Promoter mutant and use thereof

By mutating the PsrfA promoter in Bacillus subtilis WB600, the expression level of NADH pyrophosphatase was increased, solving the problem of insufficient NADH pyrophosphatase expression and realizing the efficient generation of NMNH and the efficient application of biocatalysis.

WO2025227530A1PCT designated stage Publication Date: 2025-11-06SERAGON BIOSCIENCES INC +2
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/108043
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-04-28
Filing Date
2024-07-29
Publication Date
2025-11-06

AI Technical Summary

Technical Problem

In the existing technology, the expression level of NADH pyrophosphatase in Bacillus subtilis WB600 is low, resulting in insufficient NMNH production efficiency, which cannot meet the growing demand. Furthermore, the existing promoters do not provide strong enough regulation of NADH pyrophosphatase, thus failing to achieve efficient expression.

Method used

A novel promoter mutant was constructed by mutating the core region and spacer sequence of the PsrfA promoter of Bacillus subtilis. This mutant was then combined with a vector and recombinant plasmid to increase the expression level of NADH pyrophosphatase. Bacillus subtilis WB600 was then used as the host bacterium to biocatalyze the production of NMNH.

Benefits of technology

It significantly improved the activity of NADH pyrophosphatase, achieving efficient NMNH production, meeting the requirements of biocatalysis, and reaching the highest yield in whole-cell catalytic batch conversion.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024108043_06112025_PF_FP_ABST
    Figure CN2024108043_06112025_PF_FP_ABST
Patent Text Reader

Abstract

Disclosed are a promoter mutant and use thereof. On the basis of a promoter PsrfA, by mutating core regions and an interval sequence of the two core regions, a PsrfA promoter mutant with improved induced expression activity compared to the wild type is obtained. Meanwhile, also provided is a vector containing the promoter mutant. By using the promoter mutant or the vector, the expression quantity of the expressed protein can be increased. The present invention has wide application prospects in the field of protein expression. Meanwhile, on the basis of the promoter mutant, further provided are a recombinant plasmid and recombinant bacteria with improved NADH pyrophosphatase expression quantity, and the recombinant plasmid and recombinant bacteria can be used in the biocatalysis reaction of reduced nicotinamide mononucleotides, facilitating large-scale efficient production of reduced nicotinamide mononucleotides.
Need to check novelty before this filing date? Find Prior Art

Description

Promoter mutant and application thereof TECHNICAL FIELD

[0001] The present application belongs to the technical field of enzyme engineering. More particularly, it relates to a promoter mutant and application thereof. BACKGROUND

[0002] Nicotinamide adenine dinucleotide (NAD + ) is a coenzyme of various dehydrogenases, and is involved in various metabolic reactions such as tricarboxylic acid cycle and glycolysis. With the growth of age, the decrease of NAD + level in the human body can induce neurodegenerative diseases such as Alzheimer's disease and retinal degenerative diseases. Reduced nicotinamide mononucleotide (NMNH) is an effective NAD + supplement, which can effectively increase the NAD + content. Therefore, the demand for NMNH is also increasing day by day.

[0003] The biological catalytic method for generating NMNH is to hydrolyze the ether bond of reduced nicotinamide adenine dinucleotide (NADH) into NMNH and AMP (adenosine monophosphate) by NADH pyrophosphatase, which has mild enzymatic reaction conditions and is easy to produce active chiral products. In the biological catalysis of NMNH, Escherichia coli is often used as an expression host of NADH pyrophosphatase to participate in the biological catalysis of NMNH. However, as a gram-negative bacterium, the endotoxin produced by Escherichia coli limits its application in the field of food additives and drug production. At the same time, the target protein often forms inactive inclusion bodies in Escherichia coli, and lacks effective post-translational modification process, which also limits the expression of NADH pyrophosphatase and catalytic generation of NMNH in Escherichia coli.

[0004] To avoid the safety problems caused by Escherichia coli itself, some technicians have realized the recombinant expression of NADH pyrophosphatase in Bacillus subtilis WB600. As a biologically safe GRAS (Generally regarded as safe) strain (Schumann et al., Adv Appl Microbiol 2007, 62: 137-189), WB600 is more suitable for generating NMNH by expressing NADH pyrophosphatase, which can be used as food or medicine to improve the NAD + level in the organism. However, the expression amount of NADH pyrophosphatase in WB600 is low, and the enzyme activity of the expressed NADH pyrophosphatase is less than 2 U / mL, which cannot meet the needs of efficient generation of NMNH to meet its growing demand.

[0005] Promoter engineering is a common strategy to improve microbial protein production. Among them, the constitutive promoter usually activates the transcription of genes during cell growth, but this transcription mode will cause metabolic burden of cells, thus producing production pressure to reduce productivity. The inducible promoter can regulate the expression of target genes, but the inducer is expensive and not economically feasible on an industrial scale. The self-inducible promoter can regulate the expression of genes in response to the bacterial quorum sensing (QS) system in Bacillus subtilis, without adding inducers. However, the existing self-inducible promoter is still not strong enough to regulate NADH pyrophosphatase, and cannot efficiently express NADH pyrophosphatase, such as using the promoter P srfA When expressing NADH pyrophosphatase, the enzyme activity of the expressed NADH pyrophosphatase is less than 3 U / mL.

