% or more of total beads) having non- unique spatial barcodes (e.g., attributable to a relative lack of degeneracy within the bead population, e.g., due to a probabilistically determinable lack of sequence degeneracy calculated as possible within the bead population, as then compared to the number of sites across which the bead population is ultimately distributed and / or due to an artifact such as non-randomness of bead association occurring during pool-and-split rounds of oligonucleotide synthesis, etc.) could still yield high resolution transcriptome expression images, even while removing (or otherwise adjusting for) any beads that turn out to be redundant in barcode within the array). This spatial barcode provides a substrate for identification. Exemplified receiver bead-attached 27oligonucleotides of the instant disclosure also include a poly-dT sequence; a Unique Molecular Identifier (UMI); a barcode; a common sequence (“PCR priming site”) to enable PCR amplification, and a linker. Exemplified sender bead-attached oligonucleotides of the instant disclosure also include a poly-dA sequence; a Unique Molecular Identifier (UMI); a barcode; a common sequence (“PCR priming site”) to enable PCR amplification, and a photocleavable linker. mRNAs present in the sample bind to poly-dT-presenting bead-attached oligonucleotides on the receiver beads. At steps where mRNA sequence is to be identified, the mRNAs are reverse-transcribed into cDNAs. The barcoded cDNAs can then be amplified in pools for high- throughput mRNA-seq.

[0086] The poly-dA presenting bead-attached oligonucleotides on the sender beads bind to poly-dT-presenting bead-attached oligonucleotides on the receiver beads. Photocleavage of the linker releases the bead bound oligonucleotides from the sender beads. Split-and-pool synthesis

[0087] To generate the cell barcode, the pool of microparticles (here, microbeads) is repeatedly split into four equally sized oligonucleotide synthesis reactions, to which one of the four DNA bases is added, and then pooled together after each cycle for multiple (e.g., at least 12) cycles. The barcode synthesized on any individual bead reflects that bead's unique (or sufficiently unique) path through the series of synthesis reactions. The result is a pool of microparticles, each possessing a unique barcode sequences. Extension of the split-pool process for additional cycles can provide for production of an even greater numbers of possible barcode sequences for use in the compositions and methods of the instant disclosure. Functional use of barcodes does not require complete non-redundancy of spatial barcodes among all beads. Rather, provided that the majority of such barcodes are unique to a bead within a bead array, it is expressly contemplated that a bead array possessing only a small fraction of beads (e.g., even up to 10%, 20%, 30% or 40% or more of total beads) having non-unique spatial barcodes (e.g., attributable to an artifact such as non-randomness of bead association having occurred during pool-and-split rounds of oligonucleotide synthesis, or simply to the likelihood that an array of a million beads derived from a ten million-fold complex library would still be expected to include a number of beads having redundant spatial barcodes in pairwise comparisons) could still yield high resolution transcriptome expression data, where removal or other adjustment (averaging or 28other such adjustment) of any beads that turn out to be redundant in barcode within the array could be performed, e.g., during data analysis.

[0088] Exemplary synthesis of a unique molecular identifier (UMI). Following the completion of the “split-and-pool” synthesis cycles described above for generation of spatial barcodes, all microparticles are together subjected to at least eight rounds of degenerate synthesis with all four DNA bases available during each cycle, such that each individual oligonucleotide receives one of 48(65,536) possible sequences (UMIs). A UMI is thereby provided that allows distinguishing between, e.g., individual bead-attached oligonucleotides upon the same bead which otherwise share a common barcode (being that such oligonucleotides are attached to the same bead and therefore receive the same barcode).

[0089] In some embodiments of the instant disclosure, the linker of a sender bead- attached oligonucleotide is a chemically-cleavable, straight-chain polymer. In some embodiments, the linker is a photolabile optionally substituted hydrocarbon polymer.

[0090] In some embodiments, the linker of a receiver bead-attached oligonucleotide is a non-cleavable, straight-chain polymer. In some embodiments, the linker is a non-cleavable, optionally substituted hydrocarbon polymer. In certain embodiments, the linker is a polyethylene glycol (PEG) linker.

[0091] In some embodiments, the oligonucleotide probe used in a composition or method set forth herein can include a target capture moiety. In particular embodiments, the target capture moiety is a target capture sequence. The target capture sequence is generally complementary to a target sequence such that target capture occurs by formation of a probe-target hybrid complex. In some embodiments, the target capture sequence for the receiver bead comprises a poly-dT sequence. In some embodiments, the target capture sequence for the sender bead comprises a poly-dA sequence.

[0092] In certain embodiments, a plurality of different nucleic acid probes can include different target capture sequences that hybridize to different target nucleic acid sequences from a biological specimen. Different target capture sequences can be used to selectively bind to one or more desired target nucleic acids from a biological specimen.

[0093] Any of a variety of target nucleic acids can be captured and analyzed in a method set forth herein including, but not limited to, messenger RNA (mRNA), copy DNA (cDNA), genomic DNA (gDNA), ribosomal RNA (rRNA) or transfer RNA (tRNA). Particular target 29sequences can be selected from databases and appropriate capture sequences designed using techniques and databases known in the art.

[0094] A method set forth herein can include a step of hybridizing nucleic acid probes, that are on a supported bead array, to target nucleic acids that are from portions of the biological specimen that are proximal to the probes. Generally, a target nucleic acid will flow or diffuse from a region of the biological specimen to an area of the probe-presenting bead array that is in proximity with that region of the specimen. Here the target nucleic acid will interact with nucleic acid probes that are proximal to the region of the specimen from which the target nucleic acid was released. A target-probe hybrid complex can form where the target nucleic acid encounters a complementary target capture sequence on a nucleic acid probe. The location of the target-probe hybrid complex will generally correlate with the region of the biological specimen from where the target nucleic acid was derived. In certain embodiments, the beads will include a plurality of nucleic acid probes, the biological specimen will release a plurality of target nucleic acids and a plurality of target-probe hybrids will be formed on the beads. The sequences of the target nucleic acids and their locations on the bead array will provide spatial information about the nucleic acid content of the biological specimen. Although the example above is described in the context of target nucleic acids that are released from a biological specimen, it will be understood that the target nucleic acids need not be released. Rather, the target nucleic acids may remain in contact with the biological specimen, for example, when they are attached to an exposed surface of the biological specimen in a way that the target nucleic acids can also bind to appropriate nucleic acid probes on the beads.

[0095] A method of the present disclosure can include a step of extending bead-attached probes to which target nucleic acids are hybridized. In embodiments where the probes include barcode sequences, the resulting extended probes will include the barcode sequences and sequences from the target nucleic acids (albeit in complementary form). The extended probes are thus spatially tagged versions of the target nucleic acids from the biological specimen or the sender oligonucleotides. The sequences of the extended probes identify a) what nucleic acids are in the biological specimen and b) where in the receiver bead was in proximity to any sender beads. It will be understood that other sequence elements that are present in the nucleic acid probes can also be included in the extended probes. Such elements include, for example, primer binding sites, cleavage sites, other tag sequences (e.g. sample identification tags), capture 30sequences, recognition sites for nucleic acid binding proteins or nucleic acid enzymes, or the like.

[0096] Extension of probes can be carried out using methods exemplified herein or otherwise known in the art for amplification of nucleic acids or sequencing of nucleic acids. In particular embodiments one or more nucleotides can be added to the 3′ end of a nucleic acid, for example, via polymerase catalysis (e.g. DNA polymerase, RNA polymerase or reverse transcriptase). Chemical or enzymatic methods can be used to add one or more nucleotide to the 3′ or 5′ end of a nucleic acid. One or more oligonucleotides can be added to the 3′ or 5′ end of a nucleic acid, for example, via chemical or enzymatic (e.g. ligase catalysis) methods. A nucleic acid can be extended in a template directed manner, whereby the product of extension is complementary to a template nucleic acid that is hybridized to the nucleic acid that is extended. In some embodiments, a DNA primer is extended by a reverse transcriptase using an RNA template, thereby producing a cDNA. Thus, an extended probe made in a method set forth herein can be a reverse transcribed DNA molecule.

[0097] All or part of a target nucleic acid that is hybridized to a nucleic acid probe can be copied by extension. For example, an extended probe can include at least, 1, 2, 5, 10, 25, 50, 100, 200, 500, 1000 or more nucleotides that are copied from a target nucleic acid. The length of the extension product can be controlled, for example, using reversibly terminated nucleotides in the extension reaction and running a limited number of extension cycles. The cycles can be run as exemplified for SBS techniques and the use of labeled nucleotides is not necessary.

[0098] Accordingly, an extended probe produced in a method set forth herein can include no more than 1000, 500, 200, 100, 50, 25, 10, 5, 2 or 1 nucleotides that are copied from a target nucleic acid. Of course extended probes can be any length within or outside of the ranges set forth above.

[0099] It will be understood that probes used in a method, composition or apparatus set forth herein need not be nucleic acids. Other molecules can be used such as proteins, carbohydrates, small molecules, particles or the like. Probes can be a combination of a nucleic acid component (e.g. having a barcode, primer binding site, cleavage site and / or other sequence element set forth herein) and another moiety (e.g. a moiety that captures or modifies a target nucleic acid).

[0100] A method set forth herein can further include a step of acquiring an image of a 31biological specimen that is in contact with a bead array. The solid support can be in any of a variety of states set forth herein. For example, the bead array can include attached nucleic acid probes or clusters derived from attached nucleic acid probes.

[0101] The number of bead-attached oligonucleotides present upon an individual bead can vary across a wide range, e.g., from tens to thousands, or millions, or more. Due to the transcriptome profiling nature of the instant disclosure, it is generally preferred to pack as many capture oligonucleotides as spatially and sterically (as well as economically) possible onto an individual bead (i.e., thousands, tens of thousands, or more, of oligonucleotides per individual bead), provided that mRNA capture from a contacted tissue is optimized. It is contemplated that optimization of the oligonucleotide-per-bead metric can be readily performed by one of ordinary skill in the art.

[0102] It is further expressly contemplated that in addition to the above-described sequence features, oligonucleotides of the instant disclosure can possess any number of other art- recognized features while remaining within the scope of the instant disclosure. Capture Material

[0103] In certain aspects of the instant disclosure, a capture material is employed to associate a bead array with a solid support (e.g., a glass slide). In some embodiments a liquid capture material such as liquid tape can be applied as a liquid, which then dries to a vinyl polymer that resists dirt, dust, chemicals, and moisture, ensuring that applied beads are attached to a capture material-coated slide in a dry condition. It is contemplated that beads of the instant disclosure can be applied to a capture material-coated solid support, either immediately upon deposit of capture material to the solid support, or following an initial drying period for the capture material. Capture materials of the instant disclosure can be applied by any of a number of methods, including brushed onto the solid support, sprayed onto the solid support, or the like, or via submersion of the solid support in the capture material. For certain forms of liquid capture material, use of a brush top applicator can allow coverage without gaps and can enable access to tight spaces, which offers advantages in certain embodiments over forms of capture material (i.e., tape) that are applied in a non-liquid state.

[0104] Other capture materials are also contemplated, including any art-recognized glue or other reagent that is (a) spreadable and / or depositable upon a solid surface (e.g., upon a slide, 32optionally a slide that allows for light transmission through the slide, e.g., a microscope slide) and (b) capable of binding or otherwise capturing a population of beads of 1-100 μm size. Exemplary other capture materials that are expressly contemplated include latex such as cis-1,4- polyisoprene and other rubbers, as well as elastomers (which are generally defined as polymers that possess viscoelasticity (i.e., both viscosity and elasticity), very weak inter-molecular forces, and generally low Young's modulus and high failure strain compared with other materials), including artificial elastomers (e.g., neoprene) and / or silicone elastomers. Acrylate polymers (e.g., scotch tape) are also expressly contemplated, e.g., for use as a capture material of the instant disclosure. Tissue Samples

[0105] In some embodiments, a tissue section is employed. The tissue can be derived from a multicellular organism. Exemplary multicellular organisms include, but are not limited to a mammal, plant, algae, nematode, insect, fish, reptile, amphibian, fungi or Plasmodium falciparum. Exemplary species are set forth previously herein or known in the art. The tissue can be freshly excised from an organism or it may have been previously preserved for example by freezing, embedding in a material such as paraffin (e.g. formalin fixed paraffin embedded samples), formalin fixation, infiltration, dehydration or the like. Optionally, a tissue section can be cryosectioned, using techniques and compositions as described herein and as known in the art. As a further option, a tissue can be permeabilized and the cells of the tissue lysed. Any of a variety of art-recognized lysis treatments can be used. Target nucleic acids that are released from a tissue that is permeabilized can be captured by nucleic acid probes, as described herein and as known in the art. In some embodiments, the methods comprise delivering to a biological tissue permeabilization reagents (e.g., detergents such as Triton-X 100 or Tween-20).

[0106] A tissue can be prepared in any convenient or desired way for its use in a method, composition or apparatus herein. Fresh, frozen, fixed or unfixed tissues can be used. A tissue can be fixed or embedded using methods described herein or known in the art.

[0107] A tissue sample for use herein, can be fixed by deep freezing at temperature suitable to maintain or preserve the integrity of the tissue structure, e.g. less than −20° C. In another example, a tissue can be prepared using formalin-fixation and paraffin embedding (FFPE) methods which are known in the art. Other fixatives and / or embedding materials can be 33used as desired. A fixed or embedded tissue sample can be sectioned, i.e. thinly sliced, using known methods. For example, a tissue sample can be sectioned using a chilled microtome or cryostat, set at a temperature suitable to maintain both the structural integrity of the tissue sample and the chemical properties of the nucleic acids in the sample. Exemplary additional fixatives that are expressly contemplated include alcohol fixation (e.g., methanol fixation, ethanol fixation), glutaraldehyde fixation and paraformaldehyde fixation.

[0108] In some embodiments, a tissue sample will be treated to remove embedding material (e.g. to remove paraffin or formalin) from the sample prior to release, capture or modification of nucleic acids. This can be achieved by contacting the sample with an appropriate solvent (e.g. xylene and ethanol washes). Treatment can occur prior to contacting the tissue sample with a solid support-captured bead array as set forth herein or the treatment can occur while the tissue sample is on the solid support-captured bead array.

[0109] Exemplary methods for manipulating tissues for use with solid supports to which nucleic acids are attached are set forth in US Pat. App. Publ. No.2014 / 0066318 A1, which is incorporated herein by reference.

[0110] The thickness of a tissue sample or other biological specimen that is contacted with a bead array in a method, composition or apparatus set forth herein can be any suitable thickness desired. In representative embodiments, the thickness will be at least 0.1 μm, 0.25 μm, 0.5 μm, 0.75 μm, 1 μm, 5 μm, 10 μm, 50 μm, 100 μm or thicker. Alternatively or additionally, the thickness of a tissue sample that is contacted with bead array will be no more than 100 μm, 50 μm, 10 μm, 5 μm, 1 μm, 0.5 μm, 0.25 μm, 0.1 μm or thinner.

[0111] In some embodiments, a sample is a biological sample. Non-limiting examples of biological samples include tissues and cells. The biological sample may be adult tissue, embryonic tissue, or fetal tissue, for example. In some embodiments, a biological sample is from a human or other animal. For example, a biological sample may be obtained from a murine (e.g., mouse or rat), feline (e.g., cat), canine (e.g., dog), equine (e.g., horse), bovine (e.g., cow), leporine (e.g., rabbit), porcine (e.g., pig), hircine (e.g., goat), ursine (e.g., bear), or piscine (e.g., fish). Other animals are contemplated herein.

[0112] A particularly relevant source for a tissue sample is a human being. The sample can be derived from an organ, including for example, an organ of the central nervous system such as brain, brainstem, cerebellum, spinal cord, cranial nerve, or spinal nerve; an organ of the 34musculoskeletal system such as muscle, bone, tendon or ligament; an organ of the digestive system such as salivary gland, pharynx, esophagus, stomach, small intestine, large intestine, liver, gallbladder or pancreas; an organ of the respiratory system such as larynx, trachea, bronchi, lungs or diaphragm; an organ of the urinary system such as kidney, ureter, bladder or urethra; a reproductive organ such as ovary, fallopian tube, uterus, vagina, placenta, testicle, epididymis, vas deferens, seminal vesicle, prostate, penis or scrotum; an organ of the endocrine system such as pituitary gland, pineal gland, thyroid gland, parathyroid gland, or adrenal gland; an organ of the circulatory system such as heart, artery, vein or capillary; an organ of the lymphatic system such as lymphatic vessel, lymph node, bone marrow, thymus or spleen; a sensory organ such as eye, ear, nose, or tongue; or an organ of the integument such as skin, subcutaneous tissue or mammary gland. In some embodiments, a tissue sample is obtained from a bodily fluid or excreta such as blood, lymph, tears, sweat, saliva, semen, vaginal secretion, ear wax, fecal matter or urine.

[0113] A sample from a human can be considered (or suspected) healthy or diseased when used. In some cases, two samples can be used: a first being considered diseased and a second being considered as healthy (e.g. for use as a healthy control). Any of a variety of conditions can be evaluated, including but not limited to, an autoimmune disease, cancer, cystic fibrosis, aneuploidy, pathogenic infection, psychological condition, hepatitis, diabetes, sexually transmitted disease, heart disease, stroke, cardiovascular disease, multiple sclerosis or muscular dystrophy. Certain contemplated conditions include genetic conditions or conditions associated with pathogens having identifiable genetic signatures. Target molecules

[0114] In addition to the poly-A-tailed RNAs captured by poly-dT sequences in certain exemplified embodiments of the instant disclosure, it is expressly contemplated that the instant compositions and methods can be applied to obtain spatially-resolvable abundance data for a wide range of macromolecules, including not only poly-A-tailed RNAs / transcripts, but also, e.g., non-poly-A-tailed RNAs (e.g., tRNAs, miRNAs, etc.; optionally specifically captured using sequence-specific oligonucleotide sequences), and DNAs (including, e.g., capture via gene- specific oligonucleotides, loaded transposases, etc.), and proteins (including, e.g., DNA- barcoded antibodies, optionally where a DNA barcode effectively tags a capture antibody for 35detection, allowing for direct comparison of spatial distribution(s) of antibodies and / or antibody- captured proteins with spatially-resolvable expression profiling that also can be performed upon the test sample via use of the compositions and methods of the instant disclosure. Accordingly, the range of target molecules expressly contemplated for capture using the compositions and methods of the instant disclosure includes all forms of RNA (including, e.g., transcripts, tRNAs, rRNAs, miRNAs, etc.), DNAs (including, e.g., genomic DNAs, barcode DNAs, etc.) and proteins (including, e.g., antibodies that are tagged for binding and detection and / or other forms of protein, optionally including proteins captured by antibodies). Tagmentation

[0115] In some embodiments, the cDNA library is modified to include a barcode or tag prior to sequencing. A tag may include, for example, a primer binding site for sequencing. In some embodiments, a tag can include a nucleotide sequence having a length of at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 10 nucleotides, at least 15 nucleotides, at least 20 nucleotides, at least 25 nucleotides, at least 30 nucleotides, at least 35 nucleotides, at least 40 nucleotides, at least 45 nucleotides, at least 50 nucleotides, or 50 nucleotides or greater, or a length within a range of any two of the foregoing lengths. In some embodiments, tagging is performed by tagmentation. As used herein,“tagmentation” can refer to the insertion of transposons into target nucleic acids such that the transposon cleaves the target nucleic acids, and adds adaptor sequences to the ends of the cleaved target nucleic acids. Example methods of tagmentation are disclosed in U.S. Pat. Nos. 9,115,396; 9,080,211 ; 9,040,256; U.S. patent application publication 2014 / 0194324, each of which is incorporated herein by reference in its entirety.

[0116] Transposon based technology can be utilized for fragmenting DNA, for example, as exemplified in the workflow for NEXTERA™ XT and FLEX DNA sample preparation kits (Illumina, Inc.), wherein target nucleic acids, such as genomic DNA, are treated with transposome complexes that simultaneously fragment and tag (tagmentation) the target, thereby creating a population of fragmented nucleic acid molecules tagged with unique adaptor sequences at the ends of the fragments.

[0117] A transposition reaction is a reaction wherein one or more transposons are inserted into target nucleic acids at random sites or almost random sites. Components in a 36transposition reaction include a transposase (or other enzyme capable of fragmenting and tagging a nucleic acid as described herein, such as an integrase) and a transposon element that includes a double-stranded transposon end sequence that binds to the transposase (or other enzyme as described herein), and an adaptor sequence attached to one of the two transposon end sequences. One strand of the double-stranded transposon end sequence is transferred to one strand of the target nucleic acid and the complementary transposon end sequence strand is not (a non- transferred transposon sequence). The adaptor sequence can include one or more functional sequences or components (e.g., primer sequences, universal sequences, spacer regions, or index tag sequences) as needed or desired. Sequencing Methods

[0118] Some of the methods and compositions provided herein employ methods of sequencing nucleic acids. A number of DNA sequencing techniques are known in the art, including fluorescence-based sequencing methodologies (See, e.g., Birren et al, Genome Analysis Analyzing DNA, 1, Cold Spring Harbor, N.Y., which is incorporated herein by reference in its entirety). In some embodiments, automated sequencing techniques understood in that art are utilized. In some embodiments, parallel sequencing of partitioned amplicons can be utilized (PCT Publication No WO2006084132, which is incorporated herein by reference in its entirety). In some embodiments, DNA sequencing is achieved by parallel oligonucleotide extension (See, e.g., U.S. Pat. Nos.5,750,341; 6,306,597, which are incorporated herein by reference in their entireties). Additional examples of sequencing techniques include the Church polony technology (Mitra et al, 2003, Analytical Biochemistry 320, 55-65; Shendure et al, 2005 Science 309, 1728-1732; U.S. Pat. Nos.6,432,360, 6,485,944, 6,511,803, which are incorporated by reference), the 454 picotiter pyrosequencing technology (Margulies et al, 2005 Nature 437, 376-380; US 20050130173, which are incorporated herein by reference in their entireties), the Solexa single base addition technology (Bennett et al, 2005, Pharmacogenomics, 6, 373-382; U.S. Pat. Nos.6,787,308; 6,833,246, which are incorporated herein by reference in their entireties), the Lynx massively parallel signature sequencing technology (Brenner et al. (2000). Nat. Biotechnol.18:630-634; U.S. Pat. Nos.5,695,934; 5,714,330, which are incorporated herein by reference in their entireties), and the Adessi PCR colony technology (Adessi et al. (2000). Nucleic Acid Res.28, E87; WO 00018957, which are incorporated herein by reference in their 37entireties).

[0119] Next-generation sequencing (NGS) methods can be employed in certain aspects of the instant disclosure to obtain a high volume of sequence information (such as are particularly required to perform deep sequencing of bead-associated RNAs following capture of RNAs) in a highly efficient and cost-effective manner. NGS methods share the common feature of massively parallel, high-throughput strategies, with the goal of lower costs in comparison to older sequencing methods (see, e.g., Voelkerding et al, Clinical Chem., 55: 641-658, 2009; MacLean et al, Nature Rev. Microbiol, 7-287-296; which are incorporated herein by reference in their entireties). NGS methods can be broadly divided into those that typically use template amplification and those that do not. Amplification-utilizing methods include pyrosequencing commercialized by Roche as the 454 technology platforms (e.g., GS 20 and GS FLX), the Solexa platform commercialized by Illumina, and the Supported Oligonucleotide Ligation and Detection (SOLiD™) platform commercialized by Applied Biosystems. Non-amplification approaches, also known as single—molecule sequencing, are exemplified by the HeliScope platform commercialized by Helicos Biosciences, SMRT sequencing commercialized by Pacific Biosciences, and emerging platforms marketed by VisiGen and Oxford Nanopore Technologies Ltd.

[0120] In pyrosequencing (U.S. Pat. Nos.6,210,891; 6,258,568, which are incorporated herein by reference in their entireties), template DNA is fragmented, end-repaired, ligated to adaptors, and clonally amplified in-situ by capturing single template molecules with beads bearing oligonucleotides complementary to the adaptors. Each bead bearing a single template type is compartmentalized into a water-in-oil microvesicle, and the template is clonally amplified using a technique referred to as emulsion PCR. The emulsion is disrupted after amplification and beads are deposited into individual wells of a picotitre plate functioning as a flow cell during the sequencing reactions. Ordered, iterative introduction of each of the four dNTP reagents occurs in the flow cell in the presence of sequencing enzymes and luminescent reporter such as luciferase. In the event that an appropriate dNTP is added to the 3′ end of the sequencing primer, the resulting production of ATP causes a burst of luminescence within the well, which is recorded using a CCD camera. It is possible to achieve read lengths greater than or equal to 400 bases, and 106sequence reads can be achieved, resulting in up to 500 million base pairs (Mb) of sequence.

[0121] In the Solexa / Illumina platform (Voelkerding et al, Clinical Chem., 55-641-658, 382009; MacLean et al, Nature Rev. Microbiol, 7:287-296; U.S. Pat. Nos.6,833,246; 7,115,400; 6,969,488, which are incorporated herein by reference in their entireties), sequencing data are produced in the form of shorter-length reads. In this method, single-stranded fragmented DNA is end-repaired to generate 5′-phosphorylated blunt ends, followed by Klenow-mediated addition of a single A base to the 3′ end of the fragments. A-addition facilitates addition of T-overhang adaptor oligonucleotides, which are subsequently used to capture the template-adaptor molecules on the surface of a flow cell that is studded with oligonucleotide anchors. The anchor is used as a PCR primer, but because of the length of the template and its proximity to other nearby anchor oligonucleotides, extension by PCR results in the “arching over” of the molecule to hybridize with an adjacent anchor oligonucleotide to form a bridge structure on the surface of the flow cell. These loops of DNA are denatured and cleaved. Forward strands are then sequenced with reversible dye terminators. The sequence of incorporated nucleotides is determined by detection of post-incorporation fluorescence, with each fluorophore and block removed prior to the next cycle of dNTP addition. Sequence read length ranges from 36 nucleotides to over 50 nucleotides, with overall output exceeding 1 billion nucleotide pairs per analytical run.

[0122] Sequencing nucleic acid molecules using SOLiD technology (Voelkerding et al, Clinical Chem., 55: 641-658, 2009; U.S. Pat. Nos.5,912,148; and 6,130,073, which are incorporated herein by reference in their entireties) can initially involve fragmentation of the template, ligation to oligonucleotide adaptors, attachment to beads, and clonal amplification by emulsion PCR. Following this, beads bearing template are immobilized on a derivatized surface of a glass flow-cell, and a primer complementary to the adaptor oligonucleotide is annealed. However, rather than utilizing this primer for 3′ extension, it is instead used to provide a 5′ phosphate group for ligation to interrogation probes containing two probe-specific bases followed by 6 degenerate bases and one of four fluorescent labels. In the SOLiD system, interrogation probes have 16 possible combinations of the two bases at the 3′ end of each probe, and one of four fluors at the 5′ end. Fluor color, and thus identity of each probe, corresponds to specified color-space coding schemes. Multiple rounds (usually 7) of probe annealing, ligation, and fluor detection are followed by denaturation, and then a second round of sequencing using a primer that is offset by one base relative to the initial primer. In this manner, the template sequence can be computationally re-constructed, and template bases are interrogated twice, resulting in increased accuracy. Sequence read length averages 35 nucleotides, and overall output 39exceeds 4 billion bases per sequencing run.

[0123] In certain embodiments, nanopore sequencing is employed (see, e.g., Astier et al, J. Am. Chem. Soc.2006 Feb.8; 128(5): 1705-10, which is incorporated by reference). The theory behind nanopore sequencing has to do with what occurs when a nanopore is immersed in a conducting fluid and a potential (voltage) is applied across it. Under these conditions a slight electric current due to conduction of ions through the nanopore can be observed, and the amount of current is exceedingly sensitive to the size of the nanopore. As each base of a nucleic acid passes through the nanopore (or as individual nucleotides pass through the nanopore in the case of exonuclease-based techniques), this causes a change in the magnitude of the current through the nanopore that is distinct for each of the four bases, thereby allowing the sequence of the DNA molecule to be determined.

[0124] The Ion Torrent technology is a method of DNA sequencing based on the detection of hydrogen ions that are released during the polymerization of DNA (see, e.g., Science 327(5970): 1190 (2010); U.S. Pat. Appl. Pub. Nos.20090026082, 20090127589, 20100301398, 20100197507, 20100188073, and 20100137143, which are incorporated herein by reference in their entireties). A microwell contains a template DNA strand to be sequenced. Beneath the layer of microwells is a hypersensitive ISFET ion sensor. All layers are contained within a CMOS semiconductor chip, similar to that used in the electronics industry. When a dNTP is incorporated into the growing complementary strand a hydrogen ion is released, which triggers a hypersensitive ion sensor. If homopolymer repeats are present in the template sequence, multiple dNTP molecules will be incorporated in a single cycle. This leads to a corresponding number of released hydrogens and a proportionally higher electronic signal. This technology differs from other sequencing technologies in that no modified nucleotides or optics are used. The per base accuracy of the Ion Torrent sequencer is approximately 99.6% for 50 base reads, with approximately 100 Mb generated per run. The read-length is 100 base pairs. The accuracy for homopolymer repeats of 5 repeats in length is approximately 98%. The benefits of ion semiconductor sequencing are rapid sequencing speed and low upfront and operating costs. Computational Analysis of Receiver:Sender Bead Connections

[0125] Following the sequencing process, computational analysis is performed. In some embodiments, the data from sequencing of the molecules released from the sender beads 40following photocleavage provides data from two proximal beads, namely a receiver bead and a proximal sender bead. Each bead connection includes unique molecular identifiers (UMIs) which help in identifying and quantifying individual connection molecules. Additionally, there are two types of reads: R1, which contains the barcode for the receiver, and R2, which contains the barcodes for the sender bead. The reads are mapped to a list of barcodes with 1 base pair error, including the UMI sequence. Duplicated reads are then filtered, and a file is generated with receiver bead, UMI, and sender bead barcode, where each line represents a unique molecular connection between a receiver bead and a sender bead.

[0126] In some embodiments, filtering is performed to ensure each connection between two beads has a minimum of 10 UMIs, ensuring a sufficient level of data for analysis.

[0127] In some embodiments, after filtering, a matrix is generated where each row represents a receiver bead, and each column represents a sender bead. The values in the matrix correspond to the number of UMIs for each receiver-sender connection.

[0128] In some embodiments, principle component analysis (PCA) is applied to the matrix to reduce the dimensionality of the data while preserving its variance. In some embodiments, before running PCA, an elbow plot is generated to determine the optimal number of principal components. The elbow plot helps identify the point at which the explained variance begins to level off, indicating the most significant components. Approximately 80% of the variance or less is typically chosen for subsequent analysis.

[0129] In some embodiments, following PCA, the PCA matrix of receiver and sender connections is subjected to Uniform Manifold Approximation and Projection (UMAP) to obtain a square-shaped projection, similar to the bead array that was generated. In some embodiments, UMAP is performer using a minimum distance of 0.2 and approximately 20 neighbors. The UMAP Coordinates for each receiver bead are extracted and are used for subsequent mapping of receiver spatial location. Computational Analysis of Captured Target Molecules

[0130] After the sequencing process, the data is obtained in the form of two sets of FASTQ files: R1 and R2. R1 FASTQ files contain the barcode sequences for receiver beads along with their associated Unique Molecular Identifiers (UMIs). R2 FASTQ files contain the sequence data for the captured target molecules. In some embodiments, the R2 FASTQ files 41contain sequence data for tagmented cDNA sequences of captured RNA molecules. The barcode sequences from R1 are mapped to a list of bead barcodes with a tolerance of 1 base pair error. The identified bead barcode is then added as an identifier (ID) for the corresponding sequences in R2.

[0131] New Read2 files are generated where the name of each sequence in R2 contains the corresponding Read1 barcode. Additionally, any PolyA tails present at the end of the sequences are trimmed to ensure accurate mapping and analysis.

[0132] The filtered and trimmed reads are then mapped to the reference genome using a tool such as STAR9 (Spliced Transcripts Alignment to a Reference). This step involves aligning the sequences from R2 to the genomic sequences to identify their locations and potential splice sites.

[0133] After mapping, duplicate reads are identified and removed to eliminate redundant data and ensure accuracy in downstream analysis. This process generates new SAM (Sequence Alignment / Map) files containing the mapped reads with duplicates removed.

[0134] In some embodiments, transcript or gene count matrices are generated for each associated Bead1. This involves counting the number of reads aligned to each gene for every Bead1, providing quantitative information about gene expression levels.

[0135] In some embodiments, the data obtained in the form of bead by gene expression matrices, undergo one or more preprocessing steps. This may include, but is not limited to, quality control checks, normalization, and filtering to remove low-quality cells and genes with low expression levels.

