Method for producing oligonucleotide

Abstract

The purpose of the present invention is to provide a method for efficiently producing an oligonucleotide by a solid-phase synthesis approach. The present invention provides a method for producing an oligonucleotide by a solid phase synthesis approach, the method comprising a step for reacting an oligonucleotide in which a hydroxyl group at a chain extendable end is protected with a protective group that can be removed under acidic conditions and a deblocking solution to remove a protective group for a hydroxyl group at the chain extendable end, wherein the deblocking solution is a deblocking solution containing a base, an acid, and an aprotic solvent, and the base is a base having an acid dissociation constant (pKa) of a conjugate acid of 5-12, and an oligonucleotide in which the content ratio of the 2', 3'transfer body is a certain amount or less.

Description

Methods for producing oligonucleotides

[0001] This patent application claims priority under the Paris Convention to and the benefit of Japanese Patent Application No. 2024-073433 (filed April 30, 2024), the entire contents of which are incorporated herein by reference. The present invention relates to a method for producing oligonucleotides.

[0002] In recent years, there has been growing interest in the application of nucleic acids in the medical field, including antisense nucleic acids, aptamers, ribozymes, and nucleic acids that induce RNA interference (RNAi), such as siRNA, which are called nucleic acid drugs.

[0003] Oligonucleotides can be produced, for example, by the phosphoramidite method. The phosphoramidite method includes a step of deprotecting the hydroxyl-protecting group at the chain extension end of the oligonucleotide. As the hydroxyl-protecting group at the chain extension end, a protecting group that can be removed under acidic conditions is usually used. Therefore, the step of deprotecting the hydroxyl-protecting group at the chain extension end of the oligonucleotide is carried out by reacting the protecting group at the chain extension end of the oligonucleotide that can be removed under acidic conditions with an acid (deblocking reaction), thereby removing the hydroxyl-protecting group that can be removed under acidic conditions from the oligonucleotide.

[0004] Here, when oligonucleotide synthesis is performed by solid-phase synthesis, it has been known that side reactions occur in the process of deprotecting the hydroxyl protecting group at the chain extension terminal of the oligonucleotide. For example, in solid-phase synthesis of DNA, if the acidic conditions in the deblocking reaction are too strong, a side reaction called depletion occurs as the deprotection reaction progresses. Conversely, if the acidic conditions are too weak, the deprotection reaction progresses insufficiently (see Non-Patent Document 1). Furthermore, in solid-phase synthesis of RNA, it is known that the deblocking reaction involves the removal of the protecting group from the hydroxyl group at the 2' position of ribose as a side reaction, which is known to result in short-chain components and 2',3' rearranged products as by-products. The by-product 2',3' rearranged product is also known as 2',5'-linked sugar in RNA (see Non-Patent Document 2). Although various studies have been conducted to date, the effect of suppressing the production of such by-products in the deblocking reaction has not been sufficient.

[0005] Nucleic Acids Research, 1996, Vol. 24, No. 15, 3053-3058NUCLEIC ACID THERAPEUTICS, 2017, Vol. 27, No. 6, 309-322

[0006] An object of the present invention is to provide an efficient method for producing oligonucleotides by solid phase synthesis.

[0007] As a result of extensive research to achieve the above-mentioned object, the present inventors have found that, in the production of oligonucleotides by solid-phase synthesis, the use of a deblocking solution containing a base, an acid, and an aprotic solvent in the step of deprotecting the hydroxyl protecting group at the chain elongation terminal of an oligonucleotide allows the deblocking reaction to proceed efficiently and suppresses the production of 2',3' rearrangement by-products.As a result, the present invention provides an efficient method for producing oligonucleotides by solid-phase synthesis, and oligonucleotides in which the content ratio of 2',3' rearrangement in the oligonucleotide is a certain amount or less.

[0008] The present invention includes, but is not limited to, the following aspects. [1] A method for producing an oligonucleotide by solid-phase synthesis, comprising a step of reacting an oligonucleotide, the hydroxyl group of which at the end of a chain extension is protected with a protecting group removable under acidic conditions, with a deblocking solution to remove the protecting group for the hydroxyl group at the end of the chain extension, wherein the deblocking solution contains a base, an acid, and an aprotic solvent, and the base is a base whose conjugate acid has an acid dissociation constant (pKa) of 5 or more and 12 or less. [2] The method for producing an oligonucleotide according to [1], wherein the base is a base whose conjugate acid has an acid dissociation constant (pKa) of 5 or more and 8 or less. [3] The method for producing an oligonucleotide according to [1] or [2], wherein the base is a heterocyclic compound. [4] The method for producing an oligonucleotide according to [1] or [2], wherein the base is at least one base selected from the group consisting of pyridine, 1-methylimidazole, and morpholine. [5] The method for producing an oligonucleotide according to [1] or [2], wherein the base is pyridine. [6] The production method according to any one of [1] to [5], wherein the acid has a pKa of 0 to 5. [7] The production method according to any one of [1] to [5], wherein the acid is at least one acid selected from dichloroacetic acid and trichloroacetic acid. [8] The production method according to any one of [1] to [5], wherein the acid is dichloroacetic acid. [9] The production method according to any one of [1] to [8], wherein the aprotic solvent is at least one solvent selected from the group consisting of dichloromethane, acetonitrile, and aromatic hydrocarbon solvents.

[10] The production method according to [9], wherein the aromatic hydrocarbon solvent is toluene.

[11] The production method according to any one of [1] to

[10] , wherein the base is pyridine, the acid is dichloroacetic acid, and the aprotic solvent is toluene.

[12] The production method according to any one of [1] to

[11] , wherein the molar ratio of base to acid is 0.001 to 0.9.

[13] The method according to any one of [1] to

[12] , wherein the oligonucleotide in which the hydroxyl group at the end of the chain extension is protected with a protecting group removable under acidic conditions is an oligonucleotide having a chain length of 2 to 400 mer.

[14] The method according to any one of [1] to

[12] , wherein the oligonucleotide in which the hydroxyl group at the end of the chain extension is protected with a protecting group removable under acidic conditions is an oligonucleotide represented by formula (1): (In the formula, G 1 represents a protecting group that can be removed under acidic conditions from the hydroxyl group at the end of the chain extension; 2 represents a protecting group for a hydroxyl group, a are each independently the same or different and represent a nucleobase which may be protected with a protecting group; R are each independently the same or different and represent a protected hydroxyl group, hydrogen atom, fluorine atom, methoxy group, 2-methoxyethyl group, or OQ' group; Q' are each independently the same or different and represent a methylene group bonded to the 4' carbon atom of ribose, an ethylene group bonded to the 4' carbon atom of ribose, or an ethylidene group bonded to the 4' carbon atom of ribose; Y are each independently the same or different and represent an oxygen atom or a sulfur atom; n represents an integer of 1 to 399; W1 represents an OZ group and X1 represents an R group, or W1 represents an OV group and X1 represents an OZ group; V represents a protecting group for a hydroxyl group; Z is a group having a structure consisting of a solid phase carrier and a linking group, and when n is an integer of 2 or more, a non-nucleotide linker may be incorporated between each nucleotide, and the oligonucleotide from which the protecting group of the hydroxyl group at the chain extension terminal has been removed is represented by formula (2): (In the formula, G 2 , B a , R, Y, n, W1 and X1 are as defined above, and a non-nucleotide linker may be incorporated between each nucleotide as defined in formula (1).

[15] The method according to any one of [1] to

[13] , wherein an oligonucleotide represented by formula (2) is subjected to a cleavage and deprotection step to give an oligonucleotide represented by formula (2'): (Wherein, Y and n are as defined in formula (1), B c are each independently the same or different and represent a nucleic acid base; 4are each independently the same or different and represent a hydrogen ion, an alkali metal ion, an ammonium ion, an alkylammonium ion, or a hydroxyalkylammonium ion, R' are each independently the same or different and represent a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group, Q' is as defined in formula (1), and X3 and W3 each independently represent a hydroxyl group, or X3 represents an R' group and W3 represents a hydroxyl group, as defined in formula (1), a non-nucleotide linker may be incorporated between each nucleotide.

[16] The production method according to

[14] , further comprising a step of obtaining an oligonucleotide represented by the formula (In the formula, R 1 , R 2 and R 3

[17] The method according to any one of [1] to

[15] , wherein R is a protecting group represented by the formula: 1 and R 2 is a methoxy group, and R 3is a hydrogen atom.

[18] The manufacturing method according to any one of [1] to

[17] , wherein the oligonucleotide is an oligonucleotide containing ribonucleic acid (RNA).

[19] The manufacturing method according to any one of [1] to

[18] , wherein the oligonucleotide is an oligonucleotide containing ribonucleic acid (RNA), and the protecting group for the hydroxyl group at the 2'-position of the ribose is a 2'-tert-butyldimethylsilyl (TBS) group.

[20] The manufacturing method according to any one of [1] to

[19] , wherein the obtained oligonucleotide is an oligonucleotide having a chain length of 50 mer or more and 400 mer or less.

[21] The manufacturing method according to any one of [1] to

[20] , wherein the solid phase support used in solid phase synthesis is an inorganic porous support.

[22] The manufacturing method according to

[21] , wherein the inorganic porous support is Controlled Pore Glass (CPG).

[23] The manufacturing method according to any one of [1] to

[22] , wherein the deblocking solution has a water content of 300 ppm or more and 3% or less.

[24] The manufacturing method according to any one of [1] to

[23] , wherein the oligonucleotide manufacturing method is a method of manufacturing an oligonucleotide by a phosphoramidite method.

[25] An oligonucleotide manufactured by solid-phase synthesis, wherein the chain length is 50 mer or more and 400 mer or less, and the content ratio of 2',3' rearrangement in the oligonucleotide is 20% or less.

[26] A deblocking solution containing a base, an acid, and an aprotic solvent, wherein the base is a base whose conjugate acid has an acid dissociation constant (pKa) of 5 or more and 12 or less.

[27] Use of a deblocking solution containing a base, an acid, and an aprotic solvent, wherein the base is a base whose conjugate acid has an acid dissociation constant (pKa) of 5 or more and 12 or less, in the synthesis of an oligonucleotide.

[0009] According to the present invention, oligonucleotides can be efficiently produced by solid phase synthesis.

[0010] FIG. 1 shows Scheme A, which shows a typical example of producing a nucleic acid represented by formula (5) from a nucleic acid represented by formula (1). 1As the protecting group for the hydroxyl group, any protecting group generally known as a protecting group for the hydroxyl group that can be removed under acidic conditions can be used without any particular limitation. 3 are each independently the same or different and represent an alkyl group, or two G 3 may be bonded to each other to form a cyclic structure. 3 are each independently the same or different and are preferably an alkyl group such as a methyl group, an ethyl group, a propyl group, or an isopropyl group, and more preferably both are an isopropyl group. m represents an integer of 1 to 400. Other symbols are as defined above.

[0011] According to one embodiment of the present invention, the present invention relates to a method for producing an oligonucleotide by solid-phase synthesis, comprising a step of reacting an oligonucleotide, the hydroxyl group of which at the end of a chain elongation terminal is protected with a protecting group that can be removed under acidic conditions, with a deblocking solution to remove the protecting group for the hydroxyl group at the end of the chain elongation terminal, wherein the deblocking solution contains a base, an acid, and an aprotic solvent, and the base is a base whose conjugate acid has an acid dissociation constant (pKa) of 5 or more and 12 or less.

[0012] The term "solid phase synthesis" as used herein includes, for example, solid phase synthesis of oligonucleotides by the phosphoramidite method.

[0013] The term "oligonucleotide" as used herein includes, for example, oligonucleotides having chain lengths of 2 mers or more, 10 mers or more, 20 mers or more, 40 mers or more, 50 mers or more, 60 mers or more, 80 mers or more, 100 mers or more, 200 mers or more, 300 mers or more, 2 to 400 mers, 2 to 300 mers, 2 to 200 mers, 2 to 150 mers, 50 to 400 mers, 50 to 300 mers, 50 to 200 mers, 50 to 150 mers, 100 to 400 mers, 100 to 300 mers, 100 to 200 mers, and 100 to 150 mers. The sugars constituting the oligonucleotide may be ribose only, or may be both ribose and deoxyribose. The 2'-position of ribose may be a hydroxyl group, a protected hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group. Q' represents a methylene group bonded to the 4'-carbon atom of ribose, an ethylene group bonded to the 4'-carbon atom of ribose, or an ethylidene group bonded to the 4'-carbon atom of ribose. The bond between nucleotides constituting the oligonucleotide may be a phosphodiester bond or a phosphorothioate bond. Examples of nucleosides constituting the oligonucleotide include various nucleosides described in Xiulong, Shen et al., Nucleic Acids Research, 2018, Vol. 46, No. 46, 1584-1600, and Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558.

[0014] The term "hydroxyl group at the chain elongation end" as used herein means the hydroxyl group at the 5'-position of the 5'-terminal nucleotide when an oligonucleotide is synthesized from the 3'-side to the 5'-side, and means the hydroxyl group at the 3'-position of the 3'-terminal nucleotide when an oligonucleotide is synthesized from the 5'-side to the 3'-side.

[0015] The term "protecting group removable under acidic conditions" used herein is not particularly limited as long as it is a commonly known protecting group. Specific examples of the protecting group include, for example, a protecting group represented by the formula (3): (In the formula, R 1 , R 2 and R 3 and each independently represent the same or different hydrogen atom or an alkoxy group.) However, there is no particular limitation as long as it can be eliminated as a cation.

