Dietary supplement composition for poultry comprising lactococcus lactis sub. SP. lactis

Abstract

The present disclosure provides a dietary supplement for poultry comprising Lactococcus lactis subsp. lactis strain alone or in combination with prebiotic for example fructooligosaccharides. The present disclosure provides a composition or formulation comprising the freeze-dried L. lactis subsp. lactis cells and fructo- oligosaccharides are used in the ratio of about 50:1, 50:2.5, and 50:5 g / tonne, pre- starter, starter, and finisher diet, respectively. Present disclosure also provides the efficiency of dietary supplement of Lactococcus lactis on broilers gut microbiome, biochemical and histopathology in broiler poultry birds.

Description

DIETARY SUPPLEMENT COMPOSITION FOR POULTRY COMPRISING LACTOCOCCUS LACTIS SUB. SP. LACTISFIELD OF THE INVENTION

[0001] The present disclosure relates to the field of poultry feed formulation using the probiotic potential of lactic acid bacteria for the growth enhancement of broiler poultry birds. Particularly, the present disclosure provides a dietary supplement composition for poultry comprising probiotic bacteria Lactococcus lactis subsp. lactis strain either alone and or in combination with a prebio tic, fructooligosaccharides (FOS).BACKGROUND OF THE INVENTION

[0002] The background description includes information that may be useful in understanding the present invention. It is not an admission that any of the information provided herein is prior art or relevant to the presently claimed invention, or that any publication specifically or implicitly referenced is prior art.

[0003] The global population is predicted to reach 9 billion by 2050, resulting in a 60% rise in demand for high-quality, low-cost protein such as milk, beef, and eggs. In commercial poultry, broiler feed production contributes up to 70% of the total production cost. India is one of the global most populous countries in terms of livestock production. The Indian organized feed industry currently produces around 3 million tonnes of feed / year, which is only 5% of its actual potential.

[0004] Food safety is the primary objective for improving the health of humans and animals. Contaminations of poultry feeds by various types of microorganisms are responsible for detrimental effects on poultry and human health. To address such microbial contaminations of animal and poultry feed, various antibiotics are employed to treat pathogenic and toxigenic microorganisms through competitive exclusion, antibiotic growth promoter (AGP) to boost body weight of the broiler poultry birds. Excessive antimicrobial use (AMU) in poultry feed results in development of antimicrobial resistance (AMR) in bacteria, which end up with food chain (National Research Council, Washington, DC, National Academy Press,1999). AMR is a major global threat of increasing concern to human and animal health. It also has implications for food safety, food security and the economic wellbeing of millions of farming households.

[0005] As global feed prices are in rise, the poultry feed sector is seeking an alternate or unconventional feed ingredients. Eventually, there has been an increased demand and consumption of antibiotic-free food along with growing consumption of organic food. Such antibiotic -free food also demanded antibiotic- free poultry nutrition, which finally led to high-quality, affordable protein and human food.

[0006] Considering the probiotic potential of Lactic acid bacteria (LAB), the use of LAB as feed additives are attaining importance in the poultry industry. Also, because of the wide spectrum of beneficial impacts of LAB, such as promoting growth and production, immune enhancement, and health protection, thereby obviating need of antibiotics and provide antibiotic-free poultry.

[0007] Several LAB are gaining importance worldwide due to their effects on promoting animal growth by reducing the pathogenic microbes, and mycotoxins in food and feed. LAB are generally recognized as safe (GRAS) and having potential health benefits to the consumers and can be used as a food grade preservative. These LAB also find applications as antimicrobial agents, anti-inflammatory, and having antioxidant properties, which can be used in poultry feed to enhance the growth and prevent the hazardous health effects of mycotoxin, and pathogenic microbes.

[0008] Lactobacillus, Lactococcus, Bacillus, Clostridium, Paenibacillus, Streptococcus, Bifidobacterium, Enterococcus, and Pediococcus, have been explored individually or as mixed strains to improve growth, meat quality, egg laying capability, gut microbiota, and reduce toxin bioavailability in chicken. Mixed strain probiotic products have been found to be beneficial, however requirement of multiple strain make such products cost wise non-feasible as a feed, also keeping such multiple strains viable and stable in a single product can be challenging. Also, some of the bacteria when used singly may not impart the desired growth to the poultry.

[0009] Linh et al., (Journal of Agricultural Science and Technology, Hue University of Agriculture and Forestry 2021, 5 (1), 2310-2319) discloses a symbiotic mixture of lactic acid -producing bacteria Lactococcus lactis and fructooligosaccharides (FOS) on immune response factors of white leg shrimp, while CN113652372B discloses a Lactococcus lactis (Lactococcus sp.) psml6, classified and named Lactococcus lactis subsp. lactis, and application thereof in the preparation of an animal feed. However, Lactococcus lactis with / without fructooligosaccharides has been reported for various applications in food and pharmaceutical industries but not for poultry.

[0010] Deraz et al., (Journal of Applied Pharmaceutical Science, Volume: 9, Supplement 1, March 2019) discloses the assessment of probiotic- supplementation of Lactococcus lactis sub. sp. lactis and / or Lactobacillus plantarum along with a basal diet of 22.4% protein and 3,160 kcal / kg on the growth performance, lipid peroxidation, antioxidant capacity, and caecal microflora in broiler chickens.

[0011] Therefore, there is a need to provide a dietary supplement for poultry comprising L. lactis sub. sp. lactis strain alone or in combination with FOS as an alternate to the synthetic feed additive in poultry industries to avoid AMR for the betterment of poultry health, food safety and to act as growth promoter.SUMMARY OF THE INVENTION

[0012] Accordingly, the present disclosure provides a dietary supplement composition for poultry, wherein the said composition comprises a probiotic alone or in combination with a prebiotic mixed with a carrier, wherein the probiotic comprises freeze-dried L. lactis subsp. lactis MCC 0263 cells in the range of 4xl09cfu / kg to 5xl09cfu / kg, the carrier is dextrose, wherein the ratio of L. lactis cells and the carrier is in the range of 1:2 to 1:5 .

[0013] In an aspect of the present disclosure the prebiotic is fructooligosaccharides (FOS) in an amount in the range of 0.1% to 0.5% by weight of the composition.

[0014] In an aspect of the present disclosure the freeze-dried L. lactis subsp. lactis cells are mixed with basal feed without any antibiotics.

[0015] In yet another aspect of the present disclosure the dietary supplement is selected from pre- starter, starter, and finisher diet.

[0016] In still another aspect of the present disclosure the freeze-dried L. lactis subsp. lactis cells and fructooligosaccharides are in the ratio of 50:1 g / tonne, 50:2.5 g / tonne, and 50:5 g / tonne for pre- starter, starter, and finisher diet respectively.

[0017] In yet another aspect of the present disclosure provides a process for preparing the dietary supplement composition for poultry, wherein the said process comprises the steps of: a. isolating L. lactis subsp. lactis from milk sample; b. culturing L. lactis subsp. lactis in a De Man, Rogosa and Sharpe (MRS) nutrient medium, followed by harvesting cell pellets to obtain biomass; c. freeze drying the biomass obtained in step (ii) by suspending the cell pellets in a cryo-protecting agent and freeze-drying at around freezing temperature of -80°C for 40-60 h; d. mixing the freeze-dried L. lactis subsp. lactis cells in the range of 4xl09cfu / kg to 5xl09cfu / kg with basal diet and fructooligosaccharides (FOS); and e. continued mixing of the mixture obtained in step (iv) for 1 day to 42 days; and with intermittent checking of the viability count of L. lactis subsp. lactis cells after 3-5 days to obtain the dietary supplement composition; with 4xl09cfu / kg to 5xl09cfu / kg viable cell count of L. lactis subsp. lactis cells.