[0136] In some embodiments, at least one dimensionality reduction technique such as principal component analysis (PCA) or non-linear methods like t-distributed stochastic neighbor embedding (t-SNE) and uniform manifold approximation and projection (UMAP) is applied to reduce the high-dimensional gene expression data into lower-dimensional representations. This facilitates the visualization and clustering of cells based on their transcriptional profiles.

[0137] In some embodiments, clustering algorithms are utilized to group receiver bead with similar gene expression profiles into clusters. These clusters represent distinct cell populations within the sample. Additionally, cells within each cluster are annotated based on known cell type markers or differential gene expression analysis, providing insights into the identity and heterogeneity of the cell populations. 42Imaging Reconstruction using Indexed Sequencing

[0138] Utilizing the UMAP spatial coordinates generated from the receiver:sender bead interaction matrices, each receiver bead location is mapped in a spatial context, providing information about its spatial distribution within the sample.

[0139] In some embodiments, a spatial map is generated from the combination of the receiver:sender bead interaction matrix with the gene expression matrix. With spatial barcodes of individual beads identified, and with sequences of those RNAs captured by individual bead- attached oligonucleotides (capture probes) also identified, high-resolution maps of RNA expression can be readily constructed. In certain embodiments, the spatial locations of a receiver bead is assigned to a spatial location based on associations with proximal sender beads using the receiver bead:sender bead matrix and all associated RNA sequence (expression) data associated with the receiver bead is also assigned to that position. High resolution maps representing the extent of capture of individual or grouped RNAs / transcripts across the various spatial positions of the arrays can then be generated using the underlying RNA sequence information (which was at least originally bead-associated). Spatial expression maps or images (i.e., pixel coloring and / or intensities) can be adjusted and / or normalized using any (or any number of) art-recognized technique(s) deemed appropriate by one of ordinary skill in the art.

[0140] In some embodiments, the spatial expression map can be overlaid on an image of the sample. Images can be obtained using detection devices known in the art. Examples include microscopes configured for light, bright field, dark field, phase contrast, fluorescence, reflection, interference, or confocal imaging. A biological specimen can be stained prior to imaging to provide contrast between different regions or cells. In some embodiments, more than one stain can be used to image different aspects of the specimen (e.g. different regions of a tissue, different cells, specific subcellular components or the like). In other embodiments, a biological specimen can be imaged without staining.

[0141] A method set forth herein can include a step of correlating locations in an image of a biological specimen with a spatial expression map generated according to the methods of the invention. Accordingly, characteristics of the biological specimen that are identifiable in the image can be correlated with the nucleic acids that are found to be present in their proximity. Any of a variety of morphological characteristics can be used in such a correlation, including for 43example, cell shape, cell size, tissue shape, staining patterns, presence of particular proteins (e.g. as detected by immunohistochemical stains) or other characteristics that are routinely evaluated in pathology or research applications. Accordingly, the biological state of a tissue or its components as determined by visual observation can be correlated with molecular biological characteristics as determined by spatially resolved nucleic acid analysis.

[0142] A solid support upon which a biological specimen is imaged can include fiducial markers to facilitate determination of the orientation of the specimen or the image thereof in relation to probes that are attached to the solid support. Exemplary fiducials include, but are not limited to beads (with or without fluorescent moieties or moieties such as nucleic acids to which labeled probes can be bound), fluorescent molecules attached at known or determinable features, or structures that combine morphological shapes with fluorescent moieties. Exemplary fiducials are set forth in US Pat. App. Publ. No.2002 / 0150909 A1 or U.S. patent application Ser. No. 14 / 530,299, each of which is incorporated herein by reference. One or more fiducials are preferably visible while obtaining an image of a biological specimen. Preferably, the solid support includes at least 2, 3, 4, 5, 10, 25, 50, 100 or more fiducial markers. The fiducials can be provided in a pattern, for example, along an outer edge of a solid support or perimeter of a location where a biological specimen resides. In one embodiment, one or more fiducials are detected using the same imaging conditions used to visualize a biological specimen. However if desired separate images can be obtained (e.g. one image of the biological specimen and another image of the fiducials) and the images can be aligned to each other. Kits

[0143] The instant disclosure also provides kits containing agents of this disclosure for use in the methods of the present disclosure. Kits of the instant disclosure may include one or more containers comprising a plurality of sender beads, a plurality of receiver beads, or a combination thereof of this disclosure. In some embodiments, the kits further include instructions for use in accordance with the methods of this disclosure. In some embodiments, these instructions comprise a description of a protocol for preparing the sender and receiver beads for spatial transcriptomics (e.g., mixing the sender and receiver beads), contacting a sample with a combination of sender and receiver beads, photocleavage of the sender beads and preparaing a sequencing library for spatial transcriptomic analysis. 44

[0144] Instructions supplied in the kits of the instant disclosure are typically written instructions on a label or package insert (e.g., a paper sheet included in the kit), but machine- readable instructions (e.g., instructions accessible on a website or using electronic media) are also acceptable.

[0145] The kits of this disclosure are in suitable packaging. Suitable packaging includes, but is not limited to, vials, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags), and the like.

[0001] Kits may optionally provide additional components such as buffers, tissue fixation reagents, reverse transcription reagents, ligation reagents, polymerase chain reaction reagents, template switching reagents, and sequencing reagents. Normally, the kit comprises a container and a label or package insert(s) on or associated with the container. Methods of Use

[0146] In some embodiments, provided are methods of use of the transcriptional profiles generated using the methods of the invention to determine the transcriptional levels in cell populations in a biological sample and to identify novel biomarkers or transcriptional changes associated with disease or disorders or developmental stages. In some embodiments, the level of one or more transcript in a cell population in a biological sample from a specific developmental stage or disease or disorder is determined to be statistically different than the level of the transcript in a cell population in a biological sample in a control sample. In various embodiments, the transcriptional profiles generated according to the disclosure can be used to determine the extent, severity, or stage of disease, to determine the right treatment approach (e.g., disease-specific therapy, surgical intervention), to select the appropriate dose for a medical treatment, to determine whether a patient is likely to respond to a particular medical or surgical treatment, to monitor response to treatment, or to monitor disease progression.

[0147] In some embodiments, the method of the invention involves a step of comparing the level of at least one transcript in a cell population in a biological sample obtained from a subject to the level of the transcript in the same cell population in a comparator control (i.e., positive control, negative control, historical norm, baseline level or reference value). In some embodiments, an increase in the level of at least one transcript in a cell population in a biological sample from the subject under study relative to the level of the transcript in the same cell 45population in a comparator control is indicative of a disease or disorder associated with the increased level of the transcript, i.e., it is an indication that said subject is suffering from a disease or disorder associated with the presence of increased level of the transcript or has a predisposition to develop a disease or disorder associated with increased level of the transcript. In some embodiments, a decrease in the level of at least one transcript in a cell population in a biological sample from the subject under study relative to the level of the transcript in a cell population in a comparator control sample is indicative of a disease or disorder associated with the decreased level or absence of the transcript, i.e., it is an indication that said subject is suffering from a disease or disorder associated with the decreased level or absence of the transcript or has a predisposition to develop a disease or disorder associated with the decreased level or absence of the transcript. Diagnostic Index

[0148] In one embodiment, the present invention relates to the identification of a transcriptional profile and optionally one or more additional clinical features to generate diagnostic indexes for diagnosing a disease or disorder or risk of a disease or disorder. Accordingly, the present invention features methods for identifying subjects who have or are at risk of developing a disease or disorder by detection of the transcriptional profile in a tissue sample from the subject and assessing the clinical factors disclosed herein. These factors, or otherwise health profile, are also useful for monitoring subjects undergoing treatments and therapies, and for selecting or modifying therapies and treatments to alternatives that would be efficacious in subjects determined by the methods of the invention to have a disease or disorder associated with the presence or absence of a rare cell population or an increased risk of developing a disease or disorder associated with the presence or absence of a rare cell population.

[0149] Exemplary diseases or disorders that can be evaluated or diagnosed using the assay system of the invention include, but are not limited to, an autoimmune disease or disorder, an inflammatory disease or disorder, a neurodegenerative disease or disorder, a disease or disorder associated with a pathogen and cancer. Exemplary neurological diseases or disorders that can be evaluated using the assay system of the invention include, but are not limited to, Lewy body dementia, Alzheimer's disease or Alzheimer's Disease Related Dementias (ADRD). 46

[0150] The present invention provides an index of for use in patient monitoring or diagnostics. In some embodiments, the index is calculated as a function of multiple markers, biomarkers or factors that strongly correlate to a specific disease or disorder associated with the presence or absence of a transcriptional change or altered cell population. These factors may include a combination of clinical factors, transcriptional changes and relative cell population levels.

[0151] The risk of developing a specific disease or disorder associated with the presence or absence of a transcriptional change or altered cell population can be assessed by measuring one or more of the factors described herein, and comparing the presence and values of the factors to reference or control values. Subjects identified as having a specific disease or disorder associated with the presence or absence of a transcriptional change or altered cell population or an increased risk of a specific disease or disorder associated with the presence or absence of a transcriptional change or altered cell population can optionally be selected to receive counseling, an increased frequency of monitoring, or treatment regimens, or administration of therapeutic compounds.

[0152] The factors of the present invention can thus be used to generate a health profile or signature of subjects: (i) who do not have and are not expected to develop a specific disease or disorder associated with a transcriptional change or altered cell population and / or (ii) who have or expected to develop a specific disease or disorder associated with a transcriptional change or altered cell population. The health profile of a subject can be compared to a predetermined or reference profile to diagnose or identify subjects at risk for developing a specific disease or disorder associated with the presence or absence of a transcriptional change or altered cell population, to monitor the response to a therapeutic treatment (e.g. an antibiotic or a chemotherapeutic agent), and to monitor the effectiveness of a treatment or preventative measure for a specific disease or disorder associated with the presence or absence of a transcriptional change or altered cell population. Data concerning the factors of the present invention can also be combined or correlated with other data or test results, such as, without limitation, measurements of clinical parameters or other algorithms for a specific disease or disorder associated with the presence or absence of a transcriptional change or altered cell population.

[0153] In one embodiment, the health profile includes at least one additional factor. Exemplary additional factors that can be included in the health profile include, but are not 47limited to, age, sex, race, family history and previous history of a specific disease or disorder associated with the presence or absence of a rare cell population. Information obtained from the methods of the invention described herein can be used alone, or in combination with other information (e.g., age, race, sexual orientation, vital signs, blood chemistry, etc.) from the subject or from a biological sample obtained from the subject.

[0154] One of skill in the art recognizes that for an individual test statistical analysis can be performed on a reference or normative population sample of cells to determine confidence levels of having a specific disease or disorder associated with the presence or absence of a transcriptional change or altered cell population based on the results of that test. Accordingly for each test, a scale can be arbitrarily partitioned into regions having scores such that a correct combination of the scores provides a diagnostic index having a certain degree of confidence. The partitioning can be performed by conventional classification methodology including, but not limited to, histogram analysis, multivariable regression or other typical analysis or classification techniques. Methods for Identifying Biomarkers

[0155] In one embodiment, the systems and methods disclosed herein may be used in biomarker identification, for example for identifying tumor cells from a sample to diagnose cancer or metastasis or for identifying biomarkers to determine additional information about the prognosis or stage of a diagnosed cancer. The systems and methods described herein may be particularly useful for characterizing cell populations, including, but not limited to rare pathogenic cell populations.

[0156] In one embodiment, the transcriptional profiles generated are useful for diagnosing a disease or disorder in the subject, monitoring the progression of a disease or disorder in the subject, providing a disease prognosis, or evaluating the effects of a treatment provided to a subject.

[0157] In some embodiments, the methods of the invention are used to identify a transcriptional profile associated with an abnormal cell population. In some embodiments, the abnormal cell population is associated with a disease or disorder. In some embodiments the abnormal cell population is associated with cancer. In some embodiments the abnormal cell population is associated with a neurological disease or disorder. 48

[0158] In one aspect, the disclosure provides a method of diagnosing, treating or preventing a disease or disorder associated with an altered level of a cell population. In some embodiments, the method comprises administering to the subject an effective amount of a pharmaceutical agent for the treatment of a disease or disorder identified as associated with an altered level of a specific cell population, including, but not limited to, diseases or disorders associated with the inflammatory process, pathogens, and cancers.

[0159] Exemplary inflammatory diseases and disorder that can be diagnosed, treated or monitored for treatment include, but are not limited to, autoimmune diseases, inflammatory diseases, neurodegenerative diseases and disorders, diseases and disorders associated with pathogens and cancer.

[0160] In some embodiments, the invention includes using a biomarker or panel of biomarkers as set forth in Table 12-Table 19 for diagnosing a disease or disorder. In one embodiment, the invention includes the use of a biomarker or panel of biomarkers as set forth in Table 12-Table 16 for the diagnosis of a disease or disorder associated with aging. In one embodiment, the invention includes the use of a biomarker or panel of biomarkers as set forth in Table 17-Table 18 for the diagnosis of a disease or disorder associated with immunodeficiency.

[0161] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. EXPERIMENTAL EXAMPLES

[0162] The invention is further described in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless otherwise specified. Thus, the invention should in no way be construed as being limited to the following examples, but rather, should be construed to 49encompass any and all variations which become evident as a result of the teaching provided herein.

[0163] Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the compounds of the present invention and practice the claimed methods. The following working examples therefore, specifically point out the preferred embodiments of the present invention, and are not to be construed as limiting in any way the remainder of the disclosure. Example 1: Spatial Mapping of Mouse Brain Aging through Indexed Sequencing

[0164] The intricate structure and varied composition of cells in the brain present challenges in systematically characterizing age-related changes and understanding the mechanisms that contribute to the decline in brain function during aging. While single-cell genomics has shed light on gene expression dynamics in specific cell types during aging, decoding the connections between different cell types has remained elusive. Even with the recent rise of spatial genomic techniques, mapping the brain connectome remains difficult due to cost and throughput limitations. Here, a novel methodology called IRIS (Imaging Reconstruction using Indexed Sequencing) was developed that enables cost-effective spatial transcriptomics profiling without the requirement of optical imaging. IRIS was applied to spatially map mouse brain aging and quantified changes in gene expression and spatial organization across major cell types throughout the mouse lifespan. IRIS is broadly applicable to study spatial gene expression changes in various systems. Overview of Computational Analysis Pipeline

[0165] A computational pipeline was developed for recovering mapped transcripts and their spatial distance (Figure 1B) by starting with an interaction counts matrix between sender and receiver beads, along with the other matrix detailing mapped transcripts for each receiver bead. To enhance signal accuracy and eliminate error connections between sender and receiver beads interaction matrix was refined by selectively including only interactions between sending and receiver beads with high counts by employing Principle Component Analysis (PCA) and Uniform Manifold Approximation and Projection (UMAP) (Stolarek et al., 2022, iScience 25, 105142; Traag et al., 2019, Sci. Rep.9, 5233), then 2D spatial coordinates were generated for 50receiver beads that resemble beads array shape designed during the experiment. Dimensionality reduction was performed and clustering of gene expression matrix of RNA captured by receiver beads and then receiver beads were map onto the 2D spatial coordinates generated prior, with their associated gene expression clusters overlayed. With this pipeline, receiver beads gene expression clusters were observed mapping onto the 2D coordinates resembling whole mouse brain tissue architecture and whole mouse brain hemi-section globally reconstructed without any microscopy or equipment for spatial indexing, and solely based on dimensionality reduction analysis of interacting DNA barcodes. Detailed computational protocols are described below. Quality control of IRIS (Imaging Reconstruction using Indexed Sequencing)

[0166] IRIS was applied to profile a coronal section of an adult mouse brain. With less than 10% cost of the commercial 10x Visium platform, a median of 5,462 SGEMs was detected per slide, each with a median of 2,310 unique transcripts), aligning with the performance of the 10X Visium spatial transcriptomics platform. A computational pipeline was established to reconstruct intricate spatial features within various brain regions, such as the cortex, ventricle, hippocampus, and thalamus (Figure 2B). This resolution was validated by the detection of region-specific gene signatures (Figure 2C). The successful reconstruction of these areas showcases the capacity of IRIS to create a comprehensive spatial map of a mouse brain hemisection, utilizing neighborhood interactions instead of traditional optical imaging. Application of the IRIS platform in aging study

[0167] To confirm the effectiveness of IRIS in identifying gene expression changes and cellular states associated with aging, it was applied to profile coronal hippocampal sections from both adult and aged mouse brains, including six sections from each group. Following library preparation and sequencing, a differential gene expression analysis was conducted, revealing region-specific changes associated with aging (Figure 3A). For example, a significant increase in the expression of C4b and Serpina3n was detected in the Subventricular Zone (SVZ) regions of the aged brain (Figure 3B). This aligns with a previous analysis using 10X Visium (Sziraki et al., 2023, Nat. Genet.55, 2104–2116), providing further validation of the reliability of IRIS in detecting age-related molecular changes. Moreover, to identify cellular states associated with aging, RTCD (Cable et al., 2022, Nat. Biotechnol.40, 517–526) was used to deconvolute IRIS 51spatial gene expression data per bead using single-cell datasets from prior research (Sziraki et al., 2023, Nat. Genet.55, 2104–2116). Fitting the mixture of transcripts from the mixture of cells captured per receiver bead as a linear combination of cell types based on single cell RNA expression profiles allowed mapping of the distribution of various cell types in the brain across different brain regions. With this, the locations of various aging-associated vulnerable cell types (e.g., DAM was mapped to ventricle regions, Figure 3B) were successfully mapped. Four advantages of IRIS over other spatial transcriptomics approaches

[0168] The IRIS platform offers four advantages over other spatial transcriptomics approaches: i) Cost-Effectiveness: IRIS costs less than $100 per slide, over a ten-fold reduction compared to commercial platforms. This makes it a highly economical choice for large-scale spatial profiling. ii) Scalability: Operating independently of specialized equipment, IRIS can process over ns of sections in a single experiment, enhancing scalability and suitability for large- scale settings. (iii) Neighborhood Interaction-Based Reconstruction: Unlike imaging-based methods, IRIS uses local neighborhood information for spatial mapping. This innovative approach is particularly valuable for mapping cellular interactions in larger tissues (e.g., human brains). (iv) Adjustable Resolution: IRIS allows for adjustable mapping resolution (5-50µm), which is crucial for revealing cellular interactions at different distances and scales, making it a versatile tool for diverse research applications. Example 2: Detailed protocol for IRIS profiling

[0169] Here, we introduce IRISeq (Imaging Reconstruction using Indexed Sequencing), a novel, scalable, and cost-effective method for spatial genomic analysis that operates solely through sequencing, without the need for predefined capture arrays or optical imaging. IRISeq employs similar principles as those of DNA Hi-C (1) and DNA microscopy (2), decoding the spatial locations of molecules by sequencing their interactions with nearby molecules. Specifically, barcoded gel beads were utilized to capture gene expression locally, with the global spatial positions of these beads decoded through their interaction signals with adjacent beads.

[0170] The optimized IRISeq protocol comprises several key steps: (i) Bead Fabrication: Two types of oligo-barcoded beads are prepared: 'receiver beads' coated with PolyT sequences to 52capture nearby cellular mRNA, and 'sender beads' with a photocleavable linker and a PolyA sequence. These barcoded beads are created through a split-pool ligation approach (3), such that each bead has its unique barcode. (ii) Photocleavage and Oligo Capture: Beads are evenly distributed on a glass slide. A UV device is then utilized to photocleave oligos from the sender beads diffuse and are captured by the receiver beads, mimicking the capture of tissue mRNA. The beads array is then frozen on dry ice to stabilize the beads array. (ii) Tissue Transfer and mRNA Capture: Frozen tissue sections are then transferred onto this array using cryosectioning. The mRNA from the tissue is then captured by the receiver beads through hybridization and tissue digestion. (iv) Reverse Transcription and Sequencing: Post tissue digestion, beads are collected for reverse transcription and PCR, followed by sequencing to obtain transcriptome data and bead connection details. Table 1: Primer Sequences Name Oligo sequence TSO AAGCAGTGGTATCAACGCAGAGTGAATrG+GrG (SEQ ID NO:1) T53PN1- Acrydite_Sen / 5ACryd / TTT / iSpPC / ACTAACAATAAGCTCTATCGATGACCTAATAC C Ap μ y . plit primers are ordered at a larger scale due to their shorter length. The photocleavable linker (iSpPC) is shown in Figure 26. Bead Preparation

[0171] Using a microfluidic device, acrylamide-based gel beads were generated with Acrydite modified DNA oligonucleotides (PN1) to serve as an attachment site for split-pool- based barcoding. A previous bead barcoding protocol (Delley et al., 2021, Sci Rep 11, 10857) was followed, with slight modifications. The PN1 concentration was increased in the gel mix by 10x. This protocol was followed to generate both receiver beads (‘bead 1’) and sender beads (‘bead 2’). After split-pool barcoding, beads are quality-checked by using fluorescent hybridization probes that are reverse complementary for both sender and receiver beads.

[0172] Bead Fabrication 1. Prepare 10 ml of droplet generation oil with 0.6% v / v TEMED. Mix well in a 15 ml reservoir tube. (Note that the oil volume depends on the flow rates used and may require adjustments for different drop makers.) 2. Prepare the following three solutions: Note: PN1 primers are diluted in water. Table 2: Solution 1: Receiver Bead (PolyT) 54Component stock Volume / µlComponent stock Volume / µlTable 4: Solution 3: Oil Component stock final Volume / µl55droplet generation oil 100% 994µloir tubes. 4. Note that there are two ports available on the reservoir cap: One port is the Luer lock connector, which connects the pressure source from the PreciGenome microfluidic controller. The other port is for reagent tubing, one side of which dips into the reagent, and the other side connects to the inlet of a microfluidic chip. 5. Connect the gas tubing to the reagent reservoir and the pressure controller integrated pressure pumps inside. Connect the reagent tubing to the reagent reservoir and the microfluidic chip. Ensure that the connections and fittings are airtight. 6. Set up the pressure controller appropriately for your experiment (Oil pressure ~8.2, Solution pressure ~5.8) . Start running the controller by simply clicking the "Run" button on the touch screen. 7. When the controller provides positive pressure, the reagents in the tubes are pushed to flow through the reagent tubing into microfluidic channels and then flow out to the waste. 8. Aim for a droplet diameter of 30 - 40 μm. Before collecting the droplets into the collection tube, take 5 μl of the droplets to a hemocytometer to check their size. If the size is in the desired range, collect the droplets into the first collection tube. Once a tube is full, close the lid and move it to an incubator set at 50°C for 1 hour or incubate the tube at room temperature overnight. Note: Overnight incubation at room temperature (RT) works equally well. Bead Cleanup

[0173] 1. Centrifugation and Oil Removal: (1) Centrifuge the collection tubes at 100 g for 30 seconds. (2) Use a 200 μl pipette tip to remove the droplet generation oil from the bottom of the tubes. Repeat this step multiple times to ensure thorough removal. (3) Overlay the beads with 1 ml of TBSET and centrifuge at 3000 g for 30 seconds. (4) Remove any leftover droplet generation oil and the mineral oil overlay, along 56with TBSET, by pipetting or aspiration. (5) Repeat the TBSET washing step once more.

[0174] 2. PFO Treatment and Centrifugation: (1) Add 600 μl TBSET and 20 μl of 100% (v / v) 1H,1H,2H,2H-Perfluoro-1-octanol to each tube. (2) Briefly vortex at full power. (3) Centrifuge at 1500 g for 30 seconds. (4) Use a pipette tip to remove the PFO mix from the bottom, followed by the mineral oil emulsion and TBSET from the top, without disturbing the beads.

[0175] 3. Bead Collection and Washing: (1) Place a 30 μm strainer on a 50 ml falcon tube and combine the beads from all tubes by transferring the bead emulsions to the strainer. (2) Flush the strainer with TBSET until only bead precipitates remain on top. (3) Transfer the strainer with beads precipitate on top to the top of a new tube, and flip over the strainer and flush the beads into the tube with TBSET.

[0176] 4. Centrifugation, Resuspension, and Filtering: (1) Centrifuge the tube at 1500 g for 3 minutes. (2) Remove the supernatant and resuspend the pellet with 10 ml of TET. (3) Transfer the bead suspension to a 15 ml tube. (4) Filter the beads using a 100 μm filter to remove large beads. (5) Wash the beads three times by centrifugation at 1500 g for 2 minutes, followed by resuspension with 10 ml TET. Stopping Point: At this stage, the beads can be stored at 4°C for three months.

[0177] For high resolution IRISeq only: bead Fabrication of 5 um receiver and sender bead. 1. Prepare and activate the carboxyl groups on the 5 µm magnetic beads following 57the manufacturer's protocol (BcMag™ Quick oligo-DNA conjugation kit). 2. Prepare a dendrimer solution by mixing 500 µL of dendrimer solutions and 500 µl of manufacturer conjugation buffer, and incubate overnight on a rotator. 3. After incubation, wash the beads according to the manufacturer's protocol. Perform multiple rounds of washing with 1X PBS. 4. Bead Conjugation with PN1 oligonucleotide: (1) Prepare 100 µL of 25 mM DSS solution fresh and place on ice. (2) Mix 100 µL of 200 µM PN1-AmMC6_Receiver_Bead primer with 500 µL of 1X PBS. (3) Add the fresh 20 µL DSS solution to the oligonucleotide mixture. (4) Incubate the beads with the PN1 primer mixture with DSS on a rotator for 1 hour at room temperature. (5) Inhibit the reaction by washing the beads with 1 mL of 1M Tris-HCl (pH 7.5) and then performing multiple rounds of washing with 1X PBS. *Store the conjugated beads at 4°C in water and / or PBS for several weeks until barcoding is performed. *During split-pool barcoding, beads are washed on a magnetic separator instead of spinning.

[0178] For high-resolution IRISeq only: bead fabrication of 10 um receiver and sender bead. 1. Spin 5 ml 50 mg / ml of beads, and remove supernatant. 2. Suspend beads in 50 ml methanol, spin and wash 3X at 800 g, for 16 minutes, and remove supernatant. 3. Let beads dry under a chemical hood for 30 minutes 4. Prepare a dendrimer solution by mixing 1 ml of dendrimer stock solution and 1 ml of methanol, and incubate overnight on a rotator, in a 5 ml tube. 5. After incubation, spin beads and remove the dendrimer solution. 6. Wash beads in 50 ml of methanol, and spin 3X 800 g, for 16 minutes, then let it dry for 30 minutes after removing the supernatant from the last step. 587. Resuspend beads in 1 ml of 1X PBS

[0179] Oligonucleotide conjugation

[0180] Receiver beads oligonucleotide conjugation 1. Take 750 µl of 1 ml beads for receiver beads conjugation 2. Split receiver beads into two, 5 ml tubes and dilute each down using 3 ml 1X PBS *Below amount is per 5 ml tube 3. Add 400 µl of 400 uM PN1-Amc6 (200 µl of 400 uM PN1-Amc6 also works well) 4. Add 40 µl 25 mM DSS solution for the first 10 minutes 5. Then add another 40 µl 25 mM DSS 6. Leave on a shaker for 3 hours 7. Collect beads after 3 hours, and inhibit the reaction by washing the beads with 30 mL of 1M Tris-HC / 01% Tween-20l (pH 7.5) and then perform 3 rounds of washing with 1X PBS / .01% Tween-20 (50 ml washes each time). *Store the conjugated beads at 4°C in water and / or PBS for several weeks until barcoding is performed. If beads cross link and form doublets, filter beads using 20 um filter also.

[0181] Sender beads 1. Suspend 250 µl left over beads in 800 µl 1X PBS 2. Add 340 µl of PN1 amc6 PC, 100 uM concentration 3. Add 15 µl 25 mM DSS solution and leave on the shaker 4. Add 10 µl 25 mM DSS, after 10 minutes 5. Leave on a shaker for 3 hours 6. Collect beads after 3 hours, and inhibit the reaction by washing the beads with 30 mL of 1M Tris-HC / 01% Tween-20l (pH 7.5) and then perform 3 rounds of washing with 1X PBS / .01% Tween-20 (50 ml washes each time). *Store the conjugated beads at 4°C in water and / or PBS for several weeks until 59barcoding is performed.

[0182] Beads Barcoding 1. Calculate the volumes required based on the bead volume used (1 ml or 5 ml). Ensure that the PCR plate can hold the total volume. 2. Thaw all barcode plates with the added splints mixed in a 1:1 ratio, for a final concentration of 100 uM when combined with splits.

[0183] Phosphorylation of Primers: 1. Prepare the T4 polynucleotide kinase (PNK) master mix for each plate. Table 4: T4 PNK master mix T4 lig buffer 10 1.00 x 600µl. μ ll of a PCR plate. 3. Add 20 μl from each well of the Ligation_1_Receiver primers mixed with Ligation_1_SP (final 100 uM concentration) to the corresponding well of the PCR plate using a multi-channel pipette. Mix by pipetting up and down. Similar reaction is performed for sender beads barcoding, with an exception to use Ligation_1_Sender beads primer plate. 4. Seal the plate with aluminum foil and incubate at 37°C for 30 minutes. 5. Heat-inactivate the reaction at 65°C for 20 minutes.

[0184] Split-Pool Protocol, 1st Round: 1. While primers are phosphorylating, wash beads 3 times with 10 ml PL buffer. 2. Resuspend the beads according to Table 5 and heat to 75°C for 2 minutes. 3. Let the mix cool down to room temperature slowly to anneal the beads and PN2 primer. 60Table 5: Bead Resuspension Beads - - - 500µlxtra single PN2. 5. Prepare the mixture including beads and T4 ligase buffer. Table 6: Bead Wash Beads - - - 500µl1. Once primer phosphorylation is complete, remove the foil and distribute 20 μl beads to each well. 2. Store a 5 μl bead aliquot in a PCR tube, labeled "round 0" for quality control. 3. Prepare the T4 ligase master mix in 5 ml tubes and distribute 40 μl to each well. Mix by pipetting up and down. Use a multi-channel pipette and a reagent reservoir. Replace tips after each pipette cycle to avoid cross-contamination. Table 7: T4 ligase master mix T4 ligase buffer 10 1 x 420µl4. Seal the plate and incubate at room temperature for 1 hour. Heat-inactivate the 61reaction at 65°C for 10 minutes and cool to room temperature.

[0186] Washing: 1. Use a multi-pipette to collect beads into a reagent reservoir filled with 3 ml TET. No need to replace tips in this step. 2. Collect beads from reagent reservoir to 15ml tubes. Centrifuge at 1000 g for 3 minutes and remove the supernatant. 3. Wash five times in 10 ml TET. Note: 5 µm receiver beads are washed on the magnetic separator, and not by spinning.

[0187] Split-Pool Protocol, 2nd, 3rd, and 4th Round: 1. Proceed as for the first round barcoding using barcode plate 2, barcode plate 3 and barcode plate 4. 2. No need to add more PN2 for either receiver or sender beads since the barcode fragments are already double-stranded. Replace the PN2 volume with water. 3. Always store a 5 μl bead aliquot in a PCR tube, labeled with the corresponding cycle number for quality control. Note: barcode plates 1 and 4 for receiver and sender beads are different.

[0188] Denaturing and Quenching: 1. Pellet beads at 2000 g for 3 minutes, remove supernatant. 2. Wash the beads 3 times with 10 ml denaturing buffer to make the conjugated primer single-stranded. 3. After the last wash, remove the supernatant and wash 3 times with 10 ml LS buffer to quench the denaturing buffer. Note: 5 um receiver beads are washed on the magnetic separator, and not by spinning.

[0189] Quality Control of Beads by Fluorescence Imaging 1. Resuspend the quality control beads in 20µl TET buffer and transfer 5μl aliquots to PCR tubes. 622. Add 25 μl TET to each tube. 3. Add 1 μl of fluorescence probe (100 μM stock) to the tube. Use 488-polyT probe for sender bead, and 488-PolyA for receiver bead. 4. Vortex and incubate the beads with probes for 30 minutes at room temperature in the dark. 5. Wash the beads 3 times with 1 ml of TET. 6. Image beads under a fluorescence microscope.