[0006] In addition, although there are reports in the prior art that the inducibility of the promoter P srfA Core region sequence is replaced or mutated to improve its inducibility, but the same P srfA The inducibility of the mutant is different for different expression systems and different genes, and there is still a lack of a promoter or a promoter mutant that can effectively improve the expression of NADH pyrophosphatase.

[0007] SUMMARY

[0008] The present application is aimed at the defects and steps in the prior art, and provides a promoter mutant and its application. The mutant can improve the expression of NADH pyrophosphatase, thereby improving the enzyme activity of NADH pyrophosphatase, and better meeting the needs of efficient production of NMNH by biological catalysis.

[0009] The first object of the present application is to provide a promoter mutant.

[0010] The second object of the present application is to provide a vector.

[0011] The third object of the present application is to provide the application of the promoter mutant or the vector in improving protein expression.

[0012] The fourth object of the present application is to provide the application of the promoter mutant or the vector in preparing a product for improving protein expression.

[0013] The fifth object of the present application is to provide a method for improving protein expression.

[0014] The sixth object of the present application is to provide a recombinant plasmid.

[0015] The seventh object of the present application is to provide a recombinant bacteria.

[0016] The eighth object of the present application is to provide the use of the recombinant plasmid or the recombinant bacteria in the biological catalysis of generating reduced nicotinamide mononucleotide.

[0017] The ninth object of the present application is to provide the use of the recombinant plasmid or the recombinant bacteria in the preparation of a product for the biological catalysis of generating reduced nicotinamide mononucleotide.

[0018] The tenth object of the present application is to provide a method for the biological catalysis of generating reduced nicotinamide mononucleotide.

[0019] The above objects of the present application are achieved by the following technical solutions.

[0020] The present application utilizes different promoters selected from the genome of Bacillus subtilis for the recombinant expression of NADH pyrophosphatase and finds that, compared to the promoter P HpaII , the promoters P 43 , P mpr , P bpr , P aprE , P nprB , P epr , P srfA and P wapA can all improve the expression amount of NADH pyrophosphatase in Bacillus subtilis. Among the promoters, the most significant effect is the promoter P srfA , but its regulation on NADH pyrophosphatase is still not strong enough. On this basis, the present application makes different modifications to the promoter P srfA , and finds that the mutants obtained by mutating the core region -10, -15 or the spacer sequence between the core region -15 and -35 can improve the inducible expression activity and further improve the expression amount of NADH pyrophosphatase. Therefore, the present application claims the protection of the promoter mutants and the use thereof.

[0021] The present application provides a promoter mutant, and the nucleotide sequence of the mutant is shown in any one of SEQ ID NO. 4-5.

[0022] Specifically, the promoter mutant is obtained by mutating the core region -10, -15 or the spacer sequence between the core region -15 and -35 of the P srfA promoter.

[0023] The present application also provides a vector containing the promoter mutant of the present application.

[0024] The present application improves the inducible expression activity of the P srfA promoter by mutating the same. Therefore, the present application claims the protection of the use of the promoter mutant or the vector in improving the expression amount of proteins.

[0025] The application also claims the use of the promoter mutant or the vector in the preparation of a product for improving the expression amount of a protein.

[0026] The application also provides a method for improving the expression amount of a protein, which comprises constructing a recombinant plasmid of the protein with the promoter mutant shown in any one of SEQ ID NO. 4-5 or inserting the promoter mutant shown in any one of SEQ ID NO. 4-5 in front of the original promoter in the plasmid in series.

[0027] As one of the embodiments, the protein is NADH pyrophosphatase.

[0028] As one of the embodiments, the use or method refers to improving the expression amount of a protein in Bacillus subtilis.

[0029] In the specific embodiments of the application, the amino acid sequence of the used NADH pyrophosphatase is shown in SEQ ID NO. 2.

[0030] In the specific embodiments of the application, the used Bacillus subtilis is B. subtilis WB600.

[0031] The application also provides a recombinant plasmid containing the promoter mutant shown in any one of SEQ ID NO. 3-5 and a gene encoding NADH pyrophosphatase.

[0032] As one of the embodiments, the nucleotide sequence of the gene is shown in SEQ ID NO. 1.

[0033] The application also provides a recombinant bacterium containing the recombinant plasmid described above.

[0034] Optionally, the recombinant bacterium is Bacillus subtilis as an expression host.

[0035] The recombinant plasmid or the recombinant bacterium of the application can efficiently express NADH pyrophosphatase. Therefore, the application claims the use of the recombinant plasmid or the recombinant bacterium in the biological catalysis of generating reduced nicotinamide mononucleotide.

[0036] The application also claims the use of the recombinant plasmid or the recombinant bacterium in the preparation of a product for the biological catalysis of generating reduced nicotinamide mononucleotide.

[0037] The application also provides a method for the biological catalysis of generating reduced nicotinamide mononucleotide, which comprises using the recombinant bacterium of the application as an expression host of NADH pyrophosphatase to catalyze the hydrolysis of reduced nicotinamide adenine dinucleotide.

[0038] Specifically, the method is a whole-cell catalysis method for biocatalysis of reduced nicotinamide mononucleotide, and the volume ratio of 50 mM Tris-HCl (pH=8.0), 5 mM MgCl2, 25 mM NADH and recombinant bacterial lytic enzyme solution in the whole-cell catalysis system is 27:5:2.5:15.5.