[0018] In still another aspect of the present disclosure the growth of L. lactis subsp. lactis in step (ii) is in the pH range of 5.5 to 7; incubation temperature in the range of 25°C to 40°C; and 10 % dissolved oxygen (DO) saturation with constant agitation at 50 rpm to 100 rpm.

[0019] In still another aspect of the present disclosure the harvesting in step (ii) is effected by centrifugation at 3000 rpm to 6000 rpm for a duration in the range of 10 minutes to 30 minutes.

[0020] In yet another aspect of the present disclosure provides the isolation of Lactococcus lactis subsp. lactis from raw milk in step (i) comprising the steps of: a. providing raw milk; b. homogenising the raw milk with sterile distilled water containing 0.85% NaCl and 0.1% peptone; c. preparing serially diluted samples from the homogenized raw milk and spreading the diluted samples on Man, Ragosa, and Sharpe (MRS) agar plate; d. incubating the MRS agar plates at 32 °C to 37°C for 24 to 48 h under aerobic conditions; e. picking up colonies with Lactococcus characteristics and streaking on MRS agar plates followed by Gram’s staining and microscopic observation; and f. confirming the strains of L. lactis subsp. lactis with accession number MCC 0263 by molecular identification using 16s RNA gene.BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The following drawings form part of the present specification and are included to further illustrate aspects of the present disclosure. The disclosure may be better understood by reference to the drawings in combination with the detailed description of the specific embodiments presented herein.

[0022] Figure 1 is an optical image obtained by Field Emission Scanning Electron Microscopes (FE-SEM) identifying Lactococcus lactis subsp. lactis, as per one of the exemplary embodiments of the present disclosure.

[0023] Figure 2 is an image of agarose gel electrophoresis (1% agarose) of 16s rRNA gene by PCR showing a single amplicon at 1500 bp, as per one of the exemplary embodiments of the present disclosure.

[0024] Figure 3 is phylogenetic tree of L. lactis subsp. lactis strain isolated from dairy milk samples, as per one of the exemplary embodiments of the present disclosure.

[0025] Figure 4 is a graph showing the effect of temperature on survivability of L. lactis subsp. lactis strain, as per one of the exemplary embodiments of the present disclosure.

[0026] Figure 5 is a photographic image depicting haemolytic activity of L. lactis subsp. lactis strain, as per one of the exemplary embodiments of the present disclosure.

[0027] Figure 6 is a graph depicting auto-aggregations and co-aggregation efficiency of lactis subsp. lactis strain, as per one of the exemplary embodiments of the present disclosure.

[0028] Figure 7 is a graph depicting metagenomic studies of gut microbiomes of broiler poultry birds, as per one of the exemplary embodiments of the present disclosure.

[0029] Figure 8 is a graph depicting lipid profiling of broiler poultry birds (LDL- low-density lipoproteins; VLDL- very-low-density lipoproteins; HDL- high- density lipoproteins; Tl_28- non-treatment group 28 day old broiler sample; Tl_42- non-treatment group 42 day old broiler sample; T2_28- FOS treatment group 28 day old broiler sample; T2_42- FOS treatment group 42 day old broiler sample; T3_28- L. lactis treatment group 28 day old broiler sample; T3_42- L. lactis treatment group 42 day old broiler sample; T4_28- L. lactis + FOS treatment group 28 day old broiler sample; and T4_42- L. lactis + FOS treatment group 28 day old broiler sample), as per one of the exemplary embodiments of the present disclosure.

[0030] Figure 9 is a graph depicting effect of feed supplement of prebiotic and probiotic on weight growth of broiler chicken. (Tl- basal diet; T2- basal diet+ fructooligosaccharide ; T3- basal diet+ L. lactis subsp. lactis; T4- basal diet+ fructooligosaccharides +L. lactis subsp. lactis', ns- P values > 0.05; Asterisks (*** and ****) show P values at 0.0001 and 0.00001, respectively), as per one of the exemplary embodiments of the present disclosure.DETAILED DESCRIPTION OF THE INVENTION

[0031] Those skilled in the art will be aware that the present disclosure is subject to variations and modifications other than those specifically described. It is to beunderstood that the present disclosure includes all such variations and modifications. The disclosure also includes all such steps, features, compositions, and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any or more of such steps or features.

[0032] Unless the context requires otherwise, throughout the specification which follow, the word “comprise” and variations thereof, such as, “comprises” and “comprising” are to be construed in an open, inclusive sense that is as “including, but not limited to. ’’Reference throughout this specification to “one embodiment” or “an embodiment” means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment. Thus, the appearances of the phrases “in one embodiment” or “in an embodiment” in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in one or more embodiments.

[0033] As used in the description herein and throughout the claims that follow, the meaning of “a,” “an,” and “the” includes plural reference unless the context clearly dictates otherwise. Also, as used in the description herein, the meaning of “in” includes “in” and “on” unless the context clearly dictates otherwise.

[0034] In some embodiments, the numbers expressing quantities of ingredients, properties such as concentration, and so forth, used to describe and claim certain embodiments of the invention are to be understood as being modified in some instances by the term “about.”

[0035] Accordingly, in some embodiments, the numerical parameters set forth in the written description are approximations that can vary depending upon the desired properties sought to be obtained by a particular embodiment. In some embodiments, the numerical parameters should be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. Notwithstanding that the numerical ranges and parameters setting forth the broad scope of some embodiments of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as practicable. The recitation ofranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein.

[0036] All methods described herein can be performed in suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g. “such as”) provided with respect to certain embodiments herein is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention otherwise claimed. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the invention.

[0037] All publications herein are incorporated by reference to the same extent as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference. Where a definition or use of a term in an incorporated reference is inconsistent or contrary to the definition of that term provided herein, the definition of that term provided herein applies and the definition of that term in the reference does not apply.

[0038] The headings and abstract of the invention provided herein are for convenience only and do not interpret the scope or meaning of the embodiments.

[0039] Various terms are used herein. To the extent a term used in a claim is not defined below, it should be given the broadest definition as persons in the pertinent art have given that term as reflected in printed publications and issued patents at the time of filing.

[0040] The deposition of microbe “ Lactococcus lactis subsp. lactis (MG917752)” is done at authority National Centre for Cell Science (NCCS), Pune, MH, India on 9 February 2023, and acknowledgement received on 17 July 2023, and the details are provided below:**The obtained sequences were subjected to similarity search analysis using NCBI Basic Local Alignment Search Tool (BLAST), and the results revealed 100% similarity with Lactococcus lactis subsp. lactis. The obtained sequences were deposited in NCBI with GenBank accession number MG917752.

[0041] The present disclosure relates to a composition comprising a probiotic alone or in combination with a prebio tic as dietary supplement for poultry, especially for broiler birds.

[0042] In an embodiment, the present disclosure provides a composition for dietary supplement for poultry comprising the freeze-dried Lactococcus lactis subsp. lactis cells and nutritional constituents.

[0043] In an embodiment, the freeze-dried Lactococcus lactis subsp. lactis cells are present in the composition in a range of 4xl09cfu / kg to 5xl09cfu / kg.

[0044] In an embodiment, the present disclosure provides a composition for dietary supplement for poultry comprising the freeze-dried Lactococcus lactis subsp. lactis cells in the range of 4xl09to 5xl09cfu / kg and nutritional constituents.

