Nucleic acid sequences for reducing chemoresistance and treating disease

WO2025226652A3PCT designated stage Publication Date: 2026-03-12THE CLEVELAND CLINIC FOUND
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-04-22
Publication Date
2026-03-12

AI Technical Summary

Technical Problem

Existing treatments for cancer, particularly those involving platinum-containing chemotherapeutics, face challenges due to chemoresistance mechanisms driven by IL-17 signaling, which are not well understood and lead to therapeutic resistance in solid tumors.

Method used

Utilizing nucleic acid sequences, such as aptamers and antisense sequences, that bind to specific mRNAs or the SEFIR domain of the ACT1 protein to inhibit IL-17-mediated chemoresistance by targeting mRNAs like WTAP, PRDX2, TNX1, SOD1, PCNA, and RAD23b, thereby reducing chemoresistance and treating diseases like cancer, neurodegenerative diseases, and fibrosis.

Benefits of technology

The nucleic acid sequences effectively reduce chemoresistance and enhance the efficacy of platinum-containing chemotherapeutics by stabilizing or inhibiting key mRNA targets, leading to increased cancer cell sensitivity and reduced resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025025725_12032026_PF_FP_ABST
    Figure US2025025725_12032026_PF_FP_ABST
Patent Text Reader

Abstract

Provided herein are compositions, systems, kits, and methods for reducing chemoresistance (e.g., to platinum containing chemotherapeutics) and treating certain diseases, using nucleic acid sequences (e.g., aptamers and antisense sequences) that bind to certain mRNAs (e.g., WTAP), or bind a SEFIR domain of an ACT1 protein, or bind to or inhibit mRNA sequences that bind to Act1 protein.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] NUCLEIC ACID SEQUENCES FOR REDUCING CHEMORESISTANCE AND TREATING DISEASE

[0002] The present application claims priority to U.S. Provisional application serial number 63 / 637,516, filed April 23, 2024, which is herein incorporated by reference in its entirety.

[0003] This invention was made with government support under CA062220 and CA272161 awarded by the National Institutes of Health. The government has certain rights in the invention.

[0004] FIELD

[0005] Provided herein are compositions, systems, kits, and methods for reducing chemoresistance (e.g., to platinum containing chemotherapeutics) and treating certain diseases, using nucleic acid sequences (e.g., aptamers and antisense sequences) that bind to certain mRNAs (e.g., WTAP), or bind a SEFIR domain of an ACT1 protein, or bind to or inhibit mRNA sequences that bind to Actl protein.

[0006] BACKGROUND

[0007] Emerging evidences indicate that IL- 17 signaling plays a critical role in cancer progression and resistance to anti-cancer therapies for a variety of solid tumors in human, especially those of mucosal origin such as cutaneous squamous cell carcinoma (cSCC) and head and neck SCC1 14. Preclinical studies have focused on the mechanisms for IL-17- mediated early tumorigenesis in various organs. However, the urgent medical need lies in understanding the different mechanisms of cancer drug resistance, which is the key in combatting cancer progression for late-stage cancer patients. The mechanism for IL- 17- mediated therapeutic resistance is poorly understood.

[0008] IL- 17 binds the IL- 17 receptor (IL-17R) to trigger the production of pro-inflammatory cytokines and chemokines in tissue cells15 16. This is achieved through a combination of weak transcriptional changes (activation of NF-kB17-21and C / EBP22-26) and less well-defined, but more robust post-transcriptional changes that include stabilization and translational control of specific mRNAs15, 21, 27-3°. Multiple mRNA destabilizing mechanisms have been discovered for cytokine and chemokine mRNAs, which provides the basis for the critical role of IL- 17 signaling in promoting posttranscriptional regulation of the proinflammatory genes. Cytokine and chemokine mRNAs have short half-lives because of conserved cis-elements within the 3’ UTRs that can be recognized by RNA binding proteins (including TTP31, 32, AUF133, 34, KSRP35 36, SF237, 38and Regnase-139, 40) and mediate the sequential deadenylation, decapping, and ultimately exonucleolytic degradation of the RNA29, 30, 38, 41 l?. Actl is the key adaptor molecule directly recruited to IL-17R, and is required for both the transcriptional and post-transcriptional changes of pro-inflammatory genes induced by IL-1729, 44"46. Significant progress has been made in understanding how specific mRNAs are targeted for regulation in response to IL- 17 signaling. A key breakthrough was the unanticipated discovery that Actl directly binds inflammatory mRNAs44. Upon IL- 17 stimulation, Actl is recruited to IL- 17 receptor through a SEFIR-dependent interaction17, 19, 46. It was discovered that a specific region in SEFIR domain of Actl directly binds stem- loop RNA structures at the 3’ untranslated region (3’UTR) of inflammatory mRNAs (e.g. Cxcll) to stabilize them and promote their translation in response to IL- 17 stimulaiton44.

[0009] SUMMARY

[0010] Provided herein are compositions, systems, kits, and methods for reducing chemoresistance (e.g., to platinum containing chemotherapeutics) and treating certain diseases, using nucleic acid sequences (e.g., aptamers and antisense sequences) that bind to certain mRNAs (e.g., WTAP), or bind a SEFIR domain of an ACT1 protein, or bind to or inhibit mRNA sequences that bind to Actl protein.

[0011] In some embodiments, provided herein are methods of treating a subject with cancer comprising: treating a subject with cancer with: i) a nucleic acid sequence, wherein the nucleic acid sequence binds at least part of an mRNA sequence selected from: Wilms' tumor 1 -associating protein (WTAP) mRNA, peroxiredoxin 2 (PRDX2) mRNA, thioredoxin 1 (TNX1) mRNA, superoxide dismutase 1 (SOD1) mRNA, proliferating cell nuclear antigen (PCNA) mRNA, and RAD23 homolog B, nucleotide excision repair protein (RAD23b) mRNA; and ii) a cancer therapeutic that can cause toxicity to the subject when administered to the subject in the absence of the nucleic acid sequence.

[0012] In certain embodiments, the subject is administered an amount of the cancer therapeutic that would cause toxicity in the subject if the nucleic acid sequence was not also administered to the subject. In particular embodiments, the nucleic acid sequence comprises an antisense or aptamer sequence (e.g., with one or more modified bases). In certain embodiments, at least a portion of the nucleic acid sequence is from a gene selected from: WTAP, PRDX2, TNX1, SOD1, PCNA, and RAD23b, and optionally wherein the at least a portion of the nucleic acid sequence is from a 5’ UTR from a gene selected from: WTAP, PRDX2, TNX1, SOD1, PCNA, and RAD23b. In additional embodiments, the nucleic acid sequence comprises a sequence shown in SEQ ID NOs: 1-52 (Table 1). In further embodiments, the nucleic acid sequence comprises RNA bases. In additional embodiments, the nucleic acid sequence comprises DNA bases. In some embodiments, the subject is human. In further embodiments, the nucleic acid sequence is from a human gene. In other embodiments, the WTAP mRNA, PRDX2 mRNA, TNX1 mRNA, SOD1 mRNA, PCNA mRNA , RAD23b mRNA is human WTAP mRNA, PRDX2 mRNA, TNX1 mRNA, SOD1 mRNA, PCNA mRNA , RAD23b mRNA.

[0013] In particular embodiments, the nucleic acid sequence is between 12 and 70 nucleotides in length (e.g., 12 . .. 15 . .. 20, 21, 22, 23, ... 30 ... 40 ... 50 ... 60 ... or 70 nucleotides in length). In additional embodiments, the nucleic acid sequence comprises modified bases (e.g., one or more modified bases as described further below), optionally selected from: 2'-O-Methyl NTP or 1 -methylpseudouridine, and optionally, wherein the modified bases are prevalent in an amount that improves stability in vivo and / or reduces immunogenicity in vivo. In additional embodiments, the cancer therapeutic comprises a platinum containing compound, which is optionally cisplatin, carboplatin, or oxaliplatin.

[0014] In particular embodiments, provided herein are compositions, kits, and systems comprising: a nucleic acid sequence that comprises, or consists of, a sequence shown in any of SEQ ID NOs: 1-52, wherein the nucleic acid sequences comprises at least one modified base, wherein the nucleic acid sequence is optionally 12 to 70 nucleotides in a length (e.g., 12 ... 15 ... 20, 21 , 22, 23, ... 30 ... 40 ... 50 ... 60 ... or 70 nucleotides in length), and wherein the nucleic acid sequence is optionally an aptamer or antisense sequence. In particular embodiments, the kits and systems further comprise a container for the compositions, such as a syringe bottle or shipment container.

[0015] In further embodiments, provide herein are methods of treating a subject with cancer comprising: treating a subject with cancer with: i) a nucleic acid sequence, wherein the nucleic acid sequence binds a SEFIR domain of an ACT1 protein, and ii) a cancer therapeutic that can cause toxicity to the subject when administered to the subject in the absence of the nucleic acid sequence. In some embodiments, the subject is administered an amount of the cancer therapeutic that would cause toxicity in the subject if the nucleic acid sequence was not also administered to the subject.

[0016] In particular embodiments, the nucleic acid sequence comprises an aptamer or an antisense sequence. In additional embodiments, at least a portion of the nucleic acid sequence is from a gene selected from: CXCL1, TNF, GM-CSF, Zc3hl2a, Serpincl, Cyp2d26, C3, H2-Q10, Nfkbiz, Igfbpl, Ccl7, Asbl5, Ccl2, Cgn, Cxcl5, G6pc, Cp, Slc27a2, Apocl, Uox and Bcl3, and optionally wherein the at least a portion of the nucleic acid sequence is from a 3’ UTR from the gene. In additional embodiments, the at least a portion of the nucleic acid sequence is from a gene selected from Table 2, and optionally wherein the at least a portion of the nucleic acid sequence is from a 5' UTR, 3'UTR, or coding sequence from the gene. In certain embodiments, the nucleic acid sequence comprises a sequence shown in any of SEQ ID NOs:53-429 (Table 2).

[0017] In further embodiments, the comprises RNA bases or DNA bases or both. In additional embodiments, the subject is human. In other embodiments, the nucleic acid sequence is from a human gene. In some embodiments, the ACT1 protein is human ACT1 protein. In further embodiments, the nucleic acid sequence is between about 12 and 100 nucleotides in length (e.g., 12 ... 15 ... 20 ... 30 ... 40 ... 50 ... 60 ... 70 ... 80 ... 90 ... or about 100 nucleotides in length). In additional embodiments, the nucleic acid sequence comprises modified bases, optionally selected from: 2'-O-Methyl NTP or 1- methylpseudouridine, and optionally, wherein the modified bases are prevalent in an amount that improves stability in vivo and / or reduces immunogenicity in vivo.

[0018] In some embodiments, the nucleic acid sequence is from a gene selected from CXCL1, TNF, GM-CSF, Zc3hl2a, Serpincl, Cyp2d26, C3, H2-Q10, Nfkbiz, Igfbpl, Ccl7, Asbl5, Ccl2, Cgn, Cxcl5, G6pc, Cp, Slc27a2, Apocl, Uox and Bcl3. In additional embodiments, the nucleic acid sequence comprises SEQ ID NO:464-466 (from Figures 13- 15), and optionally is not naturally occurring. In other embodiments, the nucleic acid sequence comprises SEQ ID NO: 467-503 (from Table 3), and optionally is not naturally occurring.

[0019] In particular embodiments, provided herein are compositions, kits, and systems comprising: a nucleic acid sequence that comprises, or consists of, a sequence shown in any of SEQ ID NOs: 467-503, wherein the nucleic acid sequences comprises at least one modified base, wherein the nucleic acid sequence is optionally 12 to 70 nucleotides in a length (e.g., 12 ... 15 ... 20, 21, 22, 23, ... 30 ... 40 ... 50 ... 60 ... or 70 nucleotides in length), and wherein the nucleic acid sequence is optionally an aptamer or antisense sequence. In particular embodiments, the kits and systems further comprise a container for the compositions, such as a syringe bottle or shipment container.

[0020] In some embodiments, provided herein are methods of treating a subject with a disease comprising: treating a subject with a disease with a nucleic acid sequence, wherein the nucleic acid sequence binds a SEFIR domain of an ACT1 protein, and wherein the disease is selected from: cancer, neurodegenerative disease, and fibrosis. In particular embodiments, the nucleic acid sequence comprises an aptamer or an antisense sequence. In additional embodiments, at least a portion of the nucleic acid sequence is from a gene selected from: CXCL1, TNF, GM-CSF, Zc3hl2a, Serpincl, Cyp2d26, C3, H2-Q10, Nfkbiz, Igfbpl, Ccl7, Asbl5, Ccl2, Cgn, Cxcl5, G6pc, Cp, Slc27a2, Apocl, Uox and Bcl3, and optionally wherein the at least a portion of the nucleic acid sequence is from a 3' UTR from the gene. In other embodiments, at least a portion of the nucleic acid sequence is from a gene selected from Table 2, and optionally wherein the at least a portion of the nucleic acid sequence is from a 5’ UTR, 3'UTR, or coding sequence from the gene. In further embodiments, the nucleic acid sequence comprises a sequence shown in any of SEQ ID NOs:53-429 (Table 2).

[0021] In further embodiments, the comprises RNA bases or DNA bases or both. In additional embodiments, the subject is human. In other embodiments, the nucleic acid sequence is from a human gene. In some embodiments, the ACT1 protein is human ACT1 protein. In further embodiments, the nucleic acid sequence is between about 12 and 100 nucleotides in length (e.g., 12 ... 15 ... 20 ... 30 ... 40 ... 50 ... 60 ... 70 ... 80 ... 90 ... or about 100 nucleotides in length). In additional embodiments, the nucleic acid sequence comprises modified bases, optionally selected from: 2'-O-Methyl NTP or 1- methylpseudouridine, and optionally, wherein the modified bases are prevalent in an amount that improves stability in vivo and / or reduces immunogenicity in vivo.

[0022] In further embodiments, the nucleic acid sequence is from a gene selected from CXCL1, TNF, GM-CSF, Zc3hl2a, Serpincl, Cyp2d26, C3, H2-Q10, Nfkbiz, Igfbpl, Ccl7, Asbl5, Ccl2, Cgn, Cxcl5, G6pc, Cp, Slc27a2, Apocl, Uox and Bcl3. In other embodiments, the nucleic acid sequence comprises SEQ ID NO:464-466 (from Figures 13-15), and optionally is not naturally occurring. In other embodiments, the nucleic acid sequence comprises SEQ ID NO: 467-503 (from Table 3), and optionally is not naturally occurring.

[0023] In additional embodiments, provided herein are methods of treating a subject with cancer comprising: treating a subject with cancer with: i) a nucleic acid sequence, wherein the nucleic acid sequence binds to, and / or inhibits, and / or competes with, mRNA sequences that bind to Actl protein, ii) a cancer therapeutic that can cause toxicity to the subject when administered to the subject in the absence of the nucleic acid sequence. In further embodiments, the subject is administered an amount of the cancer therapeutic that would cause toxicity in the subject if the nucleic acid sequence was not also administered to the subject. In some embodiments, at least a portion of the nucleic acid sequence is from a gene selected from a portion of: Hifla mRNA or an mRNA listed in Table 4.

[0024] In additional embodiments, the nucleic acid sequence comprises an antisense or aptamer sequence. In further embodiments, the nucleic acid sequence comprises a sequence shown in any of SEQ ID NOs: 430-463 (table 5). In certain embodiments, the nucleic acid sequence comprises RNA bases or DNA bases, or both. In additional embodiments, the subject is human. In further embodiments, the nucleic acid sequence is from a human gene. In certain embodiments, the mRNAs are human mRNAs. In other embodiments, the nucleic acid sequence is between 12 and 100 nucleotides in length (e.g., 12 ... 15 ... 20 ... 30 ... 40 ... 50 ... 60 ... 70 ... 80 ... 90 ... or about 100 nucleotides in length). In additional embodiments, the nucleic acid sequence comprises modified bases, optionally selected from: 2'-O-Methyl NTP or I -methylpseudouridine, and optionally, wherein the modified bases are prevalent in an amount that improves stability in vivo and / or reduces immunogenicity in vivo.

[0025] In some embodiments, provided here are methods of treating a subject with a disease comprising: treating a subject with a disease with a nucleic acid sequence, wherein the nucleic acid sequence binds to, and / or inhibits, and / or competes with, mRNA sequences that bind to Actl protein, and wherein the disease is selected from cancer, liver cirrhosis, severe asthma, and COPD. In additional embodiments, the cancer is a highly fibrotic cancer (e.g., selected from: hepatocellular, gastric, esophageal, head and neck, colon, pancreatic, cervix, and vulvar cancers). In other embodiments, at least a portion of the nucleic acid sequence is from a gene selected from a portion of: Hifla mRNA or an mRNA listed in Table 4.

[0026] In certain embodiments, the nucleic acid sequence comprises an antisense or aptamer sequence. In some embodiments, the nucleic acid sequence comprises a sequence shown in any of SEQ ID NOs: 430-463 (table 5). In other embodiments, the nucleic acid sequence comprises RNA bases or DNA bases or both. In some embodiments, the subject is human. In additional embodiments, the nucleic acid sequence is from a human gene. In further embodiments, the mRNAs are human mRNAs. In certain embodiments, the nucleic acid sequence is between 12 and 100 nucleotides in length (e.g., 12 ... 15 ... 20 ... 30 ... 40 ... 50 ... 60 ... 70 ... 80 ... 90 ... or about 100 nucleotides in length). In other embodiments, the nucleic acid sequence comprises modified bases, optionally selected from: 2'-O-Methyl NTP or 1 -methylpseudouridine, and optionally, wherein the modified bases are prevalent in an amount that improves stability in vivo and / or reduces immunogenicity in vivo.

[0027] DESCRIPTION OF THE FIGURES

[0028] Figure 1. CLIP analysis of Actl -RNA interactions. A. Percentage of various RNA species bound by Actl based on CLIP analyses. Mouse mmlO Gencode M25(GRCm38.p6) were used to determine the gene annotation of clusters. The majority of Actl binding sites were located in protein coding genes. B. Metagene profile showing the distribution of Actl binding clusters across the mouse transcriptome. 5’ UTRs, CDSs, and 3’ UTRs of mRNAs were individually binned into regions spanning 1 % of their longest transcript length, and the percentage of Actl binding clusters that fall within each bin was determined. C. Boxplot showing the density of Actl binding clusters on 5’UTR and 3’UTR of target genes. Two tailed t test was performed. (****P<0.0001) D. Scatter plot summarizing the enrichment of all possible hexamers (4096 in total) in the 5’UTR (x-axis) and 3’UTR CLIP sites (y-axis). Hexamer enrichment analyses were performed using the EMBOSS tools. E. Pathway analysis (ranked by significance) of the genes with identified Actl binding sites on the 5’UTR of their transcripts.

[0029] Figure 2. Actl’s binding to the 5’UTR of transcripts encoding Wtap and antioxidant proteins promotes their translation. A. Normalized count of indicated genes in untreated and IL-17A treated MEFs were measured by RNAseq and analyzed using DEseq2. ****Padj<0.0001 B. Genome browser views of Actl binding clusters on Wtap and Sodl genes using the Integrative Genomics Viewer (IGV). C. Binding of purified recombinant His- MBP-Actl SEFIR domain (Actl WT) and SEFIR1 deletion mutant (Actl ASEF1) to the 5’UTR of Wtap, Prdx2, Sodl, and Txnl were examined by REMSA. D. Actl- / - MEFs reconstituted with FLAG-tagged wild-type Actl (WT) by retroviral infection were treated with IL-17A. The cell lysates were then subjected to western blot analysis. E. Actl- / - MEFs cells reconstituted retrovirally with either WT Actl or Actl ASEF1 were treated with IL-17A for 0 or 24h, followed by fractionation. Indicated mRNAs from translation- active pools and translation-inactive pools were analyzed by RT-PCR and normalized to Gapdh. Graph shows the ratios of mRNAs from translation-active / inactive pools (mean and s.d. of 3 independent plates of cells). Two tailed t test was performed. *P < 0.05, **P < 0.01 and ***P < 0.001; NS, not significant. All data are representative of three independent experiments.

[0030] Figure 3. Actl promotes cap-independent translation of transcripts encoding Wtap and antioxidant proteins. A. Actl- / - MEFs reconstituted retrovirally with either FLAG- tagged WT Actl or Actl deltaSEFl were pre-treated with rapamycin or DMSO for 24h, followed by IL-17A treatment and western blot analysis. B. WT Actl or Actl deltaSEFl MEFs were transfected with plasmid encoding a bicistronic RNA expressing renilla luciferase (via cap-dependent translation) and firefly luciferase (via cap-independent translation driven by the inserted 5’UTR sequence, including Prdx2, Txnl, Wtap, Sodl, as indicated on diagram (top panel)), followed by IL-17A treatment for 24h and dual luciferase reporter assay. Graph shows the ratio of firefly to renilla luciferase activity determined by luminescence (mean and s.d. of 3 independent plates of cells). C. WT Actl or Actl deltaSEFl MEFs were pre-treated either with rapamycin or DMSO for 24h and then treated with IL-17A for 24h, followed by fractionation and RT-PCR normalized to Gapdh. Graph shows the ratios of mRNAs from translation- active / inactive pools (mean and s.d. of 3 independent plates of cells). Two tailed t test was performed. *P < 0.05, **P < 0.01 and ***P < 0.001 ; NS, not significant. All data are representative of three independent experiments.