[0039] Specifically, the whole-cell catalysis method is a whole-cell catalysis batch conversion. When HPLC is used to detect the consumption of the substrate NADH, the next batch of substrate is added. When the reaction system is added with the fourth batch of substrate, the yield of NMNH reaches the highest.

[0040] Preferably, the carbon source used in the culture medium for culturing the recombinant bacteria is glycerol, and the nitrogen source is cottonseed cake powder and proteose peptone; the use of the carbon source and the nitrogen source can improve the enzyme activity of NADH pyrophosphatase in the recombinant bacteria.

[0041] More preferably, the concentration of glycerol is 16 g / L, and the concentration of cottonseed cake powder and proteose peptone is 54 g / L, wherein the ratio of cottonseed cake powder to proteose peptone is 2:1.

[0042] Preferably, when the recombinant bacteria are placed in a fermentation tank for fermentation culture, the culture temperature is 35-38℃, the pH is 7±0.1, the rotation speed is 400-600 rpm, and the dissolved oxygen is 28-32%. When the dissolved oxygen decreases to the lowest point and cannot be maintained by adjusting the rotation speed, constant feeding is started at a rate of 12 mL / h, so that the carbon source concentration in the culture medium is always maintained at a dynamic balance of about 3 g / L.

[0043] More preferably, the culture temperature is 37℃, and the dissolved oxygen is 30%.

[0044] The present application has the following beneficial effects:

[0045] The present application is based on a promoter P srfA , and the expression activity of the obtained P srfA promoter mutant is higher than that of the wild type. The present application also provides a vector containing the promoter mutant. The use of the promoter mutant or the vector can improve the expression amount of the expressed protein, and has a wide application prospect in the field of protein expression. Meanwhile, based on the promoter mutant, the present application also provides a recombinant plasmid and a recombinant bacteria with improved expression amount of NADH pyrophosphatase, which are used in the biocatalysis reaction of reduced nicotinamide mononucleotide, and are beneficial to the large-scale and efficient production of reduced nicotinamide mononucleotide. BRIEF DESCRIPTION OF DRAWINGS

[0046] Figure 1 is the SDS-PAGE analysis result of NADH pyrophosphatase of recombinant bacteria B. subtilis WB600 / pMA5-EcNudc; lane 1 is the protein band of culture supernatant of recombinant bacteria B. subtilis WB600 / pMA5; lane 2 is the protein band of broken enzyme solution of recombinant bacteria B. subtilis WB600 / pMA5; lane 3 is the protein band of broken enzyme solution of recombinant bacteria B. subtilis WB600 / pMA5-EcNudc; lane 4 is the protein band of culture supernatant of recombinant bacteria B. subtilis WB600 / pMA5-EcNudc.

[0047] Figure 2 is the detection result of NADH pyrophosphatase enzyme activity of 12 recombinant bacteria containing different promoters.

[0048] Figure 3 is the P srfA Figure, a is the P srfA Figure, b is the NADH pyrophosphatase enzyme activity detection result of the mutant strain.

[0049] Figure 4 is the process of random saturation mutation, screening and sequencing of -35 region, -15 region and space sequence of P srfA Figure, a is the process of random saturation mutation, screening and sequencing of -35 region, -15 region and space sequence of P srfA Figure, b is the histogram of flow screening result; MSpace is the designation of mutant of space sequence between -35 region and -15 region; M15 is the designation of mutant of -15 region; M35 is the designation of mutant of -35 region.

[0050] Figure 5 is the medium optimization result of NADH pyrophosphatase recombinant bacteria; a is the carbon source type optimization result; b is the carbon source concentration optimization result; c is the nitrogen source type optimization result; d is the nitrogen source proportion optimization result; e is the nitrogen source concentration optimization result.

[0051] Figure 6 is the result of change of enzyme activity of NADH pyrophosphatase recombinant bacteria in scale-up culture system with culture time.

[0052] Figure 7 is the enzyme characterization result of NADH pyrophosphatase; a is the result of influence of temperature on NADH pyrophosphatase activity; b is the result of influence of pH on NADH pyrophosphatase activity; c is the result of influence of different metal ions on NADH pyrophosphatase activity.

[0053] Figure 8 is the optimization results of Tween 80 concentration and its treatment time on cells; Figure a is the optimization results of Tween 80 concentration; Figure b is the optimization results of Tween 80 treatment time on cells.

[0054] Figure 9 is the batch conversion results of NMNH. DETAILED DESCRIPTION

[0055] The present application will be further described in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present application in any form. Unless otherwise specified, the reagents, methods and devices used in the present application are conventional reagents, methods and devices in the technical field.

[0056] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0057] Example 1 Heterologous expression of NADH pyrophosphatase

[0058] The present application uses an optimized EcNudc gene fragment (the nucleotide sequence of the EcNudc gene fragment is shown in SEQ ID NO. 1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO. 2) derived from Escherichia coli as a template, and uses primers EcNudc-F / R to amplify the EcNudc gene fragment. After double digestion of the obtained gene fragment and pMA5 vector, the EcNudc gene fragment is connected to the linearized pMA5 vector using Ligation Kit, and the connection product is transferred into JM 109 competent cells by chemical transformation method, cultured on Amp resistance plates, and single colonies on the plates are picked for verification and identification to obtain recombinant plasmid pMA5-EcNudc.

