Duckweed glutamine synthetase GS2, coding gene, and use in improving utilization efficiency of plant urea

Abstract

Provided are a coding gene for duckweed plastidic glutamine synthetase GS2, a duckweed plastidic glutamine synthetase GS2, and use of the coding gene for duckweed plastidic glutamine synthetase GS2 in improving the utilization efficiency of plants on urea nitrogen fertilizer. Experiments prove that the coding gene for duckweed plastidic glutamine synthetase GS2 is recombined to a strong promoter-driven plant overexpression vector, the obtained recombinant expression vector is introduced into a receptor plant to overexpress the coding gene for duckweed plastidic glutamine synthetase GS2 to obtain a transgenic plant, the obtained transgenic plant is cultured under the condition that a nitrogen source contains urea, and the transgenic plant has higher urea nitrogen fertilizer utilization efficiency relative to the receptor plant. The provided method provides a new way for improving the utilization efficiency of the urea nitrogen fertilizer and reducing the application amount of the urea nitrogen fertilizer, and has important significance for the sustainable development of green agriculture.

Description

Duckweed glutamine synthase GS2, its encoding gene and its application in improving plant urea utilization efficiency Technical Field

[0001] This application belongs to the field of plant genetic engineering and relates to duckweed glutamine synthase GS2, its encoding gene, and its application in improving the efficiency of plant urea utilization. Background Technology

[0002] Nitrogen is a macronutrient essential for plant growth and development, indispensable for normal plant life activities. Nitrogen deficiency leads to abnormal plant growth and physiological changes, such as stunted growth, yellowing leaves, and decreased biomass and protein content. Nitrogen fertilizer is the main source of nitrogen for plants, but excessive application of nitrogen fertilizer causes increased economic costs and environmental damage, posing a significant challenge to humanity. Therefore, reducing the amount of nitrogen fertilizer applied and improving its utilization efficiency will bring immense benefits to humankind. Urea, as the most widely used nitrogen fertilizer in agriculture worldwide, accounts for approximately 50% of the total annual nitrogen fertilizer consumption in agriculture. Compared to other major forms of nitrogen fertilizer (such as nitrate nitrogen, ammonium nitrogen, and their mixtures), most plants utilize urea nitrogen at a rate approximately 10%–20% lower. Even rice, under suitable urea concentrations, achieves only one-fifth the utilization rate of other forms of nitrogen fertilizer. Meanwhile, urea is easily hydrolyzed into ammonium by urease in the soil by microorganisms or further converted into nitric oxide, leading to nitrogen loss and causing significant economic and ecological problems such as groundwater pollution. Therefore, improving the utilization efficiency of urea nitrogen fertilizer and reducing its application rate are of great significance for the sustainable development of green agriculture.

[0003] Currently, the main way to reduce urea nitrogen loss and improve urea utilization efficiency is to add urease inhibitors to the plant culture environment, which can reduce nitrogen loss caused by urea hydrolysis in the soil to a certain extent. However, studies have shown that even after urea is directly absorbed into plants, some urea cannot be effectively utilized. For example, urea is hardly hydrolyzed in hydroponic environments, and the biomass and protein content of rice, corn, wheat, and Arabidopsis thaliana grown with urea as a nitrogen source are lower than those of other forms of nitrogen fertilizer, such as nitrate nitrogen, ammonium nitrogen, and their mixed sources, when the same amount of nitrogen is supplied. Therefore, improving the utilization rate of urea nitrogen fertilizer is crucial for nitrogen fertilizer use in agriculture. Exploring the differences in urea nitrogen utilization among different plants, identifying dominant species with high urea nitrogen fertilizer utilization rates, and elucidating their mechanisms are new ways to improve the utilization efficiency of urea nitrogen fertilizer in different crops and thus reduce nitrogen fertilizer input. This is also the goal pursued by many researchers and breeders.

