Gene editing method for b2m locus
By designing a complex of highly specific and stable sgRNA and Cas9 nuclease to precisely knock out the B2M gene, the problems of high off-target risk and low knockdown efficiency in existing technologies have been solved, enabling the preparation of universal CAR-T cells with reduced immunogenicity and improving the safety and therapeutic effect of allogeneic CAR-T cell therapy.
Patent Information
- Application Number
- PCT/CN2025/082053
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-23
- Filing Date
- 2025-03-12
- Publication Date
- 2025-10-30
AI Technical Summary
Existing B2M gene knockout methods have a high risk of off-target effects and low knockdown efficiency, leading to frequent immune rejection reactions in allogeneic CAR-T cell therapy and limiting its clinical application.
We designed a highly specific and stable sgRNA-Cas9 nuclease complex, precisely knocked out the B2M gene using CRISPR/Cas9 technology, reduced HLA-I expression, and prepared universal CAR-T cells with reduced immunogenicity.
This method achieves efficient and stable knockout of the B2M gene, reduces the risk of host anti-graft reaction and immune rejection, and improves the safety and efficacy of CAR-T cell therapy.
Smart Images

Figure PCTCN2025082053-FTAPPB-I100001 
Figure PCTCN2025082053-FTAPPB-I100002 
Figure PCTCN2025082053-FTAPPB-I100003
Abstract
Description
Gene editing methods for the B2M locus
[0001] Related citations
[0002] This application claims priority to Chinese Patent Application No. 202410488220.7, filed on April 23, 2024, the entire contents of which are incorporated herein by reference. Technical Field
[0003] This invention relates to the fields of genetic engineering and cell biology. Specifically, it relates to cells with reduced immunogenicity, gene editing methods, and related applications. Background Technology
[0004] Chimeric antigen receptor T-cell (CAR-T) therapy has achieved great success in the treatment of cancer, especially for hematologic malignancies. Nevertheless, some limiting factors in autologous CAR-T cell therapy prevent its large-scale clinical application, such as the expensive and lengthy manufacturing process and the limited cell source.
[0005] To overcome these drawbacks, universal allogeneic CAR-T cells were developed. However, organisms often reject xenografts or allogeneic grafts, mainly because the donor's genes encode antigens that are not present in the recipient. These antigens are recognized by the recipient's immune cells, causing a rejection reaction known as host versus graft reaction (HVGR).
[0006] To address this issue, universal CAR-T cells can reduce cellular immunogenicity by editing human leukocyte antigen (HLA) molecules, thus supporting more patients to receive effective treatment through CAR-T therapy.
[0007] Cells expressing allogeneic major histocompatibility complex (MHC)-I can be detected by CD8. + T cells (killer T cells) recognize and eliminate these cells. HLA-I (HLA-A, HLA-B, HLA-C) encode MHC-I. Knocking out HLA-I molecules helps allogeneic T cells survive better in the host.
[0008] β2-microglobulin (B2M) is an important subunit of MHC-I. By knocking out the B2M gene using CRISPR / Cas9 gene editing technology, HLA-I molecules can no longer be expressed in cells, reducing cellular immunogenicity and effectively reducing the risk of host anti-graft reaction and immune rejection.
[0009] Existing sgRNAs used to knock out the B2M gene suffer from high off-target risks and low knockdown efficiency. Therefore, this invention aims to provide an sgRNA with high gene knockdown efficiency and low off-target risk. Consequently, there is a great need in the art for improved gene editing methods and techniques to obtain cells with reduced immunogenicity. Summary of the Invention
[0010] One object of this invention is to provide a stable sgRNA that is highly efficient in gene cleavage, does not interfere with each other, is not prone to off-target effects, and is stable. Another object of this invention is to provide a reagent for preparing immunogenic cells (e.g., universal CAR-T cells) that can be used for allogeneic cell therapy, capable of efficiently, specifically, stably, without off-target effects, and without interfering with each other to knock out the B2M gene.
[0011] In one aspect, the present invention provides an sgRNA comprising a recognition sequence that specifically recognizes a target site in the B2M gene, said recognition sequence having at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with the nucleotide sequence of any one of SEQ ID NO:1-38. In some embodiments, the target site is located within a first, second, third, or fourth coding exon of the B2M gene.
[0012] In some specific embodiments, the identification sequence has or consists of a nucleotide sequence of any one of SEQ ID NO: 1, 6, 16, 4, 5, 8 and 10.
[0013] In some embodiments, the sgRNA further comprises a constant sequence as a framework, such as the constant sequence shown in SEQ ID NO:40. The sgRNAs of the present invention may share the same constant sequence. The constant sequence may comprise a portion of crRNA and a tracrRNA sequence. The constant sequence used in the sgRNA in combination with the recognition sequence is not limited to those used herein and is conventionally chosen by those skilled in the art.
[0014] In some embodiments, the sgRNA may have at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity in a constant sequence with the nucleotide sequence of SEQ ID NO:40. In some specific embodiments, the sgRNA comprises or consists of sequences as shown in SEQ ID NO:41-78.
[0015] In one aspect, the present invention provides a system or reagent for modifying the endogenous β-2 microglobulin (B2M) gene in cells (thereby reducing the immunogenicity of the cells), comprising: sgRNA or an expression vector for expressing said sgRNA, wherein said sgRNA contains a recognition sequence that specifically recognizes a target site in the B2M gene. In some embodiments, said recognition sequence has at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with the nucleotide sequence of any one of SEQ ID NO:1-38. Preferably, said recognition sequence comprises the nucleotide sequence of any one of SEQ ID NO:1-38. Optionally, the system further comprises a nuclease or a nucleic acid (e.g., DNA or mRNA) or vector encoding said nuclease. Specifically, the modification is knocking out or inactivating the B2M gene.
[0016] In some embodiments, the identification sequence has or consists of a nucleotide sequence of any one of SEQ ID NO: 1, 6, 16, 4, 5, 8 and 10.
[0017] In some embodiments, the nuclease is capable of cleaving and inactivating the B2M gene under the guidance of the sgRNA.
[0018] The nuclease can be any of the Cas nucleases commonly used in the art, such as Cas9 or Cas12 nucleases. Specifically, the nuclease can be the Streptococcus pyogenes Cas9 (SpCas9) nuclease.
[0019] In some embodiments, the system comprises a nuclease. In some embodiments, when the system is used, the nuclease forms a complex with the sgRNA.