[0031] Figure 4. Actl RNA binding activity is required for IL-17-induced m6A methylation of Actl 5’UTR targets and cap-independent translation. A. Density plots corresponding to distances of Actl binding sites on 5’UTR (red) and 3’UTR regions (blue) to the closest annotated m6A sites from published database (GSE147489) on gene transcripts. Random distances on each transcript region were used as control (dashed lines). B. M0C1 cells, Actl WT, or Actl deltaSEFl MEFs were treated with IL-17A, followed by methylated (m6A) RNA immunoprecipitation (MeRIP) and RT-PCR as described in the Materials and Methods section. C. WT Actl or Actl deltaSEFl MEFs with and without IL-17A stimulation were subjected to methylated (m6A) RNA immunoprecipitation (MeRIP) followed by RT-PCR. Graphs show relative levels of indicated mRNAs normalized to Gapdh (mean and s.d. of 3 independent plates of cells). D. WT Actl or Actl deltaSEFl MEFs were transfected with siCTRL, siWTAP or siWTAP+HA-WTAP. The transfected cells pretreated with rapamycin were treated with 1L-17A, followed by western blot analysis. Vehicle control (DMSO) for rapamycin was shown in Fig. 12C. E. Actl WT MEFs were transfected with siCTRL or siWTAP. The transfections cells pre- treated with rapamycin were either left untreated or IL- 17A, followed by fractionation and RT-PCR normalized to Gapdh. Graph shows the ratios of mRNAs from translation-active / inactive pools (mean and s.d. of 3 independent plates of cells). F. Wtap-knockdown MEFs with or without restoration of HA-WTAP (HA-WTAP) were analyzed using a bicistronic reporter system as described in Fig. 3B. The transfected cells pre-treated with Rapamycin were treated with IL- 17 for 24h, followed by dual luciferase reporter assay. Graphs show firefly and renilla luciferase activity determined by luminescence (mean and s.d. of 3 independent plates of cells). Two tailed t test was performed. All data are representative of three independent experiments. *P < 0.05, **P < 0.01 and ***P < 0.001; NS, not significant.

[0032] Figure 5. Wtap ASO inhibits Actl binding to Wtap mRNA and diminishes IL-17- induced m6A methylation of the Actl 5’UTR targets and their translation. A. Top panel: The Wtap ASO candidates (Wl-4) were used to compete with Wtap 5' UTR probe for binding to Actl SEFIR. Data are representative of three independent experiments. Bottom panel: Wtap- ASO and Ctrl-ASO were modified with 2'-M0E and phosphonothioate linkage. B. Footprinting analysis of Actl-Wtap interaction. The 5 '-end-labeled Wtap probe alone or together with Wtap ASO was incubated in the absence or presence of Actl SEFIR. The reactions were then partially digested with RNases T1 or A. The alkali and sequencing (G and C + U) ladders are shown in the left lanes. The numbers to the left of the gels indicate the positions of nucleotides according to the numbering in the RNA structure graph. While Actl- SEFIR protected area is marked in green line, the ASO binding site is labeled in red line. C. M0C1 cells were transfected with Wtap ASO with or without restoration of HA-tagged WTAP. The rapamycin pre-treated transfected cells were treated with IL-17A, followed by western blot analysis. Vehicle control (DMSO) for rapamycin was shown in Fig. S6D. D. M0C1 cells transfected with Wtap or Control ASO, were pretreated with rapamycin and then treated with IL-17A, followed by RNA immunoprecipitation with anti-Actl and RT-PCR. Relative values normalized against IgG control are shown (mean and s.d. of 3 independent plates of cells). E. M0C1 cells were transfected with Wtap ASO with or without restoration of HA-tagged WTAP. The rapamycin pre-treated transfected cells were treated with IL-17A, followed by methylated (m6A) RNA immunoprecipitation (MeRIP) and RT-PCR. Graphs show relative levels of indicated mRNAs normalized to Gapdh (mean and s.d. of 3 independent plates of cells). F. M0C1 cells transfected with Wtap or Control ASO were pretreated with rapamycin and then treated with IL- 17 A, followed by immunoprecipitation with anti-Actl and western blot analysis. WCL (whole cell lysate). G. M0C1 cells transfected with either Wtap or Control ASO, were pretreated with rapamycin and then treated with IL-17A, followed by RNA immunoprecipitation with anti-eIF3G and RT-PCR. Relative values normalized against IgG control are shown (mean and s.d. of 3 independent plates of cells). H. Actl- / - MEFs reconstituted retrovirally with Actl WT or ASEF1 were pretreated with rapamycin and then treated with IL-17A, followed by RNA immunoprecipitation with anti-eIF3G and RT-PCR. Relative values normalized against IgG control are shown (mean and s.d. of 3 independent plates of cells). I. Schematic model for IL- 17 -induced chemoresistance. During cisplatin treatment, IL- 17 induces cap-independent translation of Wtap in cancer cells through upregulating its methylation. Increased expression of Wtap leads to increased m6A level of antioxidant genes including Prdx2, Txnl and Sodl. Actl binds in proximity to m6A sites on the 5’UTR and promotes cap-independent translation of antioxidant genes through the recruitment of EIF3G. All data are representative of three independent experiments. Two tailed t test was performed. *P < 0.05, **P < 0.01 and ***P < 0.001; NS, not significant.

[0033] Figure 6. IL- 17 A renders M0C1 cancer cells resistance to cisplatin-mediated cell killing through WTAP-dependent induction of antioxidants. A. M0C1 cells were pre-treated with cisplatin, followed by IL-17A treatment. Cells were then stained with Annexin V / PI and analyzed by flow cytometry. Shown is the percentage of apoptotic cells (annexin V positive). The data are presented as the mean ± s.d. (n = 3). One way ANOVA was performed, followed by Tukey’s multiple-comparisons test. B. M0C1 cells were pre- treated with cisplatin, followed by IL-17A treatment and CellROX Green staining assay. Representative fluorescence images show intracellular levels of ROS (green fluorescence). Scale bar, 100 pm. Graph shows the percentage of CellROX stained cells and s.d. (n = 3 independent plates). 3 independent fields per plate were analyzed for quantification. C. MOC1 cells were pre-treated with cisplatin, followed by IL-17A treatment and western blot analysis. D. MOC1 cells transfected with siCTRL or siWTAP were pre-treated with cisplatin, followed by IL- 17A treatment. Cytoplasmic extracts of these cells were fractionated, followed by RT-PCR and normalized to Gapdh. Graph shows the ratios of mRNAs from translation-active / inactive pools (mean and s.d. of 3 independent plates of cells). E. M0C1 cells were transfected with siCTRL or siWTAP. The transfected cells were pre-treated with cisplatin followed by treatment with IL-17A. The cell lysates were subjected to western blot analysis. Vehicle control (DMSO) for rapamycin was shown in Fig. S7B. All data are representative of three independent experiments. Two tailed t test was performed. *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001; NS, not significant.

[0034] Figure 7. Wtap ASO render MOC1 tumors sensitive to cisplatin treatment.

[0035] A. MOC1 cells pre-treated with cisplatin or vehicle control (PBS) were transfected with Wtap or Control ASO, followed by IL-17A. Cells were then stained with Annexin V / PI and analyzed by flow cytometry. Shown is the percentage of apoptotic population (annexin V positive cells). The data are presented as the mean ± s.d. (n = 3). B. MOC1 cells transfected with Wtap or Control ASO were treated with cisplatin or vehicle control (PBS), followed by IL-17A treatment and CellROX Green staining assay. Representative fluorescence images show intracellular levels of ROS (green fluorescence). Scale bar, 100 pm. Graph shows the percentage of CellROX stained cells and s.d. (n = 3 independent plates). 3 independent fields per plate were analyzed for quantification. C. MOC1 cells transfected with Wtap or Control ASO, were treated with cisplatin, followed by IL-17A treatment and western blot analysis. D. Treatment timeline for M0C1 tumor model-based experiments in D-H: C57BL / 6 mice (n = 5 / group) were injected in the right flank with M0C1 cells (5 x 106, in matrigel), and 10 days later randomized into treatment groups. Mice were then treated with cisplatin (5 mg / kg) and simultaneously subjected to intra-tumor injections of WTAP or Control ASO (1 nmol / mouse). Treatment was repeated every 4 days up to day 21, after which mice were sacrificed and tumor tissue was collected. E-F. Tumors from mice in D were measured.

[0036] Graph shows total tumor volume (E) and fold increase in tumor size (F). Represented as mean ± SEM, n = 5 / group. G. IL-17A levels in tumor homogenates from mice in D were determined by ELISA (n=5 biological samples / group ± s.d.). H. Representative images of immunofluorescence staining for cleaved caspase-3 in sections of M0C1 tumors from mice in D. Blue, DAPI nuclear staining. Graph shows the percentage of cleaved caspase-3 positive tumor cells over EpCam positive cells. Five random regions were analyzed for each group, bar graphs show mean and s.d. of biological replicates. I. Representative images of immunohistochemical analysis of cleaved caspase-3 in M0C1 tumor sections from mice in D, counterstained with hematoxylin-eosin-safran. Graph shows the percentage of cleaved caspase-3 positive cells. Five random regions were analyzed for each group, bar graphs show mean and s.d. of biological replicates. Scale bar, 50 pm. J. Left panel: representative images of TUNEL assay in M0C1 tumor sections from mice in D, counterstained with methyl-green. Graph shows the percentage of cleaved caspase-3 positive cells. Five random regions were analyzed for each group, bar graphs show mean and s.d. of biological replicates. Scale bar, 50 pm. K. M0C1 tumor lysates from mice in D were subjected to western blot analysis. L. Realtime PCR analysis of Wtap mRNA in the MOC1 tumor tissue from mice in D. M. Representative images of immunohistochemical analysis of 4-Hydroxynonenal levels in M0C1 tumor tissue lysates from mice in D. Graph shows the percentage of 4- Hydroxynonenal positive cells. Five random regions were analyzed for each group, bar graphs show mean and s.d. of biological replicates. Scale bars, 100 pm. Two tailed t test was performed. *P < 0.05, **P < 0.01 and ***P < 0.001; NS, not significant. All data are representative of three independent experiments.

[0037] Figure 8. A. Autoradiograph of radiolabeled cross-linked Actl-RNA complexes immunopurified from IL-17A-stimulated WT Actl or Actl deltaSEFl MEFs lysates treated with either a low (1:20,000) or high (1 :1,000) concentration of RNaseA. No UV cross linking and IgG were used as negative controls. Arrow denotes position of Actl. Open bracket indicates region of membrane excised for library preparation. B. Genome browser views of Actl CLIP binding sites on the 3’UTR of Cxcll, Cebpb and Hifl a overlap with the previously reported SBE sites. C. Pathway analysis of the genes with identified Actl binding sites on the 3’UTR of their transcripts. D. Genome browser views of Actl CLIP binding sites on the 5’UTR of Prdx2 and Txnl. E. WT Actl or Actl deltaSEFl MEFs were either left untreated or treated with IL- 17 A, followed by RNA immunoprecipitation with anti-Actl and RT-PCR. Relative values normalized against IgG control are shown (mean and s.d. of 3 independent plates of cells). One way ANOVA was performed, followed by Tukey’s multiple-comparisons test. F. MOC1 cells and PDVC57 cells were treated with IL-17A, followed by western blot analysis. G. WT Actl MEFs, M0C1 cells and PDVC57 cells were treated with IL-17A, followed by RT-PCR analyses (n = 3 independent plates of cells). H. M0C1 cells and PDVC57 cells were treated with IL-17A and subjected to RNA immunoprecipitation with anti-Actl followed by RT-PCR analyses (n = 3 independent plates of cells). Relative values normalized against IgG control are shown. All data are representative of three independent experiments. Two tailed t test was performed. *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001 ; NS, not significant.

[0038] Figure 9. A. Green boxes indicate the stained WTAP areas that were subjected to Image J analysis. Arrows indicate the samples that belong to IL-17A high group. B. Images of WTAP staining and IL-17A staining from two samples (IL-17A high: F7; IL-17A low: B7, as shown in panel A). Scale bar, 500 pm. (C) Bar graph comparing the quantification of WTAP staining in IL-17A-low and IL-17A-high groups, p = 0.0037 by t-test. ±SEM. C. WT Actl or Actl deltaSEFl MEFs transfected with siCTRL or si-eIF4E were treated with IL- 17A. The cell lysates were subjected to western blot analysis. D.M0C1 cells pre-treated with rapamycin were either left untreated or treated with IL-17A, followed by fractionation. Indicated mRNAs from translation-active pools and translation-inactive pools were analyzed by RT-PCR and normalized to P-actin. Graph shows the ratios of mRNAs from translation- active / inactive pools (n = 3 independent plates of cells). Two tailed t test was performed. *P < 0.05, **P < 0.01 and ***P < 0.001; NS, not significant.

[0039] Figure 10. A. Density plots corresponding to distances of Actl binding sites on the 5’UTR (red) and 3’UTR regions (blue) mRNA transcript region to the closest annotated m6A binding sites using additional published datasets (GSE53244, GSE61995). Random distances on each transcript region were used as control (dashed lines). B. M0C1 cells transfected with either siCTRL, siWTAP or siWTAP+HA-WTAP were either left untreated or treated with IL-17A, followed by methylated (m6A) RNA immunoprecipitation (MeRIP) and RT-PCR. Graphs show relative levels of indicated mRNAs normalized to Gapdh (mean and s.d. of 3 independent plates of cells). C. WT Actl MEFs were transfected with siCTRL, siWTAP or siWTAP+HA-WTAP. The transfected cells pretreated with rapamycin or vehicle control (DMSO) were treated with IL-17A, followed by western blot analysis. D. M0C1 cells transfected with siCTRL or siWTAP were pre- treated with rapamycin, followed by IL-17A treatment and fractionation. Indicated mRNAs from translation-active pools and translationinactive pools were analyzed by RT-PCR and normalized to Gapdh. Graph shows the ratios of mRNAs from translation-active / inactive pools (n = 3 independent plates of cells). E. M0C1 cells transfected with siCTRL, siWTAP or siWTAP+HA-WTAP were pre-treated with rapamycin, followed by IL-17A. The cell lysates were subjected to western blot analysis. Two tailed t test was performed. *P < 0.05, **P < 0.01 and ***P < 0.001 ; NS, not significant. Figure 11. A. Schematic representation of the Wtap 5' UTR. Actl probe, W1-W4 ASO and MeRIP primers corresponding sites are indicated. W1-W4 and Ctrl ASO sequences are listed in the table. B. Graph shows the structure of Wtap ASO bound Wtap 5 ’UTR RNA probe. C. REMSA competition assay using Ctrl-ASO or Wtap- ASO to compete with indicated 5’ UTR probes for binding to Actl SEFIR. D. M0C1 cells transfected with Ctrl- ASO or WTAP- ASO, were pretreated with rapamycin or vehicle control (DMSO) and then either left untreated or treated with IL-17A. The cell lysates were subjected to western blot analysis. E. A-431 cells transfected with h_Ctrl-ASO or h_WTAP-ASO, were pretreated with rapamycin and then either left untreated or treated with IL- 17 A, followed by RNA immunoprecipitation with anti-Actl and RT-PCR. Relative values normalized against IgG control are shown (mean and s.d. of 3 independent plates of cells). F. A-431 cells transfected with h_Ctrl-ASO or h_WTAP-ASO, were pretreated with rapamycin and then either left untreated or treated with IL- 17 A. The cell lysates were subjected to western blot analysis. G. A-431 cells were treated with IL-17A, followed by RT-PCR analyses (n = 3 independent plates of cells). One way ANOVA was performed, followed by Tukey’s multiplecomparisons test. H. M0C1 cells either left untreated or pre-treated with RNaseA were stimulated with IL-17A. Cell lysates were immunoprecipitated with anti-Actl and subjected to western blot analysis. Whole cell lysate (WCL). *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001; NS, not significant.

[0040] Figure 12. A. M0C1 cells transfected with siCTRL or siWTAP were pretreated with cisplatin or vehicle control (PBS), followed by IL-17A treatment. Cells were then stained with Annexin V / PI and analyzed by flow cytometry. Shown is the percentage of apoptotic cells (annexin V positive). The data are presented as the mean ± s.d. (n = 3). B. M0C1 cells were transfected with siCTRL or siWTAP. The transfected cells were pre-treated with cisplatin or PBS followed by treatment with IL- 17 A. The cell lysates were subjected to western blot analysis. C. M0C1 cells transfected with a control shRNA vector or Actl shRNA constructs were selected by puromycin treatment. Cell lysates were analyzed by Western blot. D. Treatment timeline for M0C1 tumor model-based experiments in E-F: C57BL / 6 mice (n = 5 / group) were injected in the right flank with M0C1 cells transfected with either shRNA Actl or scramble shRNA as described in D (5 x 106, in Matrigel), and 10 days later randomized into treatment groups. Mice were then treated with cisplatin (5 mg / kg) every 4 days up to day 21 , after which mice were sacrificed and tumor tissue was collected. E. Tumors from mice treated as described in D were measured. Graph shows total tumor volume, represented as mean ± SEM, n = 5 / group. Two tailed t test was performed. *P < 0.05 and ****P < 0.0001 ; NS, not significant. F. Immunofluorescence of either Wtap-ASO-FAM, Ctrl-ASO-FAM (green channel) or Ep-CAM (red channel) in sections of M0C1 tumors from mice described in D. Blue, DAPI nuclear staining. Scale bar, 50 um.

[0041] Figure 13 shows a consensus structure of an exemplary aptamer for binding ACT1 protein (SEQ ID NO:464). Additional sequences for binding ACT1 are described in US Pat. 11,352,630, incorporated herein by reference in its entirety, particularly for ACT1 protein binding sequences therein (e.g., aptamers).

[0042] Figure 14 shows a consensus structure of an exemplary aptamer for binding ACT 1 protein (SEQ ID NO:465).

[0043] Figure 15 shows a consensus structure of an exemplary aptamer for binding ACT1 protein (SEQ ID NO:466).

[0044] DETAILED DESCRIPTION

[0045] Provided herein are compositions, systems, kits, and methods for reducing chemoresistance (e.g., to platinum containing chemotherapeutics) and treating certain diseases, using nucleic acid sequences (e.g., aptamers and antisense sequences) that bind to certain mRNAs (e.g., WTAP), or bind a SEF1R domain of an ACT1 protein, or bind to or inhibit mRNA sequences that bind to Actl protein.

[0046] In some embodiments, the nucleic acid sequences herein (e.g., antisense or aptamers) comprise at least one chemical modification or chemically modified base, nucleoside, or nucleotide. The chemical modifications may comprise any modification which is not naturally present in DNA or RNA or any naturally-occurring modification of adenosine (A), guanosine (G), uridine (U), Thymine (T) or cytidine (C) ribonucleosides. For example, a nucleic acid sequence herein may include both naturally-occurring and non-naturally- occurring modifications. Chemical modifications may be located in any portion of the nucleic acid sequences herein and may contain any percentage of modified nucleosides (1-100%, such as at least 20% ... at least 40% ... or at least 60%). In some embodiments, every particular base or nucleoside may be modified (e.g., every uridine is a modified uridine). In some embodiments, at least 20%, or 50%, or 80% of any single nucleotide (e.g., uracil) in the nucleic acid sequences herein is chemically modified. In some embodiments, a particular modification is used for every particular type of nucleoside or base (e.g., every uridine is modified to a 1-methyl-pseudouridine). Exemplary RNA modifications can be found in the RNA modification database (See, mods(dot)rna(dot)albany(dot)edu / home).

[0047] In some embodiments, the at least one chemical modification comprises a modified uridine residue. Exemplary modified uridine residues include, but are not limited to, pseudouridine, 1 -methylpseudouridine, 1 -ethylpseudouridine, 2-thiouridine, 4'- thiouridine, 5-methyluridine, 2-thio-l -methyl- 1 -deaza-pseudouridine, 2- thio-l-methyl-pseudouridine, 2- thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio- dihydrouridine, 2-thio- pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy- pseudouridine, 4-thio-l-methyl- pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine and 2'-0-methyl uridine.

[0048] In some embodiments, the at least one chemical modification comprises a modified cytosine residue. Exemplary nucleosides having a modified cytosine include 5 -aza-cytidine,

[0049] 6-aza-cytidine, pseudoisocytidine, 3-methyl -cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl-cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1-methyl- pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2- thio-cytidine, 2-thio-5- methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-l-methyl-pseudoisocytidine, 4-thio-l- methyl- 1 -deaza-pseudoisocy tidine, 1 -methyl- 1-deaza-pseudoisocytidine, zebularine, 5-aza- zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy- cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy- 1 -methyl - pseudoisocytidine, lysidine, a-thio-cytidine, 2'-O-methyl-cytidine, 5,2'-O-dimethyl-cytidine, N4-acetyl-2'-O-methyl-cytidine, N4,2'-O-dimethyl-cytidine, 5-formyl-2'-O-methyl-cytidine, N4,N4,2'-O-trimethyl-cytidine, 1 -thio-cytidine, 2'-F-aracytidine, 2'-F-cytidine, and 2'-OH- aracytidine.