[0004] Duckweed is the world's smallest flowering plant, highly adaptable to its environment, and exhibits near-exponential growth, doubling its biomass within 30 hours under suitable conditions. It is also used as a supplementary source of protein in animal feed and human food due to its high protein content. Our previous systematic screening work revealed that some duckweed strains cultured with urea as the nitrogen source showed biomass and protein content close to or superior to other nitrogen fertilizers such as nitrate nitrogen and ammonium nitrogen. Therefore, exploring the mechanism by which dominant duckweed strains utilize urea and applying it to improve the utilization efficiency of urea nitrogen in other plants is crucial. Glutamine synthase (GS) is a key enzyme in plant nitrogen metabolism, converting ammonium ions (NH4+) from various nitrogen forms into nitrogen. + The nitrogen from inorganic nitrogen is converted into glutamine, and then into glutamate via glutamate synthase (GOGAT), thus achieving the assimilation of inorganic nitrogen into organic nitrogen. Plant nitrogen saturates (GS) are mainly divided into cytoplasmic GS1 and plastid GS2. Currently, there are many studies on GS1 regarding primary nitrogen assimilation under different nitrogen states, while research on GS2 mainly focuses on nitrogen assimilation during photorespiration and nitrogen reuse in plant life activities. There are no reports on the impact of GS2 on nitrogen use efficiency under urea as the nitrogen source. Technical issues

[0005] This application provides the duckweed glutamine synthase GS2, its encoding gene, and its application in improving the urea utilization efficiency of plants to solve the above-mentioned technical problems. Technical solutions

[0006] The purpose of this application is to provide the duckweed glutamine synthase GS2, its encoding gene, and its application in improving the urea utilization efficiency of plants, thereby providing a new approach to improve the utilization efficiency of urea nitrogen fertilizer and reduce the amount of urea nitrogen fertilizer applied.

[0007] To achieve the above-mentioned objectives, the technical solution adopted by the present invention is as follows:

[0008] A gene encoding a duckweed plastid glutamine synthase GS2, the nucleotide sequence of which is selected from:

[0009] (a) A nucleotide sequence as shown in SEQ ID NO.1; or,

[0010] (b) A nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.2; or,

[0011] (c) A nucleotide sequence that has at least 69% similarity to the nucleotide sequence defined in (a) or (b) and encodes a protein with the same function.

[0012] In the above-mentioned technical solution for the GS2 encoding gene of the duckweed plastid glutamine synthase, a feasible nucleotide sequence having at least 80% similarity to the nucleotide sequence defined in (a) or (b) and encoding the same functional protein is shown in SEQ ID NO.3. The nucleotide sequence shown in SEQ ID NO.3 has 83% similarity to the nucleotide sequence shown in SEQ ID NO.1 and encodes the same functional protein.

[0013] Further, (c) and (a) define nucleotide sequences that have at least 69% similarity and encode the same functional protein, wherein (c) and (a) define nucleotide sequences that have at least 69%, 70%, 73%, 75%, 76%, 78%, 80%, 81%, 83%, 85%, 87%, 88%, 89%, 90%, 92%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 99.9% similarity and encode the same functional protein.

[0014] Further, the nucleotide sequences defined in (c) and (b) have at least 69% similarity and encode the same functional protein, wherein the nucleotide sequences defined in (c) and (b) have at least 69%, 70%, 73%, 75%, 76%, 78%, 80%, 81%, 83%, 85%, 87%, 88%, 89%, 90%, 92%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 99.9% similarity and encode the same functional protein.

[0015] Furthermore, SEQ ID NO.1

[0016] This invention also provides a duckweed plastid glutamine synthase GS2, the amino acid sequence of which is selected from:

[0017] (a) The amino acid sequence as shown in SEQ ID NO.2; or,

[0018] (b) An amino acid sequence derived from the amino acid sequence defined in (a) by substitution and / or deletion and / or addition of one or more amino acid residues, and having the same function as the amino acid sequence defined in (a).

[0019] Furthermore, in the aforementioned technical solution for the glume-plastoid glutamine synthase GS2, the glume-plastoid glutamine synthase GS2 is encoded by the aforementioned glume-plastoid glutamine synthase GS2 encoding gene. For example, the amino acid sequence of the glume-plastoid glutamine synthase encoded by the nucleotide sequence shown in SEQ ID NO.1 is shown in SEQ ID NO.2, and the amino acid sequence of the glume-plastoid glutamine synthase encoded by the nucleotide sequence shown in SEQ ID NO.3 is shown in SEQ ID NO.4. The amino acid sequences shown in SEQ ID NO.2 and SEQ ID NO.4 have the same function, that is, both can improve the plant urea utilization efficiency.

[0020] Furthermore, SEQ ID NO.4

[0021] This application also provides a recombinant expression vector containing the GS2 encoding gene of the duckweed plastid glutamine synthase. This recombinant expression vector is formed by recombining the GS2 encoding gene of the duckweed plastid glutamine synthase into a plant overexpression vector driven by a strong promoter.