[0020] In some other embodiments, the system includes a vector encoding the nuclease, optionally the vector encoding the nuclease and the vector for expressing sgRNA are separate vectors or the same vector.
[0021] The cells can be various cell types suitable for allogeneic cell therapy or organ transplantation, such as immune cells like T cells, NK cells, macrophages, and hematopoietic stem cells. In some embodiments, the cells are T cells, such as CAR-T cells. CAR-T cells can be obtained by engineering T cells isolated from a donor using a CAR construct.
[0022] In one aspect, the present invention provides a method for preparing immunogenically reduced cells, the method comprising: contacting and introducing the cells with any of the sgRNAs, systems, or reagents disclosed herein. When the system contains a nuclease, the nuclease in the system may be made to form a complex with the sgRNA prior to contact. Further, the method further comprises electrotransfection of a mixture of the cells and the system. When the system contains a nucleic acid molecule or vector encoding a nuclease, the method may include co-transfecting the cells with the nucleic acid molecule encoding the nuclease (e.g., in the form of mRNA or a vector) and the sgRNA. In some other embodiments, the nucleic acid molecule encoding the nuclease and the nucleic acid molecule encoding the sgRNA may be encoded by the same vector. The cells are cells suitable for allogeneic cell therapy; optionally, the cells are T cells, such as CAR-T cells.
[0023] In one aspect, the present invention provides immunogenic cells prepared by the method described above. These cells can be used in cell therapy to treat a variety of diseases. The cells may be T cells. In some embodiments, the cells are CAR-T cells and the B2M gene in the CAR-T cells is knocked out or inactivated, thereby possessing reduced immunogenicity (referred to as "universal CAR-T cells").
[0024] In one aspect, the present invention provides a nucleic acid molecule encoding sgRNA. The nucleic acid molecule may be a DNA molecule or an RNA molecule.
[0025] In one aspect, the present invention provides a vector comprising a nucleotide sequence encoding the sgRNA. The vector may be a DNA vector such as a plasmid, or a viral vector such as a retrovirus, adeno-associated virus, or lentivirus.
[0026] In one aspect, the present invention provides a kit comprising:
[0027] A first container contains sgRNA or an expression vector for expressing said sgRNA, wherein the sgRNA contains a recognition sequence that specifically recognizes a target site in the B2M gene, said recognition sequence having at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any of the nucleotide sequences in SEQ ID NO:1-38. In some embodiments, the recognition sequence has a nucleotide sequence in any of SEQ ID NO:1-38.
[0028] In some embodiments, the kit further comprises a second container containing a nuclease or a nucleic acid (e.g., mRNA or a vector) encoding the nuclease. The nucleic acid encoding the nuclease may be contained in an expression vector. The vector may be a DNA vector such as a plasmid, or a viral vector such as a retrovirus, adeno-associated virus, or lentiviral vector. The vector encoding the nuclease and the vector used to express the sgRNA may be separate vectors or the same vector.
[0029] In some embodiments, the sgRNA included in the kit comprises a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any of the nucleotide sequences in SEQ ID NO:41-78.
[0030] In one aspect, the present invention provides the use of systems or sgRNAs as disclosed herein for generating cells with reduced immunogenicity. These cells are preferably inactivated with the endogenous β-2 microglobulin (B2M) gene.
[0031] In one aspect, the present invention provides the use of cells (e.g., T cells) prepared by the method of the present invention as a medicament. In another aspect, the present invention provides the use of cells (e.g., T cells) prepared by the method of the present invention in the preparation of a medicament for treating cancer, autoimmune diseases, or inflammatory diseases in a subject, optionally wherein said cells are allogeneic or autologous to said subject. The cells may be CAR-T cells. In one aspect, the present invention provides a method for treating cancer, autoimmune diseases, or inflammatory diseases in a subject, wherein cells (e.g., T cells such as CAR-T cells) prepared by the method of the present invention are administered. In another aspect, the present invention provides cells (e.g., T cells such as CAR-T cells) prepared by the method of the present invention for treating cancer, autoimmune diseases, or inflammatory diseases in a subject. The cancer can be any cancer suitable for cell therapy such as CAR-T therapy, including leukemia including acute myeloid leukemia (AML) and acute lymphoblastic leukemia (ALL), lymphoma, multiple myeloma (MM), glioma, breast cancer, kidney cancer, liver cancer, esophageal cancer, stomach cancer, pancreatic cancer, prostate cancer, lung cancer, ovarian cancer, colorectal cancer, head and neck cancer, gallbladder cancer, etc. The autoimmune or inflammatory diseases include, but are not limited to, graft-versus-host disease, inflammatory bowel disease, multiple sclerosis, rheumatoid arthritis, systemic lupus erythematosus, aplastic anemia, celiac disease, type 1 diabetes, Graves' disease, psoriasis, scleroderma, etc.
[0032] In one aspect, the present invention provides the use of cells (e.g., T cells) prepared by the method of the present invention in the preparation of medicaments for organ transplantation. The cells may be CAR-T cells.
[0033] Brief description of the attached diagram
[0034] Figure 1A shows the expression of HLA-ABC in T cells after knocking out the B2M gene in CAR-T cells with several sgRNAs (B2M-sgRNA-KO1, B2M-sgRNA-KO2, B2M-sgRNA-KO3, B2M-sgRNA-KO4, B2M-sgRNA-KO5, B2M-sgRNA-KO6, B2M-sgRNA-KO7, B2M-sgRNA-KO8, B2M-sgRNA-KO13, B2M-sgRNA-KO15, B2M-sgRNA-KO19, B2M-sgRNA-KO21, and B2M-sgRNA-KO23). The second figure shows the positive control B2M-sgRNA-KO39. The bar chart below shows the knockout efficiency of all sgRNAs.
[0035] Figure 1B shows two cases of HLA-B2M. KOThe knockout efficiency of sgRNA was compared with that of the positive control, showing better knockout ability than the positive control.
[0036] Figure 2 shows the allogeneic CD8 in an in vitro simulated GVHD experiment. + T cells in several cases of B2M KO CAR-T cells exhibit different reactivity compared to the control group.
[0037] Figure 3 shows the editing efficiency of several sgRNAs.
[0038] Figure 4 shows several examples of B2M. KO The in vitro killing ability of CAR-T cells and autologous CAR-T cells against 7860-luc, U251-luc and Huh7-luc cells.
[0039] Figure 5 shows two HLA-B2M KO Statistics on the target and off-target sites of sgRNA.