[0045] In an embodiment, the present disclosure provides a dietary supplement composition for poultry, wherein the composition comprises a probiotic alone or in combination with a prebiotic mixed with a carrier, wherein the probiotic comprises freeze-dried L. lactis subsp. lactis MCC 0263 cells in the range of 4xl09cfu / kg to 5xl09cfu / kg, the carrier is dextrose, wherein the ratio of L. lactis cells and the carrier is in a range of 1:2 to 1:5.

[0046] In one embodiment, the present disclosure provides a composition for dietary supplement for poultry comprising the freeze-dried L. lactis subsp. lactis cells; nutritional constituents; and oligosaccharide.

[0047] In one embodiment, the prebiotic is an oligosaccharide.

[0048] In one embodiment, the oligosaccharide is fructooligosaccharides (FOS).

[0049] In one embodiment, the present disclosure provides a composition for dietary supplement for poultry comprising the freeze-dried L. lactis subsp. lactis cells; nutritional constituents; and fructooligosaccharides (FOS).

[0050] In another aspect, the present disclosure provides freeze-dried L. lactis subsp. lactis cells in the range of 4xl09cfu / kg to 5xl09cfu / kg comprising the freeze-dried L. lactis subsp. lactis cells mixed with a carrier.

[0051] In another aspect the present disclosure provides freeze-dried L. lactis subsp. lactis cells in the range of 4xl09cfu / kg to 5xl09cfu / kg comprising the freeze-dried L. lactis subsp. lactis cells mixed with a carrier in the ratio of 1:2 to 1:5, preferably in the ratio of about 1:3.

[0052] In one embodiment, the prebiotic is fructo-oligosaccharides (FOS) in an amount in the range of 0.1% to 0.5% by weight of the composition.

[0053] In one embodiment, the fructooligosaccharides (FOS) are present in the concentration of 0.1% to 0.5% by weight of the composition.

[0054] In one embodiment, the freeze-dried L. lactis subsp. lactis cells and fructooligosaccharides are in the ratio of 50:1 g / tonne, 50:2.5 g / tonne, and 50:5 g / tonne for pre- starter, starter, and finisher diet respectively.

[0055] In one embodiment, the present disclosure provides a composition for dietary supplement for poultry comprising the freeze-dried L. lactis subsp. lactis cells; nutritional constituents; and fructooligosaccharides (FOS), wherein the freeze-dried L. lactis subsp. lactis cells and fructooligosaccharides are in the ratio of 50: 1 g / tonne, 50:2.5 g / tonne, and 50:5 g / tonne for pre- starter, starter, and finisher diet respectively.

[0056] In one embodiment, the present disclosure provides a composition for dietary supplement for poultry comprising the freeze-dried L. lactis subsp. lactis cells in the range of 4xl09cfu / kg to 5xl09cfu / kg, basal diet constituents and fructooligosaccharides, wherein the freeze-dried L. lactis subsp. lactis cells and fructooligosaccharides are in the ratio of 50:1 g / tonne, 50:2.5 g / tonne, and 50:5 g / tonne for pre- starter, starter, and finisher diet respectively.

[0057] In another embodiment the present disclosure provides a composition for pre-starter, starter (%), or finisher dietary supplement for poultry.

[0058] In one embodiment, the present disclosure provides a composition for prestarter, starter (%), or finisher dietary supplement for poultry comprising the freeze- dried L. lactis subsp. lactis cells in the range of 4xl09cfu / kg to 5xl09cfu / kg, basaldiet constituents and fructooligosaccharides, wherein the freeze-dried L. lactis cells and fructooligosaccharides are in the ratio of 50:1 g / tonne, 50:2.5 g / tonne, and 50:5 g / tonne for pre- starter, starter, and finisher diet respectively and one or more basal diet constituents are in varied concentrations.

[0059] In another embodiment, the present disclosure provides the composition in accordance with the present disclosure in the form of a formulation.

[0060] In one embodiment, the present disclosure provides a formulation for dietary supplement for poultry comprising the freeze-dried L. lactis subsp. lactis cells in the range of 4xl09cfu / kg to 5xl09cfu / kg; mixed with basal diet constituent and fructooligosaccharides, wherein the freeze-dried L. lactis subsp. lactis cells and fructose as a carrier are in the ratio of about 1:3.

[0061] In another embodiment, the present disclosure provides a formulation for pre-starter, starter, or finisher dietary supplement for poultry comprising the freeze- dried L. lactis subsp. lactis cells in the range of 4xl09cfu / kg to 5xl09cfu / kg, basal diet constituents and fructooligosaccharides, wherein the freeze-dried L. lactis cells and fructooligosaccharides are in the ratio of 50:1 g / tonne, 50:2.5 g / tonne, and 50:5 g / tonne for pre- starter, starter, and finisher diet respectively and one or more basal diet constituents are in varied concentrations.

[0062] In another aspect the present disclosure provides a process for preparing a dietary supplement for poultry comprising the steps of: i. isolating L. lactis subsp. Lactis from milk sample; ii. culturing L. lactis subsp. lactis in a nutrient medium, followed by harvesting the cell pellets to obtain a biomass; iii. freeze drying the biomass obtained in step (ii); iv. mixing the freeze-dried L. lactis subsp. lactis cells in the range of 4xl09cfu / kg to 5xl09cfu / kg with basal diet and fructooligosaccharides (FOS); and v. continued mixing of the mixture obtained in step (iv) for 1 day to 42 days with intermittent checking of the viability count of L. lactis subsp. lactis cells after every 3-5 days to obtain the dietary supplement composition with 4xl09to 5xl09viable cell count of L. lactis subsp. lactis cells.

[0063] In an embodiment, the mixing of freeze-dried L. lactis subsp. lactis cells in the range of 4xl09cfu / kg to 5xl09cfu / kg with basal diet and fructooligosaccharides (FOS) is in the ratio 5of 0:1, 50:2.5, or 50:5 g / tonne, for prestarter, starter, and finisher diet, respectively.

[0064] The culture of L. lactis subsp. lactis can be grown under suitable conditions for example, the conditions maintained at pH 5.5 to 7, preferably at pH 6.5; incubation temperature of 25°C to 40°C, preferably 37°C; 10 % dissolved oxygen (DO) saturation with constant agitation at 50 to 100 rpm, preferably about 75 rpm.

[0065] In an embodiment, the growth of L. lactis subsp. lactis in step (ii) is in the pH range of 5.5 to 7; incubation temperature in the range of 25°C to 40°C; and 10 % dissolved oxygen (DO) saturation with constant agitation at 50 rpm to 100 rpm.

[0066] Cells may be harvested by any suitable method for example centrifugation at a speed of 3000 to 6000 rpm, preferably at 4000 rpm for 10 to 30 minutes, more preferably for 20 minutes.

[0067] In an embodiment, the harvesting in step (ii) is effected by centrifugation at 3000 rpm to 6000 rpm for a duration in range of 10 minutes to 30 minutes.

[0068] The bacterial cell pellet obtained may be lyophilized in a manner to afford a freeze-dried powder. Such method may include suspending the cell pellet in a cryo-protecting agent and freeze-dried at around freezing temperature, such as - 80°C for a sufficient time, such as about 40-60 h.

[0069] The freeze-dried powder may be used directly for preparing the dietary supplement for poultry or may be stored at 4°C.