[0022] Furthermore, the plant overexpression vector includes any one of pCAMBIA2301, pCAMBIA2300, pCAMBIA1300, pCAMBIA1302, pCAMBIA1305, and pCAMBIA1200.

[0023] This application also provides a method for obtaining transgenic plants, stably introducing the aforementioned duckweed plastid glutamine synthase GS2 encoding gene.

[0024] Furthermore, the plants include, but are not limited to, one or more of the following: duckweed, tobacco, Arabidopsis thaliana, rice, alfalfa, Sudan grass, ryegrass, woolly grass, corn, wheat, sorghum, tea tree, and sugar beet.

[0025] Furthermore, alfalfa includes clover or caltrop alfalfa.

[0026] Furthermore, sorghum includes red sorghum or sweet sorghum.

[0027] This application also provides a method for detecting whether a transgenic plant contains the GS2 encoding gene of the lepidocrosome-type glutamine synthase, comprising at least one of the following methods: 1) designing primers according to the GS2 encoding gene sequence of the lepidocrosome-type glutamine synthase according to claim 1, and detecting it using PCR; 2) extracting DNA from the plant and performing Southern hybridization; 3) extracting protein from the plant and performing Western blot analysis; 4) extracting RNA from the plant and performing real-time quantitative PCR to detect gene expression quantification.

[0028] This application also provides the application of the duckweed plastid glutamine synthase GS2 encoding gene in improving the plant's utilization efficiency of urea nitrogen fertilizer.

[0029] Furthermore, in the above-mentioned application, the GS2 encoding gene of the lepidocrosome glutamine synthase is recombined into a plant overexpression vector driven by a strong promoter. The resulting recombinant expression vector is introduced into a recipient plant to overexpress the GS2 encoding gene of the lepidocrosome glutamine synthase, thereby obtaining a transgenic plant. The transgenic plant is then cultured under conditions where urea is present as a nitrogen source. This transgenic plant exhibits higher urea nitrogen fertilizer utilization efficiency compared to the recipient plant.

[0030] Furthermore, in the above-mentioned application, the transgenic plant has a higher urea nitrogen fertilizer utilization efficiency than the recipient plant, which is manifested in that the transgenic plant has a higher biomass, amino acid content, and protein content than the recipient plant, and the transgenic plant has a higher protein production efficiency, nitrogen absorption rate, and nitrogen utilization efficiency than the recipient plant.

[0031] In the above-mentioned technical solutions, the recipient plants include, but are not limited to, one or more of duckweed, tobacco, Arabidopsis thaliana, rice, alfalfa, Sudan grass, ryegrass, woolly grass, corn, wheat, sorghum, tea tree, and sugar beet.

[0032] Furthermore, alfalfa includes clover or caltrop alfalfa.

[0033] Furthermore, sorghum includes red sorghum or sweet sorghum.

[0034] In the above-mentioned technical solutions, especially when the transgenic plant is cultured in an environment where urea is the only nitrogen source, the transgenic plant has a significantly higher urea nitrogen fertilizer utilization efficiency compared to the recipient plant.

[0035] This application experimentally demonstrates that, under urea-based nitrogen source conditions, the transgenic plants exhibit higher GS2 gene expression and total GS enzyme activity compared to the recipient plants, which is beneficial for improving urea nitrogen fertilizer utilization efficiency. For example, under urea-based nitrogen source conditions, compared to wild-type duckweed ZH0403, the transgenic duckweed ZH0403, incorporating the GS2 encoding gene of the duckweed plastid glutamine synthase, showed significantly higher GS2 gene expression and total GS enzyme activity. Simultaneously, the biomass, protein content, and amino acid content of the transgenic duckweed ZH0403 plants were all higher than those of the wild-type duckweed ZH0403 plants. Compared to the wild-type duckweed ZH0403 plants, the transgenic duckweed ZH0403 plants showed approximately 31% higher protein production efficiency, approximately 29% higher nitrogen uptake rate, and approximately 5% higher nitrogen utilization efficiency. Transgenic plants created by transferring the GS2 gene encoding the pluripotent glutamine synthase into other plants, such as rice, tobacco, and Arabidopsis, and then culturing them with urea as the nitrogen source, can produce similar effects to the aforementioned transgenic duckweed. For example, transgenic rice, transgenic tobacco, and transgenic Arabidopsis thaliana, all induced by the GS2 gene, exhibited higher biomass and protein content than wild-type rice, tobacco, and Arabidopsis thaliana when cultured with urea as the nitrogen source. This indicates that, under the same nitrogen supply, the urea utilization rate of transgenic plants increased, meaning that urea nitrogen fertilizer utilization efficiency was higher. Based on these experimental results, in practical applications, the GS2 gene encoding the pluripotent glutamine synthase can be transferred into more other plants to improve their urea nitrogen fertilizer utilization efficiency. Beneficial effects