[0040] Invention Details
[0041] definition
[0042] As used in this article, the human "B2M gene," or "β2-microglobulin-encoding gene," is located on human chromosome 15 (15q21.1) and contains four exons. β2M protein exists as a membrane protein and free β2M. The membrane protein β2M, as a constant light chain, non-covalently associates with the heavy chain of MHC class I molecules (i.e., human leukocyte antigen class I molecules, HLA-I) on the cell surface. B2M is involved in the recognition of lymphocytes and target cell surface antigens; therefore, B2M is closely related to tissue compatibility. Almost all nucleated cells in the body can synthesize β2-microglobulin, which attaches to the cell surface. The absence of β2-microglobulin leads to abnormal aggregation of HLA-I molecules, thus preventing the formation of complete functional molecules.
[0043] As used herein, the term "Cas9 nuclease" or "Cas9" refers to an RNA-directed nuclease belonging to the CRISPR / Cas9 gene editing system, including wild-type Cas9 protein or variants or fragments thereof, such as proteins containing the active DNA-cutting domain and / or the gRNA-binding domain of Cas9. As is known in the art, Cas9 is a component of the CRISPR / Cas gene editing system, and wild-type Cas9, guided by gRNA, targets and cleaves DNA target sequences to form DNA double-strand breaks (DSBs). The DNA-cutting activity of Cas9 depends on two domains: RuvC and HNH, which are responsible for cleaving the two strands of DNA, respectively. Activity of the RuvC domain cleaves the complementary strand of the guiding RNA, while activity of the HNH domain cleaves the non-complementary strand. These two domains can be artificially mutated and inactivated as needed to achieve single-strand or double-strand cleavage.
[0044] As used herein, the term "guide RNA" or "gRNA" refers to an RNA sequence containing a guide sequence (also referred to herein as a recognition sequence) and optionally a tracrRNA. Common guide RNAs consist of crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA) sequences that form a complex through partial complementarity, wherein the recognition sequence contained in the crRNA is sufficiently complementary to the target sequence to hybridize and target the CRISPR complex to the specifically binding target sequence. The term also includes single guide RNA (sgRNA), which combines the characteristics of both crRNA and tracrRNA. Typically, the guide sequence of the sgRNA is complementary to the target nucleic acid sequence and is responsible for initial guide RNA / target base pairing. Preferably, the guide sequence of the sgRNA is free of mismatches.
[0045] As used herein, "specific recognition" of a target site by a guide sequence or recognition sequence means that the base complementarity between the guide sequence or recognition sequence in the sgRNA and the target site sequence is at least 85%, preferably at least 90%, more preferably at least 95%, and most preferably 100%.
[0046] As used herein, the term "CAR-T cell" refers to a T cell that expresses any CAR construct or has been introduced with nucleic acid or a vector encoding a CAR construct. Polynucleotides encoding CAR construct peptides can be introduced into cells using various methods, and CAR construct peptides can also be synthesized in situ within cells. Methods for introducing polynucleotide constructs into cells are known in the art. In some embodiments, stable transformation methods can be used to integrate the polynucleotide construct into the cell's genome. In other embodiments, transient transformation methods can be used for transient expression of the polynucleotide construct, and the polynucleotide construct is not integrated into the cell's genome. In other embodiments, virus-mediated methods can be used. Polynucleotides can be introduced into cells by any suitable method, such as recombinant viral vectors (e.g., retroviruses, adenoviruses), liposomes, etc. Transient transformation methods include, for example, but not limited to, microinjection, electroporation, or particle bombardment. Polynucleotides can be included in vectors, such as plasmid vectors or viral vectors.
[0047] Construction of CAR-T cells
[0048] The basic principle of chimeric antigen receptor T-cell (CAR-T) technology is to extract T cells from the patient and culture them in vitro. During the culture process, genetic engineering is used to modify the patient's own T cells to express specific tumor antigen receptors. After recognizing tumor-associated antigens or tumor-specific antigens, the T cells are efficiently activated and proliferate in large numbers, releasing anti-tumor active molecules, thereby exerting a powerful tumor-killing effect. After the modified T cells proliferate in large quantities in vitro, the CAR-T cells are injected back into the patient to attack cancer cells expressing specific antigens.
[0049] The key to CAR-T therapy is the engineering of T cells using chimeric antigen receptor (CAR) constructs. CAR constructs typically contain extracellular antigen-binding domains, transmembrane domains, and intracellular signal transduction domains. Antigen-binding domains often originate from antigen-binding fragments capable of recognizing and binding specific antigens, such as the variable region of a single-chain antibody (scFv, VHH, or Fab). By selecting appropriate antigen-binding domains, cell surface markers associated with specific disease states, such as tumors, can be identified. Intracellular signal transduction domains are used to transduce effector and functional signals and guide cells to perform specific functions (e.g., cytolytic or co-activating activities, including cytokine secretion). These domains typically contain primary signal transduction domains and co-stimulatory signal transduction domains. Primary signal transduction domains are protein portions that can regulate the primary activation of the TCR complex in a stimulatory or inhibitory manner. Stimulatory primary signal transduction domains often contain signal transduction motifs known to be based on the tyrosine-based activation motif of the immune receptor (ITAM). Co-stimulatory signal transduction domains are intracellular signal transduction domains of co-stimulatory molecules. Co-stimulatory molecules are cell surface molecules, other than antigen receptors or Fc receptors, that provide a second signal required for the efficient activation and function of T lymphocytes after binding to an antigen.
[0050] This invention does not impose any particular limitation on the CAR constructs used for engineering T cells and the antigens designed to bind to them. The antigens bound to the CAR constructs can be selected from a variety of tumor-associated antigens, tumor-specific antigens, or antigens related to other immune diseases. For example, and not as a limitation, the CAR constructs can be designed to recognize any of the following antigens: CD70, CD3, CD19, CD20, 4.1BB (CD137), OX40 (CD134), CD16, CD47, CD22, CD33, CD38, CD123, CD133, CEA, cdH3, EpCAM, epidermal growth factor receptor (EGFR), EGFRvIII, HER2, HER3, dLL3, BCMA, Sialyl-Lea, 5T4, ROR1, mesothelin, folate receptor 1, VEGF receptor, HER2 / neu, HER3 / neu, G250, CEA, MAGE, VEGF, FGFR, alphaVbeta3-integrin, HLA, HLA-DR, ASC, CD1, CD2, CD4, CD5, CD6, CD7, CD8, CD11, CD13, CD14, CD21, CD23, CD24, CD28, CD30, CD37, CD40, CD41, CD44, CD52, CD64, c-erb-2, CALLA, MHCII, CD44v3, CD44v6, p97, gangliosides GM1, GM2, GM3, GD1a, GD1b, GD2, GD3, GT1b, GT3, GQ1, NY-ESO-1, NFX2, SSX2, SSX4Trp2, gp100, tyrosinase, Muc-1, telomerase, survivin, G250, p53, CA125 MUC, Lewis Y antigen, HSP-27, HSP-70, HSP-72, HSP-90, Pgp, MCSP, EpHA2, GC182, GT468 or GT512, IL-17, IL-20, IL-13 and IL-4.