[0016] In the protecting group represented by formula (3), R 1 , R 2 and R 3 Preferably, one of the groups is a hydrogen atom and the remaining two are the same or different (preferably the same) alkoxy groups, and a methoxy group is particularly preferred as the alkoxy group.

[0017] Specific preferred protecting groups include, for example, groups selected from a 4,4'-dimethoxytrityl (DMTr) group, a 4-monomethoxytrityl group, and a 4,4',4"-trimethoxytrityl group. The 4,4'-dimethoxytrityl (DMTr) group is particularly preferred.

[0018] As used herein, the term "deblocking solution" refers to a solution used to remove hydroxyl-protecting groups that are removable under acidic conditions. Methods for preparing the deblocking solution of the present invention include, but are not limited to, the following methods. The deblocking solution of the present invention may be prepared in advance by mixing a base, an acid, and an aprotic solvent, or by mixing a commercially available deblocking solution containing an acid and an aprotic solvent with a base. Alternatively, the deblocking solution of the present invention may be prepared by mixing a base, an acid, and an aprotic solvent in a solid-phase synthesis column or in a line upstream of the solid-phase synthesis column. Specific examples of methods for preparing the deblocking solution of the present invention within a solid-phase synthesis column or within a line upstream of the solid-phase synthesis column include: a method in which a base, an acid, and an aprotic solvent are separately supplied to a solid-phase synthesis column and then mixed within the solid-phase synthesis column or within a line upstream of the solid-phase synthesis column; a method in which a mixture of two of a base, an acid, and an aprotic solvent and the remaining solvent are separately supplied to a solid-phase synthesis column and then mixed within the solid-phase synthesis column or within a line upstream of the solid-phase synthesis column; and a method in which a commercially available deblocking solution containing an acid and an aprotic solvent and a base are separately supplied to a solid-phase synthesis column and then mixed within the solid-phase synthesis column or within a line upstream of the solid-phase synthesis column. The term "deblocking reaction" as used herein refers to a deprotection reaction in which a nucleoside or oligonucleotide that is bound to a solid-phase support via a linker and whose hydroxyl group at the end of the elongated chain is protected with a protecting group that can be removed under acidic conditions is reacted with a deblocking solution to remove the protecting group at the hydroxyl group at the end of the elongated chain from the nucleoside or oligonucleotide. That is, the term "a process of reacting an oligonucleotide, the hydroxyl group of which is protected with a protecting group removable under acidic conditions, with a deblocking solution to remove the protecting group of the hydroxyl group at the end of the chain elongation" used in this specification means a deblocking reaction.

[0019] The term "heterocyclic compound" as used herein means a ring having one or more heteroatoms (e.g., nitrogen, oxygen, and sulfur atoms) as ring-constituting atoms, and includes aromatic heterocyclic compounds and non-aromatic heterocyclic compounds. Examples of aromatic heterocyclic compounds include pyridine, pyrimidine, pyrazine, pyridazine, 2,6-lutidine, 3,5-lutidine, 2-dimethylaminopyridine, 4-dimethylaminopyridine, quinoline, isoquinoline, indole, furan, pyrrole, thiophene, pyrazole, imidazole, 1-methylimidazole, benzimidazole, purine, oxazole, isoxazole, and thiazole. Examples of non-aromatic heterocyclic compounds include aziridine, oxirane, azetidine, azeto, 1,3-diazetidine, oxetane, pyrrolidine, 2-pyrroline, pyrazolidine, imidazolidine, 2-imidazolidine, 1,3-dioxolane, tetrahydrofuran, piperazine, 1,4-dioxane, morpholine, quinuclidine, succinimide, DABCO, and hydantoin.

[0020] The bases contained in the deblocking solution include bases whose conjugate acids have an acid dissociation constant (pKa) of 5 or more and 12 or less, bases whose conjugate acids have an acid dissociation constant (pKa) of 5 or more and 11 or less, bases whose conjugate acids have an acid dissociation constant (pKa) of 5 or more and 10 or less, bases whose conjugate acids have an acid dissociation constant (pKa) of 5 or more and 9 or less, bases whose conjugate acids have an acid dissociation constant (pKa) of 5 or more and 8 or less, bases whose conjugate acids have an acid dissociation constant (pKa) of 5.0 or more and 8.0 or less, and bases whose conjugate acids have an acid dissociation constant (pKa) of 9 or more and 12 or less. The acid dissociation constant (pKa) of the conjugate acid is a value measured in an aqueous solution at 25°C. For example, the values ​​described in the pKa table (by R. Williams) and the pKa table (by Dave Evans and D. H. Ripin) described in Tetrahedron Letters 59 (2018) 3738-3748, https: / / organicchemistrydata.org / hansreich / resources / pka / (as of April 26, 2024) can be used as reference. Examples of bases having a conjugate acid dissociation constant (pKa) of 5 or more and 8 or less include pyridine (conjugate acid pKa of 5.2), 1-methylimidazole (conjugate acid pKa of 7.0), 2,6-lutidine (conjugate acid pKa of 6.7), 2-dimethylaminopyridine (conjugate acid pKa of 7.0), and morpholine (conjugate acid pKa of 8.4), with pyridine being preferred. Examples of bases having a conjugate acid dissociation constant (pKa) of 9 or more and 12 or less include triethylamine (conjugate acid pKa of 10.7), 4-dimethylaminopyridine (conjugate acid pKa of 9.7), DABCO (conjugate acid pKa of 8.7), and phenol (conjugate acid pKa of 9.9). Two or more of these bases may also be used in combination. The molar ratio of the base to the oligonucleotide in which the hydroxyl group at the chain extension terminal is protected with a protecting group removable under acidic conditions is, but is not limited to, equal to or greater than 1. The molar ratio of the base to the acid may be 0.001 to 0.9, 0.001 to 0.5, 0.001 to 0.25, or 0.001 to 0.20.

[0021] The acid contained in the deblocking solution can be any acid used in the deblocking reaction in the phosphoramidite method, without limitation. Examples include, but are not limited to, acetic acid, dichloroacetic acid, trichloroacetic acid, trifluoroacetic acid, methanesulfonic acid, trifluoromethanesulfonic acid, and p-toluenesulfonic acid. Preferred examples include acids with an acid dissociation constant (pKa) of 0 to 5, such as acetic acid, dichloroacetic acid, trichloroacetic acid, and trifluoroacetic acid. More preferred examples include dichloroacetic acid and trichloroacetic acid. Even more preferred examples include dichloroacetic acid. Two or more of these acids may also be used in combination. The acid content in the deblocking solution is not particularly limited, and may be, for example, 0.1 to 20 wt %, 0.1 to 15 wt %, 0.1 to 10 wt %, 0.1 to 5 wt %, 0.1 to 4 wt %, 0.1 to 3 wt %, 0.1 to 2 wt %, or 0.1 to 1 wt %.

[0022] The aprotic solvent contained in the deblocking solution is not particularly limited as long as it is a commonly known aprotic solvent. Examples include, but are not limited to, dichloromethane, acetonitrile, and aromatic hydrocarbon solvents. Examples of aromatic hydrocarbon solvents include toluene, xylene, monochlorobenzene, and o-dichlorobenzene, with toluene being preferred. Two or more of these aprotic solvents may be used in combination. The amount of the aprotic solvent used is not particularly limited, but is, for example, 0.5 to 30 times by weight relative to the amount of the acid used.

[0023] According to a preferred embodiment of the present invention, the deblocking solution includes a deblocking solution containing pyridine as a base, dichloroacetic acid as an acid, and toluene as an aprotic solvent.

[0024] The deblocking solution of the present invention may contain a thiol. Examples of thiols include C2-C20 alkylthiols and C4-C8 cycloalkylthiols. Examples of C2-C20 alkylthiols include ethanethiol, 1-propanethiol, 2-propanethiol, 1-butanethiol, 2-butanethiol, 2-methyl-1-propanethiol (isobutyl mercaptan), 2-methyl-2-propanethiol (tert-butyl mercaptan), 1-pentanethiol, 1-hexanethiol, 1-heptanethiol, 1-octanethiol, 1-nonanethiol, 1-decanethiol, 1-undecanethiol, 1-dodecanethiol, tert-dodecanethiol, 1-tetradecanethiol, 1-pentadecanethiol, 1-hexadecanethiol, 1-octadecanethiol, and 1-eicosanethiol. Examples of C4-C8 cycloalkylthiols include cyclobutanethiol, cyclopentanethiol, cyclohexanethiol, cycloheptanethiol, cyclooctanethiol, 1-dodecanethiol, and cyclohexanethiol. By including a thiol in the deblocking solution, it is expected that the deblocking reaction will proceed more efficiently. The molar ratio of the thiol to the oligonucleotide in which the hydroxyl group at the chain extension terminal is protected with a protecting group removable under acidic conditions is 1 or more, but is not limited thereto. Furthermore, the molar ratio of the thiol to the acid is 1 to 100, but is not limited thereto. According to a preferred embodiment of the present invention, the deblocking solution may include a deblocking solution containing pyridine as a base, dichloroacetic acid as an acid, toluene as an aprotic solvent, and dodecanethiol as a thiol.

[0025] The reaction time for the deblocking reaction is not particularly limited, and may be, for example, 0.1 to 20 minutes, 0.1 to 10 minutes, 0.1 to 5 minutes, 0.1 to 4 minutes, 0.1 to 3 minutes, 0.1 to 2 minutes, or 0.1 to 1 minute. After the deblocking reaction, the nucleoside or oligonucleotide supported on the solid phase support may be washed by passing an aprotic solvent such as acetonitrile through the solid phase synthesis column.

[0026] The reaction temperature for the deblocking reaction is not particularly limited, and may be, for example, 0 to 50°C, 0 to 45°C, 0 to 40°C, 0 to 35°C, 0 to 30°C, 0 to 25°C, 0 to 20°C, 0 to 15°C, 0 to 10°C, 0 to 5°C, 5 to 30°C, or 10 to 25°C.

[0027] The water content of the deblocking solution used in the deblocking reaction is, for example, 0.1 ppm to 3%, 0.1 ppm to 2.5%, 0.1 ppm to 2%, 0.1 ppm to 1.5%, 0.1 ppm to 1%, 0.1 to 5000 ppm, 0.1 to 4000 ppm, 0.1 to 3000 ppm, 0.1 to 2000 ppm, 0.1 to 1000 ppm, 0 It may be 1 to 500 ppm, 0.1 to 400 ppm, 0.1 to 300 ppm, 0.1 to 200 ppm, 0.1 to 100 ppm, 0.1 to 90 ppm, 0.1 to 80 ppm, 0.1 to 70 ppm, 0.1 to 60 ppm, 0.1 to 50 ppm, 0.1 to 40 ppm, 0.1 to 30 ppm, 0.1 to 20 ppm, or 0.1 to 10 ppm.

[0028] It is known that in a deblocking reaction, if the water content of the deblocking solution is high, the efficiency of the deblocking reaction decreases. Therefore, commercially available deblocking solutions are usually standardized for their water content. Commercially available deblocking solutions usually have a water content of 200 ppm or less. For example, the standard value for the water content of the deblocking solution [dichloroacetic acid-toluene (3:97)] (product code: 043-34441) sold by Fujifilm Wako Pure Chemical Industries, Ltd. is 200 ppm or less. In another aspect of the present invention, by using a deblocking solution containing a base, an acid, and an aprotic solvent, the efficiency of the deblocking reaction is improved even when the deblocking solution has a high water content. For example, even if the water content of a deblocking solution containing a base, an acid, and an aprotic solvent is higher than that of commercially available deblocking solutions (e.g., 300 ppm or more), the deblocking reaction proceeds more efficiently than in a deblocking solution containing an acid and an aprotic solvent but no base, with the same water content. Examples of water contents in deblocking solutions with high water contents include 300 ppm to 3%, 300 ppm to 2.5%, 300 ppm to 2%, 300 ppm to 1.5%, 300 ppm to 1%, 300 to 5000 ppm, 300 to 4000 ppm, 300 to 3000 ppm, 300 to 2000 ppm, and 300 to 1500 ppm. m, 300 to 1000 ppm, 500 ppm to 3%, 500 ppm to 2.5%, 500 ppm to 2%, 500 ppm to 1.5%, 500 ppm to 1%, 500 to 5000 ppm, 500 to 4000 ppm, 500 to 3000 ppm, 500 to 2000 ppm, 500 to 1500 ppm, and 500 to 1000 ppm are examples.

[0029] As used herein, the term "oligonucleotide in which the hydroxyl group at the chain extension terminal is protected with a protecting group removable under acidic conditions" includes, for example, an oligonucleotide represented by the formula (1): (In the formula, G 1 represents a protecting group that can be removed under acidic conditions from the hydroxyl group at the end of the chain extension; 2 represents a protecting group for a hydroxyl group, aare each independently the same or different and represent a nucleobase which may be protected with a protecting group; R are each independently the same or different and represent a protected hydroxyl group, hydrogen atom, fluorine atom, methoxy group, 2-methoxyethyl group, or OQ' group; Q' are each independently the same or different and represent a methylene group bonded to the 4' carbon atom of ribose, an ethylene group bonded to the 4' carbon atom of ribose, or an ethylidene group bonded to the 4' carbon atom of ribose; Y are each independently the same or different and represent an oxygen atom or a sulfur atom; n represents an integer of 1 to 399; W1 represents an OZ group and X1 represents an R group, or W1 represents an OV group and X1 represents an OZ group; V represents a protecting group for a hydroxyl group; Z is a group having a structure consisting of a solid phase carrier and a linking group, and when n is an integer of 2 or more, a non-nucleotide linker may be incorporated between each nucleotide.