[0036] The beneficial effects of this application are as follows: The technical solution provided in this application produces the following beneficial technical effects: This invention provides a gene encoding GS2 for lepidocrosome-type glutamine synthase, which encodes GS2. A recombinant expression vector containing the GS2 encoding gene is also provided. It has been demonstrated that transgenic plants formed by transferring the GS2 encoding gene into recipient plants exhibit higher urea nitrogen fertilizer utilization efficiency compared to the recipient plants when cultured under urea-based nitrogen source conditions. This invention provides a new approach to reducing urea application and improving crop urea utilization efficiency in agriculture, which is of great significance for the sustainable development of green agriculture. Attached Figure Description

[0037] Figure 1 shows the positive detection results of GS2-overexpressing transgenic duckweed plants.

[0038] Figure 2 shows the results of GS2 gene expression, GS enzyme activity, biomass, and protein content detection for wild-type duckweed ZH0403 and transgenic duckweed ZH0403.

[0039] Figure 3 shows the amino acid content detection results of wild-type duckweed ZH0403 and transgenic duckweed ZH0403.

[0040] Figure 4 shows the results of protein production efficiency, nitrogen uptake rate, and nitrogen utilization efficiency of wild-type duckweed ZH0403 and transgenic duckweed ZH0403.

[0041] Figure 5 shows the positive detection results of GS2 overexpressing transgenic rice plants.

[0042] Figure 6 shows photographs of wild-type rice Zhonghua 11 and transgenic rice after four weeks of cultivation, along with the results of biomass and protein content analysis.

[0043] Figure 7 shows the positive detection results of GS2 overexpressing transgenic tobacco plants.

[0044] Figure 8 shows photographs of wild-type tobacco and transgenic tobacco after three weeks of cultivation, along with the results of biomass and protein content analysis.

[0045] Figure 9 shows the positive detection results of GS2-overexpressing transgenic Arabidopsis plants.

[0046] Figure 10 shows photographs of wild-type Arabidopsis thaliana and transgenic Arabidopsis thaliana after three weeks of culture, along with the results of biomass and protein content analysis.

[0047] Figure 11 shows the positive detection results of GS2 overexpressing transgenic duckweed plants derived from duckweed ZH0403.

[0048] Figure 12 shows the biomass and protein content of wild-type duckweed ZH0403 and GS2 transgenic duckweed ZH0403 derived from ZH0403. Modes for Carrying Out the Invention

[0049] The following examples further illustrate the glutamine synthase GS2, its encoding gene, vector, host, and applications provided by the present invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods in this technical field. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0050] In the following embodiments, the duckweed ZH0104 and duckweed ZH0403 are derived from the duckweed germplasm resource bank of the Chengdu Institute of Biology, Chinese Academy of Sciences.

[0051] In the following examples, the formulation of the modified nitrogen-free Hoagland medium is as follows: 1 mM CaCl2, 3 mM KCl, 1 mM KH2PO4, 0.14 mM HCl, 4 μM Tartaric acid, 4 μM FeCl3·6H2O, 0.4 mM MgSO4·7H2O, 9.25 μM H3BO3, 0.15 μM ZnSO4·7H2O, 0.1 μM Na2MoO4·2H2O, 0.64 μM CuSO4·5H2O, 3.65 μM MnCl2·4H2O, 6 μM EDTA, and 0.01 mM KOH.

[0052] Example 1: Cloning of the full-length CDS of the duckweed GS2 gene

[0053] First, the GS2 gene coding region sequences published in Arabidopsis thaliana and rice were compared with the reference genome sequence of *Leptochloa spp.* to obtain the homologous GS2 gene coding region sequence. Then, primers were designed based on the GS2 gene coding region sequence of *Leptochloa spp.*: forward primer 5'ATGGCGACGCAGATTCCGGCG3' and reverse primer 5'TTAGGCGTTCAGAAGCACCTTC3'.