[0051] In some embodiments, the CAR construct comprises an antigen-binding domain in the form of scFv. In other embodiments, the CAR construct comprises an antigen-binding domain in the form of VHH.
[0052] In some implementations, the primary signal transduction domain of the CAR construct contains an ITAM derived from TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD3ζ, CD22, CD79a, CD79b, and CD66d.
[0053] In some embodiments, the co-stimulatory signal transduction domain of the CAR construct is derived from co-stimulatory molecules selected from CARD11, CD2, CD7, CD27, CD28, CD30, CD40, CD54 (ICAM), CD83, CD134 (OX40), CD137 (4-1BB), CD150 (SLAMF1), CD270 (HVEM), CD278 (ICOS), and DAP10.
[0054] In some embodiments, the CAR construct further includes a linker domain or adapter sequence between the antigen-binding domain and the transmembrane domain and / or between the transmembrane domain and the intracellular signal transduction domain.
[0055] In some embodiments, engineered CAR-T cells are obtained by transfecting immune cells with a virus containing the CAR construct. In some embodiments, the virion used for transfection is generated by transfecting cells with a plasmid encoding the CAR construct and a viral packaging plasmid. In some other embodiments, engineered CAR-T cells are obtained by transfecting immune cells with an expression vector of the CAR construct. CAR-T cells that can be used for CAR construct modification are T lymphocytes, including thymocytes, immature T lymphocytes, mature T lymphocytes, resting T lymphocytes, or activated T lymphocytes. T cells can be T helper (Th) cells, such as T helper 1 (Th1) or T helper 2 (Th2) cells. T cells can be helper T cells (HTL; CD4 T cells), CD4 T cells, cytotoxic T cells (CTL; CD8 T cells), CD4CD8 T cells, or any other T cell subset. In some embodiments, T cells may include primordial T cells and memory T cells.
[0056] In some embodiments, the engineered T lymphocytes are isolated from peripheral blood mononuclear cells (PBMCs). Methods for isolating various cell fractions from PBMCs are well known to those skilled in the art. In some embodiments, the peripheral blood mononuclear cells are isolated from a subject requiring cell therapy (e.g., CAR-T). In some embodiments, the peripheral blood mononuclear cells are isolated from an allogeneic donor.
[0057] Methods for preparing modified CAR-T cells
[0058] This invention utilizes gene editing technology to knock out the B2M molecule in CAR T cells, thereby preventing them from expressing normal HLA-I molecules and reducing the transplant rejection effect of CAR T cells. In one aspect, this invention provides a method for preparing modified CAR-T cells, wherein the endogenous β-2 microglobulin (B2M) gene in CAR-T cells is knocked out or inactivated. The modified CAR-T cells, due to the modification of HLA molecules, exhibit reduced cellular immunogenicity and are considered universal CAR-T cells. Modified CAR-T cells are also referred to herein as B2M. KO CAR-T cells are characterized by the inactivation, knockout, or very low expression of the B2M gene. In this invention, the target locus in B2M is cleaved by Cas9 guided by sgRNA, and DNA sequence insertion or base deletion is introduced to render the B2M gene non-functional.
[0059] The sgRNA of the present invention is particularly suitable for CRISPR / Cas-mediated oligonucleotide binding and / or editing, wherein the oligonucleotide binding and / or editing is mediated by a complex comprising the gRNA of the present invention and a Cas enzyme, the complex of which may comprise any suitable Cas enzyme.
[0060] In some embodiments, the endogenous B2M gene is inactivated by the deletion of nucleotides, resulting in complete non-expression of B2M. Preferably, each allele of B2M in the genome (e.g., a diploid genome) is inactivated.
[0061] In some embodiments, inactivating the endogenous B2M gene includes introducing a complex with the Cas nuclease and sgRNA into CAR-T cells. In some embodiments, inactivating the endogenous B2M gene includes introducing the sgRNA and Cas nuclease-encoding plasmids into CAR-T cells, respectively. In some embodiments, the Cas enzyme is selected from Cas9, Cas12a, Cas12e, Cas12b, Cas12i, Cas12h, Cas12c, Cas12d, Cas12f, Cas12g, Cas12k, Cas12j, Cas13a, Cas13b, Cas13c, Cas13d, and Cas14, including any recombinant variants thereof, particularly selected from Cas9, including any recombinant variants thereof. The Cas9 enzyme can be streptococcal, such as Streptococcus pyogenes or Lactobacillus Cas9 enzyme, as described by Briner et al. (2014), the contents of which are incorporated herein by reference, including any recombinant variants thereof. In some embodiments, the Cas nuclease is selected from Cas9 nuclease and Cas12 nuclease. Those skilled in the art will understand that the sgRNA of this invention can be used in conjunction with various Cas proteins for use in various CRISPR / Cas systems, such as the CRISPR / Cas9 system, CRISPR / Cas12 system, CRISPR / nCas9 system, and CRISPR / dCas9 system. The Cas9 protein is a multifunctional protein whose protein structure includes a recognition region (REC) composed of an α-helix, a nuclease region composed of an HNH domain and a RuvC domain, and a PAM binding region located at the C-terminus. These two important nuclease domains, RuvC and HNH, can respectively cleave the complementary and non-complementary DNA strands of the gRNA, producing blunt-ended DNA double-strand breaks. The Cas9 protein can be mutated as needed to form single-strand DNA breaks. Cas9 recognition of target DNA depends on the tracrRNA:crRNA complex and the PAM sequence located downstream of the target site. In some embodiments, the Cas9 protein is wild-type Cas9. In some embodiments, the Cas9 protein is derived from Streptococcus pyogenes Cas9 protein or Staphylococcus aureus Cas9 protein. In some embodiments, the Cas9 protein induces double-strand breaks at the target locus of the B2M gene.