[0059] The verified plasmid is transferred into B. subtilis WB600 competent cells, cultured on Kan resistance plates, and single colonies on the plates are picked for verification and identification to obtain NADH pyrophosphatase recombinant bacteria, named B. subtilis WB600 / pMA5-EcNudc. The same method is used to construct a recombinant bacteria containing a pMA5 empty vector as a control, and the recombinant bacteria is named B. subtilis WB600 / pMA5.

[0060] The correct recombinant bacteria were picked and inoculated into LB medium containing 1‰ kanamycin, and cultured at 37°C, 220 rpm for 12 h. Then, 1% of the culture was inoculated into TB medium containing 1‰ kanamycin, and cultured at 37°C, 220 rpm for 12 h. After the culture, the bacteria and the culture supernatant were collected by centrifugation at 4°C, 8000 rpm for 10 min. The collected bacteria were washed twice with Tris-HCl, and then resuspended and ultrasonically broken with 14 mg / mL lysozyme. The NADH pyrophosphatase activity of the culture supernatant and the broken enzyme solution was measured, and SDS-PAGE analysis was performed.

[0061] The sequences of the primers EcNudc-F and EcNudc-R are as follows:

[0062] EcNudc-F: taaaaaggagcgatttacatatgATGGACCGTATCATTGAGAAAC

[0063] EcNudc-R: gaatttcgacctctagaacgcgtTTAatgatgatgatgatgatgTTCATATTCAGCGCG

[0064] The NADH pyrophosphatase activity (enzyme activity) determination method is as follows:

[0065] (1) Enzyme activity reaction: The following enzyme activity reaction system (50 μL) was prepared: 50 mM Tris-HCl (pH=8.0) 27 μL, 5 mM MgCl2 5 μL, 25 mM NADH 2.5 μL, culture supernatant or broken enzyme solution 15.5 μL; 37°C reaction for 15 min, and then 250 μL EDTA (4 mM, pH=8.00) was immediately added to terminate the reaction.

[0066] (2) HPLC determination: C18 column (5 μm, 250×4.6 mm) was used for detection; the mobile phase mainly included two parts: mobile phase A was methanol, water, glacial acetic acid and tetrabutylammonium hydroxide with a volume ratio of 3:97:1:0.60, and mobile phase B was 100% methanol; the elution program was: 0 min, 100% A; 5 min, 100% A; 25 min, 40% A; 30 min, 20% A; 40 min, 100% A; each group of experiments was measured 3 times and the average value was taken.

[0067] (3) Enzyme activity calculation: the enzyme activity was calculated by the amount of product NMNH generated; the NADH pyrophosphatase enzyme activity was defined as follows: under the above enzyme activity reaction conditions, 1 unit (U) of enzyme activity was defined as the amount of enzyme protein required to produce 1 μmol of NMNH per minute.

[0068] The recombinant bacteria B. subtilis WB600 / pMA5-EcNudc has almost no detectable extracellular enzyme activity, and its intracellular enzyme activity is 1.70 U / mL. The SDS-PAGE analysis results of NADH pyrophosphatase of the recombinant bacteria B. subtilis WB600 / pMA5-EcNudc are shown in FIG. 1; lane 1 in the figure is the protein band of the culture supernatant of the recombinant bacteria B. subtilis WB600 / pMA5; lane 2 is the protein band of the broken enzyme solution of the recombinant bacteria B. subtilis WB600 / pMA5; lane 3 is the protein band of the broken enzyme solution of the recombinant bacteria B. subtilis WB600 / pMA5-EcNudc; and lane 4 is the protein band of the culture supernatant of the recombinant bacteria B. subtilis WB600 / pMA5-EcNudc. As can be seen from FIG. 1, compared with the recombinant bacteria B. subtilis WB600 / pMA5, there is an obvious protein band in lane 3, with a molecular weight of about 30 kDa, which is consistent with the theoretical molecular weight of EcNudc protein, while no band appears at the same position in lane 4, indicating that the NADH pyrophosphatase gene shown in SEQ ID NO. 1 is successfully expressed intracellularly in B. subtilis WB600.

[0069] Example 2 High-efficiency heterologous expression of NADH pyrophosphatase

[0070] In order to further improve the expression amount of the NADH pyrophosphatase gene and avoid the problems such as cost increase, complex operation and cell toxicity caused by the addition of an inducer, the expression amount of the NADH pyrophosphatase gene is regulated by the following method, so as to realize high-efficiency heterologous expression of NADH pyrophosphatase, thereby improving the enzyme activity of the expressed NADH pyrophosphatase.

[0071] 1. Promoter capable of improving the expression amount of NADH pyrophosphatase

[0072] The present application selects the following constitutive promoters P 43 , P mpr , P bpr , P nprB , P yolA , P epr , P trnQ , P gsiB , P sigX , P wapA and the autoinduction promoter P aprE and P srfA. The recombinant bacteria B. subtilis WB600 / pMA5-EcNudc is used as a control strain (named BSE00 in this example). Based on the recombinant plasmid contained in the control strain, 12 recombinant bacteria containing different promoters are constructed by designing primers for whole plasmid reverse PCR amplification. 43 , P mpr , P bpr , P nprB , P yolA , P epr , P trnQ , P gsiB , P sigX , P wapA , P aprE and P srfA promoters.