[0030] According to a preferred embodiment of the present invention, the oligonucleotide in which the hydroxyl group at the end of the chain extension is protected with a protecting group removable under acidic conditions is represented by the formula (1'): (In the formula, G 2 , B a , R, Y, n, W1 and X1 are as defined in formula (1), and 1 , R 2 and R 3 are each independently the same or different and represent a hydrogen atom or an alkoxy group.

[0031] According to a more preferred embodiment of the present invention, in formula (1′), R 1 and R 2 is a methoxy group, R 3 represents a hydrogen atom.

[0032] According to a preferred embodiment of the present invention, the oligonucleotide from which the protecting group of the hydroxyl group at the chain extension terminal has been removed is an oligonucleotide represented by the formula (2): (In the formula, G 2 , B a, R, Y, n, W1, and X1 are as defined in formula (1), and when n is an integer of 2 or more, a non-nucleotide linker may be incorporated between each nucleotide.

[0033] Furthermore, examples of oligonucleotides obtained by subjecting the oligonucleotide represented by formula (2) to the excision and deprotection steps include oligonucleotides represented by formula (2'): (Wherein, Y and n are as defined in formula (1), B c are each independently the same or different and represent a nucleic acid base; 4 are each independently the same or different and represent a hydrogen ion, an alkali metal ion, an ammonium ion, an alkylammonium ion, or a hydroxyalkylammonium ion; R' are each independently the same or different and represent a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group; Q' is as defined in formula (1); X3 and W3 each independently represent a hydroxyl group, or X3 represents an R' group and W3 represents a hydroxyl group; and when n is an integer of 2 or greater, a non-nucleotide linker may be incorporated between each nucleotide.

[0034] In formulas (1), (1'), (2), and (2'), compounds represented by Q', which may be the same or different and independently represent a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, or an ethylidene group bonded to the carbon atom at the 4' position of ribose, specifically include structures represented by LNA-1, LNA-2, or LNA-3 of formula (7): Formula (7): (In the formula, B a represents an optionally protected nucleobase.

[0035] More specifically, the group represented by Z having a structure consisting of a solid phase carrier and a linking group includes a structure represented by formula (8): Formula (8): In formula (8), Sp represents a spacer. Examples of the spacer (Sp) in formula (8) include a structure represented by formula (9). Formula (9): Linker in formula (8) represents a structure that serves as a linker (junction structure). The structure of Linker may be, for example, a structure represented by formula (8-1) to formula (8-8). Solid support in formula (8) represents a structure that serves as a solid support. Examples of solid support include inorganic porous supports and organic resin supports. Examples of inorganic porous supports include controlled pore glass (CPG) and zeolite. Examples of organic resin supports include supports made of polystyrene. Formulas (8-1) to (8-8): (In the formula, each A may independently be a hydroxyl group, an alkoxy group, or an alkyl group. Examples of the alkoxy group include a methoxy group and an ethoxy group. Examples of the alkyl group include a methyl group, an ethyl group, an isopropyl group, and an n-propyl group. Si indicates that it is bonded to the oxygen of a hydroxyl group on the surface of the support.)

[0036] A method for producing an oligonucleotide by solid phase synthesis includes a step of reacting an oligonucleotide, the hydroxyl group of which at the end of a chain elongation is protected with a protecting group removable under acidic conditions, with a deblocking solution to remove the protecting group for the hydroxyl group at the end of the chain elongation, wherein the deblocking solution contains a base, an acid, and an aprotic solvent, and the base is a base whose conjugate acid has an acid dissociation constant (pKa) of 5 or more and 12 or less, and typically includes the following steps: Step (1): a step of reacting a nucleoside or oligonucleotide bound to a solid support via a linker, and having a hydroxyl group at the end of a chain extension protected with a protecting group removable under acidic conditions, with a deblocking solution to remove the protecting group for the hydroxyl group at the end of the chain extension from the nucleoside or oligonucleotide; Step (2): a step of coupling the hydroxyl group at the end of the chain extension from which the protecting group has been removed in Step (1) with a phosphoramidite compound to produce a phosphite triester; Step (3): a step of converting the phosphite triester produced in Step (2) into a phosphate triester or a phosphorothioate triester by oxidizing or sulfurizing; Step (4): a step of repeating a cycle of steps (1) to (3), i.e., a series of reactions consisting of Step (1) the deblocking reaction, Step (2) the coupling reaction, and Step (3) the oxidation or sulfurization reaction, any number of times to synthesize an oligonucleotide on a solid support; Step (5): A step of subjecting the oligonucleotide synthesized on the solid support in step (4) to a cleavage and deprotection step to liberate the oligonucleotide from the solid support, thereby obtaining an oligonucleotide from which the protecting groups have been removed. Furthermore, a step of capping hydroxyl groups that have not undergone the coupling reaction with the phosphoramidite compound may be added before or after the oxidation or sulfurization step.

[0037] More specifically, step (5) is carried out by sequentially subjecting the oligonucleotide synthesized on the solid support in step (4) to the following reactions in steps (5-1), (5-2), and (5-3). The reaction in step (5-1) may be carried out arbitrarily, and the reaction in step (5-2) may be carried out using the method described in Japanese Patent No. 4705716. As a result, an oligonucleotide from which all protecting groups have been removed, or an oligonucleotide in which only the hydroxyl group at the chain elongation terminal is protected, can be released from the solid support. Step (5-1): A step of removing the protecting group for the hydroxyl group at the chain elongation terminal of the oligonucleotide; Step (5-2): A step of cleaving and releasing the oligonucleotide from the solid support; and Step (5-3): A step of removing the protecting group for the hydroxyl group at the 2'- or 3'-position of the ribose constituting the oligonucleotide cleaved from the solid support.

[0038] Scheme A in Figure 1 shows a scheme of steps (1) to (5). At least one of the step (1) deblocking reactions in the cycle of a series of reactions constituting step (1) or step (4) is carried out by the deblocking reaction of the present invention. The definitions of the symbols in each formula in Scheme A in Figure 1 are as described above. Note that, although Scheme A in Figure 1 shows a method for synthesizing an oligonucleotide from the 3' side to the 5' side, embodiments of the present invention are not limited thereto and also include methods for synthesizing an oligonucleotide from the 5' side to the 3' side. Each formula will be explained in more detail below.

[0039] B a and a nucleobase optionally protected by a protecting group represented by the formula: cThe nucleic acid base represented by the formula (I) is not particularly limited. Examples of the nucleic acid base include adenine, cytosine, guanine, uracil, thymine, 5-methylcytosine, pseudouracil, and 1-methylpseudouracil. The nucleic acid base may be substituted with a substituent. Examples of such a substituent include halogen atoms such as a fluoro group, a chloro group, a bromo group, and an iodo group, acyl groups such as an acetyl group, alkyl groups such as a methyl group and an ethyl group, arylalkyl groups such as a benzyl group, alkoxy groups such as a methoxy group, alkoxyalkyl groups such as a methoxyethyl group, cyanoalkyl groups such as a cyanoethyl group, hydroxy groups, hydroxyalkyl groups, acyloxymethyl groups, amino groups, monoalkylamino groups, dialkylamino groups, carboxy groups, cyano groups, and nitro groups, as well as combinations of two or more of these substituents. B a The protecting group for the nucleic acid base, which may be protected with a protecting group represented by the formula (I), is not particularly limited, and any protecting group known in nucleic acid chemistry can be used. Examples of such protecting groups include a benzoyl group, a 4-methoxybenzoyl group, a 4-methylbenzoyl group, an acetyl group, a propionyl group, a butyryl group, an isobutyryl group, a phenylacetyl group, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, and a (dimethylamino)methylene group, as well as combinations of two or more of these protecting groups. a More specifically, the group represented by formula (4) can be mentioned. Formula (4): (In the formula, R 4 represents a hydrogen atom, a methyl group, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group, or a benzoyl group; R 5 represents a hydrogen atom, an acetyl group, an isobutyryl group, or a benzoyl group; R 6 represents a hydrogen atom, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group, or an isobutyryl group; R 7represents a 2-cyanoethyl group, R 8 represents a hydrogen atom, a methyl group, a benzoyl group, a 4-methoxybenzoyl group, or a 4-methylbenzoyl group; R 9 represents a dimethylaminomethylene group.

[0040] B c More specifically, examples of the group include groups obtained by removing the protecting group from formula (4).

[0041] G 1 is preferably a group represented by formula (3): Formula (3): (In the formula, R 1 , R 2 and R 3 are each independently the same or different and represent a hydrogen atom or an alkoxy group. 1 , R 2 and R 3 Preferably, one of G is a hydrogen atom and the remaining two are the same or different (preferably the same) alkoxy groups, and a methoxy group is particularly preferred as the alkoxy group. 1 is a 4,4'-dimethoxytrityl (DMTr) group.

[0042] G 2 There are no particular limitations on the protecting group G as long as it can function as a protecting group for a hydroxyl group, and a wide range of known protecting groups used in phosphoramidite compounds can be used. 2 Examples of the group G include an alkyl group, an alkenyl group, an alkynyl group, a cycloalkyl group, a haloalkyl group, an aryl group, a heteroaryl group, an arylalkyl group, a cycloalkenyl group, a cycloalkylalkyl group, a cyclylalkyl group, a hydroxyalkyl group, an aminoalkyl group, an alkoxyalkyl group, a heterocyclylalkenyl group, a heterocyclylalkyl group, a heteroarylalkyl group, a silyl group, a silyloxyalkyl group, a mono- or dialkylsilyl group, or a trialkylsilyl group, or a monoalkylsilyloxyalkyl group, a dialkylsilyloxyalkyl group, or a trialkylsilyloxyalkyl group, and the like, which may be substituted with one or more electron-withdrawing groups.2 is preferably an alkyl group substituted with an electron-withdrawing group. Examples of the electron-withdrawing group include a cyano group, a nitro group, an alkylsulfonyl group, a halogen atom, an arylsulfonyl group, a trihalomethyl group, and a trialkylamino group, and a cyano group is preferred. 2 Particularly preferred as the group is a group represented by formula (5):

[0043] The R 1 , R 2 , R 3 and G 2 The alkyl group in the definition may be either linear or branched, and is preferably an alkyl group having 1 to 12 carbon atoms, more preferably an alkyl group having 1 to 6 carbon atoms. Specific examples of the alkyl group include a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a tert-butyl group, an n-pentyl group, an isopentyl group, and a hexyl group. The alkyl group moiety constituting the alkoxy group in the definition of the substituent has the same definition as the alkyl group herein.

[0044] In the method of the present invention, the phosphoramidite compound can be used in its free state or in its salt state. Examples of the salt of the phosphoramidite compound include, but are not limited to, base addition salts and acid addition salts. Specific examples of the base addition salt include salts with inorganic bases such as sodium salts, magnesium salts, potassium salts, calcium salts, and aluminum salts; salts with organic bases such as methylamine, ethylamine, and ethanolamine; salts with basic amino acids such as lysine, ornithine, and arginine; and ammonium salts. Specific examples of the acid addition salt include salts with mineral acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, and phosphoric acid; organic acids such as formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, malic acid, tartaric acid, fumaric acid, succinic acid, lactic acid, maleic acid, citric acid, methanesulfonic acid, trifluoromethanesulfonic acid, and ethanesulfonic acid; and acidic amino acids such as aspartic acid and glutamic acid. The phosphoramidite compounds also include forms such as salts, hydrates, solvates, and crystalline polymorphs.

[0045] R preferably represents a protected hydroxyl group. When R represents a protected hydroxyl group, or a protecting group for a hydroxyl group represented by V, it is sufficient that it can be used in the phosphoramidite method, for example, 2'-tert-butyldimethylsilyl (TBS) group, 2'-bis (2-acetoxyethoxy) methyl (ACE) group, 2'- (triisopropylsilyloxy) methyl (TOM) group, 2'- (2-cyanoethoxy) ethyl (CEE) group, 2'- (2-cyanoethoxy) methyl (CEM) group (described in WO 2006 / 022323), 2'-para - toluylsulfonylethoxymethyl (TEM) group, 2'-EMM group (described in WO 2013 / 027843), and 2'-PMM group (described in WO 2019 / 208571) can be used. V is preferably a 2'-tert-butyldimethylsilyl (TBS) group. When the oligonucleotide produced by the method of the present invention is a ribonucleic acid (RNA), for example, and the oligonucleotide structure contains ribose, the protecting group for the hydroxyl group at the 2'-position of the ribose is preferably a 2'-tert-butyldimethylsilyl (TBS) group or a protecting group represented by formula (6). More preferably, E W An example of a protecting group is a protecting group represented by formula (12) having a cyano group as an electron-withdrawing group represented by formula (6): (wherein, q represents an integer of 0 to 5; R a and R b are each independently the same or different and represent a methyl group, an ethyl group, or a hydrogen atom, * represents the bonding point with the oxygen atom derived from the hydroxyl group at the 2'-position of ribose, and E W represents an electron-withdrawing group.) Formula (12): (In the formula, q, R a and R b is as defined in formula (6). More preferably, in the group represented by formula (12), q is 0 and R a and R b are simultaneously hydrogen atoms (i.e., CEM groups), q is 1, and R a and R band R are simultaneously hydrogen atoms (i.e., EMM group), or q is 1 and R a Or R b Examples include a group in which one of the groups is a methyl group and the other is a hydrogen atom (i.e., a PMM group). The protecting groups represented by formula (6) and formula (12) can be synthesized, for example, according to the descriptions in WO 2006 / 022323, WO 2013 / 027843, and WO 2019 / 208571, and phosphoramidite compounds having such protecting groups can be used to produce oligonucleotides. For example, a phosphoramidite compound represented by formula (13) is used in the coupling reaction of step (2) in Scheme A in Figure 1.