[0054] Total RNA was extracted from the *Lemna minor* strain ZH0104 using the Promega East Super Total RNA Extraction Kit according to the manufacturer's instructions. The RNA was then reverse transcribed into cDNA using the Prime Script™ RT Reagent kit (Takara). Using the reverse-transcribed cDNA as a template, the full-length CDS sequence of the *Lemna minor* ZH0104 GS2 gene was amplified by PCR using the aforementioned forward and reverse primers, and then sequenced. Its nucleotide sequence is shown in SEQ ID NO.1 of the sequence listing. The nucleotide sequence shown in SEQ ID NO.1 encodes the *Lemna minor* plastid glutamine synthase GS2, whose amino acid sequence is shown in SEQ ID NO.2.

[0055] PCR reaction system:

[0056] PCR amplification procedure:

[0057] Example 2: Construction of the GS2 transgenic expression vector

[0058] Recombinant primers (5'GAGCTCGGTACCGGATCCATGGCGACGCAGATTCCGGCG3' and 5'CACCATAGATCTGCCAAGCTTGGCGTTCAGAAGCACCTTCTGCGAG3') containing BamH1 and HindIII restriction sites were designed. The GS2 coding region was amplified using cDNA from the duckweed strain ZH0104 as a template. The PCR amplification system and procedure were the same as in Example 1. The amplified fragment was then recombined with the pCAMBIA2301 vector, which had been double-digested with BamH1 and HindIII, to obtain a fusion overexpression vector.

[0059] Example 3: Obtaining and detecting GS2-overexpressing transgenic duckweed plants

[0060] Using Agrobacterium GV3101-mediated genetic transformation, the fusion overexpression vector obtained in Example 2 was introduced into the wild-type duckweed ZH0403 line with low urea nitrogen utilization. Screening was then performed using the antibiotic G418. Genomic DNA was extracted from the transgenic duckweed ZH0403 and amplified by PCR. The detection primers were those for the vector's resistance gene (5'CTGGGAACTACTC ACACATT3' and 5'GAAAGCTCGAGAGAGATA3'). The PCR amplification system and procedure were the same as in Example 1. Positive plants identified by PCR were screened with G418 antibiotic and asexually propagated to obtain homozygotes for phenotypic detection of the transgenic duckweed ZH0403.

[0061] To examine the phenotype of transgenic duckweed under urea culture, transgenic duckweed ZH0403 and wild-type duckweed ZH0403 plants were cultured in a modified nitrogen-free Hoagland medium supplemented with 2.5 mM urea. After one week of culture, transgenic duckweed ZH0403 and wild-type duckweed ZH0403 plants were harvested, and the expression level of GS2 gene, total GS enzyme activity, biomass, amino acid content, protein content, protein production efficiency (kg protein yield / kg N supply), nitrogen uptake rate (NUpE, kg plant N content / kg N supply), and nitrogen use efficiency (NUE, kg biomass / kg N supply) were measured. All treatments were performed in at least three biological replicates.

[0062] Figure 1 shows the positive detection results of GS2-overexpressing transgenic duckweed ZH0403. Figure 2 shows the detection results of GS2 gene expression level, GS enzyme activity, biomass, and protein content in wild-type duckweed ZH0403 and transgenic duckweed ZH0403. Figure 3 shows the detection results of 18 amino acid contents in wild-type duckweed ZH0403 and transgenic duckweed ZH0403. Figure 4 shows the detection results of protein production efficiency, nitrogen uptake rate, and nitrogen use efficiency in wild-type duckweed ZH0403 and transgenic duckweed ZH0403. In Figures 2-4, WT and OE-GS2 represent wild-type and transgenic duckweed ZH0403, respectively.

[0063] As shown in Figure 2, compared to the wild-type duckweed ZH0403, the transgenic duckweed ZH0403 showed significantly increased GS2 gene expression and total GS enzyme activity. Simultaneously, the biomass and protein content of the transgenic duckweed ZH0403 plants increased by approximately 10% and 23% respectively compared to the wild-type ZH0403 plants. As shown in Figure 3, the content of all 18 amino acids in the transgenic duckweed ZH0403 plants increased by 15%–30% compared to the wild-type ZH0403 plants. Since nitrogen use efficiency is defined as the harvested biomass or grain yield under a given nitrogen supply, an increase in protein or amino acid content indicates enhanced nitrogen assimilation, which is beneficial for increasing biomass. In this embodiment, the increase in protein content, amino acid content, and biomass represents and is characteristic of increased urea nitrogen use efficiency, implying an increase in urea utilization efficiency. As shown in Figure 4, compared with the wild-type duckweed ZH0403 plant, the transgenic duckweed ZH0403 plant has an increased protein production efficiency of about 31%, an increased nitrogen uptake rate of about 29%, and an increased nitrogen use efficiency of about 5%.