[0190] Before the barcoding process, mix 200 uM of each Ligation and Ligation Splints for a final concentration of 100 uM. The mixed primer plate can be stored at -20 C for up to a year. Table 8: Receiver Bead ligation plate combinations Ligation Ligation SplintTable 9: Sender Bead ligation plate combinations Ligation Ligation Splint

[0191] Array fabrication for high resolution

[0192] Beads monolayering is adapted from Slide-seq V2(4), with slight modification. 1. Prepare a bead suspension by mixing receiver and sender beads in a 3:1 ratio. 63Use approximately 600,000 total beads for 10 µm beads or 2,000,000 total beads for 5 µm beads, for a 6 cm diameter array. Suspend the beads in 50 ul water. 2. Prepare a glass slide by treating it with silicone spray and framing it with rubber tape, following the Slide-seq V2⁴ protocol. 3. Dispense the bead mixture into a Grace Bio 0.6 cm slide gasket mounted on the prepared slide. Spin the slide gasket containing the bead suspension in a spin-bucket centrifuge for 1 minute to facilitate even monolayering. 4. Remove the slide gasket and allow the slide to air dry overnight to ensure the beads adhere to the glass surface. Gently wash the slide with water to remove any unbound beads. Add 100% formamide to the slide to denature the DNA barcodes, ensuring they are single- stranded. 5. Wash beads array again gently, with water to remove formamide. Library Preparation and Sequencing

[0193] Library preparation is modified from Slide-seq V2(4). Specifically, three versions of the protocol have been developed for tissue RNA capture with different beads: 1) IRISeq with Frozen bead array: this is the most optimized version of IRISeq compatible for profiling both small and large bead array; 2) IRISeq with non-frozen bead array; 3) IRISeq with 5um magnetic beads or 10 um beads: this is an alternative version of IRISeq for spatial transcriptome profiling at high resolution. Tissue Preparation and Transfer

[0194] Mice were anesthetized with CO2and decapitated. The brain was rapidly dissected, frozen on crushed dry ice, and stored at −80 °C until cryosectioning. Upon IRIS profiling, fresh frozen tissue was warmed to -20 C in a cryostat (Leica CM3050S) for 20 minutes before handling. The tissue was then mounted onto a cutting block with OCT and sliced at 10 µm thickness for RNA capture.

[0195] IRIS-seq with the frozen bead array tissue RNA capture (Optimized protocol for both small and large areas profiling): 1. Cut a 0.6 cm x 0.6 cm (or 1.5cm x 1.5cm for large array) square-shaped area in 64a 96-well plate plastic tape. Tape the cut area onto a glass slide to define the square shape of the bead layer. 2. Prepare a 15ul mixture of receiver beads and sender beads in a 3:1 ratio in hybridization buffer (Prepare 50 ul 3:1 mixture for 1.5 cm x 1.5 cm array size). Place 5ul bead mixture on the glass slide in the taped square-shaped area, making sure all area is covered with gel beads (Place ~30 ul of beads mix for 1.5 cm x 1.5 cm array, and add more beads accordingly to fill the square). Add 1 µl of Proteinase K to the bead mixture. Homogenize the beads using a pipette tip to facilitate the beads to form a monolayer. (Add 5 ul for Proteinase K for 1.5 X 1.5 cm sized array) 3. Incubate the beads array at room temperature for 1-2 minutes to allow the surface to form a monolayer. Take care to make sure the array is not too dry as this reduces barcode diffusion. Then, place the beads array in a photocleavage chamber for 2 minutes. 4. After photocleavage, immediately place the beads array on dry ice to freeze and stabilize the array. Transfer the tissue section onto the slide. Place the beads array with the tissue on dry ice again and transfer it to a 37°C humid chamber for 20 minutes for tissue digestion and RNA capture. 5. Collect the beads in a 15 ml tube using a funnel. Wash the glass array in the funnel with 6XSCC to collect the beads. Centrifuge the tube at 2000 g for 5 minutes. Collect the supernatant and wash the beads twice more with approximately 5 ml of 6XSCC.

[0196] IRIS-seq with the non-frozen bead array (Developmental version of the protocol for profiling 0.6cm x 0.6cm sections): 1. Cut a 0.6 cm x 0.6 cm (or 1.5cm x 1.5cm for large array) square-shaped area in a 96-well plate plastic tape. Tape the cut area onto a glass slide to define the square shape of the bead layer. 2. Prepare a 15ul mixture of receiver beads and sender beads in a 3:1 ratio in hybridization buffer. Place 5ul bead mixture on the glass slide in the taped square-shaped area, making sure all area is covered with gel beads 3. When the beads array was slightly dry and no liquid layer was observed, the slide was placed on the cutting stage in the cryostat and cooled for ~10 seconds, and then 10 µm tissue was transferred to the bead array. 654. The tissue was melted onto the slide by moving the glass slide off the stage and placing a finger on the bottom side of the glass. 5. Very carefully, the slide was removed from the cryostat and placed into a humidity glass slide chamber with liquid at bottom of chamber to keep tissue humid and not dry. 6. The array in the chambered slide with tissue on top was incubated at room temperature for 13 minutes. 7. Photocleavage of the beads array was performed for 2 minutes under UV light using (oYo-Link LED PX Device), an ice chilled metal plate is used to prevent tissue from becoming too dry during photocleaving. 8. A 10x genomic gasket chamber, with a 20 µm filter between the gasket and the beads array, was placed to stabilize tissue on the beads during reverse transcription.

[0197] High resolution IRIS-seq tissue RNA capture 1. Add 50 ul of 6XSSC on beads array 2. Then, place the beads array in a photocleavage chamber for 2 minutes. 3. Incubate array for 20 minutes after photocleavage 4. Dip the array gently in 50 ml 6XSSC buffer, avoiding disturbance of beads 5. Let the array air dry 6. Place 10 um thick section onto the array 7. Add proteinase K mixture (15 ul 6XSSC+ 5 ul proteinase K) 8. Place the array in a 37°C humid chamber for 20 minutes for tissue digestion and RNA capture. 9. Dislodge beads using 200 ul pipette tip, and collect beads into 5 ml of 6XSSC / .01% Tween-20, then spin for 8 minutes, at 2000 g, in 4C, 10. Wash beads again in 2X in 5 ml 6XSSC / .01% Tween-20 buffer (Add 2 ul per 5 ml RNAse inhibitor to this wash buffer) 11. Beads are ready for reverse transcription

[0198] Reverse Transcription The sample library was then prepared as below. (The remaining tissue was re- deposited at -80 C and stored for processing at a later date). The reaction volume below is for 66.6 X .6 cm sized array tissue capture. For 1.5 X 1.5 cm array tissue capture, reaction conditions are multiplied by 5X. Beads are separated into 5 tubes following tissue RNA capture, with each tube counted as a .6 X .6 cm reaction (same reaction mixture concentrations described below), and all samples are merged before library preparation for sequencing. 1. Prepare the RT reaction buffer (can be prepared in advance without RTase): 120 µL H2O 40 µL Maxima 5x RT Buffer 20 µL 10 mM dNTPs 5 µL RNase Inhibitor (ThermoFisher) 5 µL 100 uM Template Switch Oligo (TSO) 10 µL Maxima H- RTase Total volume 200 μl 2. Add 200 µl of RT mix to the beads (very gently to avoid bubbles on the filter for hybridization-based RNA capture). Reverse transcription is performed in the tube with beads for IRISeq with the frozen bead array and high resolution, or on the beads array for IRIS-seq with the non-frozen bead array. 3. Incubate the reaction at 50°C for 90 minutes (use PCR machine glass slide adapter for IRISeq with the non-frozen bead array).

[0199] Tissue Lysis (IRISeq with non-frozen bead array only) 1. Prepare a working solution for tissue digestion by adding proteinase K to the tissue-clearing buffer stock solution at a 1:50 ratio: Working Solution: 196 μL Tissue lysis buffer 4 μL Proteinase K enzyme Note: The tissue lysis buffer (without proteinase K) can be made in advance and stored at room temperature for several months. 2. Add 200 μL of the tissue lysis mix to the beads in each tube, bringing the total volume to 400 μL. 3. Incubate the mixture at 37°C for 30 minutes. 4. Cut the filter and collect all beads as much as possible into a PCR tube. 67Note: This is a stopping point. The beads can be stored at 4°C in TE-TW for overnight.

[0200] Exonuclease I Treatment 1. Prepare Exonuclease I mix recipe (200 µL): 20 µL 10X Exo I Buffer 170 µL H2O 10 µL Exo I 2. Pellet and then wash the beads with 10 mM Tris-HCl, pH 7.5. 3. Pellet beads again and resuspend the beads in 200 µL Exonuclease I mix. Incubate the reaction at 37 °C for 50 minutes. 4. After Exonuclease I treatment is done, pellet the beads and remove supernatant. Wash beads twice with TE-TW. 5. Pellet beads once more and resuspend the beads in 200 µL 0.1 N NaOH for 5 minutes at room temperature. Note: Prepare 0.1 N NaOH immediately before use. 6. Quench NaOH with 200 µL TE-TW. 7. Pellet beads as before, wash once with TE-TW and once with 1x TE buffer.

[0201] Second Strand Synthesis 1. Prepare second strand synthesis mix per puck: 133 µL ultrapure water 40 µL Maxima 5x RT Buffer 20 µL 10 mM dNTPs 2 µL 1 mM dN-SMRT oligo 5 µL Klenow Enzyme Total volume 200 µL 2. Pellet beads and resuspend the beads in 200 µL second strand synthesis mix. Incubate the reaction at 37 °C for 1 hour.

[0202] cDNA Library Amplification 1. Resuspend the beads in 200 μl the TE-TW buffer and transfer them to new DNA Lo-bind tubes. 2. Repeat the washing step with the TE-TW buffer for three times. 3. Pellet the beads once more. 684. Add 80 μl of 0.1 N NaOH to the bead pellets and incubate for 5 minutes. 5. Pellet the beads and collect the supernatant into a tube. 6. Quench the reaction with 13.5 μl of 1 M pH 7 Tris buffer. 7. Perform 1X Ampure beads purification and elute the cDNA in 30 μl EB buffer. 8. Prepare the following PCR mix per tube: 30 μl Elution supernatant 60 μl Ultrapure water 100 μl Terra PCR Direct Buffer 3 μl 100 μM P5_Truseq_ Read1 primer 3 μl 100 μM SMRT PCR primer 4 μl Terra Polymerase Total volume 200 μl 9. Divide the total volume of each sample into two PCR tubes, each containing 100 μl (50%) of the total. Run the following PCR program: 95 °C for 3 minutes 4 cycles of: 98 °C for 20 seconds 65 °C for 45 seconds 72 °C for 3 minutes 9 cycles of: 98 °C for 20 seconds 67 °C for 20 seconds 72 °C for 3 minutes Then: 72 °C for 5 minutes 4 °C forever

[0203] cDNA Library Purification 1. Transfer 200 µL of PCR product into a 1.5ml tube. 2. Perform 0.6X Ampure beads purification and elute the cDNA in 22 μl water. 3. Normalize the library concentration to 3 ng / ul using water.

[0204] Receiver bead-sender bead Connections Library: PCR and Gel Extraction 1. Wash the beads with TE-TW twice, then with water, and suspend them in 27 µL of H2O. 2. Prepare a PCR mix containing: o Beads suspended in 27 µL of H2O o 1.5 µL of 10 uM Truseq_indexed_P7_Read2 69o 1.5 µL of 10 uM P5_Truseq_ Read1 o 30 µL of NEBnext master mix o Total volume: 60 µL 3. Run the following PCR program: o Start o 72 °C for 3 minutes o 95 °C for 30 seconds o 12 cycles of: ▪ 95 °C for 10 seconds ▪ 55 °C for 10 seconds ▪ 72 °C for 20 seconds o Then: ▪ 72 °C for 3 minutes ▪ 4 °C, hold 4. After PCR, take 3 µL to run on a gel. Then, cut the desired band and perform gel extraction according to the manufacturer's instructions using Zymoclean Gel DNA Recovery Kit. 5. Finally, normalize the library concentration to 2 nM with water for sequencing.

[0205] Tn5 Tagmentation Prepare buffer -Dialysis buffer Recipe: 50 mM Tris-HCl pH 7.5, 800 mM NaCl, 0.2 mM EDTA, 10% glycerol 1. Prepare the Nextera-P7 / P5 Tn5: Mix 100 µL of Tn5 dialysis buffer with 2 µL of 100 mM DTT. 2. Prepare the Oligos for Annealing for each end as shown below: Table 10: For End 1 Tn5_Nextera_R1 Stock Final 1X 20X T N R1 1 M M 4 l l d: uTable 11: For End 2 Tn5_Nextera_R2 Stock Final 1X 20XTn5 dialysis / dilution buffer 1.7ul 34ul (with 2mM DTT final) for each d: u3. Run the PCR program in a thermocycler to anneal the oligonucleotides: ^ Start at 95°C for 5 minutes. ^ Slowly cool down to 65°C at a rate of 0.1°C per second. ^ Hold at 65°C for 5 minutes. ^ Slowly cool down to 4°C at a rate of 0.1°C per second. ^ Combine the two annealed oligo mixes to obtain 100 µL (50 µL * 2) of 16 µM annealed Tn5 oligo mix (8 µM for each end). 4. Prepare Glycerol Tn5 Stock (~50%): ^ Thaw 30 µL of Tn5 extract on ice (original concentration: 4 mg / mL). ^ Prepare 90 µL of diluted glycerol buffer (30 µL Dialysis buffer + 60 µL 100% ultrapure glycerol + 1.8 µL of 100 mM DTT), mix gently by pipetting until no separation of layers. ^ Add the thawed Tn5 to the diluted glycerol buffer, and mix by gentle rotation (15rpm) at 4°C for 20 minutes. ^ Gently mix the reaction several times by a P1000 pipette, and keep the tube on ice until Tn5 loading. 5. Load Nextera R1 / R2-Tn5: ^ Add 110 µL of prepared Glycerol Tn5 Stock stock to the combined annealed oligo mix tube and mix gently by pipetting for several times. ^ Incubate the reaction at 25°C for 30 minutes with gentle shaking on the thermomixer at 300 rpm. ^ Store at -20°C until needed.

[0206] cDNA Library Tagmentation and PCR 1. Preheat the PCR machine to 55°C. 2. Prepare the Tn5 reaction in a PCR tube: 2.5 μl 2X TD buffer 710.5 μl Tn5 2 μl DNA (3 ng / ul working concentration) Total volume: 5 μl 3. Incubate the PCR tube at 55°C for 5 minutes. 4. Add 5 μl DNA binding buffer to the PCR tube, and mix well. 5. Perform 1X Ampure beads purification and elute the cDNA in 9 μl Elution buffer. 6. Prepare the PCR mix: 9 μl Eluted DNA from the previous step 1 μl 10 uM P5_Truseq_ Read1primer 1 μl 10 uM Nexterra_indexed_P7_Read2 primer 11 μl 2X NEBnext Master Mix Total volume: 22 μl 7. Run the following PCR program: Start: 72°C for 3 minutes 95°C for 30 seconds 13 cycles of: 95°C for 10 seconds 55°C for 10 seconds 72°C for 30 seconds Then: 72°C for 3 minutes 4°C, hold

[0207] Library Purification 1. Add an additional 18 µl of H2O to the PCR mix, increasing the total volume to 40 µl. 2. Perform 0.8X Ampure beads purification and elute the cDNA in 12 μl water. 3. Normalize the library concentration to 2 nM for sequencing. Note: PCR Library Characteristics - the tagmented library should be fairly smooth, with an average bp size of 300-400bp. Example 3: Detailed protocol for computational analysis Beads Connections processing 72Initial Data Preparation:

[0208] Following the sequencing process, data from two beads, namely Bead1 and Bead2, are obtained. Each bead connection includes unique molecular identifiers (UMIs) which help in identifying and quantifying individual connection molecules. Additionally, there are two types of reads: R1, which contains the barcode for Bead1, and R2, which contains the barcodes for Read 2. The reads are mapped to a whitelist of barcodes with 1 base pair error, including the UMI sequence. Duplicated reads are then filtered, and a csv file is generated with bead1, UMI, and bead2 barcode, where each line represents a unique molecular connection between bead1 and bead2. Filtering Bead Connections:

[0209] Filtering is performed to ensure each connection between two beads has a minimum of 10 UMIs, ensuring a sufficient level of data for analysis. Matrix Generation:

[0210] After filtering, a matrix is generated where each row represents a Bead1 (receiver bead), and each column represents a Bead2 (sender bead). The values in the matrix correspond to the number of UMIs for each Bead1-Bead2 connection. Principal Component Analysis (PCA):

[0211] PCA is applied to the matrix to reduce the dimensionality of the data while preserving its variance. Before running PCA, an elbow plot is generated to determine the optimal number of principal components. The elbow plot helps identify the point at which the explained variance begins to level off, indicating the most significant components. Approximately 80% of the variance or less is typically chosen for subsequent analysis. Uniform Manifold Approximation and Projection (UMAP):

[0212] Following PCA, the PCA matrix of Bead1 and Bead2 connections is subjected to UMAP. UMAP is a dimensionality reduction technique similar to t-SNE (t-distributed stochastic neighbor embedding) but is computationally more efficient. UMAP is run with user-defined parameters to obtain a square-shaped projection, similar to the bead array that was generated. Commonly used parameters include a minimum distance of 0.2 and approximately 20 neighbors. 73UMAP Coordinates for each Bead1 are extracted, and saved in csv files, and are used for subsequent mapping of Bead1 spatial location. cDNA data processing: Initial Data Preparation:

[0213] After the sequencing process, the data is obtained in the form of two sets of FASTQ files: R1 and R2. R1 FASTQ files contain the barcode sequences for Bead1 along with their associated Unique Molecular Identifiers (UMIs). R2 FASTQ files contain the tagmented cDNA sequences. Barcode Mapping and Tagging:

[0214] The barcode sequences from R1 are mapped to a whitelist of bead barcodes with a tolerance of 1 base pair error. The identified bead barcode is then added as an identifier (ID) for the corresponding sequences in R2. Read2 File Generation and PolyA Trimming:

[0215] New Read2 files are generated where the name of each sequence in R2 contains the corresponding Read1 barcode. Additionally, any PolyA tails present at the end of the sequences are trimmed to ensure accurate mapping and analysis. Read Mapping to Genome:

[0216] The filtered and trimmed reads are then mapped to the reference genome using a tool such as STAR9 (Spliced Transcripts Alignment to a Reference). This step involves aligning the sequences from R2 to the genomic sequences to identify their locations and potential splice sites. Duplicate Removal:

[0217] After mapping, duplicate reads are identified and removed to eliminate redundant data and ensure accuracy in downstream analysis. This process generates new SAM (Sequence Alignment / Map) files containing the mapped reads with duplicates removed. Gene Count Matrices Generation: 74

[0218] From the processed SAM files, gene count matrices are generated for each associated Bead1. This involves counting the number of reads aligned to each gene for every Bead1, providing quantitative information about gene expression levels. Downstream data analysis: Data Preprocessing:

[0219] Raw data obtained from beads cDNA experiment, in the form of bead by gene expression matrices, undergo initial preprocessing steps. This may include quality control checks, normalization, and filtering to remove low-quality cells and genes with low expression levels. Dimensionality Reduction and Embedding:

[0220] Dimensionality reduction techniques such as principal component analysis (PCA) or non-linear methods like t-distributed stochastic neighbor embedding (t-SNE) and uniform manifold approximation and projection (UMAP) are applied to reduce the high-dimensional gene expression data into lower-dimensional representations. This facilitates the visualization and clustering of cells based on their transcriptional profiles. Clustering and Annotation:

[0221] Clustering algorithms, such as those implemented in Seurat and Scanpy, are utilized to group beads1 with similar gene expression profiles into clusters. These clusters represent distinct cell populations within the sample. Additionally, cells within each cluster are annotated based on known cell type markers or differential gene expression analysis, providing insights into the identity and heterogeneity of the cell populations. Spatial Mapping of Bead Types:

[0222] Utilizing the UMAP spatial coordinates generated earlier from bead1 bead2 interaction matrices, each bead1 location is mapped in a spatial context, providing information about its spatial distribution within the sample. Example 4: Unraveling Lymphocyte-Driven Mechanisms in Mouse Brain Aging with Optics- Free Spatial Genomics 75

[0223] The rapid advancement of spatial transcriptomics technologies has revolutionized the ability to map the locations and interactions of heterogeneous cellular states in situ (Chen et al., 2015, Science 348, aaa6090; Eng et al., 2019, Nature 568, 235–239; Wang et al., 2018, Science 361, eaat5691; Ståhl et al., 2016, Science 353, 78–82; Rodriques et al., 2019, Science 363, 1463–1467; Liu et al., 2020, Cell 183, 1665–1681.e18; Vickovic et al., 2019, Nat. Methods 16, 987–990; Chen et al., 2022, Cell 185, 1777–1792.e21; Cho et al., 2021, Cell 184, 3559– 3572.e22; Fu et al., 2021, Cell 185, 4621–4633.e17), particularly in the context of aging or disease. However, most current approaches, especially imaging-based methods, often prioritize resolution at the expense of throughput and time, typically restricting analyses to specific tissue regions and limiting their utility across various conditions and replicates.

[0224] To address these limitations, IRISeq, an optics-free spatial profiling platform that leverages "spatial interaction mapping by indexed sequencing" was developed. IRISeq bypasses the need for imaging or pre-indexed arrays, allowing multiple sections to be processed in a single day at significantly reduced costs—approximately $30 per tissue section—without requiring complex equipment. Furthermore, its optics-free design is particularly suited for mapping large tissue areas exceeding 1cm², which are traditionally limited by imaging speed and the constraints of pre-indexed arrays. Additionally, IRISeq offers adjustable resolution based on bead size (ranging from 5 to 50 µm), enhancing its flexibility and user-friendliness. These features make IRISeq a versatile and accessible tool for a wide range of applications, from basic research to clinical diagnostics.

[0225] Using the IRISeq platform, age-related changes in gene expression and cellular dynamics were explored across twenty-five regions of the mouse brain. These findings indicate a general down-regulation of genes associated with mitochondrial activity, ribosomal function, and neuronal modulation across almost all regions. Conversely, genes related to the complement and interferon pathways, as well as inflammation markers, were predominantly up-regulated in specific areas such as the ventricles and white matter. This regional specificity aligns with previous reports highlighting increased susceptibility to aging in these locations (Shi et al., 2023, Nature 622, 552–561; Allen et al., 2023, Cell 186, 194–208.e18).

[0226] Further cell-centric analysis pinpointed precise region-specific changes in cell populations. For example, a marked depletion of neurogenesis-related cells was observed in the subventricular zone and oligodendrocyte precursor cells in the white matter and ventricles, 76corroborating earlier studies (Wu et al., 2024, Aging Cell 23, e14109). Additionally, this analysis uncovered significant changes in other cell types, such as the expansion of border-associated macrophages (BAM) and the concurrent depletion of Gfap-low Fact2-high astrocytes and vascular endothelial cells in the aged meninges. Moreover, a computational pipeline was developed to analyze local cell-cell interactions by assessing the co-localization of two cell types on the same beads. This approach revealed that in the aged white matter, not only is there an expansion of disease-associated microglia, reactive oligodendrocytes, and activated astrocytes, but there is also a significant increase in their co-localization, independent of changes in their abundance. This observation aligns with findings from previous imaging-based studies (Allen et al., 2023, Cell 186, 194–208.e18) and validates the effectiveness of the platform in detecting region-specific alterations in cellular networks during aging.

[0227] IRISeq is a highly optimized platform for spatial transcriptomics, yet there are opportunities for further improvement. Currently, the method does not provide isolated single- cell information. However, it is readily compatible with nuclei hashing techniques that can extend its capabilities to direct spatial analysis at the single-cell level (Srivatsan et al., 2021, Science 373, 111–117). Additionally, IRISeq can be integrated with methods to profile proteins (Ben-Chetrit et al., 2023, Nat. Biotechnol.41, 788–793) and epigenetic landscape (Deng et al., 2022, Nature 609, 375–383), broadening its application spectrum. A current limitation lies in the image reconstruction process, which relies on the stochastic UMAP algorithm (McInnes et al., 2018, arXiv:1802.03426). This results in digital approximations that do not exactly replicate the original images. Despite this, the technique robustly maps the relative locations of different anatomical regions, as confirmed through comparisons with the 10x Visium platform. It's important to note that the downstream biological analyses—including transcriptome annotation, cell population dynamics, and cellular interaction studies—remain unaffected by these imaging constraints.

[0228] In summary, IRISeq demonstrates significant potential for detailed mapping of region-specific molecular signatures, cell population dynamics, and local cell-cell interactions across varied and complex biological landscapes. Its capacity to reconstruct images based solely on sequencing local DNA interactions allows for the profiling of tissues without size constraints and across varied resolutions. Looking ahead, the high-throughput, cost-effective nature of IRISeq positions it as a transformative tool for comprehensive spatial mapping of entire organs 77or organisms, across various genders, ages, and disease states. This opens new possibilities for identifying region-specific vulnerabilities linked to different diseases, enhancing the understanding of complex biological systems. The materials and methods are now described. Animals

[0229] C57BL / 6 wild-type mice, B6.129S7-Rag1tm1Mom / J and B6.Cg-Prkdcscid / SzJ were acquired from the Jackson Laboratory and the National Institute on Aging colony at Charles River. All mice were housed under standard conditions, with groups matched for sex and age. Mice were socially housed. Brain Nuclei Extraction for EasySci

[0230] The samples were processed by EasySci (Sziraki et al., 2023, Nat. Genet.55, 2104–2116) with minor modifications. In brief, 40 μm thick, cryosectioned, frozen brain tissues were added to a 6 cm cell culture dish containing 3mL of lysis buffer solution (EZ Lysis Buffer containing 1% diethylpyrocarbonate). Each sample was homogenized with a razor blade until the solution could be aspirated with 1000uL tips to pass through a 40μM filter above a 50mL tube that contained 6 mL of lysis buffer solution. The plunger from a 10mL syringe was used to further homogenize the tissue on the filter until the solution passed through the filter completely. The filters were washed with 1 mL of additional lysis solution. The nuclei were concentrated by centrifugation at 500g for 5 minutes at 4°C. The nuclei were washed 3 times in nuclei wash buffer (NWB), containing Nuclei buffer (NB, 10 mM Tris-HCl pH 7.5, 10 mM NaCl, 3 mM MgCl2 in RNase-free water) supplemented by 1% of 10% Tween-20 diluted in RNase-free water, 1% recombinant albumin (NEB, #B9200S), and 0.1% SUPERase•In™ RNase Inhibitor. After the washes, nuclei were aliquoted into 2 cryovials containing 500μL of nuclei resuspended in NWB containing 10% dimethyl sulfoxide and stored in slow freezers, cooling at 1°C per minute, at -80C overnight.

[0231] The following day, one aliquot of the nuclei from each sample was rapidly thawed in a 37 °C water bath and centrifuged at 500g for 5 minutes at 4°C. The supernatant was removed, and the nuclei were resuspended in freshly prepared NWB containing 0.005 mg / mL 78DAPI (Thermo Fisher, #D1306) for fluorescence-activated cell sorting (FACS). The nuclei were stained for 10 minutes before performing FACS on a SH800 Cell Sorter with a 100 μm sorting chip (Sony, #LE-C3210), to capture all DAPI-positive singlet nuclei and to exclude cellular debris and doublet cell populations. Nuclei were collected into a 1.5 mL DNA Lo-Bind tube containing 100 μL of NWB, vortexed to coat the tubes for optimal nuclei capture, and subsequently centrifuged at 500g for 5 minutes at 4 °C before proceeding directly to library construction. EasySci library construction and sequencing

[0232] The subsequent steps for the generation of sequencing libraries followed the published EasySciRNA protocol (2). Initially, the sorted nuclei were distributed across 96-well plates (Geneseesci, #24-302) for reverse transcription (RT). Prior to RT, indexed oligo-dT and indexed random hexamer primers were utilized to introduce the first index. The nuclei were pooled, washed, and redistributed into new 96-well plates for the addition of the second index through ligation. After subsequent pooling and washing steps, the nuclei were diluted to 500 nuclei / uL and distributed into new plates for second-strand synthesis and 1x AMPure XP SPRI purification (Beckman Coulter, #A63882). After elution of the cDNA, tagmentation with Tn5 transposase was performed followed by a 16-cycle PCR reaction. The resulting PCR products were then pooled and purified twice using 0.8X volume of AMPure XP SPRI. The library concentration and fragment size were measured using an Agilent TapeStation, and sequencing was carried out on an Illumina NovaSeq 6000 System with an S4 Flow Cell. Computational procedures for processing IRISeq libraries Beads Connections Processing

[0233] Following the sequencing process, data from two beads—receiver beads and sending beads—were obtained, with unique molecular identifiers (UMIs) used to identify and quantify individual connection molecules. Reads were classified into R1 (receiver bead barcodes) and R2 (sender bead barcodes), and mapped to a whitelist of barcodes with a 1 base pair error tolerance. Duplicated reads were filtered out based on UMIs, and a CSV file was generated containing the receiver bead barcode, UMI, and sender bead barcode, where each line 79represented a unique molecular connection between beads.

[0234] To ensure data quality, connections between beads with fewer than 7 UMIs were filtered out. A matrix was then generated, with each row representing a receiver bead, each column representing a sender bead, and the values corresponding to the number of UMIs for each connection. Principal Component Analysis (PCA) was applied to this matrix to reduce dimensionality while preserving variance, using an elbow plot to determine the optimal number of principal components, typically capturing around 80% of the variance. Subsequently, Uniform Manifold Approximation and Projection (UMAP) was performed on the PCA matrix to further reduce dimensionality, using parameters such as a minimum distance of ~0.2 and approximately ~20 neighbors to obtain a square-shaped projection. UMAP coordinates for each receiver bead were saved in CSV files for spatial mapping. For larger arrays, UMAP was run on a GPU with increased training epochs (from ~500 to ~10,000 or more) to handle the larger data matrix. Additionally, for large array analysis, density-based spatial clustering of applications with noise (DBSCAN) was applied post-UMAP to remove several erroneously mapped beads (Bushra et al., 2024, PeerJ Comput Sci 10, e1921). cDNA Data Matrix processing

[0235] After the sequencing process, the data is obtained as two sets of fastq files. The first set of fastq files (R1.fastq) contains the barcode sequences for receiver beads along with their associated UMIs, while the second set of fastq files (R2.fastq) contains the tagmented cDNA sequences. The barcode sequences from R1.fastq are mapped to a whitelist of bead barcodes with a tolerance of one base pair error, and the identified bead barcode is added as an identifier for the corresponding sequences in R2.fastq. New Read2 files are then generated, incorporating the corresponding Read1 barcodes in the sequence names, and any PolyA tails present at the end of the sequences are trimmed for accurate mapping and analysis. The filtered and trimmed reads are mapped to the reference genome using STAR (Spliced Transcripts Alignment to a Reference) (Dobin et al., 2013, Bioinformatics 29, 15–21) to align the sequences from R2 to the genomic sequences, identifying their locations and potential splice sites. Duplicate reads are identified and removed post-mapping to eliminate redundant data and ensure accuracy in downstream analysis, resulting in new SAM files containing the mapped reads with duplicates removed. Finally, gene count matrices are generated from the processed SAM files for 80each receiver bead, quantifying the number of reads aligned to each gene and providing information about gene expression levels. EasySci sequencing data preprocessing

[0236] BCL files were demultiplexed using the barcode information from the last round of PCR indexing utilizing Illumina’s bclfastq2 program (version 2.20.0.422) to convert the file format to FASTQ. For single-nucleus RNA-seq, read alignment and gene / exon count matrix generation were conducted using the EasySci pipeline (github.com / JunyueCaoLab / EasySci). Cells from the gene count matrix were filtered according to the following parameters: unmatched rate less than 0.4, combined shortdT and randomN UMI (Unique Molecular Identifier) count less than 200, and gene counts less than 100. Scrublet (version 0.2.3) was utilized for the doublet removal set with the following parameters min_count = 3, min_cells = 3, vscore_percentile = 85, n_pc = 30, expected_doublet_rate = 0.08, sim_doublet_ratio = 2, n_neighbors = 30. Cells with a doublet score of more than 0.2 were discarded, which corresponded to 10% of the processed and filtered dataset. Dimensionality Reduction, Clustering, and Region Annotation for IRISeq spatial dataset

[0237] Raw data from the cDNA sequencing experiment, presented as receiver bead-by- gene expression matrices, undergoes several preprocessing steps. The first step includes removing Beads with low UMI counts (Less than 600 for the mouse aging dataset). The second step includes dividing the data set according to the anatomical sections by which tissue sections were cryosectioned. LIGER objects are constructed by first normalizing the number of UMIs25. Then 2000 highest variable features are selected for each tissue section, followed by scaling of gene expression features. After data normalization and processing, each anatomical data set with associated individual tissue sections is integrated by LIGER’s non-negative matrix factorization (iNMF) approach, followed by UMAP mapping. Louvain clustering is then performed on the normalized NMF factor loadings. Clusters with low UMI and non-specific gene features were iteratively removed to ensure data quality, followed by LIGER iNMF workflow to recluster and run UMAP again until no low-quality clusters were formed.

[0238] Brain region identification was performed based on NMF factors gene markers, and 81also performing Wilcoxon differential expression analysis for each identified cluster. A similar analysis scheme and data processing were performed for IRISeq and 10X Visium integration analysis, and 10X Visium aging validation analysis. Similar normalization and scaling were done for IRISeq high-resolution data analysis.