[0073] The promoter contained in the control strain BSE00 is the original P HpaII . Whole plasmid reverse PCR amplification is performed by designing primers to linearize the plasmid and replace the original promoter P HpaII . The product is then digested with Dpn I, and 12 recombinant plasmids containing different promoters are obtained by homologous recombination. 43 The same method as in Example 1 is used to transform the 12 recombinant plasmids containing different promoters into WB600 to obtain 12 recombinant bacteria containing different promoters, namely recombinant bacteria BSE01 (containing promoter P mpr ), BSE02 (containing promoter P bpr ), BSE03 (containing promoter P aprE ), BSE04 (containing promoter P nprB ), BSE05 (containing promoter P yolA ), BSE06 (containing promoter P epr ), BSE07 (containing promoter P trnQ ), BSE08 (containing promoter P srfA ), BSE09 (containing promoter P gsiB ), BSE10 (containing promoter P sigX ), BSE11 (containing promoter P wapA ). The same method as in Example 1 is used to culture the 12 recombinant bacteria containing different promoters and detect their NADH pyrophosphatase enzyme activities.

[0074] The NADH pyrophosphatase enzyme activity detection results of the 12 recombinant bacteria containing different promoters are shown in Figure 2. As shown in Figure 2, the enzyme activity of recombinant bacteria BSE09 is the highest, reaching 2.40 U / mL, which is 41% higher than that of the control strain BSE00.

[0075] 2、P srfA Modification of the core region of the promoter

[0076] In order to improve the transcription efficiency of P srfA , the core region of the promoter is semi-rationally designed to improve the transcription level. A series of mutant strains are constructed by replacing the -10, -15 and -35 regions of P srfA with conservative sequences (TATAAT, TATG and TTGACA). Among them, the mutant strain P srfA is shown in Fig. 3a, and the conservative sequence of the corresponding region is boxed in black. Specifically, P1 in the figure is that the -15 region of P srfA is mutated to the conservative sequence TATG; P2 is that the -10 region of P srfA is mutated to the conservative sequence TATAAT; P3 is that the -35 region of P srfA is mutated to the conservative sequence TTGACA; P4 is that the -15 region and the -10 region of P srfA are simultaneously mutated to the corresponding conservative sequences; P5 is that the -35 region and the -15 region of P srfA are simultaneously mutated to the corresponding conservative sequences; P6 is that the -35 region and the -10 region of P srfA are simultaneously mutated to the corresponding conservative sequences; and P7 is that the -35 region, the -15 region and the -10 region of P srfA are simultaneously mutated to the corresponding conservative sequences.

[0077] The P srfA mutant strain constructed in the application has the highest NADH pyrophosphatase enzyme activity. As shown in Fig. 3b, compared with the wild-type P srfA , the highest enzyme activity is obtained by replacing the -10 region of the wild-type P srfA with the conservative sequence TATAAT, reaching 3.26 U / mL, which is increased by 35.8% compared with the enzyme activity of the unmodified mutant strain. Among them, the wild-type strain BSE09 is the control strain. The above results show that the mutation of the -10 region of the wild-type P srfA to the conservative sequence TATAAT can enhance the transcription activity of NADH pyrophosphatase. The mutant strain P srfA obtained by mutating the -10 region of the wild-type P srfA to the conservative sequence TATAAT has the nucleotide sequence shown in SEQ ID NO. 3.

[0078] 3、P srfA Modification of the key region of the promoter

[0079] (1) P srfAMutations of the spacer region, -35 region and -15 region of the promoter

[0080] The present application takes green fluorescent protein gene (egfp) as a reporter gene, maintains P srfA -10 region conservative sequence unchanged, through designing degenerate primer (F: AACTTTTCACCCATTTTTCGNNNNNNAAAACATTTTTTTCATTTATAA / R: ATGAAAAAAATGTTTTTGTCAACGAA), using reverse PCR method, carries out random saturation mutation to the -35 region of P srfA -10 region conservative sequence unchanged, through designing degenerate primer (F: AACTTTTCACCCATTTTTCGNNNNNNAAAACATTTTTTTCATTTATAA / R: ATGAAAAAAATGTTTTTGTCAACGAA), using reverse PCR method, carries out random saturation mutation to the -35 region of P srfA -10 region conservative sequence unchanged, through designing degenerate primer (F: AACTTTTCACCCATTTTTCGNNNNNNAAAACATTTTTTTCATTTATAA / R: ATGAAAAAAATGTTTTTGTCAACGAA), using reverse PCR method, carries out random saturation mutation to the -35 region of P srfA -10 region conservative sequence unchanged, through designing degenerate primer (F: AACTTTTCACCCATTTTTCGNNNNNNAAAACATTTTTTTCATTTATAA / R: ATGAAAAAAATGTTTTTGTCAACGAA), using reverse PCR method, carries out random saturation mutation to the -35 region of P srfA -10 region conservative sequence unchanged, through designing degenerate primer (F: AACTTTTCACCCATTTTTCGNNNNNNAAAACATTTTTTTCATTTATAA / R: ATGAAAAAAATGTTTTTGTCAACGAA), using reverse PCR method, carries out random saturation mutation to the -35 region of P