[0062] The sgRNA contains a recognition sequence targeting the B2M gene. This recognition sequence is typically designed to be 20 nt in length. In addition to the recognition sequence, the sgRNA also contains a constant frame, which may include partial crRNA and tracrRNA sequences. In the CRISPR / Cas9 gene editing system, sgRNA plays a crucial role in accurately recognizing target gene sequences. Its effectiveness can influence editing efficiency, off-target effects, and even determine the final gene editing outcome. Therefore, designing a reasonable and effective sgRNA is a fundamental aspect of gene editing, and selecting a suitable recognition sequence is the core task in sgRNA design. For designed sgRNAs, analysis can be performed based on specificity scores, splicing efficiency scores, potential off-target situations, and off-target site information to select the optimal sgRNA.
[0063] In some embodiments, the sgRNA of the present invention comprises a recognition sequence that is a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any of the nucleotide sequences in SEQ ID NO:1-38.
[0064] Furthermore, the sgRNA described in this invention can be modified, for example, by thiolation and / or methoxylation, to improve its stability. The sgRNA described in this invention can be synthesized by in vitro transcription or by chemical methods.
[0065] Evaluation of the effects of B2M gene editing
[0066] This invention also provides a method for evaluating the B2M gene editing effect of modified CAR-T cells. In some embodiments, the method assesses the resistance of the modified CAR-T cells to heterologous immune cells (e.g., CAR-T cell viability after contact) by exposing the modified CAR-T cells to heterologous immune cells. In some embodiments, the immune cells are allogeneic to the CAR-T cells; for example, the immune cells include an MHC-I different from that of the CAR-T cells. In some embodiments, the immune cells are isolated from PBMCs of a subject different from the subject who received the CAR-T. In some embodiments, the immune cells are selected from T cells, such as cytotoxic CD8+ T cells or natural killer cells.
[0067] In some embodiments, the method identifies B2M gene efficiency by combining PCR reaction with T7E1 restriction enzyme digestion. The method includes extracting genomic DNA from modified CAR-T cells, designing primers for PCR amplification to obtain PCR products with knockout sites, adding T7E1 enzyme for digestion, and then performing agarose gel electrophoresis on the reaction products to determine the editing effect by the presence or absence of bands.
[0068] This invention also provides a method for evaluating the tumor-killing effect of modified CAR-T cells. The method assesses the killing power of modified CAR-T cells against tumor cells by incubating modified CAR-T cells with tumor cells at a specific ratio. In some embodiments, the tumor cells are liver cancer cells, breast cancer cells, kidney cancer cells, lung cancer cells, etc.
[0069] This invention also provides a method for assessing the off-target probability of designed sgRNAs using Guide-seq. Guide-seq is a commonly used extracellular detection method for assessing off-target effects. It utilizes the NHEJ DNA repair mechanism, ligating a short double-stranded nucleotide sequence (dsODN) to the CRISPR-induced DNA double-strand break, essentially ligating the first round of adapters. Then, the genome is normally broken, and a second round of adapters is ligated on the other side. Libraries constructed in this way can obtain sequences on the off-target side; the easier it is to ligate a dsODN site, the higher the probability of off-target cleavage.
[0070] As shown in the embodiments, this application verifies that the B2M gene of target cells is knocked out using constructed sgRNA through electroporation experiments, and the knockout efficiency is detected by flow cytometry; the genome of the knockout cells is extracted and amplified by PCR using the T7EI restriction enzyme method, and the editing efficiency is detected by T7E1 experiments; the knockout cells are co-cultured with allogeneic T cells through in vitro HVG experiments to verify that the knockout cells can have lower loss in the in vivo environment; and the knockout cells are used to kill tumor cells through killing experiments to prove that gene knockout does not affect the tumor killing function of the knockout cells.
[0071] Systems, reagents, and kits for gene editing
[0072] In one aspect, this article provides modified CAR-T cells prepared by any of the methods provided herein. Specifically, it provides an improved universal CAR-T cell wherein the B2M gene is not expressed or is expressed at low levels. The universal CAR-T cells provided by this invention can effectively reduce the risk of graft-versus-host disease and immune rejection, thereby improving the therapeutic effect of CAR-T cells.
[0073] In one respect, this article provides pharmaceutical compositions comprising any of the modified CAR-T cells and pharmaceutically acceptable carriers provided herein.
[0074] In one respect, this article provides a composition comprising at least one sgRNA and a nuclease or an mRNA encoding a nuclease.
[0075] In one aspect, this document provides a gene editing system for inactivating the endogenous β-2 microglobulin (B2M) gene in cells. In some embodiments, the system includes a nuclease or nucleic acid encoding the nuclease capable of cleaving a target locus in the endogenous B2M gene within the cellular genome. In some embodiments, the system includes an sgRNA having a recognition sequence complementary to a target sequence in the B2M gene, the sgRNA being adapted to inactivate the endogenous B2M gene. In some embodiments, the sgRNA includes a recognition sequence of a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any of the nucleotide sequences in SEQ ID NO:1-38.
[0076] In some embodiments, the nuclease includes a Cas nuclease. In some embodiments, the Cas nuclease includes a Cas9 nuclease.
[0077] The gene editing system of the present invention is particularly suitable for gene editing in CAR-T cells. In some embodiments, the gene editing system of the present invention is used to knock out the B2M gene in CAR-T cells.
[0078] Beneficial effects of the present invention
[0079] 1) The sgRNA provided by this invention for preparing immunogenic cells (e.g., universal CAR-T cells) that can be used for cell therapy is stable and does not easily knock out the B2M gene off-target. It also has good specificity and high cleavage efficiency, which greatly improves the gene knockout efficiency.
[0080] 2) The universal CAR-T cells provided by this invention can effectively reduce the risk of graft-versus-host disease and immune rejection, thereby improving the therapeutic effect of CAR-T cells. Example
[0081] The following embodiments are provided to better understand the invention, and are not intended to be limiting.