[0070] In one more embodiment, the present disclosure provides a process for preparing a formulation for a dietary supplement for poultry comprising the steps of uniformly mixing freeze-dried L. lactis subsp. lactis cells in the range of 4xl09cfu / kg to 5xl09cfu / kg with basal diet and fructooligosaccharides, wherein in the ratio and L. lactis subsp. lactis cells and fructooligosaccharides, is in the ratio of about 1:3 for 1 day to 42 days with intermittent checking of the viability count of L. lactis subsp. lactis cells after every 3-5 days to obtain the dietary supplement composition with 4xl09to 5xl09viable cell count of L. lactis subsp. lactis cells.

[0071] In an embodiment, the isolation of Lactococcus lactis subsp. lactis from raw milk in step (i) comprises the steps of: a. providing raw milk; b. homogenising the raw milk with sterile distilled water containing 0.85% NaCl and 0.1% peptone; c. preparing serially diluted samples from the homogenized raw milk and spreading the diluted samples on Man, Ragosa, and Sharpe (MRS) agar plate; d. incubating the MRS agar plates at 32 °C to 37°C for 24 to 48 h under aerobic conditions; e. picking up colonies with Lactococcus characteristics and streaking on MRS agar plates followed by Gram’s staining and microscopic observation; and f. confirming the strains of L. lactis subsp. lactis with accession number MCC 0263 by molecular identification using 16s RNA gene.

[0072] The dietary supplement for poultry comprising L. lactis subsp. lactis either alone or in combination can be used as an antibiotic growth promoter (AGP) for improving the growth performance of the poultry and reducing the microbial load in the poultry for the food safety of the consumers. The strain L. lactis subsp. lactis can be used as an antibacterial, antifungal, antioxidant, and mycotoxin detoxification / neutralization efficiencies of the poultry feed.

[0073] In addition, Lactococcus lactis is reported to produce a peptide “Nisin” used as a natural preservative, hence, L. lactis subsp. Lactis strain as per the present disclosure can also be used as a preservative in foods with low pH. Nisin is reported to fight against wide variety of Gram-positive bacteria by targeting the cell membrane of the bacteria. L. lactis can survive the harsh conditions of the gastrointestinal tract but does not colonize the gut (like other Lactobacillus strains), hence it can be used as a “vehicle” to deliver therapeutics, such as cytokines into the human body. L. lactis has been shown to be particularly effective against pathogens of the respiratory tract. Accordingly, L. lactis subsp. Lactis strain can beused for boosting the immune system. L. lactis also appears to exhibit protection against non-respiratory pathogens, such as HIV, Human papilloma virus and the malarial parasite. Hence, L. lactis subsp. Lactis strain can be used for fighting such pathogens.Efficiency of dietary supplement of Lactococcus lactis on broilers gut microbiome.

[0074] The relative abundance of different bacterial OTUs was studied at the phylum, class, order, and family level. Bacteroidetes was the most abundant phyla observed in all groups, followed by Firmicutes, Proteobacteria, Actinobacteria and Fusobacteria.

[0075] While the foregoing description discloses various embodiments of the disclosure, other and further embodiments of the invention may be devised without departing from the basic scope of the disclosure. The invention is not limited to the described embodiments, versions, or examples, which are included to enable a person having ordinary skill in the art to make and use the invention when combined with information and knowledge available to the person having ordinary skill in the art.

[0076] The disclosure will now be illustrated with working examples, which is intended to illustrate the working of disclosure and not intended to take restrictively to imply any limitations on the scope of the present disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice of the disclosed methods and compositions, the exemplary methods, devices, and materials are described herein. It is to be understood that this disclosure is not limited to particular methods, and experimental conditions described, as such methods and conditions may vary.MaterialsEXAMPLES

[0077] The following examples are given by way of illustration and therefore should not be construed to limit the scope of the present invention.Example 1Dietary supplement composition

[0078] A dietary supplement composition for poultry, wherein the said composition comprises a probiotic alone or in combination with a prebiotic (fructooligosaccharides) mixed with a carrier. The probiotic is 5xl09cfu / kg of freeze-dried L. lactis subsp. lactis MCC 0263 cells, the carrier is dextrose, the ratio of L. lactis cells and the carrier is 1:5, and the prebiotic is 0.5% fructooligosaccharides (FOS) by weight of the composition. The freeze-dried L.lactis subsp. lactis cells were mixed with basal feed without any antibiotics. The dietary supplement composition was used as a dietary supplement in a diet selected from pre- starter, starter, or finisher diet. The dietary supplement composition had the freeze-dried L. lactis subsp. lactis cells and fructooligosaccharides in the ratio of 50:1 g / tonne, 50:2.5 g / tonne, and 50:5 g / tonne in a pre- starter, starter, and finisher diet respectively.The process for preparing the dietary supplement composition for poultry

[0079] L. lactis subsp. lactis was isolated from milk sample and cultured in a De Man, Rogosa and Sharpe (MRS) nutrient medium, followed by harvesting the cell pellets to obtain a biomass. The biomass obtained in step (ii) was freeze dried by suspending the cell pellets in a cryo-protecting agent and followed by at freezing at -80°C for about 60 h; the freeze-dried L. lactis subsp. lactis cells win the range of 4xl09cfu / kg to 5xl09cfu / kg were mixed with basal diet and fructooligosaccharides (FOS); and continued mixing of the mixture obtained in step (iv) for 1 day to 42 days; and with intermittent checking of the viability count of L. lactis subsp. lactis cells after every 3-5 days to obtain the dietary supplement composition with 4xl09cfu / kg to 5xl09cfu / kg viable cell count. The process was carried out in the pH range of 5.5 to 7; incubation temperature in the range of 25°C to 40°C; and 10 % dissolved oxygen (DO) saturation with constant agitation at 50 rpm to 100 rpm and the harvesting was effected by centrifugation at 3000 rpm to 6000 rpm for a duration in the range of 10 minutes to 30 minutes.Example 2Dietary supplement composition

[0080] A dietary supplement composition for poultry, wherein the said composition comprises a probiotic alone or in combination with a prebiotic (fructooligosaccharides) mixed with a carrier, wherein the probiotic comprises freeze-dried L. lactis subsp. lactis MCC 0263 cells in the range of 4xl09cfu / kg, and the carrier is dextrose, wherein the ratio of L. lactis cells and the carrier is 1:2. The prebiotic is fructooligosaccharides (FOS) in an amount of 0.1% by weight of the composition and the freeze-dried L. lactis subsp. lactis cells were mixed withbasal feed without any antibiotics and the dietary supplement was selected from pre- starter, starter, and finisher diet. The freeze-dried L. lactis subsp. lactis cells and fructooligosaccharides were in the ratio of 50:1 g / tonne, 50:2.5 g / tonne, and 50:5 g / tonne for pre- starter, starter, and finisher diet respectively.