[0050] In some embodiments, the at least one chemical modification comprises a modified adenine residue. Exemplary nucleosides having a modified adenine include 2-amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido- adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza- 2-amino-purine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyl- adenosine, 2-methyl-adenine, N6-methyl-adenosine, 2-methylthio-N6-methyl-adenosine, N6- isopentenyl-adenosine, 2-methylthio-N6-isopentenyl-adenosine, N6-(cis- hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6- glycinylcarbamoyl-adenosine, N6-threonylcarbamoyl-adenosine, N6-methyl-N6- threonylcarbamoyl-adenosine, 2-methylthio-N6-threonylcarbamoyl-adenosine, N6,N6- dimethyl-adenosine, N6-hydroxynoryalylcarbamoyl-adenosine, 2-methylthio-N6- hydroxynoryalylcarbamoyl-adenosine, N6-acetyl-adenosine, 7-methyl-adenine, 2-methylthio- adenine, 2-methoxy-adenine, a-thio-adenosine, 2'-O-methyl-adenosine, N6,2'-O-dimethyl- adenosine, N6,N6,2'-O-trimethyl-adenosine, l,2'-O-dimethyl-adenosine, 2'-O- ribosyladenosine (phosphate), 2-amino-N6-methyl-purine, 1 -thio-adenosine, 8-azido- adenosine, 2'-F-ara-adenosine, 2'-F-adenosine, 2'-OH-ara-adenosine, and N6-(19-amino- pentaoxanonadecyl)-adenosine. In some embodiments, the at least one chemical modification comprises a modified guanine residue. Exemplary nucleosides having a modified guanine include inosine, 1 - methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxy wybutosine, hydroxy wybutosine, undermodified hydroxywybutosine, 7-deaza- guanosine, queuosine, epoxy queuosine, galactosyl-queuosine, mannosyl-queuosine, 7-cyano- 7-deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza- guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7- methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1 - methyl-guanosine, N2-methyl-guanosine, N2,N2-dimethyl-guanosine, N2,7-dimethyl- guanosine, N2,N2,7-dimethyl-guanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1- methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, a- thio-guanosine, 2'-O-methyl-guanosine, N2-methyl-2'-O-methyl-guanosine, N2,N2-dimethyl- 2'-O-methyl-guanosine, l-methyl-2'-O-methyl-guanosine, N2,7-dimethyl-2'-O-methyl- guanosine, 2'-O-methyl-inosine, l,2'-O-dimethyl-inosine, and 2'-O-ribosylguanosine (phosphate).

[0051] In certain embodiments, provided herein are SEQ ID NOs 1-52 (in Table 1 below) and variants thereof (e.g., with one or two nucleotide deletions or substitutions) that, for example, may be used as antisense against at least a portion of a gene selected from: WTAP, PRDX2, TNX1, SOD1, PCNA, and RAD23b (e.g., to reduce chemoresistance to a chemotherapeutic). Such sequences may be about 12-70 nucleotides, for example, and may comprise one or more modified bases, optionally selected from: 2'-O-Methyl NTP or 1- methylpseudouridine, and optionally, wherein said modified bases are prevalent in an amount that improves stability in vivo and / or reduces immunogenicity in vivo.

[0052] TABLE 1 - Antisense Oligonucleotides

[0053] In some embodiments, provided herein are SEQ ID NOs 53-429 (in Table 2 below) and variants thereof (e.g., with one or two nucleotide deletions or substitutions, or where U it replaced by T throughout) that, for example, may be aptamers that bind a SEFIR domain of an ACT1 protein (e.g., to reduce chemoresistance to a chemotherapeutic). Such sequences may comprise one or more modified bases, optionally selected from: 2'-O-Methyl NTP or 1- methylpseudouridine, and optionally, wherein said modified bases are prevalent in an amount that improves stability in vivo and / or reduces immunogenicity in vivo.

[0054] TABLE 2 - Aptamers

[0055] In particular embodiments, provided herein are SEQ ID NOs 467-504 (in Table 3 below) and variants thereof (e.g., with one or two nucleotide deletions or substitutions) that, for example, may he aptamers that bind a SEFIR domain of an ACT1 protein (e.g., to reduce chemoresistance to a chemotherapeutic or treat a disease). Such sequences may comprise one or more modified bases (e.g., disclosed herein), optionally selected from: 2'-O-Methyl NTP or 1 -methylpseudouridine, and optionally, wherein said modified bases are prevalent in an amount that improves stability in vivo and / or reduces immunogenicity in vivo. In Table 3, the, non-underlines N's are unpaired nucleotides without sequence restriction (can be any nucleotide), and underlined N's are paired nucleotides without sequence restriction (can be any nucleotide).

[0056] Table 3

[0057] In some embodiments, provided herein are SEQ ID NOs 430-463 (in Table 5 below) and variants thereof (e.g., with one or two nucleotide deletions or substitutions) that, for example, may be a nucleic acid sequence that binds to, and / or inhibits, and / or competes with, mRNA sequences that bind to Actl protein. In particular embodiment, at least a portion of the nucleic acid sequence is from a gene selected from a portion of: Hifla mRNA or an mRNA from the genes listed in Table 4 below.

[0058] TABLE 4

[0059] Slco5al; Ptp4al; Mfsd9; Nabpl; Acadl; Fnl; Dbi; Lamcl; Cacybp; Pbxl; Noslap; Grem2; Wdr26; Proxl; Ppp2r5a; Rblccl; Col3al; Tmeff2; Eeflb2; Rpl37a; Arpc2; Ptma; L'be2f; Twist2; Ubxn4; Rbbp5; Trmtll; Torlaip2; Cregl; Tagln2; Vsig8; Gm33887; Rmndl; Heca; L3mbtl3; Mareks; Manta; Unc5b; Cisdl; Mif; Smarcbl; Lrrc3; Mknk2; Ckap4; Hsp90bl; Tmpo; Elk3; Metap2; Nudt4; Yeats4; Nxph4; Pa2g4; Latsl; Map3k5; Ccn2; Sec63; Prep; Nusl; Msl312; Psap; Ppal; Bsg; Ptbpl; Stkl 1; Cirbp; Dazapl; Timp3; Gnptab; Btgl; Ppplrl2a; Csrp2; Naplll; Smtn; Cabp7; Tbrg4; GrblO; Npml; Timd2; Canx; Ube2b; Hspa4; Slc22a5; Sparc; Atpaf2; Ulk2; Ntnl ; Rnasek; Taokl; Myoid; Cite; Scpepl ; Cacnalg; Krtl9; P3h4; Cavinl; Hdac5; Ddx5; Jptl; H3f3b; Acoxl; Jmjd6; Srsf2; Timp2; Slc38alO; Actgl; P4hb; Mafg; Fasn; Xpol; Rtn4; Hba-al; Rackl; Aff4; Sap301; Larpl; Mprip; Ubb; Gabarap; Rnfl67; Camkkl; Cluh; Mnt; Prpf8; Rab34; Zfp207; Ccl2; Srsfl; Mmd; Tobi; Collal; Spop; Grb7; Igfbp4; Eifl; Apoh; Sox9; Rptor; Baiap2; Slc25al0; Kcns3; Alir; Bazla; Rpl36al; Irf2bpl; Gtf2al; Dicerl; Cdc42bpb; Atp5mpl; Brfl; Rrm2; Lambl; Foxgl; Mgat2; Arf6; Gphn; Srsf5; Caimi; Ifi27; Slc25a47; Dynclhl; Mark3; Gtpbp4; Zkscan3; Histlh4n; H114; Ssrl; Nupl53; Macroh2al; HnmpaO; Iqgap2; Btf3; Radl7; Zfpl31; Gdi2; Adarb2; H2bc8; Hlf2; H2ac4; Ptdssl; Slcl2a7; Foxdl; I16st; Hmgcsl; Ube2e2; Dlg5; Slmap; Sh3bp5; Dadi; Ephx2; Ppp2r2a; Itm2b; Flnb; Ptprg; Kat6b; Zmizl; Tkt; Mustnl; Gludl; Pck2; Rnf31; Egr3; Gfra2; Tptl; Trim52; Rap2a; Pabpcl; Zfp706; Ubr5; Azinl; Atad2; Asapl; Plec; Cyhrl; Myh9; Sun2; Nptxr; Rangapl; Desil; 5031439G07Rik; Arsa; Slc38a2; Col2al; Kansl2; Mucll; Golph3; Zfp622; Sdc2; Mtdh; Rims2; Zfpm2; Sqle; Ly6e; Gpt; Lgalsl; Atf4; L3mbtl2; AtxnlO; Gramd4; Slc48al; Cacnb3; Kcnh3; Pcbp2; Crebbp; Cdipl; Gsptl; Comt; Xxyltl; Pdia5; Atp5j; Brwdl; Hmgnl;

[0060] 1810013L24Rik; Arvcf; Eif4g 1 ; Ahsg; Dig 1 ; Tfrc; Zfpl48; Itgb5; Cd47; Tomm70a; Sodl; Ifnar2; Itsnl; Slc5a3; Dyrkla; Qk; Wtap; Atp6v0c; RpslO; Ilrun; 42064; Csnk2b; Tubb5; Hsp90abl; Vegfa; C3; Efna5; Memol; Zfp3612; Tcpl; Ppp2rla; Srrm2; Pgp; Pkdl; RpllOa; Lsm2; Bag6; H2-D1; Cchcrl ; Ppplrl8; PpplrlO; Tctel; Yipf3; Ranbp3; Zbtbl4; Yipf4; Pkdcc; Epasl; Cdh2; B4galt6; Hspa9; Dpysl3; Mcc; Tmed7; Cdol; Lox; Hmgxb3; Txnll; Fech; 8030462N17Rik; Wac; Mibl; Ttr; Cxxc5; Csnklg3; Lmnbl; Ldlrad4; Zbtb7c; Pias2; Atp5al; Kdm2a; Lrfn4; Vegtb; Cox8a; Rtn3; Psatl; Gda; Tm9sf3; Gotl; Chuk; Mrpl43; Fam204a; Pitpnml; Cd248; Cfll; Ltbp3; Sfl; Hnmpul2; Ahnak; Fthl; Fadsl; Ddbl; Gnaq; Rcll; Tnks2; Lgil ; Zfyve27; Scd2; Sema4g; Trim8; Atrnll ; Echdc3; Atp5c1 ; Tubb4b; Agpat2; Brd3; Swi5; Cdk9; Sestdl ; Frzb; Zdhhc5; Dgkz; Hsdl7bl2; Cat; Caprinl; Hipk3; Ino80; Mfaplb; Pcedla; Rnl24; Mkks; Rrbpl; Cst3; Sntal; Rbm39; Mafb; Serinc3; Ptgis; Adnp; Vim; Rxra; Col5al; Set; Hspa5; Epc2; Gorasp2; Plekha3; Itgav; Ambral; Thbsl; Inafm2; Disp2; Pdia3; B2m; Slc27a2; Slc20al; Nop56; H13; Pofutl; Dlgap4; Rpn2; Srsf6; Ccn5; Pckl; Vapb; Stxl6; Gnas; Snxl6; Kpna4; Golim4; Rapgef2; Rps3al; Lmna; Nprl; Prunel; H3cl5; H2acl8; Tent5c; Atplal; Magi3; Atp5pb; Csfl; Ptbp2; Tmem56; Abcd3; Nfkbl; Sh3glbl; Ccnl; Prkacb; ZbtblO; Ythdf3; Mtfrl; Jadel; Spg20; Tsc22d2; Mbnll; Hdgf; Khdc4; S100a6; Mell; H2acl9; H3cl4; Txnip; Csdel; Kcnd3; Cnn3; F3; Gclm; Gng5; Rps20; Pnrcl; Dcafl2; Vcp; Tpm2; Gba2; Aldob; Txnl; Ptbp3; Tlel; Cdkn2a; Jun; Jakl; Prkaa2; Ptprf; Mfsd2a; Epb41; Tardbp; Phfl3; Rab2a; Chd7; Akirin2; Dnajal; Galt; Clta; Anp32b; Rad23b; Ugcg; Cachdl ; Epsl5; Prdxl; Sfpq; Phc2; Adgrb2; Srsf4; Rpa2; Fgr; Rsrpl; Hmgcl; Id3; Aldh4al; Lzic; Enol; Errfil; Faap20; Gnbl; Ube2j2; Noc21; Gatadl; Cldnl2; Ptpnl2; Faml84b; Pds5a; Igfbp7; Ccni; Hnmpd; Sec31a; Gak; Fbrsll ; 2900026A02Rik; RnflO; Ptpnl l; Mapkapk5; Aldh2; Atp2a2; Hpd; Gtf2i; Ywhag; Serpinel ; Srrt; Pcolce; Actb; Rael; Katnall; Chpf2; Ube3c; Selenoi; Ppplcb; Yesl; Adra2c; Ppp2r2c; Cpeb2; Pcdh7; Tbcldl; Ociadl; Ftp 111 ; Tmeml65; Paics; Ankle2; Wsb2; Hectd4; Brap; Pptc7; Tmed2; Ran; Tpstl; Mlxipl; Mdh2; Tfr2; Azgpl; Stag3; Fam20c; Kdelr2; Fam220a; Lmtk2; Zkscan5; Pan3; Cadps2; Wasl; Chchd3; Slc35b4; Mkml; Clec5a; Hnrnpa2bl; Snca; Pcbpl; Cnbp; Wnt7a; Rpl32; Wnkl; Ptms; Cd9; Ybx3; Colla2; Glccil; Phfl4; Tmeml06b; Smo; Bpgm; Caldl; Luc712; Fabpl;

[0061] Gm20594; Aupl; Rpnl; Empl; Etnkl; Rest 1 ; Ppp6rl ; Peg3; Apoe; Zfpl09; Grik5; Hnmpull; Actn4; Spint2; Hpn; Atf5; Ap2al; Prmtl; Ftll; TsglOl; Chd2; Furin; Tlnrdl; Abhdl7c; Dgat2; Serpinhl; Hbb-bt; Hbb-bs; Faml60a2; Scube2; Eif4g2; Xpo6; Vkorcl ; Tiall; Chstl5; Tubgcp2; Cendl; Igf2; Epnl; Slcla5; Smg9; Cadm4; Cyp2bl3; Cyp2b9; Rpsl6; Pnkp; Lmtk3; Kcncl ; Ldha; Nav2; Ttc23; Igfl r; Picalm; Ccdc89; Ucp2; StardlO; Ipo7; Teadl ; Hs3st4; Fus; Cyp2el ; Taldol ; Rplp2; Tspan4; Ap2a2; Cd81; Insr; Efnb2; Irs2; AnkrdlO; Rbpms; Mtusl; Snx25; Slc25a4; Palld; Uba52; Med26; Largel; Usp38; Pknl; Nfix; Calr; Csnk2a2; Cnotl; Chtf8; Ctrbl; Piezol; Sipall2; Irf2bp2; Lampl; Nsd3; Tti2; Ppplrjb; Slc7a2; Tmeml61a; Cope; Jund; Ddal; Otud4; Adgrll; Cacnala; Syce2; Prdx2; Gpt2; Fto; Cx3cll; Nfat5; Zfhx3; Aplgl; Cog4; Znrfl; Gabarapl2; Gsel; Foxc2; Tcf25; Itgbl; Pafahlb2; Rexo2; AI593442; Acatl; Tspan3; Rplpl; Hacd3; Tpml; Rnfl ll; Trf; Glyctk; Gnai2; Pdcd6ip; Rbms3; Oxsrl; AnolO; Caimi; Snxl9; Zbtb44; Etsl; Hspa8; H2ax; Bcl91; Ddx6; Apoal; Ube2q2; Pstpipl; Tle3; Anp32a; Cln6; Rpl4; Ppib; Nedd4; Elovl5; Tpbg; Plod2; Ppia; Copb2; Slco2al; Wdr82; Hyal2; Rhoa; Gpxl; Ip6k2; Shisa5; Map4; Cspg5; Epm2aipl; Ctdspl; Acaala; Rpsa; Ctnnbl; Rbm3; Rpl39; Lamp2; Gpc4; Pdzd4; Flna; Cmc4; Nexmif; Lrch2; Atp6ap2; Ube2a; Fmrl; Ssr4; Pgkl; Col4a5; Huwel ; Apls2; Pir; Arfgefl; Traml; Gls; Idhl; Iglbp5; Tnsl; Irsl; Col6a3; Per2; Hdlbp; Pam; Kdsr; Tmeml83a; Camsap2; Qsoxl; Soatl; Prrc2c; Atplbl; Ncstn; Hnmpu; Map4k4; Illrll ; Cflar; Cpsl; Cab39; Eif4e2; 43710; Pigr; Nucksl; Nuak2; Ppplrl5b; Plekha6; Etnk2; Phlda3; Rgsl6; Glul; Abl2; Dpt; Rgs5; Apoa2; Bpntl; Dse; Slc29a3; Eif4ebp2; Hkl; Ddx21 ; Arid5b; Agpat3; Pdxk; R3hdm4; Tmem259; Sbno2; Timml3; Nfic; Slcl6a7; Shmt2; Lrpl; Esytl; Mettl7b; Adat2; Map7; Sgkl; Pbld2; Ipmk; Ftcd; Pttglip; Sumo3; Midn; Reep6; Oazl; Zbtb7a; Eef2; Igfl; Dusp6; Ctdsp2; Rdhl6; Baz2a; Ankrd52; Ewsrl; Actr2; Ugp2; Ranbpl7; Aldh3a2; Chd3; Mpdul; Eif4al; Eif5a; Pfnl; Dhx33; Medl3; Dynll2; Msi2; Acsf2; Rab5c; Etv4; Dusp3; Lsml2; Ube2o; Nploc4; Arhgdia; Alyref; Pcyt2; Rfng; PuslO; Vdacl; Gm2a; G3bpl; Alkbh5; Speed; Trp53; Ywhae; Nufip2; Myol8a; Rhbdl3; Bcas3; Phosphol; Hoxb9; Laspi; Msll; FkbplO; Psme3; G6pc; Arl4d; Dcaf7; Ttyh2; 43717; Foxk2; Rhob; Lpinl; Rsad2; Soxl 1; Hectdl; Wdr89; Actnl; Tmed8; Selll; Foxn3; Serpinala; Clmn; Aktl; Sdc 1 ; Laptm4a; Pdia6; Pcnx4; Acot4; Acot3; Serpina3n; Pacs2; Wdr37; Sox4; Serpinb6a; Nrnl; Txndc5; Atxnl; Shc3; Dbnl; Pdlim7; Bhmt; Sv2c; Tnpol; Klf6; Nidi; Inhba; Slcl7a2; Bicd2; Dapkl; Arrdc3; Mocs2; Zcchc24; Bmprla; Ghitm; Prxl2a; Nedd8; Dpysl2; Slc25a37; Bmpl; Slc25a30; Akapl l; Dgkli; Vcl; Tasor; Sfmbtl; Pbrml; Matla; Mapklipll; Rnase4; Pabpnl; Khnyn; Mrpl57; Fgf9; Ctsb; Loxl2; Reep4; Dnajc3; Skp2; Trio; Rad21; Derll; Lratd2; Fam49b; Srtgall; Ago2; Dgatl; Rbfox2; Tmeml84b; Ddxl7; Josdl; Cbx6; Tcf20; Pricklel; Slc38al; Adcy6; Rndl; Kmt2d; Tubalb; Spryd3; Atp5g2; Cbx5; Zfp385a; Mucl2; Selenop; Nupl55; Prlr; MyolO; Dap; Cmbl; Efr3a; Micalll; Gtpbpl; Tnrc6b; Rbxl; Zc3h7b; Srebf2; Parvb; Pim3; Trabd; Pphlnl; Tmbim6; Gpdl; Atfl; Tns2; Iglbp6; Spl; Prrl3; Copzl; Usp7; Marfl; Ccdcll6; Ehhadh; Gap43; Gm4737; Alcam; Col8al; Paxbpl; Zbtb21; Dnaja3; Mapkl; Ap2ml; Eif4a2; Lpp; Opal; Pcytla; Mylk; Fstll; Lrrc58; Naa50; Cxadr; Son; Ets2; Tedc2; Capnl5; Zfp871; Rabl lb; Tnf; Slc29al; Khsrp; Myll2a; Srsf7; Slc8al; Pig; Zfp946; Rpusdl; Ergicl; Hmgalb; Mapkl4; Brpf3; Zfand3; Tapbp; H2-Q10; Epb4113; Lbh; Hbegf; Ndstl ; Pcyoxll; Lmanl; Tshzl; Bini; Ik; Sehll; Tcf4; Smad7; Rbm4; Rbml4; Gm21992; Banfl; Stipl; Slc3a2; Scgblal; Fads2; Fenl; Acta2; Pankl; Noc31; Aldhl8al; Hpse2; Scdl; Sh3pxd2a; Ccdcl86; Tmcml34; Nxfl; Alcf; Borcs7; Tcf712; McmlO; Dnajcl; Surf4; Gapvdl; Strbp; Atp5g3;

