Compositions and methods for treating hypoxia-related conditions

Abstract

Provided are compositions and methods for treating hypoxia-related conditions. The compositions comprise a hypoxia-inducible factor (HIF) interfering nucleic acid encapsulated by a neutral or positively charged phospholipid component. Also provided are methods of making the disclosed compositions.

Description

COMPOSITIONS AND METHODS FOR TREATING HYPOXIA-RELATED CONDITIONSCROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to and the benefit of United States Provisional Patent Application Serial No. 63 / 637,783, filed April 23, 2024, the content of which is incorporated herein by this reference as if fully set forth herein.BACKGROUND

[0002] Despite significant strides in neonatal care for congenital diaphragmatic hernia (CDH) and other congenital cardiopulmonary conditions, mortality and morbidity persist at alarming rates. For example, with respect to CDH, cardiac dysfunction is emerging as a critical but poorly understood aspect of the condition. Postnatal cardiac complications in CDH neonates are rooted in complex fetal developmental factors, encompassing mechanical forces, visceral displacement, and altered blood flow dynamics, all of which disrupt cardiac structure and function. This disruption, characterized by reduced left atrial and ventricular blood volume and potential hindrance to cardiac growth, precipitates left ventricular dysfunction independently of pulmonary hypertension or right ventricular involvement. The heterogeneous clinical presentations of cardiac dysfunction, pulmonary hypertension, and respiratory failure underscore the necessity for personalized diagnosis and treatment strategies. While therapeutic interventions like inhaled nitric oxide and sildenafil show promise in very specific clinical scenarios, they pose risks in others, emphasizing the urgency for tailored approaches.BRIEF SUMMARY

[0003] Aspects of the present disclosure encompass compositions and methods relating to liposomal delivery of interfering nucleic acids for therapeutic purposes. Provided herein are methods to treat, inhibit, or ameliorate a hypoxia-related condition by administering to a subject an effective amount of one or more hypoxia-inducible factor (HIF) interfering nucleic acids in a liposomal delivery system as described herein. In some embodiments, the methods are to prenatally treat, inhibit, or ameliorate a hypoxia-related condition in a fetus by administering the composition to a pregnant subject. In some embodiments, the methods are to postnatally treat, inhibit, or ameliorate a hypoxia-related condition in a subject by administering the composition to the subject. Also provided are methods of making the compositions.

[0004] In one aspect, the disclosure provides compositions that include a hypoxia-inducible factor (HIF) interfering nucleic acid encapsulated by a phospholipid component. In someembodiments, the phospholipid component has a neutral or net zero charge. In some embodiments, the phospholipid component is positively charged. In some embodiments, the HIF interfering nucleic acid is selected from a group consisting of a hypoxia-inducible factor 2 alpha (HIF-2a) interfering nucleic acid, hypoxia-inducible factor 1 alpha (HIF- la) interfering nucleic acid, hypoxia-inducible factor 2 beta (HIF-2P) interfering nucleic acid, and hypoxia-inducible factor 1 beta (HIF-ip) interfering nucleic acid. In certain embodiments, the HIF-interfering nucleic acid is a HIF-2a interfering nucleic acid. In some embodiments, the HIF interfering nucleic acid is selected from a group consisting of a small interfering RNA (siRNA), short hairpin RNA (shRNA), single-stranded interfering RNA (ss-siRNA), and microRNA (miRNA). In certain embodiments, the HIF-interfering nucleic acid is a siRNA. In particular embodiments, the HIF interfering nucleic acid is a HIF-2a siRNA. In some embodiments, the HIF interfering nucleic acid comprises 15 to 30 nucleotides. In some embodiments, the HIF interfering nucleic acid comprises SEQ ID NO: 1 and / or SEQ ID NO: 2.

[0005] In some embodiments, the phospholipid component has a neutral or net zero charge and comprises a neutral phospholipid selected from a group consisting of dipalmitoylphosphatidylcholine (DPPC), di oleoyl-sn-glycero-3 -phosphocholine (DOPC), egg phosphatidylcholine (EPC), dilauryloylphosphatidylcholine (DLPC), dimyristoylphosphatidylcholine (DMPC), distearoylphosphatidylcholine (DSPC), l-myristoyl-2- palmitoyl phosphatidylcholine (MPPC), l-palmitoyl-2-myristoyl phosphatidylcholine (PMPC), l-palmitoyl-2-stearoyl phosphatidylcholine (PSPC), l-stearoyl-2-palmitoyl phosphatidylcholine (SPPC), dimyristoyl phosphatidylcholine (DMPC), l,2-diarachidoyl-sn-glycero-3- phosphocholine (DAPC), l,2-dibehenoyl-sn-glycero-3 -phosphocholine (DBPC), 1,2- dieicosenoyl-sn-glycero-3 -phosphocholine (DEPC), palmitoyloleoyl phosphatidylcholine (POPC), lysophosphatidylcholine (LPC), dilinoleoylphosphatidylcholine (DLPC), distearoylphosphatidylethanolamine (DSPE), dimyristoylphosphatidylethanolamine (DMPE), dipalmitoyl phosphatidylethanolamine (DPPE), palmitoyloleoyl phosphatidylethanolamine (POPE), lysophosphatidylethanolamine (LPE), and a combination thereof. In certain embodiments, the neutral phospholipid component comprises DPPC, DOPC, or a combination thereof. In certain embodiments, the neutral phospholipid component comprises DPPC and DOPC in a 7:3 w / w ratio. In certain embodiments, the HIF-interfering nucleic acid is mixed with the phospholipid component in a 1 : 10 w / w ratio. The compositions may further include a pharmaceutically acceptable carrier.

[0006] In some embodiments, the phospholipid component is positively charged. In some embodiments, the phospholipid component comprises a cationic lipid, a multivalent cationic lipid,an ionizable lipid, a certest ionizable lipid, a fixed cationic lipid, or a certest lipid. In some embodiments the cationic lipid is stearylamine. In certain embodiments, the phospholipid component comprises l,2-dioleoyl-sn-glycero-3 -phosphocholine stearylamine (DOPC- stearylamine). In some embodiments the multivalent cationic lipid is selected from a group consisting of N,N-ditetradecylamine-polylysine (N-TETAMINE-pLys40), Nl-[2-((lS)-l-[(3- aminopropyl)amino]-4-[di(3-amino-propyl)amino]butylcarboxamido)ethyl]-3,4-di[oleyloxy]- benzamide (MVL5), 2,3-dioleyloxy-N-[2-(sperminecarboxamido)ethyl]-N,N-dimethyl-l- propanaminium HC1 salt (DOSPA), and N4-Cholesteryl-Spermine HC1 Salt (GL67). In some embodiments the ionizable lipid is selected from a group consisting of 3B-[N-(N’,N’- dimethylaminoethane)-carbamoyl]cholesterol hydrochloride (DC-Cholesterol HC1), 3B-[N- (N’ ,N’ -dimethylaminoethane)-carbamoyl]cholesterol(d7) hydrochloride (DC-cholesterol-d7), (Z)-non-2-en- 1 -yl 6-((((2-(dimethylamino)ethyl)thio)carbonyl)(6-oxo-6-(pentadecan-8- yloxy)hexyl)amino)hexanoate (ATX-95), (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3- (diethylamino)propoxy)carbonyl)oxy)methyl)propyloctadeca-9,12-di enoate (LP-01), heptadecan-9-yl 8-((2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (SM-102), N- (4-carboxybenzyl)-N,N-dimethyl-2,3-bis(oleoyloxy)propan-l-aminium (DOBAQ), 1, l’-((2-(4- (2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-l- yl)ethyl)azanediyl)bis(dodecan-2-ol) (C12-200), dipalmitoyl-rac-glycero-3-carbobetaine (16:0 CB (DPCB)), dipalmitoyl-rac-glycero-3-sulfobetaine (16:0 SB (DPSB)), l,2-distearoyl-3- dimethylammonium-propane (18:0 DAP), l,2-dipalmitoyl-3-dimethylammonium-propane (16:0 DAP), l,2-dimyristoyl-3-dimethylammonium-propane (14:0 DAP), l,2-distearoyl-3- dimethylammonium-propane (18: 1 DAP), 1,2-di oleyl oxy-3 -dimethylaminopropane (DODMA), 6-((2-hexyldecanoyl)oxy)-N-(6-((2-hexyldecanoyl)oxy)hexyl)-N-(4-hydroxybutyl)hexan-l- aminium (ALC-0315), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4- (dimethylamino)butanoate (Dlin-MC3-DMA), and 3,6-bis(4-(bis(2- hydroxydodecyl)amino)butyl)piperazine-2, 5-dione (cKK-E12). In some embodiments the certest ionizable lipid is selected from a group consisting of Octyl 2-methyl-14-((3-(octyloxy)-3- oxopropyl)thio)-6,9-dioxo-7-(2-((3-oxo-3-(tridecyloxy)propyl)thio)ethyl)-17-thia-2,5,8- triazaicosan-20-oate (CP-LC-1067), 2-hexyldecyl 3-((4-((2-(dimethylamino)ethyl)amino)-3-(2- hexyldecanamido)-4-oxobutyl)thio)propanoate (CP-LC-0729), and 6-methylheptyl 7-(2-((3-((2- hexyldecyl)oxy)-3-oxopropyl)thio)ethyl)-2-methyl-14-((3-((6-methylheptyl)oxy)-3- oxopropyl)thio)-6,9-dioxo-17-thia-2,5,8-triazaicosan-20-oate (CP-LC-1421). In some embodiments the fixed cationic lipids are selected from a group consisting of N-(2-hydroxyethyl)- N,N-dimethyl-2,3-bis(oleoyloxy)propan-l-aminium bromide (DORI), O,O’-ditetradecanoyl-N-(a-trimethylammonioacetyl)di ethanolamine chloride (DC-6-14), l,2-dilauroyl-sn-glycero-3- ethylphosphocholine (chloride salt) (12:0 EPC (Cl Salt)), l,2-dimyristoyl-sn-glycero-3- ethylphosphocholine (chloride salt) (14:0 EPC (Cl Salt)), l,2-dipalmitoyl-sn-glycero-3- ethylphosphocholine (chloride salt) (16:0 EPC (Cl Salt)), l,2-distearoyl-sn-glycero-3- ethylphosphocholine (chloride salt)(18:0 EPC (Cl Salt)), l,2-dioleoyl-sn-glycero-3- ethylphosphocholine (chloride salt) (18: 1 EPC (Cl Salt)), l-palmitoyl-2-oleoyl-sn-glycero-3- ethylphosphocholine (chloride salt) (16:0-18: 1 EPC (Cl Salt)), l,2-dimyristoleoyl-sn-glycero-3- ethylphosphocholine (Tf salt) (14: 1 EPC (Tf Salt)), Dimethyldioctadecylammonium (Bromide Salt) (18:0 DDAB), l,2-dimyristoyl-3-trimethylammonium-propane (chloride salt) (14:0 TAP), l,2-dipalmitoyl-3-trimethylammonium-propane (chloride salt) (16:0 TAP), l,2-stearoyl-3- trimethylammonium-propane (chloride salt) (18:0 TAP), l,2-dioleoyl-3-trimethylammonium- propane (chloride salt) (18: 1 TAP (DOTAP)), l,2-dioleoyl-3-trimethylammonium-propane (methyl sulfate salt) (18: 1 TAP (DOTAP, MS Salt)), and l,2-di-O-octadecenyl-3- trimethylammonium propane (chloride salt) (DOTMA). In some embodiments the certest lipids are selected from a group consisting of Octyl 2-methyl-14-((3-(octyloxy)-3-oxopropyl)thio)-6,9- dioxo-7-(2-((3-oxo-3-(tridecyloxy)propyl)thio)ethyl)-17-thia-2,5,8-triazaicosan-20-oate (CP-LC- 1067), 2-hexyldecyl 3-((4-((2-(dimethylamino)ethyl)amino)-3-(2-hexyldecanamido)-4- oxobutyl)thio)propanoate (CP-LC-0729), and 6-methylheptyl 7-(2-((3-((2-hexyldecyl)oxy)-3- oxopropyl)thio)ethyl)-2-methyl-14-((3-((6-methylheptyl)oxy)-3-oxopropyl)thio)-6,9-dioxo-17- thia-2,5,8-triazaicosan-20-oate (CP-LC-1421). In certain embodiments, the positively charged phospholipid component comprises DOPC and stearylamine in a 7:3 w / w ratio. In certain embodiments, the HIF -interfering nucleic acid is mixed with the phospholipid component in a 1 : 10 w / w ratio. The compositions may further include a pharmaceutically acceptable carrier.

[0007] In another aspect, the disclosure provides methods for treating a hypoxia-related condition. The methods include administering to a subject in need thereof a composition comprising a hypoxia-inducible factor (HIF) interfering nucleic acid encapsulated by a phospholipid component. In some embodiments, the phospholipid component comprises a neutral phospholipid. In some embodiments, the phospholipid component is positively charged. In some embodiments, the hypoxia-related condition is selected from a group consisting of congenital diaphragmatic hernia (CDH), pulmonary hypoplasia, pulmonary atresia, congenital pulmonary airway malformation, congenital anatomic cardiac disease, prenatal cardiac dysfunction, ectopic cordis, atrial septal defect (ASD), cleft lip, cleft palate, craniosynostosis, esophageal atresia, anophthalmia and microphthalmia, inflammation, tricuspid atresia, truncus arteriosus (TA), chorioamnionitis, cytomegalovirus infection, congenital rubella infection, congenital toxoplasmosis,acute respiratory distress syndrome, restrictive lung disease, and idiopathic pulmonary fibrosis (IPF). In some embodiments, the hypoxia-related condition is a cardiac disease or condition selected from a group consisting of congenital anatomic cardiac disease, prenatal cardiac dysfunction, and ectopic cordis. In other embodiments, the hypoxia-related condition is a pulmonary disease or condition selected from a group consisting of CDH, pulmonary hypoplasia, pulmonary atresia, and congenital pulmonary airway malformation. In certain embodiments, the hypoxia-related condition is CDH, and the HIF-interf ering nucleic acid encapsulated by the neutral phospholipid component is administered to a pregnant subject with a fetus that has CDH. In some embodiments, the HIF interfering nucleic acid is selected from a group consisting of a hypoxia-inducible factor 2 alpha (HIF-2a) interfering nucleic acid, hypoxia-inducible factor 1 alpha (HIF- la) interfering nucleic acid, hypoxia-inducible factor 2 beta (HIF-2P) interfering nucleic acid, and hypoxia-inducible factor 1 beta (HIF-ip) interfering nucleic acid. In certain embodiments, the HIF-interfering nucleic acid is a HIF-2a interfering nucleic acid. In some embodiments, the HIF interfering nucleic acid is selected from a group consisting of a small interfering RNA (siRNA), short hairpin RNA (shRNA), single-stranded interfering RNA (ss- siRNA), and microRNA (miRNA). In certain embodiments, the HIF-interfering nucleic acid is a siRNA. In some embodiments, the HIF interfering nucleic acid comprises 15 to 30 nucleotides. In certain embodiments, the HIF interfering nucleic acid comprises SEQ ID NO: 1 and / or SEQ ID NO: 2. In some embodiments, the phospholipid component has a neutral or net zero charge and comprises a neutral phospholipid selected from a group consisting of dipalmitoylphosphatidylcholine (DPPC), di oleoyl-sn-glycero-3 -phosphocholine (DOPC), egg phosphatidylcholine (EPC), dilauryloylphosphatidylcholine (DLPC), dimyristoylphosphatidylcholine (DMPC), distearoylphosphatidylcholine (DSPC), l-myristoyl-2- palmitoyl phosphatidylcholine (MPPC), l-palmitoyl-2-myristoyl phosphatidylcholine (PMPC), l-palmitoyl-2-stearoyl phosphatidylcholine (PSPC), l-stearoyl-2-palmitoyl phosphatidylcholine (SPPC), dimyristoyl phosphatidylcholine (DMPC), l,2-diarachidoyl-sn-glycero-3- phosphocholine (DAPC), l,2-dibehenoyl-sn-glycero-3 -phosphocholine (DBPC), 1,2- dieicosenoyl-sn-glycero-3 -phosphocholine (DEPC), palmitoyloleoyl phosphatidylcholine (POPC), lysophosphatidylcholine (LPC), dilinoleoylphosphatidylcholine (DLPC), distearoylphosphatidylethanolamine (DSPE), dimyristoylphosphatidylethanolamine (DMPE), dipalmitoyl phosphatidylethanolamine (DPPE), palmitoyloleoyl phosphatidylethanolamine (POPE), lysophosphatidylethanolamine (LPE), and a combination thereof. In certain embodiments, the neutral phospholipid component comprises DPPC, DOPC, or a combination thereof. In certain embodiments, the neutral phospholipid component comprises DPPC and DOPCin a 7:3 w / w ratio. In certain embodiments, the HIF -interfering nucleic acid is mixed with the phospholipid component in a 1 : 10 w / w ratio. The compositions may further include a pharmaceutically acceptable carrier.