[0064] Example 4: Obtaining and detecting GS2 overexpression transgenic rice

[0065] The Agrobacterium GV3101-mediated genetic transformation method was used to introduce the fusion overexpression vector obtained in Example 2 into wild-type rice Zhonghua 11, followed by screening with the antibiotic G418. Genomic DNA of the overexpressing transgenic rice was extracted and amplified by PCR. The detection primers were the primers for the vector's resistance gene (5'CTGGGAACTACTCACACATT3' and 5'GAAAGCTCGAGAGAGATA3'), and the PCR amplification system and procedure were the same as in Example 1. Seeds from positive plants were selected, and after germination, they were screened with G418 antibiotic. The homozygous individuals that survived the screening were used for seedling culture.

[0066] To examine the phenotypic changes in transgenic rice cultured with urea as the sole nitrogen source, seedlings of transgenic rice and wild-type rice Zhonghua 11 were hydroponically cultured in a modified nitrogen-free Hoagland medium supplemented with 2.5 mM urea, with the medium changed weekly. After four weeks of culture, biomass and protein content of both transgenic and wild-type Zhonghua 11 rice were measured. All treatments were performed in at least five biological replicates.

[0067] Figure 5 shows the positive detection results of GS2 overexpression transgenic rice. Figure 6(A) shows photographs of wild-type rice Zhonghua 11 and transgenic rice after four weeks of cultivation. Figures 6(B) and (C) show the biomass and protein content detection results of wild-type rice Zhonghua 11 and transgenic rice. In Figure 6, WT and OE-GS2 represent wild-type rice Zhonghua 11 and transgenic rice, respectively.

[0068] As shown in Figure 6, after four weeks of cultivation in a modified nitrogen-free Hoagland medium supplemented with 2.5 mM urea, the transgenic rice grew better than the wild-type rice Zhonghua 11. Compared to the wild-type rice Zhonghua 11, the biomass and protein content of the transgenic rice increased by about 11% and about 23%, respectively, which means an increase in urea utilization.

[0069] Example 5: Obtaining and detecting GS2-overexpressing transgenic tobacco

[0070] The Agrobacterium GV3101-mediated genetic transformation method was used to introduce the fusion overexpression vector obtained in Example 2 into wild-type tobacco, followed by screening with the antibiotic G418. Genomic DNA was extracted from the overexpressing transgenic tobacco and amplified by PCR. The primers used for detection were the primers for the vector's resistance gene (5'CTGGGAACTACTCACACATT3' and 5'GAAAGCTC GAGAGAGATA3'). The PCR amplification system and procedure were the same as in Example 1. Seeds from positive plants were selected, and after germination, they were screened with G418 antibiotic. The surviving homozygotes were used for germination and seedling growth.

[0071] To examine the phenotype of transgenic tobacco under urea nitrogen source culture, seedlings of transgenic and wild-type tobacco were hydroponically cultured in a modified nitrogen-free Hoagland medium supplemented with 2.5 mM urea, with the culture medium changed weekly. After three weeks of culture, the biomass and protein content of transgenic and wild-type tobacco were measured. Five biological replicates were performed for both transgenic and wild-type tobacco.

[0072] Figure 7 shows the positive detection results of GS2 overexpression transgenic tobacco. Figure 8(A) shows photographs of wild-type tobacco and transgenic tobacco after three weeks of cultivation, while Figures 8(B) and (C) show the biomass and protein content detection results of wild-type tobacco and transgenic tobacco. In Figure 8, WT and OE-GS2 represent wild-type tobacco and transgenic tobacco, respectively.

[0073] As shown in Figure 8, after three weeks of cultivation in a modified nitrogen-free Hoagland medium supplemented with 2.5 mM urea, the transgenic tobacco grew better than the wild-type tobacco. Compared with the wild-type tobacco, the biomass and protein content of the transgenic tobacco increased by about 18% and about 28%, respectively, which means an increase in urea utilization.