[0239] Large-area dataset analysis (see Figure 1) was performed utilizing Scanpy (Wolf et al., 2018, Genome Biol.19, 15) for principal component analysis (PCA) followed by UMAP. Leiden clustering was implemented using Scanpy (Wolf et al., 2018, Genome Biol.19, 15) to group beads with similar gene expression profiles. Additionally, beads within each cluster are annotated by utilizing differential gene expression analysis for each cluster, and associated cluster-specific genes to known cell type and / or brain regions, along with utilizing genes and / or cluster mapping onto spatial anatomical location. Differential Expression Analysis for spatial IRISeq data, and EasySci single-cell RNA sequencing

[0240] In the differential expression (DE) gene analysis, the likelihood ratio test was employed to identify aging differential expression for specific regions using Monocle2 (Qiu et al., 2017, Nat. Methods 14, 979–982). DE genes were filtered based on the following cutoffs: q- value < 0.05, with fold change (FC) > 3 between the maximum and second expressed condition, and with transcripts per million (TPM) > 50 in the highest expressed condition. Cell Type Deconvolution

[0241] To perform cell type deconvolution, robust cell type decomposition (RCTD) (Cable et al., 2022, Nat. Biotechnol.40, 517–526), a computational method that uses cell type profiles from single-cell RNA-seq to decompose cell-type mixtures while accounting for differences across sequencing technologies, was applied. IRISeq spatial expression data was integrated with a single-cell transcriptome dataset from an earlier study (Sziraki et al., 2023, Nat. Genet.55, 2104–2116) following parameters suited for ~50 µm-sized spots and excluded cell types not present in the microdissected sections. Differential Abundance Analysis

[0242] To perform cell abundance analysis across different regions, first, RTCD 82maximum-likelihood cell type proportions are binarized by assigning them into one of five categories: values less than 0.05 were categorized as 0, values between 0.05 and 0.2 as 1, values between 0.2 and 0.6 as 2, values between 0.6 and 0.8 as 3, and values greater than 0.8 as 4. This method allowed for transforming continuous proportion data into discrete categories, facilitating subsequent analysis and visualization. After this, a count matrix of receiver bead by cell subtypes is obtained. Raw counts of cell subtypes were converted into normalized counts per million (CPM). For differential abundance analysis of cell subtypes, the negative binomial model was used, a common approach for differential gene expression analysis that is well-suited for count data and large-scale datasets. A likelihood-ratio test was used to identify differentially abundant cell subtypes, employing the differentialGeneTest() function of Monocle2 (version 2.28.0) (Qiu et al., 2017, Nat. Methods 14, 979–982).

[0243] For fold change calculations, first the cell counts for each cell subtype were normalized relative to the total cell count in each condition. Then these normalized values were compared between case and control conditions, adding a small numerical value (10^-6) to reduce noise from very small clusters. To classify a cell subtype as a "significantly changed cell subtype," criteria of a maximum false discovery rate of 1e-5 and a fold change greater than 1.5 between conditions were set. The abundance of aging-associated cell subtypes was quantified in the different annotated brain regions by performing differential abundance tests comparing adult and aged samples. Recognizing that variations in one cell subtype can influence the relative proportions of others, particularly static cell subtypes, this analysis focused on cell subtypes exhibiting significant changes—more than a 1.5 shift in population during aging. This approach is based on the observation that many significantly changed cell clusters correspond to rare cell states and represent a small portion of the global cell population. Consequently, even if these changing cell subtypes have a substantial impact on others, the overall relative proportion shifts are expected to remain within a two-fold range. Cell-cell interaction analysis

[0244] To assess whether the increased spatial interaction of specific cell subtypes is due to their expansion, a hypergeometric test was performed. This test compared the observed number of beads with colocalized cell types against a null model that assumes a random distribution of cell subtypes colocalization within the region. Prior to conducting the 83hypergeometric test, a new receiver bead by cell-cell interaction matrix was created. This matrix was generated by first filtering out low RTCD likelihood probability values (< 0.05) for subtype deconvolutions. Next, a pairwise analysis of cell subtype co-existence on the same bead was conducted. If two cell subtypes had a positive value after filtering out low RTCD likelihood probability values, a count of 1 was added to the corresponding cell-cell interaction column. Using the hypergeometric test the total number of beads within the region (N), the number of beads with a specific cell subtype-subtype interaction (k), the number of beads where colocalization is observed (n), and the number of beads with the other interacting cell subtype (x) were defined. The hypergeometric probability ^ ( ^ = ^ ) was calculated as: This formula determined the likeliof colocalized cell subtypes under the null hypothesis. Dimensionality Reduction, and Clustering, and Region Annotation for EasySci single cell analysis

[0245] To increase the resolution of main cell population clustering, this dataset was integrated with the published EasySci brain atlas (Sziraki et al., 2023, Nat. Genet. 55, 2104– 2116). The EasySci brain atlas (Sziraki et al., 2023, Nat. Genet. 55, 2104–2116) containing ~1.5 million cells is firstly sampled to 126,285 cells by subsetting 5,000 cells from each main cell population (for cell populations that have less than 5,000 cells, all cells are subset). The subsampled EasySci brain atlas is then integrated with the full brain immunodeficiency dataset using Seurat integration functions. Briefly, each dataset is normalized and the top 5,000 highly variable features are selected using “vst” method. The integration features are selected by SelectIntegrationFeatures() and anchors are determined using FindIntegrationAnchors(). The two datasets were then integrated with the IntegrateData() function. To visualize all the cells together, all the cells were co-embedded in the same low-dimensional space. To annotate cell types, BICCN MapMyCells program is utilized, using hierarchical mapping knowledge.brain- map.org / mapmycells / process / , high probability labels were used to annotate single cells. 84The Experimental Results are now described Overview of IRISeq (Imaging Reconstruction using Indexed Sequencing)

[0246] The optimized IRISeq protocol comprises several key steps (Figure 4A-4B, Figure 5): (i) Bead preparation: Two types of oligo-barcoded beads are prepared: 'receiver beads' coated with PolyT sequences to capture nearby cellular mRNA and 'sender beads' with a photocleavable linker and a PolyA sequence. These barcoded beads are created through a split-pool ligation approach (Delley et al., 2021, Sci. Rep.11, 10857), such that each bead has its unique barcode (Figure 5A). (ii) Photocleavage and oligo capture: Beads are evenly distributed on a glass slide. A UV device is then utilized to photocleave oligos from the sender beads, which then diffuse and are captured by the receiver beads, mimicking the capture of tissue mRNA (Figure 5B). The bead array is then frozen on dry ice to stabilize it. (iii) Tissue transfer and mRNA capture: Frozen tissue sections are transferred onto this array. The mRNA from the tissue is then captured by the receiver beads through hybridization and tissue digestion processes. (iv) Reverse transcription and sequencing: post tissue digestion, beads are collected for reverse transcription, second strand synthesis, tagmentation, and PCR, followed by sequencing to obtain transcriptome data and bead connection details. Detailed IRISeq protocols are provided in Example 2 to enable cost-efficient spatial transcriptomic mapping of large tissue sections in individual laboratories.

[0247] After library preparation and sequencing, the output from IRISeq includes a bead- bead interaction counts matrix, which identifies connections between sender and receiver beads, and a gene expression matrix that details transcripts mapped to each receiver bead (Figure 4C, left). To determine the global spatial positions of the receiver beads, principal component analysis (PCA) was applied to the bead-bead interaction matrix, followed by Uniform Manifold Approximation and Projection (UMAP) analysis (McInnes et al., 2018, arXiv:1802.03426) (Figure 7). The resulting 2D UMAP coordinates reflect the designed layout of the assay, preserving the positional relationships among the beads (Figure 4C, middle). Furthermore, dimension reduction and clustering techniques were utilized on the gene expression matrix to annotate each receiver bead based on region-specific gene expression patterns (Figure 4C, right). This was followed by cell-type-specific deconvolution analysis, integrating single-cell RNA-seq data to map diverse cell types and quantify their spatial interactions. 85

[0248] As an initial demonstration of IRISeq, a coronal mouse brain section was profiled using a 0.6 cm x 0.6 cm bead array with a bead diameter of approximately 50 μm (Figure 4D). This experiment yielded 5,028 receiver beads, each capturing a median of 4,587 unique transcripts (2,535 genes) and 1,998 unique bead-bead connection oligos, with each receiver bead connecting to a median of five sender beads (Figure 4E-4F, Figure 7A). Clustering analyses based on the gene expression profiles of all receiver beads identified 12 transcriptionally distinct brain region clusters, including cortical, caudal putamen, amygdalar, ventricles, white matter, and midbrain regions, validated using region-specific gene markers (Figure 4G, Figure 7B). Further validation was achieved by integrating the IRISeq data with the published 10x Visium spatial transcriptome dataset (Sziraki et al., 2023, Nat. Genet.55, 2104–2116), which showed consistent region-specific gene expression patterns across spatial locations (Figure 7B-7D). The spatial locations of all receiver beads were then mapped based solely on their connection signals with sender beads (Figure 4F). The resulting reconstructed image preserved the local neighborhood structure of the receiver beads and accurately positioned beads from different regions to their expected locations, similar to the pre-indexed 10x Visium oligo array (Figure 4H, Figure 7D-7F). This success highlights the capability of IRISeq to map the spatially barcoded transcriptome without the need for optical imaging.

[0249] A distinctive feature of IRISeq is its ability to construct the spatial distribution of microbeads based solely on their local interactions, bypassing the need for pre-indexed bead arrays or imaging to decode transcript locations. This enables the spatial profiling of large tissue sections beyond the typical size limits of conventional methods, such as the 0.65 cm x 0.65 cm restriction with the commercial 10x Visium platform (Ståhl et al., 2016, Science 353, 78–82). Demonstrating this capability, a large 1.5 cm x 1.5 cm bead array was constructed without subdivisions, allowing the simultaneous profiling of two entire mouse brain coronal sections (Figure 4I). This setup recovered a total of 14,756 receiver beads, each yielding a median of 5,329 unique transcripts and 652 unique bead-to-bead connection oligos. Similar to its performance on the small array, IRISeq effectively mapped transcriptionally distinct brain regions to their precise spatial locations on the large array (Figure 4J-4L), which underscores its efficacy in spatial transcriptomics analysis for large tissue areas.

[0250] Another distinctive feature of IRISeq is its adaptable resolution, achieved by adjusting the size of the beads used in the bead array—an approach similar to other bead-based 86spatial transcriptomics methods (Rodriques et al., 2019, Science 363, 1463–1467; Stickels et al., 2021, Nat. Biotechnol.39, 313–319). To enable high-resolution spatial transcriptomics profiling, a dendrimer-based strategy was employed during bead synthesis (Figure 9A), similar to a previous study that generated high-density DNA arrays (Cao et al., 2024, Nature Biotechnology 42, 1735–1746). This dendrimer strategy markedly increased the oligo density on the bead surface, as evidenced by the significant enhancement in fluorescence intensity on coated beads compared to uncoated ones (Figure 8A). Afterward, DNA primers were conjugated to the beads, followed by split-pool bead barcoding (Figure 9A).

[0251] Using high-DNA density beads in two sizes (5 µm and 10 µm), the ability of IRISeq to achieve high-resolution spatial transcriptome in a mouse hindbrain coronal hemisection was evaluated. At a sequencing depth of approximately 600 million reads, IRISeq recovered 384,802 pre-filtered 10 µm beads, while Slide-seqV2 (Langlieb et al., 2023, Nature 624, 333–342) recovered only 18,104 beads despite nearly doubled sequencing depth (Figure 8B). The quality assessment further demonstrated robust performance: the bead array with a 10 µm size yielded a median capture of 926 UMIs and 646 genes per receiver bead, whereas the bead array with a 5 µm size yielded a median capture of 404 UMIs and 309 genes per receiver bead (Figure 8C). Additionally, both bead arrays performed well in recovering high-resolution spatial brain structures. Clustering analyses based on the gene expression profiles of all receiver beads (Figure 8D-8E) revealed distinct, high-resolution brain region clusters (Figure 9B-9C, 9E- 9F). Despite the reduced bead size, the connection signals between beads enabled the precise reconstruction of the global distribution of most sender beads and detailed mapping of gene expression features with high specificities. For example, specific markers such as Calb1 in Purkinje neurons (Figure 9D) and C1ql2 in the dentate gyrus (Figure 9G) were accurately localized, aligning with data from published spatial transcriptomics studies (Langlieb et al., 2023, Nature 624, 333–342). Moreover, an annotated single-cell reference from the mouse brain (Kleshchevnikov et al., 2022, Nat Biotechnol 40, 661–671) was utilized to evaluate the performance of 10 µm beads in capturing single-cell transcriptomic profiles. Derived from the same tissue region as the spatial transcriptomics analysis, the reference enabled identification of all major cell types and map them onto the spatial data (Figure 9F). Similar to the 10 µm beads, the 5 µm bead array also enabled detailed mapping of gene expressions (e.g., Ttr in the ventricles; Hpca in the hippocampus; Figure 8F). However, global reconstruction with UMAP 87did not fully capture the tissue architecture, likely due to its limitations in handling the larger dataset produced by the 5 µm array, which contains more than twice as many beads and consequently increases bead-bead interactions (Figure 8F).

[0252] In summary, the IRISeq platform distinguishes itself from traditional spatial genomic methods through several unique features: (i) Cost-effectiveness: IRISeq is significantly more affordable than commercial platforms, costing approximately $30 per tissue section (or less than $1 per mm²) (Figure 4B), compared to over $1,000 per section typically required by other commercial methods (Bressan et al., 2023, Science 381, eabq4964). (ii) Scalability: the ability to process multiple tissue sections in a large-area array facilitates comparative studies of various conditions and replicates within the same experiment. (iii) Optics-free spatial mapping: By relying on local neighborhood interactions for spatial reconstruction, IRISeq is particularly well- suited for profiling large tissues without the need for imaging. (iv) Adjustable resolution: IRISeq offers flexibility to explore gene expression and cellular interactions at different scales by varying bead sizes. This adaptability makes IRISeq a versatile tool suitable for a wide array of research applications. A spatially resolved transcriptome atlas of the mouse brain

[0253] With the IRISeq platform, a spatial transcriptome analysis of the brains of adult (4-month) and aged (23-month) wild-type C57BL / 6 female mice were conducted, with three replicates per age group (Figure 10A). Twenty-four coronal sections were profiled in total, including one section each for the frontal and middle part of the cortex ("Section 1" and "Section 2"), and two adjacent sections near the dorsal part of the cortex ("Section 3") (Figure 10A). These sections covered brain areas from the frontal part of the isocortex to the dorsal aspect of the cortex, including the hippocampus, thalamus, hypothalamus, and others. Following data processing and quality control to exclude low-quality receiver beads, a median of 6,358 receiver beads were recovered per section, resulting in a total of 98,006 spatially distinct transcriptome profiles (Figure 10B). Of note, these samples were profiled using an earlier version of IRISeq (0.6cm x 0.6cm bead array with a bead size of ~50um), which has slightly lower efficiency compared to the optimized version (protocol details in Example 2). Nevertheless, an average of 3,725 unique transcripts (median of 2,670) and 6,771 unique bead-bead connection oligos (median of 4,209) were successfully recovered per receiver bead (Figure 10C-10D). 88

[0254] To annotate spatially barcoded transcriptome profiles across brain regions, LIGER (Welch et al., 2019, Cell 177, 1873–1887.e17), a non-negative matrix factorization technique, to integrate gene expression data from IRISeq with published spatial transcriptomics datasets profiling corresponding sections (Langlieb et al., 2023, Nature 624, 333–342; Ortiz et al., 2020, Sci Adv 6, eabb3446) was utilized. The spatially resolved transcriptomes from IRISeq showed a high degree of overlap with published datasets, enabling the identification of twenty-five distinct brain regions annotated from the existing studies (Figure 10E, Figure 11A). Based on bead connection data, the spatial distribution of each receiver bead was reconstructed across different sectioning regions. This reconstruction accurately mapped the receiver beads to specific brain regions, consistent with their gene expression-based annotations and with the published spatial transcriptome datasets (Figure 10F-10G, Figure 10I, Figure 11B). The region-specific gene expression signatures, such as Tac1 for the striatal and caudate putamen regions, and Ttr for the ventricles, further validated the accuracy of the spatial reconstruction (Figure 10G). These results underscore the capacity of the IRISeq platform to recover region-specific molecular signatures without reliance on pre-indexed oligo arrays or optical imaging.

[0255] To further investigate the spatial distribution of brain cell types, RCTD (Cable et al., 2022, Nat. Biotechnol.40, 517–526), a supervised learning approach that integrates spatial expression data with single-cell transcriptome data for mapping region-specific distribution of heterogeneous cell types, was utilized. RCTD computes mean gene expression profiles for each cell type from the scRNA-seq dataset and generates a spatial cell type map by representing each spatial transcriptomics pixel as a linear combination of these cell types. Using RCTD, the spatial transcriptomics data from IRISeq was integrated with a previously published brain single-cell transcriptome dataset that identified over 300 distinct cell subtypes across different age stages (Sziraki et al., 2023, Nat. Genet.55, 2104–2116). This integration effectively mapped known brain cell types and subtypes across various regions, such as different subtypes of striatal neuron 1, and choroid plexus epithelial subtypes in the ventricles (Figure 10H). As further validation, a high consistency in cell-type-specific locations inferred by IRISeq was observed compared to a spatial transcriptomics dataset generated using the 10X Visium platform (Sziraki et al., 2023, Nat. Genet.55, 2104–2116) (Figure 12).

[0256] Through differential analysis, highly region-specific gene features and cell types were identified (Figure 10I-10J, Table 12-13). For instance, genes like Ccdc153 and Rarres2 89were highly enriched in the ventricular areas of sections 2 and 3, consistent with previous findings (Miranda-Angulo et al., 2014, J. Comp. Neurol.522, 876–899; Campbell et al., 2017, Nat. Neurosci.20, 484–496). However, section-specific features were also evident, such as the enriched expression of Enpp2 only in section 3 (Figure 10I). Similarly, cell type distributions varied by section and region; specific choroid plexus subtypes (e.g., ChPec-2, ChPec-4) enrichment mainly appeared in section 3, corresponding with its prevalence near the ventricle regions. This analysis highlights the necessity of sampling multiple brain regions to map the spatial distribution of heterogeneous cell types. Age-associated changes in region-specific gene expression programs

[0257] Next, aging-associated gene expression changes were investigated by conducting differentially expressed gene (DEG) analysis across twenty-five brain regions, identifying 538 unique upregulated genes and 386 unique downregulated genes (FDR of 0.05 with more than three-fold changes between aged and young brains) (Figure 13A, Table 14). Among these, 80 downregulated and 33 upregulated genes consistently exhibited aging-associated changes in over ten brain regions (Figure 13B). Genes showing global downregulation were primarily associated with mitochondrial function and oxidative phosphorylation (e.g., COX8A, COX17), and ribosomal functions (e.g., Rpl30, Rps15a, Rps17) (Figure 14A). These findings are consistent with previous studies (Hahn et al., 2023, Cell 186, 4117–4133.e22; Gonskikh et al., 2017, Mech. Ageing Dev.168, 30–36), indicating significant declines in energy production, cellular metabolism, and protein synthesis in aged brains. Additionally, global downregulation of genes related to cilia functions (e.g., Cfap74, Catsperd) suggests potential age-related disruptions in ependymal cells. Given that ependymal cells rely on properly functioning cilia to regulate cerebrospinal fluid flow, changes in the expression of these genes may compromise ciliary performance, potentially leading to impaired fluid circulation and associated neurological deficits in the aging brain (Kumar et al., 2021, Fluids Barriers CNS 18, 31) (Figure 13B).

[0258] In contrast, genes upregulated across various aged brain regions were significantly enriched in immune response pathways, including the complement pathway (e.g., C4b, C1qa), antigen presentation (e.g., Psmb8, H2-Q7, B2m, H2-K1) and interferon response (e.g., Ifit3, Isg20, lsg15) (Figure 13B, Figure 14A). Notably, although interferon response- associated genes exhibited altered expression throughout the aged brain, the most pronounced 90changes occurred in the ventricular regions, a primary site of inflammation in brain aging (Hahn et al., 2023, Cell 186, 4117–4133.e22) (Figure 13C-13D). Furthermore, the published scRNA- seq dataset (Sziraki et al., 2023, Nat. Genet.55, 2104–2116) detected an increase in interferon- associated genes in ependymal cells, underscoring the enhanced interferon response in these areas (Figure 15).

[0259] Focusing on the ventricle regions, significant gene expression differences were observed between young and aged brains. The down-regulated genes are predominantly involved neurogenesis (e.g., Hdac8, Romo1), while the up-regulated genes indicated an increase in immune response and inflammation (e.g., C1qa, C1qb, Ctss, Ifit3), antigen presentation (e.g., B2m, H2-D1) and glial activation (e.g., Serpina3n, Gfap) (Figure 14B, upper panel). These changes suggest a state of chronic inflammation and heightened immune activity in the aged ventricles, associated with neurodegenerative processes in the aging brain (Adamu et al., 2024, Front. Aging Neurosci.16, 1347987). The gene expression changes were highly consistent across different ventricular regions from two coronal sections, demonstrating the robustness of the platform in identifying region-specific vulnerable genes in aging (Figure 14B, lower panel).

[0260] Meanwhile, some aging-associated expression changes are region-specific (Figure 13B). In several brain areas, downregulated genes are primarily neuronal markers involved in signaling and transcriptional regulation (e.g., Pvalb, Cck, Sst), suggesting neuronal loss with age (Figure 14C, left). Additionally, smooth muscle-related genes (e.g., Myom1, Mylk, Myl9) were significantly downregulated in aged brain vascular regions, indicating declining vascular integrity with age (Figure 14C, right). Conversely, region-specific upregulation includes lymphocyte markers (e.g., Cd24a, Ighm, and Cd52), particularly in the ventricles, white matter, and hypothalamus (Figure 14D). Notably, Sult1c1, associated with detoxification, hormone regulation, and inflammation (Kurogi et al., 2021, Expert Opin. Drug Metab. Toxicol.17, 767– 784), showed more than a fivefold increase in the aged ventricular region of section 3. Clec18a, known for its roles in metabolic and immune responses (Liao et al., 2023, Microbiol Spectr 11, e0290322), was uniquely upregulated in the aged habenular region. In contrast, the aged hypothalamic region displayed a significant decrease in Hcrt expression, which is linked to changes in sleep-wake cycles and appetite control in aging (Siegel, 2004, Annu. Rev. Psychol. 55, 125–148). The observed age-related, region-specific gene expression changes were further validated using the 10x Visium platform (Sziraki et al., 2023, Nat. Genet.55, 2104–2116) (Figure 9114E). Age-associated changes in the spatial distribution and interaction of different cell types

[0261] Using the cell-type-specific deconvolution approach RTCD (Cable et al., 2022, Nat. Biotechnol.40, 517–526) as previously described, IRISeq spatial expression data was integrated with a published single-cell transcriptome dataset (Sziraki et al., 2023, Nat. Genet.55, 2104–2116). This integration enabled mapping of previously annotated brain cell types and subtypes across various brain regions, identifying both widespread and region-specific cell types (Figure 10J). Differential abundance analyses were also conducted to explore region-specific cell population dynamics during aging. Additionally, by analyzing cell-cell co-locations on the same bead, cell-cell interactions were quantified and changes in these interactions were examined across regions (Figure 16A).

[0262] To analyze age-associated changes in the spatial distribution of cell types, cell- type-specific fractions were quantified across each of the twenty-five reconstructed brain regions. Using differential abundance analysis between adult and aged conditions, 123 region- specific differentially abundant cellular subtypes were identified (2-fold change between ages with an FDR of .05 or less) (Figure 16B-16C, Table 15). Despite the deconvolution pipeline not accounting for aging-associated cell dynamics, a comparison between the top region-specific cell population changes in the IRISeq spatial dataset and the published scRNA-seq dataset (Sziraki et al., 2023, Nat. Genet.55, 2104–2116) showed high consistency, validating the reliability of the cell type deconvolution pipeline and regional cell abundance analysis (Figure 16D).

[0263] Compared to single-cell analysis, spatial transcriptome analysis offers unique advantages for identifying region-specific cell population alterations in the aged brain. For example, the most depleted populations in the aged brain included OB neuroblasts (OBN 1-11, marked by Prokr2 and Robo2 (Zeisel et al., 2018, Cell 174, 999–1014.e22; Puverel et al., 2009, J. Comp. Neurol.512, 232–242)) and OB neuronal progenitor cells (OBN 1-17, marked by Mki67 and Egfr (Pastrana et al., 2009, Proc. Natl. Acad. Sci. U. S. A.106, 6387–6392)), both detected primarily in the reconstructed ventricle regions from section 2 (Figure 16C). This aligns with the well-known location of adult neurogenesis along the walls of the lateral ventricles (Lim et al., 2016, Cold Spring Harb. Perspect. Biol.8, a018820). Additionally, various vascular and blood cell types, including Myocd+ vascular smooth muscle cells (Myocd+ vSMC, EC-9), 92Cxcl12+ endothelial cells (EC-6), Nefh+ endothelial cells (EC-5), and Hbb-bs+ erythrocyte progenitor cells (EC-13) were significantly depleted (Figure 16C), consistent with age-related declines in blood flow, energy supply, and neurovascular functions (Bennet et al., 2024, Nat. Commun.15, 6398). The depletion of these cell types corresponds with global cell population changes (Figure 16D), indicating region-specific dysregulation of the vascular system in aging. Furthermore, a depletion of a specific ependymal cell subtype (marked by Slit2) was observed in the ventricles, corroborating the previous global single-cell analysis (Figure 15C-16D). Prior studies (Ozaki et al., 1993, Proc Natl Acad Sci U S A.90, 2593–2597) suggest that aging is associated with thinning the ependymal layer, which can disrupt cerebrospinal fluid (CSF) flow and impair the clearance of proteins and metabolites from brain tissue.

[0264] Meanwhile, several cell subtypes significantly expanded across different regions in the aged brain (Figure 16C-16D). These included a microglia subtype (MG-9, Apoe+, Csf1+), identified as disease-associated microglia ('DAM') (Keren-Shaul et al., 2017, Cell.169, 1276- 1290.e17) (Figure 16E, Figure 17A), and a reactive oligodendrocyte subtype (OLG-7, C4b+, Serpina3n+ (Zhou et al., 2020, Nat. Med.26, 131–142; Kenigsbuch et al., 2022, Nat. Neurosci. 25, 876–886)), both predominantly found in the white matter and ventricle regions, validated by the 10x Visium dataset (Sziraki et al., 2023, Nat. Genet.55, 2104–2116) (Figure 17B-17C). This expansion aligns with the notably upregulated inflammatory response in these areas (Figure 13D). Furthermore, a region-specific expansion of Lyz2+ border-associated macrophages (Lyz2+ BAM, MG-11) was observed around the meningeal regions (Figure 16C-16D). This cell type is known to degrade the extracellular matrix, contributing to vascular function defects (Da Mesquita et al., 2024, Trends Immunol.45, 346–357; Dermitzakis et al., 2023, Curr. Issues Mol. Biol.45, 4285–4300), which is consistent with the observed depletion of endothelial cells in the same region (Figure 16C-16D).

[0265] Leveraging the IRISeq platform, where each bead captures transcriptomes from multiple cells within the same neighborhood, the colocalization of two cell subtypes around the same beads was quantified to assess local cellular spatial interactions. Next, a differential analysis was conducted to identify cell-cell spatial interactions that are significantly altered with aging across various brain regions. This analysis revealed a total of 499 cell-cell spatial interaction pairs that are either significantly upregulated or downregulated in aging (1.5-fold change between ages with an FDR of 1e-5), prominently in regions such as the cortical 93associated area, olfactory / striatal area, amygdala, and white matter region (Figure 16F-16G, Table 16).

[0266] While most aging-associated changes in cell-cell interactions are highly region- specific, several interaction pairs were identified that consistently occur across multiple regions. For example, in the aged white matter, a significant decrease was observed in interactions between oligodendrocyte precursor cells (OLG-6) and Gfap-low Fact2-high astrocytes (Astrocyte-12) across different sections (Figure 16F), corresponding with their reduced abundance in these regions during aging (Figure 16C). Conversely, a notable increase in interactions was noted among three cell types: disease-associated microglia (‘DAM’, MG-9), reactive oligodendrocytes (OLIG-7), and Gfap-high activated astrocytes (Astrocyte-9), which are involved in astroglial activation and gliosis during aging and neurodegeneration (Brahmachari et al., 2006, J. Neurosci.26, 4930–4939) (Figure 16F-16G). The up-regulated co-localization of these cell types in the aged white matter could form a potential “DAM niche”, which was further validated by the 10x Visium technique (Figure 17).

[0267] To assess whether the increased spatial interaction of these cell subtypes is simply due to their expansion, a hypergeometric test was performed comparing the observed number of beads with colocalized cell types against a null model assuming random distribution within the region. The results demonstrate that the interactions between reactive oligodendrocytes, DAM, and activated astrocytes are not only more frequent in the aged brain but are also significantly enriched within the same neighborhood (p-values = 0.0005 and 1e-17 for interactions between DAM and reactive oligodendrocytes, and between DAM and activated astrocytes) (Figure 16H, Figure 17E). As a further validation, gene signature analysis of beads within the “DAM niche” shows significantly higher expression of markers for activated astrocytes (e.g., Gfap) and reactive oligodendrocytes (e.g., C4b) compared to non-DAM beads from the same region (Figure 16H, Figure 17F), underscoring altered cellular interaction and communication networks as key features of brain aging. Unraveling lymphocyte-driven mechanisms in mouse brain aging

[0268] Previous studies (Gemechu et al., 2012, Front Cell Neurosci 6, 38; Dulken et al., 2019, Nature 571, 205–210; Kaya et al., 2022, Nat Neurosci 25, 1446–1457) have shown aging is associated with increased lymphocyte presence in the brain parenchyma and this might be 94associated with increased presence of activated glial states and neuronal loss. Recent studies (Gate et al., 2020, Nature 577, 399–404; Gate et al., 2021, Science 374, 868–874) have also identified that T cells, particularly CD4+ subsets, infiltrate the central nervous system in neurodegenerative diseases like Lewy body dementia and Alzheimer's disease, contributing to neuronal damage. Aligning with these reports, a dramatic increase was observed in lymphocyte markers across different brain regions associated with aging (Figure 13). To further investigate the role of lymphocytes in brain aging, a systemic lymphocyte knockdown strategy was employed using two immunodeficient mouse genotypes—B6.129S7-Rag1tm1Mom / J and B6.Cg- Prkdcscid / SzJ—which lacks functional or mature lymphocytes (Mombaerts et al., 1992, Cell 68, 869–877; Dorshkind et al., 1984, J. Immunol.132, 1804–1808).

[0269] Utilizing the IRISeq platform, spatial transcriptome analysis was performed on the brains of 23-month-old wild-type and mutant mice (3 replicates per group). A total of 45 coronal sections were profiled—including representative sections from the frontal, middle, and dorsal cortex (Figure 18A)—thereby covering brain regions from the isocortex to areas such as the hippocampus, thalamus, and hypothalamus. After quality control filtering to remove low-quality receiver beads (Figure 19A-19B), a median of 7470 beads per section was recovered, yielding 363,777 spatially distinct transcriptome profiles (Figure 18B). Bead connection data enabled reconstruction of the spatial distribution of each bead across the sections, accurately mapping them to specific brain regions (Figure 18C).

[0270] To study lymphocyte deficiency-driven transcriptome changes, differential gene expression analysis was performed across twenty-five brain regions, identifying 132 upregulated genes and 252 downregulated genes (FDR < 0.05 with > three-fold changes between WT and mutant brains) (Figure 18D, Table 14). The genes that were globally upregulated showed mutant-specific effects. For example, several PRKDC-upregulated genes play key roles in senescence pathways, including Cdkn1a. The elevated expression of these senescence-associated genes is likely related to the accumulation of unrepaired DNA damage and chronic cellular stress arising from impaired DNA repair mechanisms in this specific mutant. Furthermore, the lack of functional lymphocytes diminishes immune surveillance, reducing the clearance of damaged or senescent cells and thereby reinforcing a pro-senescent environment. Other genes upregulated more than threefold in the Prkdc mutant include Ak7 and Foxj1, which are strongly expressed in ependymal cells, underscoring the preservation of the ependymal layer (Figure 18E, Figure 19C). 95Additionally, increased expression of Ttr, a marker for choroid plexus cells was observed. The most pronounced fold change occurred in the Habenuela—a region adjacent to the ventricles— although similar upregulation was also evident within the ventricles. In the Rag1 mutant, these genes were similarly upregulated in the Habenuela, albeit to a lesser extent (Figure 19C).