[0081] The reverse PCR amplification reaction in the application is carried out in a 50 μL system, 25 μL PrimeSTAR HS (Premeix) is added in the reaction system, 20 μL ddH2O, 1 μL template DNA, 2 μL of the upstream and downstream materials are added. The reaction conditions are as follows: 95℃ pre-denaturation for 3 min, then start the cycle: 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 8 min, a total of 34 cycles; 72℃ final extension for 5 min. The PCR products of random saturation mutation of the above three regions are collected, the plasmid is circularized by transforming JM 109, after 37℃ culture for 12 h, the mixed plasmid is extracted and transformed into Bacillus subtilis WB600. In order to quickly screen the transcription enhanced mutants, FACS is used to detect the expression of EGFP, the detection process is shown in a of Fig. 4, and the detection result is shown in b of Fig. 4.

[0082] Through the above random saturation mutation, a series of P srfAmutants, wherein the mutant of the-15 region is named M15, the mutant of the-35 region is named M35, and the mutant of the spacer sequence between the-35 region and the-15 region is named MSpace. Meanwhile, as shown in FIG. 4, in general, the conservative sequence of the-10 region is kept unchanged, the degenerate primer saturation mutation (Mspace) of the-15 region (M15) and the spacer sequence between the-15 region and the-35 region can improve the fluorescence intensity of egfp, and the fluorescence intensity is increased by about 54%, and the result of the random mutation of the sequence of the-35 region is not ideal.

[0083] The M15 and MSpace mutants are collected for 2x10 4 and then subjected to secondary culture and screening.

[0084] (2) P srfA Identification of the mutation library of the key region of the promoter

[0085] In order to obtain the P srfA mutation sequence of the mutant with the strongest fluorescence intensity, the cells collected by FACS are subjected to secondary screening using a 24-deep-well plate, 1x10 4 cells collected from the M15 and Mspace mutants are shaken and recovered for 4 hours, and then plated on Kan resistance plates, and 100 single colonies are respectively picked and cultured in the 24-deep-well plate for 18 hours, and the fluorescence intensity is measured to obtain two variant libraries.

[0086] Through screening, the present application obtains an M15 mutant, which is mutated to TAAC in the-15 region. On this basis, the present application obtains an-15 region mutant with improved NADH pyrophosphatase enzyme activity, which is mutated to TAAC in the-15 region of the P srfA promoter and replaced with the egfp gene, and named M15-1. It is detected that the enzyme activity of M15-1 is improved by 21% compared with the control (BSE09), reaching 3.94 U / mL. The sequence of the P srfA promoter mutant in M15-1 is shown as SEQ ID NO. 4.

[0087] The Space region is a sequence of 12 bp, and if each bit of the detected sequence is mutated according to the highest frequency of the base, a sequence with a very high content of G and T, GGGGTGTTCTGG, is obtained. After the Space region is mutated to this sequence and the egfp gene is replaced with the EcNudc gene, it is verified that the EcNudc almost loses the enzyme activity. However, the present application finds that after the Space region is mutated to GCAGGCACGGCC, the corresponding P srfAThe enzyme activity of the mutant strain of MSpace-1 constructed by the promoter mutant reaches 5.23 U / mL, which is increased by 60.4% compared with the control strain (BSE09). The P srfA The sequence of the promoter mutant is shown as SEQ ID NO. 5.

[0088] Example 3 Medium optimization of NADH pyrophosphatase recombinant bacteria

[0089] In the present application, the fermentation medium of the recombinant bacteria constructed by the present application is optimized at the level of a shake flask with the mutant strain of MSpace-1 as the experimental bacteria.

[0090] Based on the TB medium, the present application optimizes the five medium components in sequence, i.e., the type of carbon source, the concentration of carbon source (glycerol), the type of nitrogen source, the ratio of nitrogen source (cottonseed cake powder and peptone), and the concentration of nitrogen source. The mutant strain of MSpace-1 is inoculated into the medium with different formulations at a 2% inoculation amount after being cultured in 10 mL LB medium overnight, and the concentration of the bacteria and the enzyme activity of NADH pyrophosphatase are determined after 24 h of culture.

[0091] The medium optimization results of the NADH pyrophosphatase recombinant bacteria are shown in Figure 5; a in Figure 5 is the optimization result of the type of carbon source; b in Figure 5 is the optimization result of the concentration of carbon source; c in Figure 5 is the optimization result of the type of nitrogen source; d in Figure 5 is the optimization result of the ratio of nitrogen source; and e in Figure 5 is the optimization result of the concentration of nitrogen source.

[0092] As shown in Figure 5, the recombinant bacteria have the best enzyme production effect when the concentration of glycerol is 16 g / L, the ratio of soybean cake hydrolysate to yeast powder is 2:1, and the concentration of nitrogen source is 54 g / L. In combination with the results shown in Figure 5, the formulation of the optimized TB medium obtained by the present application is shown as follows:

[0093] Optimized TB (1L): glycerol 16 g / L, cottonseed cake powder 36 g / L, peptone 18 g / L, KH2PO4 16 mM, K2HPO4 95 mM, pH 7.0.