[0046] Examples of non-nucleotide linkers include linkers consisting of an amino acid backbone (for example, linkers consisting of an amino acid backbone described in WO 2006 / 022323 or WO 2013 / 027843). Specific, non-limiting examples include linkers represented by formula (A14-1) or formula (A14-2) or formula (A14-3) (for example, as described in WO 2019 / 074110). In addition to these linkers, for example, linkers described in WO 2012 / 005368, WO 2018 / 182008, or WO 2019 / 074110 are included. Formula (A14-1), Formula (A14-2), Formula (A14-3): (In the formula, Y is as defined above.)

[0047] Nucleotides and phosphoramidites in which the R group in formula (13) and the R′ group in formula (5) are substituents other than a hydroxyl group can be produced from nucleosides synthesized by known methods described in Japanese Patent No. 3745226, WO 2001 / 053528, JP 2014-221817 A, and known methods cited therein, or can be produced using commercially available products in accordance with the methods described in the Examples below or by methods with appropriate modifications to these methods.

[0048] G 4represents a hydrogen atom, an alkali metal ion, an ammonium ion, an alkylammonium ion, or a hydroxyalkylammonium ion. Examples of alkali metal ions include sodium ions and lithium ions. Specific examples of alkyl groups in the alkylammonium ions include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, and hexyl groups, and more specific examples include diethylammonium ion, triethylammonium ion, tetrabutylammonium ion, hexylammonium ion, and dibutylammonium ion. Specific examples of hydroxyalkyl moieties in the hydroxyalkylammonium ions include hydroxymethyl, hydroxyethyl, hydroxy-n-propyl, hydroxyisopropyl, hydroxy-n-butyl, and trishydroxymethyl, and more specific examples of hydroxyalkylammonium ions include trishydroxymethylammonium ions. G 4 preferably represents a hydrogen atom.

[0049] Y is preferably an oxygen atom or a sulfur atom.

[0050] W1 and X1 preferably represent an OZ group and X1 an R group.

[0051] Preferably, W3 and X3 each independently represent a hydroxyl group.

[0052] R' is preferably a hydroxyl group.

[0053] The synthesis of oligonucleotides by the phosphoramidite method, which comprises steps (1) to (5), can be carried out according to a generally known method (e.g., the method described in the aforementioned Japanese Patent No. 5,157,168 or Japanese Patent No. 5,554,881). Alternatively, the synthesis can be carried out using an automatic nucleic acid synthesizer. Each step will be described below.

[0054] The deblocking reaction of step (1) is a step of reacting a nucleoside or oligonucleotide, which is bound to a solid support via a linker and in which the protecting group for the hydroxyl group at the end of a chain extension is protected with a protecting group removable under acidic conditions, with a deblocking solution to remove the protecting group for the hydroxyl group at the end of the chain. At least one of the deblocking reaction of step (1) or the deblocking reaction of step (1) in the cycle of a series of reactions constituting step (4) is carried out by the deblocking reaction of the present invention.

[0055] The coupling reaction of step (2) is a reaction in which the hydroxyl group at the end of the chain extension from which the protecting group has been removed in the deblocking reaction of step (1) is coupled with a phosphoramidite compound in the presence of an activator. The phosphoramidite compound represented by formula (13) is a phosphoramidite compound used when synthesizing an oligonucleotide from the 3' to the 5' side. When synthesizing an oligonucleotide from the 5' to the 3' side, a phosphoramidite compound in which the substituent of the hydroxyl group at the 3' position and the substituent of the hydroxyl group at the 5' position of the phosphoramidite compound represented by formula (13) are interchanged can be used. Examples of the phosphoramidite compound represented by formula (13) include the uridine EMM amidite described in Example 2 of WO 2013 / 027843, the cytidine EMM amidite described in Example 3, the adenosine EMM amidite described in Example 4, and the guanosine EMM amidite described in Example 5, as well as the uridine PMM amidite, cytidine PMM amidite, adenosine PMM amidite, and guanosine PMM amidite described in WO 2019 / 208571. Other usable phosphoramidite compounds include, for example, 2'-OMe amidite, 2'-F amidite, 2'-O-tert-butyldimethylsilyl (TBS) amidite, 2'-O-methoxyethyl amidite, 2'-bis(2-acetoxyethoxy)methyl (ACE) amidite, 2'-(triisopropylsilyloxy)methyl (TOM) amidite, 2'-(2-cyanoethoxy)ethyl (CEE) amidite, 2'-(2-cyanoethoxy)methyl (CEM) amidite, 2'-para-tolylsulfonylethoxymethyl (TEM) amidite, 2'-H amidite, and 2'-fluoro-2'-deoxy-β-D-arabinofuranosylamidite. As the activating agent, any activating agent used in the phosphoramidite method can be used without limitation.Examples thereof include 5-benzylthio-1H-tetrazole (BTT) (also referred to as 5-benzylmercapto-1H-tetrazole), 1H-tetrazole, 4,5-dicyanoimidazole (DCI), 5-ethylthio-1H-tetrazole (ETT), N-methylbenzimidazolium triflate (N-MeBIT), benzimidazolium triflate (BIT), N-phenylimidazolium triflate (N-PhIMT), imidazolium triflate (IMT), 5-nitrobenzimidazolium triflate (NBT), 1-hydroxybenzotriazole (HOBT), and 5-(bis-3,5-trifluoromethylphenyl)-1H-tetrazole.

[0056] The phosphoramidite compound (also called amidite) represented by formula (13) is as follows: Formula (13): (In the formula, G 1 , G 2 , G 3 , B a and R are as defined above.

[0057] The oxidation or sulfurization reaction in step (3) converts the phosphite triester produced in the coupling reaction in step (2) into a phosphate triester or a phosphorothioate triester. This reaction converts trivalent phosphorus to pentavalent phosphorus using an oxidizing or sulfurizing agent, and can be carried out by reacting the oxidizing or sulfurizing agent with an oligonucleotide derivative supported on a solid support. When converting the phosphite triester to a phosphate triester, any oxidizing agent used in the phosphoramidite method can be used without limitation. For example, iodine can be used. The oxidizing agent can be diluted with an appropriate solvent to a concentration of 0.005 to 2 M and may contain a base. Water can be used as an oxygen source for oxidation. Examples of bases that can be used include pyridine, N-methylimidazole (NMI), N-methylmorpholine, and triethylamine. The solvent is not particularly limited as long as it is not involved in the reaction, and examples include acetonitrile, tetrahydrofuran (THF), and mixtures of these solvents in any ratio. For example, iodine / water / pyridine / acetonitrile, iodine / water / pyridine, iodine / water / pyridine / NMI, or iodine / water / pyridine / THF can be used. The reaction temperature is preferably 5°C to 50°C. The reaction time is usually 1 minute to 30 minutes. The amount of oxidizing agent used is preferably 1 to 100 mol, more preferably 1 to 10 mol, per mol of oligonucleotide derivative supported on the solid phase support. When converting a phosphite triester to a phosphorothioate triester, any sulfurizing agent used in the phosphoramidite method can be used without limitation. For example, sulfur, 3H-1,2-benzodithiol-3-one-1,1-dioxide (Beaucage reagent), 3-amino-1,2,4-dithiazole-5-thione (ADTT), 5-phenyl-3H-1,2,4-dithiazol-3-one (POS), [(N,N-dimethylaminomethylidene)amino]-3H-1,2,4-dithiazoline-3-thione (DDTT), and phenylacetyl disulfide (PADS) can be used.The sulfurizing agent can be used after diluting it with an appropriate solvent to a concentration of 0.001 to 2 M. The solvent is not particularly limited as long as it is not involved in the reaction, and examples include dichloromethane, acetonitrile, pyridine, and mixed solvents of these in any ratio. When capping hydroxyl groups that did not undergo the coupling reaction with the phosphoramidite compound before or after the oxidation or sulfurization step, the capping solution can be any of the capping solutions used in the phosphoramidite method, without any restrictions. Examples include an acetic anhydride-tetrahydrofuran solution and a phenoxyacetic anhydride / N-methylimidazole solution.

[0058] In step (5-1), the protecting group for the hydroxyl group at the chain elongation terminal of the oligonucleotide may be used for column purification using the protecting group for the hydroxyl group at the chain elongation terminal as a tag after cleavage from the solid phase support and deprotection of the protecting group in steps (5-2) and (5-3), or the protecting group for the hydroxyl group at the chain elongation terminal may be deprotected after column purification.

[0059] In step (5-2), the protecting group of the phosphate moiety of the oligonucleotide is deprotected by reacting an amine compound to deprotect the protecting group of the phosphate moiety after the synthesis of the oligonucleotide having the desired sequence is completed. Examples of amine compounds include diethylamine, as described in Japanese Patent No. 4705716. In step (5-2), the oligonucleotide elongated to the desired chain length on the solid support is typically cleaved from the solid support using concentrated aqueous ammonia as a cleavage agent. Furthermore, the oligonucleotide is cleaved and recovered from the solid support using ammonia or an amine compound, for example. Examples of amine compounds include methylamine, ethylamine, isopropylamine, ethylenediamine, and diethylamine.

[0060] In step (5-3), the protecting group of the hydroxyl group at the 2'- or 3'-position of the ribose constituting the oligonucleotide cleaved from the solid phase support in step (5-2) is, WO 2006 / 022323, WO 2013 / 027843, or WO 2019 / 208571, Nucleic Acids Research, Volume 22, Issue 12, 25 June 1994, Pages 2430-2431, J. Am. Chem. Soc. 1987, 109, 25, 7845-7854, US5986084A, Synthesis of Therapeutic Oligonucleotides It can be removed according to the method described in, to obtain a deprotected oligonucleotide.