[0074] Example 6: Obtaining and detecting GS2-overexpressing transgenic Arabidopsis thaliana

[0075] The Agrobacterium GV3101-mediated genetic transformation method was used to introduce the fusion overexpression vector obtained in Example 2 into wild-type Arabidopsis thaliana, followed by screening with the antibiotic G418. Genomic DNA was extracted from the overexpressing transgenic Arabidopsis thaliana and amplified by PCR. The detection primers were the primers for the vector's resistance gene (5'CTGGGAACTACTCACACATT3' and 5'GAAAGCTCGAGAGAGATA3'), and the PCR amplification system and procedure were the same as in Example 1. Seeds from positive plants were selected, and after germination, they were screened with the G418 antibiotic. The surviving homozygotes were used for germination and seedling growth.

[0076] To examine the phenotype of transgenic Arabidopsis thaliana under urea nitrogen source culture, seedlings of both transgenic and wild-type Arabidopsis thaliana were hydroponically cultured in a modified nitrogen-free Hoagland medium supplemented with 2.5 mM urea, with the culture medium changed weekly. After three weeks of culture, the biomass and protein content of both transgenic and wild-type Arabidopsis thaliana were measured. Five biological replicates were performed for both transgenic and wild-type Arabidopsis thaliana.

[0077] Figure 9 shows the positive detection results of GS2 overexpressing transgenic Arabidopsis thaliana. Figure 10(A) shows photographs of wild-type Arabidopsis thaliana and transgenic Arabidopsis thaliana after three weeks of culture. Figures 10(B) and (C) show the biomass and protein content detection results of wild-type Arabidopsis thaliana and transgenic Arabidopsis thaliana. In Figure 10, WT and OE-GS2 represent wild-type Arabidopsis thaliana and transgenic Arabidopsis thaliana, respectively.

[0078] As shown in Figure 10, after three weeks of cultivation in a modified nitrogen-free Hoagland medium supplemented with 2.5 mM urea, the transgenic Arabidopsis thaliana grew better than the wild-type Arabidopsis thaliana. Compared with the wild-type Arabidopsis thaliana, the biomass and protein content of the transgenic Arabidopsis thaliana increased by about 14% and about 12%, respectively, which means an increase in urea utilization.

[0079] Example 7: Obtaining and detecting GS2 overexpressing transgenic duckweed derived from duckweed ZH0403

[0080] The coding region sequence of the GS2 gene of the duckweed strain ZH0104 was compared with the reference genome sequence of *Lemna minor* to obtain the coding region sequence of the GS2 gene of the duckweed strain ZH0403, which had 83% homology. The nucleotide sequence shown in SEQ ID NO.3 of the sequence listing is the coding region sequence of the GS2 gene of the duckweed strain ZH0403. The nucleotide sequence shown in SEQ ID NO.3 of the sequence listing encodes the duckweed plastid glutamine synthase GS2, whose amino acid sequence is shown in SEQ ID NO.4.

[0081] RNA was extracted from the duckweed strain ZH0403 using the method described in Example 1 and reverse transcribed into cDNA. Recombinant primers (5'GGAGCTCGGTACCGGATCCATGGCGGCGCAGATTCCCG3' and 5'CCATAGATCTGCCAAGCTTGGAGGCGACATACTCCACAG3') containing BamH1 and HindIII restriction sites were designed. The GS2 coding region was amplified using the cDNA from the duckweed strain ZH0403 as a template, and then sequenced. The PCR amplification system and procedure were the same as in Example 1. The amplified fragment was then recombined with the pCAMBIA2301 vector, which had been double-digested with BamH1 and HindIII, to obtain a GS2 overexpression vector derived from the ZH0403 strain.

[0082] Using Agrobacterium GV3101-mediated genetic transformation, the fusion overexpression vector obtained in this example was introduced into the wild-type duckweed ZH0403 line with low urea nitrogen utilization. Screening was then performed using the antibiotic G418. Genomic DNA was extracted from the transgenic duckweed ZH0403 and amplified by PCR. The detection primers were those for the vector's resistance gene (5'CTGGGAACTACTC ACACATT3' and 5'GAAAGCTCGAGAGAGATA3'). The PCR amplification system and procedure were the same as in Example 1. Positive plants identified by PCR were screened with G418 antibiotic and asexually propagated to obtain homozygotes for phenotypic detection of the transgenic duckweed ZH0403.

[0083] To examine the phenotype of transgenic duckweed under urea culture, transgenic duckweed ZH0403 and wild-type duckweed ZH0403 plants were cultured in modified nitrogen-free Hoagland medium supplemented with 2.5 mM urea. After one week of culture, transgenic duckweed ZH0403 and wild-type duckweed ZH0403 plants were harvested, and biomass and protein content were measured. All treatments were performed in at least three biological replicates.