[0062] Ctnndl; Slc39al3; Madd; Prdmll; Cd44; 1700037H04Rik; Soxl2; Bcl211; E2fl; Eif6; Sdc4; B4galt5; Taf4; Didol; Sephsl; Ymelll; Edfl; Med27; Rapgefl; Ptpa; Prrc2b; Akl; Gsn; Rifl; Ssb; Ubr3; Ppplrlc; Ube216; Celfl; Ttneml27; Cdc25b; Cds2; Fkbpla; Csnk2al; Cbfa2t2; Raly; Trp53inp2; Epb4111; Rprdlb; Pigt; Cebpb; Rbm38; Tm4sfl; I16ra; Ubap21; Tars2; Ptgfrn; Hipkl; Ahcyll; Gstml; Pkn2; Car3; Sec62; Ttcl4; Pklr; Tpm3; Gatad2b; Selenbpl; Vps72; Cdc42sel ; Cers2; Sv2a; Rbm8a; Fmo5; Hmgcs2; Tbxl5; Nras; Dkk2; Uox; Fubpl; B4galtl; Tlnl; Tstd2; Acnatl; Mup3; Slc35dl; Cyp4al4; Nasp; Thrap3; Khdrbsl ; Phactr4; Pigv; Clic4; Srrml; Lypla2; Eloa; Pert; Kcnab2; Ski; Acol; Galntl2; Stxl7; Tmem38b; Nfia; Dhcr24; Gpbplll; Eya3; Camk2nl ; Capzb; Ubr4; Rcc2; Mrfapl; Wdrl ; Cnot61; Tgfbr3; Corolc; KctdlO; Mlec; Hspb8; Rnft2; Pitpnm2; Ncor2; Ubc; Eif4h; Pdgfa; Ttyh3; Hmgbl; Cdk6; Kcnk3; Dpysl5; Fosl2; Klf3; Rhoh; Uchll; Alb; Cxcll; Affl; Lrrc8d; Ube3b; Medl31; Slc8bl; Setdlb; Kmt5a; Castor2; Bazlb; Ache; Ephb4; Lfng; Wipi2; Fscnl; Pdk4; Ube2h; Mtpn; Kdm7a; Tmeml76b; Tgolnl; Reg3g; Duspll; Rab43; Sec61al; Plxnal; Iqsecl; Nup210; Adipor2; Atnl; Kenai; Ccnd2; Grin2b; Ipo8; Capza2; Arf5; Fine; Ahcyl2; Nrfl; Tmeml76a; Cbx3; Slc6a6; Ppp4r2; Jagnl; Cxcll2; Fbxll4; Ing4; Chd4; Clec2d; Ube2s; Selenow; Calm3; Erf; Kcnk6; Cox6bl; Usf2; Gramdla; Gpil; Scafl; Snrnp70; Nucbl; Mfge8; Iqgapl; Itpripl2; Ppp4c; Aldoa; Maz; Ifitm3; Slc25a22; Polr21; Ctsd; Tnfrsf22; Tnfrsf23; Cttn; Ccndl; Myadm; Cacng7; Leng8; Plaur; BC024978; Hnrnpl; Sbsn; Gm38999; Pde8a; Stard5; Rsfl; Numal; Mical2; Srcap; Hsd3b7; Pexl lg; Elavil; Col4al; Ido2; Adam9; Spcs3; Slc25a42; Upfl; Cmtm4; 4931428F04Rik; Hp; Glgl; Maf; Slc7a5; Actal; Map2k7; Mcf21; Tfdpl; Fgfrl; Pcml; Fatl; Acsll; Slc27al; Colgaltl; Sin3b; Herpudl; Cyb5b; Cox4il; Galnt2; Yapl; Zfp560; Dnmtl ; Vps26b; Ccdcl5; Arhgefl2; Rnf26; Kmt2a; Ube4a; Apoc3; Zbtbl6; Femlb; Mel; Syncrip; Srprb; Slc38a3; Dagl; Crtap; Acaalb; Ldlr; Nectinl; Thyl; Hyoul; Apoa5; Cspg4; Nptn; Pkm; Anxa2; Sltm; Paqr9; Amotl2; Slc25a20; Smarccl; Trakl; Lars2; Plp2; Suv39hl; Morf412; Tsc22d3; Ptchdl; Tmsb4x; Syp; Otud5; Usp9x; Cdkl6; Bgn; Atp6apl; Msn; Yipf6; Alas2; Ubqln2; Rps6ka3; Vamp7; Col5a2; Hspdl; Fzd5; Let; Tmcc2; Tiprl; Ephxl; 42063; Hsdl lbl; Sulfl; Pou3f3; Wdr75; Nif311; Fzd7; Map2; Igfbp2; Ttll4; Stkl lip; Utpl4b; Ugtlal; Lrrfipl; Scly; Gpcl; Reich; Adiporl; Zfp648; Serpincl;

[0063] Slcl9a2; Aldh9al; Olfml2b; Dedd; Fl lr; Pigm; Cnih4; Pex7; Argl; Afgll; Sobp; Serinci; Col6al; Coll8al; Sydel; Rnfl26; Btbd2; Mob3a; Ap3dl; Ncln; Slc25a3; Amdhdl ; Rab21 ; Tmeml9; Lemd3; Mbd6; Nab2; Gdfll; Hivep2; Ptprk; Traf3ip2; Wasfl ; Cdl64; Cd24a; Pcdhl5; Bcr; Atp5d; Scamp4; Sf3a2; Smim24; Gns; Atp5b; Smarcc2; Cd63; Purb; Rars; Csf2; Pemt; Srebfl ; Slc47al; Kdm6b; Dnah2; Senp3; Polr2a; Pelpl; Serpinfl; Serpinf2; Cpd; Tnfaipl; Utp6; Nme2; Abcc3; Nrldl; Ccr7; Slc4al; Slc25a39; Kifl8b; Ernl; Abca6; Fads6; Trim47; Mrpl38; Usp36; Dcxr; Zmiz2; Igfbpl; Spata48; Fancl; Nudcd2; Slu7; Rnfl45; Mgatl; Tbcld9b; Clk4; 9530068E07Rik; Irfl; Acsl6; Gpx3; H2aw; Triml7; MyhlO; Perl; Ctdnepl; Mybbpla; Slc43a2; Crk; 2610507Bl lRik; Poldip2; Suzl2; Lig3; Ap2bl; Vezfl; Lrrc59; Hoxb3; Vps25; Adaml l; Mrc2; Tmem94; Rnf213; Gcgr; Gdf7; Tpo; Foxal; Aldh6al; TmedlO; Ttc7b; Serpinalb; Serpinald; Serpinalc; Serpinale; Apob; Kidins220; Pxdn; Sypl; Twistnb; Tmxl; Syne2; Mthfdl; Smocl; Acot2; Acotl; Acot6; Bdkrb2; Hecwl; Gprl41b; Hlf5; H2acl l; H2bc9; H2ac8; H2ac6; H3c3; Uqcrfsl; Gcm2; Faml20a; Ltnan2; Iscal; Cts8; Fbpl; Ctsl; led; F2r; Ankddlb; Pik3rl; Zswim6; I131ra; H2acl3; H2bcl5; Histlh4m; H2bcl2; H2acl0; H3c7; H2ac7; H3c2; Gpldl; Nqo2; Tmed9; Gfm2; Plk2; Cadps; Psmd6; Zfp5O3; Itihl ; Gnl3; Stabl ; Nisch; Zfhx2; Tm9sfl ; Gata4; Ptk2b; Nefm; Adam28; Pcdh8; Stk24; Atxn7; Zswim8; Arf4; Itih4; Rpgripl; Mmpl4; LrplO; Shisa2; Sacs; Clu; Vwa8; Kbtbd7; Slainl; Farpl; Tm9sf2; Mtssl; Oplah; Fbxl6; Zfp251; Zfp647; Tmprss6; Cyp2dl0; Plxnb2; Lmf2; WntlOb; Tubala; Fignl2; Itga5; Pkhdlll; Tribl; Mapkl5; Grina; Cycl; Rpl8; Kctdl7; Eif31; Tspo; Shank3; Smgc; Tubalc; Dip2b; Mfsd5; Hnrnpal; Adcy9; Litaf; Pdxdcl; Pi4ka; Maspl; Atpl3a3; Umps; Slc49a4; Casr; Phldb2; Cep97; Zfp654; Synjl; Rcanl; Glis2; Vasn; Abeel; Hrg; Osbplll; Cpox; Cldndl; Slc22al; Vmn2rll l; Tnfrsfl2a; Paqr4; Tbcld24; Mapk8ip3; Pigq; AI413582; Tff2; Sikl; H2-K1; Slc39a7; C4b; Skiv21; Cft>; Prrc2a; 2 10061104 Rik; Tmetnl51b; Gnmt; Mydgf; Slc25a23; Fbxll7; Haao; Abcg5; Lrpprc; Mcfd2; Scaf8; Abca3; Ecil; Rps2; Clcn7; Bnipl; Cyp4fl5; Agpatl; Ehmt2; Vars; H2-Q7; lert; Man2al; Washcl; Lpin2; Spast; Ltbpl; Criml; Ppmlb; Sft2d3; Reep5; Brd8; Spata24; Dndl; Ppic; Gm4841; Atp9b; Gata6; Dsglc; Dsgla; Galntl; Delel;

[0064] Sh3tc2; Acaa2; Lrp5; Tcirgl; Rad9a; Pcnx3; Prdx5; Tkfc; Cd6; Tmeml32a; Myof; Rbp4; Cyp2c68; Cyp2c40; Pdzd7; Eif3a; Rnaseh2c; Ganab; Eeflg; Pten; Cyp2c50; Cnnml; Abcc2; Scd4; Tlxl; Wbpll; Slcl8a2; Arhgap21; Cacnalb; Sardh; Fpgs; Stk39; Abcbl l; Ttn; Cerkl; Nckapl; Ptprj; Ndufs3; F2; Cd82; Rpapl; Ubrl; Fbnl; Snrpb; Acssl; Trpc4ap; Sulf2; Ctsz; Lama5; Helz2; Otudl; Anapc2; Pmpca; Torlb; Tbrl; Sp9; Lgr4; Snmp200; Sec23b; Scrt2; Bpifal; Nnat; Hnf4a; Csell; Limel; Phc3; Ssrt; Tdo2; Fgb; Kirrel; Bglap3; Bglap2; Sema4a; Ints3; Sprrla; Psmb4; MovlO; Kcnc4; Mttp; Migal; Ptx3; Fgg; Fga; Ssrt; Arhgef2; Slc39al; Hrnr; Notch2; Frrsl; Adhl; Selenof; Mos; Pigo; Gne; Arnbp; Cyp2j6; Cpt2; Zygl lb; Plk3; Ybxl; Map7dl; Tekt2; Tinagll; Serinc2; Aridla; Kdmla; Epha8; Pinkl; Car6; Tmem64; Npr2; Foxel; Tmeffl; Leprot; Plpp3; Txndcl2; Cyp4al2a; Cyp4al0; Cyp4a32; Hectd3; Slc2al; Pabpc4; Yrdc; Gpn2; Hspg2; Ddost; Cplane2; Clstnl; Nphp4; Wrap73; Ccnl2; Dhrsx; Cyp51; Rsbnll; Otof; Preb; Nopl4; D5Ertd579e; Adgra3; Ugt2b34; Grsfl; Ge; Naaa; Antxi'2; Hsdl7bl l; Tmed5; Cmklrl; Cox6al; Suds3; Tpcnl; Erp29; Scarbl; Asl; Gnb2; Mcm7; Prkarlb; E130309D02Rik; Usp42; Slc7al; Hgf; Abcb8; Cct811; Tmem214; Cad; Gckr; Tmem33; Slain2; Gpat3; Pkd2; Mnl; Sppl3; RplpO; Genl; Sds; Atxn2; Atp6v0a2; FzdlO; Plod3; Gigyfl; Eif3b; Bri3; Arpcla; Brca2; KI; Ponl; Klrg2; Braf; Gm2663; Tcafl; Pdia4; Lrigl; Plxndl; Pex5; Ncapd2; Ndufa9; Pzp; Dennd5b; Cavl; Mklnl; Zyx; Serbpl; St3gal5; Retsat; Urocl; Zxdc; K1115; Aldhlll; Fbln2; Arl6ip5; Edeml; Mugl; Mug2; Phb2; Nop2; Gprc5a; Mgstl; Slcolb2; Fizl; Vmnlr56; Psg25; Vasp; Clptml; Apoc2; Rabacl; Axl; Ltbp4; Samd4b; Capnsl; Hamp2; Hamp; Fxydl; Scgb2b26; Uba2; Ptovl; Med25; Aldhl6al; Trpm4; Emp3; Abcc6; Nr2f2; Slco3al; Idh2; Pcfl 1; Inppll; Hpx; Dennd5a; Atp2al; Atxn21; Tmem219; Sephs2; Cox6a2; Nsmce4a; Oat; Tollip; Tsen34; Rps9; Trim28; Ligl; Napa; Slc8a2; Tmeml60; Dact3; Mypop; Megf8; Cyp2a5; Yiflb; Prodh2; Scgblb27; Pepd; Ctul; Shankl; Kcnc3; Gysi; Bcat2; Kdelrl; Chsyl; Prcl; Mex3b; Lrrc32; Rbmxl2; Eif3f; Rbbp6; D430042009Rik; Fbrs; Fbxll9; Setdla; Bag3; Bub3; Jakmip3; Nlrp6; Ikbkb; Cpe; Gdfl5; Ifi30; Nr2f6; Abhd8; Cheip; Smadl; Tecr; Adgre5; Naccl; Itfgl; Ceslb; Ceslc; Cesle; Ceslf; Ccdcl02a; Cdhl l; Bcarl; Ttcl3; Abhdl3; Col4a2; Kat6a; Plpp5; Saraf; Atpl3al; Cersl; Fkbp8; Myo9b; 1700067K01Rik; Wdr83os; Mtl; Tat; Aars; Exosc6; Zfp469; Zc3hl8; Cdtl; Tubb3; MaplO; Map3k21; Nrpl; Tmem205; Stt3a; Pknox2; Cbl; Cypla2; Neol; Arihl; Eeflal; Alasl; Apeh; Ptpn23; Pthlr; Stt3b; ScnlOa; Smarca4; Hepacam; Slc37a4; Sik3; Gm4894; Poglut3; lsl2; Herd; Gclc; Sh3bgrl2; Tmemll5; Qars; Uqcrcl; Plxnbl; Scap; Dyncllil; Limdl; Irs4; Ubal; Pgrmcl; Slc25a5; Rnfl l3al; Zxdb; Foxo4; Gjbl; Map7d2; and Rbbp7.

[0065] TABLE 5

[0066] EXAMPLES

[0067] EXAMPLE 1

[0068] Actl propels chemoresistance by modulating redox homeostasis via epitranscriptomic regulation of antioxidant RNA metabolism

[0069] The IL- 17 receptor adaptor molecule Actl, an RNA binding protein, plays a critical role in IL-17-mediated cancer progression. Here we report a novel mechanism for how IL- 17 / Actl induces chemoresistance by modulating redox homeostasis through epitranscriptomic regulation of antioxidant RNA metabolism. Transcriptome-wide mapping of direct Actl -RNA interactions revealed that Actl binds to the 5'UTR of antioxidant mRNAs and Wilms' tumor 1-associating protein (WTAP), a key regulator in m6A methyltransferase complex. Strikingly, Actl's binding sites are located in proximity to m6A modification sites, which allows Actl to promote the recruitment of elF3G for capindependent translation. Loss of Actl ’s RNA binding activity or Wtap knockdown abolished IL-17-induced m6A modification and translation of Wtap and antioxidant mRNAs, indicating a feedforward mechanism of Actl -WTAP loop. We then developed antisense oligonucleotides (Wtap ASO) that specifically disrupts Actl’s binding to Wtap mRNA, abolishing IL-17 / Actl-WTAP-mediated antioxidant protein production during chemotherapy. Wtap ASO substantially increased the antitumor efficacy of cisplatin, demonstrating a therapeutic strategy for chemoresistance.

[0070] We hypothesize that transcriptome-wide mapping of direct Actl -RNA interactions may yield novel effector molecules for molecular pathogenesis of IL-17-mediated cancer progression, implicating new therapeutic targets for anti-cancer therapies. We report here that transcriptome-wide mapping of direct Actl -RNA interactions in vivo revealed that Actl binds in high density to the 5'UTR of a set of transcripts including antioxidant mRNAs and Wilms' tumor 1-associating protein (WTAP), a key regulator in m6A methyltransferase complex. IL- 17 stimulation induced the expression of these 5'UTR Actl -targets at the protein levels without detectable impact on the mRNA levels. Previous studies have reported that regulatory elements in the 5’UTR may modulate protein translation both in cap-dependent or cap-independent manner49, 50. Importantly, while cap-independent translation is initiated under aberrant stress conditions such as cancer, 5' UTR m6A-methylation has been shown to promote cap-independent translation during cancer progression51-53. Interestingly, we found that Actl's binding sites are located in proximity to m6A modification sites on the 5'UTRs of Actl targets, including Wtap and antioxidant mRNAs. This allows Actl to promote the recruitment of elF3G's binding to m6A sites of Wtap and antioxidant mRNAs to drive their cap-independent translation in cancer cells. Loss of Actl ’s RNA binding activity or Wtap knockdown abolished IL-17-induced m6A modification and translation of Wtap and antioxidant mRNAs, indicating a feedforward mechanism of Actl -WTAP loop. We then developed antisense oligonucleotides (Wtap ASO) that specifically disrupts Actl’s binding to Wtap mRNA, abolishing IL-17 / Actl-WTAP-mediated antioxidant protein production during chemotherapy. Furthermore, WTAP ASO was efficacious in promoting cisplatin-mediated cancer cell killing with enhanced ROS. The results unravel a novel mechanism by which IL- 17 induces chemoresistance by modulating redox homeostasis through epitranscriptomic regulation of antioxidant RNA metabolism and their cap-independent translation. Importantly, WTAP ASO was indeed able to robustly enhance the antitumor efficacy of cisplatin in mice, demonstrating a novel therapeutic strategy to sensitize cancer cells to chemotherapy.

[0071] Results

[0072] Transcriptome- wide mapping of Actl-RNA interactions defines direct targets and binding sites of Actl

[0073] It was previously shown that the SEFIR domain of Actl, an IL- 17 receptor complex adaptor, directly binds stem-loop RNA structures at the 3’ untranslated region (3 ’UTR) of inflammatory mRNAs (e.g., Cxcll) to stabilize them and promote their translation in response to IL-17 stimulation44. To identify Actl-binding sites at high resolution in a transcriptome-wide manner, we performed Cross-Linking and Immunoprecipitation in combination with next-generation sequencing (CLIP-seq). Mouse embryonic fibroblasts (MEF) stably expressing FLAG-tagged Actl were UV-crosslinked. Immunoprecipitated radio-labeled Actl-RNA complexes were ribonuclease- treated and separated by SDS- polyacrylamide gel electrophoresis (PAGE) (Fig. 8A). The purified Actl-RNA complexes were then subjected to protease digestion, from which peptide remnants cross-linked to the RNA cause the reverse transcriptase to pause in the library preparation step, thereby allowing for the identification of cross-link sites at single- nucleotide resolution. We identified 75609 genomic coordinates with overlapping CLIP reads from at least 2 out of 3 biological replicates (Fig. 1A). Importantly, Actl CLIP reads in the 3’UTR of Cxcll, Cebpb and Hifla indeed overlap with the Actl binding sites previously identified by in vitro RNA-binding assays and mutagenesis (44-47-54and Fig. 8B).

[0074] While it has been well documented that IL- 17- Actl modulates mRNA metabolism via the regulatory sequences at the 3’UTR, it is interesting to note that there is a substantial enrichment of Actl -binding sites in the 5’UTR of its target transcripts (Fig. IB). Despite the fact that the average length of 5’UTR is much shorter compared to the 3’UTR, Actl has a higher binding density on the 5’UTR than that on 3’UTR (Fig. 1C). We performed hexamer enrichment analysis against all possible hexamers (4096 in total) and found that the top enriched hexamers in the Actl binding sites are distinct for 3’UTR (AU-rich) versus 5’UTR (GC-rich) (Fig. ID). In most cases, Actl binds dominantly to either the 5’UTR or 3’UTR of the transcripts. Strikingly, whereas inflammation-related GO terms are enriched for 3’UTR targets of Actl, the 5’UTR targets are enriched for mRNAs encoding proteins important for mRNA processing (such as Wtap, a key regulator in m6A methyltransferase complex), redox homeostasis (including antioxidant proteins Prdx2, Txnl, and Sodl), cellular stress and DNA damage repair (Fig. IE, Fig. 8C). These results suggest that functionally different cohorts of mRNAs might be subject to specific modes of Actl binding and regulation.

[0075] Actl’s binding to the 5’UTR of Wtap and antioxidant mRNAs promotes their capindependent translation

[0076] Analysis of CLIP in combination with RNA sequencing data indicated that a group of 5’UTR targets with robust binding of Actl in CLIP were barely induced by IL- 17 at the mRNA levels, including important genes for mRNA processing (such as Wtap) and antioxidants (Prdx2, Txnl and Sodl) (Fig. 2A-B and Fig. 8D). Actl’s binding to these 5’UTR targets were validated by RNA electrophoretic mobility shift assay (REMSA) and RNA immunoprecipitation (Fig. 2C and Fig. 8E). Several critical questions arose from these observations: Does the binding of Actl to the 5’UTR targets play a role in the protein translation of these mRNAs? If yes, what is the mechanism of regulation? What is the functional impact of such regulation?

[0077] Previous studies have implicated that 5’ untranslated region (UTR) of mRNA can impact translation initiation, and therefore, the amount of protein produced from each mRNA50. IL-17 treatment markedly induced the expression of Actl’s 5’UTR targets (Wtap, Prdx2, Txnl and Sodl) at the protein levels, but not at the RNA levels (Fig. 2D and Fig. 8G). Ribosomal fractionation of Actl' / _cells reconstituted with Actl WT or Actl ASEF1 (RNA binding mutant) indicated that Actl RNA binding activity is necessary for IL- 17- induced shift of the transcripts of WTAP and antioxidants to the actively translating fractions (Fig. 2E). Taken together, these results suggest that the binding of Actl to the 5’UTR targets plays a critical role in driving the translation of these target mRNAs. Notably, IL-17 induced the expression of these Actl’s 5’UTR targets at the protein levels (without altering RNA levels) in various cancer cell lines including PDVC57 (Mouse skin SCC cell line), M0C1 (Mouse Oral Cancer 1) cell line derived from squamous cell carcinoma of the mouse oral cavity and human A431 epidermoid carcinoma cell line (Fig. 8F-G, 11F-G). By performing Actl RNA immunoprecipitation, we indeed detected IL-17-induced robust binding of Actl to these 5’UTR targets in multiple cancer cell lines (Fig. 9E). Since IL- 17 signaling plays a critical role in tumorigenesis and resistance to anti-cancer therapies, the findings here implicate a potential functional impact of this newly discovered IL-17 / Actl ’s regulated mRNA cohort in cancer. In support of this, WTAP expression was significantly elevated in human skin tumor tissue containing high number of IL-17A-producing cells (IL-17A high) compared to human skin tumor tissue containing low number of lL-17A-producing cells (1L- 17A low) (Fig. 9A-B).