[0082] Materials and reagents
[0083] Example 1: Construction of CAR-T cells
[0084] Prepare 1×10 7 293T cells were cultured overnight in T75 flasks. In a 1.5ml sterile centrifuge tube, 460μl of serum-free DMEM medium was added, followed by 40μl of PEI transfection reagent. The mixture was thoroughly mixed and incubated for 5 minutes. In another 1.5ml sterile centrifuge tube, 15μl of CAR plasmid (a CD70-targeting CAR constructed by replacing the CMV promoter with the EF1a promoter on the pCDH-CMV (addgene: 72265) plasmid) was added, along with 5μg of pMDLg / pRRE plasmid, 5μg of pMD2.G plasmid, and 5μg of pRSV-Rev plasmid. Finally, 470μl of serum-free DMEM medium was added, and the mixture was thoroughly mixed. The medium containing PEI transfection reagent was then added to the medium containing the plasmids to form the transfection system. The mixture was thoroughly mixed and incubated for 15 minutes. Remove the 293T cells cultured overnight, discard the culture medium in the flask, carefully add 9 ml of serum-free DMEM medium, and then add 1 ml of transfection system. Return the cells to the incubator and continue culturing for 6 hours. After 6 hours, remove the culture flask, discard the culture medium, and carefully add 15 ml of serum-free DMEM medium. After 42 hours, collect the virus solution from the culture flask, and add another 15 ml of serum-free DMEM medium. After 24 hours, collect the virus solution from the culture flask again, and pour the total 30 ml of virus solution collected from both collections into a 50 ml sterile syringe. Filter the solution through a 0.45 μm filter membrane into a sterile ultracentrifuge tube. Centrifuge the tube at 21,000 × G for 2 hours, discard the supernatant, resuspend the virus pellet in 200 μl of X-VIVO medium, and store overnight at 4°C.
[0085] 1×10⁻⁶ separated from the recovered PBMC 6 T cells were cultured overnight. The next day, 100 μl of viral resuspension was added, and the cells were incubated at 37°C for 24 hours. After 24 hours, all cells were aspirated, centrifuged at 500G for 5 minutes, and the medium was changed to continue culturing, resulting in CAR-T cells with a high positive rate.
[0086] Example 2: Electroporation knockout of the B2M gene
[0087] Prepare sterile PCR tubes and add 75 pmol of various sgRNAs (as shown in Table A), followed by 60 pmol of Cas9 protein. Mix gently and incubate at room temperature for 10 min. Resuspend 1×10⁻⁶ cells in 20 μl of Lonza electroporation buffer. 6CAR-T cells. Thoroughly mix the RNP system with the cells for electroporation and add them to the electroporation chamber of the Lonza electroporation instrument. Set the electroporation conditions to EN113 on the electroporator and perform electroporation. Add the electroporated cells to a pre-prepared 12-well plate at a density of 1 × 10⁻⁶ cells / well. 6 Cells were cultured at 37°C under conditions of 1 cell / ml. As shown in Figure 1, flow cytometry analysis revealed that some of the selected sgRNAs, such as B2M-sgRNA-KO1, B2M-sgRNA-KO4, B2M-sgRNA-KO6, B2M-sgRNA-KO8, B2M-sgRNA-KO10, and B2M-sgRNA-KO16, yielded CAR-T cells with high HLA-B2M knockout rates.
[0088] Table A
[0089] In addition to the recognition sequence, the above-mentioned sgRNAs also contain a constant sequence serving as a framework. The constant sequence is shown in SEQ ID NO:40: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU. The full-length sequences of B2M-sgRNA-KO1 to B2M-sgRNA-KO39 are shown in SEQ ID NO:41-79, respectively.
[0090] Example 3: B2M ko In vitro validation of CAR-T cell depletion
[0091] The 5×10⁵ cells were removed from the liquid nitrogen freeze-thawed container. 7Thaw PBMCs in a 37°C water bath. Note that the PBMCs used must originate from a different donor than the knockout CAR-T cells. Add the PBMCs to 7 ml of preheated X-VIVO medium and centrifuge at 500g for 5 min. Discard the supernatant, add 50 μl of Stemcell easysep separation antibody and 800 μl of X-VIVO medium to the cells, and incubate at room temperature for 5 min. Add 1 ml of preheated X-VIVO medium to a cryovial. Add 50 μl of magnetic beads to the cells, mix thoroughly, and then transfer the entire 900 μl of cell suspension to the cryovial, mixing again. Place the cryovial in a magnetic rack, and after 3 min, aspirate all the cell suspension and transfer it to 7 ml of preheated X-VIVO medium, centrifuging at 500g for 5 min. Discard the supernatant, resuspend the cells in 10 ml of X-VIVO medium, and count them. After counting, centrifuge again at 500g for 5 min. Discard the supernatant, and use 100 μl / 1×10 7 Cells were added with activating magnetic beads, then at 50 μl / 1×10 7 Cells were added to preheated X-VIVO medium and resuspended. After thoroughly mixing the cells, they were incubated in an incubator for 7 minutes. After 7 minutes, the cells were gently pipetted again to thoroughly mix them with the magnetic beads. This step was repeated twice. The isolated T cells were then cultured at 2 × 10⁻⁶ cells / mL. 6 T cells were cultured at 37°C under conditions of 1 cell / ml. After 48 h of culture, T cells were counted. All cells were then centrifuged at 500g for 5 min and resuspended in 1 ml of pre-warmed X-VIVO solution, which was then transferred to cryovials. The cryovials were placed on a magnetic rack, and after 3 min, all cell suspension was aspirated and centrifuged at 500g for 5 min. The supernatant was discarded, and 20 μl / 1×10⁶ cells were transferred to a cryovial. 7 Adding CD8 to cells + Anode magnetic beads, then 80μl / 1×10 7 Cells were added to X-VIVO medium and mixed thoroughly. Incubation was performed for 10 min. After incubation, the cells were centrifuged at 500 G for 5 min. The supernatant was discarded, and the cells were resuspended in 3 ml of X-VIVO medium. The cell suspension was passed through a Miltenyi LS sorting column and filtered thoroughly with 10 ml of X-VIVO medium. The filtrate was discarded, and 3 ml of X-VIVO medium was added. The sorting column was removed, and the stopcock was quickly squeezed to obtain CD8. + T cells. The sorted CD8 cells... + T cells were stained with CFSE and centrifuged at 500G for 5 minutes after staining at 37℃ for 10 minutes. The supernatant was discarded, and the cells were then centrifuged at 1×10⁻⁶ cells / mL. 7 Add cells / ml to PBS and centrifuge again at 500G for 5 min. Discard the supernatant and centrifuge at 1×10⁻⁶ cells / ml. 6 Add cells / ml to X-VIVO medium.
[0092] Take out 5×10 5 CD8 + T cells were adjusted to a volume of 500 μl using X-VIVO medium. Then, 5 × 10⁶ cells were collected. 5 After knockout, CAR-T cells were adjusted to a volume of 500 μl using X-VIVO medium. They were then co-cultured in 24-well plates with a total volume of 1 ml, designated as well 1. Three replicates were then prepared for each well.