[0008] In some embodiments, the phospholipid component is positively charged. In certain embodiments, the phospholipid component comprises a cationic lipid, a multivalent cationic lipid, an ionizable lipid, a certest ionizable lipid, a fixed cationic lipid, or a certest lipid. In some embodiments the cationic lipid is stearylamine. In certain embodiments, the phospholipid component comprises l,2-dioleoyl-sn-glycero-3 -phosphocholine stearylamine (DOPC- stearylamine). In some embodiments the multivalent cationic lipids are selected from a group consisting of N,N-ditetradecylamine-polylysine (N-TETAMINE-pLys40), Nl-[2-((lS)-l-[(3- aminopropyl)amino]-4-[di(3-amino-propyl)amino]butylcarboxamido)ethyl]-3,4-di[oleyloxy]- benzamide (MVL5), 2,3-dioleyloxy-N-[2-(sperminecarboxamido)ethyl]-N,N-dimethyl-l- propanaminium HC1 salt (DOSPA), and N4-Cholesteryl-Spermine HC1 Salt (GL67). In some embodiments the ionizable lipids are selected from a group consisting of 3B-[N-(N’,N’- dimethylaminoethane)-carbamoyl]cholesterol hydrochloride (DC-Cholesterol HC1), 3B-[N- (N’ ,N’ -dimethylaminoethane)-carbamoyl]cholesterol(d7) hydrochloride (DC-cholesterol-d7), (Z)-non-2-en- 1 -yl 6-((((2-(dimethylamino)ethyl)thio)carbonyl)(6-oxo-6-(pentadecan-8- yloxy)hexyl)amino)hexanoate (ATX-95), (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3- (diethylamino)propoxy)carbonyl)oxy)methyl)propyloctadeca-9,12-di enoate (LP-01), heptadecan-9-yl 8-((2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (SM-102), N- (4-carboxybenzyl)-N,N-dimethyl-2,3-bis(oleoyloxy)propan-l-aminium (DOBAQ), 1, l’-((2-(4- (2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-l- yl)ethyl)azanediyl)bis(dodecan-2-ol) (C12-200), dipalmitoyl-rac-glycero-3-carbobetaine (16:0 CB (DPCB)), dipalmitoyl-rac-glycero-3-sulfobetaine (16:0 SB (DPSB)), l,2-distearoyl-3- dimethylammonium-propane (18:0 DAP), l,2-dipalmitoyl-3-dimethylammonium-propane (16:0 DAP), l,2-dimyristoyl-3-dimethylammonium-propane (14:0 DAP), l,2-distearoyl-3- dimethylammonium-propane (18: 1 DAP), 1,2-di oleyl oxy-3 -dimethylaminopropane (DODMA), 6-((2-hexyldecanoyl)oxy)-N-(6-((2-hexyldecanoyl)oxy)hexyl)-N-(4-hydroxybutyl)hexan-l- aminium (ALC-0315), and (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4- (dimethylamino)butanoate (Dlin-MC3-DMA), 3,6-bis(4-(bis(2- hydroxydodecyl)amino)butyl)piperazine-2, 5-dione (cKK-E12). In some embodiments the certest ionizable lipids are selected from a group consisting of: Octyl 2-methyl-14-((3-(octyloxy)-3- oxopropyl)thio)-6,9-dioxo-7-(2-((3-oxo-3-(tridecyloxy)propyl)thio)ethyl)-17-thia-2,5,8- triazaicosan-20-oate (CP-LC-1067), 2-hexyldecyl 3-((4-((2-(dimethylamino)ethyl)amino)-3-(2-hexyldecanamido)-4-oxobutyl)thio)propanoate (CP-LC-0729), and 6-methylheptyl 7-(2-((3-((2- hexyldecyl)oxy)-3-oxopropyl)thio)ethyl)-2-methyl-14-((3-((6-methylheptyl)oxy)-3- oxopropyl)thio)-6,9-dioxo-17-thia-2,5,8-triazaicosan-20-oate (CP-LC-1421). In some embodiments the fixed cationic lipids are selected from a group consisting of N-(2- hydroxyethyl)-N,N-dimethyl-2,3-bis(oleoyloxy)propan-l-aminium bromide (DORI), 0,0’- ditetradecanoyl-N-(a-trimethylammonioacetyl)di ethanolamine chloride (DC-6-14), 1,2- dilauroyl-sn-glycero-3-ethylphosphocholine (chloride salt) (12:0 EPC (Cl Salt)), 1,2-dimyristoyl- sn-glycero-3 -ethylphosphocholine (chloride salt) (14:0 EPC (Cl Salt)), 1,2-dipalmitoyl-sn- glycero-3 -ethylphosphocholine (chloride salt) (16:0 EPC (Cl Salt)), l,2-distearoyl-sn-glycero-3- ethylphosphocholine (chloride salt)(18:0 EPC (Cl Salt)), l,2-dioleoyl-sn-glycero-3- ethylphosphocholine (chloride salt) (18: 1 EPC (Cl Salt)), l-palmitoyl-2-oleoyl-sn-glycero-3- ethylphosphocholine (chloride salt) (16:0-18: 1 EPC (Cl Salt)), l,2-dimyristoleoyl-sn-glycero-3- ethylphosphocholine (Tf salt) (14: 1 EPC (Tf Salt)), Dimethyldioctadecylammonium (Bromide Salt) (18:0 DDAB), l,2-dimyristoyl-3-trimethylammonium-propane (chloride salt) (14:0 TAP), l,2-dipalmitoyl-3-trimethylammonium-propane (chloride salt) (16:0 TAP), l,2-stearoyl-3- trimethylammonium-propane (chloride salt) (18:0 TAP), l,2-dioleoyl-3-trimethylammonium- propane (chloride salt) (18: 1 TAP (DOTAP)), l,2-dioleoyl-3-trimethylammonium-propane (methyl sulfate salt) (18: 1 TAP (DOTAP, MS Salt)), and l,2-di-O-octadecenyl-3- trimethylammonium propane (chloride salt) (DOTMA). In some embodiments the certest lipids are selected from a group consisting of : Octyl 2-methyl-14-((3-(octyloxy)-3-oxopropyl)thio)-6,9- dioxo-7-(2-((3-oxo-3-(tridecyloxy)propyl)thio)ethyl)-17-thia-2,5,8-triazaicosan-20-oate (CP-LC- 1067), 2-hexyldecyl 3-((4-((2-(dimethylamino)ethyl)amino)-3-(2-hexyldecanamido)-4- oxobutyl)thio)propanoate (CP-LC-0729), and 6-methylheptyl 7-(2-((3-((2-hexyldecyl)oxy)-3- oxopropyl)thio)ethyl)-2-methyl-14-((3-((6-methylheptyl)oxy)-3-oxopropyl)thio)-6,9-dioxo-17- thia-2,5,8-triazaicosan-20-oate (CP-LC-1421). In certain embodiments, the positively charged phospholipid component comprises DOPC and stearylamine in a 7:3 w / w ratio. In certain embodiments, the HIF -interfering nucleic acid is mixed with the phospholipid component in a 1 : 10 w / w ratio. The compositions may further include a pharmaceutically acceptable carrier.

[0009] In another aspect, the disclosure provides methods for producing the disclosed compositions comprising a hypoxia-inducible factor (HIF) interfering nucleic acid encapsulated by a phospholipid component. In some embodiments, the methods include mixing a first phospholipid, a second phospholipid, and a HIF interfering nucleic acid. In other embodiments, the methods include mixing a phospholipid, a cationic lipid, and a HIF -interfering nucleic acid. In some embodiments, the HIF interfering nucleic acid is selected from a group consisting of ahypoxia-inducible factor 2 alpha (HIF-2a) interfering nucleic acid, hypoxia-inducible factor 1 alpha (HIF-la) interfering nucleic acid, hypoxia-inducible factor 2 beta (HIF-2P) interfering nucleic acid, and hypoxia-inducible factor 1 beta (HIF-ip) interfering nucleic acid. In certain embodiments, the HIF interfering nucleic acid is a HIF-2a interfering nucleic acid (e.g., a HIF-2a siRNA). In some embodiments, the HIF interfering nucleic acid is selected from a group consisting of a small interfering RNA (siRNA), short hairpin RNA (shRNA), single-stranded interfering RNA (ss-siRNA), and microRNA (miRNA). In certain embodiments, the HIF- interfering nucleic acid is a siRNA. In some embodiments, the HIF interfering nucleic acid comprises 15 to 30 nucleotides. In certain embodiments, the HIF interfering nucleic acid comprises SEQ ID NO: 1 and / or SEQ ID NO: 2. In some embodiments, the phospholipid component has a neutral or net zero charge and comprises a neutral phospholipid component selected from a group consisting of dipalmitoylphosphatidylcholine (DPPC), dioleoyl-sn-glycero- 3 -phosphocholine (DOPC), egg phosphatidylcholine (EPC), dilauryloylphosphatidylcholine (DLPC), dimyristoylphosphatidylcholine (DMPC), distearoylphosphatidylcholine (DSPC), 1- myristoyl-2-palmitoyl phosphatidylcholine (MPPC), l-palmitoyl-2-myristoyl phosphatidylcholine (PMPC), l-palmitoyl-2-stearoyl phosphatidylcholine (PSPC), l-stearoyl-2- palmitoyl phosphatidylcholine (SPPC), dimyristoyl phosphatidylcholine (DMPC), 1,2- diarachidoyl-sn-glycero-3-phosphocholine (DAPC), l,2-dibehenoyl-sn-glycero-3- phosphocholine (DBPC), l,2-dieicosenoyl-sn-glycero-3 -phosphocholine (DEPC), palmitoyloleoyl phosphatidylcholine (POPC), lysophosphatidylcholine (LPC), dilinoleoylphosphatidylcholine (DLPC), distearoylphosphatidylethanolamine (DSPE), dimyristoylphosphatidylethanolamine (DMPE), dipalmitoyl phosphatidylethanolamine (DPPE), palmitoyloleoyl phosphatidylethanolamine (POPE), lysophosphatidylethanolamine (LPE), and a combination thereof. In certain embodiments, the neutral phospholipid component comprises DPPC, DOPC, or a combination thereof. In certain embodiments, the neutral phospholipid component comprises DPPC and DOPC in a 7:3 w / w ratio. In certain embodiments, the HIF- interfering nucleic acid is mixed with the phospholipid component in a 1:10 w / w ratio.

[0010] In some embodiments, the phospholipid component is positively charged. In certain embodiments, the phospholipid component comprises a cationic lipid, a multivalent cationic lipid, an ionizable lipid, a certest ionizable lipid, a fixed cationic lipid, or a certest lipid. In some embodiments the cationic lipid is stearylamine. In certain embodiments, the phospholipid component comprises l,2-dioleoyl-sn-glycero-3 -phosphocholine stearylamine (DOPC- stearylamine). In some embodiments the multivalent cationic lipids are selected from a group consisting of N,N-ditetradecylamine-polylysine (N-TETAMINE-pLys40), Nl-[2-((lS)-l-[(3-aminopropyl)amino]-4-[di(3-amino-propyl)amino]butylcarboxamido)ethyl]-3,4-di[oleyloxy]- benzamide (MVL5), 2,3-dioleyloxy-N-[2-(sperminecarboxamido)ethyl]-N,N-dimethyl-l- propanaminium HC1 salt (DOSPA), and N4-Cholesteryl-Spermine HC1 Salt (GL67). In some embodiments the ionizable lipids are selected from a group consisting of 3B-[N-(N’,N’- dimethylaminoethane)-carbamoyl]cholesterol hydrochloride (DC-Cholesterol HC1), 3B-[N- (N’ ,N’ -dimethylaminoethane)-carbamoyl]cholesterol(d7) hydrochloride (DC-cholesterol-d7), (Z)-non-2-en- 1 -yl 6-((((2-(dimethylamino)ethyl)thio)carbonyl)(6-oxo-6-(pentadecan-8- yloxy)hexyl)amino)hexanoate (ATX-95), (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3- (diethylamino)propoxy)carbonyl)oxy)methyl)propyloctadeca-9,12-di enoate (LP-01), heptadecan-9-yl 8-((2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (SM-102), N- (4-carboxybenzyl)-N,N-dimethyl-2,3-bis(oleoyloxy)propan-l-aminium (DOBAQ), 1 , 1 ’ -((2-(4- (2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-l- yl)ethyl)azanediyl)bis(dodecan-2-ol) (C12-200), dipalmitoyl-rac-glycero-3-carbobetaine (16:0 CB (DPCB)), dipalmitoyl-rac-glycero-3-sulfobetaine (16:0 SB (DPSB)), l,2-distearoyl-3- dimethylammonium-propane (18:0 DAP), l,2-dipalmitoyl-3-dimethylammonium-propane (16:0 DAP), l,2-dimyristoyl-3-dimethylammonium-propane (14:0 DAP), l,2-distearoyl-3- dimethylammonium-propane (18: 1 DAP), 1,2-di oleyl oxy-3 -dimethylaminopropane (DODMA), 6-((2-hexyldecanoyl)oxy)-N-(6-((2-hexyldecanoyl)oxy)hexyl)-N-(4-hydroxybutyl)hexan-l- aminium (ALC-0315), and (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4- (dimethylamino)butanoate (Dlin-MC3-DMA), 3,6-bis(4-(bis(2- hydroxydodecyl)amino)butyl)piperazine-2, 5-dione (cKK-E12). In some embodiments the certest ionizable lipids are selected from a group consisting of: Octyl 2-methyl-14-((3-(octyloxy)-3- oxopropyl)thio)-6,9-dioxo-7-(2-((3-oxo-3-(tridecyloxy)propyl)thio)ethyl)-17-thia-2,5,8- triazaicosan-20-oate (CP-LC-1067), 2-hexyldecyl 3-((4-((2-(dimethylamino)ethyl)amino)-3-(2- hexyldecanamido)-4-oxobutyl)thio)propanoate (CP-LC-0729), and 6-methylheptyl 7-(2-((3-((2- hexyldecyl)oxy)-3-oxopropyl)thio)ethyl)-2-methyl-14-((3-((6-methylheptyl)oxy)-3- oxopropyl)thio)-6,9-dioxo-17-thia-2,5,8-triazaicosan-20-oate (CP-LC-1421). In some embodiments the fixed cationic lipids are selected from a group consisting of: N-(2- hydroxyethyl)-N,N-dimethyl-2,3-bis(oleoyloxy)propan-l-aminium bromide (DORI), O,O’- ditetradecanoyl-N-(a-trimethylammonioacetyl)di ethanolamine chloride (DC-6-14), 1,2- dilauroyl-sn-glycero-3-ethylphosphocholine (chloride salt) (12:0 EPC (Cl Salt)), 1,2-dimyristoyl- sn-glycero-3 -ethylphosphocholine (chloride salt) (14:0 EPC (Cl Salt)), 1,2-dipalmitoyl-sn- glycero-3 -ethylphosphocholine (chloride salt) (16:0 EPC (Cl Salt)), l,2-distearoyl-sn-glycero-3- ethylphosphocholine (chloride salt)(18:0 EPC (Cl Salt)), l,2-dioleoyl-sn-glycero-3-ethylphosphocholine (chloride salt) (18: 1 EPC (Cl Salt)), l-palmitoyl-2-oleoyl-sn-glycero-3- ethylphosphocholine (chloride salt) (16:0-18: 1 EPC (Cl Salt)), l,2-dimyristoleoyl-sn-glycero-3- ethylphosphocholine (Tf salt) (14: 1 EPC (Tf Salt)), Dimethyldioctadecylammonium (Bromide Salt) (18:0 DDAB), l,2-dimyristoyl-3-trimethylammonium-propane (chloride salt) (14:0 TAP), l,2-dipalmitoyl-3-trimethylammonium-propane (chloride salt) (16:0 TAP), l,2-stearoyl-3- trimethylammonium-propane (chloride salt) (18:0 TAP), l,2-dioleoyl-3-trimethylammonium- propane (chloride salt) (18: 1 TAP (DOTAP)), l,2-dioleoyl-3-trimethylammonium-propane (methyl sulfate salt) (18: 1 TAP (DOTAP, MS Salt)), and l,2-di-O-octadecenyl-3- trimethylammonium propane (chloride salt) (DOTMA). In some embodiments the certest lipids are selected from a group consisting of : Octyl 2-methyl-14-((3-(octyloxy)-3-oxopropyl)thio)-6,9- dioxo-7-(2-((3-oxo-3-(tridecyloxy)propyl)thio)ethyl)-17-thia-2,5,8-triazaicosan-20-oate (CP-LC- 1067), 2-hexyldecyl 3-((4-((2-(dimethylamino)ethyl)amino)-3-(2-hexyldecanamido)-4- oxobutyl)thio)propanoate (CP-LC-0729), and 6-methylheptyl 7-(2-((3-((2-hexyldecyl)oxy)-3- oxopropyl)thio)ethyl)-2-methyl-14-((3-((6-methylheptyl)oxy)-3-oxopropyl)thio)-6,9-dioxo-17- thia-2,5,8-triazaicosan-20-oate (CP-LC-1421). In certain embodiments, the positively charged phospholipid component comprises DOPC and stearylamine in a 7:3 w / w ratio. In certain embodiments, the HIF -interfering nucleic acid is mixed with the phospholipid component in a 1 : 10 w / w ratio.BRIEF DESCRIPTION OF THE DRAWINGS

[0011] FIG 1 provides representative transmission electron microscopy (TEM) images of the myocardium of control (normal) and CDH prenatal Sprague-Dawley pups, showing abnormal shape, vacuolization, cristae loss, and a less dense mitochondrial matrix.