[0078] Regulatory elements in the 5’UTR may modulate protein translation both in capdependent or cap- independent manner49, 50, 52. To study the mechanism of IL-17-induced translation of Actl 5’UTR targets, we used rapamycin to block cap-dependent translation55, 56in MEFs containing either Actl WT or Actl ASEF1 mutant (loss of Actl-RNA binding). We found that IL-17-induced expression of WTAP and antioxidants (Prdx2, Txnl, and Sodl) was not inhibited by rapamycin in Actl WT cells (Fig. 3A), implicating a potential role of capindependent translation for the induction of these proteins. On the other hand, IL-17-induced expression of WTAP and antioxidants was greatly diminished in Actl-ASEFl cells (Fig. 3A), indicating the importance of Actl ’s RNA binding activity for IL-17-induced translation of these Actl’s 5’UTR targets. As a control, we showed that rapamycin substantially inhibited IL-17-induced Arid5a translation, supporting that IL- 17 induced Arid5a expression is capdependent as previously reported (Fig. 3A)57. Moreover, knocking down eIF4E (required for Cap-dependent translation) substantially inhibited IL-17-induced Arid5a translation, but had no impact on IL-17-induced translation of these Actl’s 5’UTR targets (Fig. 9C).

[0079] Bicistronic reporter system (including Renilla-Luc and Firefly-Luc reporters) is designed to measure cap-independent translation. In this system, Renilla-Luc is translated via a cap-dependent mechanism, but the downstream Firefly-Luc relies solely on the intergenic region for translation (cap-independent translation). To study IL-17-induced cap-independent translation, we cloned 5’UTRs of Prdx2, Txnl, SOD1, Arid5a, and WTAP into the intergenic region of bicistronic reporter system (Fig. 3B). We found that IL- 17 stimulation increased the ratio of Firefly (cap-independent) over Renilla (cap-dependent) luciferase activity, indicating that these 5’UTR regions have the ability to drive IL-17-induced cap-independent translation (Fig. 3B). Moreover, IL-17-induced cap-independent translation was abolished by the loss of Actl RNA binding activity (Actl ASEF1) (Fig. 3B). By ribosomal fractionation experiment, we showed that IL- 17 induce the shift of antioxidant mRNAs to actively translating fractions in Actl WT cells, but not Actl ASEF1 cells (Fig. 3C). Consistently, rapamycin failed to block IL-17-induced shift of Wtap and antioxidant mRNAs to actively translating fractions in M0C1 (Mouse Oral Cancer 1) cell line (Fig. 9D). Taken together, these results suggest that Actl ’s RNA binding activity is required for IL- 17 induced cap-independent translation of WTAP and antioxidant proteins mRNAs.

[0080] IL-17 induces m6A methylation and translation of Actl 5’UTR targets in a Wtap- dependent manner

[0081] Cap-independent translation is initiated under aberrant stress conditions such as cancer, under which cap-dependent translation is often downregulated58-61. It is plausible that IL- 17 signaling, known to play a critical role in cancer progression, induces the expression of WTAP and antioxidants via cap-independent translation for cancer cells to cope with stress thereby promoting cell survival. Therefore, it is important to investigate the molecular mechanism for how IL- 17 signaling turns on cap-independent translation of these Actl ’s 5’UTR targets with antioxidation function. The initiation of cap-independent translation requires functional intrinsic elements such as methylated A residues located within 5’UTR52,53. By comparing our CLIP data with several published MeRIP-seq database62-64, we found that Actl binding sites are located in proximity to m6A sites on Actl’s 5’UTR targets, but not on 3’UTR targets (Fig. 4A and Fig. 10A). Strikingly, m6A sites in the 5’UTRs of Wtap, Sodl, Prdx2 and Txnl transcripts are all located in regions that are within lOnt of CLIP identified Actl binding sites (Fig. 4A and Fig. 10A). Furthermore, mRNA encoding Wtap, a major component of m6A methyltransferase complex, is robustly bound by Actl in the 5’UTR (Fig. 1); and Wtap is upregulated by IL-17 / Actl axis via a cap-independent manner (Fig. 2-3). These observations led us to propose the potential impact of IL-17 / Actl-WTAP axis on m6A- methylation of Actl ’s 5’UTR targets to trigger their cap-independent translation.

[0082] By methylated (m6A) RNA immunoprecipitation (MeRIP), we found that IL-17 stimulation was able to induce m6A methylation in the 5’UTR of Wtap (Fig. 4B) and antioxidant mRNAs in M0C1 cancer cells (Fig. 4C), which can be impaired by Wtap depletion (Fig. 10B). Consistently, Wtap depletion diminished IL-17-induced shift of antioxidant mRNAs to actively translating ribosomes as well as their IL-17-stimulated protein expression (Fig. 4D-E and Fig. 10C-E). Taken together, these results indicate that Wtap is required for IL-17-induced m6A methylation of antioxidant mRNAs and their translation. In support of this, bicistronic assay showed that Wtap depletion inhibited IL- 17- induced cap-independent translation of antioxidants (Fig. 4F).

[0083] We next examined the potential impact of Actl ’s RNA binding activity on IL-17- induced m6A methylation. Interestingly, we found that loss of Actl RNA biding (ASEF1) activity also diminished m6A methylation of Wtap and antioxidant mRNAs (Fig. 4B-C). Consistently, Actl ’s RNA binding activity is indeed required for their lL-17-induced capindependent translation of Wtap and antioxidant mRNAs (Fig. 2 and 3). Taken together, either loss of Actl’s RNA binding activity or Wtap knockdown abolished IL-17-induced m6A modification (Fig. 4B-C) and translation of Wtap and antioxidant mRNAs (Fig. 4D), indicating a feedforward mechanism of Actl -WTAP loop.

[0084] Wtap ASO inhibits Actl binding to Wtap mRNA and diminishes IL-17-induced m6A methylation of the Actl 5’UTR targets.

[0085] Our results implicate a critical feedforward loop of IL-17-Actl-WTAP in driving IL- 17 -induced m6A methylation of Actl’s 5 UTR targets and their cap-independent translation. To disrupt this Actl-WTAP feedforward loop, we developed chemically modified RNA antisense oligonucleotides (ASO) to effectively block Actl binding to Wtap mRNA. We designed 4 AS Os with sequences complementary to the Actl binding region in the WTAP 5’UTR identified in CLIP experiment as well as a control ASO. Actl -Wtap complex was efficiently disrupted with increasing amounts of W3 and W4 ASO added, whereas W1 , W2 and control ASO failed to inhibit Actl binding to Wtap 5’UTR (Fig. 5A and Fig. 11A).

[0086] Since W4 ASO represents a unique sequence through blasting without forming any secondary structure, W4-AS0 was selected for further validation. We performed a footprinting experiment to further map the binding site of Actl on Wtap 5’UTR and to determine how the Wtap ASO disrupts this interaction. The 5 '-end-labeled WTAP probe alone or together with ASO was incubated in the absence or presence of purified Actl (Fig. 5B). The reactions were then partially digested with RNases T1 or A as indicated. The GC- rich Wtap 5’UTR forms a two stem-loop structure. The addition of purified Actl protein protected the top stem-loop of Wtap probe from RNases T1 or A digestion indicating this region is bound by Actl (marked in green line in the graph). Importantly, Wtap ASO sensitized RNases T1 or A digestion of the Actl’s binding site even in the presence of purified Actl protein, while ASO’s complementary sequence on Wtap probe was protected from RNases T1 or A digestion (marked in red line in the graph). These results unequivocally indicated that Wtap ASO is able to bind to its complementary sequence, which may result in the structural change of Wtap 5’UTR thereby blocking the binding of Actl to Wtap RNA (Fig. 11B).

[0087] To examine the impact of Wtap ASO on IL-17-induced Wtap and antioxidant protein expression, Wtap ASO and control ASO were modified with 2'-M0E and phosphonothioate linkage to enhance their nuclease resistance (Fig. 5A) and transfected into M0C1 cells. We found that Wtap ASO substantially diminished IL-17-induced m6A methylation (Fig. 5E) and expression (Fig. 5C and Fig. 11D) of WTAP and antioxidant mRNAs, which were restored by overexpression of WTAP. As a control, we showed that IL-17-induced Arid5a protein expression was not altered by Wtap ASO (Fig. 5C and Fig. 11D). It is important to note that both REMSA and Actl RNA immunoprecipitation showed that WTAP ASO does not block the binding of Actl to antioxidant mRNAs, indicating the specific inhibition of Wtap ASO on Actl ’s binding to Wtap mRNA (Fig. 5D and Fig. 11C). Of note, the 5’UTR of WTAP is highly conserved between human and mouse. We found that human WTAP-ASO (h_WTAP- ASO) was indeed able to block Actl binding to human Wtap mRNA (Fig. HE) and diminish IL-17-induced expression of WTAP and antioxidant proteins (Fig. 11F-G) in A-431 (a human epidermoid carcinoma cell line). Together, these results suggest that the specific disruption of Actl’s binding to Wtap mRNA using Wtap ASO diminished IL-17-induced expression of Wtap, thereby abating IL-17-induced m6A modification and translation of antioxidant mRNAs in cancer cells.

[0088] Wtap ASO attenuates the recruitment of eIF3G to the Actl 5’UTR targets for capindependent translation

[0089] The biological functions of m6A sites are mediated by different RNA binding proteins called m6A “readers” which recognize the methylated adenosine. Previous studies have demonstrated that m6A sites in 5' UTR can promote cap-independent translation via recruitment of the eukaryotic initiation factor 3 (eIF3) which acts as m6A “reader”52, 63. Our mass spectrometry analysis of Actl-immunoprecipitates66, 67showed that IL- 17 stimulation induced Actl’s association with several translation initiation factors, including eIF3G. Consistently, Actl coimmunoprecipitation in M0C1 cells with and without RNAse treatment showed that IL-17-induced Actl ’s interaction with eIF3G was RNA dependent (Fig. 11H). WTAP ASO was able to effectively abolish IL-17-induced Actl ’s interaction with eIF3G (Fig. 5F), implicating the potential role of m6A site for this interaction. By performing eIF3G RNA immunoprecipitation (RIP), we found that IL- 17 stimulation indeed induced the association of eIF3G with the mRNAs of Wtap and antioxidants (Prdx2, Txnl, SOD1), but not with Arid5a mRNA (Fig. 5G). Importantly, both loss of Actl’s RNA binding activity and WTAP ASO abolished the recruitment of eIF3G to the Actl 5’UTR targets (Fig. 5G and 5H). These results suggest that IL-17-induced Actl’s binding to the 5’UTR targets in the proximity of m6A sites may promote the recruitment of eIF3G to these sites, thereby driving cap-independent translation of the Actl 5’UTR target mRNAs (Fig. 51).

[0090] IL-17 / Actl-Wtap axis renders MOC1 resistance to cisplatin through m6A methylation and cap-independent translation of antioxidation proteins

[0091] IL- 17 signaling plays a critical role in cancer progression and resistance to anti-cancer therapies for a variety of solid tumors in human68-73. However, the molecular and cellular mechanism for IL-17-driven cancer progression remain unclear. Our results here showed that IL- 17 stimulation induces m6A methylation of Wtap and antioxidant mRNAs, driving their active translation in cancer cells. While accumulating evidence suggests that m6A RNA methylation plays a critical role in cancer progression74-76, antioxidant proteins, including Prdx2, Txnl and Sodl, are known to contribute to tumor chemo-resistance, including cisplatin-based neoadjuvant chemotherapy77-78. Cisplatin is a platinum-based chemotherapy drug, commonly utilized in the treatment of solid tumors. Besides inducing DNA damage, cisplatin mechanism of action involves the generation of the oxidative stress79and inhibit cellular translation80. Notably, canonical, cap-dependent initiation of translation can often be inhibited by oxidative stress and reactive oxygen species81. On the other hand, non-canonical, cap-independent regulation of translation initiation often continues to operate under oxidative stress81. Based on these findings, we hypothesize that IL- 17 signaling may render resistance of cancer cells to cisplatin-based chemotherapy via m6A methylation of Wtap and antioxidant mRNAs and their consequent cap-independent protein translation in cancer cells.

[0092] To test this hypothesis, we examined the impact of IL-17 / Actl-Wtap axis on the responsiveness of MOC 1 (Mouse Oral Cancer 1 ) cells to cisplatin treatment. While cisplatin efficiently induced cell death in M0C1 cells, IL- 17 stimulation induced resistance of M0C1 cells to cisplatin- mediated cell killing (Fig. 6A). Moreover, cisplatin- induced ROS levels were substantially reduced in M0C1 cells treated with IL- 17, which is consistent with IL- 17- induced expression of antioxidant proteins in cancer cells (Fig. 2F and Fig. 6B).

[0093] Furthermore, whereas cisplatin substantially diminished IL-17-induced ARID5a expression (cap-dependent translation), cisplatin did not affect IL-17-induced m6A methylation and protein induction of Wtap and antioxidants (Prdx2, Txnl, and Sodl) (capindependent translation) (Fig. 6C-D). Moreover, Wtap depletion was able to diminish IL- 17- induced expression of antioxidant proteins (Prdx2, Txnl, and Sodl) in cisplatin-pretreated M0C1 cells, which was accompanied by increased cisplatin- mediated cell death (Fig. 6E, Fig. 12A-B). Taken together, these results suggest the importance of WTAP-mediated m6A methylation in cap-independent translation of antioxidant proteins in conferring IL- 17- induced resistance to cisplatin-mediated cell killing.

[0094] To disrupt this Actl-WTAP feedforward loop, we developed Wtap ASO to effectively block Actl binding to Wtap mRNA and Wtap translation, resulting in attenuation of Wtap- mediated m6A methylation and cap-independent translation of antioxidant proteins. We then examined the efficacy of Wtap ASO in sensitizing IL-17-treated M0C1 cells to cisplatin treatment. Wtap ASO was indeed able to effectively enhance cisplatin-mediated cell death and ROS levels in IL-17-treated M0C1 cells compared to control ASO (Fig. 7A-B). Consistently, Wtap ASO substantially decreased IL-17-induced expression of antioxidant proteins in cisplatin-treated MOClcells, which was accompanied by increased caspase 3 cleavage (cell apoptosis) (Fig. 7C).

[0095] Based on the potent efficacy of Wtap ASO in cell culture model, we then tested the effect of Wtap ASO on tumor growth in cisplatin-treated mice bearing M0C1 tumors (Fig. 7D-J). M0C1 cells were injected into flanks of wild type C57BL / 6 mice; 10 days later, mice were randomized into treatment groups and subjected to cisplatin treatments in combination with either WTAP ASO or Control ASO for 21 days (Fig. 7D). Our control groups showed that cisplatin treatment increased IL- 17 expression in the tumor tissue (Fig. 7G). Knockdown of Actl in M0C1 cells sensitized them to cisplatin-mediated suppression of tumor growth, confirming the critical role of IL-17 / Actl axis in rendering tumor cells resistance to cisplatin treatment (Fig. 12C-E). Importantly, intratumoral injection of Wtap ASO substantially enhanced cisplatin-mediated suppression of tumor growth (Fig. 7E-F, Fig. 12F).

[0096] Immunofluorescence and immunohistochemistry staining showed increased cleaved- caspase 3 in tumors treated with Wtap ASO (Fig. 7H-I), indicative of increased cell apoptosis. The observed increased cell apoptosis in tumors treated with Wtap ASO was confirmed by in situ Tunel Assay (Fig. 7 J). Western analysis confirmed elevated cleaved- caspase 3 and decreased expression of WTAP and antioxidants in Wtap ASO-treated tumors (Fig. 7K), which was accompanied by increased 4-Hydroxynonenal levels (indicative of oxidative stress) in these cisplatin-sensitive tumors (Fig. 7M). Notably, Wtap RNA level in tumors was not altered by Wtap ASO treatment indicating that Wtap ASO mainly inhibited Wtap mRNA translation (Fig. 7L). Taken together, these results demonstrated specific inhibitory effect of Wtap ASO on protein expression of WTAP and antioxidants thereby rendering sensitivity of tumor cells to cisplatin-mediated tumor suppression.

[0097] Compelling epidemiological evidence presented the association of higher levels of IL- 17 with worse prognoses for a wide range of malignancies, with chemotherapy as standard of care1-8, 10 12 14, 82-84, including head neck SCC2 83, 84, colorectal cancer10, 85-87and liver cancer11, 14, 88, 89. Several studies have implicated IL- 17 in the development of chemoresistance87, 90-92, although the mechanism remains unclear. Here we report a novel mechanism for how IL- 17 induces chemoresistance by modulating redox homeostasis through epitranscriptomic regulation of antioxidant RNA metabolism and their capindependent translation. This process is driven by Actl (the adaptor protein of IL- 17 receptor) that has specific and select RNA binding to the 5'UTR of a set of transcripts including antioxidant mRNAs and WTAP (a modulator of m6A methyltransferase complex). Loss of Actl’s RNA binding activity or Wtap knockdown abolished IL-17-induced m6A modification and translation of Wtap and antioxidant mRNAs, suggesting a functional Actl- WTAP loop. We developed chemically modified RNA antisense oligonucleotides (ASO) complementary to the Actl binding region in the WTAP 5’UTR. REMSA, footprinting and RNA immunoprecipitation analyses unequivocally indicated the specific inhibition of Wtap ASO on Actl’s binding to Wtap mRNA. The specific disruption of Actl’s binding to Wtap mRNA using Wtap ASO reduced antioxidant protein production during cisplatin-mediated cancer cell killing, which robustly enhanced the antitumor efficacy of cisplatin in mice, indicating a novel therapeutic strategy for chemoresistance.

[0098] IL- 17 signaling pathway plays a critical role in the pathogenesis of autoimmune disorders and cancer progression. We previously reported that the SEFIR domain of Actl, an IL- 17 receptor complex adaptor, directly binds stem-loop RNA structures at the 3’ untranslated region (3’UTR) of inflammatory mRNAs including Cxcll to stabilize them and promote their translation in response to IL- 17 stimulation. In this example, we performed transcriptome-wide mapping of direct Actl -RNA interactions via Cross-Linking and Immunoprecipitation (CLIP), revealing that Actl binds in high density to the 5'UTR of a cohort of transcripts distinct from Actl’s 3’UTR targets. Whereas inflammation-related GO terms were enriched for 3’UTR targets of Actl, the 5’UTR targets were enriched for mRNAs encoding proteins important for cellular stress, protein translation regulation and redox homeostasis. Hexamer enrichment analysis indicated that the Actl binding sequences are distinct (AU-rich versus GC-rich) for the 3’UTR versus 5’UTR targets, implicating differential regulatory mechanism of Actl for 3’UTR and 5’UTR targets. Strikingly, Actl’s binding sites are located in proximity to m6A modification sites on the 5'UTRs of Actl targets (but not on 3’UTR targets), which may play a critical role in allowing Actl to promote the recruitment of elF3G's binding to m6A sites for cap-independent translation of the Actl 5’UTR targets.

[0099] Robust Actl CLIP reads at the 5’UTR targets including antioxidant mRNAs and WTAP, were barely induced by IL- 17 at the mRNA levels, suggesting potential protein translational control. IL- 17 treatment indeed strongly induced translation of these Actl’s 5’UTR targets in various cancer cell lines including PDVC57, M0C1 and human A431 . Consistently, Wtap expression was significantly elevated in human skin tumor tissue containing high number of IL-17A-producing cells compared to IL-17A low tumor tissue. By methylated (m6A) RNA immunoprecipitation (MeRIP), we found that IL- 17 stimulation was able to induce m6A methylation of Wtap and antioxidant mRNAs in M0C1 cancer cells, which was diminished by Wtap depletion. Importantly, inactivation of Actl’s RNA binding activity or Wtap knockdown abolished IL-17-induced m6A modification and translation of Wtap and antioxidant mRNAs, revealing a potential feedforward mechanism of Actl-WTAP loop. M6A modification is catalyzed by RNA methyltransferases complex, composed of several proteins, including methyltransferases METTL3 and METTL14 as well as regulatory protein Wtap. Mechanistically, Wtap has been shown to bind RNA and promote the recruitment of methyltransferases to the RNA targets93. Considering the critical role of Wtap in m6A methyltransferase complex, we examined the potential impact of IL-17 / Actl- mediated WTAP induction on m6A-methylation of Actl ’s 5’UTR targets. We used chemically modified RNA antisense oligonucleotides (ASO) to effectively block Actl binding to Wtap mRNA. WTAP ASO was indeed able to diminish IL-17-induced m6A methylation of Wtap and abolished IL-17-induced Wtap translation. Taken together, these results support a positive feedback mechanism by which IL-17 / Actl axis upregulates m6A mRNA modifications by augmenting Wtap expression, followed by cap-independent translation of specific, methylated 5’UTR targets via the formation of Actl / eIF3G RNP.

[0100] While m6A is known to function by recruiting eIF3 complex to promote protein translation, m6A also exerts its effect through interaction with other ‘readers’ such as YTH domain-containing proteins to influence RNA metabolism94, 95. Furthermore, noncanonical m6A readers, the IGF2 mRNA binding protein (IGF2BP) family (known as IMPs), have recently been demonstrated to stabilize target transcripts96-98. Interestingly, IMP2 was shown to promote IL-17-mediated Cebpb / d mRNA stabilization and translation, although m6A was found to be localized at the 3’UTR of Cebpb / d mRNAs. Taken together, it is possible that additional canonical and / or non-canonical readers might be recruited into the IL-17-WTAP axis to participate in IL-17-modulated posttranscriptional regulation of Actl-binding RNA targets.