[0094] The formulation of the original TB medium is shown as follows

[0095] TB medium (1L): glycerol 5 g / L, tryptone 12 g / L, yeast powder 24 g / L, KH2PO4 16 mM, K2HPO4 95 mM.

[0096] The recombinant bacteria are cultured in the medium before and after optimization, respectively, and the enzyme activity is determined, and the results show that the enzyme production amount of the recombinant bacteria in the optimized medium is increased by 46% compared with that in the TB medium, reaching 7.63 U / mL.

[0097] Example 4 Scale-up culture of NADH pyrophosphatase recombinant bacteria in 5L fermentor

[0098] To evaluate the production capacity of NADH pyrophosphatase of the recombinant bacteria constructed in the present application, based on the constant feeding strategy, the MSpace-1 mutant strain was used as the experimental bacteria for scale-up culture in a 5L fermentor.

[0099] The bacteria preservation tube was taken out from the -80℃ ultra-low temperature freezer, streaked on a solid LB plate, and inverted in a 37℃ incubator for 12h. Then, a single colony was picked and inoculated into 10mL of LB liquid medium (50mL flask) for 12h of culture at 37℃ and 220rpm. The first-stage seed liquid was obtained. The first-stage seed liquid was transferred to 100mL of LB liquid medium (500mL flask) at a 2% inoculation amount, and cultured at 37℃ and 220rpm for 8-10h to obtain the second-stage seed liquid.

[0100] After microscopic examination of the prepared second-stage seed, it was confirmed that the seed was not contaminated and grew well, and then inoculated into a 5L fermentor at a 5% inoculation amount, and Kan antibiotic with a final concentration of 50μg / mL was added. The dissolved oxygen level was controlled by adjusting the rotation speed and aeration rate, and 75%(v / v) glacial acetic acid and 2M NaOH solution were added to control the pH (7.0±0.1). During the fermentation process, samples were taken every 3h, and when the dissolved oxygen level of the fermentation broth began to rise, the feed medium was added (12mL / h).

[0101] The results of the change of enzyme activity of NADH pyrophosphatase recombinant bacteria in the scale-up culture system with the culture time are shown in Figure 6. As shown in Figure 6, in the early stage of fermentation (0-6h), glycerol was rapidly consumed, and the recombinant bacteria grew well, and at this time the enzyme production of the bacteria was relatively slow. When the fermentation was 9h, the dissolved oxygen in the system was detected to decrease to the lowest point and began to have a rising trend, at this time the constant feeding was started to the tank, and the feeding rate was set to 12mL / h, so that the carbon source concentration in the culture medium was maintained at about 3g / L. At this time, the recombinant bacteria had accumulated biomass, and the enzyme production rate was also maintained at a relatively stable level. At the 15th hour of feeding, the growth of the recombinant bacteria tended to be stable, and the enzyme activity also decreased. The enzyme activity of NADH pyrophosphatase reached the highest at the 24th hour, which was 16.47U / mL, 2.15 times of the level of the shake flask.

[0102] Example 5 Enzymatic property characterization

[0103] To explore the effects of temperature, pH and metal ions on the activity of NADH pyrophosphatase, the relative enzyme activity of NADH pyrophosphatase under different temperatures, pH and metal ions was determined using the crude enzyme solution.

[0104] After the fermentation is completed, the bacterial liquid is collected, centrifuged at 4°C and 8000 rpm for 10 min, and the supernatant and bacterial body are collected. The bacterial body is resuspended after being washed with a Tris-HCl (pH 8.0) buffer, and the bacterial body is broken by using an ultrasonic disrupter. The broken liquid is centrifuged at 4°C and 8000 rpm for 10 min, and the supernatant is collected to obtain a crude enzyme liquid. The relative enzyme activity of the recombinant NADH pyrophosphatase is measured in the range of 25-55°C, and the result is shown in a of FIG. 7. As shown in the figure, as the temperature increases, the molecular motion becomes more intense, the substrate is more easily combined with the enzyme to react, and therefore the enzyme activity gradually increases, and reaches the highest enzyme activity at 45°C. However, at too high a temperature, the enzyme structure and activity are often destroyed, and the generated product is more easily degraded. When the temperature is higher than 45°C, the enzyme activity gradually decreases. Therefore, the optimum reaction temperature of the enzyme is 45°C.

[0105] The activity of the recombinant NADH pyrophosphatase is measured in different pH buffers (pH 6.0-12.0), and the result is shown in b of FIG. 7. The NADH pyrophosphatase exhibits the highest enzyme activity at pH = 10, and can better maintain the enzyme activity under alkaline conditions.

[0106] Compared with the optimum pH and temperature of the NADH pyrophosphatase in the reported Escherichia coli expression system, the NADH pyrophosphatase expressed in the WB600 in the present application can better tolerate alkaline environment and higher temperature (Liu et al., Front Bioeng Biotechnol 2023, 11:1159965).

[0107] In order to explore the effect of different metal ions on the activity of the NADH pyrophosphatase, different metal ions with a final concentration of 2.50 mM and 5 mM are added to the reaction system, and the result is shown in c of FIG. 7. Except for Mg2+, the addition of the remaining metal ions inhibits the activity of the NADH pyrophosphatase.