[0012] FIGS. 2A-2D demonstrate elevated hypoxia levels and overexpression of HIF-2a in CDH. FIG. 2A is a graph showing the hypoxia-probe intensity in (normal) and CDH prenatal Sprague-Dawley pups. FIG. 2B provides images of Western blots showing the expression of HIF- 2a or a control marker (a-tubulin) in control pups or CDH. FIG. 2C is a graph of the relative intensity of HIF-2a in the Western blots. FIG. 2D is a graph of the relative intensity of HIF-2a determined by confocal microscopy analysis.

[0013] FIGS. 3A-3B are schematic diagrams of the prenatal hypoxia intervention system according to certain embodiments of the disclosure. FIG. 3 A depicts the production of liposomal siHIF-2a, its delivery in a model system to prenatal rodents, and analysis of the effects on lung and cardiac tissues of the prenatal rodents. FIG. 3B depicts an embodiment of the liposomal delivery system in which siHIF-2a is encapsulated by l,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) and l,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC). The Sprague- Dawley rats were treated by intravenous injection of liposomal siHIF-2a at days 14, 17, and 20.

[0014] FIG. 4 is a graph demonstrating the uptake of liposomal siRNA by prenatal heart tissues as shown by confocal microscopy. The graph shows the relative intensity observed in cardiac tissues of control pups, CDH pups, CDH pups treated with a liposomal control siRNA, and CDH pups treated with liposomal siHIF-2a (n = 3, P < 0.05).

[0015] FIGS. 5A-5C demonstrate the expression of HIF-2a in normal and CDH-associated cardiac dysfunction. FIG. 5A provides images of Western blots showing the expression of HIF- 2a, as well as a control marker, a-tubulin, in control pups, CDH pups, or CDH pups treated with liposomal siHIF-2a. FIG. 5B is a graph of the relative intensity of HIF-2a in the Western blots. FIG. 5C is a graph of the relative intensity of HIF-2a in confocal microscopy analysis of cardiac tissue.

[0016] FIGS. 6A-6E demonstrate the effect of liposomal siHIF-2a on prenatal cardio-metabolic gene remodeling in CDH-associated cardiac dysfunction. FIG. 6A provides images of Western blots showing the expression of mitochondrial and fatty acid biogenesis markers, PGC-la, PPARa, ACADVL, and ACADS, as well as a control marker, P-actin. FIGS. 6B-6E are graphs of the relative intensity of PGC-la (FIG. 6B), PPARa (FIG. 6C), ACADVL (FIG. 6D), and ACADS (FIG. 6E) in control pups, CDH pups, or CDH pups treated with liposomal siHIF-2a.

[0017] FIGS. 7A-7D demonstrate the effect of liposomal siHIF-2a on the prenatal cardiac- ventricular mitochondrial proteins and ultrastructure. FIG. 7A-7B provide images of Western blots showing the expression of mtDNA-encoded proteins, CytB, MT-ND4L, as well as control marker P-actin. FIGS. 7C-7D are graphs of the relative intensity of CytB (FIG. 7C) and MT-ND4L (FIG. 7D) in control pups, CDH pups, or CDH pups treated with liposomal siHIF-2a.

[0018] FIGS. 8A-8B demonstrate the effect of liposomal siHIF-2a on prenatal cardio- ventricular mitochondrial ultrastructure. FIG. 8A provides representative TEM images of ventricular tissues (right (top images) or left (bottom images)) of normal pups (left images), CDH pups (middle images), or CDH pups treated with liposomal siHIF-2a (right images). Magnifications of the images is 26,300*, and the scale bars = 100 nm. FIG. 8B is a graph of the relative intensity of the mitochondrial density in the pups (n=3 for each category).

[0019] FIGS. 9A-9B are graphs showing the impact of liposomal siHIF-2a on the oxygenation of prenatal rodents as shown by oxygen saturation (SpO2) (FIG. 9A) or heart rate (FIG. 9B).

[0020] FIGS. 10A-10F are graphs demonstrating the effect of liposomal siHIF-2a on the oxygenation of prenatal rodents. The effect was assessed with respect to the systolic right ventricle diameter (FIG. 10 A), diastolic right ventricle diameter (FIG. 10B), diastolic right ventricle freewall size (FIG. IOC), peak velocity (FIG. 10D), velocity time integral (FIG. 10E), and resistance index (FIG. 10F).

[0021] FIGS. 11 A-l IB depict an embodiment of the methods to induce nitrofen-induced CDH in the Sprague Dawley model. FIG. 11B shows the oxygen saturation of newborn offspring in control versus CDH (Mouse Ox measurements).

[0022] FIGS. 12A-12D demonstrate the postnatal effects of nitrofen -induced congenital diaphragmatic hernia (CDH) observed in the lungs of Sprague-Dawley rodent neonates, providing evidence of postnatal hypoxia. FIG. 12A is a Western blot showing increased siHIF-la and siHIF- 2a expression in CDH as compared to controls. FIG. 12B provides hypoxia probe quantification that shows evidence of postnatal hypoxia in the lungs of pups of rodents exposed to 4% oxygen (“4% hypoxia”) or CDH rodents, as compared to the control rodents. The hypoxy probe stains pink, and the relative intensity is shown in the graph. FIGS. 12C-12D depict the quantification of Western blot intensity, showing increased expression of siHIF-la and siHIF-2a in CDH as compared to controls.

[0023] FIGS. 13A-13D demonstrate the prenatal effects of nitrofen-induced congenital diaphragmatic hernia (CDH) observed in the lungs of Sprague-Dawley rodent neonates, providing evidence of prenatal hypoxia. FIG. 13A is a Western blot showing increased siHIF-la and siHIF- 2a expression observed in the left pulmonary parenchyma of control or CDH rodents. FIG. 13B shows the hypoxyprobe quantification of intensity observed in control versus CDH rodents. FIGS. 13C-13D depict the quantification of Western blot intensity, showing increased expression of siHIF-la and siHIF-2a in CDH as compared to controls.

[0024] FIGS. 14A-14B depict an embodiment of the Sprague Dawley model for CDH and prenatal treatment with siHIF-2a. FIG. 14B depicts the quantification of Western blot data for siHIF-2a expression in the lungs of control rodents, CDH rodents, and CDH rodents after prenatal liposome siHif2a RNA delivery.

[0025] FIGS. 15A-15B depict the effect of Hif2a modulation on heart rate (FIG. 15A) and oxygenation (FIG. 15B) for rodents at 20 minutes of life. Results are shown for control, CDH, and CDH+liposomal siHif2a rodents.

[0026] FIGS. 16A-16F demonstrate the effects of prenatal delivery of liposomal siHIF-2a on inflammation (Western blot data (FIGS. 16A-16B, 16C, 16E) or RT-PCR data (FIGS. 16D and 16F)). FIG. 16A is a Western blot comparing the postnatal and prenatal effect on inflammation.

[0027] FIG. 17A demonstrates the delivery of the liposomal siHif2a RNA to various tissues. FIG. 17B shows the quantification of Cy5-stained liposomes that reached the lungs.

[0028] FIG. 18A-18F demonstrate the effect of prenatal delivery of positively charged liposomal siHIF-2a on inflammation in lung tissue. FIG. 18A and FIG. 18D are Western blots comparing the effect observed after delivery of siHIF-2a (FIGS. 18A-18C) as compared to siControl (FIGS. 18D-18F). FIGS. 18B-18C and 18E-18F depict the quantification of Western blot intensity, showing reduced expression of inflammation markers IL-6 and NFkb after delivery of liposomal positively charged siHIF-2a.DETAILED DESCRIPTIONI. Introduction

[0029] The heterogeneous clinical presentations of cardiac dysfunction, pulmonary hypertension, and pulmonary hypoplasia, resulting in respiratory failure in neonatal CDH, as an example, provide motivation for the development of personalized diagnosis and treatment strategies for these patients. Although certain therapeutic interventions (e.g., inhaled nitric oxide and sildenafil) are presently available for specific cardiopulmonary issues, they pose risks for certain clinical situations, emphasizing the urgency for tailored approaches. Surfactant systems have been described in the literature for endotracheal administration in neonates. However, they are not precise in their delivery, are misguided in their target, and may provide little improvement for clinical outcomes.

[0030] The present disclosure provides an innovative Prenatal Hypoxia Intervention System (PHIS) for hypoxia-inducible factor (HIF), and downstream molecule, modulation. This system allows for the precise downregulation of target genes by triggering the RNA interference (RNAi) mechanism, using HIF siRNA (e.g., HIF-2a) incorporated in neutral or positively-charged liposomes. Liposomes, nano-sized lipid-based vesicles, offer a promising avenue for delivering therapeutic payloads to the fetus by crossing the placental barrier or through carrier-mediated transport from mother to fetus, and with the potential to preferentially target specific organs or tissues. These liposomal carriers can encapsulate various drugs, nucleic acids, or other bioactive molecules, protecting them from degradation and enhancing their delivery efficiency. By leveraging the unique properties of these novel nanoliposomal formulations, such as the biocompatibility and ability to be tailored for specific cargo, safe and effective strategies are provided for treating fetal hypoxia-related diseases or conditions, while minimizing potential risks to both the mother and the unborn child. Therefore, the present disclosure provides compositions comprising a hypoxia-inducible factor (HIF) interfering nucleic acid encapsulated by a phospholipid component, as well as methods for treating hypoxia-related conditions.II. Terms and Definitions

[0031] A number of terms and concepts are discussed below. They are intended to facilitate the understanding of various embodiments of the present disclosure in conjunction with the rest of the present document and the accompanying figures. These terms and concepts may be further clarified and understood based on the accepted conventions in the fields of the present disclosure, as well as the description provided throughout the present document and / or the accompanying figures. Some other terms can be explicitly or implicitly defined in other sections of this document and in the accompanying figures and may be used and understood based on the accepted conventions in the fields of the present disclosure, the description provided throughout the present document, and / or the accompanying figures. The terms not explicitly defined can also be defined and understood based on the accepted conventions in the fields of the present disclosure and interpreted in the context of the present document and / or the accompanying figures.

[0032] Unless otherwise defined, all terms of art, notations, and other scientific or medical terms or terminology used herein are intended to have the meanings commonly understood by those of ordinary skill in the art. In some cases, terms with commonly understood meanings are defined herein for clarity and / or for ready reference, and the inclusion of such definitions herein should not be construed as representing a substantial difference over the definition of the term as generally understood in the art.

[0033] Articles “a” and “an” are used herein to refer to one or to more than one (i.e., at least one) of the grammatical object of the article. By way of example, “an element” means at least one element and can include more than one element.

[0034] The use herein of the terms “including,” “comprising,” or “having,” and variations thereof, is meant to encompass the elements listed thereafter and equivalents thereof as well as additional elements. Embodiments recited as “including,” “comprising,” or “having” certain elements are also contemplated as “consisting essentially of’ and “consisting of those certain elements.” As used herein, “and / or” refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations where interpreted in the alternative (“or”).

[0035] As used herein, the transitional phrase “consisting essentially of’ (and grammatical variants) is to be interpreted as encompassing the recited materials or steps “and those that do not materially affect the basic and novel characteristic(s)” of the claimed subject matter. See, for example, In re Herz, 537 F.2d 549, 551-52, 190 U.S.P.Q. 461, 463 (CCPA 1976) (emphasis in the original); see also MPEP §2111.03. Thus, the term “consisting essentially of’ as used herein should not be interpreted as equivalent to “comprising.”

[0036] The terms “about” and “approximately” as used herein shall generally mean an acceptable degree of error for the quantity measured given the nature or precision of the measurements. Exemplary degrees of error are within 20% (%); preferably, within 10%; and more preferably, within 5% of a given value or range of values. Any reference to “about X” or “approximately X” specifically indicates at least the values X, 0.95X, 0.96X, 0.97X, 0.98X, 0.99X, 1.01X, 1.02X, 1.03X, 1.04X, and 1.05X. Thus, expressions “about X” or “approximately X” are intended to teach and provide written support for a claim limitation of, for example, “0.98X .” Numerical quantities given herein are approximate unless stated otherwise, meaning that the term “about” or “approximately” can be inferred when not expressly stated. When “about” is applied to the beginning of a numerical range, it applies to both ends of the range.

[0037] As used throughout, the terms “nucleic acid,” “nucleic acid sequence,” “polynucleotide,” “oligonucleotide,” “nucleotides,” or other grammatical equivalents as used herein mean at least two nucleotides, either deoxyribonucleotides or ribonucleotides, or analogs thereof, covalently linked together. Polynucleotides are polymers of any length, including, e.g., 15, 20, 50, 100, 200, 300, 500, 1000, 2000, 3000, 5000, 7000, 10,000, etc. A polynucleotide described herein generally contains phosphodiester bonds, although in some cases, nucleic acid analogs are included that may have at least one different linkage, e.g., phosphoramidate, phosphorothioate, phosphorodithioate, or O-methyl phosphoroamidite linkages, and peptide nucleic acid backbones and linkages. Mixtures of naturally occurring polynucleotides and analogs can be made; alternatively, mixtures of different polynucleotide analogs, and mixtures of naturally occurring polynucleotides and analogs may be made. The following are non-limiting examples of polynucleotides: a gene or gene fragment, exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), ribozymes, complementary DNA (cDNA), complementary RNA (cRNA), recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after the assembly of the polymer. The sequence of nucleotides may be interrupted by nonnucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component. The term also includes both double- and singlestranded molecules. Unless otherwise specified or required, the term polynucleotide encompasses both the double-stranded form and each of two complementary single-stranded forms known or predicted to make up the double-stranded form. A polynucleotide is composed of a specific sequence of four nucleotide bases: adenine (A), cytosine (C), guanine (G), thymine (T), and uracil(U) for thymine when the polynucleotide is RNA. Thus, the term “polynucleotide sequence” is the alphabetical representation of a polynucleotide molecule. Unless otherwise indicated, a particular polynucleotide sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues.

[0038] Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof, alleles, orthologs, single nucleotide polymorphisms (SNPs), and complementary sequences as well as the sequence explicitly indicated. The terms “portion” and “fragment” are used interchangeably herein to refer to parts of a polypeptide, nucleic acid, or other molecular construct.

[0039] The term “identity” or “substantial identity,” as used in the context of a polynucleotide or polypeptide sequence described herein, refers to a sequence that has at least 60% sequence identity to a reference sequence (e.g., any one of SEQ ID Nos: 1-8). Alternatively, percent identity can be any integer from 60% to 100%. Exemplary embodiments include at least 60%, 65%, 70%, 75%, 80%, 85%, 88%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, as compared to a reference sequence using the programs described herein; preferably BLAST using standard parameters, as described below. One of ordinary skill in the art will recognize that these values can be appropriately adjusted to determine corresponding identity of proteins encoded by two nucleotide sequences by taking into account codon degeneracy, amino acid similarity, reading frame positioning, and the like.

[0040] For sequence comparison, typically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters. A “comparison window,” as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of alignment of sequences for comparison are well- known in the art. Optimal alignment of sequences for comparison may be conducted by the localhomology algorithm of Smith & Waterman, 1981, Add. APL. Math. 2:482, by the homology alignment algorithm of Needleman & Wunsch, 1970, J. Mol. Biol. 48:443, by the search for similarity method of Pearson & Lipman, 1988, Proc. Natl. Acad. Sci. (U.S.A.) 85: 2444, by computerized implementations of these algorithms (e.g., BLAST), or by manual alignment and visual inspection.

[0041] Algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul etal. 1990, J. Mol. Biol. 215: 403-10 and Altschul etal., 1977, Nucleic Acids Res. 25: 3389-402, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (NCBI) website. The algorithm involves first identifying high-scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al. (1977)). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a word size (W) of 28, an expectation (E) of 10, M=l, N=-2, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a word size (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, 1989, Proc. Natl. Acad. Sci. USA 89: 10915).

[0042] The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, 1993, Proc. Nat'L Acad. Sci. USA 90:5873-5787). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to thereference nucleic acid is less than about 0.01, more preferably less than about 10'5, and most preferably less than about IO'20.

[0043] As used herein, the terms “interfering nucleic acid,” “inhibitory nucleic acid,” and the like refer to a polynucleotide (e.g., oligonucleotide) that is an agent used to decrease or inhibit the expression of a target gene. The interfering nucleic acid may be, for example, a DNA oligonucleotide or an RNA oligonucleotide as described in more detail below.