[0101] While cap-independent translation is initiated under aberrant stress conditions such as cancer, 5' UTR m6A- methylation has been shown to promote cap-independent translation during cancer progression. The m6A writer complex METTL3 / 14-WTAP has indeed been implicated in cancer progression of multiple hematoma and solid malignancies, including chemotherapy resistance. A number of small molecule inhibitors targeting methyltransferases Mettl3 or Mettll4 have been identified for preclinical or clinical evaluation99, 10°. Our results here showed that IL- 17 stimulation induces m6A methylation of Wtap and antioxidant mRNAs, driving their active cap-independent translation in cancer cells. Notably, antioxidant proteins, including Prdx2, Txnl and Sodl, have also been shown to play critical roles in cancer chemoresistance, including cisplatin-based chemotherapy. Cisplatin is a platinum-based chemotherapy drug, a first line treatment for a variety of solid tumors79. In addition to DNA damage, cisplatin is known to generate oxidative stress and reactive oxygen species, which can often inhibit canonical, cap-dependent initiation of cellular protein translation. Our results showed that IL- 17 signaling renders resistance of cancer cells to cisplatin-based chemotherapy via m6A methylation of Wtap and antioxidant mRNAs and their consequent cap-independent protein translation in cancer cells. Indeed, we found that WTAP ASO effectively enhanced cisplatin-mediated cancer cell killing accompanied by reduction of antioxidant protein production and dramatically enhanced ROS. Consistently, WTAP ASO inhibited M0C1 tumor growth in cisplatin- treated mice.

[0102] One important take away from this study is the therapeutic ability for treating IL- 17- mediated pathologies by disrupting the interaction between Actl and the disease-driven target mRNAs. Antisense oligonucleotides (ASOs) are single-stranded oligonucleotides that can be designed as therapeutic agents to disrupt protein-RNA interaction. We here designed Wtap ASO to have a sequence complementary to Actl binding site at the 5 ’UTR of Wtap mRNA, which inhibited Actl’s binding to the 5 ’UTR of Wtap mRNA. This inhibition was specific to Wtap mRNA, since Wtap ASO did not block the binding of Actl to the antioxidant mRNAs. Importantly, the 5 ’UTR of WTAP is highly conserved between human and mouse. Human WTAP-ASO interfered with Actl binding to human Wtap mRNA and reduced IL-17-induced expression of WTAP and antioxidant proteins in human epidermoid carcinoma cells, implicating the application of WTAP-ASO in human cancer treatment. The success of Wtap ASO in inhibiting chemoresistance serves as a proof for this novel therapeutic strategy, which can be applied to other disease driven Actl binding target mRNAs. CLIP-seq has allowed us to comprehensively characterize Actl ’s RNA binding targets and precisely define Actl binding sites. Notably, 3’UTR and 5’UTR targets were not only functionally different, distinct sequences were enriched in Actl’s binding sites in 3’UTR versus 5’UTR targets. These results suggest that it is possible to selectively disrupt the interaction of Actl with specific targets. Notably, while inflammatory mRNAs were enriched in Actl 3’UTRs; genes regulating RNA metabolism and redox homeostasis were enriched among Actl 5’UTR targets, both of which are important for tumor development and progression. Consistently, in addition to cancer progression, IL- 17 has a well-established role in the pathology of many autoimmune inflammatory diseases, including psoriasis, psoriatic arthritis, and ankylosing spondylitis. Therefore, the success of Wtap ASO in ameliorating chemoresistance not only demonstrated a promising novel anti-cancer strategy, but also the ability to develop a new class of drugs for autoimmune and inflammatory diseases by selectively disrupting the interaction of Actl with specific disease-driven 3’UTR and / or 5’UTR targets.

[0103] Materials and methods

[0104] Animals

[0105] All experiments were conducted in accordance with 1ACUC guidelines at the Cleveland Clinic Lerner Research Institute. C57BL / 6 mice were purchased from Jackson Laboratory.

[0106] Cell culture and Reagents

[0107] The following antibodies were used: Santa Cruz Biotechnology: anti-Actl (sc-11444, clone H300), anti-GAPDH (sc-47724, mouse monoclonal), anti-P-actin (sc-8432, mouse monoclonal). Sigma anti-HA (H-9658, mouse monoclonal). Cell Signaling Technology: anti- Wtap, anti-Prdx2, anti-Txnl, anti-SODl, anti-Arid5a, anti-Cleaved Caspase-3, anti-Caspase 3, anti P-p70S6K.

[0108] TUNEL Assay was performed using TUNEL Assay Kit - HRP-DAB (ab206 86, Abeam) following manufacturer’s instructions.

[0109] Primary MEFs were isolated from wild-type and Actl -deficient embryos at embryonic day 14. Cell culture of mouse embryonic fibroblasts (MEFs) was performed as previously described101.

[0110] M0C1 cell line was obtained from Kerafast102, 103, EWL001-FP and cultured according to the manufacturer’s instructions.

[0111] PDVC57 cell line was kindly provided by Dr. Allan Balmain at UCSF, San Francisco, CA. and cultured as previously described47, 104, 105.

[0112] A-431 cell line was obtained from ATCC, CRL-1555 and cultured according to the manufacturer’s instructions. When stimulated ex vivo, cells were stimulated with mouse IL-17A (50 ng / ml, 421- MT, R&D Systems), Rapamycin (25 ng / ml, R8781, Sigma) or Cisplatin (1 ug / ml, 15663-27- 1, Sigma). 24 hours before treatments fetal bovine serum concentration was reduced to 0.5%. Cells were maintained in culture for no more than 20 passages.

[0113] Cellular ROS Assay

[0114] ROS in cells was analyzed by use of the DCFDA / H2DCFDA - Cellular ROS Assay Kit (abl 13851 , Abeam) according to the instructions of the manufacturer. 3 x 106cells were treated with the indicated drugs. Upon treatment, DCFDA reagent was added to a final concentration of 20pM, and cells were incubated for 45 min at 37 °C. Microscopy images were taken BZ-X710 microscope (Keyence).

[0115] Annexin V-FITC / PI-staining and Flow cytometry

[0116] Cells (3 x 106) were stained using the APC Annexin V Apoptosis Detection Kit with PI (640914, Biolegend) according to the manufacturer's instructions. Stained cells were diluted in Annexin V-binding buffer (Invitrogen). Suspended cells were subjected to flow cytometry. Annexin V-FITC / PI-stained cells were analyzed using a BD FACSymphony™ Al flow cytometer (BD Biosciences, Heidelberg, Germany). In total 10,000 cells were analyzed per measurement. Data was analyzed using FlowJo 10.4 software.

[0117] Constructs: HA-Wtap was constructed by cloning Wtap cDNA with HA-tag into pcDNA3.1 vector. Wild-type (FLAG-Actl) and Actl internal deletion mutant of the SEFIR domain ASEF1 constructs were previously described44.

[0118] Bicistronic reporter system

[0119] Bicistronic reporter construct were prepared using the Renilla / Firefly expression plasmid pcDNA3 Rluc POLIRES Flue (Addgene, Plasmid #45642). After removing poliovirus internal ribosome entry site, 5’UTR of PRDX2 (nucleotides 1-143), TXN1 (nucleotides 1-201), SOD1 (nucleotides 1-96) or Wtap (nucleotides 1-191) were cloned into the Pmll and Notl sites; plasmid without 5’UTR insert was used as a control.

[0120] Transfection and retroviral infection

[0121] Transfections of cells were conducted either with Lipofectamine 3000 (Invitrogen) or using Amaxa nucleofector apparatus (Amaxa, GmbH, Cologne, Germany) according to the manufacturer’s instructions. For Actl reconstitution into Act!7' MEFs, cells were infected by retroviral particles containing Act l or ASEF1 constructs as described previously106.

[0122] ShRNA and siRNAi

[0123] For WTAP siRNA knock-down, siRNA duplexes (Qiagen) to the target sequence AAG CTT TGG AGG GCA AGT ACA (SEQ ID NO:X) or control siRNA were transfected overnight with lipofectamine 3000 (Invitrogen), according to the manufacturer’s protocol. Both shRNA Actl (clone TRCN0000105992) as well as non-target shRNA Control Plasmid DNA were purchased from Sigma- Aldrich.

[0124] MeRIP

[0125] Total RNA extraction was performed using TRIzol reagent (Invitrogen). rRNA was removed from 300 pg total RNA using the rRNA removal kit (Arraystar). Purified mRNA was fragmented using the NEBNext® RNA Fragmentation Kit (NEB) for 5 minutes at 94°C, followed by RNA purification using Dynabeads™ MyOne™ Silanebeads (Thermo Fisher). The fragmented RNA was subjected to methylated (n / A ) RNA immunoprecipitation (MeRIP) by using EpiMark N6-methyladenosine Enrichment kit (NEB) according to manufacturer’s instructions. Briefly, 25 pL protein G magnetic beads per sample were washed twice and resuspend completely in 250 pl Reaction Buffer (150 mM NaCl, 10 mM Tris-HCl, pH 7.5, 0.1 % NP-40). 1 pl of anti-N6-Methyladenosine Antibody was attached to the beads. Antibody-conjugated beads were washed two more times before resuspending completely in 250 pl of Reaction Buffer supplemented with 1 pl RNAse inhibitor. Next, purified RNA (200 pg) was added to the re-suspended beads. Samples were incubated with orbital rotation for 4 hours at 4°C. Beads were then washed twice with 500 pL Reaction Buffer, two times with low salt wash buffer (50 mM NaCl, 10 mM Tris-HCl, pH 7.5, 0.1% NP-40), then two times with high salt buffer (500 mM NaCl, 10 mM Tris-HCl, pH 7.5, 0.1% NP-40), and with Reaction Buffer again. M6A-modified RNA was eluted twice in 100 pL Reaction Buffer containing 5 mM m6A salt (Santa Cruz Biotechnology) for 30 minutes at 4 °C with rotation and concentrated by ethanol precipitation. Supernatant was discarded and beads were incubated for 1 minute at room temperature in 150 pl of Monarch RNA Cleanup Binding Buffer and RNA (in the eluent) was further cleaned-up using Monarch RNA Cleanup kit (NEB), following manufacturer instruction. Purified RNA was used for quantitative real-time PCR analysis using primers listed in Table 1. For Prdx2, Txnl, Sodl and Wtap primers were designed to surround reported 5’UTR methylation site. (Table 1, primers indicated as MeRIP). Quantitative real-time PCR

[0126] Total RNA was isolated with TRIzol reagent (Invitrogen). The cDNA was synthesized with random hexamers (Applied Biosystems) and M-MLV reverse transcriptase (Promega). Real-time PCR was performed with a SYBR Green PCR Master Mix kit (Applied Biosystems). All gene expression results were calculated by the change in cycling threshold (ACt) method, where ACt = Ct of target gene - Ct of either -actin or GAPDH, and are presented as 2-ACt. The primers used for qPCR are listed in Table 1. Table 1. Primers for Real-Time Quantitative Polymerase Chain Reaction.

[0127] MOC1 tumor model

[0128] C57BL / 6 mice at 6-8 weeks were obtained from Jackson Laboratories. Mice (n = 5 / group) were injected subcutaneously in the right flank with MOC1 cells (0.5 x 106, in Matrigel) and allowed to grow for 10 days, and then randomized into treatment groups. Mice were then treated with cisplatin (5 mg / kg), simultaneously with each cisplatin treatment, intra-tumor injection of WTAP or Control ASO was performed at 1 nmol / mouse (~20 pl PBS per injection). Treatment was repeated every 4 days up to day 21 after which mice were sacrificed and tumor tissue collected. Tumors were measured for size and volume using formula tumor volume =l / 2(length x width2).

[0129] Immunohistochemistry and Immunofluorescence

[0130] For paraffin sections tissues were fixed (10% formalin overnight) and then stored in 70% ethanol at 4 °C before processing into paraffin blocks at Cleveland Clinic Imaging Core. Paraffin sections were de -paraffinized and subjected to epitope retrieval recommended by the antibody manufacturer. Subsequently sections were blocked for 2 hours (PBS containing 2% Donkey Serum, 0.5% BSA, 0.5% fish skin gelatin, 0.05% Tween 20 and 0.1% Triton X-100, PH7.2) and incubated with primary antibody overnight. Then slides were treated with 0.3% H2O2 and incubated with biotinylated secondary antibodies and Peroxidase Streptavidin (Vector Laboratories). For chromogenic detection of horseradish peroxidase (HRP) activity DAB substrate kit from BD Pharmingen was used. IHC staining was captured with a with Keyence BZ-X700 microscope. For frozen sections, tissues were embedded in OCT (Tissue- Tek) and snap frozen in liquid nitrogen. Frozen tissue sections (5 pm) or cells grown on a glass coverslip were fixed and permeabilized with 4% paraformaldehyde solution containing 0.2% Triton X-100 for 10 minutes. Subsequently samples were incubated with primary antibody (1:100) overnight and then antigens were visualized following incubation with fluorescence-conjugated secondary Abs (Molecular Probes).

[0131] Tissue array staining and analysis

[0132] Tissue array slides (with a collection of skin squamous cell carcinoma, Tissuearray Cat# SK802b) were subjected to IHC staining for WTAP (slide 197; abeam, abl95380, 1:100) and IL-17A (slide 196; R&D, AF-317, 1 :50), and then scanned with Hamamatsu Nanozoomer S60. For WTAP, data were reviewed and exported using Aperio ImageScope. For each sample, a random rectangle region (cropped with the Rectangle tool) was selected for further analysis in ImageJ. The following criteria were applied for the regions to be analyzed: 1) Three samples were omitted due to complete poor quality or missing tissue (A2, A3 and G3), 2) normal skin H7-H10 or irrelevant tumor Hl 1 were not analyzed. 3) Large broken areas and the background area of the slides were avoided; and staining background areas were avoided (e.g. B8 & F2). Imagel plugin ‘IHC Profiler’ was used for WTAP intensity quantification107. The percentage of ‘High positive + Positive’ signal was considered as significant WTAP staining signals at the threshold of 85 for the DAB channel. For IL- 17 A, samples were reviewed and grouped into IL-17A low and IL- 17 A high by blindly estimating the number of infiltrating IL-17A-producing cells in each sample. Microscopy

[0133] Both IHC staining and fluorescent images were captured with BZ-X710 microscope (Keyence).

[0134] RNA Electrophoretic Mobility Shift Assay (REMSA)

[0135] Increasing amounts of purified protein and labeled probes (10 fmol, see in vitro transcription) were combined in the binding buffer for 30 minutes. The final REMSA binding buffer concentrations were 140 mM KC1, 10 mM HEPES pH 7.9, 5% glycerol, 1 mM DTT and 0.33 mg / ml tRNA. The reaction was further supplemented with 15 pg salmon sperm DNA to reduce non-specific interactions from the lysate. Complexes were resolved on either 4% or 6% non-denaturing polyacrylamide gels. The gels were dried and the appearance of complexes was visualized by exposure to BioMax MR film.

[0136] In vitro transcription

[0137] Fragments containing the 5'-LJTR of Wtap (nt81— 150), Sodl(nt9-126), Prdx2(nt51- 143), Txnl(nt81-201) were generated by PCR and cloned into the pGEM-3ZF (+) vector (Promega) through the EcoRI and BamHI sites. REMSA radiolabeled 5’ UTR RNA probes were synthesized from BamHI linearized plasmids templates with T7 RNA polymerase using 1 mM GTP, 1 mM ATP, 1 mM CTP, 0.005 mM UTP and 25 pCi of32P-labeled UTP for 3 hours at 37°C. Probes were DNAse I treated for 20 minutes and then phenol: chloroform extracted. The aqueous phase was passed through a Micro Bio-Spin P30 column according to manufacturer’s instructions (BioRad).

[0138] For RNase footprinting experiments, cold synthetic transcripts were dephosphorylated with SuperSAP (Affymetrix), purified and resuspended in nuclease-free water. Dephosphorylated transcripts were end-labeled with [y-32P ] ATP (3,000 Ci / mmol; Perkin Elmer Easy Tides) and T4 PNK (NEB) using 20 units / pmol RNA. The transcripts were gel purified on 8% acrylamide (19: l) / 7 M urea gels and eluted in 10 mM Tris-HCl, pH 7.5, 1 mM EDTA, pH 8, and 300 mM NaOAc, pH 5.5, at 4 °C overnight. Purified RNA was stored in 10 mM Tris-HCl, pH 7.5, at -20 °C.

[0139] RNase footprinting

[0140] 32P-end-labeled RNA with or without cold ASO was heated to 95 °C and cooled to room temperature. The RNA (2.5 nM) was incubated in REMSA binding buffer with or without Actl SEFIR protein (1.5 pM) at 30 °C for 10 min. Reactions were cooled to room temperature over a 2-min period and then placed at 22 °C for 2-5 min. The indicated amounts of RNase T1 or A (Ambion) were added to the appropriate samples and incubated at 22 °C for 5 min. Enzymatic reactions were quenched with 30 pl Inactivation / Precipitation buffer (Ambion) and purified according to the manufacturer's directions. Samples were resuspended in 10 pl of loading buffer (Ambion), heat denatured at 95 °C for 5 min and separated in a denaturing 8% (19:1) polyacrylamide / 7 M urea gel. The dried gels were visualized on BioMax BXRfilm.

[0141] Sequencing ladders were prepared by incubating32P-end-labeled RNA (2.5 nM) in l x Sequencing Buffer (Ambion) supplemented with 50 ng / pl yeast tRNA. The RNAs were incubated at 50°C for 5 min and cooled to 22°C, and the indicated amounts of RNases T1 or A were then added. The samples were incubated, quenched and purified as described above. Alkali ladders were prepared by incubating32P-end-labeled RNA (2.5 nM) in 100 mM NaOH, 2 mM EDTA, pH 8.0, and 2 pg / pl yeast tRNA at 37°C for 3 min, to which 2ul IM Tris-HCl, pH 8.0 was added. The samples were frozen on dry ice and combined with an equal volume of loading buffer.

[0142] Antisense oligonucleotide (ASO) design:

[0143] ASO containing sequences (Wl: UCACACAGGCCGAGGCCGCG; W2: CGAGGCCGCGCCGCCGCCGG; W3: CCGCCGCCGGCCCCCCCGCG; W4: CCCCCCCGCGCUCCUCCCG; Ctrl: GCGACUAUACGCGCAAUAUG; h_WTAP-ASO: CCCCGCCGCGCUCCUAGUCCCG; h_Ctrl-ASO: CCUAUAGGACUAUCCAGGAA) were ordered form Integrated DNA Technologies. The first three residues form both 5’ and 3’end were modified (2'-O- Methyl RNA bases) in order to enhance stability. For detection, ASOs were further modified at 5’ end with 6-FAM dyes.

[0144] Immunoblot and immunoprecipitation

[0145] Cells were harvested and lysed on ice in a lysis buffer containing 0.5% Triton X-100, 20 mM Hepes pH 7.4,150 mM NaCl, 12.5 mM glycerophosphate, 1.5 mM MgC12, 10 mM NaF, 2 mM dithiothreitol, 1 mM sodium orthovanadate, 2 mM EGTA, 20 mM aprotinin, and 1 mM phenylmethylsulfonyl fluoride for 20 minutes, followed by centrifuging at 12,000 rpm for 15 minutes to extract clear lysates. For immunoprecipitation, cell lysates were incubated with 1 pg of antibody and A-sepharose beads at 4°C overnight. After incubation, the beads were washed four times with lysis buffer and the precipitates were eluted with 2x sample buffer. Elutes and whole cell extracts were resolved on SDS-PAGE followed by immunobloting with antibodies. Protein expression levels were quantified by measuring band intensity using ImageJ (NIH). Arbitrary densitometric units, normalized against tubulin, were calculated as the fold change versus the first sample for each blot and shown under each protein signal.

[0146] Polysomal fractionation analysis

[0147] Cytoplasmic extracts were carefully layered over 10%-50% linear sucrose gradients in polysome buffer (lOmM HEPES [pH 7.5], lOOmM KC1, 2.5 mM MgCh, 1 mM DTT, 50 U recombinant RNasin (Promega), and 0.1 % IGEPAL CA-630 (Sigma) and centrifuged at 17,000 rpm in a Beckman SW32.1 Ti rotor for 4h at 4°C. Gradients were fractioned using an ISCO gradient fractionation system equipped with a UA-6 detector. Light ribonucleoprotein (RNP) fractions, 40S, 60S, and 80S, as well as light and heavy polysome fractions were monitored by the continuous UV absorption profile at A254, and fractions of 750 mL were collected. The fractions representing light RNP, free ribosomes and light polysomes were used to prepare the translation-inactive and poorly translated pool of mRNAs, and the fractions representing heavy polysomes were used to isolate the translation-active mRNAs. One fifth of each fraction was used for RNA isolation by extraction with TRlzol.

[0148] Statistical analyses

[0149] Statistical analysis was applied to biologically independent samples (separate plates of cells or mice) from every single experiment and data were not pooled from independent experiments for statistical analysis. Experiments were repeated at least twice, and the exact number of repetitions is indicated in figure legend for each panel. For all RT-PCR and ELISA analyses, at least 3 biological replicates (separate plate of cells) were used. Unless otherwise indicated, comparison between two groups were analyzed by two-tailed Student’s t test. Comparisons between multiple groups were analyzed using one-way ANOVA, followed by Tukey’s multiple-comparisons test. All bar graphs show mean and standard deviation or standard error, which is indicated for each panel in the figure legend. GraphPad Prism 9 or R (4.2.2) was used for data analysis and representation.

[0150] CLIP-SEQ library construction and analysis

[0151] Three 15cm plates of flag-ActlKO / WT MEF cells were treated with IL-17A (50ng / mL) for Ih, followed by irradiating with 365 nm UV light to induce crosslinking as described previously108, 109. Immunoprecipitated protein-RNA complexes were separated by SDS-PAGE and then transferred to PVDF membrane; RNA-protein complexes were cut out from the membrane corresponding to the size of flag-Actl. Purified RNAs from RNA-Protein complex were subjected to the small RNA library construction as described previously108and then sequenced with HiSeq 2000 system (Illumina Inc.) at the Cleveland Clinic Genomic Core.