[0061] In one embodiment, the production method of the present invention can produce oligonucleotides with a reduced content of 2',3' rearrangements. Here, the content of 2',3' rearrangements in an oligonucleotide, i.e., the content (%) of 2',3' rearrangements when the entire oligonucleotide containing 2',3' rearrangements is taken as 100%, is defined as the "content ratio of 2',3' rearrangements." Examples of the content ratio of 2',3' rearrangements in an oligonucleotide include, but are not limited to, 20% or less, 15% or less, 10% or less, and 5% or less. Specific examples of oligonucleotides include, but are not limited to, the following: An oligonucleotide produced by solid-phase synthesis, having a chain length of 50-400 mers and a content ratio of 2',3' rearrangements in the oligonucleotide of 20% or less. An oligonucleotide produced by solid-phase synthesis, having a chain length of 50-400 mers and a content ratio of 2',3' rearrangements in the oligonucleotide of 15% or less. An oligonucleotide produced by solid-phase synthesis, having a chain length of 50 mer or more and 400 mer or less, and having a 2',3' rearrangement content of 10% or less. An oligonucleotide produced by solid-phase synthesis, having a chain length of 50 mer or more and 400 mer or less, and having a 2',3' rearrangement content of 5% or less. An oligonucleotide produced by solid-phase synthesis, having a chain length of 50 mer or more and 300 mer or less, and having a 2',3' rearrangement content of 20% or less. An oligonucleotide produced by solid-phase synthesis, having a chain length of 50 mer or more and 300 mer or less, and having a 2',3' rearrangement content of 15% or less. An oligonucleotide produced by solid-phase synthesis, having a chain length of 50 mer or more and 300 mer or less, and having a 2',3' rearrangement content of 10% or less. An oligonucleotide produced by solid phase synthesis, which has a chain length of 50 mer or more and 300 mer or less, and in which the content ratio of 2',3' rearrangements in the oligonucleotide is 5% or less.An oligonucleotide produced by solid-phase synthesis, having a chain length of 50 mer or more and 200 mer or less, and having a 2',3' rearrangement content of 20% or less. An oligonucleotide produced by solid-phase synthesis, having a chain length of 50 mer or more and 200 mer or less, and having a 2',3' rearrangement content of 15% or less. An oligonucleotide produced by solid-phase synthesis, having a chain length of 50 mer or more and 200 mer or less, and having a 2',3' rearrangement content of 10% or less. An oligonucleotide produced by solid-phase synthesis, having a chain length of 50 mer or more and 200 mer or less, and having a 2',3' rearrangement content of 5% or less. An oligonucleotide produced by solid-phase synthesis, having a chain length of 50 mer or more and 150 mer or less, and having a 2',3' rearrangement content of 20% or less. An oligonucleotide produced by solid-phase synthesis, having a chain length of 50 mer or more and 150 mer or less, and having a 2',3' rearrangement content of 15% or less. An oligonucleotide produced by solid-phase synthesis, having a chain length of 50 mer or more and 150 mer or less, and having a 2',3' rearrangement content of 10% or less. An oligonucleotide produced by solid-phase synthesis, having a chain length of 50 mer or more and 150 mer or less, and having a 2',3' rearrangement content of 5% or less. An oligonucleotide produced by solid-phase synthesis, having a chain length of 50 mer or more and 400 mer or less, and having a 2',3' rearrangement content of 0.01% or more and 20% or less. An oligonucleotide produced by solid-phase synthesis, having a chain length of 50 mer or more and 400 mer or less, and having a 2',3' rearrangement content of 0.01% or more and 15% or less. An oligonucleotide produced by solid phase synthesis, which has a chain length of 50 mer or more and 400 mer or less, and a content ratio of 2',3' rearrangements in the oligonucleotide of 0.01% or more and 10% or less.An oligonucleotide produced by solid-phase synthesis, having a chain length of 50-400 mers and a content ratio of 2',3' rearrangements in the oligonucleotide of 0.01% to 5%. An oligonucleotide produced by solid-phase synthesis, having a chain length of 50-300 mers and a content ratio of 2',3' rearrangements in the oligonucleotide of 0.01% to 20%. An oligonucleotide produced by solid-phase synthesis, having a chain length of 50-300 mers and a content ratio of 2',3' rearrangements in the oligonucleotide of 0.01% to 15%. An oligonucleotide produced by solid-phase synthesis, having a chain length of 50-300 mers and a content ratio of 2',3' rearrangements in the oligonucleotide of 0.01% to 10%. An oligonucleotide produced by solid-phase synthesis, having a chain length of 50 mer or more and 300 mer or less, and having a 2',3' rearrangement content of 0.01% or more and 5% or less. An oligonucleotide produced by solid-phase synthesis, having a chain length of 50 mer or more and 200 mer or less, and having a 2',3' rearrangement content of 0.01% or more and 20% or less. An oligonucleotide produced by solid-phase synthesis, having a chain length of 50 mer or more and 200 mer or less, and having a 2',3' rearrangement content of 0.01% or more and 15% or less. An oligonucleotide produced by solid-phase synthesis, having a chain length of 50 mer or more and 200 mer or less, and having a 2',3' rearrangement content of 0.01% or more and 10% or less. An oligonucleotide produced by solid-phase synthesis, having a chain length of 50 mer or more and 200 mer or less, and having a 2',3' rearrangement content of 0.01% or more and 5% or less. An oligonucleotide produced by solid-phase synthesis, having a chain length of 50 mer or more and 150 mer or less, and having a 2',3' rearrangement content of 0.01% or more and 20% or less. An oligonucleotide produced by solid-phase synthesis, having a chain length of 50 mer or more and 150 mer or less, and having a 2',3' rearrangement content of 0.01% or more and 15% or less.An oligonucleotide having a chain length of 50 mer or more and 150 mer or less, and a content ratio of 2',3' rearrangement in the oligonucleotide of 0.01% or more and 10% or less, which is produced by solid-phase synthesis. An oligonucleotide having a chain length of 50 mer or more and 150 mer or less, and a content ratio of 2',3' rearrangement in the oligonucleotide of 0.01% or more and 5% or less, which is produced by solid-phase synthesis.

[0062] Typical examples of nucleic acids that can be produced by the production method of the present invention are shown below in addition to the examples described in the Examples, but are not limited to these. In the following sequence descriptions, U represents uridine (ST.25 format), T represents uridine (ST.26 format), C represents cytidine, A represents adenosine, and G represents guanosine. Examples include nucleic acids having the following sequences (A) and (B), which are described in WO 2019 / 060442. Sequence (A): 5'-AUGGAAUmACUCUUGGUUmACdTdT-3' (based on ST.25 format) (5'-ATGGAATmACTCTTGGTTmACdTdT-3' (based on ST.26 format)) (Antisense) (SEQ ID NO: 1) 21 mer Sequence (B): 5'-GUmAACmCmAAGAGUmAUmUmCmCmAUmdTdT-3' (based on ST.25 format) (5'-GTmAACmCmAAGAGTmATmTmCmCmATmdTdT-3' (based on ST.26 format)) (Sense) (SEQ ID NO: 2) 21 mer In sequences (A) and (B), Um represents 2'-O-methyluridine (ST.25 format), Tm represents 2'-O-methyluridine (ST.26 format), Cm represents 2'-O-methylcytidine, and dT represents thymidine. Unless otherwise specified, the abbreviations in the sequences herein apply to both the ST.25 format and the ST.26 format.

[0063] Examples include the nucleic acids described in Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558 (see page 553). A typical example is a nucleic acid having the following sequence (C): Sequence (C): 5'-AGAGCCAGCCUUCUUAUUGUUUUAGAGCUAUGCUGU-3' (based on the ST.25 format) (5'-AGAGCCAGCCTTCTTATTGTTTTAGAGCTATGCTGT-3' (based on the ST.26 format)) (SEQ ID NO: 3) 36mer

[0064] An example is a nucleic acid having the following sequence (D) described in Nucleic Acids Research, 2019, Vol. 47, No. 2: 547. Sequence (D): 5'-ACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU-3' (based on the ST.25 format) (5'-ACAGCATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT-3' (based on the ST.26 format)) (SEQ ID NO: 4) 67mer

[0065] An example is a nucleic acid having the following sequence (E) described in JP-A No. 2015-523856, page 173: Sequence (E): 5'-GUUUUCCCUUUUCAAAGAAAUCUCCUGGGCACCUAUCUUCUUAGGUGCCCUCCCUUGUUUAAACCUGACCAGUUAACCGGCUGGUUAGGUUUUU-3' (based on the ST.25 format) (5'-GTTTTCCCTTTTCAAAGAAATCTCCTGGGCACCTATCTTCTTAGGTGCCCTCCCTTGTTTAAACCTGACCAGTTAACCGGCTGGTTAGGTTTT-3' (based on the ST.26 format)) (SEQ ID NO: 5) 94mer

[0066] Examples include the nucleic acids described in JP-A-2017-537626. Typical examples include nucleic acids having the following sequences (F), (G), (H), and (J).Sequence (F): 5'-AGUCCUCAUCUCCCUCAAGCGUUUUAGAGCUAGUAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (based on ST.25 format) (5'-AGTCCTCATCTCCCTCAAGCGTTTTAGAGCTAGTAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3' (based on ST.26 format)) (SEQ ID NO: 6) 100mer Sequence (G): 5'-GCAGAUGUAGUGUUUCCACAGUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3' (based on ST.25 format) (5'-GCAGATGTAGTGTTTCCACAGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3' (based on ST.26 format)) (SEQ ID NO: 7) 113mer Sequence (H): 5'-dAdGdTdCdCdTdCdAdTdCdTdCdCdCdTdCdAdGdCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3' (based on ST.25 format) (5'-dAdGdTdCdCdTdCdAdTdCdTdCdCdCdTdCdAdGdCGTTTAAGAGCTATGCTGGTAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3' (based on ST.26 format)) (SEQ ID NO: 8) 113mer In sequence (H), dT represents thymidine, dC represents 2'-deoxycytidine, dA represents 2'-deoxyadenosine, and dG represents 2'-deoxyguanosine.Sequence (J): 5'-AmsGmsUmsCCUCAUCUCCCUCAAGCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUmsUmsU-3' (based on ST.25 format) (5'-AmsGmsTmsCCTCATCTCCCTCAAGCGTTTAAGAGCTATGCTGGTAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTmsTmsTmsT-3' (based on ST.26 format)) (SEQ ID NO: 9) 113mer In sequence (J), Um represents 2'-O-methyluridine (ST.25 format), Tm represents 2'-O-methyluridine (ST.26 format), Am represents 2'-O-methyladenosine, Gm represents 2'-O-methylguanosine, and s represents a phosphorothioate modification.

[0067] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0068] Measurement Methods First, the various measurement methods used in the following tests are shown below.

[0069] (Measurement Method 1: Measurement of Oligonucleotide Purity) The purity of the oligonucleotide was calculated by HPLC measurement. The HPLC measurement conditions are shown in Table 1.

[0070] (Measurement method 2: Measurement of the content of enzymatic degradation products and 2',3' rearrangements of oligonucleotides) The content of 2',3' rearrangements of oligonucleotides was calculated by HPLC measurement of enzymatic degradation products of oligonucleotides. The HPLC measurement conditions are shown in Table 2.

[0071] Formula (U-15), Formula (U-16):

[0072] (Enzymatic Decomposition Method) The enzymatic decomposition method of oligonucleotides is described below. 83 μL of an aqueous solution of crude oligonucleotides prepared to a concentration of 0.5 mg / mL was added to a 2 mL vial. 2 μL of an aqueous solution of 0.2 unit / μL Nuclease P1 (derived from Penicillium citrinum) and Alkaline Phosphatase (Calf 5 μL of ATP (derived from Intestinal) was added. The vial was then incubated for 2 hours in an incubator set to 56°C. The above procedure hydrolyzes the 3',5'-phosphodiester bonds and phosphate esters of RNA and thermally denatured DNA, resulting in degradation of natural RNA and DNA down to nucleosides. For example, if all phosphodiester bonds in an oligonucleotide consisting only of uridine are 3',5'-phosphodiester bonds, only the compound represented by formula (U-15) is produced as an enzymatic degradation product. On the other hand, if an oligonucleotide consisting only of uridine contains a 2',3' rearrangement, the presence of a 2',5'-phosphodiester bond that is not degraded by this enzymatic degradation method results in the production of the compound represented by formula (U-16) as well as the compound represented by formula (U-15).

[0073] When the enzymatic degradation products of the oligonucleotides were subjected to HPLC measurement according to the above-mentioned measurement method 2, the retention time of the compound represented by formula (U-15) was approximately 5.4 minutes, and the retention time of the compound represented by formula (U-16) was approximately 8.2 minutes. The proportion of 2',3' rearrangements contained in the oligonucleotides was calculated from the HPLC area percentages of the detected compounds represented by formula (U-15) and formula (U-16). The calculation method is shown below. [c] = [a] x ([a] + [b]) x 100 ... formula (X) (In the formula, [a] represents the HPLC area percentage of the compound represented by formula (U-16) detected by HPLC measurement according to the measurement method 2. [b] represents the HPLC area percentage of the compound represented by formula (U-15) detected by HPLC measurement according to the measurement method 2.) [e] = ([a] / [α]) x ([a] / [α] + [b] / [β] x [d]) x 100 ... formula (Y) (In the formula, [a] and [b] are as defined in formula (X). [d] represents the ratio of the portion of the oligonucleotide sequence at which enzymatic degradation products derived from 2',3' rearrangements such as the compound represented by formula (U-16) can be generated relative to the total number of nucleotides. For example, in the case of a 50-mer oligonucleotide consisting only of uridine (U), there are 49 positions with UU sequences, so [d] is 49÷50=0.98. In the case of a 103-mer oligonucleotide consisting only of uridine (U), there are 102 positions with UU sequences, so [d] is 102÷103=0.99. [α] represents the sensitivity ratio (ε 260 M -1 cm -1 ), and [α] is the value described in Handbook of Analysis of Oligonucleotides and Related Products / chapter 12 / Table 12.1 (Jose V. Bonilla, G. Susan Srivatsa, ISBN: 1439819939). [β] is the sensitivity ratio (ε 260 M -1 cm -1), and [β] is the value described in the Handbook of Analysis of Oligonucleotides and Related Products / chapter 12 / Table 12.1 (Jose V. Bonilla, G. Susan Srivatsa, ISBN: 1439819939). For example, in the case of an oligonucleotide sequence containing 50 consecutive uridines (U), [α] is the UU sensitivity ratio, which has a value of 19,600, and [β] is the U sensitivity ratio, which has a value of 9,900. The values ​​described in the Handbook of Analysis of Oligonucleotides and Related Products / chapter 12 / Table 12.1 (Jose V. Bonilla, G. Susan Srivatsa, ISBN: 1439819939) take into account the sensitivity ratio between compounds at UV 260 nm, and the unit is ε. 260 M -1 cm -1 [e] represents the proportion of 2',3' rearrangements in the oligonucleotide, determined from the HPLC area percentages of the compound represented by formula (U-15) and the compound represented by formula (U-16) detected by HPLC measurement according to Measurement Method 2, taking into consideration the sequence and sensitivity ratio. The calculation method shown in Formula (Y) can also be applied to oligonucleotides containing nucleobases other than uridine by using the values ​​described in the Handbook of Analysis of Oligonucleotides and Related Products / Chapter 12 / Table 12.1 (Jose V. Bonilla, G. Susan Srivatsa, ISBN: 1439819939).