[0044] The terms “expression” and “expressed” refer to the production of a transcriptional and / or translational product, e.g., of a nucleic acid sequence encoding a protein (e.g., a HIF protein). The level of expression of a DNA molecule in a cell may be assessed on the basis of either the amount of corresponding mRNA that is present within the cell or the amount of protein encoded by that DNA produced by the cell.

[0045] The term “gene” means the segment of DNA involved in producing a polypeptide chain. It may include regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons).

[0046] The phrase “complementary DNA” or “cDNA” refers to a synthetic DNA reverse- transcribed from RNA through the action of a reverse transcriptase. The cDNA may be singlestranded or double-stranded and can include strands that have either or both of a sequence that is substantially identical to a part of the RNA sequence or a complement to a part of the RNA sequence.

[0047] Other terms used in the fields of recombinant nucleic acid technology, microbiology, immunology, and molecular and cell biology as used herein will be generally understood by one of ordinary skill in the applicable arts.III. COMPOSITIONS TARGETING HIF PATHWAY

[0048] Compositions are provided for targeted treatment of a hypoxia-related disease or condition. In some embodiments, the compositions comprise a hypoxia-inducible factor (HIF) interfering nucleic acid encapsulated by a neutral phospholipid component. In some embodiments, the compositions comprise a HIF-interfering nucleic acid encapsulated by a positively charged phospholipid component.

[0049] Hypoxia-inducible factors (HIFs) are transcription factors that are involved in the physiological response to oxygen concentration. These genes are active under conditions of hypoxia (i.e., decrease in available oxygen in the cellular environment). Hypoxia impairs ATP production by mitochondria. HIFs include, for example, hypoxia-inducible factor 1 (HIF1) and hypoxia-inducible factor 2 (HIF2). HIFs consist of a and P subunits (e.g., HIF-la, HIF-ip, HIF-2a, HIF-2P), which each contain basic helix-loop-helix-PAS (bHLH-PAS) domains that mediate heterodimerization and DNA binding (See, e.g., Semenza, 2012, Cell 148(3):399-408). In the presence of oxygen, HIF is inactivated by posttranslational hydroxylation of specific amino acid residues within its a subunits. Under hypoxic conditions, the HIF heterodimer binds hypoxia response elements (HREs) at target gene loci and activates transcription. Much of mammalian embryogenesis occurs in a state of partial hypoxia (e.g., oxygen concentrations of 1-5%), and this state is believed to be necessary for normal development of the vascular and other systems in the fetus. However, periods of more severe hypoxia, for example, can cause birth defects (e.g., heart defects, limb defects, cleft lip / palate) (Webster & Abela, 2007, Birth Defects Research 81:215- 228). Increased HIF activity in embryonic tissues may result in dysregulation of development and congenital malformations.

[0050] HIF-1 is considered a master switch that allows cells to respond to falling oxygen levels. Many genes (as much as 10% of the genome) are transcriptionally activated by HIF-1 under hypoxic conditions, such as glucose transporters, glycolytic enzymes, and VEGF for angiogenesis (Semenza, 2006, Exp. Physiol. 91:803-806). Exemplary HIF-la and HIF-ip (also referred to as ARNT (aryl hydrocarbon receptor nuclear translocator)) nucleic acid sequences are shown in GenBank Accession numbers U22431.1 and AF001307.1 (SEQ ID Nos: 5 and 6). HIF -2 regulates the expression of genes such as, for example, mitochondrial and fatty acid biogenesis markers, PGC-la, PPARa, ACADVL, and ACADS. Exemplary HIF-2a (also referred to as EPAS1 (endothelial PAS domain protein 1)) and HIF-2P (also referred to as ARNT2 (aryl hydrocarbon receptor nuclear translocator 2)) nucleic acid sequences are shown in GenBank Accession numbers U81984.1 and NM_014862.4 (SEQ ID Nos: 7 and 8). HIF-2a is expressed most abundantly in embryonic development stage and adult vascular endothelial cells, lungs, placenta, and heart; HIF-la has a ubiquitous expression in all analyzed mammalian tissues and cell types.

[0051] In some embodiments, the interfering nucleic acid may be a DNA oligonucleotide or an RNA oligonucleotide. In some embodiments, the interfering nucleic acid may target an mRNA transcript of HIF-la, HIF-ip, HIF -2a, or HIF-2P for cleavage and degradation. In some embodiments, the compositions include a single species of HIF-interfering nucleic acid (e.g., HIF siRNA). In other embodiments, the compositions include 2, 3, 4, or more species of HIF interfering nucleic acids that target 1, 2, 3, 4, or more genes.

[0052] In some embodiments, an interfering nucleic acid may be about 15 to 300 or more nucleotides long, or any length in between these lengths, and in certain embodiments about 15 to 30 nucleotides long. In certain embodiments, the interfering nucleic acid may be 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 100, 200, 300, or more nucleotideslong. The interfering nucleic acid may comprise a nucleic acid and / or a nucleic acid analog. Typically, an interfering nucleic acid will inhibit the translation of a single gene within a cell; however, in certain embodiments, an interfering nucleic acid may inhibit the translation of more than one gene within a cell. In particular embodiments, the interfering nucleic acid is a doublestranded siRNA comprising about 15 to 30, 19 to 25, 20 to 23, or 21 contiguous nucleobases or nucleobase pairs. Interfering nucleic acids can contain natural nucleotides, as well as non-natural or modified nucleotides (e.g., a modified nucleobase, modified internucleoside linkage, and / or modified sugar). In certain embodiments, the interfering nucleic acid is a HIF-2a interfering nucleic acid. In some embodiments, the HIF-interf ering nucleic acid is identical or substantially identical (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical) to a target sequence of a HIF polynucleotide (e.g., a portion comprising at least 15, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 contiguous nucleotides, e.g., from 15-500, 15-250, 15-100, 15-50, or 15-30 contiguous nucleotides of a HIF-encoding gene, such as those described above.

[0053] Exemplary interfering nucleic acids include short interfering RNAs (siRNAs), short hairpin RNAs (shRNAs), single-stranded interfering RNAs (ss-siRNAs, also referred to as antisense oligonucleotides or ASOs), and microRNAs (miRNAs). A short hairpin RNA or small hairpin RNA (shRNA) is an artificial RNA molecule with a hairpin turn that can be used to silence target gene expression via the small interfering RNA (siRNA) it produces in cells. See, e.g., Fire et. al., 1998, Nature 391 :806-811; Elbashir et. al., 2001, Nature 411 :494-498; Chakraborty et al., 2017, Mol. Ther. Nucleic Acids 8: 132-143; Bouard et al., 2009, Br. J. Pharmacol. 157: 153-165. SEQ ID NO: 1 (UUGAUGAAUCCUCGACUUAUU) is the sense strand, and SEQ ID NO: 2 (UAAGUCGAGGAUUCAUCAAUU) is the antisense strand of an exemplary HIF-2a siRNA (purchased from Dharmacon (Lafayette, CO)). In some embodiments, the interfering nucleic acid comprises a sequence that is at least at least 80%, 85%, 88%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 1 or SEQ ID NO: 2. Other siRNAs and interfering nucleic acids can be designed using known methods with the available HIF cDNA and mRNA sequences as references (e.g., SEQ ID NOs: 5-8). Techniques for selecting target motifs in a HIF gene (e.g., SEQ ID NOs: 5-8) for RNAi are known to those skilled in the art, for example, as disclosed in Tuschl, T. et al., “The siRNA User Guide,” revised May 6, 2004, available on the Rockefeller University website; by Technical Bulletin #506, “siRNA Design Guidelines,” Ambion Inc. at Ambion’s website; Naito and Ui-Tei, 2012, siRNA design software for target gene-specific RNA interference, Front. Genet. 3:102; and by other web-based design tools at, forexample, the Invitrogen, Dharmacon, Integrated DNA Technologies, Genscript, or Proligo websites. Initial search parameters can include G / C contents between 35% and 55% and siRNA lengths between 19 and 27 nucleotides. The target sequence may be located in the coding region or in the 5' or 3' untranslated regions of the mRNA. The target sequences can be used to derive interfering RNA molecules, such as those described herein.

[0054] Efficiency of the knock-down of the HIF gene can be assessed by measuring the amount of HIF mRNA or protein using methods well known in the art, for example, quantitative PCR, Western blot, flow cytometry, and the like. In some embodiments, the level of HIF protein is evaluated to assess knock-out or knock-down efficiency. In certain embodiments, the reduction of HIF expression is at least 5%, at least 10%, at least 20%, at least 30%, at least 50%, at least 60%, or at least 80% as compared to control cells. In certain embodiments, the efficiency of reduction is from about 10% to about 90%. In certain embodiments, the efficiency of reduction is from about 30% to about 80%. In certain embodiments, the efficiency of reduction is from about 50% to about 80%. In some embodiments, the efficiency of reduction is greater than or equal to about 80%.

[0055] Expression of shRNA in cells is typically accomplished by delivery of plasmids or through viral or bacterial vectors. Suitable bacterial vectors include but not limited to adeno- associated viruses (AAVs), adenoviruses, and lentiviruses. Exemplary viral delivery vectors are described further below. Once the vector has integrated into the host genome, the shRNA is then transcribed in the nucleus by polymerase II or polymerase III depending on the promoter choice. The resulting pre-shRNA is exported from the nucleus and then processed by Dicer and loaded into the RNA-induced silencing complex (RISC). The sense strand is degraded by RISC, and the antisense strand directs RISC to an mRNA that has a complementary sequence. A protein called Ago2 in the RISC then cleaves the mRNA, or in some cases, represses translation of the mRNA, thus, leading to its destruction and an eventual reduction in the protein encoded by the mRNA. Thus, the shRNA leads to targeted gene silencing. shRNA is an advantageous mediator of siRNA in that it has relatively low rate of degradation and turnover. In some embodiments, shRNA or siRNA molecules may be used to silence the expression of any of the target genes.

[0056] In some embodiments, the methods described herein include treating a hypoxia-related disease or condition in a subject using a synthetic miRNA. Generally, microRNAs (miRNA) are single-stranded RNA molecules of about 21-23 nucleotides in length which regulate gene expression. miRNAs are encoded by genes from whose DNA they are transcribed, but miRNAs are not translated into protein (non-coding RNA); instead, each primary transcript (a pri-miRNA) is processed into a short stem-loop structure called a pre-miRNA and finally into a functionalmature miRNA. Mature miRNA molecules are either partially or completely complementary to one or more messenger RNA (mRNA) molecules, and their main function is to downregulate gene expression.

[0057] The genes encoding miRNA are much longer than the processed mature miRNA molecule. miRNA is first transcribed as a primary transcript or pri-miRNA with a cap and poly- A tail and processed to short, ~70-nucleotide stem-loop structures known as pre-miRNA in the cell nucleus. This processing is performed in animals by a protein complex known as the Microprocessor complex, consisting of the nuclease Drosha and the double-stranded RNA binding protein Pasha (Denli et al., 2004, Nature, 432:231-23). The pre-miRNA is then processed to mature miRNA in the cytoplasm by interaction with the endonuclease Dicer, which also initiates the formation of the RNA-induced silencing complex (RISC) (Bernstein et al., 2001, Nature, 409:363-366). Either the sense strand or antisense strand of DNA can function as templates to give rise to miRNA. When Dicer cleaves the pre-miRNA stem-loop, two complementary short RNA molecules are formed, but only one is integrated into the RISC complex. This strand is known as the guide strand and is selected by the argonaute protein, the catalytically active RNase in the RISC complex, on the basis of the stability of the 5’ end (Preall et al., 2006, Curr. BioL, 16:530-535). The remaining strand, known as the anti-guide or passenger strand, is degraded as a RISC complex substrate (Gregory etal., 2005, Cell, 123:631-640). After integration into the active RISC complex, miRNAs base pair with their complementary mRNA molecules and induce target mRNA degradation and / or translational silencing.

[0058] Mammalian miRNA molecules are usually complementary to a site in the 3’ UTR of the target mRNA sequence. In certain instances, the annealing of the miRNA to the target mRNA inhibits protein translation by blocking the protein translation machinery. In certain other instances, the annealing of the miRNA to the target mRNA facilitates the cleavage and degradation of the target mRNA through a process similar to RNA interference (RNAi). miRNA may also target methylation of genomic sites which correspond to targeted mRNA. Generally, miRNAs function in association with a complement of proteins collectively termed the miRNP.

[0059] In some embodiments, the miRNA molecules described herein are about 15-100, 15-90, 15-80, 15-75, 15-70, 15-60, 15-50, or 15-40 nucleotides in length, more typically about 15-30, 15- 25, or 19-25 nucleotides in length, and are preferably about 20-24, 21-22, or 21-23 nucleotides in length. In some embodiments, miRNA molecules may be used to silence the expression of any of the target genes.

[0060] In some embodiments, the methods described herein include treating a hypoxia-related disease or condition in a subject using a synthetic antisense oligonucleotide (ASO). The terms“antisense oligonucleotide” or “antisense” include oligonucleotides that are complementary to a targeted polynucleotide sequence. Antisense oligonucleotides are single strands of DNA or RNA that are complementary to a chosen sequence. Antisense RNA oligonucleotides prevent the translation of complementary RNA strands by binding to the RNA. Antisense DNA oligonucleotides can be used to target a specific, complementary (coding or non-coding) RNA. If binding occurs, this DNA / RNA hybrid can be degraded by the enzyme RNase H. In certain embodiments, antisense oligonucleotides comprise about 10 to about 60 nucleotides or about 15 to about 30 nucleotides. The term also encompasses antisense oligonucleotides that may not be exactly complementary to the desired target gene. Thus, the lipid particles described herein can be utilized in instances where non-target specific-activities are found with antisense, or where an antisense sequence containing one or more mismatches with the target sequence is the most preferred for a particular use.

[0061] Methods of producing antisense oligonucleotides are known in the art and can be readily adapted to produce an antisense oligonucleotide that targets any polynucleotide sequence. Selection of antisense oligonucleotide sequences specific for a given target sequence is based upon analysis of the chosen target sequence and determination of secondary structure, Tm, binding energy, and relative stability. Antisense oligonucleotides may be selected based upon their relative inability to form dimers, hairpins, or other secondary structures that would reduce or prohibit specific binding to the target mRNA in a host cell. Highly preferred target regions of the mRNA include those regions at or near the AUG translation initiation codon and those sequences that are substantially complementary to 5’ regions of the mRNA. These secondary structure analyses and target site selection considerations can be performed, for example, using v.4 of the OLIGO primer analysis software (Molecular Biology Insights) and / or the BLASTN 2.0.5 algorithm software (Altschul et al., 1997, Nucleic Acids Res., 25:3389-402). In some embodiments, antisense oligonucleotides can be used to inhibit the expression or replication of a gene of interest.

[0062] In the present disclosed compositions, the HIF-interfering nucleic acid is encapsulated by a neutral or positively charged phospholipid component. Liposomes have been used for drug delivery (e.g., delivery of a chemotherapeutic), and cationic liposomes are described in PCT publications W002 / 100435A1, W003 / 015757A1, and WO04 / 029213A2; U.S. Pat. Nos. 5,962,016, 5,030,453, and 6,680,068; and U.S. Patent Application 2004 / 0208921. A process of making liposomes is also described in W004 / 002453A1. Furthermore, neutral lipids have been incorporated into cationic liposomes (e.g., Farhood et al., 1995). Cationic liposomes have been used to deliver siRNA to various cell types (Sioud and Sorensen, 2003; U.S. Patent Application 2004 / 0204377; Duxbury et al., 2004; Donze and Picard, 2002). Neutral liposomes were used todeliver therapeutic antisense oligonucleotides in U.S. Patent Application 2003 / 0012812 and siRNA in U.S. Pat. No. 8,067,390 and WO 06 / 113679. Lipid-based nanoparticles (NPs) are in use in about 30% of all FDA-approved drugs, which is due to their unique qualities such as biocompatibility, high bioavailability, high safety, non-toxicity, high efficiency, and high tissue distribution. Moreover, pulmonary surfactant comprises a sophisticated blend of phospholipids (PL) and proteins (SP) aimed at reducing surface tension at the air-liquid interface within the alveoli. This composition typically consists of approximately 70% to 80% phospholipids, predominantly dipalmitoylphosphatidylcholine (DPPC), 10% surfactant proteins (SP-A, B, C, and D), and 10% neutral lipids, primarily cholesterol. The synthesis, assembly, transportation, and secretion of surfactant occur within the alveoli, where it undergoes degradation and subsequent recycling. Notably, surfactant metabolism tends to be slower in newborns, particularly premature infants, compared to adults. These references do not describe neutral liposomal delivery to traverse the placental barrier for prenatal treatment.