[0081] The process for preparing the dietary supplement composition for poultry comprised isolating L. lactis subsp. lactis from milk sample followed by culturing L. lactis subsp. lactis in a De Man, Rogosa and Sharpe (MRS) nutrient medium, followed by harvesting the cell pellets and freeze drying the biomass obtained in step (ii) by suspending the cell pellets in a cryo-protecting agent and freeze-drying at around freezing temperature of -80 °C for about 40 h, mixing freeze-dried L. lactis subsp. lactis cells in the range of 4xl09cfu / kg to 5xl09cfu / kg with basal diet and fructooligosaccharides (FOS); and continued mixing of the mixture obtained in step (iv) for 1 day to 42 days; and with intermittent checking of the viability count of L. lactis subsp. lactis cells after every 3-5 days to obtain the dietary supplement composition with 4xl09cfu / kg to 5xl09viable cell count of L. lactis subsp. lactis cells. The pH was in the range of 5.5 to 7; incubation temperature in the range of 25°C to 40°C; and 10 % dissolved oxygen (DO) saturation with constant agitation at 50 rpm to 100 rpm and harvesting was effected by centrifugation at 3000 rpm to 6000 rpm for a duration in the range of 10 minutes to 30 minutes.Example 3: Isolation, Identification and Characterization of Lactococcus lactis subsp. Lactis (1). Isolation:

[0082] The traditional dairy milk samples were collected from Kolhapur, Maharashtra, India. The collected sample, 1 ml of was homogenized with 9 ml of sterile distilled water containing 0.85% NaCl and 0.1% peptone. A 10-fold serial dilution was made from 10’6and, lOOpl sample was spread on Man, Ragosa and Sharpe (MRS) agar plate and incubated at 37°C for 48 h under aerobic condition. At the end of incubation period, the visible colonies that appeared on plate were transferred to MRS plate and pure colonies were preserved at 4°C for further studies.(2). Scanning electron Microscope observation:

[0083] Isolated bacteria primarily identified by Gram’s reaction were further subjected to microscopic identification and characterization, such as structure and arrangement under Field Emission Scanning Electron Microscopes (FE-SEM). The overnight grown culture of L. lactis .subsp. lactis was prepared by the method as per Zheng, Y., Cosgrove, D. J., & Ning, G. (2017). High-Resolution Field Emission Scanning Electron Microscopy (FESEM) Imaging of Cellulose Microfibril Organization in Plant Primary Cell Walls. Microscopy and microanalysis: the official journal of Microscopy Society of America, Microbeam Analysis Society, Microscopical Society of Canada, 23(5), 1048-1054. https: / / doi.org / 10.1017 / S 14319276170125 IX. Lactococcus lactis subsp. lactis sample was prepared in 2% glutaraldehyde solution for 1-2 h and centrifuged at 5000 rpm for 5 min. The cell pellet was washed with 0.1 M phosphate buffer, pH 7.2 at 4 °C and eluted in 200 pl cold ethanol. A volume of 25 pl of cells was applied on pre-coated gelatin slide and air dried at room temperature in a desiccator. The cells were sputter coated with gold and the morphological characteristics was observed under FE-SEM (FEI, USA, NOVA NANOSEM 450). FE-SEM image is presented in Figure. 1. As can be seen from Figure 1 cells were cocci shape and arranged in groups as pairs, with a diameter of about 940 nm to 1.12 pM.(3). Molecular identification:

[0084] Morphologically identified strain was further confirmed by molecular identification with Polymerase Chain Reaction (PCR). The genomic DNA was extracted from the overnight grown culture using genomic DNA extraction Kit (GenElute, Sigma Aldrich) as per manufacturer’s instructions and quantified using Nano-drop spectrophotometer (Thermo Scientific, USA). The PCR run was performed in 20 pL reaction with 16S rRNA universal primers 27 F 5’- AGAGTTTGATCM (A / C) TGGCTCAG-3’ and 1492 R 5’ TACCTTGTTACGACTT-3’ and 1 pL template and TaqReady Mix (JumpStart, Sigma- Aldrich), atlO pmol L1. The PCR reaction was carried out in Thermal Cycler (Applied Biosystem, Thermo Scientific) with initial denaturation at 94°C for 3 min, followed by 30 cycles of 94°C for 45 s, 55 °C for 1 min and 72 °C for 1 min,with a final extension at 72°C for 10 min for 35 cycles. The amplified PCR product was purified using Nucleopore kit as per manufacturer (Genetix Biotech Asia Pvt. Ltd.) instructions. The amplified PCR products were loaded onto 10 g L-1agarose gel containing gel red (Biotium, Life Technologies India) and visualization under UV trans-illuminator and documented by gel documentation system (Syn gene Bio Imaging System, UK). The agarose gel electrophoresis image (Figure 2) showed a single amplicon at 1500 bp. The amplified PCR product was purified with the gel purification kit according to manufacturer’s instruction and sequenced. The obtained sequences were subjected to similarity search analysis at NCBI Basic Local Alignment Search Tool (BLAST), which showed 100% similarity with Lactococcus lactis subsp. lactis. The obtained sequences were deposited in NCBI with GenBank accession number MG917752. Furthermore, the evolutionary history was inferred using the Neighbor-Joining method and the phylogenetic tree was constructed using MEGA7 and the same is represented as Figure 3.Sequences of Lactococcus lactis subsp. lactis BIONCL 17752-16S rRNA sequence: SEQ ID No 1:AACGTGGCAAGTTGAGCGCTGAAGGTTGGTACTTGTACCAACTGGATG AGCAGCGAACGGGTGAGTAACGCGTGGGGAATCTGCCTTTGAGCGGG GGACAACATTTGGAAACGAATGCTAATACCGCATAAAAACTTTAAACA CAAGTTTTAAGTTTGAAAGATGCAATTGCATCACTCAAAGATGATCCC GCGTTGTATTAGCTAGTTGGTGAGGTAAAGGCTCACCAAGGCGATGAT ACATAGCCGACCTGAGAGGGTGATCGGCCACATTGGGACTGAGACAC GGCCCAAACTCCTACGGGAGGCAGCAGTAGGGAATCTTCGGCAATGG ACGAAAGTCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGG ATCGTAAAACTCTGTTGGTAGAGAAGAACGTTGGTGAGAGTGGAAAG CTCATCAAGTGACGGTAACTACCCAGAAAGGGACGGCTAACTACGTGC CAGCAGCCGCGGTAATACGTAGGTCCCGAGCGTTCGGATTTATTGGGC GTAAAGCGAGCGCAGGTGGTTTATTAAGTCTGGTGTAAAAGGCAGTGG CTCAACCATTGTATGCATTGGAAACTGGTAGACTTGAGTGCAGGAGAG GAGAGTGGAATTCCATGTGTAGCGGTGAAATGCGTACATATATGGAGG AACACGGATGGCGAACGCGTCTCTCTGGCCTGTATCTGACACTGAGGCTCGATAGCGTGGGGGAGCAAACGATATTAGATACGGTGGTTCTCCACA CCTCAACCGCATTAGAGCGGTGCAAAGGGAAGTCCACTCTCTCTGTCT CGGAATTCAAGGCAAACAGTTTTCCAGGGGGGGCAGGGGGAGAACCA CTGGCATGTTCACACGAATTGAGAAATGCCCCGGGGCCCCGCTTTACC CCCGAAAAATTCTGGGAAAACTGCGAGGAAACCTCGTAAAAACCTGG GGGGGTCGGGGAAGTAATTCGGGCCATTCCTTTGAGGGGGGGATTCCC CTTCGGGGACAGGGTTTCGTTTTGACAAGGTTTTTTTCCCCCCAGGGGT GTTTAAGTTCCGAAAAACCTCCCCCCCCCCCGGGGGGCCTCTGTGGGT AAATTTTTTTCTTTTTTGGGGAAAAAATCCCCAGGGGGGCCGCCAGAA GGGGGGGGGGGGGGGGGCTCCCCCCCCGGGGGCCCCCCCCCCTCCGG GGGGGAATTTGCCCGGGGGGGGGACACCCACCCAAAAAAAAAAAGAGTTTTTTTTGAGTTTTTTGTTTTTTGAAAAACGGTTTATTTTTTTAGGCTCATTTTTCACCCCCCCCACAAAAAGCCCCCCCCCCCCCCTTTGTGGGAGGAAAAAATCCCTCCGGGGGGGGGGGCGGGGGTGGGGGCGATAAAAAA AAAAAAAAAAAATG(4). Probiotic characterization of Lactococcus lactis subsp. Lactis(i) Evaluation of temperature, acid, bile salt, and pancreatin tolerance