[0074] As described above, [c] and [e] are approximate values ​​of the proportion of 2',3' rearrangements contained in the oligonucleotide relative to the total number of nucleosides, i.e., the total number of nucleotides in the oligonucleotide, when the oligonucleotide is enzymatically fragmented into nucleosides. On the other hand, if an oligonucleotide contains even one 2',5'-phosphodiester bond, it can be said that the oligonucleotide contains a 2',3' rearrangement. Therefore, the content ratio [g] of 2',3' rearrangements in the oligonucleotide was calculated using the following formula. The calculation method is shown below. [g]=[e]×[f] Formula (Z) (In the formula, [e] is as defined in formula (Y). [f] represents the number of moieties at which enzymatic degradation products derived from 2′,3′ rearrangements in the oligonucleotide can be generated when the oligonucleotide is enzymatically degraded. For example, in the case of a 50-mer oligonucleotide consisting only of uridine (U), the number of moieties at which UU, an enzymatic degradation product derived from 2′,3′ rearrangements in the oligonucleotide, can be generated is 49. In addition, in the case of a 103-mer oligonucleotide consisting only of uridine (U), the number of moieties at which UU, an enzymatic degradation product derived from 2′,3′ rearrangements in the oligonucleotide, can be generated is 102. The calculation method shown in formula (Z) can also be applied to oligonucleotides containing nucleobases other than uridine.

[0075] (Measurement Method 3: Measurement of Oligonucleotide Yield) OD of the crude product 260 The OD was measured. 260 represents the UV absorbance at 260 nm per 10 mm path length in 1 mL of solution (pH = 7.5). 260 = 40 μg, 260 The yield was calculated based on the measured values.

[0076] (Measurement Method 4: Measurement of Water Content of Deblocking Solution) The water content of the deblocking solution was measured using a Karl Fischer measuring device AQ-2200 manufactured by HIRANUMA Co., Ltd. A TPT-74 electrode was used, Aqualite RS-A was used as the generating solution, and Aqualite CN was used as the counter electrode solution.

[0077] Solid-phase synthesis of oligonucleotides Sequence (I): 5'-UUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUU-3' (based on ST.25 format) (5'-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT-3' (based on ST.26 format)) (SEQ ID NO: 10) 50mer Sequence (II): 5'-UUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUU-3' (based on the ST.25 format) (5'-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT-3' (based on the ST.26 format)) (SEQ ID NO: 11) 103mer sequence (III): 5'-dTsdTsUfUfCmCmUUUUUUUUUUUUUUUUUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (based on ST.25 format) (5'-dTsdTsTfTfCmCmTTTTTTTTTTTTTTTTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3' (based on ST.26 format)) (SEQ ID NO: 12) 103mer sequence (IV): 5'-AmUmAmAmCmUmCAAUUUGUAAAAAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUmsUmsUmsU-3' (based on ST.25 format) (5'-AmTmAmAmCmTmCAATTTGTAAAAAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTmsTmsTmsT-3' (ST.26 format)) (SEQ ID NO: 13) 103mer Sequence (V): 5'-dAdTdAdAdCdTdCdAdAdTdTdTdGdTdAdAdAdAdAdAdGdTdTUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUfUfUfUfUfUfU-3' (SEQ ID NO: 14) 103mer In Sequence (I), Sequence (II), Sequence (III), Sequence (IV), and Sequence (V), A represents adenosine, C represents cytidine, G represents guanosine, U represents uridine (ST.25 format), T represents uridine (ST.26 format), dA represents deoxyadenosine, dC represents deoxycytidine, dG represents deoxyguanosine, dT represents thymidine, Am represents 2'-O-methyladenosine, Cm represents 2'-O-methylcytidine, Um represents 2'-O-methyluridine (ST.25 format), Tm represents 2'-O-methyluridine (ST.26 format), Uf represents 2'-fluorouridine (ST.25 format), Tf represents 2'-fluorouridine (ST.26 format), and s represents phosphorothioate modification. Unless otherwise specified, the abbreviations in the sequences herein apply to both the ST.25 and ST.26 formats.

[0078] Next, specific examples of oligonucleotides produced by the method of the present invention will be described. In the following examples, the oligonucleotides produced by the method of the present invention are oligonucleotides having the sequence (I) shown in SEQ ID NO: 10, the sequence (II) shown in SEQ ID NO: 11, the sequence (IV) shown in SEQ ID NO: 13, or the sequence (V) shown in SEQ ID NO: 14.

[0079] The Controlled Pore Glass (CPG) carrying the 2'-OTBS-U derivative described in the following examples and comparative examples was purchased from Synthepor and has an LCAA linker. The zeolite carrying the 2'-OTBS-U derivative described in the following examples and comparative examples was prepared according to the method described in WO 2020 / 202951 and has a structure represented by formula (10). The circle illustrated in formula (10) is a schematic representation of a zeolite. Formula (10):

[0080] The 2'-OTBS-U amidite described in the following examples and comparative examples has a structure represented by formula (18), and was purchased from Hongene. Formula (18):

[0081] The 2'-OTBS-A amidite described in the following examples and comparative examples has a structure represented by formula (19), and was purchased from Hongene. Formula (19):

[0082] The 2'-OTBS-C amidite described in the following examples and comparative examples has a structure represented by formula (20), and was purchased from Hongene. Formula (20):

[0083] The 2'-OTBS-G amidite described in the following examples and comparative examples has a structure represented by formula (21), and was purchased from Hongene. Formula (21):

[0084] The 2'-OTOM-U amidite described in the following examples and comparative examples has a structure represented by formula (23), and was purchased from Hongene. Formula (23):

[0085] The 2'-OCEM-U amidite described in the following examples and comparative examples has a structure represented by formula (24), and was synthesized according to the method described in Nucleic Acids Research, 2007, Vol. 35, No. 10, 3287-3296. Formula (24):

[0086] The 2'-OPMM-U amidite described in the following examples and comparative examples has a structure represented by formula (25), and was synthesized according to the method described in WO 2019 / 208571. Formula (25):

[0087] The 2'-OMe-A amidite described in the following examples and comparative examples has a structure represented by formula (26), and was purchased from Hongene. Formula (26):

[0088] The 2'-OMe-C amidite described in the following examples and comparative examples has a structure represented by formula (27), and was purchased from Hongene. Formula (27):

[0089] The 2'-OMe-U amidite described in the following examples and comparative examples has a structure represented by formula (28), and was purchased from Hongene. Formula (28):

[0090] The DNA-A amidite described in the following examples and comparative examples has a structure represented by formula (29), and was purchased from Hongene. Formula (29):

[0091] The DNA-C amidite described in the following examples and comparative examples has a structure represented by formula (30), and was purchased from Hongene. Formula (30):

[0092] The DNA-G amidite described in the following examples and comparative examples has a structure represented by formula (31), and was purchased from Hongene. Formula (31):

[0093] The DNA-T amidite described in the following examples and comparative examples has a structure represented by formula (32), and was purchased from Hongene. Formula (32):

[0094] The 2'-FU amidite described in the following examples and comparative examples has a structure represented by formula (33), and was purchased from Hongene. Formula (33):

[0095] Example 1: Using CPG (solid phase support) carrying 0.97 μmol of the 2'-OTBS-U derivative, the oligonucleotide shown in sequence (I) was synthesized from the 3' end toward the 5' end using an NTS M-4MX-E (manufactured by Nippon Techno Service Co., Ltd.). The synthesis procedure was as follows: first, a deblocking solution (pyridine:dichloroacetic acid:toluene = 0.25:7.80:82.15 (weight ratio)) (the molar ratio of pyridine to dichloroacetic acid was 0.051) (the water content measured according to Measurement Method 4 above was less than 200 ppm) was delivered to the solid phase support; the DMTr group, which is the protecting group for the hydroxyl group at the 5' position of the nucleoside supported on the solid phase support, was removed; and then acetonitrile was delivered. The deblocking reaction was carried out for 1.5 minutes. Next, an acetonitrile solution of 2'-OTBS-U amidite and an acetonitrile solution of 5-benzylmercapto-1H-tetrazole as an activator were delivered to the solid support, and a coupling reaction was allowed to proceed at the 5'-position hydroxyl group, after which acetonitrile was delivered. Next, an oxidation solution containing 50 mM iodine was delivered to the solid support, and the phosphite triester was converted to a phosphate triester, after which acetonitrile was delivered. Next, a 0.1 M phenoxyacetic anhydride acetonitrile solution and a 10% N-methylimidazole / 10% 2,6-lutidine acetonitrile solution were delivered to the solid support as capping solutions, and hydroxyl groups that had not progressed in the coupling reaction were capped, after which acetonitrile was delivered. These steps were repeated a total of 49 times, after which the DMTr group of the 5'-terminal hydroxyl group was removed with a deblocking solution (pyridine:dichloroacetic acid:toluene = 0.25:7.80:82.15 (weight ratio)), and the oligonucleotide of sequence (I) was synthesized on the solid support. A diethylamine solution (diethylamine:acetonitrile = 2:8) was pumped onto the solid support for 10 minutes, and then acetonitrile was pumped. Subsequently, 570 μL of 28% aqueous ammonia and 190 μL of ethanol were poured into the solid support, and the mixture was incubated at 40 °C for 4 hours to liberate the oligonucleotide from the solid support. The solid support was then removed by filtration, and the aqueous ammonia and ethanol were removed by drying under reduced pressure to obtain a dry solid.The dry solid was then dissolved in 755 μL of dimethyl sulfoxide, and 1.48 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) that had been dehydrated using molecular sieves 4A was added. The mixture was then incubated at 30°C for 4 hours to remove the TBS group, the protecting group for the hydroxyl group at the 2'-position of the oligonucleotide. The reaction was then terminated by adding 1.40 mL of a 3 M aqueous ammonium acetate solution. The mixture was then poured into 9.04 g of ethanol, centrifuged, and the supernatant was removed to obtain a precipitated crude product. The precipitate was then dissolved in water to obtain the desired oligonucleotide as an aqueous solution. The purity of the resulting oligonucleotide was calculated according to Measurement Method 1 and found to be 52%. The yield of the resulting oligonucleotide was measured according to Measurement Method 3 and found to be 7.7 mg, which corresponds to 7.9 mg per 1.00 μmol of 2'-OTBS-U derivative-supported solid support. The resulting oligonucleotide was enzymatically decomposed according to the enzymatic degradation method, and the resulting enzymatic degradation product was subjected to HPLC analysis according to Measurement Method 2, and the values ​​of [c], [e], and [g] were calculated. As a result, the value of [c] was 0.41%, the value of [e] was 0.21%, and the value of [g] was 10%. The results are shown in Table 3.

[0096] Example 2 An oligonucleotide of sequence (I) was obtained in the same manner as in Example 1, except that 0.95 μmol of CPG was used as the solid support carrying the 2'-OTBS-U derivative, and a deblocking solution of pyridine:dichloroacetic acid:toluene=0.25:6.24:83.02 (weight ratio) (the molar ratio of pyridine to dichloroacetic acid was 0.064) (the water content measured according to Measurement Method 4 above was less than 200 ppm) was used. The purity of the obtained oligonucleotide was calculated according to Measurement Method 1 above and found to be 54%. The yield of the obtained oligonucleotide was calculated according to Measurement Method 3 above and found to be 7.8 mg, which was equivalent to a yield of 8.2 mg per 1.00 μmol of the 2'-OTBS-U derivative-carrying solid support. The obtained oligonucleotide was enzymatically hydrolyzed according to the enzymatic method, and the enzymatic hydrolyzate obtained was subjected to HPLC analysis according to Measurement Method 2 above, and the values ​​of [c], [e], and [g] were calculated. As a result, the value of [c] was 0.17%, the value of [e] was 0.09%, and the value of [g] was 4%. The results are shown in Table 3.

[0097] Example 3 An oligonucleotide having sequence (I) was obtained in the same manner as in Example 1, except that 0.95 μmol of CPG was used as the solid support carrying the 2'-OTBS-U derivative, pyridine:dichloroacetic acid:toluene = 0.49:4.68:83.67 (weight ratio) (the molar ratio of pyridine to dichloroacetic acid was 0.171) (the water content measured according to Measurement Method 4 above was less than 200 ppm) was used as the deblocking solution, and the deblocking reaction was carried out for 4.0 minutes. The purity of the obtained oligonucleotide was calculated according to Measurement Method 1 above and was found to be 52%. The yield of the obtained oligonucleotide was calculated according to Measurement Method 3 above and was found to be 8.0 mg, which corresponds to a yield of 8.5 mg per 1.00 μmol of the 2'-OTBS-U derivative-carrying solid support. The resulting oligonucleotide was enzymatically decomposed according to the enzymatic degradation method, and the resulting enzymatic degradation product was subjected to HPLC analysis according to Measurement Method 2, and the values ​​of [c], [e], and [g] were calculated. As a result, the value of [c] was 0.10%, the value of [e] was 0.05%, and the value of [g] was 2%. The results are shown in Table 3.

[0098] Comparative Example 1 An oligonucleotide of sequence (I) was obtained in the same manner as in Example 1, except that 0.97 μmol of CPG was used as the solid support carrying the 2'-OTBS-U derivative, and a dichloroacetic acid:toluene ratio of 7.80:82.37 (weight ratio) (water content measured according to Measurement Method 4 above was less than 200 ppm) was used as the deblocking solution. The purity of the obtained oligonucleotide was calculated according to Measurement Method 1 above and found to be 43%. The yield of the obtained oligonucleotide was calculated according to Measurement Method 3 above and found to be 6.8 mg, which was equivalent to a yield of 7.0 mg per solid support carrying 1.00 μmol of the 2'-OTBS-U derivative. The obtained oligonucleotide was enzymatically hydrolyzed according to the enzymatic hydrolysis method, and the resulting enzymatic hydrolyzate was subjected to HPLC analysis according to Measurement Method 2 above to calculate the values ​​of [c], [e], and [g]. The results were: [c] was 0.97%, [e] was 0.50%, and [g] was 24%. The results are shown in Table 3.