[0271] In contrast, the downregulated genes were more consistent across B6.129S7- Rag1tm1Mom / J and B6.Cg-Prkdcscid / SzJ mutants. As expected, a brain-wide decrease of lymphocyte marker genes was observed as Igkc across both mutants, a B cell marker, validating the depletion of mature B cells. Other genes that were significantly depleted were primarily associated with the interferon response pathway (e.g., Ifit3, Ifit3b, Oasl2) (Figure 18E). Notably, while aged wild-type brains show increased interferon-related gene expression compared to young brains (Figure 13D), this activation is markedly diminished in lymphocyte-deficient mutants (Figure 18F-18G). Interestingly, although interferon-related gene expression was generally reduced in the aged brains of lymphocyte-deficient mutants, the most pronounced decreases were observed in the lateral ventricular regions and to a lower extent also the white matter—areas that are key sites of inflammation during brain aging (Hahn et al., 2023, Cell 186, 4117–4133.e22) (Figure 18E-18G). Previous studies reported that aging-associated interferon signatures peak in the ventricular regions of both humans and mice (Baruch et al., 2014, Science 346, 89–93). While the cause remains unclear, these findings show that lymphocyte depletion significantly reduces this signature, underscoring the role of lymphocytes in interferon activation and suggesting that targeted lymphocyte ablation may help mitigate ventricular inflammation in the aging brain.

[0272] To further elucidate lymphocyte-driven mechanisms in brain aging, the transcriptional profiles of single cells isolated from brain sections of aged wild-type and lymphocyte-deficient mice were analyzed using the EasySci platform—an optimized single-cell combinatorial indexing method (Martin et al., 2023, Nat. Protoc.18, 188–207; Cusanovich et al., 2015, Science 348, 910–914; Cao et al., 2017, Science 357, 661–667; Cao et al., 2019, Nature 566, 496–502). In total, 36 samples were profiled: the three brain regions included in the IRISeq analysis, as well as the midbrain and hindbrain regions omitted from the spatial analysis. Samples were derived from wild-type mice and two immune-deficient genotypes, with three biological replicates per condition. After sequencing and rigorous filtering to remove low-quality cells and doublets, 783,264 high-quality single-nucleus gene expression profiles (Figure 20A) 96were obtained, with an average of 3,155 unique transcripts per cell (median = 2,122 UMIs; Figure 21A). UMAP visualization and Leiden clustering (Traag et al., 2019, Sci. Rep.9, 5233) revealed 42 major cell types (Figure 20B, Figure 21B), which was annotated using predicted labels from published brain atlas data (Sziraki et al., 2023, Nat. Genet.55, 2104–2116; Yao et al., 2023, Nature 624, 317–332) (Figure 22-24). The anatomical origins of these cell types further validated the annotations (Figure 21B); for example, dentate gyrus glutamatergic neurons (DG Glut) and thalamic glutamatergic neurons (TH Glut) predominantly originated from the hippocampal section (Section 3), while cerebellar granule glutamatergic neurons (CB Granule Glut) and Bergmann glial cells were exclusively identified in the midbrain / hindbrain regions.

[0273] A differential gene expression (DE) analysis was performed across 42 brain cell types, identifying 9,860 and 7,836 cell-type-specific DE genes in Rag1 and Prkdc mutants, respectively. Among these, 2,113 DE genes were shared between the two mutants, exhibiting significantly consistent changes (Pearson r = 0.87, p-value < 2.2e-16, Figure 20C). Gene Ontology (GO) analysis revealed that the shared upregulated genes were enriched in neurogenesis and axonogenesis pathways (Figure 20D), consistent with the regulatory function of inflammatory lymphocytes in suppressing neurogenesis (Wang et al., 2010, J Neurosci 30, 5020–5027). Focusing on immune cell populations, 55 shared DE genes displaying consistent changes in both mutants (Figure 20E) were found. Notably, immune-response genes, such as Igkc and Ighm—both key to B-cell receptor assembly—were significantly downregulated in both immune-deficient mutants (Figure 20E). Their reduced expression indicates impaired B-cell development, aligning with the known roles of Rag1 and Prkdc in V(D)J recombination and DNA repair (Gellert, 2002, Annu Rev Biochem 71, 101–132; Yin et al., 2021, Tumori 107, 483– 488).

[0274] To further validate lymphocyte deficiency in both mutants, 18,588 immune cells were extracted for clustering analysis, which yielded nine distinct immune cell populations— including T and B lymphocytes as well as different microglia subtypes—based on cell-type- specific markers (Figure 20F-20G). Differential abundance analysis using Milo (Dann et al., 2021, Nature Biotechnology 40, 245–253) confirmed a significant depletion of lymphocytes in the mutants, as expected (Figure 20H). In contrast, major microglial subtypes such as proliferating microglia and disease-associated microglia (DAM) showed minimal alterations, suggesting that their dynamics are less affected by lymphocyte depletion. Notably, a unique 97mutant-specific microglial state was identified characterized by the expression of genes involved in cholesterol biosynthesis (Dhcr7 (Freel et al., 2022, Dis Model Mech 15)) and calcium homeostasis (Tmtc2 (Sunryd et al., 2014, J Biol Chem 289, 16085–16099))( Figure 20H-20I). Although this state has not been reported previously, prior studies have shown that Dhcr7 is expressed in a subset of microglia, with mutations in Dhcr7 driving increased microglial activation and astrocyte reactivity (Freel et al., 2022, Dis Model Mech 15).

[0275] Next, how lymphocyte depletion affects other brain cell populations was investigated, focusing on the hippocampal as this region contains two regions of the lateral ventricles medial near the habenuela and lateral near the hippocampus, and also the third ventricles near the hypothalamus. Further, the spatial analysis revealed gene expression alterations in the ventricle regions (Figure 18E-18F). Both mutants exhibited consistent changes, including a reduction in pallidal-striatal GABAergic-cholinergic neurons (PAL-STR GABA- Chol) and an expansion of two ventricle-specific cell types—choroid plexus epithelial cells and ependymal cells (Figure 20J, Figure 25A). Notably, the increased abundance of ependymal cells in the mutants appears to counteract the typical age-related decline of this population (Figure 20K). This observation was further validated by cell-type deconvolution analysis of spatial IRISeq data, which confirmed elevated proportions of ependymal cells in ventricle regions across two different regions (Figure 20L).

[0276] Next, the molecular signatures underlying the increased abundance of ependymal cells in both immune-deficient mutants was examined. Notably, the expansion of these cells was