[0085] L. lactis subsp. lactis isolated from milk sample was processed for probiotic characterization as per guidelines by Indian council of medical research (ICMR, India). L. lactis subsp. lactis was grown under various gastric conditions for exploring percent of survival. The assessment was carried out at distinctive temperature (20-50°C), pH (1.0-6.0), bile solution (0.3%), and pancreatin (0.5 %). The flasks thus prepared were incubated at 37°C for 0, 1, 2, and 3 h. for both acid and bile salt tolerance. Additionally, temperature and pancreatin tolerance flasks were incubated at 37°C for 48 h. At the end of the 48 h the absorbance was recorded at 600 nm using a spectrophotometer (Eppendorf, Germany). L. lactis subsp. lactis culture grown under different temperatures showed optimum growth at 35 °C and also showed 88% survivability at 40°C. On the other hand, at 20°C and 50°C reduction or rise in temperature with little or zero survival of the bacteria was observed (Figure 4).

[0086] At pH 2, 3, and 4, 60.42%, 67.11 %, and 69.5 %, survivability was observed after 3 h of incubation. Further, in the MRS medium containing bile salt and pancreatin, 70-80% surviv ability was noticed after 1 h of incubation, however with additional 3 h incubation, the subsistence rate down to 10% was observed. However, in both bile salt and pancreatin conditions, after 3 h of incubation the survivability was around 60-65 % (Table 2).Table 2. Effect of gastric conditions on survivability of Lactococcus lactis subsp. lactis pH Survivability (%)2.0 60.423.0 67.114.0 69.50Bile (0.3) 60.00Pancreatin (0.5) 65.00(ii) Auto-aggregation and Co-aggregation

[0087] The auto-aggregation potential of L. lactis subsp. lactis was studied by growing culture in MRS media. The overnight grown culture was inoculated in 2 mL broth and incubated at 37 °C for 6 h. After the completion of incubation period, upper suspension was collected, and absorbance was taken at 600 nm. In addition, co-aggregation potential was determined against E. coli and B. subtilis. 2 mL overnight grown cultures of each L. lactis subsp. lactis and E. coli, and B. subtilis were taken and horizontally shaken for 2 min and incubated at 37°C for 6 h. Whereas, 4 mL of individual bacterial culture were used as control. The absorbance was measured at 0 and 6 h and aggregation percentage were calculated. 55% autoaggregations, and co-aggregation with E. coli- 32% and B. subtilis-35% were recorded, which indicates the proficiency to adhere to epithelial cells and mucosal surfaces and an additional usefulness, could enable better elimination of pathogens from the gut (Figure. 6).(iii) Haemolytic plate assay

[0088] Haemolytic activity of L. lactis subsp. lactis was evaluated on Colombia Blood agar plate. The medium supplemented with human blood (10%) allows solidifying. A loopful of L. lactis subsp. lactis culture was streaked on agar plate and incubated for 24 and 72 h. At the end of the incubation period, the zone of clearance around the bacteria representing the haemolytic activity was measured. No zone of hydrolysis around the colonies on solid blood agar medium indicating no haemolytic property (a, P, and y) that generate destructive enzymes apart from the red blood cells was found (Figure. 5).Example 4: Effect of dietary supplement of Lactococcus lactis on broilers growth performance:(1). Fermentation

[0089] The L. lactis subsp. lactis biomass was obtained by growing culture in Man Rogosa Sharpe medium (MRS) using 10 L fermenter (New Brunswick BioFlo / CelliGen 115, Germany). The fermentation conditions maintained at pH 6.5, incubation temperature 37°C, 10 % dissolved oxygen (DO) saturation with constant agitation at 75 rpm were optimized as ideal conditions. During incubation period, the absorbance was measured after every 2h at 600 nm, when the absorbance reached maximum (after 24 h) the fermentation process was stopped. After successful fermentation batch, cells were harvested by centrifugation at 4000 rpm for 20 min. The bacterial cell pellet thus obtained was re-suspended in cryoprotecting agent (5% sucrose and skim milk) and freeze-dried at -80°C (Labconco Co., USA) for 48 h. Freeze-dried powder (10 mg) were serially diluted up to 10’5in sterile saline water (0.85%), and 10’3dilution was spread on to the MRS agar plates, plates were incubated for 48 h and colony forming unit (cfu) were calculated. The freeze-dried powder containing 1011colony forming units (cfu) / g was stored at 4 °C for future study.(2). Formulations:

[0090] The live freeze-dried L. lactis subsp. lactis cells 4xl09cfu / kg, to 5xl09cfu / kg were mixed with fructose as a carrier in a ratio of (1:3) denoted as formulated product (FP-1). The FP-1 powder and basal diet (in differentconcentration as per Table 3) were mixed uniformly after every 4 d. L. lactis subsp. lactis viable count was checked for each feed batch to provide the same viable count and provide pre-starter, starter, and finisher diet supplement.Table 3 Basal diet components and its nutritional level (%) given for the broilersBasal diet components Pre-starter Starter (%) Finisher (%)(%)Maize 51.350 54.400 58.000Soya DOC 39.700 36.000 31.522Lime Stone Powder 0.970 1.120 1.100Di Calcium Phosphate 1.200 0.950 0.850Soya Refined Oil 2.660 3.769 4.800Soya Refined Oil 0.240 0.240 0.253DL-Methionine 0.290 0.260 0.270L- Threonine 0.100 0.051 0.120BROVIT PREMIX 0.050 0.050 0.050Tracemin CB 0.100 0.100 0.100Upliv-H Premix 0.050 0.050 0.025Levucell 0.000 0.000 0.000CMP 1 0.100 0.100 0.100BioBentox 0.100 0.100 0.100BioBentox 0.030 0.030 0.030Optiphos DS 0.010 0.010 0.010Soda Premix 1.200 1.100 1.100Salt Premix 1.170 1.000 0.900Choline Chloride Premix 0.680 0.670 0.670(3). Experimental animals and study design:

[0091] One day-old Vencobb 430Y broilers were chosen for the present study purchased from modern hatchery and breeding farm (Haryana). All the birds werevaccinated against ranikhet disease. The entire study was performed at Dr. B. V. Rao Institute of Poultry Management and Technology (Pune, Maharashtra).

[0092] A total of 1650 broilers were included in the present study. Experimental broilers were divided into five groups based on their dietary supplemented feed additives and each group consists of three replicates containing 110 birds per replicates. Group T1 contained basal diet without feed additive (non-treatment group), treatment group T2 contained basal diet + fructo-oligosaccharides (FOS) 0.5 to 2.5%, treatment group T3 contained basal diet + FP-1, treatment group T4 contained basal diet+FOS+FP-1, and the group T5, basal diet + commercial multistrain probiotic (4xl09)cfu / kg feed. Further, feeding diet plan was scheduled as, pre-starter diet (0.5kg / tonne) given for initial 1-14 d, starter diet (2.5kg / tonne) given for 15-28 d and finisher diet (5kg / tonne) given for 29-42 d. All the broilers were reared in single house with similar conditions in which feed and clean water were offered ad libitum to all the broilers.