[0099] The results of Examples 1 to 3 and Comparative Example 1 are shown in Table 3.

[0100]

[0101] Example 4 An oligonucleotide of sequence (I) was obtained in the same manner as in Example 1, except that 0.94 μmol of CPG was used as the solid support carrying the 2'-OTBS-U derivative, and a deblocking solution of morpholine:dichloroacetic acid:toluene=0.26:7.80:82.14 (weight ratio) (the molar ratio of morpholine to dichloroacetic acid was 0.050) (the water content measured according to Measurement Method 4 above was less than 200 ppm). The yield of the obtained oligonucleotide was calculated according to Measurement Method 3 above to be 7.1 mg, which was equivalent to 7.6 mg of yield per 1.00 μmol of the 2'-OTBS-U derivative-carrying solid support. The obtained oligonucleotide was enzymatically hydrolyzed according to the enzymatic hydrolysis method described above, and the resulting enzymatic hydrolyzate was subjected to HPLC analysis according to Measurement Method 2 described above, and the values ​​of [c], [e], and [g] were calculated. As a result, the value of [c] was 0.81%, the value of [e] was 0.41%, and the value of [g] was 20%. The results are shown in Table 4.

[0102] Example 5 An oligonucleotide of sequence (I) was obtained in the same manner as in Example 1, except that 0.98 μmol of CPG was used as the solid support carrying the 2'-OTBS-U derivative, and a deblocking solution of 1-methylimidazole:dichloroacetic acid:toluene=0.25:7.80:82.16 (weight ratio) (the molar ratio of 1-methylimidazole to dichloroacetic acid was 0.050) (the water content measured according to Measurement Method 4 above was less than 200 ppm) was used. The yield of the obtained oligonucleotide was calculated according to Measurement Method 3 above to be 7.2 mg, which was equivalent to 7.3 mg of the yield per 1.00 μmol of the 2'-OTBS-U derivative-carrying solid support. The obtained oligonucleotide was enzymatically hydrolyzed according to the enzymatic hydrolysis method described above, and the resulting enzymatic hydrolyzate was subjected to HPLC analysis according to Measurement Method 2 described above, and the values ​​of [c], [e], and [g] were calculated. As a result, the value of [c] was 0.69%, the value of [e] was 0.36%, and the value of [g] was 17%. The results are shown in Table 4.

[0103] Example 6 An oligonucleotide of sequence (I) was obtained in the same manner as in Example 1, except that 0.97 μmol of CPG was used as the solid support carrying the 2'-OTBS-U derivative, and a deblocking solution of triethylamine:dichloroacetic acid:toluene=0.31:7.80:81.99 (weight ratio) (the molar ratio of triethylamine to dichloroacetic acid was 0.051) (the water content measured according to Measurement Method 4 above was less than 200 ppm). The yield of the obtained oligonucleotide was calculated according to Measurement Method 3 above to be 7.6 mg, which was equivalent to 7.9 mg of yield per 1.00 μmol of the 2'-OTBS-U derivative-carrying solid support. The obtained oligonucleotide was enzymatically hydrolyzed according to the enzymatic hydrolysis method described above, and the resulting enzymatic hydrolyzate was subjected to HPLC analysis according to Measurement Method 2 described above, and the values ​​of [c], [e], and [g] were calculated. As a result, the value of [c] was 0.42%, the value of [e] was 0.22%, and the value of [g] was 11%. The results are shown in Table 4.

[0104] The results of Examples 4 to 6 and Comparative Example 1 are shown in Table 4.

[0105]

[0106] Example 7 An oligonucleotide of sequence (I) was obtained in the same manner as in Example 1, except that 1.07 μmol of zeolite was used as the solid support carrying the 2'-OTBS-U derivative, and a deblocking solution of pyridine:dichloroacetic acid:toluene=0.25:7.80:82.15 (weight ratio) (the molar ratio of pyridine to dichloroacetic acid was 0.051) (the water content measured according to Measurement Method 4 above was less than 200 ppm). The yield of the obtained oligonucleotide was calculated according to Measurement Method 3 above to be 9.0 mg, which was equivalent to a yield of 8.3 mg per solid support carrying 1.00 μmol of the 2'-OTBS-U derivative. The obtained oligonucleotide was enzymatically hydrolyzed according to the enzymatic hydrolysis method described above, and the resulting enzymatic hydrolyzate was subjected to HPLC analysis according to Measurement Method 2 described above, and the values ​​of [c], [e], and [g] were calculated. As a result, the value of [c] was 0.51%, the value of [e] was 0.26%, and the value of [g] was 13%. The results are shown in Table 5.

[0107] Example 8 An oligonucleotide of sequence (I) was obtained in the same manner as in Example 1, except that 1.04 μmol of zeolite was used as the solid support carrying the 2'-OTBS-U derivative, and a deblocking solution of pyridine:dichloroacetic acid:toluene=0.25:4.68:83.88 (weight ratio) (the molar ratio of pyridine to dichloroacetic acid was 0.085) (the water content measured according to Measurement Method 4 above was less than 200 ppm). The yield of the obtained oligonucleotide was calculated according to Measurement Method 3 above to be 8.2 mg, which was equivalent to 7.9 mg of yield per solid support carrying 1.00 μmol of the 2'-OTBS-U derivative. The obtained oligonucleotide was enzymatically hydrolyzed according to the enzymatic hydrolysis method described above, and the resulting enzymatic hydrolyzate was subjected to HPLC analysis according to Measurement Method 2 described above, and the values ​​of [c], [e], and [g] were calculated. As a result, the value of [c] was 0.57%, the value of [e] was 0.29%, and the value of [g] was 14%. The results are shown in Table 5.

[0108] Example 9 An oligonucleotide of sequence (I) was obtained in the same manner as in Example 1, except that 0.98 μmol of zeolite was used as the solid support carrying the 2'-OTBS-U derivative, and a deblocking solution of pyridine:dichloroacetic acid:toluene=0.49:4.68:83.67 (weight ratio) (the molar ratio of pyridine to dichloroacetic acid was 0.171) (the water content measured according to Measurement Method 4 above was less than 200 ppm). The yield of the obtained oligonucleotide was calculated according to Measurement Method 3 above to be 9.2 mg, which was equivalent to 9.3 mg of the yield per 1.00 μmol of the 2'-OTBS-U derivative-carrying solid support. The obtained oligonucleotide was enzymatically hydrolyzed according to the enzymatic hydrolysis method described above, and the resulting enzymatic hydrolyzate was subjected to HPLC analysis according to Measurement Method 2 described above, and the values ​​of [c], [e], and [g] were calculated. As a result, the value of [c] was 0.24%, the value of [e] was 0.13%, and the value of [g] was 6%. The results are shown in Table 5.

[0109] Comparative Example 2 An oligonucleotide of sequence (I) was obtained in the same manner as in Example 1, except that 1.03 μmol of zeolite was used as the solid support carrying the 2'-OTBS-U derivative, and a deblocking solution of dichloroacetic acid:toluene = 4.68:84.10 (weight ratio) (water content measured according to Measurement Method 4 above was less than 200 ppm) was used. The yield of the obtained oligonucleotide was calculated according to Measurement Method 3 above to be 6.5 mg, which was equivalent to 6.3 mg of yield per solid support carrying 1.00 μmol of the 2'-OTBS-U derivative. The obtained oligonucleotide was enzymatically decomposed according to the enzymatic degradation method described above, and the obtained enzymatic degradation product was subjected to HPLC analysis according to Measurement Method 2 described above to calculate the values ​​of [c], [e], and [g]. The values ​​of [c] were 1.40%, [e] were 0.72%, and [g] were 35%. The results are shown in Table 5.

[0110] The results of Examples 7 to 9 and Comparative Example 2 are shown in Table 5.

[0111]

[0112] Example 10: An oligonucleotide of sequence (II) was obtained in the same manner as in Example 1, except that 0.96 μmol of CPG was used as the solid support carrying the 2'-OTBS-U derivative, and a deblocking solution of pyridine:dichloroacetic acid:toluene=0.25:7.80:82.15 (weight ratio) (the molar ratio of pyridine to dichloroacetic acid was 0.051) (the water content measured according to Measurement Method 4 above was less than 200 ppm). The yield of the obtained oligonucleotide was calculated according to Measurement Method 3 above to be 13.1 mg, which was equivalent to 13.6 mg of yield per solid support carrying 1.00 μmol of the 2'-OTBS-U derivative. The obtained oligonucleotide was enzymatically hydrolyzed according to the enzymatic hydrolysis method described above, and the resulting enzymatic hydrolyzate was subjected to HPLC analysis according to Measurement Method 2 described above, and the values ​​of [c], [e], and [g] were calculated. As a result, the value of [c] was 0.19%, the value of [e] was 0.10%, and the value of [g] was 10%. The results are shown in Table 6.

[0113] Comparative Example 3 An oligonucleotide of sequence (II) was obtained in the same manner as in Example 1, except that 0.96 μmol of CPG was used as the solid support carrying the 2'-OTBS-U derivative, and a dichloroacetic acid:toluene ratio of 7.80:82.37 (weight ratio) was used as the deblocking solution (the water content measured according to Measurement Method 4 above was less than 200 ppm). The yield of the obtained oligonucleotide was calculated according to Measurement Method 3 above to be 12.3 mg, which was equivalent to 12.8 mg of yield per 1.00 μmol of the 2'-OTBS-U derivative-carrying solid support. The obtained oligonucleotide was enzymatically decomposed according to the enzymatic degradation method described above, and the resulting enzymatic degradation product was subjected to HPLC analysis according to Measurement Method 2 described above to calculate the values ​​of [c], [e], and [g]. The values ​​of [c] were 0.40%, [e] were 0.20%, and [g] were 21%. The results are shown in Table 6.

[0114] The results of Example 10 and Comparative Example 3 are shown in Table 6.

[0115]

[0116] Example 11 An oligonucleotide of sequence (I) was obtained in the same manner as in Example 1, except that 1.09 μmol of zeolite was used as the solid support carrying the 2'-OTBS-U derivative, pyridine:dichloroacetic acid:toluene=0.25:7.80:82.15 (weight ratio) (the molar ratio of pyridine to dichloroacetic acid was 0.051) (the water content measured according to Measurement Method 4 above was less than 200 ppm) was used as the deblocking solution, and an acetonitrile solution of 2'-OPMM-U amidite was used as the amidite. The purity of the obtained oligonucleotide was calculated according to Measurement Method 1 above and was found to be 55%. The yield of the obtained oligonucleotide was calculated according to Measurement Method 3 above and was found to be 8.4 mg, which corresponds to 7.7 mg when converted to a yield per 1.00 μmol of the 2'-OTBS-U derivative-carrying solid support. The resulting oligonucleotide was enzymatically decomposed according to the enzymatic degradation method, and the resulting enzymatic degradation product was subjected to HPLC analysis according to Measurement Method 2, and the values ​​of [c], [e], and [g] were calculated. As a result, the value of [c] was 0.02%, the value of [e] was 0.01%, and the value of [g] was 0.6%. The results are shown in Table 7.

[0117] Comparative Example 4 An oligonucleotide of sequence (I) was obtained in the same manner as in Example 1, except that 1.03 μmol of zeolite was used as the solid support carrying the 2'-OTBS-U derivative, a dichloroacetic acid:toluene ratio of 7.80:82.37 (weight ratio) was used as the deblocking solution (water content measured according to Measurement Method 4 above: less than 200 ppm), and an acetonitrile solution of 2'-OPMM-U amidite was used as the amidite. The purity of the obtained oligonucleotide was calculated according to Measurement Method 1 above and was found to be 46%. The yield of the obtained oligonucleotide was calculated according to Measurement Method 3 above and was found to be 7.3 mg, which was equivalent to 7.1 mg per solid support carrying 1.00 μmol of the 2'-OTBS-U derivative. The obtained oligonucleotide was enzymatically hydrolyzed according to the enzymatic hydrolysis method described above, and the resulting enzymatic hydrolyzate was subjected to HPLC analysis according to Measurement Method 2 described above, and the values ​​of [c], [e], and [g] were calculated. As a result, the value of [c] was 0.04%, the value of [e] was 0.02%, and the value of [g] was 1.0%. The results are shown in Table 7.

[0118] The results of Example 11 and Comparative Example 4 are shown in Table 7.

[0119]

[0120] Example 12 An oligonucleotide of sequence (I) was obtained in the same manner as in Example 1, except that 0.95 μmol of CPG was used as the solid phase support carrying the 2'-OTBS-U derivative, pyridine:dichloroacetic acid:toluene=0.25:7.80:82.15 (weight ratio) (the molar ratio of pyridine to dichloroacetic acid was 0.051) (the water content measured according to Measurement Method 4 above was 248 ppm) was used as the deblocking solution, and an acetonitrile solution of 2'-OCEM-U amidite was used as the amidite. The purity of the obtained oligonucleotide was calculated according to Measurement Method 1 above and was found to be 71%. The yield of the obtained oligonucleotide was calculated according to Measurement Method 3 above and was found to be 9.7 mg, which corresponds to 10.3 mg when converted to a yield per 1.00 μmol of the 2'-OTBS-U derivative-carrying solid phase support. The resulting oligonucleotide was enzymatically decomposed according to the enzymatic degradation method, and the enzymatic degradation product was subjected to HPLC measurement according to the measurement method 2 to calculate the values ​​of [c], [e], and [g]. As a result, the value of [c] was 0.059%, the value of [e] was 0.030%, and the value of [g] was 1.49%.