[0277] accompanied by a marked suppression of interferon signaling (Figure 20M), which is consistent with the spatial analysis revealing reduced interferon activity in the ventricle region (Figure 18G). In addition, 12 differentially expressed genes were identified that were significantly downregulated in ependymal cells from mutant mice, including key regulators of inflammation and complement activation (e.g., C3), DNA damage response (e.g., Ube2w), and Reissner’s fiber formation (e.g., Sspo) (Figure 20N, Figure 25B). This downregulation correlated with decreased activity in pathways related to complement activation (adjusted p-value = 0.03), NF-κB signaling (adjusted p-value = 0.04), and apoptotic cell clearance (adjusted p-value = 0.07) (Figure 20O). Collectively, these findings suggest that immune deficiency creates a molecular environment that favors the expansion of ependymal cells in the aging brain. 98Table 12: Region-specific gene features for reconstructed brain regions p_val^ avg_log2FC^ pct.1^ pct.2^ p_val_adj^ cluster^ gene^0^ 0.882517^ 0.757^ 5.86E‐01^ 0^ Cortex_section2^ Gm42418^0^ 0.827902^ 0.718^ 0.472^ 0^ Cortex_section2^ 1110008P14Rik^0^ 0.820293^ 0.984^ 0.91^ 0^ Cortex_section2^ Camk2n1^5.74E‐229^ 0.863123^ 0.416^ 0.272^ 1.47E‐224^ Cortex_section2^ Asxl2^1.04E‐188^ 0.951193^ 0.248^ 0.144^ 2.66E‐184^ Cortex_section2^ Epha6^3.17E‐162^ 0.930458^ 0.443^ 0.314^ 8.13E‐158^ Cortex_section2^ mt‐Tp^1.37E‐142^ 1.064212^ 0.181^ 0.102^ 3.52E‐138^ Cortex_section2^ Lama4^0^ 1.676138^ 0.841^ 5.95E‐01^ 0^ Substantia^Inominata_section2^ Gm42418^0^ 1.32007^ 0.332^ 3.00E‐02^ 0^ Substantia^Inominata_section2^ A230065H16Rik^0^ 1.265098^ 0.359^ 6.40E‐02^ 0^ Substantia^Inominata_section2^ Nts^0^ 1.202137^ 0.616^ 0.253^ 0^ Substantia^Inominata_section2^ Zcchc12^0^ 1.133416^ 0.423^ 0.112^ 0^ Substantia^Inominata_section2^ Zic1^0^ 1.072338^ 0.855^ 0.641^ 0^ Substantia^Inominata_section2^ Nap1l5^0^ 0.998176^ 0.442^ 0.173^ 0^ Substantia^Inominata_section2^ Slc32a1^0^ 0.95487^ 0.692^ 0.418^ 0^ Substantia^Inominata_section2^ Resp18^0^ 0.843971^ 0.885^ 6.84E‐01^ 0^ Substantia^Inominata_section2^ 6330403K07Rik^0^ 0.816209^ 0.417^ 1.47E‐01^ 0^ Substantia^Inominata_section2^ Gad2^0^ 2.136228^ 0.765^ 3.48E‐01^ 0^ White^matter_section2^ Cldn11^0^ 1.938778^ 0.964^ 7.66E‐01^ 0^ White^matter_section2^ Plp1^0^ 1.83919^ 0.846^ 4.79E‐01^ 0^ White^matter_section2^ Mobp^0^ 1.737748^ 0.933^ 0.676^ 0^ White^matter_section2^ Mbp^0^ 1.572399^ 1^ 0.998^ 0^ White^matter_section2^ Fth1^1.59E‐293^ 1.938782^ 0.607^ 0.218^ 4.07E‐289^ White^matter_section2^ Opalin^5.56E‐292^ 1.78449^ 0.836^ 0.479^ 1.43E‐287^ White^matter_section2^ Apod^4.17E‐275^ 1.598998^ 0.832^ 0.512^ 1.07E‐270^ White^matter_section2^ Cryab^7.42E‐272^ 1.703354^ 0.683^ 0.289^ 1.90E‐267^ White^matter_section2^ Ppp1r14a^4.52E‐267^ 1.685574^ 0.658^ 0.268^ 1.16E‐262^ White^matter_section2^ Mog^0^ 2.767919^ 0.894^ 0.326^ 0^ Caudate^Putamen_section2^ Penk^0^ 2.234599^ 0.923^ 0.489^ 0^ Caudate^Putamen_section2^ Arpp21^0^ 2.20195^ 0.771^ 0.246^ 0^ Caudate^Putamen_section2^ Ppp1r1b^0^ 2.081863^ 0.528^ 0.085^ 0^ Caudate^Putamen_section2^ Lrrc10b^0^ 2.033769^ 0.66^ 0.198^ 0^ Caudate^Putamen_section2^ Gng7^0^ 2.03299^ 0.731^ 0.225^ 0^ Caudate^Putamen_section2^ Tac1^0^ 2.014115^ 0.521^ 0.1^ 0^ Caudate^Putamen_section2^ Gpr88^0^ 1.948045^ 0.506^ 0.074^ 0^ Caudate^Putamen_section2^ Syndig1l^0^ 1.932474^ 0.447^ 0.061^ 0^ Caudate^Putamen_section2^ Scn4b^0^ 1.874404^ 0.464^ 0.076^ 0^ Caudate^Putamen_section2^ Rxrg^0^ 2.519459^ 0.896^ 0.341^ 0^ Nucleus^Accumbens_section2^ Penk^0^ 1.971835^ 0.76^ 0.238^ 0^ Nucleus^Accumbens_section2^ Tac1^0^ 1.858533^ 0.902^ 5.01E‐01^ 0^ Nucleus^Accumbens_section2^ Arpp21^0^ 1.755965^ 0.784^ 0.389^ 0^ Nucleus^Accumbens_section2^ Crym^0^ 1.661996^ 0.622^ 0.211^ 0^ Nucleus^Accumbens_section2^ Gng7^0^ 1.622335^ 0.657^ 0.296^ 0^ Nucleus^Accumbens_section2^ Tmem158^0^ 1.43594^ 0.671^ 0.262^ 0^ Nucleus^Accumbens_section2^ Ppp1r1b^0^ 1.294762^ 0.297^ 0.052^ 0^ Nucleus^Accumbens_section2^ Pdyn^0^ 1.282772^ 0.424^ 0.113^ 0^ Nucleus^Accumbens_section2^ Gpr88^1.17E‐307^ 1.02256^ 0.231^ 0.041^ 3.00E‐303^ Nucleus^Accumbens_section2^ Ido1^0^ 2.727949^ 0.673^ 0.049^ 0^ Ventricles_section2^ Ccdc153^0^ 2.454315^ 0.71^ 0.093^ 0^ Ventricles_section2^ Rarres2^0^ 2.276279^ 0.58^ 0.029^ 0^ Ventricles_section2^ Tmem212^0^ 1.986355^ 0.543^ 6.00E‐02^ 0^ Ventricles_section2^ Gm45396^0^ 1.677662^ 0.41^ 2.20E‐02^ 0^ Ventricles_section2^ 1700012B09Rik^0^ 1.608912^ 0.429^ 5.10E‐02^ 0^ Ventricles_section2^ Fam183b^0^ 1.59799^ 0.414^ 2.80E‐02^ 0^ Ventricles_section2^ Dynlrb2^0^ 1.556015^ 0.401^ 3.20E‐02^ 0^ Ventricles_section2^ Mia^0^ 1.526378^ 0.442^ 6.50E‐02^ 0^ Ventricles_section2^ Tm4sf1^0^ 1.499316^ 0.425^ 4.80E‐02^ 0^ Ventricles_section2^ 1110017D15Rik^1.84E‐267^ 1.557032^ 0.796^ 2.65E‐01^ 4.71E‐263^ Lateral^Septum_section2^ Ppp1r1b^2.13E‐242^ 1.0412^ 0.493^ 0.104^ 5.48E‐238^ Lateral^Septum_section2^ Rgs9^3.09E‐215^ 0.898028^ 0.422^ 0.088^ 7.94E‐211^ Lateral^Septum_section2^ Dgkb^9.07E‐209^ 3.374667^ 0.899^ 0.602^ 2.33E‐204^ Lateral^Septum_section2^ Gm42418^4.97E‐198^ 0.951983^ 0.453^ 0.104^ 1.28E‐193^ Lateral^Septum_section2^ Pde10a^1.40E‐196^ 0.910279^ 0.485^ 0.115^ 3.60E‐192^ Lateral^Septum_section2^ Gpr88^1.70E‐195^ 1.400085^ 0.899^ 0.505^ 4.37E‐191^ Lateral^Septum_section2^ Arpp21^2.70E‐185^ 1.059864^ 0.533^ 0.147^ 6.92E‐181^ Lateral^Septum_section2^ Rasd2^998.38E‐179^ 1.19863^ 0.564^ 0.172^ 2.15E‐174^ Lateral^Septum_section2^ Meis2^2.60E‐174^ 0.982479^ 0.814^ 0.347^ 6.67E‐170^ Lateral^Septum_section2^ Penk^0^ 1.116325^ 0.649^ 0.25^ 0^ Cortical_associated_area_section1^ 3110035E14Rik^0^ 0.807571^ 0.792^ 0.463^ 0^ Cortical_associated_area_section1^ Lmo4^0^ 0.806904^ 0.774^ 4.65E‐01^ 0^ Cortical_associated_area_section1^ Efhd2^0^ 2.659548^ 0.846^ 2.27E‐01^ 0^ Olfactory_Striatal_area_section1^ Tac1^0^ 1.928402^ 0.784^ 2.52E‐01^ 0^ Olfactory_Striatal_area_section1^ Ppp1r1b^0^ 1.890817^ 0.847^ 3.34E‐01^ 0^ Olfactory_Striatal_area_section1^ Penk^0^ 1.606141^ 0.814^ 3.51E‐01^ 0^ Olfactory_Striatal_area_section1^ Pcp4l1^0^ 1.589596^ 0.909^ 4.95E‐01^ 0^ Olfactory_Striatal_area_section1^ Arpp21^0^ 1.560456^ 0.53^ 1.05E‐01^ 0^ Olfactory_Striatal_area_section1^ Gpr88^0^ 1.549654^ 0.55^ 1.30E‐01^ 0^ Olfactory_Striatal_area_section1^ Cartpt^0^ 1.372177^ 0.785^ 3.83E‐01^ 0^ Olfactory_Striatal_area_section1^ Crym^0^ 1.368722^ 0.489^ 9.40E‐02^ 0^ Olfactory_Striatal_area_section1^ Rgs9^0^ 1.366366^ 0.635^ 0.205^ 0^ Olfactory_Striatal_area_section1^ Gng7^3.43E‐221^ 2.970669^ 0.643^ 0.083^ 8.81E‐217^ Glia_Endothelial_rich_region_section1^ Mgp^7.49E‐197^ 0.850159^ 0.186^ 0.008^ 1.92E‐192^ Glia_Endothelial_rich_region_section1^ Fmod^7.16E‐196^ 1.523415^ 0.312^ 0.021^ 1.84E‐191^ Glia_Endothelial_rich_region_section1^ Tagln^2.86E‐195^ 2.21287^ 0.371^ 0.03^ 7.35E‐191^ Glia_Endothelial_rich_region_section1^ Acta2^2.80E‐175^ 0.954568^ 0.195^ 0.009^ 7.19E‐171^ Glia_Endothelial_rich_region_section1^ Eln^6.03E‐170^ 0.81158^ 0.244^ 0.015^ 1.55E‐165^ Glia_Endothelial_rich_region_section1^ Bmp4^7.59E‐142^ 0.87678^ 0.19^ 0.011^ 1.95E‐137^ Glia_Endothelial_rich_region_section1^ Edn1^2.43E‐137^ 2.117283^ 0.412^ 0.051^ 6.23E‐133^ Glia_Endothelial_rich_region_section1^ Myl9^4.01E‐134^ 1.503701^ 0.407^ 0.049^ 1.03E‐129^ Glia_Endothelial_rich_region_section1^ Igf2^1.10E‐123^ 0.854399^ 0.208^ 0.015^ 2.83E‐119^ Glia_Endothelial_rich_region_section1^ Mustn1^5.98E‐262^ 0.865478^ 0.952^ 0.765^ 1.53E‐257^ White^matter_section1^ Plp1^0^ 0.94943^ 0.402^ 2.49E‐01^ 0^ Cortex_section3^ Lamp5^0^ 0.89622^ 0.962^ 0.83^ 0^ Cortex_section3^ Nrgn^0^ 0.86922^ 0.411^ 0.27^ 0^ Cortex_section3^ 1700016P03Rik^0^ 2.692089^ 0.616^ 0.021^ 0^ Habenuela_V3_section3^ Gng8^0^ 2.478511^ 0.592^ 0.034^ 0^ Habenuela_V3_section3^ Tac2^0^ 2.387416^ 0.723^ 0.117^ 0^ Habenuela_V3_section3^ Zic1^0^ 2.299038^ 0.594^ 0.06^ 0^ Habenuela_V3_section3^ Sncg^0^ 2.252375^ 0.723^ 0.122^ 0^ Habenuela_V3_section3^ Calb2^0^ 2.170194^ 0.795^ 0.3^ 0^ Habenuela_V3_section3^ Ttr^0^ 2.152068^ 0.548^ 0.062^ 0^ Habenuela_V3_section3^ Nwd2^0^ 2.029394^ 0.727^ 0.214^ 0^ Habenuela_V3_section3^ Necab2^0^ 1.487287^ 0.385^ 0.051^ 0^ Habenuela_V3_section3^ Ccdc153^0^ 1.317059^ 0.285^ 0.002^ 0^ Habenuela_V3_section3^ Nppa^0^ 1.041112^ 0.857^ 6.67E‐01^ 0^ Interneurons_section3^ mt‐Nd5^0^ 1.03336^ 0.95^ 8.11E‐01^ 0^ Interneurons_section3^ mt‐Co1^0^ 0.998395^ 1^ 9.98E‐01^ 0^ Interneurons_section3^ mt‐Rnr2^0^ 0.968604^ 0.983^ 9.21E‐01^ 0^ Interneurons_section3^ mt‐Nd4^0^ 0.886245^ 0.997^ 9.73E‐01^ 0^ Interneurons_section3^ mt‐Cytb^0^ 0.882287^ 0.959^ 8.62E‐01^ 0^ Interneurons_section3^ mt‐Nd2^0^ 0.865681^ 1^ 9.92E‐01^ 0^ Interneurons_section3^ mt‐Rnr1^6.19E‐273^ 1.055497^ 0.712^ 4.94E‐01^ 1.59E‐268^ Interneurons_section3^ Camk2a^7.39E‐272^ 0.974213^ 0.717^ 0.517^ 1.90E‐267^ Interneurons_section3^ Slc1a2^5.33E‐213^ 0.98713^ 0.217^ 0.075^ 1.37E‐208^ Interneurons_section3^ Cabp7^0^ 3.68923^ 0.33^ 0.037^ 0^ Hypothalamus_section3^ Pmch^0^ 3.149743^ 0.222^ 0.018^ 0^ Hypothalamus_section3^ Hcrt^0^ 1.788348^ 0.447^ 0.107^ 0^ Hypothalamus_section3^ Calb2^0^ 1.537153^ 0.745^ 0.407^ 0^ Hypothalamus_section3^ Sparc^0^ 1.444377^ 0.591^ 0.244^ 0^ Hypothalamus_section3^ Zcchc12^0^ 1.428301^ 0.714^ 0.409^ 0^ Hypothalamus_section3^ Resp18^0^ 1.419066^ 0.789^ 0.461^ 0^ Hypothalamus_section3^ Nnat^0^ 1.38016^ 0.306^ 0.133^ 0^ Hypothalamus_section3^ Cartpt^0^ 1.28484^ 0.857^ 0.68^ 0^ Hypothalamus_section3^ 6330403K07Rik^0^ 1.274414^ 0.829^ 0.636^ 0^ Hypothalamus_section3^ Nap1l5^0^ 2.415473^ 0.483^ 0.014^ 0^ Hippocampus_DG_section3^ C1ql2^0^ 1.382729^ 0.875^ 0.651^ 0^ Hippocampus_DG_section3^ Ncdn^0^ 0.865687^ 0.177^ 0.014^ 0^ Hippocampus_DG_section3^ Crlf1^1.72E‐287^ 1.077542^ 0.926^ 0.751^ 4.41E‐283^ Hippocampus_DG_section3^ Olfm1^2.08E‐273^ 1.0033^ 0.245^ 0.047^ 5.33E‐269^ Hippocampus_DG_section3^ Cebpd^4.40E‐225^ 1.280681^ 0.349^ 0.104^ 1.13E‐220^ Hippocampus_DG_section3^ Fam163b^2.67E‐222^ 0.865126^ 0.23^ 0.049^ 6.84E‐218^ Hippocampus_DG_section3^ Plk5^9.92E‐218^ 1.087333^ 0.318^ 0.09^ 2.54E‐213^ Hippocampus_DG_section3^ Tubgcp2^5.78E‐212^ 1.250409^ 0.463^ 1.79E‐01^ 1.48E‐207^ Hippocampus_DG_section3^ Neurod2^1.74E‐211^ 1.045551^ 0.876^ 0.713^ 4.47E‐207^ Hippocampus_DG_section3^ Ppp3ca^1000^ 2.781681^ 0.614^ 0.079^ 0^ Thalamus_Central_Ventral_section3^ Prkcd^0^ 2.583701^ 0.5^ 0.054^ 0^ Thalamus_Central_Ventral_section3^ Tnnt1^0^ 2.000542^ 0.985^ 0.886^ 0^ Thalamus_Central_Ventral_section3^ Pcp4^0^ 1.863509^ 0.408^ 0.07^ 0^ Thalamus_Central_Ventral_section3^ Ramp3^0^ 1.844963^ 0.561^ 0.221^ 0^ Thalamus_Central_Ventral_section3^ Ccdc136^0^ 1.519071^ 0.383^ 0.103^ 0^ Thalamus_Central_Ventral_section3^ Zic1^0^ 1.348677^ 0.246^ 0.033^ 0^ Thalamus_Central_Ventral_section3^ Rgs16^0^ 1.348125^ 0.274^ 0.036^ 0^ Thalamus_Central_Ventral_section3^ Tcf7l2^0^ 1.253255^ 0.323^ 0.147^ 0^ Thalamus_Central_Ventral_section3^ Lrrtm1^0^ 1.22961^ 0.273^ 0.072^ 0^ Thalamus_Central_Ventral_section3^ Cox6a2^0^ 2.720008^ 0.89^ 0.491^ 0^ White^matter_section3^ Neat1^0^ 2.64512^ 0.986^ 0.758^ 0^ White^matter_section3^ Plp1^0^ 2.643168^ 0.893^ 0.463^ 0^ White^matter_section3^ Apod^0^ 2.534338^ 0.868^ 0.42^ 0^ White^matter_section3^ Trf^0^ 2.482302^ 0.897^ 4.62E‐01^ 0^ White^matter_section3^ Mobp^0^ 2.363809^ 0.957^ 6.65E‐01^ 0^ White^matter_section3^ Mbp^0^ 2.310655^ 0.763^ 3.33E‐01^ 0^ White^matter_section3^ Cldn11^0^ 2.154926^ 0.67^ 2.52E‐01^ 0^ White^matter_section3^ Mog^0^ 2.078657^ 0.662^ 2.84E‐01^ 0^ White^matter_section3^ Mal^0^ 2.054439^ 0.639^ 2.38E‐01^ 0^ White^matter_section3^ Mag^2.57E‐36^ 0.996226^ 0.53^ 0.462^ 6.59E‐32^ Cortex_Retrosplenial_Area_section3^ Pvalb^1.02E‐18^ 1.242072^ 0.107^ 0.054^ 2.61E‐14^ Cortex_Retrosplenial_Area_section3^ Pmch^1.54E‐06^ 0.853152^ 0.346^ 0.332^ 0.039484^ Cortex_Retrosplenial_Area_section3^ Vamp1^0^ 2.567091^ 0.546^ 0.044^ 0^ Hippocampus_CA1_CA2_CA3_section3^ Spink8^0^ 2.200404^ 0.991^ 0.8^ 0^ Hippocampus_CA1_CA2_CA3_section3^ Hpca^0^ 1.768173^ 0.598^ 0.172^ 0^ Hippocampus_CA1_CA2_CA3_section3^ Neurod6^0^ 1.678937^ 0.462^ 0.068^ 0^ Hippocampus_CA1_CA2_CA3_section3^ Cabp7^0^ 1.355093^ 0.769^ 4.51E‐01^ 0^ Hippocampus_CA1_CA2_CA3_section3^ Cnih2^0^ 1.338216^ 0.471^ 1.55E‐01^ 0^ Hippocampus_CA1_CA2_CA3_section3^ Wipf3^0^ 1.279753^ 0.509^ 1.88E‐01^ 0^ Hippocampus_CA1_CA2_CA3_section3^ Cpne6^0^ 1.038327^ 0.311^ 0.082^ 0^ Hippocampus_CA1_CA2_CA3_section3^ Gabra5^0^ 1.030493^ 0.94^ 0.735^ 0^ Hippocampus_CA1_CA2_CA3_section3^ Cck^0^ 1.024447^ 0.993^ 0.966^ 0^ Hippocampus_CA1_CA2_CA3_section3^ Tmsb4x^0^ 1.926879^ 0.549^ 0.204^ 0^ Amygdala_section3^ Lypd1^0^ 1.601235^ 0.63^ 0.296^ 0^ Amygdala_section3^ Nptxr^0^ 1.215796^ 0.416^ 0.134^ 0^ Amygdala_section3^ Hpcal1^0^ 1.013839^ 0.367^ 0.155^ 0^ Amygdala_section3^ Slc30a3^0^ 0.877187^ 0.909^ 0.744^ 0^ Amygdala_section3^ Olfm1^0^ 0.873898^ 0.602^ 0.389^ 0^ Amygdala_section3^ Syn2^0^ 0.803956^ 0.267^ 0.088^ 0^ Amygdala_section3^ Nov^1.35E‐258^ 0.89555^ 0.405^ 0.223^ 3.46E‐254^ Amygdala_section3^ Rprm^0^ 2.663604^ 0.762^ 0.458^ 0^ Thalamus_Reticular_Nucleus_section3^ Pvalb^1.56E‐239^ 1.144105^ 0.158^ 0.024^ 4.00E‐235^ Thalamus_Reticular_Nucleus_section3^ Spp1^2.13E‐173^ 0.89583^ 0.894^ 0.766^ 5.48E‐169^ Thalamus_Reticular_Nucleus_section3^ Plp1^3.23E‐131^ 0.808989^ 0.121^ 0.024^ 8.30E‐127^ Thalamus_Reticular_Nucleus_section3^ Syt2^2.37E‐130^ 1.38033^ 0.547^ 0.329^ 6.08E‐126^ Thalamus_Reticular_Nucleus_section3^ Vamp1^1.29E‐115^ 0.993417^ 0.647^ 0.438^ 3.32E‐111^ Thalamus_Reticular_Nucleus_section3^ Trf^5.74E‐89^ 1.049463^ 0.32^ 0.153^ 1.47E‐84^ Thalamus_Reticular_Nucleus_section3^ Kcnc1^7.43E‐86^ 1.179646^ 0.348^ 0.179^ 1.91E‐81^ Thalamus_Reticular_Nucleus_section3^ Slc32a1^1.91E‐85^ 1.071077^ 0.151^ 0.047^ 4.90E‐81^ Thalamus_Reticular_Nucleus_section3^ Six3^9.83E‐85^ 1.467839^ 0.474^ 3.13E‐01^ 2.52E‐80^ Thalamus_Reticular_Nucleus_section3^ Gad1^0^ 2.648592^ 0.857^ 3.37E‐01^ 0^ Caudate_Putamen_section3^ Penk^0^ 1.739963^ 0.651^ 2.36E‐01^ 0^ Caudate_Putamen_section3^ Tac1^0^ 1.726075^ 0.697^ 2.58E‐01^ 0^ Caudate_Putamen_section3^ Ppp1r1b^0^ 1.70138^ 0.448^ 1.10E‐01^ 0^ Caudate_Putamen_section3^ Gpr88^0^ 1.337394^ 0.353^ 1.00E‐01^ 0^ Caudate_Putamen_section3^ Rgs9^0^ 1.263222^ 0.793^ 5.01E‐01^ 0^ Caudate_Putamen_section3^ Arpp21^0^ 1.19393^ 0.229^ 3.60E‐02^ 0^ Caudate_Putamen_section3^ Adora2a^0^ 0.977138^ 0.224^ 3.90E‐02^ 0^ Caudate_Putamen_section3^ Ido1^0^ 0.935952^ 0.942^ 8.02E‐01^ 0^ Caudate_Putamen_section3^ Hpca^1.79E‐262^ 1.146144^ 0.478^ 0.212^ 4.59E‐258^ Caudate_Putamen_section3^ Gng7^0^ 3.209277^ 0.963^ 0.821^ 0^ Meninges_section3^ Ptgds^0^ 2.866747^ 0.91^ 0.593^ 0^ Meninges_section3^ Hbb‐bt^0^ 2.831199^ 0.992^ 0.931^ 0^ Meninges_section3^ Hbb‐bs^0^ 2.544063^ 0.81^ 0.342^ 0^ Meninges_section3^ Hba‐a1^0^ 2.45017^ 0.756^ 0.283^ 0^ Meninges_section3^ Hba‐a2^0^ 1.969335^ 0.484^ 0.076^ 0^ Meninges_section3^ Mgp^0^ 1.956259^ 0.426^ 0.092^ 0^ Meninges_section3^ Alas2^0^ 1.400496^ 0.379^ 0.043^ 0^ Meninges_section3^ Igf2^1010^ 1.299974^ 0.25^ 0.036^ 0^ Meninges_section3^ Isg20^0^ 1.083614^ 0.215^ 0.022^ 0^ Meninges_section3^ Cd74^0^ 6.11166^ 0.927^ 0.293^ 0^ Ventricles_section3^ Ttr^0^ 3.495038^ 0.716^ 0.21^ 0^ Ventricles_section3^ Enpp2^0^ 3.215004^ 0.727^ 0.042^ 0^ Ventricles_section3^ Ccdc153^0^ 2.963341^ 0.655^ 0.023^ 0^ Ventricles_section3^ Calml4^0^ 2.911575^ 0.62^ 0.03^ 0^ Ventricles_section3^ 1500015O10Rik^0^ 2.868677^ 0.589^ 0.078^ 0^ Ventricles_section3^ Col9a3^0^ 2.793541^ 0.698^ 0.052^ 0^ Ventricles_section3^ Gm45396^0^ 2.605227^ 0.52^ 0.012^ 0^ Ventricles_section3^ Folr1^0^ 2.569153^ 0.581^ 0.024^ 0^ Ventricles_section3^ Tmem212^0^ 2.509546^ 0.654^ 0.088^ 0^ Ventricles_section3^ Rarres2^3.45E‐48^ 1.010988^ 0.2^ 0.008^ 8.84E‐44^ Low_quality_section3^ Fmod^1.69E‐42^ 1.068962^ 0.156^ 0.005^ 4.33E‐38^ Low_quality_section3^ Fgfbp1^1.55E‐27^ 1.946152^ 0.267^ 0.024^ 3.98E‐23^ Low_quality_section3^ Dcn^1.58E‐24^ 0.937069^ 0.156^ 0.009^ 4.04E‐20^ Low_quality_section3^ Aldh1a2^6.72E‐21^ 1.111718^ 0.133^ 0.008^ 1.72E‐16^ Low_quality_section3^ Ogn^2.56E‐16^ 1.003445^ 0.156^ 0.014^ 6.56E‐12^ Low_quality_section3^ Gjb2^5.37E‐15^ 1.485883^ 0.156^ 0.015^ 1.38E‐10^ Low_quality_section3^ Aspg^2.65E‐14^ 1.17534^ 0.178^ 0.02^ 6.80E‐10^ Low_quality_section3^ Aebp1^7.36E‐13^ 0.997144^ 0.178^ 0.022^ 1.89E‐08^ Low_quality_section3^ Myoc^2.67E‐12^ 1.169656^ 0.111^ 0.01^ 6.86E‐08^ Low_quality_section3^ Eln^Table 13: Region-specific cell types for reconstructed brain regions. Cell_Subtype^ Percentage_contribution^ Brain_region^Astrocytes‐12^ 18.4665^ CTX2_S2^Astrocytes‐9^ 3.2266^ CTX2_S2^Astrocytes‐9^ 4.5187^ NA_S2^Choroid.plexus.epithelial.cells‐3^ 4.9582^ NA_S2^Endothelial.cells‐14^ 5.1429^ NA_S2^Endothelial.cells‐5^ 4.7912^ NA_S2^Microglia‐8^ 4.0791^ NA_S2^Striatal.neurons.1‐1^ 3.2527^ NA_S2^Striatal.neurons.1‐5^ 6.2945^ NA_S2^Striatal.neurons.1‐6^ 12.0879^ NA_S2^Striatal.neurons.1‐9^ 3.7978^ NA_S2^Astrocytes‐12^ 7.3912^ VEN_S2^Astrocytes‐9^ 6.0458^ VEN_S2^Choroid.plexus.epithelial.cells‐3^ 4.0363^ VEN_S2^Endothelial.cells‐14^ 4.7178^ VEN_S2^Endothelial.cells‐5^ 3.6170^ VEN_S2^Ependymal.cells‐3^ 9.1211^ VEN_S2^Striatal.neurons.1‐6^ 5.6089^ VEN_S2^Striatal.neurons.1‐9^ 3.1976^ VEN_S2^Astrocytes‐12^ 19.4240^ Septum_S2^Endothelial.cells‐14^ 6.7480^ Septum_S2^Endothelial.cells‐5^ 10.8892^ Septum_S2^Microglia‐8^ 3.2794^ Septum_S2^Striatal.neurons.1‐2^ 3.1953^ Septum_S2^Striatal.neurons.1‐6^ 6.2434^ Septum_S2^Striatal.neurons.1‐9^ 4.8350^ Septum_S2^Astrocytes‐12^ 22.1892^ CTX2_S3^Choroid.plexus.epithelial.cells‐3^ 4.6790^ CTX2_S3^Cortical.projection.neurons.1‐9^ 5.0207^ CTX2_S3^Endothelial.cells‐14^ 7.4994^ CTX2_S3^Endothelial.cells‐5^ 17.3335^ CTX2_S3^Microglia‐8^ 6.0998^ CTX2_S3^Astrocytes‐12^ 15.8024^ Hipp_CA_S3^Astrocytes‐9^ 4.2851^ Hipp_CA_S3^Choroid.plexus.epithelial.cells‐3^ 5.1442^ Hipp_CA_S3^Cortical.projection.neurons.1‐6^ 10.6425^ Hipp_CA_S3^Cortical.projection.neurons.1‐8^ 8.9555^ Hipp_CA_S3^Endothelial.cells‐14^ 5.6024^ Hipp_CA_S3^Endothelial.cells‐5^ 12.9543^ Hipp_CA_S3^Microglia‐8^ 8.1745^ Hipp_CA_S3^Astrocytes‐12^ 15.2317^ THcv_S3^Astrocytes‐9^ 3.7233^ THcv_S3^Choroid.plexus.epithelial.cells‐3^ 5.2134^ THcv_S3^Endothelial.cells‐14^ 5.6118^ THcv_S3^Endothelial.cells‐5^ 9.6578^ THcv_S3^Interbrain.and.midbrain.neurons.1‐6^ 12.8292^ THcv_S3^Astrocytes‐12^ 11.2978^ HAB_V3_S3Astrocytes‐9^ 6.6895^ HAB_V3_S3Choroid.plexus.epithelial.cells‐3^ 11.4464^ HAB_V3_S3Endothelial.cells‐14^ 4.0137^ HAB_V3_S3Endothelial.cells‐5^ 5.0989^ HAB_V3_S3Ependymal.cells‐3^ 3.3001^ HAB_V3_S3Habenula.neurons‐1^ 7.5814^ HAB_V3_S3Habenula.neurons‐2^ 4.6529^ HAB_V3_S3Habenula.neurons‐3^ 4.2069^ HAB_V3_S3Astrocytes‐12^ 17.7944^ CTX1_S3^Astrocytes‐9^ 3.3721^ CTX1_S3^Choroid.plexus.epithelial.cells‐3^ 4.5184^ CTX1_S3^Cortical.projection.neurons.1‐9^ 4.3565^ CTX1_S3^Endothelial.cells‐14^ 6.9815^ CTX1_S3^Endothelial.cells‐5^ 11.9369^ CTX1_S3^Microglia‐8^ 7.2276^ CTX1_S3^Astrocytes‐12^ 11.8873^ CRTX_RA_S3^Astrocytes‐9^ 4.1370^ CRTX_RA_S3^Choroid.plexus.epithelial.cells‐3^ 5.4566^ CRTX_RA_S3^Endothelial.cells‐14^ 6.8601^ CRTX_RA_S3^Endothelial.cells‐5^ 8.1274^ CRTX_RA_S3^Microglia‐8^ 4.9539^ CRTX_RA_S3^Astrocytes‐12^ 18.4026^ AMY_S3^Astrocytes‐9^ 3.7633^ AMY_S3^Choroid.plexus.epithelial.cells‐3^ 3.9715^ AMY_S3^103Cortical.projection.neurons.1‐1^ 3.5108^ AMY_S3^Endothelial.cells‐14^ 7.0893^ AMY_S3^Endothelial.cells‐5^ 12.8670^ AMY_S3^Microglia‐8^ 8.3932^ AMY S3^s_S3^s_S3^s_S3^s_S3^s_S3^s_S3^^^^^^^^^Oligodendrocytes‐2^ 3.0453^ THrn_S3^Oligodendrocytes‐6^ 3.8592^ THrn_S3^Astrocytes‐12^ 16.3760^ CTX_A_S1^Astrocytes‐9^ 4.6088^ CTX A S1^_S1^_S1^_S1^_S1^_S1^_S1^_S1^_S1^_S1^Ta e : gng-assocate erenta y expresse genes across ran regons. gene_id^ max.tissue^ second.tissue^ fold.change^ class^ RegionLrrc17^ Young^ Old^ 3.4187^ Young^ Cortex^Snrpg^ Young^ Old^ 3.0758^ Young^ Cortex^ala^ala^ala^ala^ala^ala^ala^ala^ala^ala^ala^ala^Catsperd^ Young^ Old^ 11.6768^ Young^ Amygdala^Hdac8^ Young^ Old^ 8.2950^ Young^ Amygdala^mt‐Tv^ Young^ Old^ 4.6478^ Young^ Amygdala^mt‐Tl1^ Young^ Old^ 3.3191^ Young^ Amygdala^mt‐Tq^ Young^ Old^ 5.3608^ Young^ Amygdala^mt‐Tm^ Young^ Old^ 3.0364^ Young^ Amygdala^mt‐Ta^ Young^ Old^ 5.0471^ Young^ Amygdala^mt‐Tp^ Young^ Old^ 3.0324^ Young^ Amygdala^Gm8292^ Young^ Old^ 3.2428^ Young^ Amygdala^Stau1^ Young^ Old^ 3.1177^ Young^ Thalamus_Reticular_Nucleus^Snhg8^ Young^ Old^ 4.9369^ Young^ Thalamus_Reticular_Nucleus^Lrrc17^ Young^ Old^ 3.7065^ Young^ Thalamus_Reticular_Nucleus^Cpt1c^ Young^ Old^ 3.3421^ Young^ Thalamus_Reticular_Nucleus^Lama4^ Young^ Old^ 13.0377^ Young^ Thalamus_Reticular_Nucleus^Pmch^ Young^ Old^ 7.1709^ Young^ Thalamus_Reticular_Nucleus^Nf2^ Young^ Old^ 4.4634^ Young^ Thalamus_Reticular_Nucleus^Hcrt^ Young^ Old^ 10.1933^ Young^ Thalamus_Reticular_Nucleus^A330033J07Rik^ Young^ Old^ 13.9091^ Young^ Thalamus_Reticular_Nucleus^Spidr^ Young^ Old^ 3.9977^ Young^ Thalamus_Reticular_Nucleus^Fam43a^ Young^ Old^ 4.5964^ Young^ Thalamus_Reticular_Nucleus^Tfrc^ Young^ Old^ 3.1427^ Young^ Thalamus_Reticular_Nucleus^Catsperd^ Young^ Old^ 15.6181^ Young^ Thalamus_Reticular_Nucleus^Hdac8^ Young^ Old^ 12.0592^ Young^ Thalamus_Reticular_Nucleus^mt‐Tv^ Young^ Old^ 4.7234^ Young^ Thalamus_Reticular_Nucleus^mt‐Tl1^ Young^ Old^ 3.1802^ Young^ Thalamus_Reticular_Nucleus^mt‐Tq^ Young^ Old^ 5.8462^ Young^ Thalamus_Reticular_Nucleus^mt‐Ta^ Young^ Old^ 6.8363^ Young^ Thalamus_Reticular_Nucleus^mt‐Tc^ Young^ Old^ 3.1601^ Young^ Thalamus_Reticular_Nucleus^mt‐Tl2^ Young^ Old^ 3.5445^ Young^ Thalamus_Reticular_Nucleus^mt‐Tp^ Young^ Old^ 3.8729^ Young^ Thalamus_Reticular_Nucleus^Erdr1^ Young^ Old^ 3.1963^ Young^ Thalamus_Reticular_Nucleus^Snhg8^ Young^ Old^ 3.9181^ Young^ Caudate_Putamen^Lrrc17^ Young^ Old^ 4.0337^ Young^ Caudate_Putamen^Snrpg^ Young^ Old^ 3.3792^ Young^ Caudate_Putamen^Cnot3^ Young^ Old^ 3.7738^ Young^ Caudate_Putamen^Lama4^ Young^ Old^ 14.7102^ Young^ Caudate_Putamen^Ddx21^ Young^ Old^ 5.6053^ Young^ Caudate_Putamen^Nf2^ Young^ Old^ 3.3841^ Young^ Caudate_Putamen^Pvalb^ Young^ Old^ 3.7213^ Young^ Caudate_Putamen^Spidr^ Young^ Old^ 3.7263^ Young^ Caudate_Putamen^Rps28^ Young^ Old^ 3.0118^ Young^ Caudate_Putamen^Catsperd^ Young^ Old^ 12.0621^ Young^ Caudate_Putamen^Cox8a^ Young^ Old^ 3.0514^ Young^ Caudate_Putamen^Hdac8^ Young^ Old^ 6.4644^ Young^ Caudate_Putamen^mt‐Tv^ Young^ Old^ 4.0335^ Young^ Caudate_Putamen^mt‐Tq^ Young^ Old^ 4.7942^ Young^ Caudate_Putamen^mt‐Tm^ Young^ Old^ 3.3750^ Young^ Caudate_Putamen^mt‐Ta^ Young^ Old^ 3.8140^ Young^ Caudate_Putamen^mt‐Tp^ Young^ Old^ 3.4322^ Young^ Caudate_Putamen^Gm561^ Young^ Old^ 3.4535^ Young^ Caudate_Putamen^Erdr1^ Young^ Old^ 3.2282^ Young^ Caudate_Putamen^Snhg6^ Young^ Old^ 3.1905^ Young^ Meninges^Rpl37a^ Young^ Old^ 3.1386^ Young^ Meninges^Romo1^ Young^ Old^ 3.4236^ Young^ Meninges^Snhg8^ Young^ Old^ 3.2221^ Young^ Meninges^Tomm7^ Young^ Old^ 4.0736^ Young^ Meninges^Ddx21^ Young^ Old^ 4.0811^ Young^ Meninges^Pmch^ Young^ Old^ 4.5161^ Young^ Meninges^Myl4^ Young^ Old^ 4.8774^ Young^ Meninges^Rpl35a^ Young^ Old^ 3.8064^ Young^ Meninges^Gng13^ Young^ Old^ 3.8317^ Young^ Meninges^Rps28^ Young^ Old^ 4.0025^ Young^ Meninges^Gm42418^ Young^ Old^ 11.9285^ Young^ Meninges^Catsperd^ Young^ Old^ 5.9066^ Young^ Meninges^Cox8a^ Young^ Old^ 4.4272^ Young^ Meninges^Rpl39^ Young^ Old^ 3.1131^ Young^ Meninges^Hdac8^ Young^ Old^ 4.1249^ Young^ Meninges^mt‐Ta^ Young^ Old^ 4.6563^ Young^ Meninges^Usmg5^ Young^ Old^ 3.2440^ Young^ Meninges^106Rps24‐ps3^ Young^ Old^ 3.1076^ Young^ Meninges^Erdr1^ Young^ Old^ 3.0313^ Young^ Meninges^Gm8292^ Young^ Old^ 4.6383^ Young^ Meninges^Romo1^ Young^ Old^ 3.1839^ Young^ Ventricles^Snhg8^ Young^ Old^ 3.3638^ Young^ Ventricles^Hs3st4^ Young^ Old^ 3.1906^ Young^ Ventricles^Ccdc88a^ Young^ Old^ 3.6661^ Young^ Ventricles^Rprml^ Young^ Old^ 3.5948^ Young^ Ventricles^Gm17750^ Young^ Old^ 3.0038^ Young^ Ventricles^Gm42418^ Young^ Old^ 5.3975^ Young^ Ventricles^Catsperd^ Young^ Old^ 8.5787^ Young^ Ventricles^Hdac8^ Young^ Old^ 3.4058^ Young^ Ventricles^Ncl^ Young^ Old^ 8.5302^ Young^ Low_quality^Snrpe^ Young^ Old^ 10.6498^ Young^ Low_quality^Ufc1^ Young^ Old^ 18.2648^ Young^ Low_quality^Dnlz^ Young^ Old^ 11.2836^ Young^ Low_quality^Romo1^ Young^ Old^ 4.7294^ Young^ Low_quality^Stau1^ Young^ Old^ 12.6775^ Young^ Low_quality^Tpm3^ Young^ Old^ 66.7138^ Young^ Low_quality^Rps27^ Young^ Old^ 50.4180^ Young^ Low_quality^Mllt11^ Young^ Old^ 3.6066^ Young^ Low_quality^Ensa^ Young^ Old^ 7.1381^ Young^ Low_quality^Rps20^ Young^ Old^ 3.0156^ Young^ Low_quality^Penk^ Young^ Old^ 26.4006^ Young^ Low_quality^Nrd1^ Young^ Old^ 8.8350^ Young^ Low_quality^Vwa1^ Young^ Old^ 11.3755^ Young^ Low_quality^Smarcd3^ Young^ Old^ 46.7562^ Young^ Low_quality^Commd8^ Young^ Old^ 9.9066^ Young^ Low_quality^G3bp2^ Young^ Old^ 10.8900^ Young^ Low_quality^Hnrnpdl^ Young^ Old^ 43.5778^ Young^ Low_quality^Aldh2^ Young^ Old^ 6.5958^ Young^ Low_quality^Atp5j2^ Young^ Old^ 5.6266^ Young^ Low_quality^Ptn^ Young^ Old^ 4.4817^ Young^ Low_quality^Tra2a^ Young^ Old^ 9.4604^ Young^ Low_quality^Mgll^ Young^ Old^ 12.3290^ Young^ Low_quality^H2afj^ Young^ Old^ 5.6877^ Young^ Low_quality^Ndufa3^ Young^ Old^ 4.9412^ Young^ Low_quality^Sirt2^ Young^ Old^ 27.0612^ Young^ Low_quality^Cpt1c^ Young^ Old^ 20.5439^ Young^ Low_quality^Idh2^ Young^ Old^ 23991.1872^ Young^ Low_quality^Sec11a^ Young^ Old^ 8.8969^ Young^ Low_quality^Tmem126a^ Young^ Old^ 6.8301^ Young^ Low_quality^Arl6ip1^ Young^ Old^ 4.5707^ Young^ Low_quality^Bola2^ Young^ Old^ 41.3224^ Young^ Low_quality^Sirt3^ Young^ Old^ 10.1195^ Young^ Low_quality^Gcsh^ Young^ Old^ 38.7462^ Young^ Low_quality^Trappc4^ Young^ Old^ 3.8777^ Young^ Low_quality^Cib2^ Young^ Old^ 68.0399^ Young^ Low_quality^Nptn^ Young^ Old^ 9.4547^ Young^ Low_quality^Lrrfip2^ Young^ Old^ 30.5064^ Young^ Low_quality^Arpp21^ Young^ Old^ 125.4351^ Young^ Low_quality^Slc6a20a^ Young^ Old^ 53.8965^ Young^ Low_quality^Perp^ Young^ Old^ 11.9190^ Young^ Low_quality^Lama4^ Young^ Old^ 139.1450^ Young^ Low_quality^Ddx21^ Young^ Old^ 20.1251^ Young^ Low_quality^Agpat3^ Young^ Old^ 20.1710^ Young^ Low_quality^Rps15^ Young^ Old^ 3.8935^ Young^ Low_quality^Matk^ Young^ Old^ 47496.3316^ Young^ Low_quality^Cdk4^ Young^ Old^ 17.0816^ Young^ Low_quality^Ppp3r1^ Young^ Old^ 10.1595^ Young^ Low_quality^Sar1b^ Young^ Old^ 3.1215^ Young^ Low_quality^Sparc^ Young^ Old^ 3.5052^ Young^ Low_quality^Psmd3^ Young^ Old^ 8.4973^ Young^ Low_quality^Thra^ Young^ Old^ 3.5799^ Young^ Low_quality^Eif1^ Young^ Old^ 4.2921^ Young^ Low_quality^Rbfox3^ Young^ Old^ 7.2789^ Young^ Low_quality^Foxk2^ Young^ Old^ 3.2667^ Young^ Low_quality^Pdia6^ Young^ Old^ 4.2360^ Young^ Low_quality^Ywhaq^ Young^ Old^ 14.1493^ Young^ Low_quality^107Cfl2^ Young^ Old^ 4.1295^ Young^ Low_quality^Rps29^ Young^ Old^ 3.1172^ Young^ Low_quality^Atp6v1d^ Young^ Old^ 4.4118^ Young^ Low_quality^Vti1b^ Young^ Old^ 3.2324^ Young^ Low_quality^Hnrnpc^ Young^ Old^ 6.4730^ Young^ Low_quality^Rgcc^ Young^ Old^ 43.8672^ Young^ Low_quality^Lynx1^ Young^ Old^ 17.0296^ Young^ Low_quality^Eef1d^ Young^ Old^ 4.5944^ Young^ Low_quality^Abat^ Young^ Old^ 61296.3492^ Young^ Low_quality^Sst^ Young^ Old^ 13.7483^ Young^ Low_quality^Rps28^ Young^ Old^ 3.8938^ Young^ Low_quality^Rps18^ Young^ Old^ 34.4577^ Young^ Low_quality^H2‐Ab1^ Young^ Old^ 10.4319^ Young^ Low_quality^Gm42418^ Young^ Old^ 3.9682^ Young^ Low_quality^Catsperd^ Young^ Old^ 6.6022^ Young^ Low_quality^Vapa^ Young^ Old^ 7.8077^ Young^ Low_quality^Kif5b^ Young^ Old^ 60.9775^ Young^ Low_quality^Nr3c1^ Young^ Old^ 25.6398^ Young^ Low_quality^Smarca2^ Young^ Old^ 8.9371^ Young^ Low_quality^As3mt^ Young^ Old^ 41.5975^ Young^ Low_quality^Ndufa1^ Young^ Old^ 4.9033^ Young^ Low_quality^Pja1^ Young^ Old^ 10.0172^ Young^ Low_quality^Hdac8^ Young^ Old^ 22.7760^ Young^ Low_quality^Cox7b^ Young^ Old^ 3.0208^ Young^ Low_quality^Zcchc18^ Young^ Old^ 8.1783^ Young^ Low_quality^Maged2^ Young^ Old^ 25.4945^ Young^ Low_quality^Aox2^ Young^ Old^ 49902.8408^ Young^ Low_quality^Tmem261^ Young^ Old^ 40.5788^ Young^ Low_quality^2410015M20Rik^ Young^ Old^ 4.4797^ Young^ Low_quality^1500011K16Rik^ Young^ Old^ 4.2008^ Young^ Low_quality^mt‐Tl1^ Young^ Old^ 3.8865^ Young^ Low_quality^mt‐Tp^ Young^ Old^ 3.3091^ Young^ Low_quality^Myeov2^ Young^ Old^ 4.0053^ Young^ Low_quality^Gm561^ Young^ Old^ 24.6195^ Young^ Low_quality^Gm8292^ Young^ Old^ 9.7172^ Young^ Low_quality^Pantr1^ Young^ Old^ 3.1882^ Young^ Habenuela_V3_section3^Syndig1^ Young^ Old^ 3.2263^ Young^ Habenuela_V3_section3^Snhg8^ Young^ Old^ 3.3896^ Young^ Habenuela_V3_section3^Tomm7^ Young^ Old^ 3.6465^ Young^ Habenuela_V3_section3^Snrpg^ Young^ Old^ 3.4555^ Young^ Habenuela_V3_section3^Nell1^ Young^ Old^ 7.9265^ Young^ Habenuela_V3_section3^Lama4^ Young^ Old^ 7.8594^ Young^ Habenuela_V3_section3^Pmch^ Young^ Old^ 18.7802^ Young^ Habenuela_V3_section3^Slirp^ Young^ Old^ 3.1097^ Young^ Habenuela_V3_section3^Rps28^ Young^ Old^ 3.1305^ Young^ Habenuela_V3_section3^Gm42418^ Young^ Old^ 7.4845^ Young^ Habenuela_V3_section3^Catsperd^ Young^ Old^ 8.2125^ Young^ Habenuela_V3_section3^mt‐Tv^ Young^ Old^ 3.1060^ Young^ Habenuela_V3_section3^mt‐Tm^ Young^ Old^ 3.9548^ Young^ Habenuela_V3_section3^mt‐Ta^ Young^ Old^ 3.3091^ Young^ Habenuela_V3_section3^mt‐Tl2^ Young^ Old^ 8.9004^ Young^ Habenuela_V3_section3^mt‐Tp^ Young^ Old^ 3.0821^ Young^ Habenuela_V3_section3^Rps24‐ps3^ Young^ Old^ 7.0658^ Young^ Habenuela_V3_section3^Erdr1^ Young^ Old^ 3.2310^ Young^ Habenuela_V3_section3^Gm8292^ Young^ Old^ 3.1134^ Young^ Habenuela_V3_section3^Romo1^ Young^ Old^ 3.1059^ Young^ Interneurons^Snhg8^ Young^ Old^ 3.6329^ Young^ Interneurons^Cfap74^ Young^ Old^ 3.5629^ Young^ Interneurons^Lrrc17^ Young^ Old^ 4.8511^ Young^ Interneurons^Tomm7^ Young^ Old^ 4.0305^ Young^ Interneurons^Atp5k^ Young^ Old^ 3.1740^ Young^ Interneurons^Lama4^ Young^ Old^ 11.4662^ Young^ Interneurons^Ddx21^ Young^ Old^ 3.5062^ Young^ Interneurons^Nf2^ Young^ Old^ 4.0307^ Young^ Interneurons^Myl4^ Young^ Old^ 3.6621^ Young^ Interneurons^A330033J07Rik^ Young^ Old^ 9.6907^ Young^ Interneurons^Spidr^ Young^ Old^ 5.3616^ Young^ Interneurons^Rpl35a^ Young^ Old^ 3.5931^ Young^ Interneurons^Gng13^ Young^ Old^ 3.2988^ Young^ Interneurons^108Rps28^ Young^ Old^ 3.7946^ Young^ Interneurons^Gm42418^ Young^ Old^ 12.8243^ Young^ Interneurons^Catsperd^ Young^ Old^ 16.0351^ Young^ Interneurons^Cox8a^ Young^ Old^ 3.3737^ Young^ Interneurons^Hdac8^ Young^ Old^ 6.8669^ Young^ Interneurons^mt‐Tf^ Young^ Old^ 5.6655^ Young^ Interneurons^mt‐Tv^ Young^ Old^ 4.2940^ Young^ Interneurons^mt‐Tl1^ Young^ Old^ 3.1862^ Young^ Interneurons^mt‐Tq^ Young^ Old^ 6.6119^ Young^ Interneurons^mt‐Tm^ Young^ Old^ 3.3817^ Young^ Interneurons^mt‐Ta^ Young^ Old^ 7.6751^ Young^ Interneurons^mt‐Tc^ Young^ Old^ 3.2339^ Young^ Interneurons^mt‐Ts2^ Young^ Old^ 7.0302^ Young^ Interneurons^mt‐Tl2^ Young^ Old^ 6.3561^ Young^ Interneurons^mt‐Tp^ Young^ Old^ 4.1334^ Young^ Interneurons^Usmg5^ Young^ Old^ 3.0341^ Young^ Interneurons^Rps24‐ps3^ Young^ Old^ 4.3589^ Young^ Interneurons^Gm14539^ Young^ Old^ 4.1577^ Young^ Interneurons^Gm8292^ Young^ Old^ 3.7619^ Young^ Interneurons^Cfap74^ Young^ Old^ 3.3080^ Young^ Hypothalamus^Lrrc17^ Young^ Old^ 3.6841^ Young^ Hypothalamus^Cnot3^ Young^ Old^ 3.5654^ Young^ Hypothalamus^Lama4^ Young^ Old^ 11.6579^ Young^ Hypothalamus^Ddx21^ Young^ Old^ 3.6199^ Young^ Hypothalamus^Pmch^ Young^ Old^ 18.8412^ Young^ Hypothalamus^Tac2^ Young^ Old^ 3.1204^ Young^ Hypothalamus^Nf2^ Young^ Old^ 3.5082^ Young^ Hypothalamus^Hcrt^ Young^ Old^ 48.1875^ Young^ Hypothalamus^A330033J07Rik^ Young^ Old^ 5.6217^ Young^ Hypothalamus^Spidr^ Young^ Old^ 5.3901^ Young^ Hypothalamus^Gm42418^ Young^ Old^ 16.8995^ Young^ Hypothalamus^Catsperd^ Young^ Old^ 11.4404^ Young^ Hypothalamus^Gal^ Young^ Old^ 8.2376^ Young^ Hypothalamus^Hdac8^ Young^ Old^ 8.7448^ Young^ Hypothalamus^mt‐Tv^ Young^ Old^ 3.2868^ Young^ Hypothalamus^mt‐Tq^ Young^ Old^ 4.5827^ Young^ Hypothalamus^mt‐Ta^ Young^ Old^ 4.7412^ Young^ Hypothalamus^mt‐Tl2^ Young^ Old^ 6.6358^ Young^ Hypothalamus^mt‐Tp^ Young^ Old^ 3.1082^ Young^ Hypothalamus^Gm8292^ Young^ Old^ 3.2039^ Young^ Hypothalamus^Romo1^ Young^ Old^ 3.0413^ Young^ Hippocampus_DG^Rps27^ Young^ Old^ 3.0204^ Young^ Hippocampus_DG^Snhg8^ Young^ Old^ 3.5742^ Young^ Hippocampus_DG^Lrrc17^ Young^ Old^ 3.3079^ Young^ Hippocampus_DG^Pmch^ Young^ Old^ 18.2567^ Young^ Hippocampus_DG^Gm42418^ Young^ Old^ 7.7488^ Young^ Hippocampus_DG^Catsperd^ Young^ Old^ 6.8338^ Young^ Hippocampus_DG^mt‐Tm^ Young^ Old^ 3.4086^ Young^ Hippocampus_DG^mt‐Ta^ Young^ Old^ 3.7838^ Young^ Hippocampus_DG^mt‐Tp^ Young^ Old^ 3.2202^ Young^ Hippocampus_DG^Gm2830^ Young^ Old^ 3.2690^ Young^ Hippocampus_DG^Erdr1^ Young^ Old^ 3.2205^ Young^ Hippocampus_DG^Gm8292^ Young^ Old^ 3.3806^ Young^ Hippocampus_DG^Lama4^ Young^ Old^ 6.1322^ Young^ Thalamus_Central_Ventral^Pmch^ Young^ Old^ 5.0639^ Young^ Thalamus_Central_Ventral^Nf2^ Young^ Old^ 3.1881^ Young^ Thalamus_Central_Ventral^Hcrt^ Young^ Old^ 14.8735^ Young^ Thalamus_Central_Ventral^Spidr^ Young^ Old^ 3.5639^ Young^ Thalamus_Central_Ventral^Rpl35a^ Young^ Old^ 3.5306^ Young^ Thalamus_Central_Ventral^Gm42418^ Young^ Old^ 10.5641^ Young^ Thalamus_Central_Ventral^Catsperd^ Young^ Old^ 8.2902^ Young^ Thalamus_Central_Ventral^Hdac8^ Young^ Old^ 5.5406^ Young^ Thalamus_Central_Ventral^Romo1^ Young^ Old^ 3.2039^ Young^ White_Matter^Stau1^ Young^ Old^ 3.0094^ Young^ White_Matter^Snhg8^ Young^ Old^ 3.1365^ Young^ White_Matter^Lrrc7^ Young^ Old^ 3.1833^ Young^ White_Matter^Cfap74^ Young^ Old^ 3.0587^ Young^ White_Matter^Lrrc17^ Young^ Old^ 5.6566^ Young^ White_Matter^Snrpg^ Young^ Old^ 3.0252^ Young^ White_Matter^109Lama4^ Young^ Old^ 17.3195^ Young^ White_Matter^Ddx21^ Young^ Old^ 3.1199^ Young^ White_Matter^Pmch^ Young^ Old^ 24.4385^ Young^ White_Matter^Rpl41^ Young^ Old^ 3.0072^ Young^ White_Matter^Wwc1^ Young^ Old^ 3.4067^ Young^ White_Matter^Ralgapa1^ Young^ Old^ 3.5368^ Young^ White_Matter^A330033J07Rik^ Young^ Old^ 9.7505^ Young^ White_Matter^Pvalb^ Young^ Old^ 3.0454^ Young^ White_Matter^Spidr^ Young^ Old^ 3.6494^ Young^ White_Matter^Rpl35a^ Young^ Old^ 3.7824^ Young^ White_Matter^Gng13^ Young^ Old^ 3.3627^ Young^ White_Matter^Gm42418^ Young^ Old^ 4.5785^ Young^ White_Matter^Catsperd^ Young^ Old^ 21.1617^ Young^ White_Matter^Cox8a^ Young^ Old^ 3.0512^ Young^ White_Matter^Hdac8^ Young^ Old^ 8.2943^ Young^ White_Matter^mt‐Tl1^ Young^ Old^ 3.8366^ Young^ White_Matter^mt‐Tq^ Young^ Old^ 6.0050^ Young^ White_Matter^mt‐Tm^ Young^ Old^ 3.5563^ Young^ White_Matter^mt‐Ta^ Young^ Old^ 5.0908^ Young^ White_Matter^mt‐Tc^ Young^ Old^ 3.9275^ Young^ White_Matter^mt‐Tp^ Young^ Old^ 3.3631^ Young^ White_Matter^Usmg5^ Young^ Old^ 3.0139^ Young^ White_Matter^Gm2830^ Young^ Old^ 4.1367^ Young^ White_Matter^Gm8292^ Young^ Old^ 3.1280^ Young^ White_Matter^Cnot11^ Young^ Old^ 4.5195^ Young^ Cortex_Retrosplenial_Area^Nop58^ Young^ Old^ 3.9777^ Young^ Cortex_Retrosplenial_Area^Lrrn2^ Young^ Old^ 3.8928^ Young^ Cortex_Retrosplenial_Area^Snrpe^ Young^ Old^ 3.1006^ Young^ Cortex_Retrosplenial_Area^Cep350^ Young^ Old^ 3.1895^ Young^ Cortex_Retrosplenial_Area^Rabgap1^ Young^ Old^ 3.2916^ Young^ Cortex_Retrosplenial_Area^Polr1b^ Young^ Old^ 4.1118^ Young^ Cortex_Retrosplenial_Area^Stau1^ Young^ Old^ 4.1419^ Young^ Cortex_Retrosplenial_Area^Kcnb1^ Young^ Old^ 3.0311^ Young^ Cortex_Retrosplenial_Area^Jade1^ Young^ Old^ 3.0619^ Young^ Cortex_Retrosplenial_Area^Snhg8^ Young^ Old^ 3.4001^ Young^ Cortex_Retrosplenial_Area^Lrrc7^ Young^ Old^ 3.5312^ Young^ Cortex_Retrosplenial_Area^Penk^ Young^ Old^ 3.5025^ Young^ Cortex_Retrosplenial_Area^Ago4^ Young^ Old^ 20.7299^ Young^ Cortex_Retrosplenial_Area^Cfap74^ Young^ Old^ 5.1109^ Young^ Cortex_Retrosplenial_Area^Lrrc17^ Young^ Old^ 5.1513^ Young^ Cortex_Retrosplenial_Area^Galnt11^ Young^ Old^ 3.3509^ Young^ Cortex_Retrosplenial_Area^Slc5a6^ Young^ Old^ 3.4125^ Young^ Cortex_Retrosplenial_Area^Adra2c^ Young^ Old^ 19.5252^ Young^ Cortex_Retrosplenial_Area^Tsen2^ Young^ Old^ 4.3936^ Young^ Cortex_Retrosplenial_Area^Cnot3^ Young^ Old^ 5.0741^ Young^ Cortex_Retrosplenial_Area^Cpt1c^ Young^ Old^ 3.2180^ Young^ Cortex_Retrosplenial_Area^Pgm2l1^ Young^ Old^ 4.0837^ Young^ Cortex_Retrosplenial_Area^Otoa^ Young^ Old^ 7.5377^ Young^ Cortex_Retrosplenial_Area^Ctu2^ Young^ Old^ 4.0623^ Young^ Cortex_Retrosplenial_Area^Carm1^ Young^ Old^ 3.0947^ Young^ Cortex_Retrosplenial_Area^Celf6^ Young^ Old^ 3.5746^ Young^ Cortex_Retrosplenial_Area^Ccdc12^ Young^ Old^ 3.0640^ Young^ Cortex_Retrosplenial_Area^Hint3^ Young^ Old^ 3.1263^ Young^ Cortex_Retrosplenial_Area^Lama4^ Young^ Old^ 16.1902^ Young^ Cortex_Retrosplenial_Area^Ddx21^ Young^ Old^ 5.0901^ Young^ Cortex_Retrosplenial_Area^Pmch^ Young^ Old^ 15.7400^ Young^ Cortex_Retrosplenial_Area^Nf2^ Young^ Old^ 6.9795^ Young^ Cortex_Retrosplenial_Area^Wwc1^ Young^ Old^ 3.8413^ Young^ Cortex_Retrosplenial_Area^Wipf2^ Young^ Old^ 3.3783^ Young^ Cortex_Retrosplenial_Area^Hcrt^ Young^ Old^ 101.6327^ Young^ Cortex_Retrosplenial_Area^Eftud2^ Young^ Old^ 3.1514^ Young^ Cortex_Retrosplenial_Area^Ralgapa1^ Young^ Old^ 4.3859^ Young^ Cortex_Retrosplenial_Area^Ngb^ Young^ Old^ 3.4074^ Young^ Cortex_Retrosplenial_Area^Mylip^ Young^ Old^ 5.1285^ Young^ Cortex_Retrosplenial_Area^A330033J07Rik^ Young^ Old^ 17.6508^ Young^ Cortex_Retrosplenial_Area^Fbxo34^ Young^ Old^ 4.7385^ Young^ Cortex_Retrosplenial_Area^Spidr^ Young^ Old^ 7.6271^ Young^ Cortex_Retrosplenial_Area^Rpl35a^ Young^ Old^ 4.2685^ Young^ Cortex_Retrosplenial_Area^Gm42418^ Young^ Old^ 12.0629^ Young^ Cortex_Retrosplenial_Area^110Klc4^ Young^ Old^ 3.1623^ Young^ Cortex_Retrosplenial_Area^Catsperd^ Young^ Old^ 15.6791^ Young^ Cortex_Retrosplenial_Area^Csnk1g3^ Young^ Old^ 5.0713^ Young^ Cortex_Retrosplenial_Area^Rpl39^ Young^ Old^ 3.0173^ Young^ Cortex_Retrosplenial_Area^Il1rapl1^ Young^ Old^ 4.2852^ Young^ Cortex_Retrosplenial_Area^Hdac8^ Young^ Old^ 23.3499^ Young^ Cortex_Retrosplenial_Area^Tspan6^ Young^ Old^ 3.4052^ Young^ Cortex_Retrosplenial_Area^Aox2^ Young^ Old^ 5.9450^ Young^ Cortex_Retrosplenial_Area^mt‐Tf^ Young^ Old^ 5.6620^ Young^ Cortex_Retrosplenial_Area^mt‐Tv^ Young^ Old^ 6.5491^ Young^ Cortex_Retrosplenial_Area^mt‐Tl1^ Young^ Old^ 4.0450^ Young^ Cortex_Retrosplenial_Area^mt‐Tq^ Young^ Old^ 7.8471^ Young^ Cortex_Retrosplenial_Area^mt‐Tm^ Young^ Old^ 3.3793^ Young^ Cortex_Retrosplenial_Area^mt‐Ta^ Young^ Old^ 7.5048^ Young^ Cortex_Retrosplenial_Area^mt‐Ts2^ Young^ Old^ 7.3384^ Young^ Cortex_Retrosplenial_Area^mt‐Tl2^ Young^ Old^ 5.6469^ Young^ Cortex_Retrosplenial_Area^mt‐Tp^ Young^ Old^ 5.2199^ Young^ Cortex_Retrosplenial_Area^Rps24‐ps3^ Young^ Old^ 4.4413^ Young^ Cortex_Retrosplenial_Area^Gm8692^ Young^ Old^ 13.0856^ Young^ Cortex_Retrosplenial_Area^Erdr1^ Young^ Old^ 3.1085^ Young^ Cortex_Retrosplenial_Area^Gm8292^ Young^ Old^ 3.1794^ Young^ Cortex_Retrosplenial_Area^Lama4^ Young^ Old^ 6.5287^ Young^ Hippocampus_CA1_CA2_CA3^Smim4^ Young^ Old^ 3.0190^ Young^ Hippocampus_CA1_CA2_CA3^Pphln1^ Young^ Old^ 4.8423^ Young^ Hippocampus_CA1_CA2_CA3^Rpl35a^ Young^ Old^ 3.4796^ Young^ Hippocampus_CA1_CA2_CA3^Rps28^ Young^ Old^ 3.0435^ Young^ Hippocampus_CA1_CA2_CA3^Gm42418^ Young^ Old^ 6.0329^ Young^ Hippocampus_CA1_CA2_CA3^Catsperd^ Young^ Old^ 9.1648^ Young^ Hippocampus_CA1_CA2_CA3^Hdac8^ Young^ Old^ 3.2297^ Young^ Hippocampus_CA1_CA2_CA3^mt‐Tv^ Young^ Old^ 3.4210^ Young^ Hippocampus_CA1_CA2_CA3^mt‐Ta^ Young^ Old^ 4.8639^ Young^ Hippocampus_CA1_CA2_CA3^As3mt^ Young^ Old^ 4.3084^ Young^ Cortical_associated_area^Rplp1^ Young^ Old^ 3.4851^ Young^ Cortical_associated_area^Nf2^ Young^ Old^ 7.7917^ Young^ Cortical_associated_area^Mrpl52^ Young^ Old^ 3.3729^ Young^ Cortical_associated_area^Ndufa2^ Young^ Old^ 3.6686^ Young^ Cortical_associated_area^Cox6c^ Young^ Old^ 3.7021^ Young^ Cortical_associated_area^Ndufa1^ Young^ Old^ 3.3078^ Young^ Cortical_associated_area^Lama4^ Young^ Old^ 107.4970^ Young^ Cortical_associated_area^Uqcr11^ Young^ Old^ 3.1562^ Young^ Cortical_associated_area^Ralgapa1^ Young^ Old^ 4.3893^ Young^ Cortical_associated_area^Slirp^ Young^ Old^ 4.8468^ Young^ Cortical_associated_area^Ndufa5^ Young^ Old^ 3.1544^ Young^ Cortical_associated_area^Rps26^ Young^ Old^ 3.5766^ Young^ Cortical_associated_area^Rplp2^ Young^ Old^ 3.7429^ Young^ Cortical_associated_area^Gng13^ Young^ Old^ 4.7512^ Young^ Cortical_associated_area^Taf3^ Young^ Old^ 4.5737^ Young^ Cortical_associated_area^Samhd1^ Young^ Old^ 3.5377^ Young^ Cortical_associated_area^Lrrc7^ Young^ Old^ 3.7824^ Young^ Cortical_associated_area^Rps20^ Young^ Old^ 3.1937^ Young^ Cortical_associated_area^Tomm7^ Young^ Old^ 5.0356^ Young^ Cortical_associated_area^Ndufa4^ Young^ Old^ 3.1809^ Young^ Cortical_associated_area^Mt3^ Young^ Old^ 3.0052^ Young^ Cortical_associated_area^Mt2^ Young^ Old^ 3.6440^ Young^ Cortical_associated_area^Mt1^ Young^ Old^ 3.0260^ Young^ Cortical_associated_area^Trim33^ Young^ Old^ 3.6861^ Young^ Cortical_associated_area^Rps29^ Young^ Old^ 4.2308^ Young^ Cortical_associated_area^Anapc13^ Young^ Old^ 3.9376^ Young^ Cortical_associated_area^Ndufa3^ Young^ Old^ 3.9959^ Young^ Cortical_associated_area^Dym^ Young^ Old^ 3.9643^ Young^ Cortical_associated_area^Cox8a^ Young^ Old^ 3.6979^ Young^ Cortical_associated_area^Cox6b1^ Young^ Old^ 3.1259^ Young^ Cortical_associated_area^Ndufc1^ Young^ Old^ 3.5203^ Young^ Cortical_associated_area^Asxl2^ Young^ Old^ 9.2198^ Young^ Cortical_associated_area^Atp5j2^ Young^ Old^ 3.5801^ Young^ Cortical_associated_area^Rps21^ Young^ Old^ 4.2616^ Young^ Cortical_associated_area^Foxk2^ Young^ Old^ 3.1747^ Young^ Cortical_associated_area^Stau1^ Young^ Old^ 3.0143^ Young^ Cortical_associated_area^Lrrc17^ Young^ Old^ 21.9864^ Young^ Cortical_associated_area^111Catsperd^ Young^ Old^ 49.9443^ Young^ Cortical_associated_area^Rpl37^ Young^ Old^ 5.1202^ Young^ Cortical_associated_area^Spidr^ Young^ Old^ 20.8976^ Young^ Cortical_associated_area^Arhgef37^ Young^ Old^ 14.7029^ Young^ Cortical_associated_area^Rpl37a^ Young^ Old^ 3.1564^ Young^ Cortical_associated_area^Bola2^ Young^ Old^ 3.5675^ Young^ Cortical_associated_area^C77080^ Young^ Old^ 7.6354^ Young^ Cortical_associated_area^Atp5k^ Young^ Old^ 7.6493^ Young^ Cortical_associated_area^Tatdn1^ Young^ Old^ 3.5253^ Young^ Cortical_associated_area^Epha6^ Young^ Old^ 17.6364^ Young^ Cortical_associated_area^Snrpg^ Young^ Old^ 5.7258^ Young^ Cortical_associated_area^Rpl38^ Young^ Old^ 4.3040^ Young^ Cortical_associated_area^Pantr1^ Young^ Old^ 3.1921^ Young^ Cortical_associated_area^Rpl35a^ Young^ Old^ 4.4048^ Young^ Cortical_associated_area^Rpl26^ Young^ Old^ 3.6009^ Young^ Cortical_associated_area^Rpl34^ Young^ Old^ 3.0009^ Young^ Cortical_associated_area^Rps28^ Young^ Old^ 5.2632^ Young^ Cortical_associated_area^Hdac8^ Young^ Old^ 11.0317^ Young^ Cortical_associated_area^Romo1^ Young^ Old^ 4.6539^ Young^ Cortical_associated_area^Usmg5^ Young^ Old^ 4.8656^ Young^ Cortical_associated_area^Gm561^ Young^ Old^ 3.5017^ Young^ Cortical_associated_area^Cfap74^ Young^ Old^ 6.3229^ Young^ Cortical_associated_area^Rpl39^ Young^ Old^ 4.6965^ Young^ Cortical_associated_area^Rps27^ Young^ Old^ 4.6835^ Young^ Cortical_associated_area^Rpl41^ Young^ Old^ 3.8170^ Young^ Cortical_associated_area^Otoa^ Young^ Old^ 44.3721^ Young^ Cortical_associated_area^2010107E04Rik^ Young^ Old^ 4.2131^ Young^ Cortical_associated_area^Lmod3^ Young^ Old^ 12.6773^ Young^ Cortical_associated_area^Gm5963^ Young^ Old^ 5.4943^ Young^ Cortical_associated_area^mt‐Tv^ Young^ Old^ 14.3124^ Young^ Cortical_associated_area^mt‐Tl1^ Young^ Old^ 8.6070^ Young^ Cortical_associated_area^mt‐Ti^ Young^ Old^ 3.1483^ Young^ Cortical_associated_area^mt‐Tq^ Young^ Old^ 26.6179^ Young^ Cortical_associated_area^mt‐Tm^ Young^ Old^ 10.8975^ Young^ Cortical_associated_area^mt‐Ta^ Young^ Old^ 29.3096^ Young^ Cortical_associated_area^mt‐Tc^ Young^ Old^ 15.9278^ Young^ Cortical_associated_area^mt‐Tl2^ Young^ Old^ 13.8556^ Young^ Cortical_associated_area^mt‐Tp^ Young^ Old^ 12.7127^ Young^ Cortical_associated_area^1700026J12Rik^ Young^ Old^ 12.7819^ Young^ Cortical_associated_area^1810022K09Rik^ Young^ Old^ 3.0706^ Young^ Cortical_associated_area^Aox2^ Young^ Old^ 34.7446^ Young^ Cortical_associated_area^Gm14539^ Young^ Old^ 6.4446^ Young^ Cortical_associated_area^Snhg3^ Young^ Old^ 3.2423^ Young^ Cortical_associated_area^A330033J07Rik^ Young^ Old^ 28.8416^ Young^ Cortical_associated_area^Gm8292^ Young^ Old^ 3.3670^ Young^ Cortical_associated_area^Snhg8^ Young^ Old^ 4.4364^ Young^ Cortical_associated_area^Gm20756^ Young^ Old^ 29.0212^ Young^ Cortical_associated_area^Rplp1^ Young^ Old^ 3.7651^ Young^ Olfactory_Striatal_area^Nfib^ Young^ Old^ 3.1831^ Young^ Olfactory_Striatal_area^Rps15a^ Young^ Old^ 3.0399^ Young^ Olfactory_Striatal_area^Nf2^ Young^ Old^ 4.1511^ Young^ Olfactory_Striatal_area^Rps25^ Young^ Old^ 4.2401^ Young^ Olfactory_Striatal_area^Mrpl52^ Young^ Old^ 3.2356^ Young^ Olfactory_Striatal_area^Ndufa2^ Young^ Old^ 3.9022^ Young^ Olfactory_Striatal_area^Cox6c^ Young^ Old^ 4.5122^ Young^ Olfactory_Striatal_area^Atp5e^ Young^ Old^ 3.5721^ Young^ Olfactory_Striatal_area^Ndufa1^ Young^ Old^ 3.8965^ Young^ Olfactory_Striatal_area^Cox7c^ Young^ Old^ 4.4102^ Young^ Olfactory_Striatal_area^Lama4^ Young^ Old^ 67.6632^ Young^ Olfactory_Striatal_area^Uqcr11^ Young^ Old^ 3.6048^ Young^ Olfactory_Striatal_area^Slirp^ Young^ Old^ 5.0351^ Young^ Olfactory_Striatal_area^Ndufs6^ Young^ Old^ 3.1181^ Young^ Olfactory_Striatal_area^Mylk^ Young^ Old^ 4.7211^ Young^ Olfactory_Striatal_area^Ndufa5^ Young^ Old^ 3.3950^ Young^ Olfactory_Striatal_area^Ndufv3^ Young^ Old^ 3.1581^ Young^ Olfactory_Striatal_area^Rps26^ Young^ Old^ 4.0471^ Young^ Olfactory_Striatal_area^Rplp2^ Young^ Old^ 4.6522^ Young^ Olfactory_Striatal_area^Gng13^ Young^ Old^ 5.7620^ Young^ Olfactory_Striatal_area^Taf3^ Young^ Old^ 3.2635^ Young^ Olfactory_Striatal_area^112Olfm1^ Young^ Old^ 3.2455^ Young^ Olfactory_Striatal_area^Samhd1^ Young^ Old^ 3.5076^ Young^ Olfactory_Striatal_area^Rps20^ Young^ Old^ 3.8568^ Young^ Olfactory_Striatal_area^Tomm7^ Young^ Old^ 5.9990^ Young^ Olfactory_Striatal_area^Slc30a3^ Young^ Old^ 3.7596^ Young^ Olfactory_Striatal_area^Ndufa4^ Young^ Old^ 3.5306^ Young^ Olfactory_Striatal_area^Mgp^ Young^ Old^ 7.9102^ Young^ Olfactory_Striatal_area^Cox7b^ Young^ Old^ 3.9087^ Young^ Olfactory_Striatal_area^Mt3^ Young^ Old^ 3.4414^ Young^ Olfactory_Striatal_area^Mt2^ Young^ Old^ 3.2521^ Young^ Olfactory_Striatal_area^Cck^ Young^ Old^ 4.2458^ Young^ Olfactory_Striatal_area^Trim33^ Young^ Old^ 3.6014^ Young^ Olfactory_Striatal_area^Rps29^ Young^ Old^ 6.7480^ Young^ Olfactory_Striatal_area^Anapc13^ Young^ Old^ 4.2484^ Young^ Olfactory_Striatal_area^Ndufa3^ Young^ Old^ 4.8870^ Young^ Olfactory_Striatal_area^Dym^ Young^ Old^ 3.1319^ Young^ Olfactory_Striatal_area^Cox8a^ Young^ Old^ 3.6914^ Young^ Olfactory_Striatal_area^Cox6b1^ Young^ Old^ 3.8049^ Young^ Olfactory_Striatal_area^Ndufc1^ Young^ Old^ 3.7947^ Young^ Olfactory_Striatal_area^Asxl2^ Young^ Old^ 8.7455^ Young^ Olfactory_Striatal_area^Polr2l^ Young^ Old^ 3.3526^ Young^ Olfactory_Striatal_area^Atp5j2^ Young^ Old^ 4.6379^ Young^ Olfactory_Striatal_area^Rps21^ Young^ Old^ 5.6139^ Young^ Olfactory_Striatal_area^Nrn1^ Young^ Old^ 4.2063^ Young^ Olfactory_Striatal_area^Lrrc17^ Young^ Old^ 24.0166^ Young^ Olfactory_Striatal_area^Catsperd^ Young^ Old^ 36.1436^ Young^ Olfactory_Striatal_area^Rpl37^ Young^ Old^ 4.8237^ Young^ Olfactory_Striatal_area^Spidr^ Young^ Old^ 15.9867^ Young^ Olfactory_Striatal_area^Shfm1^ Young^ Old^ 3.2518^ Young^ Olfactory_Striatal_area^Wdr89^ Young^ Old^ 3.6427^ Young^ Olfactory_Striatal_area^Rpl37a^ Young^ Old^ 3.7918^ Young^ Olfactory_Striatal_area^Cox17^ Young^ Old^ 3.4721^ Young^ Olfactory_Striatal_area^Bola2^ Young^ Old^ 4.1981^ Young^ Olfactory_Striatal_area^Atp5k^ Young^ Old^ 8.7218^ Young^ Olfactory_Striatal_area^Epha6^ Young^ Old^ 9.1750^ Young^ Olfactory_Striatal_area^Snrpg^ Young^ Old^ 5.9175^ Young^ Olfactory_Striatal_area^Rpl38^ Young^ Old^ 6.1534^ Young^ Olfactory_Striatal_area^Rpl36^ Young^ Old^ 3.7741^ Young^ Olfactory_Striatal_area^Smim4^ Young^ Old^ 4.1883^ Young^ Olfactory_Striatal_area^Rpl30^ Young^ Old^ 3.4499^ Young^ Olfactory_Striatal_area^Uqcr10^ Young^ Old^ 3.1819^ Young^ Olfactory_Striatal_area^Rpl35a^ Young^ Old^ 5.0857^ Young^ Olfactory_Striatal_area^Rpl26^ Young^ Old^ 3.9805^ Young^ Olfactory_Striatal_area^Rps17^ Young^ Old^ 4.0034^ Young^ Olfactory_Striatal_area^Rpl34^ Young^ Old^ 3.6240^ Young^ Olfactory_Striatal_area^Rpl35^ Young^ Old^ 5.1725^ Young^ Olfactory_Striatal_area^Uqcrh^ Young^ Old^ 3.2258^ Young^ Olfactory_Striatal_area^Tnnt1^ Young^ Old^ 3.3886^ Young^ Olfactory_Striatal_area^Rps28^ Young^ Old^ 8.0440^ Young^ Olfactory_Striatal_area^Hdac8^ Young^ Old^ 8.1082^ Young^ Olfactory_Striatal_area^Romo1^ Young^ Old^ 5.3066^ Young^ Olfactory_Striatal_area^Lgals1^ Young^ Old^ 3.4434^ Young^ Olfactory_Striatal_area^Ccnd1^ Young^ Old^ 3.3234^ Young^ Olfactory_Striatal_area^Usmg5^ Young^ Old^ 6.7749^ Young^ Olfactory_Striatal_area^Myeov2^ Young^ Old^ 3.8729^ Young^ Olfactory_Striatal_area^Gm561^ Young^ Old^ 4.7606^ Young^ Olfactory_Striatal_area^Rpl36a^ Young^ Old^ 3.8426^ Young^ Olfactory_Striatal_area^Rpl39^ Young^ Old^ 6.0234^ Young^ Olfactory_Striatal_area^Pet100^ Young^ Old^ 4.1528^ Young^ Olfactory_Striatal_area^Fcor^ Young^ Old^ 3.7123^ Young^ Olfactory_Striatal_area^Snrpe^ Young^ Old^ 3.1095^ Young^ Olfactory_Striatal_area^Rps27^ Young^ Old^ 5.6133^ Young^ Olfactory_Striatal_area^Rps13^ Young^ Old^ 4.2418^ Young^ Olfactory_Striatal_area^Rpl41^ Young^ Old^ 4.9325^ Young^ Olfactory_Striatal_area^Gm42418^ Young^ Old^ 3.1447^ Young^ Olfactory_Striatal_area^2010107E04Rik^ Young^ Old^ 4.9179^ Young^ Olfactory_Striatal_area^Lmod3^ Young^ Old^ 10.7782^ Young^ Olfactory_Striatal_area^Gm5963^ Young^ Old^ 7.2976^ Young^ Olfactory_Striatal_area^mt‐Tv^ Young^ Old^ 8.1739^ Young^ Olfactory_Striatal_area^113mt‐Tl1^ Young^ Old^ 4.2734^ Young^ Olfactory_Striatal_area^mt‐Tq^ Young^ Old^ 14.1418^ Young^ Olfactory_Striatal_area^mt‐Tm^ Young^ Old^ 7.1315^ Young^ Olfactory_Striatal_area^mt‐Ta^ Young^ Old^ 18.9335^ Young^ Olfactory_Striatal_area^mt‐Tc^ Young^ Old^ 12.1676^ Young^ Olfactory_Striatal_area^mt‐Tp^ Young^ Old^ 7.2934^ Young^ Olfactory_Striatal_area^1700026J12Rik^ Young^ Old^ 10.1425^ Young^ Olfactory_Striatal_area^1810022K09Rik^ Young^ Old^ 4.0700^ Young^ Olfactory_Striatal_area^Gm14539^ Young^ Old^ 7.3490^ Young^ Olfactory_Striatal_area^Snhg3^ Young^ Old^ 4.1302^ Young^ Olfactory_Striatal_area^A330033J07Rik^ Young^ Old^ 13.9822^ Young^ Olfactory_Striatal_area^Gm8292^ Young^ Old^ 3.5624^ Young^ Olfactory_Striatal_area^Snhg8^ Young^ Old^ 6.0358^ Young^ Olfactory_Striatal_area^Gm20756^ Young^ Old^ 18.1871^ Young^ Olfactory_Striatal_area^Gm9794^ Young^ Old^ 3.3042^ Young^ Olfactory_Striatal_area^Gm42730^ Young^ Old^ 4.9607^ Young^ Olfactory_Striatal_area^Gabra2^ Young^ Old^ 3.0758^ Young^ Glia_Endothelial_rich_region^Sez6^ Young^ Old^ 13.0957^ Young^ Glia_Endothelial_rich_region^Ocrl^ Young^ Old^ 8.4217^ Young^ Glia_Endothelial_rich_region^Lsr^ Young^ Old^ 5.9343^ Young^ Glia_Endothelial_rich_region^Cnn1^ Young^ Old^ 23.2526^ Young^ Glia_Endothelial_rich_region^Nfix^ Young^ Old^ 3.4165^ Young^ Glia_Endothelial_rich_region^Tmem25^ Young^ Old^ 3.8561^ Young^ Glia_Endothelial_rich_region^Nudt14^ Young^ Old^ 3.7008^ Young^ Glia_Endothelial_rich_region^Aven^ Young^ Old^ 13.3739^ Young^ Glia_Endothelial_rich_region^Ptrf^ Young^ Old^ 3.2720^ Young^ Glia_Endothelial_rich_region^Mcoln1^ Young^ Old^ 5.9322^ Young^ Glia_Endothelial_rich_region^Crip1^ Young^ Old^ 5.2431^ Young^ Glia_Endothelial_rich_region^Tmem110^ Young^ Old^ 3.4128^ Young^ Glia_Endothelial_rich_region^Dio2^ Young^ Old^ 3.7839^ Young^ Glia_Endothelial_rich_region^Id3^ Young^ Old^ 3.3105^ Young^ Glia_Endothelial_rich_region^Rplp1^ Young^ Old^ 3.3977^ Young^ Glia_Endothelial_rich_region^Cers4^ Young^ Old^ 3.1626^ Young^ Glia_Endothelial_rich_region^Nf2^ Young^ Old^ 17.5123^ Young^ Glia_Endothelial_rich_region^Stx5a^ Young^ Old^ 3.3279^ Young^ Glia_Endothelial_rich_region^Ndufa2^ Young^ Old^ 3.1613^ Young^ Glia_Endothelial_rich_region^Cox6c^ Young^ Old^ 3.7831^ Young^ Glia_Endothelial_rich_region^Atp5e^ Young^ Old^ 3.5495^ Young^ Glia_Endothelial_rich_region^Ndufa1^ Young^ Old^ 3.9040^ Young^ Glia_Endothelial_rich_region^Cuedc1^ Young^ Old^ 6.9887^ Young^ Glia_Endothelial_rich_region^Wwc1^ Young^ Old^ 4.6953^ Young^ Glia_Endothelial_rich_region^Rcn3^ Young^ Old^ 3.1182^ Young^ Glia_Endothelial_rich_region^Fmc1^ Young^ Old^ 6.5645^ Young^ Glia_Endothelial_rich_region^Lama4^ Young^ Old^ 17.5861^ Young^ Glia_Endothelial_rich_region^Ptprb^ Young^ Old^ 6.5459^ Young^ Glia_Endothelial_rich_region^Smtn^ Young^ Old^ 20.5733^ Young^ Glia_Endothelial_rich_region^Map2k6^ Young^ Old^ 3.0172^ Young^ Glia_Endothelial_rich_region^Ncoa1^ Young^ Old^ 4.5661^ Young^ Glia_Endothelial_rich_region^Mxra7^ Young^ Old^ 5.6605^ Young^ Glia_Endothelial_rich_region^Ralgapa1^ Young^ Old^ 3.7415^ Young^ Glia_Endothelial_rich_region^Slirp^ Young^ Old^ 3.0713^ Young^ Glia_Endothelial_rich_region^Pitrm1^ Young^ Old^ 3.3324^ Young^ Glia_Endothelial_rich_region^Sugt1^ Young^ Old^ 3.5925^ Young^ Glia_Endothelial_rich_region^Rhobtb2^ Young^ Old^ 3.0678^ Young^ Glia_Endothelial_rich_region^Fam160b2^ Young^ Old^ 5.4878^ Young^ Glia_Endothelial_rich_region^Mylk^ Young^ Old^ 6.4180^ Young^ Glia_Endothelial_rich_region^Epc1^ Young^ Old^ 5.1267^ Young^ Glia_Endothelial_rich_region^Adamts10^ Young^ Old^ 3.0624^ Young^ Glia_Endothelial_rich_region^Ehbp1l1^ Young^ Old^ 3.3059^ Young^ Glia_Endothelial_rich_region^Smc5^ Young^ Old^ 6.5929^ Young^ Glia_Endothelial_rich_region^Cnnm1^ Young^ Old^ 3.3608^ Young^ Glia_Endothelial_rich_region^Rps26^ Young^ Old^ 3.2981^ Young^ Glia_Endothelial_rich_region^Ifitm1^ Young^ Old^ 3.2537^ Young^ Glia_Endothelial_rich_region^Gng13^ Young^ Old^ 5.7936^ Young^ Glia_Endothelial_rich_region^Taf3^ Young^ Old^ 3.5757^ Young^ Glia_Endothelial_rich_region^Dbi^ Young^ Old^ 3.5748^ Young^ Glia_Endothelial_rich_region^Cox20^ Young^ Old^ 4.8282^ Young^ Glia_Endothelial_rich_region^Egfl7^ Young^ Old^ 6.9630^ Young^ Glia_Endothelial_rich_region^Samhd1^ Young^ Old^ 15.5858^ Young^ Glia_Endothelial_rich_region^114S100a11^ Young^ Old^ 9.1533^ Young^ Glia_Endothelial_rich_region^Lrrc7^ Young^ Old^ 4.3380^ Young^ Glia_Endothelial_rich_region^Rmdn1^ Young^ Old^ 3.0740^ Young^ Glia_Endothelial_rich_region^Rps20^ Young^ Old^ 3.2260^ Young^ Glia_Endothelial_rich_region^Tpm2^ Young^ Old^ 4.1103^ Young^ Glia_Endothelial_rich_region^Mllt3^ Young^ Old^ 5.6501^ Young^ Glia_Endothelial_rich_region^Magoh^ Young^ Old^ 3.5382^ Young^ Glia_Endothelial_rich_region^Tomm7^ Young^ Old^ 4.7069^ Young^ Glia_Endothelial_rich_region^Eln^ Young^ Old^ 5.4669^ Young^ Glia_Endothelial_rich_region^Gkn3^ Young^ Old^ 8.3896^ Young^ Glia_Endothelial_rich_region^Mgp^ Young^ Old^ 3.0125^ Young^ Glia_Endothelial_rich_region^Vasp^ Young^ Old^ 4.8253^ Young^ Glia_Endothelial_rich_region^Pdcd5^ Young^ Old^ 3.6301^ Young^ Glia_Endothelial_rich_region^Ndufab1^ Young^ Old^ 3.7199^ Young^ Glia_Endothelial_rich_region^Vps36^ Young^ Old^ 6.7186^ Young^ Glia_Endothelial_rich_region^Irf2^ Young^ Old^ 19.1528^ Young^ Glia_Endothelial_rich_region^Mt2^ Young^ Old^ 4.1132^ Young^ Glia_Endothelial_rich_region^Tmem218^ Young^ Old^ 4.3506^ Young^ Glia_Endothelial_rich_region^Mcam^ Young^ Old^ 3.4938^ Young^ Glia_Endothelial_rich_region^Cox7a2^ Young^ Old^ 3.4372^ Young^ Glia_Endothelial_rich_region^Prkar2a^ Young^ Old^ 8.9591^ Young^ Glia_Endothelial_rich_region^Chrm1^ Young^ Old^ 3.1475^ Young^ Glia_Endothelial_rich_region^Ank2^ Young^ Old^ 3.0767^ Young^ Glia_Endothelial_rich_region^Mcee^ Young^ Old^ 5.3645^ Young^ Glia_Endothelial_rich_region^Caskin1^ Young^ Old^ 3.1747^ Young^ Glia_Endothelial_rich_region^Gas2l1^ Young^ Old^ 5.0672^ Young^ Glia_Endothelial_rich_region^Uaca^ Young^ Old^ 3.2315^ Young^ Glia_Endothelial_rich_region^Rps29^ Young^ Old^ 3.8195^ Young^ Glia_Endothelial_rich_region^Anapc13^ Young^ Old^ 4.5081^ Young^ Glia_Endothelial_rich_region^Ndufa3^ Young^ Old^ 4.5252^ Young^ Glia_Endothelial_rich_region^Acta2^ Young^ Old^ 5.1698^ Young^ Glia_Endothelial_rich_region^Cox8a^ Young^ Old^ 7.4465^ Young^ Glia_Endothelial_rich_region^Fmnl2^ Young^ Old^ 5.7544^ Young^ Glia_Endothelial_rich_region^Ndufc1^ Young^ Old^ 4.1427^ Young^ Glia_Endothelial_rich_region^Gemin5^ Young^ Old^ 6.7745^ Young^ Glia_Endothelial_rich_region^Asxl2^ Young^ Old^ 13.2767^ Young^ Glia_Endothelial_rich_region^Nufip2^ Young^ Old^ 3.4606^ Young^ Glia_Endothelial_rich_region^Zc3h7a^ Young^ Old^ 7.4973^ Young^ Glia_Endothelial_rich_region^Hspb2^ Young^ Old^ 5.5490^ Young^ Glia_Endothelial_rich_region^Atp5j2^ Young^ Old^ 3.6853^ Young^ Glia_Endothelial_rich_region^Angptl6^ Young^ Old^ 3.5885^ Young^ Glia_Endothelial_rich_region^Rps21^ Young^ Old^ 4.1174^ Young^ Glia_Endothelial_rich_region^Timm8b^ Young^ Old^ 3.1366^ Young^ Glia_Endothelial_rich_region^Foxk2^ Young^ Old^ 3.2934^ Young^ Glia_Endothelial_rich_region^Stau1^ Young^ Old^ 3.3952^ Young^ Glia_Endothelial_rich_region^Lrrc17^ Young^ Old^ 20.9158^ Young^ Glia_Endothelial_rich_region^Rsbn1l^ Young^ Old^ 4.3031^ Young^ Glia_Endothelial_rich_region^Prrc2c^ Young^ Old^ 6.7270^ Young^ Glia_Endothelial_rich_region^Catsperd^ Young^ Old^ 38.7884^ Young^ Glia_Endothelial_rich_region^Plekhh2^ Young^ Old^ 7816.8436^ Young^ Glia_Endothelial_rich_region^Rpl37^ Young^ Old^ 4.6600^ Young^ Glia_Endothelial_rich_region^Ndufa7^ Young^ Old^ 3.0836^ Young^ Glia_Endothelial_rich_region^Nol4^ Young^ Old^ 3.3486^ Young^ Glia_Endothelial_rich_region^Spidr^ Young^ Old^ 10735.3441^ Young^ Glia_Endothelial_rich_region^Gm5617^ Young^ Old^ 11.6240^ Young^ Glia_Endothelial_rich_region^S100a13^ Young^ Old^ 3.0529^ Young^ Glia_Endothelial_rich_region^Mustn1^ Young^ Old^ 6.4779^ Young^ Glia_Endothelial_rich_region^Shfm1^ Young^ Old^ 4.1673^ Young^ Glia_Endothelial_rich_region^Wdr55^ Young^ Old^ 7.6506^ Young^ Glia_Endothelial_rich_region^Dpm3^ Young^ Old^ 7.0722^ Young^ Glia_Endothelial_rich_region^Lgr6^ Young^ Old^ 28.2568^ Young^ Glia_Endothelial_rich_region^Tuba1c^ Young^ Old^ 4.4368^ Young^ Glia_Endothelial_rich_region^Tmem11^ Young^ Old^ 3.5378^ Young^ Glia_Endothelial_rich_region^Dmd^ Young^ Old^ 6.1369^ Young^ Glia_Endothelial_rich_region^Lyrm2^ Young^ Old^ 3.7670^ Young^ Glia_Endothelial_rich_region^Rpl37a^ Young^ Old^ 4.0751^ Young^ Glia_Endothelial_rich_region^Chtf8^ Young^ Old^ 3.3597^ Young^ Glia_Endothelial_rich_region^Cd3eap^ Young^ Old^ 6.0285^ Young^ Glia_Endothelial_rich_region^Bola2^ Young^ Old^ 5.6695^ Young^ Glia_Endothelial_rich_region^115Ranbp3l^ Young^ Old^ 4.3331^ Young^ Glia_Endothelial_rich_region^Rps23^ Young^ Old^ 4.8350^ Young^ Glia_Endothelial_rich_region^Vcpkmt^ Young^ Old^ 3.6343^ Young^ Glia_Endothelial_rich_region^Glp2r^ Young^ Old^ 16.1945^ Young^ Glia_Endothelial_rich_region^Rspry1^ Young^ Old^ 8.3250^ Young^ Glia_Endothelial_rich_region^Atp5k^ Young^ Old^ 7.0415^ Young^ Glia_Endothelial_rich_region^Reep1^ Young^ Old^ 8.9334^ Young^ Glia_Endothelial_rich_region^Prkg1^ Young^ Old^ 11.7801^ Young^ Glia_Endothelial_rich_region^Sec61b^ Young^ Old^ 3.1899^ Young^ Glia_Endothelial_rich_region^Klf2^ Young^ Old^ 3.0757^ Young^ Glia_Endothelial_rich_region^Epha6^ Young^ Old^ 10.4569^ Young^ Glia_Endothelial_rich_region^Snrpg^ Young^ Old^ 4.4976^ Young^ Glia_Endothelial_rich_region^Rpl38^ Young^ Old^ 6.8628^ Young^ Glia_Endothelial_rich_region^Palld^ Young^ Old^ 17.8490^ Young^ Glia_Endothelial_rich_region^Dhcr7^ Young^ Old^ 4.8736^ Young^ Glia_Endothelial_rich_region^Deaf1^ Young^ Old^ 3.1190^ Young^ Glia_Endothelial_rich_region^Pantr1^ Young^ Old^ 3.7814^ Young^ Glia_Endothelial_rich_region^Rpl35a^ Young^ Old^ 26.8684^ Young^ Glia_Endothelial_rich_region^Rpl26^ Young^ Old^ 4.1664^ Young^ Glia_Endothelial_rich_region^Rps17^ Young^ Old^ 3.0206^ Young^ Glia_Endothelial_rich_region^Rpl34^ Young^ Old^ 3.4586^ Young^ Glia_Endothelial_rich_region^Tnfaip8^ Young^ Old^ 4.2033^ Young^ Glia_Endothelial_rich_region^Numa1^ Young^ Old^ 3.9842^ Young^ Glia_Endothelial_rich_region^Rps28^ Young^ Old^ 10.4770^ Young^ Glia_Endothelial_rich_region^Hdac8^ Young^ Old^ 9.3371^ Young^ Glia_Endothelial_rich_region^Myl9^ Young^ Old^ 3.1860^ Young^ Glia_Endothelial_rich_region^Romo1^ Young^ Old^ 6.3533^ Young^ Glia_Endothelial_rich_region^Etnk2^ Young^ Old^ 4.0410^ Young^ Glia_Endothelial_rich_region^Usmg5^ Young^ Old^ 4.4979^ Young^ Glia_Endothelial_rich_region^Cfap44^ Young^ Old^ 30.1790^ Young^ Glia_Endothelial_rich_region^Zfp950^ Young^ Old^ 6.9282^ Young^ Glia_Endothelial_rich_region^Gm561^ Young^ Old^ 8.9877^ Young^ Glia_Endothelial_rich_region^Ifi27l2a^ Young^ Old^ 5.8981^ Young^ Glia_Endothelial_rich_region^Rpl36a^ Young^ Old^ 3.2168^ Young^ Glia_Endothelial_rich_region^Rpl39^ Young^ Old^ 4.1591^ Young^ Glia_Endothelial_rich_region^Pet100^ Young^ Old^ 3.9244^ Young^ Glia_Endothelial_rich_region^Fcor^ Young^ Old^ 8.2120^ Young^ Glia_Endothelial_rich_region^Nwd2^ Young^ Old^ 4.0999^ Young^ Glia_Endothelial_rich_region^Snrpe^ Young^ Old^ 3.1887^ Young^ Glia_Endothelial_rich_region^Rps27^ Young^ Old^ 10.4631^ Young^ Glia_Endothelial_rich_region^Mrpl33^ Young^ Old^ 8.1951^ Young^ Glia_Endothelial_rich_region^Samd4b^ Young^ Old^ 8.4271^ Young^ Glia_Endothelial_rich_region^Myom1^ Young^ Old^ 42.5409^ Young^ Glia_Endothelial_rich_region^Otoa^ Young^ Old^ 77.2810^ Young^ Glia_Endothelial_rich_region^Ints6l^ Young^ Old^ 4.4784^ Young^ Glia_Endothelial_rich_region^Lmod3^ Young^ Old^ 17.2815^ Young^ Glia_Endothelial_rich_region^mt‐Tv^ Young^ Old^ 22.1334^ Young^ Glia_Endothelial_rich_region^mt‐Tl1^ Young^ Old^ 20.6574^ Young^ Glia_Endothelial_rich_region^mt‐Tq^ Young^ Old^ 10.1913^ Young^ Glia_Endothelial_rich_region^mt‐Tm^ Young^ Old^ 8.0155^ Young^ Glia_Endothelial_rich_region^mt‐Ta^ Young^ Old^ 10635.0693^ Young^ Glia_Endothelial_rich_region^mt‐Tc^ Young^ Old^ 10.5379^ Young^ Glia_Endothelial_rich_region^mt‐Tp^ Young^ Old^ 9.6458^ Young^ Glia_Endothelial_rich_region^Hba‐a2^ Young^ Old^ 3.1126^ Young^ Glia_Endothelial_rich_region^2510002D24Rik^ Young^ Old^ 3.0541^ Young^ Glia_Endothelial_rich_region^Gm14539^ Young^ Old^ 6108.9943^ Young^ Glia_Endothelial_rich_region^3110056K07Rik^ Young^ Old^ 8.5604^ Young^ Glia_Endothelial_rich_region^Gm2830^ Young^ Old^ 4.9418^ Young^ Glia_Endothelial_rich_region^2810001G20Rik^ Young^ Old^ 4.4445^ Young^ Glia_Endothelial_rich_region^6720427I07Rik^ Young^ Old^ 4.2524^ Young^ Glia_Endothelial_rich_region^6530403H02Rik^ Young^ Old^ 28.7148^ Young^ Glia_Endothelial_rich_region^2310009A05Rik^ Young^ Old^ 3.0276^ Young^ Glia_Endothelial_rich_region^Gm8292^ Young^ Old^ 4.2914^ Young^ Glia_Endothelial_rich_region^Snhg8^ Young^ Old^ 13.3767^ Young^ Glia_Endothelial_rich_region^Gm20756^ Young^ Old^ 24.7594^ Young^ Glia_Endothelial_rich_region^Gm9794^ Young^ Old^ 17.0635^ Young^ Glia_Endothelial_rich_region^As3mt^ Young^ Old^ 4.1768^ Young^ White^matter^Rplp1^ Young^ Old^ 3.2103^ Young^ White^matter^Nf2^ Young^ Old^ 5.9175^ Young^ White^matter^116Rps25^ Young^ Old^ 3.4994^ Young^ White^matter^Ndufa2^ Young^ Old^ 3.8464^ Young^ White^matter^Cox6c^ Young^ Old^ 3.9908^ Young^ White^matter^Ndufa1^ Young^ Old^ 3.4768^ Young^ White^matter^Lama4^ Young^ Old^ 91.4141^ Young^ White^matter^Uqcr11^ Young^ Old^ 3.1231^ Young^ White^matter^Ankfy1^ Young^ Old^ 4.0016^ Young^ White^matter^Ralgapa1^ Young^ Old^ 4.9061^ Young^ White^matter^Slirp^ Young^ Old^ 4.8529^ Young^ White^matter^Ndufa5^ Young^ Old^ 3.2552^ Young^ White^matter^Ndufv3^ Young^ Old^ 3.0908^ Young^ White^matter^Rps26^ Young^ Old^ 3.9582^ Young^ White^matter^Rplp2^ Young^ Old^ 4.2853^ Young^ White^matter^Gng13^ Young^ Old^ 3.5269^ Young^ White^matter^Taf3^ Young^ Old^ 7.5578^ Young^ White^matter^Samhd1^ Young^ Old^ 4.6619^ Young^ White^matter^Lrrc7^ Young^ Old^ 4.5402^ Young^ White^matter^Rps20^ Young^ Old^ 3.2782^ Young^ White^matter^Tomm7^ Young^ Old^ 5.3502^ Young^ White^matter^Ndufa4^ Young^ Old^ 3.3398^ Young^ White^matter^Cox7b^ Young^ Old^ 3.1289^ Young^ White^matter^Mt3^ Young^ Old^ 3.3248^ Young^ White^matter^Mt2^ Young^ Old^ 3.9695^ Young^ White^matter^Mt1^ Young^ Old^ 3.1480^ Young^ White^matter^Trim33^ Young^ Old^ 4.6261^ Young^ White^matter^Cep350^ Young^ Old^ 4.2576^ Young^ White^matter^Rps29^ Young^ Old^ 4.4368^ Young^ White^matter^Anapc13^ Young^ Old^ 3.9252^ Young^ White^matter^Ndufa3^ Young^ Old^ 3.8032^ Young^ White^matter^Dym^ Young^ Old^ 3.7148^ Young^ White^matter^Cox8a^ Young^ Old^ 3.8993^ Young^ White^matter^Cox6b1^ Young^ Old^ 3.3568^ Young^ White^matter^Ndufc1^ Young^ Old^ 3.8396^ Young^ White^matter^Asxl2^ Young^ Old^ 8.5821^ Young^ White^matter^Atp5j2^ Young^ Old^ 4.2796^ Young^ White^matter^Rps21^ Young^ Old^ 4.5984^ Young^ White^matter^Rpl22l1^ Young^ Old^ 3.1827^ Young^ White^matter^Foxk2^ Young^ Old^ 3.0083^ Young^ White^matter^Lrrc17^ Young^ Old^ 17.8732^ Young^ White^matter^Catsperd^ Young^ Old^ 46.5388^ Young^ White^matter^Rpl37^ Young^ Old^ 5.1698^ Young^ White^matter^Spidr^ Young^ Old^ 16.0932^ Young^ White^matter^Shfm1^ Young^ Old^ 3.2791^ Young^ White^matter^Arhgef37^ Young^ Old^ 11.9176^ Young^ White^matter^Wdr89^ Young^ Old^ 3.8585^ Young^ White^matter^Rpl37a^ Young^ Old^ 3.5852^ Young^ White^matter^Bola2^ Young^ Old^ 3.6618^ Young^ White^matter^Atp5k^ Young^ Old^ 7.8507^ Young^ White^matter^Tatdn1^ Young^ Old^ 3.6378^ Young^ White^matter^Bre^ Young^ Old^ 3.5017^ Young^ White^matter^Epha6^ Young^ Old^ 24.8234^ Young^ White^matter^Snrpg^ Young^ Old^ 4.5593^ Young^ White^matter^Rpl38^ Young^ Old^ 4.2231^ Young^ White^matter^Rpl36^ Young^ Old^ 3.0737^ Young^ White^matter^Smim4^ Young^ Old^ 3.8512^ Young^ White^matter^Naa38^ Young^ Old^ 3.0500^ Young^ White^matter^Rpl35a^ Young^ Old^ 5.2922^ Young^ White^matter^Rpl26^ Young^ Old^ 3.9257^ Young^ White^matter^Rps17^ Young^ Old^ 3.6382^ Young^ White^matter^Rps28^ Young^ Old^ 7.0046^ Young^ White^matter^Hdac8^ Young^ Old^ 9.2440^ Young^ White^matter^Romo1^ Young^ Old^ 5.0632^ Young^ White^matter^Usmg5^ Young^ Old^ 4.8675^ Young^ White^matter^Myeov2^ Young^ Old^ 3.2225^ Young^ White^matter^Gm561^ Young^ Old^ 3.7129^ Young^ White^matter^Cfap74^ Young^ Old^ 7.1645^ Young^ White^matter^Rpl36a^ Young^ Old^ 3.0120^ Young^ White^matter^Rpl39^ Young^ Old^ 6.0458^ Young^ White^matter^Pet100^ Young^ Old^ 3.0583^ Young^ White^matter^117RpRpRpOtEp20LmGmmtmtmtmtmtmtmtmtmtmtmtmt1718AoGmGmSnGmA3GmSnGmGmAsCpNfLaRaTaLrToCep350^ Young^ Old^ 5.1968^ Young^ Cortex^Cnot3^ Young^ Old^ 8.6809^ Young^ Cortex^Cox8a^ Young^ Old^ 3.3229^ Young^ Cortex^Asxl2^ Young^ Old^ 3.7650^ Young^ Cortex^Stau1^ Young^ Old^ 4.4736^ Young^ Cortex^Lrrc17^ Young^ Old^ 6.9977^ Young^ Cortex^Catsperd^ Young^ Old^ 25.2336^ Young^ Cortex^Rpl37^ Young^ Old^ 3.4222^ Young^ Cortex^Spidr^ Young^ Old^ 10.3489^ Young^ Cortex^C77080^ Young^ Old^ 6.3081^ Young^ Cortex^Atp5k^ Young^ Old^ 3.9539^ Young^ Cortex^Tatdn1^ Young^ Old^ 3.7037^ Young^ Cortex^Il1rapl1^ Young^ Old^ 3.3889^ Young^ Cortex^Mrps21^ Young^ Old^ 4.5133^ Young^ Cortex^Epha6^ Young^ Old^ 8.5486^ Young^ Cortex^Snrpg^ Young^ Old^ 3.8684^ Young^ Cortex^Rpl35a^ Young^ Old^ 3.1980^ Young^ Cortex^Rps28^ Young^ Old^ 3.5014^ Young^ Cortex^Hdac8^ Young^ Old^ 16.0234^ Young^ Cortex^Romo1^ Young^ Old^ 3.3650^ Young^ Cortex^Usmg5^ Young^ Old^ 3.1524^ Young^ Cortex^Cfap74^ Young^ Old^ 4.3894^ Young^ Cortex^Rpl41^ Young^ Old^ 3.2081^ Young^ Cortex^Erdr1^ Young^ Old^ 4.0541^ Young^ Cortex^Gm42418^ Young^ Old^ 4.2458^ Young^ Cortex^Otoa^ Young^ Old^ 12.3584^ Young^ Cortex^Arhgef37^ Young^ Old^ 6.8906^ Young^ Cortex^A330033J07Rik^ Young^ Old^ 22.7762^ Young^ Cortex^Aox2^ Young^ Old^ 15.8917^ Young^ Cortex^118Gm20756^ Young^ Old^ 9.1141^ Young^ Cortex^mt‐Tf^ Young^ Old^ 12.4706^ Young^ Cortex^mt‐Tv^ Young^ Old^ 8.4329^ Young^ Cortex^mt‐Tl1^ Young^ Old^ 4.5202^ Young^ Cortex^mt‐Tq^ Young^ Old^ 9.1042^ Young^ Cortex^mt‐Tm^ Young^ Old^ 5.1137^ Young^ Cortex^mt‐Ta^ Young^ Old^ 10.8080^ Young^ Cortex^mt‐Tc^ Young^ Old^ 5.6139^ Young^ Cortex^mt‐Ts2^ Young^ Old^ 24.0742^ Young^ Cortex^mt‐Tl2^ Young^ Old^ 7.8133^ Young^ Cortex^mt‐Tp^ Young^ Old^ 9.5469^ Young^ Cortex^1700026J12Rik^ Young^ Old^ 3.7143^ Young^ Cortex^Gm23935^ Young^ Old^ 3.3488^ Young^ Cortex^Gm14539^ Young^ Old^ 4.6478^ Young^ Cortex^Sez6^ Young^ Old^ 3.7334^ Young^ Substantia^Inominata^As3mt^ Young^ Old^ 4.0030^ Young^ Substantia^Inominata^Cpt1c^ Young^ Old^ 5.2329^ Young^ Substantia^Inominata^Nf2^ Young^ Old^ 18.5689^ Young^ Substantia^Inominata^Lama4^ Young^ Old^ 79.5541^ Young^ Substantia^Inominata^Ube2g1^ Young^ Old^ 3.4650^ Young^ Substantia^Inominata^Ralgapa1^ Young^ Old^ 13.3457^ Young^ Substantia^Inominata^Taf3^ Young^ Old^ 4.4506^ Young^ Substantia^Inominata^Spata3^ Young^ Old^ 5.3157^ Young^ Substantia^Inominata^Lrrc7^ Young^ Old^ 6.4016^ Young^ Substantia^Inominata^Tomm7^ Young^ Old^ 3.5723^ Young^ Substantia^Inominata^Pdcd5^ Young^ Old^ 3.0024^ Young^ Substantia^Inominata^Cep350^ Young^ Old^ 8.4303^ Young^ Substantia^Inominata^Cnot3^ Young^ Old^ 7.7976^ Young^ Substantia^Inominata^Dym^ Young^ Old^ 4.3627^ Young^ Substantia^Inominata^Cox8a^ Young^ Old^ 4.0506^ Young^ Substantia^Inominata^Asxl2^ Young^ Old^ 5.6488^ Young^ Substantia^Inominata^Foxk2^ Young^ Old^ 3.8262^ Young^ Substantia^Inominata^Stau1^ Young^ Old^ 6.8165^ Young^ Substantia^Inominata^Lrrc17^ Young^ Old^ 9.5470^ Young^ Substantia^Inominata^Sox30^ Young^ Old^ 3.1670^ Young^ Substantia^Inominata^Catsperd^ Young^ Old^ 38.2978^ Young^ Substantia^Inominata^Rpl37^ Young^ Old^ 3.2764^ Young^ Substantia^Inominata^Spidr^ Young^ Old^ 12.0678^ Young^ Substantia^Inominata^Lgr6^ Young^ Old^ 16.9170^ Young^ Substantia^Inominata^Lmod3^ Young^ Old^ 5.3521^ Young^ Substantia^Inominata^Atp5k^ Young^ Old^ 4.3168^ Young^ Substantia^Inominata^Tatdn1^ Young^ Old^ 4.8228^ Young^ Substantia^Inominata^Il1rapl1^ Young^ Old^ 4.9568^ Young^ Substantia^Inominata^Mrps21^ Young^ Old^ 6.0730^ Young^ Substantia^Inominata^Epha6^ Young^ Old^ 16.1042^ Young^ Substantia^Inominata^Dnah9^ Young^ Old^ 7.4004^ Young^ Substantia^Inominata^Snrpg^ Young^ Old^ 3.9365^ Young^ Substantia^Inominata^Palld^ Young^ Old^ 5.6605^ Young^ Substantia^Inominata^Rpl35a^ Young^ Old^ 3.3972^ Young^ Substantia^Inominata^Rpl35^ Young^ Old^ 3.9211^ Young^ Substantia^Inominata^Hdac8^ Young^ Old^ 19.9342^ Young^ Substantia^Inominata^Romo1^ Young^ Old^ 3.4045^ Young^ Substantia^Inominata^Cfap44^ Young^ Old^ 11.4097^ Young^ Substantia^Inominata^Cfap74^ Young^ Old^ 6.7377^ Young^ Substantia^Inominata^Erdr1^ Young^ Old^ 3.7325^ Young^ Substantia^Inominata^Gm42418^ Young^ Old^ 4.6170^ Young^ Substantia^Inominata^Tcam1^ Young^ Old^ 4.4746^ Young^ Substantia^Inominata^Otoa^ Young^ Old^ 23.0129^ Young^ Substantia^Inominata^A330033J07Rik^ Young^ Old^ 29.9367^ Young^ Substantia^Inominata^Abcb11^ Young^ Old^ 3.9891^ Young^ Substantia^Inominata^Aox2^ Young^ Old^ 30.1154^ Young^ Substantia^Inominata^Gm20756^ Young^ Old^ 12.9375^ Young^ Substantia^Inominata^mt‐Tf^ Young^ Old^ 11.4868^ Young^ Substantia^Inominata^mt‐Tv^ Young^ Old^ 11.4969^ Young^ Substantia^Inominata^mt‐Tl1^ Young^ Old^ 7.0629^ Young^ Substantia^Inominata^mt‐Ti^ Young^ Old^ 3.1069^ Young^ Substantia^Inominata^mt‐Tq^ Young^ Old^ 17.6447^ Young^ Substantia^Inominata^mt‐Tm^ Young^ Old^ 7.7616^ Young^ Substantia^Inominata^mt‐Ta^ Young^ Old^ 22.6607^ Young^ Substantia^Inominata^119mt‐Tc^ Young^ Old^ 11.1333^ Young^ Substantia^Inominata^mt‐Ts2^ Young^ Old^ 21.5469^ Young^ Substantia^Inominata^mt‐Tl2^ Young^ Old^ 10.3638^ Young^ Substantia^Inominata^mt‐Tp^ Young^ Old^ 10.5253^ Young^ Substantia^Inominata^1700026J12Rik^ Young^ Old^ 5.8080^ Young^ Substantia^Inominata^Gm23935^ Young^ Old^ 3.4445^ Young^ Substantia^Inominata^Gm14539^ Young^ Old^ 5.3888^ Young^ Substantia^Inominata^Gm8292^ Young^ Old^ 3.1657^ Young^ Substantia^Inominata^Slc5a6^ Young^ Old^ 3.9003^ Young^ White^matter^Cpt1c^ Young^ Old^ 4.9969^ Young^ White^matter^Nf2^ Young^ Old^ 13.9905^ Young^ White^matter^Wwc1^ Young^ Old^ 4.4982^ Young^ White^matter^Lama4^ Young^ Old^ 45.4672^ Young^ White^matter^Ralgapa1^ Young^ Old^ 9.8571^ Young^ White^matter^Slirp^ Young^ Old^ 3.3186^ Young^ White^matter^Gpr180^ Young^ Old^ 3.0849^ Young^ White^matter^Lrrc7^ Young^ Old^ 6.3118^ Young^ White^matter^Tomm7^ Young^ Old^ 3.2042^ Young^ White^matter^Cep350^ Young^ Old^ 5.0505^ Young^ White^matter^Cnot3^ Young^ Old^ 5.1805^ Young^ White^matter^Mospd3^ Young^ Old^ 3.9414^ Young^ White^matter^Asxl2^ Young^ Old^ 4.1947^ Young^ White^matter^Stau1^ Young^ Old^ 7.4743^ Young^ White^matter^Lrrc17^ Young^ Old^ 8.1525^ Young^ White^matter^Catsperd^ Young^ Old^ 18.9777^ Young^ White^matter^Spidr^ Young^ Old^ 4.9734^ Young^ White^matter^Atp5k^ Young^ Old^ 4.2043^ Young^ White^matter^Il1rapl1^ Young^ Old^ 5.1432^ Young^ White^matter^Ddx10^ Young^ Old^ 3.9482^ Young^ White^matter^Epha6^ Young^ Old^ 10.7180^ Young^ White^ma...