[0108] Example 6 Optimization of whole-cell catalytic system

[0109] Since the NADH pyrophosphatase is expressed intracellularly in the B. subtilis WB600, it is considered that the substrate and product are both small molecules, the substrate can enter the intracellularly and react with the intracellular NADH pyrophosphatase, and the product can be excreted. The present application uses the MSpace-1 mutant strain as the experimental bacteria, and uses the whole-cell catalytic method to biocatalyze the synthesis of NMNH.

[0110] The bacteria preservation tube was taken out from the -80 °C refrigerator, and single colonies were picked and inoculated into LB medium containing 1‰ kanamycin, and cultured at 37 °C, 220 rpm for 12 h. Then, 1% of the inoculum was transferred into TB medium containing 1‰ kanamycin, and cultured at 37 °C, 220 rpm. After fermentation, the bacteria were centrifuged at 8000 rpm for 10 min, and the supernatant was removed. The bacteria were washed with Tris-HCl for 3 times. The enzyme activity reaction system was prepared according to the method described in Example 1. After the reaction started, samples were taken every 15 min, and the production of NMNH and the consumption of substrate were determined by HPLC.

[0111] According to the HPLC detection, the yield of NMNH reached 580 mg / L when the mutant strain MSpace-1 was used for the biocatalytic synthesis of NMNH. This yield is still low, and it is speculated that the permeability barrier of cell wall and cell membrane to the substrate and product hinders the exocytosis of NMNH. In order to enhance the permeability of cell membrane, the surfactant Tween 80 was added to reduce the mass transfer resistance between the inside and outside of the cell, and the concentration of Tween 80 and the treatment time of the cell were optimized to avoid the damage to the cell caused by the high concentration of Tween 80. The optimization results of the concentration of Tween 80 and the treatment time of the cell are shown in Figure 8. As shown in Figure 8, the highest yield of NMNH reached 1082 mg / mL (a in Figure 8) when the concentration of Tween was 0.20%, and the highest yield of NMNH reached 1262 mg / L when the cell was pretreated with Tween 80 for 15 min (b in Figure 8).

[0112] In order to explore the optimal substrate concentration for the transformation experiment, the batch transformation conditions were explored under the optimal reaction temperature, pH and metal ion conditions obtained in Example 5. In order to obtain the optimal time point for adding substrate, it is necessary to continuously detect the production of NMNH and the consumption of NADH. When the consumption of substrate NADH is detected by HPLC, the next batch of substrate is added. When the consumption of substrate cannot be detected by HPLC and the substrate is not consumed, this is the maximum batch transformation of the recombinant bacteria. The batch transformation results of NMNH are shown in Figure 9. As shown in Figure 9, the yield of NMNH reached the highest value of 11.74 g / L when the fourth batch of substrate was added. When the sixth batch of substrate was added, the yield of NMNH decreased. The present application successfully verified that the whole cell catalytic batch transformation is very effective for the biotransformation of NMNH. Compared with the use of crude enzyme solution before optimization, the yield of one batch of substrate was increased by 9.78 times.

[0113] The above embodiments are the preferred embodiments of the present application, but the embodiments of the present application are not limited to the above embodiments, and any changes, modifications, substitutions, combinations, simplifications, etc. made without departing from the spirit and principles of the present application should be equivalent replacement manners and should be included in the protection scope of the present application.

Claims

1. A promoter mutant, characterized in that, The nucleotide sequence of the mutant is shown in any one of SEQ ID NO. 4-5.

2. A vector, characterized in that, The vector contains the promoter mutant of claim 1.

3. Use of the promoter mutant of claim 1 or the vector of claim 2 in increasing the expression amount of a protein.

4. Use of the promoter mutant of claim 1 or the vector of claim 2 in preparing a product for increasing the expression amount of a protein.

5. A method for increasing the expression amount of a protein, characterized by, The method is: constructing a recombinant plasmid of a protein with the promoter mutant shown in any one of SEQ ID NO. 4-5; or inserting the promoter mutant shown in any one of SEQ ID NO. 4-5 in series with the original promoter of the plasmid.

6. A recombinant plasmid, characterized in that, The plasmid contains the promoter mutant shown in any one of SEQ ID NO. 3-5 and a gene encoding NADH pyrophosphatase.

7. A recombinant bacterium, characterized in that, The recombinant bacteria contain the recombinant plasmid of claim 6.

8. Use of the recombinant plasmid of claim 6 or the recombinant bacteria of claim 7 in biocatalysis to generate reduced nicotinamide mononucleotide.

9. Use of the recombinant plasmid of claim 6 or the recombinant bacteria of claim 7 in preparing a product for biocatalysis to generate reduced nicotinamide mononucleotide.

10. A method of biocatalytically producing reduced nicotinamide mononucleotide, characterized in that, Using the recombinant bacteria of claim 7 as an expression host of NADH pyrophosphatase, catalyzing the hydrolysis of reduced nicotinamide adenine dinucleotide.

Citation Information

Patent Citations

  • Bacillus subtilis promoter with improved activity, and construction and applications thereof

    CN106916819A

  • Bacillus subtilis self-induced expression system and application thereof

    CN107058316A

  • Promoter capable of improving protein expression efficiency

    CN107955814A