[0063] The neutral phospholipid component of the presently disclosed compositions has an essentially neutral charge, either because it comprises a neutral phospholipid or it comprises a net neutral charge. A phospholipid is a lipid molecule that has a hydrophilic head containing a phosphate group and two hydrophobic tails derived from fatty acids, joined by an alcohol residue (e.g., a glycerol molecule). In some embodiments, a neutral phospholipid includes, but is not limited to, a dipalmitoylphosphatidylcholine (DPPC), di oleoyl-sn-glycero-3 -phosphocholine (DOPC), egg phosphatidylcholine (EPC), dilauryloylphosphatidylcholine (DLPC), dimyristoylphosphatidylcholine (DMPC), distearoylphosphatidylcholine (DSPC), l-myristoyl-2- palmitoyl phosphatidylcholine (MPPC), l-palmitoyl-2-myristoyl phosphatidylcholine (PMPC), l-palmitoyl-2-stearoyl phosphatidylcholine (PSPC), l-stearoyl-2-palmitoyl phosphatidylcholine (SPPC), dimyristoyl phosphatidylcholine (DMPC), l,2-diarachidoyl-sn-glycero-3- phosphocholine (DAPC), l,2-dibehenoyl-sn-glycero-3 -phosphocholine (DBPC), 1,2- dieicosenoyl-sn-glycero-3 -phosphocholine (DEPC), palmitoyloleoyl phosphatidylcholine (POPC), lysophosphatidylcholine (LPC), dilinoleoylphosphatidylcholine (DLPC), distearoylphosphatidylethanolamine (DSPE), dimyristoylphosphatidylethanolamine (DMPE), dipalmitoyl phosphatidylethanolamine (DPPE), palmitoyloleoyl phosphatidylethanolamine (POPE), lysophosphatidylethanolamine (LPE), and a combination thereof. In certain embodiments, the phospholipid component can include 1, 2, 3, 4, 5, 6, 7, 8, or more kinds or types of neutral phospholipid. In other embodiments, a phospholipid component can include 2, 3, 4, 5, 6, or more kinds or types of neutral phospholipids. In some embodiments, the phospholipid component includes 2 phospholipids at a molar ratio of 1 :2, 1 :3, 1 :4, 1 :5, 1 :6, 1 :7, 1 :8, 1 :9, 1 : 10,2:3, 2:5, 2:7 2:9, 3:4, 3:5, 3:7, 3:8, 4:5, 4:7, 4:9, 5:6, 5:7, 5:8, 5:9, 6:7, 7:8, 7:9, or 8:9. In certain embodiments, the phospholipid component includes DPPC and DOPC. In certain embodiments, the phospholipid component includes DPPC and DOPC in a 7:3 molar ratio. In certain embodiments, the HIF -interfering nucleic acid is mixed with the phospholipid component in a 1 : 10 w / w ratio.

[0064] In some embodiments, a lipid component can have an essentially neutral charge because it comprises a positively charged lipid and a negatively charged lipid. The lipid component may further comprise a neutrally charged lipid(s) or phospholipid(s). The positively charged lipid may be a positively charged phospholipid. The negatively charged lipid may be a negatively charged phospholipid. The negatively charged phospholipid may be a phosphatidylserine, such as dimyristoyl phosphatidylserine (DMPS), dipalmitoyl phosphatidylserine (DPPS), or brain phosphatidylserine (BPS). The negatively charged phospholipid may be a phosphatidylglycerol (PG), such as dilauryloylphosphatidylglycerol (DLPG), dimyristoylphosphatidylglycerol (DMPG), dipalmitoylphosphatidylglycerol (DPPG), distearoylphosphatidylglycerol (DSPG), or dioleoylphosphatidylglycerol (DOPG). In certain embodiments, the composition further comprises cholesterol or polyethylene glycol (PEG). In certain embodiments, a phospholipid is a naturally occurring phospholipid. In other embodiments, a phospholipid is a synthetic phospholipid.

[0065] In some embodiments, the phospholipid component has a positive charge. In certain embodiments, the phospholipid component comprises a cationic lipid, a multivalent cationic lipid, an ionizable lipid, a certest ionizable lipid, a fixed cationic lipid, or a certest lipid. In some embodiments the cationic lipid is stearylamine. In certain embodiments, the phospholipid component comprises l,2-dioleoyl-sn-glycero-3 -phosphocholine stearylamine (DOPC- stearylamine). In some embodiments the multivalent cationic lipids are selected from a group consisting of N,N-ditetradecylamine-polylysine (N-TETAMINE-pLys40), Nl-[2-((lS)-l-[(3- aminopropyl)amino]-4-[di(3-amino-propyl)amino]butylcarboxamido)ethyl]-3,4-di[oleyloxy]- benzamide (MVL5), 2,3-dioleyloxy-N-[2-(sperminecarboxamido)ethyl]-N,N-dimethyl-l- propanaminium HC1 salt (DOSPA), and N4-Cholesteryl-Spermine HC1 Salt (GL67). In some embodiments the ionizable lipids are selected from a group consisting of 3B-[N-(N’,N’- dimethylaminoethane)-carbamoyl]cholesterol hydrochloride (DC-Cholesterol HC1), 3B-[N- (N’ ,N’ -dimethylaminoethane)-carbamoyl]cholesterol(d7) hydrochloride (DC-cholesterol-d7), (Z)-non-2-en- 1 -yl 6-((((2-(dimethylamino)ethyl)thio)carbonyl)(6-oxo-6-(pentadecan-8- yloxy)hexyl)amino)hexanoate (ATX-95), (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3- (diethylamino)propoxy)carbonyl)oxy)methyl)propyloctadeca-9,12-di enoate (LP-01),heptadecan-9-yl 8-((2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (SM-102), N- (4-carboxybenzyl)-N,N-dimethyl-2,3-bis(oleoyloxy)propan-l-aminium (DOBAQ), 1 , 1 ’ -((2-(4- (2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-l- yl)ethyl)azanediyl)bis(dodecan-2-ol) (C12-200), dipalmitoyl-rac-glycero-3-carbobetaine (16:0 CB (DPCB)), dipalmitoyl-rac-glycero-3-sulfobetaine (16:0 SB (DPSB)), l,2-distearoyl-3- dimethylammonium-propane (18:0 DAP), l,2-dipalmitoyl-3-dimethylammonium-propane (16:0 DAP), l,2-dimyristoyl-3-dimethylammonium-propane (14:0 DAP), l,2-distearoyl-3- dimethylammonium-propane (18: 1 DAP), 1,2-di oleyl oxy-3 -dimethylaminopropane (DODMA), 6-((2-hexyldecanoyl)oxy)-N-(6-((2-hexyldecanoyl)oxy)hexyl)-N-(4-hydroxybutyl)hexan-l- aminium (ALC-0315), and (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4- (dimethylamino)butanoate (Dlin-MC3-DMA), 3,6-bis(4-(bis(2- hydroxydodecyl)amino)butyl)piperazine-2, 5-dione (cKK-E12). In some embodiments the certest ionizable lipids are selected from a group consisting of: Octyl 2-methyl-14-((3-(octyloxy)-3- oxopropyl)thio)-6,9-dioxo-7-(2-((3-oxo-3-(tridecyloxy)propyl)thio)ethyl)-17-thia-2,5,8- triazaicosan-20-oate (CP-LC-1067), 2-hexyldecyl 3-((4-((2-(dimethylamino)ethyl)amino)-3-(2- hexyldecanamido)-4-oxobutyl)thio)propanoate (CP-LC-0729), and 6-methylheptyl 7-(2-((3-((2- hexyldecyl)oxy)-3-oxopropyl)thio)ethyl)-2-methyl-14-((3-((6-methylheptyl)oxy)-3- oxopropyl)thio)-6,9-dioxo-17-thia-2,5,8-triazaicosan-20-oate (CP-LC-1421). In some embodiments the fixed cationic lipids are selected from a group consisting of: N-(2- hydroxyethyl)-N,N-dimethyl-2,3-bis(oleoyloxy)propan-l-aminium bromide (DORI), O,O’- ditetradecanoyl-N-(a-trimethylammonioacetyl)di ethanolamine chloride (DC-6-14), 1,2- dilauroyl-sn-glycero-3-ethylphosphocholine (chloride salt) (12:0 EPC (Cl Salt)), 1,2-dimyristoyl- sn-glycero-3 -ethylphosphocholine (chloride salt) (14:0 EPC (Cl Salt)), 1,2-dipalmitoyl-sn- glycero-3 -ethylphosphocholine (chloride salt) (16:0 EPC (Cl Salt)), l,2-distearoyl-sn-glycero-3- ethylphosphocholine (chloride salt)(18:0 EPC (Cl Salt)), 1,2-di oleoyl-sn-glycero-3- ethylphosphocholine (chloride salt) (18: 1 EPC (Cl Salt)), l-palmitoyl-2-oleoyl-sn-glycero-3- ethylphosphocholine (chloride salt) (16:0-18: 1 EPC (Cl Salt)), l,2-dimyristoleoyl-sn-glycero-3- ethylphosphocholine (Tf salt) (14: 1 EPC (Tf Salt)), Dimethyldioctadecylammonium (Bromide Salt) (18:0 DDAB), l,2-dimyristoyl-3-trimethylammonium-propane (chloride salt) (14:0 TAP), l,2-dipalmitoyl-3-trimethylammonium-propane (chloride salt) (16:0 TAP), l,2-stearoyl-3- trimethylammonium-propane (chloride salt) (18:0 TAP), l,2-dioleoyl-3-trimethylammonium- propane (chloride salt) (18: 1 TAP (DOTAP)), 1,2-di oleoyl-3-trimethylammonium-propane (methyl sulfate salt) (18: 1 TAP (DOTAP, MS Salt)), and l,2-di-O-octadecenyl-3- trimethylammonium propane (chloride salt) (DOTMA). In some embodiments the certest lipidsare selected from a group consisting of : Octyl 2-methyl-14-((3-(octyloxy)-3-oxopropyl)thio)-6,9- dioxo-7-(2-((3-oxo-3-(tridecyloxy)propyl)thio)ethyl)-17-thia-2,5,8-triazaicosan-20-oate (CP-LC- 1067), 2-hexyldecyl 3-((4-((2-(dimethylamino)ethyl)amino)-3-(2-hexyldecanamido)-4- oxobutyl)thio)propanoate (CP-LC-0729), and 6-methylheptyl 7-(2-((3-((2-hexyldecyl)oxy)-3- oxopropyl)thio)ethyl)-2-methyl-14-((3-((6-methylheptyl)oxy)-3-oxopropyl)thio)-6,9-dioxo-17- thia-2,5,8-triazaicosan-20-oate (CP-LC-1421). In certain embodiments, the positively charged phospholipid component comprises DOPC and stearylamine in a 7:3 w / w ratio. In certain embodiments, the HIF -interfering nucleic acid is mixed with the phospholipid component in a 1 : 10 w / w ratio.

[0066] In addition, the compositions may comprise a pharmaceutically acceptable carrier. As used herein, “pharmaceutically acceptable carrier” includes any of standard pharmaceutically accepted carriers known to those of ordinary skill in the art in formulating pharmaceutical compositions. Thus, the compounds, by themselves, such as being present as pharmaceutically acceptable salts, or as conjugates, may be prepared as formulations in pharmaceutically acceptable diluents; for example, saline, phosphate buffer saline (PBS), aqueous ethanol, or solutions of glucose, mannitol, dextran, propylene glycol, oils (e.g., vegetable oils, animal oils, synthetic oils, etc.), microcrystalline cellulose, carboxymethyl cellulose, hydroxylpropyl methyl cellulose, magnesium stearate, calcium phosphate, gelatin, polysorbate 80 or the like, or as solid formulations in appropriate excipients. The pH of the solution is generally about 5 to about 8 or from about 7 to 7.5.

[0067] Methods of producing the disclosed compositions are also provided. The methods of producing the disclosed compositions include mixing 2 or more phospholipids at a fixed ratio, in combination with the interfering nucleic acid. Tween-20 is added to the mixture at 1 : 19 Tween 20:siRNA / phospholipid mixture. The mixture is vortexed in the presence of excess tertiary butanol (95% v / v). The mixture is then frozen in an acetone / dry ice bath or Liquid nitrogen (N2), lyophilized (lyophilizer set at -40°C, 100 mBar), and stored at -20°C until use. In some embodiments, the compositions include DPPC and DOPC in a 7:3 molar ratio and HIF siRNA at a ratio of 1 : 10 with respect to the DPPC / DOPC.

[0068] The pharmaceutical compositions will often further comprise one or more buffers (e.g., neutral buffered saline or phosphate buffered saline), carbohydrates (e.g., glucose, mannose, sucrose or dextran), mannitol, proteins, polypeptides or amino acids such as glycine, antioxidants (e.g., ascorbic acid, sodium metabisulfite, butylated hydroxytoluene, butylated hydroxyanisole, etc.), bacteriostats, chelating agents such as EDTA or glutathione, solutes that render the formulation isotonic, hypotonic or weakly hypertonic with the blood of a recipient, suspendingagents, thickening agents, and preservatives. Suitable carriers and their formulations and methods of preparing the same are described in REMINGTON: THE SCIENCE AND PRACTICE OF PHAR ACY, 21stEdition, Philip P. Gerbino, ed., Lippincott Williams & Wilkins (2006).

[0069] In certain embodiments, the therapeutic agent is present in unit dosage forms suitable for simple administration of precise dosages. As used herein, the term “unit dosage form” refers to physically discrete units suitable as unitary dosages for humans and other mammals, each unit containing a predetermined quantity of a therapeutic agent calculated to produce the desired onset, tolerability, and / or therapeutic effects, in association with a suitable pharmaceutical excipient (e.g., an ampoule). In addition, more concentrated dosage forms may be prepared, from which the more dilute unit dosage forms may then be produced. The more concentrated dosage forms thus will contain substantially more than, e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more times the amount of the therapeutic compound. Methods for preparing such dosage forms are known to those skilled in the art (see, e.g., REMINGTON’S PHARMACEUTICAL SCIENCES). The dosage forms typically include a conventional pharmaceutical carrier or excipient and may additionally include other medicinal agents, carriers, adjuvants, diluents, tissue permeation enhancers, solubilizers, and the like. Appropriate excipients can be tailored to the particular dosage form and route of administration by methods well known in the art (see, e.g., REMINGTON’S PHARMACEUTICAL SCIENCES . For example, preparations for parenteral administration include sterile aqueous or nonaqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions, or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer’s dextrose, dextrose and sodium chloride, lactated Ringer’s, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer’s dextrose), and the like. Preservatives and other additives are optionally present such as, for example, antimicrobials, antioxidants, chelating agents, and inert gases and the like.

[0070] Examples of suitable excipients include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starches, gum acacia, calcium phosphate, alginates, tragacanth, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, saline, syrup, methylcellulose, ethyl cellulose, hydroxypropyl methylcellulose (HPMC), and polyacrylic acids such as Carbopols, e.g., Carbopol 941, Carbopol 980, Carbopol 981, etc. The dosage forms can additionally include lubricating agents such as talc, magnesium stearate, and mineral oil; wetting agents; emulsifying agents; suspending agents; preserving agents such as methyl-, ethyl-, and propyl-hydroxy-benzoates (i.e., the parabens); and pH adjusting agents such as inorganic andorganic acids and bases. The dosage forms may also comprise biodegradable polymer beads, dextran, and cyclodextrin inclusion complexes.IV. METHODS OF USE

[0071] Methods are provided for the targeted treatment of hypoxia-related diseases and conditions. In some embodiments, the hypoxia-related disease or condition is a cardiac or pulmonary disease or condition. In some embodiments, the hypoxia-related condition includes inflammation. In some embodiments, the compositions are administered to a pregnant subject for the treatment of a hypoxia-related condition or disease in the fetus. In some embodiments, the compositions are administered to a subject for the treatment of a hypoxia-related condition or disease in the subject (e.g., a newborn). The hypoxia-related condition may include, for example, congenital diaphragmatic hernia (CDH), pulmonary hypoplasia, pulmonary atresia, congenital pulmonary airway malformation, congenital anatomic cardiac disease, prenatal cardiac dysfunction, ectopic cordis, atrial septal defect (ASD), cleft lip, cleft palate, craniosynostosis, esophageal atresia, anophthalmia and microphthalmia, tricuspid atresia, truncus arteriosus (TA), chorioamnionitis, cytomegalovirus infection, congenital rubella infection, congenital toxoplasmosis, acute respiratory distress syndrome, restrictive lung disease, and idiopathic pulmonary fibrosis (IPF). In some embodiments, the hypoxia-related condition is a cardiac disease or condition selected from a group consisting of congenital anatomic cardiac disease (e.g., HLHS, TOF, truncus arteriosus, AV canal defects), prenatal cardiac dysfunction (e.g., arrhythmias, compromised cardiac function), and ectopic cordis. In some embodiments, the hypoxia-related condition is a pulmonary disease or condition selected from a group consisting of CDH, pulmonary hypoplasia (e.g., omphalocele, renal failure), pulmonary atresia, and congenital pulmonary airway malformation. In certain embodiments, the disease or condition is CDH.