[0093] Take out 5×10 5 CD8 + T cells were adjusted to a volume of 500 μl using X-VIVO medium. Then, 5 × 10⁶ cells were collected. 5 CAR-T cells that were not knocked out were also cultured in X-VIVO medium to a volume of 500 μl. They were co-cultured in a 24-well plate with a total volume of 1 ml, designated as well 2. Three replicates were then prepared for each well.
[0094] Take out 1×10 6 CD8 + T cells were cultured in 1 ml of X-VIVO medium in 24-well plates, with three replicates for each well serving as a control.
[0095] After 3 days of co-culturing, CD8 + T cells + CAR-T cell knockout group, CD8 + T cells + non-knockout CAR-T cells group, CD8 + The T cell group was treated with CD69. + CD25 + The antibody was stained and analyzed by flow cytometry. As shown in Figure 2, the prepared HLA-B2M was analyzed by flow cytometry. ko CAR-T cells (illustrated using B2M-sgRNA-KO1, B2M-sgRNA-KO6, and B2M-sgRNA-KO16 as examples) compared to CD8 + T cells + mock CART cells (i.e., CD8) + T cells + non-knockout CAR-T cells group), against allogeneic CD8 + T cells have a higher resistance capacity.
[0096] Example 4. Detection of B2M gene knockout efficiency using T7E1 restriction enzyme digestion method
[0097] Prepare 5×10 6 B2M ko CAR-T cells were centrifuged at 250G for 5 min, the supernatant was discarded, and the cells were resuspended in 200 μl PBS. Cell genome extraction was performed using... Genomic DNA kit. Add 20 μl Proteinase K to the cells, followed by 20 μl RNase A. Vortex briefly to mix, then incubate at room temperature for 2 min. Add 200 μl... After vortexing again to mix the genome lysis / binding buffer, incubate at 55°C for 10 min. Add 200 μl of anhydrous ethanol to the lysis buffer and stir for 5 seconds to form a homogeneous solution. Add the homogeneous solution to... Centrifuge the separation column at 10000G for 1 min. After centrifugation, remove the separation column and place it in a clean container. Add 500 μl of Wash Buffer 1 (prepared with ethanol) to the column and centrifuge at 10000G for 1 min. After centrifugation, remove the column and place it in a clean container. In a collection tube, add 500 μl of Wash Buffer 2 prepared with ethanol to the column and centrifuge at 20000G for 3 min. Place the separation column in a sterile 1.5 ml centrifuge tube and add 100 μl of [unspecified ingredient] to the column. Genome elution buffer. Incubate at room temperature for 1 minute, then centrifuge at 20000G for 1 minute. Take a new sterile 1.5ml centrifuge tube, place the separation column inside, and add 100μl of [unspecified ingredient] to the separation column. Genomic elution buffer. After incubation at room temperature for 1 minute, centrifuge at 20000G for 1.5 min. Quantify DNA concentration using a micro-ultraviolet spectrophotometer. After adjusting the DNA concentration, extract 200 ng of DNA and perform PCR amplification using high-fidelity DNA polymerase to obtain PCR products with knockout sites. Primers used in one example experiment are shown in Table 1.
[0098] Table 1. Primer sequences for B2M1 amplification
[0099] Similarly, perform all the above operations on the non-knockout CAR-T cells to obtain the PCR product of the non-knockout group. Purify the PCR product using the Beyotime DNA Purification Kit. Add an equal volume of DNA purification binding buffer to the PCR product and mix well. Add the homogeneous solution to the DNA purification column, incubate for 1 min, and then centrifuge at 20000G for 5 min. After centrifugation, discard the liquid in the collection tube. Add 700 μl of washing buffer to the DNA purification column, incubate for 1 min, and then centrifuge at 20000G for 1 min. After centrifugation, discard the liquid in the collection tube. Add another 500 μl of washing buffer to the DNA purification column and centrifuge at 20000g for 1 min. Further wash away impurities and discard the liquid in the collection tube. Centrifuge again to remove the remaining liquid and fully evaporate any residual ethanol. Place the DNA purification column on a 1.5 ml centrifuge tube and add 50 μl of elution buffer to the center of the column to allow the liquid to be absorbed by the purification column. Let stand for 1 min. After centrifuging at 20000g for 1 min, the resulting liquid is high-purity DNA. The T7E1 experiment used the Novizan T7 Endonuclease I kit. The preparation system for the T7E1 enzyme digestion reaction is shown in Table 2.
[0100] Table 2 T7E1 enzyme digestion reaction system
[0101] After preparing the T7E1 enzyme digestion reaction system, an annealing reaction was carried out. The annealing procedure is shown in Table 3.
[0102] Table 3 Annealing procedure for T7E1 enzyme digestion reaction
[0103] Add 1 μl of T7E1 to the annealing product and incubate at 37 °C for 30 min. Terminate the digestion reaction by adding 1.5 μl of 0.25 M EDTA. Detect the digestion products directly by 2% agarose gel electrophoresis. As shown in Figure 3, gel imaging analysis verified that some screened sgRNAs, such as KO-B2M1 and KO-B2M6, can achieve high HLA-B2M knockout efficiency.
[0104] Example 5. B2M ko CAR-T cell-mediated tumor cell killing
[0105] Add 7860-luc, U251-luc, and Huh7-luc cells to each well of a 96-well plate according to the required sample volume, at a density of 2 × 10⁶ cells / well. 4 Cells, 60 μl in volume, were incubated in an incubator for 4 h. B2M... koCAR-T cell suspension concentration was adjusted according to different positive rates at a 1:1 effector-to-target ratio. The total volume should always be 60 μl. The co-incubated cells were returned to the incubator and cultured for 8 hours. A multi-sensor microplate reader and software were turned on, and the Luminescence mode was selected for plate layout. 100 μl of reagent E605A from the ONE-Glo Luciferase Assay System was added to each well, mixed thoroughly, and incubated at room temperature in the dark for 10 minutes. 180 μl of the solution from the cell culture plate was then transferred horizontally into a 96-well white plate. The 96-well white plate was placed in the microplate reader to read the data, which was then exported and saved for calculating the cell killing rate. Cell killing rate = (background luminescence value - sample luminescence value) / background luminescence value * 100%.