[0152] Reads with length >15bp were mapped to the mm 10 genome using Gencode M25 (GRCm38.p6) with Bowtie2(2.4.4)110. The uniquely mapped reads were used to identify Actl CLIP clusters that are present in at least 2 biological replicates. Reads were normalized based on the size of uniquely mapped reads of each library. CLIP clusters were identified using SAMTools(l .14)111, BEDTools(2.30.0)112. The gene annotation of CLIP clusters was assessed by intersection with gene regions retrieved from the Gencode M25 (GRCm38.p6). The transcriptome-wide distribution of the Actl CLIP clusters were analyzed and visualized using MetaPlotR113. Integrative Genomics Viewer was used to visualize the Actl CLIP cluster114. The distribution of CLIP clusters on gene transcript was assessed by intersection with 5’UTR, 3’ UTRs and coding sequences (CDS) regions retrieved from the Gencode M25 (GRCm38.p6). To define 5’UTR or 3’UTR binding target, we calculated the sum of normalized reads on 5’UTR and 3’UTR regions. Genes with higher sum reads on 5’ UTR / 3UTR were defined as Actl 5’UTR / 3’UTR dominant binding targets. Only genes with max read >1 and sum read >3 were used for further analysis. The length of 5’UTR / 3’UTR were extracted using R package GenomicFeatures(1.50.4)115. The longest transcript per gene was selected for calculation of UTR density. Hexamer enrichment analysis was performed on a 20-nucleotide window surrounding clusters using the EMBOSS tools Compseq116. GO analyses of CLIP targets were performed using DAVID117. To calculate distance between Actl CLIP cluster and m6A sites from published miCLIP dataset (GSE147489) or MeRIP-seq datasets (GSE53244, GSE61995), genomic location of clusters was converted to transcript location using R package ensembldb(2.22.0)118. The smallest distance between Actl CLIP clusters and miCLIP sites or the middle sites of MeRIP-seq peaks on each gene were used for the density plot. Plots were produced with R(4.2.2)119ggplot2(3.4.1)120with measurements indicated in the Figure legends.

[0153] RNA-SEQ library construction and analysis

[0154] Four 10cm plates of flag- Actl KO VT MEF cells were untreated or treated with IL- 17A (50ng / mL) for Ih. Total RNA was extracted using Trizol (15596026, Invitrogen) according to the manufacturer’s instructions followed by isopropanol precipitation. Total RNAs were further purified using Qiagen’s miRNeasy micro kit (217084, Qiagen) plus Qiagen’s DNase set (79254, Qiagen) for on-column DNase digestion option. The libraries were sequenced using the 150-nt paired-end kit on Illumina NovaSeq 6000 (Novogene). RNA-seq reads were aligned against the mmlO using STAR(2.7.0e)121. The number of reads mapped to mouse genome mmlO was counted using RSEM(1.3.3)122. Differential gene expression was determined using the R-package DEseq2(1.38.3)123.

[0155] REFERENCES:

[0156] 1. Chen J, Chen Z. The effect of immune microenvironment on the progression and prognosis of colorectal cancer. Med Oncol 2014; 31:82.

[0157] 2. Punt et al. A beneficial tumor microenvironment in oropharyngeal squamous cell carcinoma is characterized by a high T cell and low IL-17(+) cell frequency. Cancer Immunol Immuno ther 2016; 65:393-403.

[0158] 3. Punt et al., The correlations between IL-17 vs. Thl7 cells and cancer patient survival: a systematic review. Oncoimmunology 2015; 4:c984547.

[0159] 4. Xu C, Hao K, Yu L, Zhang X. Serum interleukin- 17 as a diagnostic and prognostic marker for non-small cell lung cancer. Biomarkers 2014; 19:287-90.

[0160] 5. Wu J, Du J, Liu L, Li Q, Rong W, Wang L, et al. Elevated pretherapy serum IL17 in primary hepatocellular carcinoma patients correlate to increased risk of early recurrence after curative hepatectomy. PLoS One 2012; 7:e50035.

[0161] 6. Gu FM, Gao Q, Shi GM, Zhang X, Wang J, Jiang JH, et al. Intratumoral IL-17(+) cells and neutrophils show strong prognostic significance in intrahepatic cholangiocarcinoma. Ann Surg Oncol 2012; 19:2506-14.

[0162] 7. Zhang GQ, Han F, Fang XZ, Ma XM. CD4+, IL17 and Foxp3 expression in different pTNM stages of operable non-small cell lung cancer and effects on disease prognosis. Asian Pac J Cancer Prev 2012; 13:3955-60.

[0163] 8. Zhang Y, Huang Y, Qin M. Tumour-infiltrating FoxP3+ and IL-17-producing T cells affect the progression and prognosis of gallbladder carcinoma after surgery. Scand J Immunol 2013; 78:516- 22.

[0164] 9. He S, Fei M, Wu Y, Zheng D, Wan D, Wang L, et al. Distribution and clinical significance of Thl7 cells in the tumor microenvironment and peripheral blood of pancreatic cancer patients. Int J Mol Sci 2011; 12:7424-37.

[0165] 10. Tosolini M, Kirilovsky A, Mlecnik B, Fredriksen T, Mauger S, Bindea G, et al. Clinical impact of different classes of infiltrating T cytotoxic and helper cells (Thl, th2, treg, th 17) in patients with colorectal cancer. Cancer Res 2011; 71:1263-71.

[0166] 11. Yan J, Liu XL, Xiao G, Li NL, Deng YN, Han LZ, et al. Prevalence and clinical relevance of T-helper cells, Thl7 and Thl, in hepatitis B virus-related hepatocellular carcinoma. PLoS One 2014; 9:c96080.

[0167] 12. Zhang Y, Zoltan M, Riquelme E, Xu H, Sahin I, Castro-Pando S, et al. Immune Cell Production of Interleukin 17 Induces Stem Cell Features of Pancreatic Intraepithelial Neoplasia Cells. Gastroenterology 2018; 155:210-23 e3.

[0168] 13. Gopalakrishnan V, Spencer CN, Nezi L, Reuben A, Andrews MC, Karpinets TV, et al. Gut microbiome modulates response to anti-PD-1 immunotherapy in melanoma patients. Science 2018; 359:97-103.

[0169] 14. Huang Y, Wang F, Wang Y, Zhu Z, Gao Y, Ma Z, et al. Intrahepatic interleukin- 17+ T cells and FoxP3+ regulatory T cells cooperate to promote development and affect the prognosis of hepatocellular carcinoma. J Gastroenterol Hepatol 2014; 29:851-9.

[0170] 15. McGeachy MJ, Cua DJ, Gaffen SL. The IL-17 Family of Cytokines in Health and Disease. Immunity 2019; 50:892-906.

[0171] 16. Monin L, Gaffen SL. Interleukin 17 Family Cytokines: Signaling Mechanisms, Biological Activities, and Therapeutic Implications. Cold Spring Harb Perspect Biol 2018; 10. 17. Chang SH, Park H, Dong C. Actl adaptor protein is an immediate and essential signaling component of interleukin- 17 receptor. J Biol Chem 2006; 281:35603-7.

[0172] 18. Garg AV, Ahmed M, Vallejo AN, Ma A, Gaffen SL. The deubiquitinase A20 mediates feedback inhibition of interleukin- 17 receptor signaling. Sci Signal 2013; 6:ra44.

[0173] 19. Qian Y, Liu C, Hartupee J, Altuntas CZ, Gulen MF, Jane-Wit D, et al. The adaptor Actl is required for interleukin 17-dependent signaling associated with autoimmune and inflammatory disease. Nat Immunol 2007; 8:247-56.

[0174] 20. Sender SU, Saret S, Tang W, Sturdevant DE, Porcella SF, Siebenlist U. IL-17-induced NF- kappaB activation via CIKS / Actl: physiologic significance and signaling mechanisms. J Biol Chem 2011; 286:12881-90.

[0175] 21. Zhong B, Liu X, Wang X, Chang SH, Liu X, Wang A, et al. Negative regulation of IL-17- mediated signaling and inflammation by the ubiquitin-specific protease USP25. Nat Immunol 2012; 13:1110-7.

[0176] 22. Maitra A, Shen F, Hanel W, Mossman K, Tocker J, Swart D, et al. Distinct functional motifs within the IE-17 receptor regulate signal transduction and target gene expression. Proc Natl Acad Sci U S A 2007; 104:7506-11.

[0177] 23. Shen F, Li N, Gade P, Kalvakolanu DV, Weibley T, Doble B, et al. IL-17 receptor signaling inhibits C / EBPbeta by sequential phosphorylation of the regulatory 2 domain. Sci Signal 2009; 2:ra8.

[0178] 24. Shen F, Hu Z, Goswami J, Gaffen SE. Identification of common transcriptional regulatory elements in interleukin- 17 target genes. J Biol Chem 2006; 281:24138-48.

[0179] 25. Ruddy MJ, Wong GC, Liu XK, Yamamoto H, Kasayama S, Kirkwood KL, et al. Functional cooperation between interleukin- 17 and tumor necrosis factor-alpha is mediated by CCAAT / enhancer- binding protein family members. J Biol Chem 2004; 279:2559-67.

[0180] 26. Sonder SU, Paun A, Ha HE, Johnson PF, Siebenlist U. CIKS / Actl -mediated signaling by IE-

[0181] 17 cytokines in context: implications for how a CIKS gene variant may predispose to psoriasis. J Immunol 2012; 188:5906-14.

[0182] 27. Amatya N, Garg AV, Gaffen SE. IE-17 Signaling: The Yin and the Yang. Trends Immunol 2017; 38:310-22.

[0183] 28. Hartupee J, Liu C, Novotny M, Li X, Hamilton T. IL-17 enhances chemokine gene expression through mRNA stabilization. J Immunol 2007; 179:4135-41.

[0184] 29. Bulek K, Liu C, Swaidani S, Wang L, Page RC, Gulen MF, et al. The inducible kinase IKKi is required for IL- 17 -dependent signaling associated with neutrophilia and pulmonary inflammation. Nat Immunol 2011; 12:844-52.

[0185] 30. Herjan T, Yao P, Qian W, Li X, Liu C, Bulek K, et al. HuR is required for IL-17-induced Actl-mediated CXCL1 and CXCL5 mRNA stabilization. J Immunol 2013; 191:640-9.

[0186] 31. Datta S, Novotny M, Pavicic PG, Jr., Zhao C, Herjan T, Hartupee J, et al. IL-17 regulates CXCL1 mRNA stability via an AUUUA / tristetraprolin-independent sequence. J Immunol 2010; 184:1484-91.

[0187] 32. Tiedje C, Diaz-Munoz MD, Trulley P, Ahlfors H, Laass K, Blackshear PJ, et al. The RNA- binding protein TTP is a global post-transcriptional regulator of feedback control in inflammation. Nucleic Acids Res 2016; 44:7418-40.

[0188] 33. Abbadi D, Yang M, Chenette DM, Andrews JJ, Schneider RJ. Muscle development and regeneration controlled by AUF1 -mediated stage-specific degradation of fate-determining checkpoint mRNAs. Proc Natl Acad Sci U S A 2019; 116:11285-90.

[0189] 34. Sun S, Zhang X, Lyu L, Li X, Yao S, Zhang J. Autotaxin Expression Is Regulated at the Post- transcriptional Eevel by the RNA-binding Proteins HuR and AUF1. J Biol Chem 2016; 291:25823-36.

[0190] 35. Schmidtke E, Schrick K, Saurin S, Kafer R, Gather F, Weinmann-Menke J, et al. The KH- type splicing regulatory protein (KSRP) regulates type III interferon expression post- transcriptionally. Biochem J 2019; 476:333-52. 36. Bollmann F, Art J, Henke J, Schrick K, Besche V, Bros M, et al. Resveratrol post- transcriptionally regulates pro-inflammatory gene expression via regulation of KSRP RNA binding activity. Nucleic Acids Res 2014; 42:12555-69.

[0191] 37. Delestienne N, Wauquier C, Soin R, Dierick JF, Gueydan C, Kruys V. The splicing factor ASF / SF2 is associated with TIA-l-related / TIA-1 -containing ribonucleoproteic complexes and contributes to post-transcriptional repression of gene expression. FEBS J 2010; 277:2496-514.

[0192] 38. Sun D, Novotny M, Bulek K, Liu C, Li X, Hamilton T. Treatment with IL-17 prolongs the half-life of chemokine CXCL1 mRNA via the adaptor TRAF5 and the splicing-regulatory factor SF2 (ASF). Nat Immunol 2011; 12:853-60.

[0193] 39. Iwasaki H, Takeuchi O, Teraguchi S, Matsushita K, Uehata T, Kuniyoshi K, et al. The IkappaB kinase complex regulates the stability of cytokine-encoding mRNA induced by TLR-IL-1R by controlling degradation of regnase-1. Nat Immunol 2011; 12:1167-75.

[0194] 40. Mino T, Murakawa Y, Fukao A, Vandenbon A, Wessels HH, Ori D, et al. Regnase-1 and Roquin Regulate a Common Element in Inflammatory mRNAs by Spatiotemporally Distinct Mechanisms. Cell 2015; 161:1058-73.

[0195] 41. Somma D, Mastrovito P, Grieco M, Lavorgna A, Pignalosa A, Formisano L, et al. CIKS / DDX3X interaction controls the stability of the Zc3hl2a mRNA induced by IL-17. J Immunol 2015; 194:3286-94.

[0196] 42. Schoenberg DR, Maquat LE. Regulation of cytoplasmic mRNA decay. Nat Rev Genet 2012; 13:246-59.

[0197] 43. Stumpo DJ, Lai WS, Blackshear PJ. Inflammation: cytokines and RNA-based regulation. Wiley Interdiscip Rev RNA 2010; 1:60-80.

[0198] 44. Herjan T, Hong L, Bubenik J, Bulek K, Qian W, Liu C, et al. IL-17-receptor-associated adaptor Actl directly stabilizes mRNAs to mediate IL-17 inflammatory signaling. Nat Immunol 2018; 19:354-65.

[0199] 45. Li X, Bechara R, Zhao J, McGeachy MJ, Gaffen SL. IL- 17 receptor-based signaling and implications for disease. Nat Immunol 2019; 20:1594-602.

[0200] 46. Li X, Commane M, Nie H, Hua X, Chatterjee-Kishore M, Wald D, et al. Actl, an NF-kappa B-activating protein. Proc Natl Acad Sci U S A 2000; 97:10489-93.

[0201] 47. Chen X, Zhao J, Herjan T, Hong L, Liao Y, Liu C, et al. IL-17-induced HIFlalpha drives resistance to anti-PD-Ll via fibroblast-mediated immune exclusion. J Exp Med 2022; 219.

[0202] 48. Liao Y, Zhao J, Bulek K, Tang F, Chen X, Cai G, et al. Inflammation mobilizes copper metabolism to promote colon tumorigenesis via an IL-17-STEAP4-XIAP axis. Nat Commun 2020; 11:900.

[0203] 49. Hinnebusch AG, Ivanov IP, Sonenberg N. Translational control by 5'-untranslated regions of eukaryotic mRNAs. Science 2016; 352:1413-6.

[0204] 50. Leppek K, Das R, Barna M. Functional 5' UTR mRNA structures in eukaryotic translation regulation and how to find them. Nat Rev Mol Cell Biol 2018; 19:158-74.

[0205] 51. Coots RA, Liu XM, Mao Y, Dong L, Zhou J, Wan J, et al. m(6)A Facilitates eIF4F- Independent mRNA Translation. Mol Cell 2017; 68:504-14 e7.

[0206] 52. Meyer KD, Patil DP, Zhou J, Zinoviev A, Skabkin MA, Elemento O, et al. 5' UTR m(6)A Promotes Cap-Independent Translation. Cell 2015; 163:999-1010.

[0207] 53. Zhou J, Wan J, Gao X, Zhang X, Jaffrey SR, Qian SB. Dynamic m(6)A mRNA methylation directs translational control of heat shock response. Nature 2015; 526:591-4.

[0208] 54. Hong L, Herjan T, Bulek K, Xiao J, Comhair SAA, Erzurum SC, et al. Mechanisms of Corticosteroid Resistance in Type 17 Asthma. J Immunol 2022; 209:1860-9.

[0209] 55. Sonenberg N, Hinnebusch AG. Regulation of translation initiation in eukaryotes: mechanisms and biological targets. Cell 2009; 136:731-45. 56. Beretta L, Gingras AC, Svitkin YV, Hall MN, Sonenberg N. Rapamycin blocks the phosphorylation of 4E-BP1 and inhibits cap-dependent initiation of translation. EMBO J 1996; 15:658-64.

[0210] 57. Amatya N, Childs EE, Cruz JA, Aggor FEY, Garg AV, Berman AJ, et al. IL-17 integrates multiple self-reinforcing, feed-forward mechanisms through the RNA binding protein Arid5a. Sci Signal 2018; 11.

[0211] 58. Liu B, Qian SB. Translational reprogramming in cellular stress response. Wiley Interdiscip Rev RNA 2014; 5:301-15.

[0212] 59. Spriggs KA, Bushell M, Willis AE. Translational regulation of gene expression during conditions of cell stress. Mol Cell 2010; 40:228-37.

[0213] 60. El-Naggar AM, Sorensen PH. Translational control of aberrant stress responses as a hallmark of cancer. J Pathol 2018; 244:650-66.

[0214] 61. Walters B, Thompson SR. Cap-Independent Translational Control of Carcinogenesis. Front Oncol 2016; 6:128.

[0215] 62. Xi L, Carroll T, Matos I, Luo JD, Polak L, Pasolli HA, et al. m6A RNA methylation impacts fate choices during skin morphogenesis. Elife 2020; 9.

[0216] 63. Geula S, Moshitch-Moshkovitz S, Dominissini D, Mansour AA, Koi N, Salmon-Divon M, et al. Stem cells. m6A mRNA methylation facilitates resolution of naive pluripotency toward differentiation. Science 2015; 347: 1002-6.

[0217] 64. Zhao X, Yang Y, Sun BF, Shi Y, Yang X, Xiao W, et al. FTO-dependent demethylation of N6-methyladenosine regulates mRNA splicing and is required for adipogenesis. Cell Res 2014; 24:1403-19.

[0218] 65. Wolf DA, Lin Y, Duan H, Cheng Y. elF-Three to Tango: emerging functions of translation initiation factor eIF3 in protein synthesis and disease. J Mol Cell Biol 2020; 12:403-9.

[0219] 66. Wang C, Wu L, Bulek K, Martin BN, Zepp JA, Kang Z, et al. The psoriasis-associated DION variant of the adaptor Actl with impaired regulation by the molecular chaperone hsp90. Nat Immunol 2013; 14:72-81.

[0220] 67. Zhang CJ, Wang C, Jiang M, Gu C, Xiao J, Chen X, et al. Actl is a negative regulator in T and B cells via direct inhibition of STAT3. Nat Commun 2018; 9:2745.

[0221] 68. Wang K, Kim MK, Di Caro G, Wong J, Shalapour S, Wan J, et al. Interleukin- 17 receptor a signaling in transformed enterocytes promotes early colorectal tumorigenesis. Immunity 2014; 41:1052-63.

[0222] 69. Ma S, Cheng Q, Cai Y, Gong H, Wu Y, Yu X, et al. IL-17A produced by gammadelta T cells promotes tumor growth in hepatocellular carcinoma. Cancer Res 2014; 74:1969-82.

[0223] 70. McAllister F, Bailey JM, Alsina J, Nirschl CJ, Sharma R, Fan H, et al. Oncogenic Kras activates a hematopoietic-to-epithelial IL- 17 signaling axis in preinvasive pancreatic neoplasia. Cancer Cell 2014; 25:621-37.

[0224] 71. Chang SH, Mirabolfathinejad SG, Katta H, Cumpian AM, Gong L, Caetano MS, et al. T helper 17 cells play a critical pathogenic role in lung cancer. Proc Natl Acad Sci U S A 2014; 111:5664-9.

[0225] 72. Wu L, Chen X, Zhao J, Martin B, Zepp JA, Ko JS, et al. A novel IL-17 signaling pathway controlling keratinocyte proliferation and tumorigenesis via the TRAF4-ERK5 axis. J Exp Med 2015; 212:1571-87.

[0226] 73. Chen X, Cai G, Liu C, Zhao J, Gu C, Wu L, et al. IL-17R-EGFR axis links wound healing to tumorigenesis in Lrigl(+) stem cells. J Exp Med 2019; 216:195-214.

[0227] 74. Lin S, Choe J, Du P, Triboulet R, Gregory RI. The m(6)A Methyltransferase METTL3 Promotes Translation in Human Cancer Cells. Mol Cell 2016; 62:335-45.

[0228] 75. Panneerdoss S, Eedunuri VK, Yadav P, Timilsina S, Rajamanickam S, Viswanadhapalli S, et al. Cross-talk among writers, readers, and erasers of m(6)A regulates cancer growth and progression. Sci Adv 2018; 4:eaar8263. 76. Lan Q, Liu PY, Haase J, Bell JL, Huttelmaier S, Liu T. The Critical Role of RNA m(6)A Methylation in Cancer. Cancer Res 2019; 79: 1285-92.

[0229] 77. Zhu H, Tao X, Zhou L, Sheng B, Zhu X, Zhu X. Expression of thioredoxin 1 and peroxiredoxins in squamous cervical carcinoma and its predictive role in NACT. BMC Cancer 2019; 19:865.

[0230] 78. Brown DP, Chin-Sinex H, Nie B, Mendonca MS, Wang M. Targeting superoxide dismutase 1 to overcome cisplatin resistance in human ovarian cancer. Cancer Chemother Pharmacol 2009; 63:723-30.