[0072] In some embodiments, the compositions are administered to a subject for the treatment of atrial septal defect (ASD), a congenital heart defect in which blood flows between the atria (upper chambers) of the heart. Some flow is a normal condition both pre-birth and immediately post-birth via the foramen ovale; however, when this does not naturally close after birth it is referred to as a patent (open) foramen ovale (PFO). It is common in patients with a congenital atrial septal aneurysm (ASA). After PFO closure the atria normally are separated by a dividing wall, the interatrial septum. If this septum is defective or absent, then oxygen-rich blood can flow directly from the left side of the heart to mix with the oxygen-poor blood in the right side of the heart; or the opposite, depending on whether the left or right atrium has the higher blood pressure. The six typesof atrial septal defects are differentiated from each other by whether they involve other structures of the heart and how they are formed during the developmental process during early fetal development.

[0073] In some embodiments, the compositions are administered to a subject for the treatment of tricuspid atresia. The tricuspid valve is the opening between the right atrium (the upper chamber) and the right ventricle (the lower chamber). In a normal heart, the right side receives oxygen-poor blood (blue blood) from the body’s veins. It pumps the blue blood to the lungs to receive oxygen. The oxygen-rich blood (red blood) returns from the lungs to the left side of the heart, which pumps the blood to the body. A heart with the congenital heart disease tricuspid atresia is characterized by poorly developed right heart structures and has no tricuspid valve, a smaller-than-normal right ventricle / hypoplastic right ventricle, and / or an atrial septal defect (a hole between the right atrium and left atrium) so oxygen-poor and oxygen-rich blood mix inside of the heart.

[0074] In some embodiments, the compositions are administered to a subject for the treatment of truncus arteriosus (TA), an uncommon congenital cardiovascular anomaly that is characterized by a single arterial trunk arising from the normally formed ventricles by means of a single semilunar valve (i.e., truncal valve). In the most common type, the pulmonary arteries originate from the common arterial trunk distal to the coronary arteries and proximal to the first brachiocephalic branch of the aortic arch. The common trunk typically straddles a defect in the outlet portion of the interventricular septum (i.e., conal septum); however, in rare cases, it may originate almost completely from the right or left ventricle. In patients with a patent and normal caliber aortic arch, the ductus arteriosus is either absent or diminutive.

[0075] In some embodiments, the compositions are administered to a pregnant subject for the treatment of pulmonary complications for infections and disease in the fetus. In some embodiments, the compositions are administered to a subject for the treatment of chorioamnionitis, a potentially serious inflammatory complication during pregnancy. Chorioamnionitis leads to the creation of an inflammatory environment within the amniotic fluid surrounding the growing fetus. In this scenario, the fetal lungs are consistently exposed to the resulting inflammatory agents or microbial substances present in the amniotic fluid. This exposure triggers notable modifications in the fetal lung, including heightened leukocyte presence, changes in cytokine and surfactant production, and reduced alveolar development. These changes may have lasting effects on lung development and function.

[0076] In some embodiments, the compositions are administered to a subject for the treatment of cleft lip and cleft palate: Cleft lip and cleft palate are birth defects that occur when a baby’s lip or mouth do not form properly during pregnancy. Together, these birth defects commonly are called “orofacial clefts.” The lip forms between the fourth and seventh weeks of pregnancy. As a baby develops during pregnancy, body tissue and special cells from each side of the head grow toward thecenter of the face and join together to make the face. This joining of tissue forms the facial features, like the lips and mouth. A cleft lip happens if the tissue that makes up the lip does not join completely before birth. A cleft palate happens if the tissue that makes up the roof of the mouth does not join together completely during pregnancy.

[0077] In some embodiments, the compositions are administered to a subject for the treatment of craniosynostosis, a disorder present at birth in which one or more of the fibrous joints between the bones of the baby’s skull (cranial sutures) close prematurely (fuse), before the baby's brain, is fully formed. Brain growth continues, giving the head a misshapen appearance. Usually, during infancy the sutures remain flexible, allowing a baby’s skull to expand as the brain grows. In the front of the skull, the sutures meet in the large soft spot (fontanel) on top of the head. The anterior fontanel is the soft spot felt just behind a baby's forehead. The next largest fontanel is at the back (posterior). Each side of the skull has a tiny fontanel. Craniosynostosis usually involves premature fusion of a single cranial suture, but it can involve more than one of the sutures in a baby’s skull (multiple suture craniosynostosis). In rare cases, craniosynostosis is caused by certain genetic syndromes (syndromic craniosynostosis). Treating craniosynostosis involves surgery to correct the shape of the head and allow for brain growth. Early diagnosis and treatment allow the baby’s brain adequate space to grow and develop.

[0078] In some embodiments, the compositions are administered to a subject for the treatment of esophageal atresia (i.e., the baby’s esophagus has not finished developing). The esophagus does not connect to their stomach, so they cannot swallow or eat. Sometimes, it connects to their windpipe instead, which causes additional problems. Most babies have surgery to repair it soon after birth.

[0079] In some embodiments, the compositions are administered to a subject for the treatment of anophthalmia and microphthalmia. These conditions develop during pregnancy and can occur alone, with other birth defects, or as part of a syndrome. Anophthalmia and microphthalmia often result in blindness or limited vision.

[0080] In some embodiments, the compositions are administered to a subject for the treatment of cytomegalovirus (CMV) infection which may be acquired prenatally or perinatally and is the most common congenital viral infection. Signs of CMV infection at birth, if present, are intrauterine growth restriction, prematurity, microcephaly, jaundice, petechiae, hepatosplenomegaly, periventricular calcifications, chorioretinitis, pneumonitis, hepatitis, and sensorineural hearing loss. If acquired later in infancy, signs may include pneumonia, hepatosplenomegaly, hepatitis, thrombocytopenia, sepsis-like syndrome, and atypical lymphocytosis. Diagnosis of neonatal infection is best made by viral detection via culture or polymerase chain reaction (PCR) testing.

[0081] In some embodiments, the compositions are administered to a subject for the treatment of congenital rubella infection, typically resulting from a primary maternal infection. Rubella is believed to invade the upper respiratory tract, with subsequent viremia and dissemination of the virus to different sites, including the placenta. The fetus is at the highest risk of developmental abnormalities when infected during the first 16 weeks of gestation, particularly the first 8 to 10 weeks. Early in gestation, the virus is thought to establish a chronic intrauterine infection. Its effects include endothelial damage to blood vessels, direct cytolysis of cells, and disruption of cellular mitosis.

[0082] In some embodiments, the compositions are administered to a subject for the treatment of congenital toxoplasmosis. Toxoplasmosis is almost exclusively due to a primary maternal infection during pregnancy; however, there are exceptions, including reinfection with a new serotype of T. gondii or reactivation of toxoplasmosis in mothers with severe cell-mediated immunodeficiencies. Infection with T. gondii occurs primarily from ingestion of inadequately cooked meat-containing cysts or from ingestion of oocysts derived from food or water contaminated with cat feces. The rate of transmission to the fetus is higher in women infected later during pregnancy. However, fetuses infected earlier in gestation generally have more severe disease. Overall, 30 to 40% of women infected during pregnancy will have a congenitally infected child.

[0083] In some embodiments, the compositions are administered to a subject for the treatment of Acute respiratory distress syndrome (ARDS). ARDS is a severe pulmonary condition characterized by diminished blood oxygen levels. Typically, individuals afflicted with ARDS are already in a state of illness stemming from another ailment or a significant injury. In ARDS, there is an accumulation of fluid within the small air sacs of the lungs, accompanied by the degradation of surfactant — a crucial substance produced by the body to maintain lung expansion and facilitate breathing. This fluid buildup and surfactant depletion hinder the lungs from adequately filling with air, impairing the transfer of oxygen into the bloodstream and throughout the body. Additionally, the lung tissue may undergo scarring and stiffening. The onset of ARDS can occur gradually over several days or escalate rapidly. Shortness of breath typically serves as the initial symptom, accompanied by manifestations such as diminished blood oxygen levels, rapid respiration, and audible respiratory sounds like clicking, bubbling, or rattling. ARDS can affect individuals of any age group.

[0084] In some embodiments, the compositions are administered to a subject for the treatment of restrictive lung disease, which is a disease characterized by a reduction in the overall capacity of the lungs to hold air. Restrictive lung disease frequently arises from diminished lung elasticity or issues pertaining to the expansion of the chest wall during inhalation. Conditions such as asbestosis, sarcoidosis, and pulmonary fibrosis serve as examples of restrictive lung diseases.

[0085] In some embodiments, the compositions are administered to a subject for the treatment of chronic obstructive pulmonary disease (COPD), a type of progressive lung disease characterized by long-term respiratory symptoms and airflow limitation. Global Initiative for Chronic Obstructive Lung Disease (GOLD) 2024 defined COPD as a heterogeneous lung condition characterized by chronic respiratory symptoms (dyspnea, cough, sputum production, and / or exacerbations) due to abnormalities of the airways (bronchitis, bronchiolitis) and / or alveoli (emphysema) that cause persistent, often progressive, airflow obstruction. The main symptoms of COPD include shortness of breath and a cough, which may or may not produce mucus. COPD progressively worsens, with everyday activities such as walking or dressing becoming difficult.

[0086] In some embodiments, the compositions are administered to a subject for the treatment of idiopathic pulmonary fibrosis (IPF) (formerly known as fibrosing alveolitis). IPF is a rare, progressive illness of the respiratory system, characterized by the thickening and stiffening of lung tissue, associated with the formation of scar tissue. It is a type of chronic scarring lung disease characterized by a progressive and irreversible decline in lung function. The tissue in the lungs becomes thick and stiff, which affects the tissue that surrounds the air sacs in the lungs. Symptoms typically include a gradual onset of shortness of breath and a dry cough. Other changes may include feeling tired, and abnormally large and dome-shaped fingers and toenails (nail clubbing). Complications may include pulmonary hypertension, heart failure, pneumonia, or pulmonary embolism.

[0087] In some embodiments, the compositions target mitochondrial abnormalities, affecting mitochondrial biogenesis and mitochondrial function. Mitochondrial dysfunction has been consistently associated with cardiac failure. Targeting mitochondrial abnormalities has significant potential to attenuate CDH-associated ventricular dysfunction, mitigating early, post-natal clinical deterioration, decreasing the need for extracorporeal life support, and minimizing mortality.

[0088] As used throughout, a “subject” can be a vertebrate, more specifically a mammal (e.g., a human, monkey, horse, cat, dog, cow, pig, sheep, camel, goat, mouse, rabbit, rat, and guinea pig), birds, reptiles, amphibians, fish, and any other animal. The term does not denote a particular age or sex. Thus, adult and newborn subjects, whether male or female, are intended to be covered. As used herein, “patient” or “subject” may be used interchangeably and includes human and veterinary subjects. The HIF-interf ering RNA described herein is useful for treating conditions involving upregulated expression of HIF-2a in humans, including, without limitation, pediatric and geriatric populations, and in animals, e.g., veterinary applications. In some embodiments, the subject is a human. In some embodiments, the subject is pregnant with a fetus that has or is suspected of having a hypoxia-related disease or condition. In some embodiments, the subject orthe fetus of the subject has or is suspected to have a condition associated with upregulated expression of HIF-2a. In some embodiments, the subject or the fetus of the subject is diagnosed with a hypoxia-related disease or condition.

[0089] “ Treat,” “treatment,” and the like are used herein to generally mean obtaining a desired pharmacologic and / or physiologic effect. “Treating” or “treatment” may refer to any indicia of success in the treatment or amelioration of the hypoxia-related condition. Treating or treatment of any disease or disorder refers to ameliorating a disease or disorder that exists in a subject or any one or more symptoms thereof. The term ameliorating refers to any therapeutically beneficial result in the treatment of a disease state, lessening in the severity or progression, or curing thereof. Thus, treating or treatment includes ameliorating at least one physical parameter or symptom. Treating or treatment includes modulating the disease or disorder, either physically (e.g., stabilization of a discernible symptom) or physiologically (e.g., stabilization of a physical parameter), or both. Thus, in the disclosed methods, treatment can refer to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in the severity of an established disease or condition or symptom of the disease or condition. The reduction can be a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any percent reduction in between 10% and 100% as compared to native or control levels. The effect of treatment can be compared to an individual or pool of individuals not receiving the treatment, or to the same patient prior to treatment or at a different time during treatment. It is understood that treatment does not necessarily refer to a cure or complete ablation of the disease, condition, or symptoms of the disease or condition.

[0090] As used herein, the term “administering” or “administration” includes any route of introducing or delivering a therapeutic agent or treatment to a subject. Administration can be carried out by any route suitable for the delivery of the composition. Thus, delivery routes can include, e.g., intravenous, intramuscular, intraperitoneal, or subcutaneous delivery. In some embodiments, the composition is administered by intravenous injection to a pregnant subject for prenatal treatment of a fetus. In some embodiments, the composition is administered by intravenous injection to the subject having the hypoxia-related condition, disease, or disorder. In some embodiments, the administration of the composition results in systemic distribution of the composition and effective pulmonary delivery.

[0091] As used here, the term “therapeutically effective amount” refers to an amount, e.g., pharmaceutical dose, effective in inducing a desired biological effect in a subject or patient. The term “therapeutically effective amount” refers to an amount of an active agent being administered that will treat to some extent a disease, disorder, or condition, relieve one or more of the symptoms of the disease or condition being treated, and / or that amount that will prevent, to some extent, oneor more of the symptoms of the disease or condition that the subject being treated has or is at risk of developing. For example, for a given parameter, a therapeutically effective amount will show an increase or decrease of therapeutic effect of at least 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, or at least 1-fold, 2-fold, or 3-fold. A therapeutically effective dose is usually delivered over a course of therapy that may extend for a period of days, weeks, or months. A therapeutically effective dose of an agent may be taken alone or in combination with other therapeutic agents.

[0092] In some embodiments, the disclosed composition (i.e., a HIF interfering nucleic acid encapsulated by a neutral lipid component) is administered to a subject in a dosage (of the active component) ranging from about 0.0001 to 100 mg / kg, and more usually 0.01 to 20 mg / kg, of the subject’s body weight. For example, dosages can be 0.3 mg / kg body weight, 1 mg / kg body weight, 3 mg / kg body weight, 5 mg / kg body weight, 10 mg / kg body weight, or within the range of 0.1-20 mg / kg. In some embodiments, the disclosed compositions can be administered at a dose of 1.19 mg / kg, 2.38 mg / kg, or 5 mg / kg once every other day for about 1-4 times. An exemplary treatment regime may include administration once per day, once per week, twice a week, once every two weeks, once every three weeks, once every four weeks, or once a month. In some embodiments, the treatment comprises administering a disclosed composition (i.e., a HIF-interfering nucleic acid encapsulated by a neutral or positively charged lipid component) according to one of the aforementioned dosing regimens for a first period and another of the aforementioned dosing regimens for a second period. In some cases, the treatment discontinues for a period of time before the same or a different dosing regimen resumes. For example, a patient may be on a disclosed HIF liposomal composition dosing regimen for two weeks, off for a week, on for another two weeks, and so on. Preferred dosage regimens for a disclosed HIF liposomal composition include about 0.1 mg / kg body weight, 0.3 mg / kg body weight, 2 mg / kg body weight, 3 mg / kg body weight, or 10 mg / kg via intravenous administration to a pregnant subject, with the disclosed composition being given 1-3 times a week for 1-4 weeks between a human gestational age of about 20-36 weeks.EXAMPLES

[0093] The following examples are offered to illustrate, but not to limit, the present disclosure.EXAMPLE 1. MATERIALS AND METHODSChemicals

[0094] Nitrofen (2,4-dichloro-phenyl-p-nitrophenylether) was obtained from Sigma-Aldrich (St. Louis, MO, USA). Hypoxyprobe (Pimonidazole-HCl) was purchased from Hypoxyprobe Inc. (Burlington, MA).Creation of Nitrofen CDH Rodent Model

[0095] The animal experimental protocol was reviewed and approved by the Animal Welfare Committee (permit No. AWC 22-0063), University of Texas McGovern Medical School, Houston, TX, USA. To establish the CDH animal model, pregnant Sprague-Dawley rats (ENVIGO, Houston, TX, USA) were fed 100 mg of nitrofen (Sigma- Aldrich, St. Louis, MO, USA) dissolved in 1 mL of olive oil on gestational day 9.5 (±6 hours), while rats in the control group were fed the same dose of olive oil without nitrofen as previously described. Power analyses were performed to determine the optimal number of animal subjects required to observe significant differences under the proposed conditions as well as to ensure reproducibility. To more closely approximate severe human disease, only pups with large (>50% of total surface area) diaphragmatic defects underwent treatment and tissue harvest.Liposome Preparation

[0096] Liposomes were prepared with Dipalmitoylphosphatidylcholine (DPPC) and Dioleoylphosphatidylcholine (DOPC) (also known as dioleoyl-sn-glycero-3-phosphocholine) (Avanti Polar Lipids, Inc., Alabaster, AL) in a 7:3 molar ratio. Positively charged liposomes were prepared using l,2-dioleoyl-sn-glycerol-3 -phosphocholine and stearylamine (DOPC- stearylamine) in a 7:3 molar ratio. The lipids and a non-coding small interfering RNA (siRNA) sequence (siControl or on-Target siHIF-2a) tagged with Cy5 were mixed (at a w / w ratio of 1 : 10 siRNA to lipids) in excess tertiary butanol, and Tween 20 was added. This mixture was vortexed and then frozen in an acetone / dry ice bath or liquid nitrogen (N2). The mixture was lyophilized and stored at -20°C until use. The zeta potential of the liposomes was determined. The preparation method produced nanoparticles smaller than 200 nm (Table 1 and data not shown).Table 1Animal Procedure and Delivery of Liposomes