[0093] To study the growth performance of broilers, each group was weighed weekly to determine average weekly body weight gain (AWBWG), broilers were also evaluated for average weekly feed intake (AWFI) followed by feed conversion ratio (FCR) and mortality rate.

[0094] The effect of prebiotic and probiotic supplementation with basal diet on broiler growth performance showed that there was not much increase in growth performance observed in the 1stweek and 2ndweek of feeding. Whereas, from 3rdweek onwards, there was significant increase observed in broiler’s growth performance, at the end of experimental period (6thweek), 115 g weight gain was recorded in T2 group of broilers (basal diet+FOS), 152 g in T3 group (basal diet+L. lactis subsp. lactis), 171 g in T4 group (basal diet+ FOS+ L. lactis subsp. lactis) and 217 g in T5 group (multistrain commercial probiotic) compared to the T1 group broilers fed on basal diet.

[0095] The obtained results indicated that from 3rdweek onward, the AWBW of broilers group T2, T3, T4 and T5 showed enhanced growth performance of broilers. Interestingly, AWBW of broilers consuming L. lactis subsp. lactis diet alone orsupplemented with FOS was higher to that of basal diet consuming broilers and closer to that of the multistrain commercial probiotics (Table 4).

[0096] Furthermore, the feed conversion ratio (FCR) is the conventional measure of amount of feed intake and weight gained by birds. Lower FCR value denotes the higher efficiency. In the present investigations, it was found that broilers fed with L. lactis subsp. lactis containing diet enhanced the growth efficiency of broilers.

[0097] A good body weight gain of 171 gram per bird was found with combination of both probiotic L. lactis subsp. lactis and prebiotic with fructo-oligosaccharides formulation (FOS) when compared with the final body weight of the control group.

[0098] However, without any prebiotic formulation, L. lactis subsp. lactis could be able to enhance 152 gm / bird body weight gain. In addition, about 19 gm / bird difference was found with the prebiotic combination or formation of the product.

[0099] Further, the growth 171 g weight gain observed with combination of probiotic L. lactis subsp. lactis and pre-biotic FOS was near to the commercial multistrain probiotics.[000100] The present study illustrates that L. lactis subsp. lactis can be used as an AGP for the growth performance of the poultry and reducing the microbial load in the poultry for the food safety of the consumers.[000101] Additionally, for the comparison purpose, the weight gain by the feed containing L. lactis subsp. lactis was compared with the highest growth performance reported in various literature with different single probiotic strains:Table 4. Comparative data on Probiotics in poultry growth performance[000102] Based on previous reports with single probiotic strains, the highest growth performance was reported using Lactobacillus acidophilus feed supplements leading to 192 g weight gain of the broilers (Forte, C. et al., Poultry science, 97(3), pages 930-936, 2018. https: / / doi.org / ! 0.3382 / ps / pex396) . However, L. acidophilus caused common side effects including digestive complaints, such as gas, bloating, upset stomach, or diarrhoea. The maximum growth performance was observed with multi-strain probiotic product that consisted of Bacillus subtilis,Clostridium butyricum, Lactobacillus plantarum with their synergistic action leading to 211 g weight gain of the broilers birds (Tarabees Reda et al., Probiotics and Antimicrobial Proteins, 11, pages 981-989, 2019). However, requirement of multiple strains makes such products cost-wise non-feasible as a feed, also maintaining such multiple strain viable and stable in a single product would be challenging during the routine storage conditions.[000103] The example, supplement comprising Lactococcus lactis subsp. lactis strain obtained in accordance with the present disclosure in combination with prebiotic for example fructooligosaccharides, unexpectedly showed significant improvement in growth performance in terms of weight gain in poultry as compared to the other probiotic supplements reported so far (Figure 9).[000104] From the foregoing, it will be appreciated that, although specific embodiments of the invention have been described herein merely for purposes of illustration, it will be evident to those skilled in the art that numerous variations of the details may be made without departing from the invention as set forth in the appended claims.Example 5: Effect of dietary supplement of Lactococcus lactis on broilers gut microbiome: biochemical and histopathology analysis[000105] In the treatment and non-treatment group, 28- and 42-days old broiler faecal samples were collected and were stored at -80°C for further studies.[000106] The faecal samples of 250 mg (28 and 42 day old broilers) from each group were aseptically taken and labelled (Tl_28, Tl_42, T2_28, T2_42, T3_28, T3_42, T4_28 and T4_42) processed for DNA isolation using fast DNA spin kit (MP Biomedicals, USA) and quality of DNA were measured using agarose gel electrophoresis and Nanodrop Spectrophotometer (Thermo Scientific, USA).[000107] Further, DNA library preparation for Nanopore sequencing was carried using SQK-LSK109 sequencing kit (Oxford Nanopore Technologies, UK). Basecalling and demultiplexing was carried out using Guppy basecaller in MklC.[000108] The only reads with quality score of >8 and length >300 bp were processed using NanoFilt tool for further taxonomic and functional classification.Taxonomic and functional classification was carried using MG-RAST tool with RefSeq and KEGG database with default parameters, respectively.[000109] To investigate the effect of L. lactis and FOS on poultry gut microbiome, the Oxford Nanopore sequencing was used to study the metagenome of poultry bird faecal samples.[000110] Alpha diversity metrics (Chaol and Shannon) were used to find the richness, diversity, and evenness of the samples. After 28 days of feeding diet, higher richness of bacterial OTUs were observed in non-treatment group (Tl) compared to treatment groups (T2, T3 and T4), whereas after 42 days’ time interval there was higher richness in bacterial OTUs was observed in broiler diet supplemented with L. lactis + FOS (T4).[000111] The Shannon diversity indices showed that in both 28- and 42-days’ time intervals there was higher diversity in bacterial OTUs, which were observed in nontreatment group compared to L. lactis and FOS treatment groups.[000112] The overall, diversity indices showed that control group had higher richness and diversity compared to treatment group which suggest that due to L. lactis and FOS feeding groups (T2, T3 and T4), beneficial bacterial OTUs were colonising the broiler gut which may help to enhance the growth performance and feed conversion potential of the broilers (Figure 7).[000113] Further, beta diversity was studied using principal coordinate analysis (PCoA) which showed that each group (treatment and non-treatment) had variable type of beta diversity at different time interval (28 and 42 days) except L. laclis+ FOS (T4) group which showed less diversity. The beta diversity results showed that diversification in the eukaryotic microbial community which may have different role in the broilers growth performance during their early and late developmental stages.[000114] The relative abundance of different bacterial OTUs was studied at the phylum, class, order, and family level. Bacteroidetes was the most abundant phyla observed in all groups, followed by Firmicutes, Proteobacteria, Actinobacteria and Fusobacteria, which were the top five most abundant phyla observed.[000115] Interestingly, increased Bacteroidetes OTUs were observed after 42 days of diet supplemented with L. lactis and FOS, and more Firmicutes OTUs were observed after 28 days in the group fed diet supplemented with L. lactis compared to control and other treatment groups.[000116] Bacteroidaceae, Clostridiaceae, Ruminococcaceae,Porphyromonadaceae, and Rikenellaceae were the top five most abundant families. In broiler diet supplemented with L. lactis, increased OTUs of the Bacteroidaceae, Clostridiaceae, Peptococcaceae, and Thermoanaerobacteraceae families were observed (Figure 7).[000117] Furthermore, the functional metagenome analysis was carried out using MG-RAST (Metagenomic rapid annotations using subsystems technology) subsystem databases such as KO (KEGG orthology), COG (clusters of orthologous genes), and NOG (Non-supervised orthologous groups) to reveal functional modules and pathways enriched in the metagenome of poultry broilers.[000118] Overall analysis revealed that L. lactis supplementation resulted in an enhancement in the number of genes involved in carbohydrate metabolism, lipid metabolism, environmental adaptation, xenobiotic biodegradation compared to the control group, respectively.Hematology and biochemical study[000119] Whole blood was collected in EDTA anticoagulant for haematology analysis and without anticoagulant for serum for biochemical analysis, on 28 and 42 days. Haematology analyses were performed by MicroCC-20 Vet (High Technology Inc, USA). Automated Hematology Analyzer and differential percent of leucocyte were counted by blood smear observation and counting 100 leucocytes. Absolute leucocyte count and L: H ratio was calculated by using total and differential leucocyte count.[000120] Further, serum biochemical parameter analysis was carried out using Selectra Junior (Elitech, France) a fully automated biochemistry analyzer.[000121] The haematological changes in the blood serum of broilers from both the control and treatment groups were investigated. Haematocrit, haemoglobin,lymphocytes, leukocytes, heterophils, basophils, eosinophils, and monocytes were all counted in the blood serum.[000122] Interestingly, all the haematological parameters studied were found within the normal range.[000123] The serum biochemical profiling of broilers was performed after 28 and 42 days, the average rearing period in both treatment and non-treatment groups, in the present investigation, blood serum for liver enzyme concentration, lactate dehydrogenase (LDH), total protein, total albumin, bilirubin, globulin, lipid profiling, glucose, uric acid, phosphorus, and calcium level in the blood serum were examined.[000124] According to the current finding, no significant differences were observed in the treatment and non-treatment groups and all of the tested parameters were within the normal range. The lipid profile (cholesterol, triglycerides, low-density lipoprotein (LDL), very-low-density lipoprotein (VLDL) and high-density lipoprotein (HDL) was lowered in the treatment group diet supplemented with L. lactis and FOS (Figure 8).Histopathological study[000125] As scheduled (three birds from each replicate group) broilers were sacrificed on 28 and 42 days and liver, kidney, heart, and small intestine was collected and fixed in 10% neutral buffered formalin. The fixed tissues were processed using Hematoxylin and Eosin (H & E) stained sections. The slides were examined under microscope to note histopathological lesions, if any. Severity of the observed lesions were recorded as NAD= No abnormality detected, 1= Minimal, 2= Mild, s3= Moderate, 4= Moderately Severe / Marked, 5= Severe. Distribution of the lesions was recorded as focal, multifocal, and diffuse.[000126] Histological observation showed that there were no abnormalities of pathological significance observed in the organs viz., heart and small intestine in birds of treatment groups (T2, T3 and T4) and control group (Tl) on 28 and 42 days.[000127] In the present investigation, it was observed that there was no harmful or toxic effect of L. lactis and FOS feed supplementation on broilers health.[000128] Overall, the present investigation showed that feed supplement of L. lactis and FOS as probiotic and prebiotic in broilers diets could help to improve growth performance, feed conversion ratio, gut microbiome, and colonisation. In addition, this aids in the improvement of basic metabolism, environmental adaptation, and xenobiotic biodegradation.ADVANTAGES OF THE PRESENT INVENTION[000129] Provides dietary supplement for poultry comprising probiotic potential of Lactococcus lactis subsp. lactis strain either alone and or in combination with prebiotic, fructo-oligosaccharides (FOS) significantly enhanced the growth performance of poultry birds.[000130] Provides an effective dietary supplement option to the synthetic feed additive in poultry industries for the betterment of poultry health, food safety and inferences in antimicrobial resistance (AMR) / antibiotic resistance (AR) mitigation. [000131] Feed supplement of L. lactis and FOS helps to improve the health performance on broilers poultry birds.[000132] L. lactis also reduces the serum cholesterol lowering effect comprise of high-density lipoprotein (HDL), low-density lipoprotein (LDL), and triglycerides in the blood.[000133] Also enhances the gut microbiota and improved health performance of broiler chickens.