Claims

Attorney Docket No.046531-5035-00WO CLAIMS 1. A method for generating a spatial map of transcription across a sample, comprising: a) applying a mixture of i) sender beads comprising an acrylamide-based gel bead with a plurality of attached oligonucleotides wherein each attached oligonucleotide comprises: a') a photocleavable linker; b') a primer sequence; c') a barcode sequence; d') a unique molecular identifier sequence; and e') a capture sequence for binding to a receiver bead, and ii) receiver beads comprising an acrylamide-based gel bead with a plurality of attached oligonucleotides wherein each attached oligonucleotide comprises a'') a primer sequence; b'') a barcode sequence; c'') a unique molecular identifier sequence; and d'') a capture sequence for binding to: i') a target molecule of interest; ii') a capture sequence of a sender bead, or iii') a combination of i') and ii') to a surface or slide; b) applying a tissue sample to the surface or slide; c) allowing hybridization of the receiver beads to the target molecule of interest; d) applying UV light to the surface or slide to induce photocleavage of the oligonucleotides of the sender beads; e) applying a reverse transcription mixture to the surface or slide; f) performing reverse transcription of the captured target molecules and the captured photocleaved oligonucleotides; 208g) delivering to the region of interest lysis buffer or denaturation reagents to produce a lysed or denatured tissue sample; and (h) extracting the receiver beads from the lysed or denatured tissue sample.

2. The method of claim 1, further comprising a step of permeabilizing the tissue sample prior to applying the tissue sample to the slide or surface containing the sender and receiver beads.

3. The method of claim 1, further comprising a step of taking an image of the tissue sample.

4. The method of any one of claims 1-3 further comprising steps: i) generating a sequencing library from the oligonucleotides attached to the recovered receiver beads; j) sequencing the sequencing library to produce barcoded DNA reads; k) generating a matrix of bead connections based on the UMI sequences and barcodes of the sender beads and receiver beads; l) generating a spatial map of the target molecules using the barcodes on the sequencing reads of the target molecules and the matrix of bead connections.

5. The method of claim 4 further comprising identifying the anatomical location of the target molecules by correlating the spatial map to the sample image.

6. The method of claim 1, wherein the capture sequence of the sender bead comprises a poly-A region.

7. The method of claim 1, wherein the capture sequence of the receiver bead comprises a poly-T region.

8. The method of claim 1, wherein the method further comprises identifying transcriptional patterns associated with a specific tissue or cell type within a sample. 2099. The method of claim 8, wherein the sample is a normal tissue sample, and the method generates a map of normal transcription within the tissue.

10. The method of claim 8, wherein the sample is a tissue sample from a subject having a disease or disorder, and the method generates a map of transcription associated with the disease or disorder.

11. The method of claim 10, wherein the disease or disorder is an autoimmune disease or disorder, an inflammatory disease or disorder, a neurodegenerative disease or disorder, a disease or disorder associated with a pathogen and cancer.

12. The method of claim 11, wherein the neurodegenerative disease or disorder is Lewy body dementia, Alzheimer's disease or Alzheimer's Disease Related Dementias (ADRD).

13. The method of claim 8, wherein the sample is from a tissue sample at a specific developmental stage, and the method generates a map of transcription within the tissue at the specific developmental stage.

14. The method of claim 12, wherein the method generates a map of transcription at specific ages.

15. A method of identifying transcriptional changes associated with a disease or disorder or a specific developmental stage, the method comprising a) generating a map of normal transcription within a tissue according to the method of claim 9, b) generating a map of transcription associated with a disease or disorder or a specific developmental stage according to the method of claim 10 or 11, and c) identifying transcriptional changes between b) and a). 21016. The method of claim 15, wherein the disease or disorder is an autoimmune disease or disorder, an inflammatory disease or disorder, a neurodegenerative disease or disorder, a disease or disorder associated with a pathogen and cancer.

17. The method of claim 16, wherein the neurodegenerative disease or disorder is Lewy body dementia, Alzheimer's disease or Alzheimer's Disease Related Dementias (ADRD).

18. The method of claim 15, wherein the method identifies transcriptional changes associated with aging.

19. A sender bead comprising an acrylamide-based gel bead with a plurality of attached oligonucleotides wherein each attached oligonucleotide comprises: a) a photocleavable linker; b) a primer sequence; c) a barcode sequence; d) a unique molecular identifier sequence; and e) a capture sequence for binding to a receiver bead.

20. A receiver bead comprising an acrylamide-based gel bead with a plurality of attached oligonucleotides wherein each attached oligonucleotide comprises: a) a primer sequence; b) a barcode sequence; c) a unique molecular identifier sequence; and d) a capture sequence for binding to i) a target molecule of interest; ii) an oligonucleotide released upon photocleavage of the photocleavable linker from the sender bead of claim 1, or iii) a combination of i) and ii). 21121. An assay system for generating a spatial map of one or more target molecule across a sample comprising a combination of sender beads of claim 19 and receiver beads of claim 20.

22. The assay system of claim 21, wherein the assay generates a transcriptional map of mRNA molecules across the sample.

23. The assay system of claim 21, wherein the capture sequence of the sender bead comprises a poly-A region, and the capture sequence of the receiver bead comprises a poly- T region. 212

Citation Information

Patent Citations

  • Functionalized gel beads

    US20200063191A1

  • Oligonucleotides and beads for 5 prime gene expression assay

    US20210371909A1

  • Spatially-tagged analyte capture agents for analyte multiplexing

    US20220326251A1

  • Generating capture probes for spatial analysis

    US20230002812A1

  • Beads as Transposome Carriers

    US20230287476A1