[0097] At gestational day 21, 70 mg / kg intraperitoneal hypoxyprobe (Pimonidazole-HCl), a marker of cellular hypoxia, was administered to all dams. After one hour, dams underwent laparotomy, pups were delivered, and the prenatal offspring cardiopulmonary tissues were collected. To deliver liposomal siRNA, fluorescently labeled liposomal siRNA was injected through the tail vein three times, 15 pg of siRNA each time, to nitrogen-treated rodents at gestational days 14, 17, and 20, respectively (see, e.g., FIG. 3B). To control group animals injected, 500 pl of PBS was used. At gestational day 21, prenatal cardiopulmonary tissues were collected.Immunofluorescence Staining

[0098] For immunofluorescence staining (IF), the hearts or lungs were isolated and fixed with 4% paraformaldehyde in PBS (pH 7.4) overnight at 4°C. The tissue was then rinsed in 15% sucrose for 24 hours at 4°C, embedded in optimal cutting temperature compound (Tissue-Tek; Sakura Finetek, Torrance, CA), and made into slides (5-8 pm). To detect tissue hypoxia levels, the slides were washed with PBS and incubated with anti-Mabl-Red 549 dye at 4°C overnight, washed three times with PBS, and counterstained with 4', 6'-diamidino-2-phenylindole (DAPI) nucleic acid stain. Images were observed on a Keyence All-in-One Fluorescence Microscope (Keyence Corp, of America, Austin). To investigate the expression of HIF-2a, the slides were incubated with goat polyclonal anti-HIF-2a (R&D systems, 1 :50 dilution) at 4°C overnight, washed three times with PBS, and incubated with anti-goat Alexa Fluor 488 conjugated secondary antibody (Abeam, 1 :2000 dilution) at room temperature for 60 minutes. Images were analyzed using a Keyence All-in-One Fluorescence Microscope (Keyence Corp, of America, Austin). To determine the uptake of liposomal siRNA in heart tissues, the slides were washed with PBS and counterstained with DAPI nucleic acid stain. Images were observed on a Keyence All-in-One Fluorescence Microscope (Keyence Corp, of America, Austin).Western Blotting Assay

[0099] To evaluate the expression of HIF-2a, heart tissues were homogenized, and the nuclear protein was extracted using NE-PER nuclear and cytoplasmic extraction reagents (Thermo Scientific, Rockford, IL). To extract total heart tissue protein extracts, the hearts were sonicated in T-PER tissue protein extraction reagents (Thermo Scientific, Rockford, IL). Protein concentrations were measured using the BCA protein assay reagent (Pierce, Rockford, IL). Proteins were separated by using 4-15% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (25 pg protein / lane) and transferred onto Immun-Blot PVDF membrane / filter paper (Bio-Rad, Hercules, CA). The PVDF membranes were then incubated with indicated antibodies, including anti-HIF-2a (R&D systems), anti-PGC-la (Abeam), anti-PPARa, anti- ACADVL, and anti-ACADS (Santa Cruz Biotechnology, Inc.). Subsequently, the blot was incubated with goat anti-rabbit or anti-mouse HRP-labeled secondary antibodies. Proteins were detected using Pierce-enhanced chemiluminescence Western blotting substrate. B-Actin (Sigma- Aldrich) or a-tubulin (Santa Cruz Biotechnology, Inc., Dallas, TX) were used as a loading control. Transmission Electron Microscopy

[0100] T o assess the mitochondrial ultrastructure, heart tissue sections were initially fixed with 3% glutaraldehyde in PBS (pH 7.4) and post-fixed with 1% osmium tetroxide. Dehydration was carried out in a series of graded alcohol washes (70%, 80%, 90%, and 100% ethanol ), followed by two acetone washes. The samples were infiltrated with Epon plastic resin, embedded, and cut into 1 pm -thick sections with an RMC MTXL Ultra Microtome (Boeckeler Instruments, Tucson, AZ for low-resolution images. Furthermore, the ventricular sections were cut into 60-80 nm- thick sections for ultra-structure images. The thin sections were stained for uranyl acetate and lead citrate. Images were acquired with a JEOL JeM-1230 transmission electron microscope (JEOL, Tokyo, Japan).RNA sequencing

[0101] RNA sequencing was performed for whole heart tissue from three groups. Total RNA was extracted utilizing RNeasy Fibrous Tissue Mini Kit (Qiagen, Germany) and used for constructing a cDNA library, followed by high throughput sequencing on an Illumina® NovoSeq 6000 paired-end platform (Novogene, Sacramento, CA). The resulting fragments per kilobase million data were used to estimate gene expression levels, and genes with an adjusted p-value <0.05 and an absolute fold change >1 were considered differentially expressed.Evaluation of Clinical Outcome

[0102] Oxygen saturation (SpO?) and Heart rate (HR) data were collected using the MouseOx® System (STARR Life Sciences Corp.). MouseOx® is a pulse oximeter designed to measurerodents’ arterial SpO2 and HR. Prenatal pups were placed decubitus on white x 4-inch gauze pads. The MouseOx® collar sensor was attached low around the pups’ spine, and the infrared sensors transilluminated the abdomen. Once connected to the sensor, oxygenation measurements and heart rate were collected consecutively every minute (on the minute) for 10 minutes by a single, trained study team member.

[0103] Physiologic cardiac function was investigated using echocardiographic evaluation. In the established Nitrofen CDH model, CDH Sprague Dawley (SD) rodents were compared to control SD neonates and CDH SD neonates treated prenatally with liposomal HIF-2a siRNA. Cardiac function was assessed using the Vevo 3100 ultrasonography system following the caesarian section at gestation day 21. Immediately after delivery, neonatal rats were placed on a temperature-controlled pad set to 37°C. They were then positioned supine and secured by their limbs to a second temperature-controlled pad, also set to 37°C. The high-frequency MX700 (29- 71 MHz; center transmit 50 MHz) linear array transducer (all Fujifilm Visualsonics Inc., Canada) was used under the “Mouse Vascular” application preset to capture detailed images of the right ventricular anatomy and pulmonary blood flow patterns.

[0104] Right ventricular (RV) anatomy was assessed using M-mode, measuring interventricular septum (IVS) thickness, RV internal diameter (RVID), and RV free wall diameter during both diastole and systole. Changes in these parameters can indicate RV remodeling and dysfunction. Pulmonary arterial blood flow patterns were evaluated using pulsed-wave Doppler, with parameters such as peak velocity, peak gradient, mean gradient, and velocity time integral (VTI) used to assess pulmonary hypertension (PH) and RV function. Elevated peak velocities and gradients of the tricuspid regurgitant jet (TRV) typically suggest severe PH, while lower values may indicate poor cardiac output and severe right heart dysfunction. The mean gradient across the tricuspid valve reflects the average pressure gradient between the RV and right atrium, providing insight into the severity of PH. A reduced VTI may suggest impaired RV function or increased pulmonary vascular resistance.

[0105] For pulmonary tissues, the standard rodent nitrofen model was also used. At birth, Hypoxyprobe, a pimonidazole-HCl-based hypoxia marker, was administered intraperitoneally to all pups. Control pups were maintained either in an environment of normoxia (room air) or hypoxia (4% O2) for one hour. CDH pups were maintained on room air. Left lungs were collected. The extent of parenchymal hypoxia was assessed by immunofluorescence staining. The relative expression of HIF-la and HIF-2a were measured by western blotting. Comparative statistics were performed using GraphPad Prism.Statistical Analyses

[0106] Data related to neonatal rat echocardiograms were analyzed using Vevo CQ software. Kruskal -Wallis analysis was performed followed by Dunn’s post-tests to compare between two specific groups. For all analyses, comparisons among groups were made using unpaired / -tests; the significance level was set at <0.05. Results are shown as the value ± standard deviation (SD). Statistical analysis was performed using Prism 9 (GraphPad Software, San Diego, CA).EXAMPLE 2. Prenatal-CDH Cardiac Tissues Are More Hypoxic than Control Tissues

[0107] Normal and CDH cardiac tissues were evaluated in a CDH model system (described in Example 1) in the immediate postnatal period. RNA sequencing analysis was performed, and 46 genes relating to mitochondrial and fatty acid biogenesis were significantly downregulated in CDH cardiac tissue (data not shown). On transmission electron microscopy (TEM) analysis, CDH ventricular mitochondria displayed abnormal shape, cristae loss, and a less dense mitochondrial matrix (FIG. 1).

[0108] Cardiac tissue from both normal and CDH groups demonstrated prenatal hypoxia as determined by immunofluorescent staining (data not shown). However, cardiac tissues from prenatal CDH pup hearts displayed nearly 7x more hypoxia than control hearts (FIG. 2A) (n = 3, p = 0.001). Western blotting analysis showed that the expression of HIF-2a was significantly increased in the CDH cardiac tissue (FIGS. 2B-2C, n = 3, P = 0.023). Confocal microscopy analysis also demonstrated that the expression of cardiac HIF-2a was significantly elevated in CDH pups compared to control pups (FIG. 2D, n = 3, P = 0.003). These data suggested that CDH- associated hypoxia is initiated in utero.EXAMPLE 3. Liposomal Delivery of siRNA in Prenatal Cardiac Tissues

[0109] The present prenatal hypoxia intervention system (PHIS) was tested in a CDH model system (FIGS. 3A-3B). Fluorescently labeled liposomal siRNA was prepared as described in Example 1. The method of DPPC synthesis was adequate to produce nanoparticles smaller than 200 nm.

[0110] Sprague-Dawley rats were inj ected with the labeled liposomal siRNA at gestational days 14, 17, and 20. At gestational day 21, the prenatal offspring cardiopulmonary tissues were collected. Confocal microscopy images (63x magnification) showed the absence of fluorescence in cardiac tissues of a PBS-injected control and CDH rats and showed the uptake of fluorescently labeled liposomes into CDH cardiac tissues after the injection of the liposomal-siControl-Cy5 and liposomal -HIF-2a-Cy 5 (data not shown). Tissue sections were counterstained with 4’,6’- diamidino-2-phenylindole (DAPI) nucleic acid stain (data not shown). Quantitative analysis ofthese data showed a significant uptake of fluorescently labeled liposomal siRNA into CDH cardiac tissues compared to PBS-injected control and CDH pups (FIG. 4, n = 3, P < 0.05). Similar results were observed with respect to CDH lung tissues (data not shown).EXAMPLE 4. Effects of Liposomal Delivery of HIF-2a siRNA on Prenatal Cardiac Gene Expression[OHl] RNA sequencing analysis identified eight mitochondrial and fatty acid biogenesis- associated genes that were downregulated (median fold change (MFC) 0.38, range 0.04-0.52) in CDH cardiac tissues (Table 2). The siHIF-2a treatment restored this alteration (MFC 2.17, range 1.36-10.60). Moreover, eleven oxygen transport-associated genes were downregulated (MFC 0.49, range 0.05-0.69) (Table 3) and eight pulmonary hypertension-associated genes were upregulated (MFC 2.80, range 2.22-20.19) in CDH cardiac tissues (Table 4). Furthermore, siHIF- 2a treatment restored these alterations as shown in oxygen transport-related genes (MFC 1.77, range 1.28-15.05) and pulmonary hypertension-related genes (MFC 0.56. range 0.42-0.91), respectively (Tables 3-4).Table 2: Average expression of mitochondrial and fatty acid biogenesis-associated genesTable 3: Average expression of oxygen transport-related genesTable 4: Average expression of pulmonary hypertension-associated genesEXAMPLE 5. Effects of Liposomal Delivery of HIF-2a siRNA in Prenatal Cardiac Tissues

[0112] Western blotting analysis showed that the expression of HIF-2a was significantly increased in the CDH cardiac tissue (FIGS. 5A-5B, P = 0.005), and the confocal analysis also demonstrated that the expression of cardiac HIF-2a was significantly elevated in CDH pups compared to control pups (FIG. 5C, n = 3, P = 0.01). However, siHIF-2a treatment reversed the alterations (FIGS. 5A-5C). Western blotting analysis also showed that the expression of mitochondrial and fatty acid biogenesis markers, PGC-la and PPARa, ACADVL, and AC ADS, was decreased in CDH myocardium compared with controls (69%, 30%, 67.4%, and 28.3%, respectively, n = 3, all p < 0.02) (FIGS. 6A-6E). The siHIF-2a treatment restored biogenesis marker expression (FIGS. 6A-6E).

[0113] The expression of two mtDNA-encoded proteins, CytB and MT-ND4L, was measured to assess mitochondrial biogenesis. These two proteins are subunits of the mitochondrial electron transport chain complexes I and III, respectively. The relative protein expression of CytB and MT- ND4L was significantly decreased in CDH cardiac tissue (CytB, p=0.02; MT-ND4L, p<0.0001) (FIGS. 7A-7D). However, siHIF-2a treatment restored the expression of both proteins compared to CDH cardiac tissue (CytB, p=0.03; MT-ND4L, p=0.001) (FIGS. 7A-7D).

[0114] TEM analysis was conducted to assess mitochondrial ultrastructure. CDH-ventricular mitochondria appeared swollen (FIG. 8 A, middle images (Magnifications: 26,300X, Scale bars = 100 nm)). Additionally, CDH mitochondria displayed cristae loss, a less dense mitochondrial matrix, showing peripherally placed, disorientated, and disintegrating cristae (FIGS. 8A-8B), suggesting probable mitochondrial dysfunction. The siHIF-2a treatment improved the mitochondria ultrastructure (FIGS. 8A-8B).

[0115] To understand differences in prenatal oxygenation between CDH and control rodents, and the impact of liposomal siHIF-2a on the oxygenation of prenatal rodents, a MouseOx® throat sensor was connected to the torso of prenatal pups. Because CDH rodents universally die within30-60 minutes of birth, SpO2 values and HR were collected every minute for the first 10 and 20 minutes of life. Rodents with CDH had lower SpO2 levels (n = 6, 39.8%, and 44.0%) at the first 10 and 20 minutes of life compared to the control group (n = 6, 79.25%, and 92.6%); both P < 0.001 (FIG. 9A). siHIF-2a treatment showed an improvement of SpO2 levels at the first 10 minutes of life (n = 4,50.5%, P = 0.231); however, there was a significant improvement in SpO2 levels following siHIF-2a treatment at the first 20 minutes of life (n = 4, 57.8%, p = 0.042) compared to CDH rodents (FIG. 9A). The heart rate of CDH rodents was low at the first 10 minutes (n = 6, 124.2 bpm) and 20 minutes (n = 6, 140.3 bpm) of life compared to the control group (n = 6, 126 bpm and 222.7 bpm); p = 0.88 and p = 0.048 (FIG. 9B). There was a significant improvement in heart rate following siHIF-2a treatment at the first 20 minutes of life (n = 4, 254.8 bpm, p = 0.024) compared to CDH rodents (FIG. 9B).EXAMPLE 6. Effects of Liposomal Delivery of HIF-2a siRNA on Prenatal Cardiac Structure and Function

[0116] Four control, three CDH, and six siRNA rats were evaluated. The right ventricular (RV) size during systole differed significantly across all groups (p=0.015) (FIG. 10A). CDH rats showed a marked increase in size from 0.65 mm to 1.26 mm (p=0.023), while siRNA-treated rats exhibited a partial reduction to 0.87 mm. The right ventricular free wall during diastole (RVFWd) measured 0.41 mm (Control), 0.52 mm (CDH), and 0.42 mm (siRNA), suggesting early signs of right ventricular hypertrophy in CDH (FIG. 10C). Additionally, the right ventricular internal diameter during diastole (RVIDd) was 1.11 mm (Control), 1.62 mm (CDH), and 1.11 mm (siRNA), indicating right ventricular dysfunction in CDH with improvement following siRNA treatment (FIG. 10B).