[0084] Figure 11 shows the positive detection results of GS2 overexpressing transgenic duckweed plants derived from the ZH0403 strain. Figure 12(A) shows photographs of wild-type and transgenic duckweed ZH0403 after one week of cultivation. Figures 12(B) and (C) show the biomass and protein content detection results of wild-type and transgenic duckweed ZH0403 plants. In Figure 12, WT and OE-GS2 represent wild-type and transgenic duckweed ZH0403, respectively.

[0085] As shown in Figure 12, after one week of cultivation in modified nitrogen-free Hoagland medium supplemented with 2.5 mM urea, the transgenic duckweed ZH0403 showed better growth than the wild-type duckweed ZH0403. Compared to the wild-type duckweed ZH0403, the biomass and protein content of the transgenic duckweed ZH0403 increased by approximately 8% and 24%, respectively. The results of biomass and protein content of the GS2-overexpressing transgenic duckweed plants derived from the ZH0403 strain in this example are similar to those in Example 3, indicating that the two transgenic plants with 83% homology of GS2 nucleic acid sequences derived from the duckweed ZH0104 and ZH0403 strains can improve urea nitrogen utilization efficiency.

Claims

1. A gene encoding GS2, a type of duckweed plastid glutamine synthase, characterized in that, The nucleotide sequence of this gene is selected from: (a) A nucleotide sequence as shown in SEQ ID NO.1; or, (b) A nucleotide sequence encoding the amino acid sequence shown in SEQ ID No. 2; or, (c) A nucleotide sequence that has at least 69% similarity to the nucleotide sequence defined in (a) or (b) and encodes a protein with the same function.

2. A duckweed plastid glutamine synthase GS2, characterized in that, The amino acid sequence of this duckweed plastid glutamine synthase GS2 is selected from: (a) The amino acid sequence as shown in SEQ ID No. 2; or, (b) An amino acid sequence derived from the amino acid sequence defined in (a) by substitution and / or deletion and / or addition of one or more amino acid residues, and having the same function as the amino acid sequence defined in (a).

3. The duckweed plastid glutamine synthase GS2 according to claim 2, characterized in that, The duckweed plastid glutamine synthase GS2 is encoded by the gene described in claim 1.

4. A recombinant expression vector containing the GS2 encoding gene of the duckweed plastid glutamine synthase as described in claim 1.

5. A method for obtaining transgenic plants, characterized in that, The GS2 encoding gene for the duckweed plastid glutamine synthase as described in claim 1 was stably introduced.

6. A method for detecting whether a transgenic plant contains the GS2 encoding gene for the duckweed plastid glutamine synthase as described in claim 1, characterized in that, The method includes at least one of the following: 1) designing primers for the encoding gene sequence of the duckweed plastid glutamine synthase GS2 according to claim 1 and detecting it using PCR; 2) extracting DNA from the plant and performing Southern hybridization; 3) extracting protein from the plant and performing Western blot analysis; 4) extracting RNA from the plant and performing real-time quantitative PCR to detect gene expression quantification.

7. The application of the duckweed plastid glutamine synthase GS2 encoding gene as described in claim 1 in improving the plant's utilization efficiency of urea nitrogen fertilizer.

8. The application according to claim 7, characterized in that, The GS2 encoding gene of the duckweed plastid glutamine synthase was recombined into a plant overexpression vector driven by a strong promoter. The resulting recombinant expression vector was introduced into a recipient plant to overexpress the GS2 encoding gene of the duckweed plastid glutamine synthase, resulting in a transgenic plant. The transgenic plant was cultured under conditions where urea was present as a nitrogen source. The transgenic plant showed higher urea nitrogen fertilizer utilization efficiency compared to the recipient plant.

9. The application according to claim 8, characterized in that, The transgenic plant has a higher urea nitrogen fertilizer utilization efficiency than the recipient plant, which is manifested in that the transgenic plant has a higher biomass, amino acid content and protein content than the recipient plant, and the transgenic plant has a higher protein production efficiency, nitrogen absorption rate and nitrogen utilization efficiency than the recipient plant.

10. The application according to claim 8 or 9, characterized in that, The recipient plants include, but are not limited to, one or more of the following: duckweed, tobacco, Arabidopsis thaliana, rice, alfalfa, Sudan grass, ryegrass, wool grass, corn, wheat, sorghum, tea tree, and sugar beet.

Images