[0106] As shown in Figure 4, the knockout CAR-T cells have similar killing ability to the mock CAR-T cells and do not lose their killing ability due to knockout (taking KO-B2M1, KO-B2M6, KO-B2M1, and KO-B2M16 as examples). At the same time, they also do not have the ability to kill non-target cells, which proves that the prepared knockout CAR-T cells have good specific tumor killing ability.
[0107] Example 6. Guide Seq detection of sgRNA knockout off-target probability
[0108] Prepare a sterile PCR tube, add 75 pmol of sgRNA, then 75 pmol of dsODN tag, and then 60 pmol of Cas9 protein. Gently mix and incubate at room temperature for 10 min. Resuspend 1×10⁻⁶ cells in 20 μL Lonza electroporation buffer. 6 CAR-T cells. Thoroughly mix the RNP system with the cells for electroporation and add them to the electroporation chamber of the Lonza electroporation instrument. Set the electroporation conditions to EN113 on the electroporator and perform electroporation. Add the electroporated cells to a pre-prepared 12-well plate at a density of 1 × 10⁻⁶ cells / well. 6CAR-T cells were cultured at 37°C under conditions of 1 cell / ml. After 2 days, cellular DNA was extracted from the cultured CAR-T cells. PCR amplification was performed using forward and reverse ODN primers. dsODN tag primers were ligated to the DNA sequences cleaved by Cas9, and a sufficient number of DNA fragments were amplified for subsequent sequencing analysis. High-throughput sequencing was performed on the PCR-amplified DNA fragments to determine the target location of the Cas9 primers by identifying the barcode sequence and corresponding target sequence of each primer. Sequencing reads for each sample were split according to their barcode sequences. Deduplication was performed on the sequencing data to reduce bias introduced by PCR amplification. The deduplication-reduced sequencing data was compared with a reference genome to determine the target sequence of each primer, thereby identifying the DNA sequences cleaved by Cas9 and accurately determining their target locations.
[0109] Based on the alignment results, target and off-target sequences were identified. The identified sites were sorted by read count and annotated. The analysis results were summarized and reported, describing information about Cas9 target sites and off-target sequences. The detected target and off-target sites were visualized using software such as IGV to provide an intuitive presentation of the results and facilitate better understanding of the analysis.
[0110] As shown in Figure 5, taking KO-B2M1 and KO-B2M6 as examples, the designed sgRNA sequences have no mismatch rate, low off-target probability, and high safety.
[0111] Those skilled in the art should understand from this disclosure that many changes can be made to the specific embodiments disclosed and similar or identical results can still be obtained without departing from the spirit and scope of the disclosed subject matter.
Claims
1. An sgRNA comprising a recognition sequence that specifically recognizes a target site in the B2M gene, said recognition sequence having at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with the nucleotide sequence of any one of SEQ ID NO:1-38.
2. The sgRNA of claim 1, wherein the recognition sequence has or is composed of a nucleotide sequence of any one of SEQ ID NO: 1, 6, 16, 4, 5, 8 and 10.
3. The sgRNA of claim 1 or 2, wherein the sgRNA further comprises a constant sequence as a framework, such as the sequence shown in SEQ ID NO:
40.
4. The sgRNA of claim 3, wherein the sgRNA comprises or consists of the sequence shown in SEQ ID NO:41-78.
5. A system for modifying the expression of the endogenous β-2 microglobulin (B2M) gene in cells, comprising: The sgRNA of any one of claims 1-4 or a vector for expressing said sgRNA; and Optionally, a nuclease or a nucleic acid encoding the nuclease.
6. The system of claim 5, wherein the nuclease is capable of inactivating the B2M gene under the guidance of the sgRNA, optionally being a Cas nuclease, such as a Cas9 nuclease or a Cas12 nuclease, more specifically a spCas9 nuclease.
7. The system of claim 5 or 6, wherein the nuclease forms a complex with the sgRNA.
8. The system of claim 5 or 6, wherein the system comprises a vector encoding the nuclease, optionally, the vector encoding the nuclease and the vector for expressing sgRNA are separate vectors or the same vector.
9. The system of any one of claims 5-8, wherein the cell is a cell capable of being used for allogeneic cell therapy, optionally, the cell is a T cell, such as a CAR-T cell.
10. A method for preparing cells with reduced immunogenicity, the method comprising: The cells are brought into contact with the sgRNA of any one of claims 1-4 or the system of any one of claims 5-9, and the sgRNA or the system is introduced into the cells, optionally, the endogenous B2M gene in the cells is inactivated.
11. The method of claim 10, wherein the nuclease in the system is made to form a complex with the sgRNA prior to contact.
12. The method of claim 10 or 11, wherein the method further comprises introducing the system into the cell by electrotransfection.
13. The method of any one of claims 10-12, wherein the cell is a cell capable of being used for allogeneic cell therapy, optionally, the cell is a T cell such as a CAR-T cell.
14. The method of any one of claims 10-12, wherein the cell is a CAR-T cell, and the method further comprises engineering donor-derived T cells with a CAR construct to obtain CAR-T cells.
15. Cells prepared by any one of claims 9-14.
16. A nucleic acid molecule encoding the sgRNA of any one of claims 1-4.
17. A vector comprising a nucleotide sequence encoding an sgRNA of any one of claims 1-4, optionally said vector being a DNA vector such as a plasmid or a viral vector such as a retrovirus, adeno-associated virus, or lentivirus.
18. A reagent kit comprising: A first container containing sgRNA or an expression vector for expressing the sgRNA, wherein the sgRNA contains a recognition sequence that specifically recognizes a target site in the B2M gene, the recognition sequence having a nucleotide sequence of any one of SEQ ID NO:1-38.
19. The kit of claim 18, further comprising a second container containing a nuclease or a nucleic acid encoding the nuclease.
20. The kit of claim 18, wherein the vector for expressing sgRNA further comprises a nucleic acid sequence encoding a nuclease.
21. Use of the cell as described in claim 15 in the preparation of a medicament for treating cancer, autoimmune disease, or inflammatory disease in an allogeneic subject.
22. Use of the cell of claim 15 in the preparation of a medicament for organ transplantation, wherein the cell is a T cell.
Citation Information
Patent Citations
Preparation method of general type CAR-T cells
CN109055380A
Universal TRUCK-T cells as well as preparation method and application thereof
CN113122576A
Method for gene editing of cell on the basis of crispr / cas system
US20220017926A1
Methods and compositions for editing the b2m locus in b cells
WO2022006309A1
Universal car-t cell targeting CD5 and CD7 and use thereof
WO2024022513A1