[0117] Pulmonary blood flow patterns revealed a significant decrease in peak velocity across all groups (p=0.05), likely due to right ventricular failure, with values dropping from 303.1 mm / s in controls to 159.1 mm / s in CDH rats (p=0.11) and showing partial recovery to 191.2 mm / s in siRNA rats (FIG. 10D). Mean velocity values were 183.1 mm / s (Control), 82.8 mm / s (CDH), and 123.1 mm / s (siRNA), reflecting impaired blood flow in CDH with partial recovery in siRNA- treated rats (FIG. 10E). CDH rats also showed a decline in VTI (reflecting RV function and pulmonary vascular resistance) from 28.3 mm to 20.3 mm (p=0.59), with partial recovery in siRNA rats (21.4 mm, p=0.38). Resistance Index values were 0.98 (Control), 0.97 (CDH), and 0.98 (siRNA), indicating stable vascular resistance across groups (FIG. 10F). Pulmonary Index values were 1.6 (Control), 1.9 (CDH), and 1.5 (siRNA), suggesting increased pulmonary resistance in CDH, with improvement in siRNA.EXAMPLE 7. Effects of Liposomal Delivery of HIF-2ot siRNA in Prenatal PulmonaryTissues

[0118] The effect of nitrofen-induced CDH on prenatal pulmonary tissue was studied using the Sprague Dawley model (FIG. 11 A). At birth, Hypoxyprobe, a pimonidazole-HCl based hypoxia marker, was administered intraperitoneally to all pups. Control pups were maintained either in an environment of normoxia (room air) or hypoxia (4% O2) for one hour. CDH pups were maintained on room air. Left lungs were collected. The extent of parenchymal hypoxia was assessed by immunofluorescence staining. The relative expression of HIF-la and HIF-2a were measured by Western blotting. Comparative statistics were performed using GraphPad Prism. The oxygen saturation of tissue from pups of control or CDH rodents was measured (Mouse Ox measurements), showing that CDH pups exhibited significantly lower oxygen saturation (FIG. 11B). Hypoxia-related proteins were analyzed in the newborn rodents. FIG. 12B demonstrates evidence of postnatal hypoxia in the lungs of rodents exposed to 4% oxygen (“4% hypoxia”) and CDH rodents, as compared to pups of control rodents. The hypoxyprobe stains pink, and the relative intensity is shown in the graph. Western blot analysis similarly demonstrated increased expression of Hifla and Hif2a in CDH pups as compared to a control (FIGS. 12C-12D ).

[0119] The effect of nitrofen-induced CDH on prenatal hypoxia was analyzed. The level of hypoxyprobe observed in the left pulmonary parenchyma of control or CDH rodents was quantified (FIG. 13B). Western blot analysis similarly demonstrated increased expression of Hifla and Hif2a in CDH pups as compared to a control (FIGS. 13C-13D ).

[0120] The effect of siHif2a prenatal treatment on pulmonary tissue was studied using the Sprague Dawley model (FIG. 14A). Western blot analysis for Hif2a expression in the lungs of control rodents, CDH rodents, and CDH rodents after prenatal liposome siHif2a RNA delivery was performed. These data demonstrate that prenatal treatment with siHif2a resulted in decreased Hif2a expression.

[0121] The effect of Hif2a modulation on heart rate and oxygenation was determined for rodents at 20 minutes of life for control, CDH, and CDH+liposomal siHif2a rodents (FIGS. 15A-15B). The effect on inflammation also was analyzed by Western blot or QRT-PCR analysis of inflammation-related marker expression (FIGS. 16A-16E). In addition, the tissues of the rodents were analyzed to determine where the liposomal siRNA was delivered, showing the effective delivery to heart and lung tissues (FIG. 17A). The relative intensity of liposomal uptake by pulmonary tissues was also measured (FIG. 17B).EXAMPLE 8. Effects of Positive Liposomal Delivery of HIF-2ot siRNA in Prenatal Pulmonary Tissues

[0122] The effect of a positively-charged configuration of the liposomal carrier was studied using inflammation markers interleukin-6 (IL-6) and nuclear factor kappa-B (NF-kB) in lung tissue. A positively-charged liposomal siRNA composition was prepared as described in Example 1, using l,2-dioleoyl-sn-glycerol-3 -phosphocholine (DOPC) and stearylamine and HIF-2a siRNA, and delivered prenatally in the Sprague Dawley model. Western blot analysis demonstrated decreased expression of IL-6 and NF-kB with the administration of the DOPC-stearylamine HIF-2a siRNA as compared to a control (FIGS. 18A-18D).

[0123] Disclosed herein are materials, compositions, and methods that can be used for, can be used in conjunction with, or can be used in preparation for the disclosed embodiments. These and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective combinations and permutations of these compositions may not be explicitly disclosed, each is specifically contemplated and described herein. For example, if a method is disclosed and discussed, and a number of modifications that can be made to a number of molecules included in the method are discussed, each and every combination and permutation of the method, and the modifications that are possible are specifically contemplated unless specifically indicated to the contrary. Likewise, any subset or combination of these is also specifically contemplated and disclosed. This concept applies to all aspects of this disclosure including, but not limited to, steps in methods using the disclosed compositions. Thus, if there are various additional steps that can be performed, it is understood that each of these additional steps can be performed with any specific method steps or combination of method steps of the disclosed methods and that each such combination or subset of combinations is specifically contemplated and should be considered disclosed.

[0124] Publications cited herein and the material for which they are cited are hereby specifically incorporated by reference in their entireties. The following description provides further nonlimiting examples of the disclosed compositions and methods.Sequences

Claims

CLAIMS1. A composition comprising a hypoxia-inducible factor (HIF) interfering nucleic acid encapsulated by a neutral or positively charged phospholipid component.

2. The composition of claim 1, wherein the HIF interfering nucleic acid is selected from a group consisting of a hypoxia-inducible factor 2 alpha (HIF-2a) interfering nucleic acid, hypoxia-inducible factor 1 alpha (HIF- la) interfering nucleic acid, hypoxiainducible factor 2 beta (HIF-2P) interfering nucleic acid, and hypoxia-inducible factor 1 beta (HIF-ip) interfering nucleic acid.

3. The composition of claim 1 or 2, wherein the HIF interfering nucleic acid is a HIF-2a interfering nucleic acid.

4. The composition of any one of claims 1-3, wherein the HIF interfering nucleic acid is selected from a group consisting of a small interfering RNA (siRNA), short hairpin RNA (shRNA), single-stranded interfering RNA (ss-siRNA), and microRNA (miRNA).

5. The composition of any one of claims 1-4, wherein the HIF interfering nucleic acid is an siRNA.

6. The composition of any one of claims 5, wherein the HIF interfering nucleic acid is a HIF-2a siRNA.

7. The composition of any one of claims 1-6, wherein the HIF interfering nucleic acid comprises 15 to 30 nucleotides.

8. The composition of any one of claims 1-7, wherein the HIF interfering nucleic acid comprises SEQ ID NO: 1 and / or SEQ ID NO: 2.

9. The composition of any one of claims 1-8, wherein the phospholipid component comprises a phospholipid selected from a group consisting of dipalmitoylphosphatidylcholine (DPPC), di oleoyl-sn-glycero-3 -phosphocholine (DOPC), egg phosphatidylcholine (EPC), dilauryloylphosphatidylcholine (DLPC), dimyristoylphosphatidylcholine (DMPC), distearoylphosphatidylcholine (DSPC), l-myristoyl-2- palmitoyl phosphatidylcholine (MPPC), 1 -palmitoyl -2-myristoyl phosphatidylcholine (PMPC), l-palmitoyl-2-stearoyl phosphatidylcholine (PSPC), 1 -stearoyl -2-palmitoyl phosphatidylcholine (SPPC), dimyristoyl phosphatidylcholine (DMPC), l,2-diarachidoyl-sn-glycero-3-phosphocholine (DAPC), l,2-dibehenoyl-sn-glycero-3 -phosphocholine (DBPC), 1,2- dieicosenoyl-sn-glycero-3-phosphocholine (DEPC), palmitoyloleoyl phosphatidylcholine (POPC), lysophosphatidylcholine (LPC), dilinoleoylphosphatidylcholine (DLPC), distearoylphosphatidylethanolamine (DSPE), dimyristoylphosphatidylethanolamine (DMPE), dipalmitoyl phosphatidylethanolamine (DPPE), palmitoyloleoyl phosphatidylethanolamine (POPE), lysophosphatidylethanolamine (LPE), and a combination thereof.

10. The composition of any one of claims 1-9, wherein the phospholipid component comprises DPPC, DOPC, or a combination thereof.

11. The composition of claim 10, wherein the phospholipid component comprises DPPC and DOPC in a 7:3 w / w ratio.

12. The composition of any one of claims 1-8, wherein the phospholipid component comprises l,2-dioleoyl-sn-glycero-3-phosphocholine and stearylamine.

13. The composition of any one of claims 1-11, further comprising a pharmaceutically acceptable carrier.

14. A method for treating a hypoxia-related condition, comprising: administering to a subject in need thereof a composition comprising a hypoxiainducible factor (HIF) interfering nucleic acid encapsulated by a neutral or positively charged phospholipid component.

15. The method of claim 14, wherein the hypoxia-related condition is selected from a group consisting of congenital diaphragmatic hernia (CDH), pulmonary hypoplasia, pulmonary atresia, congenital pulmonary airway malformation, congenital anatomic cardiac disease, prenatal cardiac dysfunction, ectopic cordis, atrial septal defect (ASD), cleft lip, cleft palate, craniosynostosis, esophageal atresia, anophthalmia and microphthalmia, inflammation, tricuspid atresia, truncus arteriosus (TA), chorioamnionitis, cytomegalovirus infection, congenital rubella infection, congenital toxoplasmosis, acute respiratory distress syndrome, restrictive lung disease, and idiopathic pulmonary fibrosis (IPF).

16. The method of claim 14 or 15, wherein the hypoxia-related condition is a cardiac disease or condition selected from a group consisting of congenital anatomic cardiac disease, prenatal cardiac dysfunction, and ectopic cordis.

17. The method of claim 14 or 15, wherein the hypoxia-related condition is a pulmonary disease or condition selected from a group consisting of CDH, pulmonary hypoplasia, pulmonary atresia, and congenital pulmonary airway malformation.

18. The method of claim 17, wherein the hypoxia-related condition is CDH, and wherein the composition is administered to a pregnant subject with a fetus that has CDH.

19. The method of claim 17, wherein the hypoxia-related condition is CDH, and wherein the composition is administered to the subject that has CDH.

20. The method of any one of claims 14-19, wherein the HIF interfering nucleic acid is selected from a group consisting of a hypoxia-inducible factor 2 alpha (HIF-2a) interfering nucleic acid, hypoxia-inducible factor 1 alpha (HIF- la) interfering nucleic acid, hypoxia-inducible factor 2 beta (HIF-2P) interfering nucleic acid, and hypoxia-inducible factor 1 beta (HIF-ip) interfering nucleic acid.

21. The method of any one of claims 14-20, wherein the HIF interfering nucleic acid is a HIF-2a interfering nucleic acid.

22. The method of any one of claims 14-21, wherein the HIF interfering nucleic acid is selected from a group consisting of a small interfering RNA (siRNA), short hairpin RNA (shRNA), single-stranded interfering RNA (ss-siRNA), and microRNA (miRNA).

23. The method of any one of claims 14-22, wherein the HIF interfering nucleic acid is an siRNA.

24. The method of any one of claims 14-23, wherein the HIF interfering nucleic acid comprises 15 to 30 nucleotides.

25. The method of any one of claims 14-24, wherein the HIF interfering nucleic acid comprises SEQ ID NO: 1 and / or SEQ ID NO: 2.

26. The method of any one of claims 14-25, wherein the phospholipid component comprises a phospholipid selected from a group consisting of dipalmitoylphosphatidylcholine (DPPC), di oleoyl-sn-glycero-3 -phosphocholine (DOPC), egg phosphatidylcholine (EPC), dilauryloylphosphatidylcholine (DLPC), dimyristoylphosphatidylcholine (DMPC), distearoylphosphatidylcholine (DSPC), l-myristoyl-2- palmitoyl phosphatidylcholine (MPPC), 1 -palmitoyl -2-myristoyl phosphatidylcholine (PMPC),l-palmitoyl-2-stearoyl phosphatidylcholine (PSPC), 1 -stearoyl -2-palmitoyl phosphatidylcholine (SPPC), dimyristoyl phosphatidylcholine (DMPC), l,2-diarachidoyl-sn-glycero-3- phosphocholine (DAPC), l,2-dibehenoyl-sn-glycero-3 -phosphocholine (DBPC), 1,2- dieicosenoyl-sn-glycero-3-phosphocholine (DEPC), palmitoyloleoyl phosphatidylcholine (POPC), lysophosphatidylcholine (LPC), dilinoleoylphosphatidylcholine (DLPC), distearoylphosphatidylethanolamine (DSPE), dimyristoylphosphatidylethanolamine (DMPE), dipalmitoyl phosphatidylethanolamine (DPPE), palmitoyloleoyl phosphatidylethanolamine (POPE), lysophosphatidylethanolamine (LPE), and a combination thereof.

27. The method of any one of claims 14-26, wherein the phospholipid component comprises DPPC, DOPC, or a combination thereof.

28. The method of claim 27, wherein the phospholipid component comprises DPPC and DOPC in a 7:3 w / w ratio.

29. The method of any one of claims 14-25, wherein the phospholipid component comprises l,2-dioleoyl-sn-glycero-3-phosphocholine and stearylamine.

30. A method for producing a composition comprising a hypoxia-inducible factor (HIF) interfering nucleic acid encapsulated by a neutral phospholipid component, comprising: mixing a first neutral phospholipid, a second neutral phospholipid, and an HIF- interfering nucleic acid.

31. The method of claim 30, wherein the HIF interfering nucleic acid is selected from a group consisting of a hypoxia-inducible factor 2 alpha (HIF-2a) interfering nucleic acid, hypoxia-inducible factor 1 alpha (HIF- la) interfering nucleic acid, hypoxiainducible factor 2 beta (HIF-2P) interfering nucleic acid, and hypoxia-inducible factor 1 beta (HIF-ip) interfering nucleic acid.

32. The method of claim 30 or 31, wherein the HIF interfering nucleic acid is a HIF-2a interfering nucleic acid.

33. The method of any one of claims 30-32, wherein the HIF interfering nucleic acid is selected from a group consisting of a small interfering RNA (siRNA), short hairpin RNA (shRNA), single-stranded interfering RNA (ss-siRNA), and microRNA (miRNA).

34. The method of any one of claims 30-33, wherein the HIF interfering nucleic acid is an siRNA.

35. The method of any one of claims 30-34, wherein the HIF interfering nucleic acid is a HIF-2a siRNA.

36. The method of any one of claims 30-35, wherein the HIF interfering nucleic acid comprises 15 to 30 nucleotides.

37. The method of any one of claims 30-36, wherein the HIF interfering nucleic acid comprises SEQ ID NO: 1 and / or SEQ ID NO: 2.

38. The method of any one of claims 30-37, wherein the first neutral phospholipid and the second neutral phospholipid are selected from a group consisting of dipalmitoylphosphatidylcholine (DPPC), di oleoyl-sn-glycero-3 -phosphocholine (DOPC), egg phosphatidylcholine (EPC), dilauryloylphosphatidylcholine (DLPC), dimyristoylphosphatidylcholine (DMPC), distearoylphosphatidylcholine (DSPC), l-myristoyl-2- palmitoyl phosphatidylcholine (MPPC), 1 -palmitoyl -2-myristoyl phosphatidylcholine (PMPC), l-palmitoyl-2-stearoyl phosphatidylcholine (PSPC), 1 -stearoyl -2-palmitoyl phosphatidylcholine (SPPC), dimyristoyl phosphatidylcholine (DMPC), l,2-diarachidoyl-sn-glycero-3- phosphocholine (DAPC), l,2-dibehenoyl-sn-glycero-3 -phosphocholine (DBPC), 1,2- dieicosenoyl-sn-glycero-3-phosphocholine (DEPC), palmitoyloleoyl phosphatidylcholine (POPC), lysophosphatidylcholine (LPC), dilinoleoylphosphatidylcholine (DLPC), distearoylphosphatidylethanolamine (DSPE), dimyristoylphosphatidylethanolamine (DMPE), dipalmitoyl phosphatidylethanolamine (DPPE), palmitoyloleoyl phosphatidylethanolamine (POPE), and lysophosphatidylethanolamine (LPE).

39. The method of any one of claims 30-38, wherein the neutral phospholipid component comprises DPPC, DOPC, or a combination thereof.

40. The method of claim 39, wherein the neutral phospholipid component comprises DPPC and DOPC in a 7:3 w / w ratio.

41. A method for producing a composition comprising a hypoxia-inducible factor (HIF) interfering nucleic acid encapsulated by a positively charged phospholipid component, comprising mixing 1,2-di oleoyl-sn-glycero-3 -phosphocholine, stearylamine, and a HIF interfering nucleic acid.

42. The method of claim 41, wherein the HIF interfering nucleic acid is selected from a group consisting of a hypoxia-inducible factor 2 alpha (HIF-2a) interfering nucleic acid, hypoxia-inducible factor 1 alpha (HIF- la) interfering nucleic acid, hypoxiainducible factor 2 beta (HIF-2P) interfering nucleic acid, and hypoxia-inducible factor 1 beta (HIF-ip) interfering nucleic acid.

43. The method of claim 41 or 42, wherein the HIF interfering nucleic acid is a HIF-2a siRNA.

44. The method of any one of claims 41-43, wherein the phospholipid component comprises DOPC and stearylamine in a 7:3 molar ratio.

45. The method any one of claims 30-44, wherein the HIF interfering nucleic acid is mixed with the phospholipid component in a 1:10 w / w ratio.

Images