Claims

I / We Claim:

1. A dietary supplement composition for poultry, wherein the composition comprises: a probiotic alone or in combination with a prebiotic mixed with a carrier, wherein the probiotic comprises freeze-dried L. lactis subsp. lactis MCC 0263 cells in the range of 4xl09cfu / kg to 5xl09cfu / kg, the carrier is dextrose, wherein the ratio of L. lactis cells and the carrier is in a range of 1:2 to 1:5.

2. The dietary supplement composition as claimed in claim 1, wherein the prebiotic is fructo-oligosaccharides (FOS) in an amount in the range of 0.1% to 0.5% by weight of the composition.

3. The dietary supplement composition as claimed in claim 1, wherein the freeze-dried L. lactis subsp. lactis cells is mixed with basal feed without any antibiotics.

4. The dietary supplement composition as claimed in claim 1, wherein the dietary supplement composition is provided as a dietary supplement in a diet selected from pre- starter, starter, or finisher diet.

5. The dietary supplement composition as claimed in claim 4, wherein the freeze-dried L. lactis subsp. lactis cells and fructooligosaccharides are in the ratio of 50:1 g / tonne, 50:2.5 g / tonne, and 50:5 g / tonne for pre- starter, starter, and finisher diet respectively.

6. A process for preparing the dietary supplement composition for poultry as claimed in claim 1, wherein the said process comprising the steps of: i. isolating L. lactis subsp. lactis from milk sample; ii. culturing L. lactis subsp. lactis in a De Man, Rogosa and Sharpe (MRS) nutrient medium, harvesting cell pellets to obtain a biomass; iii. freeze drying the biomass obtained in step (ii) by suspending the cell pellets in a cryo-protecting agent and freeze-drying at around freezing temperature of -80°C for 40-60 h;iv. mixing freeze-dried L. lactis subsp. lactis cells in the range of 4xl09cfu / kg to about 5xl09cfu / kg with basal diet and fructooligosaccharides (FOS); and v. continued mixing of the mixture obtained in step (iv) for 1 day to 42 days with intermittent checking of the viability count of L. lactis subsp. lactis cells after every 3-5 days to obtain the dietary supplement composition with 4xl09cfu / kg to 5xl09viable cell count of L. lactis subsp. lactis cells.

7. The process as claimed in claim 6, wherein the growth of L. lactis subsp. lactis in step (ii) is in the pH range of 5.5 to 7; incubation temperature in the range of 25°C to 40°C; and 10 % dissolved oxygen (DO) saturation with constant agitation at 50 rpm to 100 rpm.

8. The process as claimed in claim 6, wherein the harvesting in step (ii) is effected by centrifugation at 3000 rpm to 6000 rpm for a duration in range of 10 minutes to 30 minutes.

9. The process as claimed in claim 6, wherein the isolation of Lactococcus lactis subsp. lactis from raw milk in step (i) comprises the steps of: a. providing raw milk; b. homogenising the raw milk with sterile distilled water containing 0.85% NaCl and 0.1% peptone; c. preparing serially diluted samples from the homogenized raw milk and spreading the diluted samples on Man, Ragosa, and Sharpe (MRS) agar plate; d. incubating the MRS agar plates at 32 °C to 37°C for 24 to 48 h under aerobic conditions; e. picking up colonies with Lactococcus characteristics and streaking on MRS agar plates followed by Gram’s staining and microscopic observation; and f. confirming the strains of L. lactis subsp. lactis with accession number MCC 0263 by molecular identification using 16s RNA gene.

Images