[0231] 79. Yu W, Chen Y, Dubrulle J, Stossi F, Putluri V, Sreekumar A, et al. Cisplatin generates oxidative stress which is accompanied by rapid shifts in central carbon metabolism. Sci Rep 2018; 8:4306.

[0232] 80. Pietras P, Aulas A, Fay MM, Lesniczak-Staszak M, Sowinski M, Lyons SM, et al. Translation inhibition and suppression of stress granules formation by cisplatin. Biomed Pharmacother 2022; 145: 112382.

[0233] 81. Yang B, Chen Q. Cross-Talk between Oxidative Stress and m(6)A RNA Methylation in Cancer. Oxid Med Cell Longev 2021; 2021:6545728.

[0234] 82. Cai Y, Shen X, Ding C, Qi C, Li K, Li X, et al. Pivotal role of dermal IL-17-producing gammadelta T cells in skin inflammation. Immunity 2011; 35:596-610.

[0235] 83. Lee MH, Tung-Chieh Chang J, Liao CT, Chen YS, Kuo ML, Shen CR. Interleukin 17 and peripheral IL-17-expressing T cells are negatively correlated with the overall survival of head and neck cancer patients. Oncotarget 2018; 9:9825-37.

[0236] 84. Li C, Zhao Y, Zhang W, Zhang W. Increased prevalence of T(H)17 cells in the peripheral blood of patients with head and neck squamous cell carcinoma. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2011; 112:81-9.

[0237] 85. Al Obeed OA, Vaali-Mohamed MA, Alkhayal KA, Bin Traiki TA, Zubaidi AM, Arafah M, et al. IL-17 and colorectal cancer risk in the Middle East: gene polymorphisms and expression. Cancer Manag Res 2018; 10:2653-61.

[0238] 86. Bedoui SA, Barbirou M, Stayoussef M, Dallel M, Mokrani A, Makni L, et al. Association of interleukin- 17A polymorphisms with the risk of colorectal cancer: A case-control study. Cytokine 2018; 110: 18-23.

[0239] 87. Lotti F, Jarrar AM, Pai RK, Hitomi M, Lathia J, Mace A, et al. Chemotherapy activates cancer-associated fibroblasts to maintain colorectal cancer-initiating cells by IL-17A. J Exp Med 2013; 210:2851-72.

[0240] 88. Liao R, Sun J, Wu H, Yi Y, Wang JX, He HW, et al. High expression of IL-17 and IL-17RE associate with poor prognosis of hepatocellular carcinoma. J Exp Clin Cancer Res 2013; 32:3.

[0241] 89. Zhang JP, Yan J, Xu J, Pang XH, Chen MS, Li L, et al. Increased intratumoral IL-17- producing cells correlate with poor survival in hepatocellular carcinoma patients. J Hepatol 2009; 50:980-9.

[0242] 90. Sui G, Qiu Y, Yu H, Kong Q, Zhen B. Interleukin- 17 promotes the development of cisplatin resistance in colorectal cancer. Oncol Lett 2019; 17:944-50.

[0243] 91. Cochaud S, Giustiniani J, Thomas C, Laprevotte E, Garbar C, Savoye AM, et al. IL-17A is produced by breast cancer TILs and promotes chemoresistance and proliferation through ERK1 / 2. Sci Rep 2013; 3:3456.

[0244] 92. Bi L, Wu J, Ye A, Wu J, Yu K, Zhang S, et al. Increased Thl7 cells and IL-17A exist in patients with B cell acute lymphoblastic leukemia and promote proliferation and resistance to daunorubicin through activation of Akt signaling. J Transl Med 2016; 14: 132.

[0245] 93. Ping XL, Sun BF, Wang L, Xiao W, Yang X, Wang WJ, et al. Mammalian WTAP is a regulatory subunit of the RNA N6-methyladenosine methyltransferase. Cell Res 2014; 24: 177-89.

[0246] 94. Xu C, Wang X, Liu K, Roundtree IA, Tempel W, Li Y, et al. Structural basis for selective binding of m6A RNA by the YTHDC1 YTH domain. Nat Chem Biol 2014; 10:927-9. 95. Wang X, Lu Z, Gomez A, Hon GC, Yue Y, Han D, et al. N6-methyladenosine-dependent regulation of messenger RNA stability. Nature 2014; 505:117-20.

[0247] 96. Huang H, Weng H, Sun W, Qin X, Shi H, Wu H, et al. Recognition of RNA N(6)- methyladenosine by IGF2BP proteins enhances mRNA stability and translation. Nat Cell Biol 2018; 20:285-95.

[0248] 97. Huang H, Weng H, Chen J. m(6)A Modification in Coding and Non-coding RNAs: Roles and Therapeutic Implications in Cancer. Cancer Cell 2020; 37:270-88.

[0249] 98. Bechara R, Amatya N, Bailey RD, Li Y, Aggor FEY, Li DD, et al. The m(6)A reader IMP2 directs autoimmune inflammation through an IL-17- and TNFalpha-dependent C / EBP transcription factor axis. Sci Immunol 2021; 6.

[0250] 99. Yankova E, Blackaby W, Albertella M, Rak J, De Braekeleer E, Tsagkogeorga G, et al. Small-molecule inhibition of METTL3 as a strategy against myeloid leukaemia. Nature 2021; 593:597-601.

[0251] 100. Cully M. Chemical inhibitors make their RNA epigenetic mark. Nat Rev Drug Discov 2019; 18:892-4.

[0252] 101. Liu C, Swaidani S, Qian W, Kang Z, Sun P, Han Y, et al. A CO loop decoy peptide blocks the interaction between Actl and IL-17RA to attenuate IL-17- and IL-25-induced inflammation. Sci Signal 2011; 4:ra72.

[0253] 102. Judd NP, Allen CT, Winkler AE, Uppaluri R. Comparative analysis of tumor-infiltrating lymphocytes in a syngeneic mouse model of oral cancer. Otolaryngol Head Neck Surg 2012; 147:493- 500.

[0254] 103. Judd NP, Winkler AE, Murillo-Sauca O, Brotman JJ, Law JH, Lewis JS, Jr., et al. ERK1 / 2 regulation of CD44 modulates oral cancer aggressiveness. Cancer Res 2012; 72:365-74.

[0255] 104. Buchmann A, Ruggeri B, Klein-Szanto AJ, Balmain A. Progression of squamous carcinoma cells to spindle carcinomas of mouse skin is associated with an imbalance of H-ras alleles on chromosome 7. Cancer Res 1991; 51:4097-101.

[0256] 105. Quintanilla M, Haddow S, Jonas D, Jaffe D, Bowden GT, Balmain A. Comparison of ras activation during epidermal carcinogenesis in vitro and in vivo. Carcinogenesis 1991; 12:1875-81.

[0257] 106. Qian Y, Liu C, Hartupee J, Altuntas CZ, Gulen MF, Jane -Wit D, et al. The adaptor Actl is required for interleukin 17-dependent signaling associated with autoimmune and inflammatory disease. Nature immunology 2007; 8:247.

[0258] 107. Varghese F, Bukhari AB, Malhotra R, De A. IHC Profiler: an open source plugin for the quantitative evaluation and automated scoring of immunohistochemistry images of human tissue samples. PLoS One 2014; 9:e96801.

[0259] 108. Zagore LL, Sweet TJ, Hannigan MM, Weyn-Vanhentenryck SM, Jobava R, Hatzoglou M, et al. DAZL Regulates Germ Cell Survival through a Network of PolyA-Proximal mRNA Interactions. Cell Rep 2018; 25:1225-40 e6.

[0260] 109. Licatalosi DD, Mele A, Fak JJ, Ule J, Kayikci M, Chi SW, et al. HITS-CLIP yields genomewide insights into brain alternative RNA processing. Nature 2008; 456:464-9.

[0261] 110. Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat Methods 2012; 9:357-9.

[0262] 111. Danecek P, Bonfield JK, Liddle J, Marshall J, Ohan V, Pollard MO, et al. Twelve years of SAMtools and BCFtools. Gigascience 2021; 10.

[0263] 112. Quinlan AR, Hall IM. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 2010; 26:841-2.

[0264] 113. Olarerin-George AO, Jaffrey SR. MetaPlotR: a Perl / R pipeline for plotting metagenes of nucleotide modifications and other transcriptomic sites. Bioinformatics 2017; 33:1563-4.

[0265] 114. Robinson JT, Thorvaldsdottir H, Wenger AM, Zehir A, Mesirov JP. Variant Review with the Integrative Genomics Viewer. Cancer Res 2017; 77:e31-e4. 115. Lawrence M, Huber W, Pages H, Aboyoun P, Carlson M, Gentleman R, et al. Software for computing and annotating genomic ranges. PLoS Comput Biol 2013; 9:el003118.

[0266] 116. Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet 2000; 16:276-7.

[0267] 117. Sherman BT, Hao M, Qiu J, Jiao X, Baseler MW, Lane HC, et al. DAVID: a web server for functional enrichment analysis and functional annotation of gene lists (2021 update). Nucleic Acids Res 2022; 50:W216-W21.

[0268] 118. Rainer J, Gatto L, Weichenberger CX. ensembldb: an R package to create and use Ensembl- based annotation resources. Bioinformatics 2019; 35:3151-3.

[0269] 119. R Core Team R. R: A language and environment for statistical computing. 2013.

[0270] 120. Villanueva RAM, Chen ZJ. ggplot2: elegant graphics for data analysis. Taylor & Francis, 2019.

[0271] 121. Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 2013; 29: 15-21.

[0272] 122. Li B, Dewey CN. RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics 2011; 12:323.

[0273] 123. Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA- seq data with DESeq2. Genome Biol 2014; 15:550.

[0274] All publications and patents mentioned in the specification and / or listed below are herein incorporated by reference, V rious modifications and variations of the described method and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the relevant fields are intended to be within the scope described herein.

Claims

CLAIMSWe Claim:

1. A method of treating a subject with cancer comprising: treating a subject with cancer with: i) a nucleic acid sequence, wherein said nucleic acid sequence binds at least part of an mRNA sequence selected from: Wilms' tumor 1 -associating protein (WTAP) mRNA, peroxiredoxin 2 (PRDX2) mRNA, thioredoxin 1 (TNX1) mRNA, superoxide dismutase 1 (SOD1) mRNA, proliferating cell nuclear antigen (PCNA) mRNA, and RAD23 homolog B, nucleotide excision repair protein (RAD23b) mRNA; and ii) a cancer therapeutic that can cause toxicity to said subject when administered to said subject in the absence of said nucleic acid sequence.

2. The method of claim 1, wherein said subject is administered an amount of said cancer therapeutic that would cause toxicity in the subject if said nucleic acid sequence was not also administered to said subject.

3. The method of claim 1, wherein said nucleic acid sequence comprises an antisense or aptamer sequence.

4. The method of claim 1 , wherein at least a portion of said nucleic acid sequence is from a gene selected from: WTAP, PRDX2, TNX1, SOD1, PCNA, and RAD23b, and optionally wherein said at least a portion of said nucleic acid sequence is from a 5' UTR from a gene selected from: WTAP, PRDX2, TNX1, SOD1, PCNA, and RAD23b.

5. The method of Claim 1, wherein said nucleic acid sequence comprises a sequence shown in SEQ ID NOs: 1-52 (Table 1).

6. The method of Claim 1, wherein said nucleic acid sequence comprises RNA bases.

7. The method of Claim 1, wherein said nucleic acid sequence comprises DNA bases.

8. The method of Claim 1, wherein said subject is human.

9. The method of Claim 1, wherein said nucleic acid sequence is from a human gene.

10. The method of Claim 1 , wherein said WTAP mRNA, PRDX2 mRNA, TNX1 mRNA, SOD1 mRNA, PCNA mRNA , RAD23b mRNA is human WTAP mRNA, PRDX2 mRNA, TNX1 mRNA, SOD1 mRNA, PCNA mRNA , RAD23b mRNA.

11. The method of Claim 1, wherein said nucleic acid sequence is between 12 and 70 nucleotides in length.

12. The method of claim 1, wherein said nucleic acid sequence comprises modified bases, optionally selected from: 2'-O-Methyl NTP or 1 -methylpseudouridine, and optionally, wherein said modified bases are prevalent in an amount that improves stability in vivo and / or reduces immunogenicity in vivo.

13. The method of claim 1, wherein said cancer therapeutic comprises a platinum containing compound, which is optionally cisplatin, carboplatin, or oxaliplatin.

14. A composition comprising a nucleic acid sequence that comprises, or consists of, a sequence shown in any of SEQ ID NOs: 1-52, wherein said nucleic acid sequences comprises at least one modified base, wherein said nucleic acid sequence is optionally 12 to 70 nucleotides in a length, and wherein said nucleic acid sequence is optionally an aptamer or antisense sequence.

15. A method of treating a subject with cancer comprising: treating a subject with cancer with: i) a nucleic acid sequence, wherein said nucleic acid sequence binds a SEFIR domain of an ACT1 protein, and ii) a cancer therapeutic that can cause toxicity to said subject when administered to said subject in the absence of said nucleic acid sequence.

16. The method of claim 15, wherein said subject is administered an amount of said cancer therapeutic that would cause toxicity in the subject if said nucleic acid sequence was not also administered to said subject.

17. The method of claim 15, wherein said nucleic acid sequence comprises an aptamer or an antisense sequence.

18. The method of Claim 15, wherein at least a portion of said nucleic acid sequence is from a gene selected from: CXCL1, TNF, GM-CSF, Zc3hl2a, Serpincl, Cyp2d26, C3, H2- Q10, Nfkbiz, Igfbpl, Ccl7, Asbl5, Ccl2, Cgn, Cxcl5, G6pc, Cp, Slc27a2, Apocl, Uox and Bcl3, and optionally wherein said at least a portion of said nucleic acid sequence is from a 3' UTR from said gene.

19. The method of Claim 15, wherein at least a portion of said nucleic acid sequence is from a gene selected from Table 2, and optionally wherein said at least a portion of said nucleic acid sequence is from a 5' UTR, 3’UTR, or coding sequence from said gene.

20. The method of Claim 15, wherein said nucleic acid sequence comprises a sequence shown in any of SEQ ID NOs:53-429 (Table 2).

21. The method of Claim 15, wherein said nucleic acid sequence comprises RNA bases.

22. The method of Claim 15, wherein said nucleic acid sequence comprises DNA bases.

23. The method of Claim 15, wherein said subject is human.

24. The method of Claim 15, wherein said nucleic acid sequence is from a human gene.

25. The method of Claim 15, wherein said ACT1 protein is human ACT1 protein.

26. The method of Claim 15, wherein said nucleic acid sequence is between 12 and 100 nucleotides in length.

27. The method of claim 15, wherein said nucleic acid sequence comprises modified bases, optionally selected from: 2'-O-Methyl NTP or 1 -methylpseudouridine, and optionally, wherein said modified bases are prevalent in an amount that improves stability in vivo and / or reduces immunogenicity in vivo.

28. The method of claim 15, wherein said nucleic acid sequence is from a gene selected from CXCL1, TNF, GM-CSF, Zc3hl2a, Serpincl, Cyp2d26, C3, H2-Q10, Nfkbiz, Igfbpl, Ccl7, Asbl5, Ccl2, Cgn, Cxcl5, G6pc, Cp, Slc27a2, Apocl, Uox and Bcl3.

29. The method of claim 15, wherein said nucleic acid sequence comprises SEQ ID NO:464-466 (from Figures 13-15), and optionally is not naturally occurring.

30. The method of claim 15, wherein said nucleic acid sequence comprises SEQ ID NO: 467-503 (from Table 3), and optionally is not naturally occurring.

31. A composition comprising a nucleic acid sequence that comprises, or consists of, a sequence shown in any of SEQ ID NOs: 467-503, wherein said nucleic acid sequences comprises at least one modified base, wherein said nucleic acid sequence is optionally 12 to 70 nucleotides in a length, and wherein said nucleic acid sequence is optionally an aptamer or antisense sequence.

32. A method of treating a subject with a disease comprising: treating a subject with a disease with a nucleic acid sequence, wherein said nucleic acid sequence binds a SEFIR domain of an ACT 1 protein, and wherein said disease is selected from: cancer, neurodegenerative disease, and fibrosis.

33. The method of claim 32, wherein said nucleic acid sequence comprises an aptamer or an antisense sequence.

34. The method of Claim 32, wherein at least a portion of said nucleic acid sequence is from a gene selected from: CXCL1, TNF, GM-CSF, Zc3hl2a, Serpincl, Cyp2d26, C3, H2- Q10, Nfkbiz, Igfbpl, Ccl7, Asbl5, Ccl2, Cgn, Cxcl5, G6pc, Cp, Slc27a2, Apocl, Uox and Bcl3, and optionally wherein said at least a portion of said nucleic acid sequence is from a 3' UTR from said gene.

35. The method of Claim 32, wherein at least a portion of said nucleic acid sequence is from a gene selected from Table 2, and optionally wherein said at least a portion of said nucleic acid sequence is from a 5' UTR, 3'UTR, or coding sequence from said gene.

36. The method of Claim 32, wherein said nucleic acid sequence comprises a sequence shown in any of SEQ ID NOs:53-429 (Table 2).

37. The method of Claim 32, wherein said nucleic acid sequence comprises RNA bases.

38. The method of Claim 32, wherein said nucleic acid sequence comprises DNA bases.

39. The method of Claim 32, wherein said subject is human.

40. The method of Claim 32, wherein said nucleic acid sequence is from a human gene.41 . The method of Claim 32, wherein said ACT1 protein is human ACT1 protein.

42. The method of Claim 32, wherein said nucleic acid sequence is between 12 and 100 nucleotides in length.

43. The method of claim 32, wherein said nucleic acid sequence comprises modified bases, optionally selected from: 2'-O-Methyl NTP or 1 -methylpseudouridine, and optionally, wherein said modified bases are prevalent in an amount that improves stability in vivo and / or reduces immunogenicity in vivo.

44. The method of claim 32, wherein said nucleic acid sequence is from a gene selected from CXCL1, TNF, GM-CSF, Zc3hl2a, Serpincl, Cyp2d26, C3, H2-Q10, Nfkbiz, Igfbpl, Ccl7, Asbl5, Ccl2, Cgn, Cxcl5, G6pc, Cp, Slc27a2, Apocl, Uox and Bcl3.

45. The method of claim 32, wherein said nucleic acid sequence comprises SEQ ID NO:464-466 (from Figures 13-15), and optionally is not naturally occurring.

46. The method of claim 32, wherein said nucleic acid sequence comprises SEQ ID NO: 467-503 (from Table 3), and optionally is not naturally occurring.

47. A method of treating a subject with cancer comprising: treating a subject with cancer with: i) a nucleic acid sequence, wherein said nucleic acid sequence binds to, and / or inhibits, and / or competes with, mRNA sequences that bind to Actl protein, ii) a cancer therapeutic that can cause toxicity to said subject when administered to said subject in the absence of said nucleic acid sequence.

48. The method of claim 47, wherein said subject is administered an amount of said cancer therapeutic that would cause toxicity in the subject if said nucleic acid sequence was not also administered to said subject.

49. The method of claim 47, wherein at least a portion of said nucleic acid sequence is from a gene selected from a portion of: Hifla mRNA or an mRNA listed in Table 4.

50. The method of claim 47, wherein said nucleic acid sequence comprises an antisense or aptamer sequence.

51. The method of Claim 47, wherein said nucleic acid sequence comprises a sequence shown in any of SEQ ID NOs: 430-463 (table 5).

52. The method of Claim 47, wherein said nucleic acid sequence comprises RNA bases.

53. The method of Claim 47, wherein said nucleic acid sequence comprises DNA bases.

54. The method of Claim 47, wherein said subject is human.

55. The method of Claim 47, wherein said nucleic acid sequence is from a human gene.

56. The method of Claim 47, wherein said mRNAs are human mRNAs.

57. The method of Claim 47, wherein said nucleic acid sequence is between 12 and 100 nucleotides in length.

58. The method of claim 47, wherein said nucleic acid sequence comprises modified bases, optionally selected from: 2'-O-Methyl NTP or 1 -methylpseudouridine, and optionally, wherein said modified bases are prevalent in an amount that improves stability in vivo and / or reduces immunogenicity in vivo.

59. A method of treating a subject with a disease comprising: treating a subject with a disease with a nucleic acid sequence, wherein said nucleic acid sequence binds to, and / or inhibits, and / or competes with, mRNA sequences that bind to Actl protein, andwherein said disease is selected from cancer, liver cirrhosis, severe asthma, andCOPD.

60. The method of claim 59, wherein said cancer is a highly fibrotic cancer.

61. The method of claim 59, wherein said cancer is selected from: hepatocellular, gastric, esophageal, head and neck, colon, pancreatic, cervix, and vulvar cancers.

62. The method of claim 59, wherein at least a portion of said nucleic acid sequence is from a gene selected from a portion of: Hifla mRNA or an mRNA listed in Table 4.

63. The method of claim 59, wherein said nucleic acid sequence comprises an antisense or aptamer sequence.

64. The method of Claim 59, wherein said nucleic acid sequence comprises a sequence shown in any of SEQ ID NOs: 430-463 (table 5).

65. The method of Claim 59, wherein said nucleic acid sequence comprises RNA bases.

66. The method of Claim 59, wherein said nucleic acid sequence comprises DNA bases.

67. The method of Claim 59, wherein said subject is human.

68. The method of Claim 59, wherein said nucleic acid sequence is from a human gene.

69. The method of Claim 59, wherein said mRNAs are human mRNAs.

70. The method of Claim 59, wherein said nucleic acid sequence is between 12 and 100 nucleotides in length.

71. The method of claim 59, wherein said nucleic acid sequence comprises modified bases, optionally selected from: 2'-O-Methyl NTP or 1 -methylpseudouridine, and optionally, wherein said modified bases are prevalent in an amount that improves stability in vivo and / or reduces immunogenicity in vivo.