[0121] Example 13 An oligonucleotide of sequence (I) was obtained in the same manner as in Example 1, except that 0.98 μmol of CPG was used as the solid support carrying the 2'-OTBS-U derivative, a deblocking solution of pyridine:dichloroacetic acid:toluene=0.25:7.80:82.15 (weight ratio) (the molar ratio of pyridine to dichloroacetic acid was 0.051), and an acetonitrile solution of 2'-OTOM-U amidite were used as the amidite. The purity of the obtained oligonucleotide was calculated according to the above-mentioned Measurement Method 1 and was found to be 47%. The yield of the obtained oligonucleotide was calculated according to the above-mentioned Measurement Method 3 and was found to be 6.9 mg, which was equivalent to 7.0 mg of yield per 1.00 μmol of the 2'-OTBS-U derivative-carrying solid support. The obtained oligonucleotide was enzymatically hydrolyzed according to the above-mentioned Enzymatic Degradation Method, and the obtained enzymatic degradation product was subjected to HPLC analysis according to the above-mentioned Measurement Method 2, and the values ​​of [c], [e], and [g] were calculated. As a result, the value of [c] was 0.17%, the value of [e] was 0.09%, and the value of [g] was 4%. The results are shown in Table 8.

[0122] Comparative Example 5 An oligonucleotide of sequence (I) was obtained in the same manner as in Example 1, except that 1.03 μmol of CPG was used as the solid support carrying the 2'-OTBS-U derivative, a dichloroacetic acid:toluene ratio of 7.80:82.37 (weight ratio) was used as the deblocking solution, and an acetonitrile solution of 2'-OTOM-U amidite was used as the amidite. The purity of the obtained oligonucleotide was calculated according to the above-mentioned Measurement Method 1 and was found to be 35%. The yield of the obtained oligonucleotide was calculated according to the above-mentioned Measurement Method 3 and was found to be 7.4 mg, which was equivalent to 7.2 mg of yield per solid support carrying 1.00 μmol of the 2'-OTBS-U derivative. The obtained oligonucleotide was enzymatically hydrolyzed according to the above-mentioned Enzymatic Degradation Method, and the obtained enzymatic degradation product was subjected to HPLC analysis according to the above-mentioned Measurement Method 2, and the values ​​of [c], [e], and [g] were calculated. As a result, the value of [c] was 0.41%, the value of [e] was 0.21%, and the value of [g] was 10%. The results are shown in Table 8.

[0123] The results of Example 13 and Comparative Example 5 are shown in Table 8.

[0124]

[0125] Example 14: Using CPG (solid phase support) carrying 1.12 μmol of the 2'-OTBS-U derivative, the oligonucleotide shown in sequence (IV) was synthesized from the 3' to the 5' end using NTS M-4MX-E (manufactured by Nippon Techno Service Co., Ltd.). The synthesis procedure was as follows: first, a deblocking solution (pyridine:dichloroacetic acid:toluene = 0.25:7.80:82.15 (weight ratio)) (the molar ratio of pyridine to dichloroacetic acid was 0.051) (the water content measured according to Measurement Method 4 above was less than 200 ppm) was delivered to the solid phase support; the DMTr group, which is the protecting group for the hydroxyl group at the 5' position of the nucleoside supported on the solid phase support, was removed; and then acetonitrile was delivered. The deblocking reaction was carried out for 1.5 minutes. Next, an acetonitrile solution of 2'-OTBS-A amidite, an acetonitrile solution of 2'-OTBS-C amidite, an acetonitrile solution of 2'-OTBS-G amidite, an acetonitrile solution of 2'-OTBS-U amidite, an acetonitrile solution of 2'-OMe-A amidite, an acetonitrile solution of 2'-OMe-C amidite, or an acetonitrile / toluene solution of 2'-OMe-U amidite, together with an acetonitrile solution of 5-benzylmercapto-1H-tetrazole as an activator, was delivered to the solid support, and a coupling reaction was allowed to proceed at the 5'-position hydroxyl group, followed by delivery of acetonitrile. Subsequently, an oxidation solution containing 50 mM iodine or a thiolation solution containing ADTT, acetonitrile, and water was delivered to the solid support, and the phosphite triester was converted to a phosphate triester or a phosphorothioate triester, followed by delivery of acetonitrile. Next, a capping solution of 0.1 M phenoxyacetic anhydride in acetonitrile and a 10% N-methylimidazole / 10% 2,6-lutidine in acetonitrile were applied to the solid support to cap any hydroxyl groups that had not undergone the coupling reaction, followed by application of acetonitrile. These steps were repeated a total of 102 times, after which the DMTr group on the 5'-terminal hydroxyl group was removed with a deblocking solution (pyridine:dichloroacetic acid:toluene = 0.25:7.80:82.15 (weight ratio)), and the oligonucleotide of sequence (IV) was synthesized on the solid support.A diethylamine solution (diethylamine:acetonitrile = 2:8) was pumped onto the solid support for 10 minutes, followed by pumping acetonitrile. Subsequently, 285 μL of 28% aqueous ammonia, 190 μL of ethanol, and 285 μL of 40% aqueous methylamine were poured into the solid support, and the mixture was incubated at 30°C for 3 hours to liberate the oligonucleotide from the solid support. The solid support was then removed by filtration, and the aqueous ammonia, ethanol, and methylamine were removed by drying under reduced pressure to obtain a dry solid. Furthermore, the dry solid was dissolved in 755 μL of dimethyl sulfoxide to prepare a solution. 0.11 μmol of oligonucleotide was extracted from this solution, and 152 μL of triethylamine trihydrofluoride was added. The mixture was incubated at 40°C for 4 hours to remove the TBS group, which is the protecting group for the hydroxyl group at the 2' position of the oligonucleotide. The above procedure yielded a crude product of the desired oligonucleotide. The purity of the obtained oligonucleotide was calculated according to the above-mentioned measurement method 1 and was found to be 30%. The yield of the obtained oligonucleotide was measured according to the above-mentioned Measurement Method 3 and was found to be 12.9 mg, which was equivalent to 11.5 mg per solid phase carrier carrying 1.00 μmol of 2′-OTBS-U derivative. The results are shown in Table 9.

[0126] Comparative Example 6 An oligonucleotide having sequence (IV) was obtained in the same manner as in Example 16, except that 1.14 μmol of CPG was used as the solid support carrying the 2'-OTBS-U derivative, and a dichloroacetic acid:toluene ratio of 7.80:82.37 (by weight) (water content measured according to Measurement Method 4 above: less than 200 ppm) was used as the deblocking solution. The purity of the obtained oligonucleotide was calculated according to Measurement Method 1 above and was found to be 24%. The yield of the obtained oligonucleotide was calculated according to Measurement Method 3 above and was found to be 12.7 mg, which corresponds to a yield of 11.1 mg per solid support carrying 1.00 μmol of the 2'-OTBS-U derivative. The results are shown in Table 9.

[0127] The results of Example 14 and Comparative Example 6 are shown in Table 9.

[0128]

[0129] Example 15: Using CPG (solid phase support) carrying 1.08 μmol of the 2'-OTBS-U derivative, the oligonucleotide shown in sequence (V) was synthesized from the 3' to the 5' end using an NTS M-4MX-E (manufactured by Nippon Techno Service Co., Ltd.). The synthesis procedure was as follows: first, a deblocking solution (pyridine:dichloroacetic acid:toluene = 0.25:7.80:82.15 (weight ratio)) (the molar ratio of pyridine to dichloroacetic acid was 0.051) (the water content measured according to Measurement Method 4 above was less than 200 ppm) was delivered to the solid phase support; the DMTr group, which is the protecting group for the hydroxyl group at the 5' position of the nucleoside supported on the solid phase support, was removed; and then acetonitrile was delivered. The deblocking reaction was carried out for 1.5 minutes. Next, an acetonitrile solution of 2'-OTBS-A amidite, 2'-OTBS-C amidite, 2'-OTBS-G amidite, 2'-OTBS-U amidite, DNA-A amidite, DNA-C amidite, DNA-G amidite, DNA-T amidite, or 2'-F-U amidite, together with an acetonitrile solution of 5-benzylmercapto-1H-tetrazole as an activator, was delivered to the solid support, and a coupling reaction was allowed to proceed at the 5'-position hydroxyl group. Subsequently, an oxidation solution containing 50 mM iodine was delivered to the solid support, and the phosphite triester was converted to a phosphate triester. Then, acetonitrile was delivered. Next, a 0.1 M phenoxyacetic anhydride acetonitrile solution and a 10% N-methylimidazole / 10% 2,6-lutidine acetonitrile solution were applied to the solid support as capping solutions. Hydroxyl groups that had not undergone the coupling reaction were capped, and then acetonitrile was applied. After repeating these steps a total of 102 times, the DMTr group on the 5'-terminal hydroxyl group was removed with a deblocking solution (pyridine:dichloroacetic acid:toluene = 0.25:7.80:82.15 (weight ratio)), and oligonucleotide (V) was synthesized on the solid support. A diethylamine solution (diethylamine:acetonitrile = 2:8) was applied to the solid support for 10 minutes, and then acetonitrile was applied.Subsequently, 285 μL of 28% aqueous ammonia, 190 μL of ethanol, and 285 μL of 40% aqueous methylamine were poured into the solid support, and the mixture was incubated at 30°C for 3 hours to liberate the oligonucleotide from the solid support. The solid support was then removed by filtration, and the aqueous ammonia, ethanol, and methylamine were removed by drying under reduced pressure to obtain a dry solid. Furthermore, the dry solid was dissolved in 755 μL of dimethyl sulfoxide to prepare a solution. 0.10 μmol of oligonucleotide was sampled from this solution, and 152 μL of triethylamine trihydrofluoride was added. The mixture was incubated at 40°C for 4 hours to remove the TBS group, which is the protecting group for the hydroxyl group at the 2' position of the oligonucleotide. The above procedure yielded a crude product of the desired oligonucleotide. The purity of the resulting oligonucleotide was calculated according to the above-mentioned Measurement Method 1 and was found to be 38%. The yield of the obtained oligonucleotide was measured according to the above-mentioned Measurement Method 3 and was found to be 13.4 mg, which was converted to a yield of 12.4 mg per solid phase carrier carrying 1.00 μmol of 2′-OTBS-U derivative. The results are shown in Table 10.

[0130] Comparative Example 7 An oligonucleotide having sequence (V) was obtained in the same manner as in Example 15, except that 1.08 μmol of CPG was used as the solid support carrying the 2'-OTBS-U derivative, and a dichloroacetic acid:toluene ratio of 7.80:82.37 (by weight) (water content measured according to Measurement Method 4 above: less than 200 ppm) was used as the deblocking solution. The purity of the obtained oligonucleotide was calculated according to Measurement Method 1 above and was found to be 36%. The yield of the obtained oligonucleotide was calculated according to Measurement Method 3 above and was found to be 12.4 mg, which corresponds to a yield of 11.5 mg per solid support carrying 1.00 μmol of the 2'-OTBS-U derivative. The results are shown in Table 10.

[0131] The results of Example 15 and Comparative Example 7 are shown in Table 10.

[0132]

[0133] Example 16 An oligonucleotide having sequence (I) was obtained in the same manner as in Example 1, except that 1.06 μmol of zeolite was used as the solid support carrying the 2'-OTBS-U derivative, and a deblocking solution of pyridine:dichloroacetic acid:toluene=0.25:7.80:82.15 (weight ratio) (the molar ratio of pyridine to dichloroacetic acid was 0.051) (the water content measured according to Measurement Method 4 above was 529 ppm) was used. The resulting oligonucleotide was enzymatically decomposed according to the enzymatic method described above, and the resulting enzymatic decomposition product was subjected to HPLC measurement according to Measurement Method 2 described above, and the values ​​of [c], [e], and [g] were calculated. As a result, the value of [c] was 0.40%, the value of [e] was 0.20%, and the value of [g] was 10%. The results are shown in Table 11.

[0134] Example 17 An oligonucleotide of sequence (I) was obtained in the same manner as in Example 1, except that 1.05 μmol of zeolite was used as the solid support carrying the 2'-OTBS-U derivative, and a deblocking solution of pyridine:dichloroacetic acid:toluene=0.25:7.80:82.15 (weight ratio) (the molar ratio of pyridine to dichloroacetic acid was 0.051) (the water content measured according to Measurement Method 4 above was 1759 ppm) was used. The resulting oligonucleotide was enzymatically hydrolyzed according to the enzymatic method described above, and the resulting enzymatic hydrolyzate was subjected to HPLC analysis according to Measurement Method 2 described above, and the values ​​of [c], [e], and [g] were calculated. The results were as follows: [c] was 0.16%, [e] was 0.08%, and [g] was 4%. The results are shown in Table 11.

[0135] Comparative Example 8 An oligonucleotide of sequence (I) was obtained in the same manner as in Example 1, except that 1.07 μmol of zeolite was used as the solid support carrying the 2'-OTBS-U derivative, and a dichloroacetic acid:toluene ratio of 7.80:82.37 (weight ratio) was used as the deblocking solution (water content measured according to Measurement Method 4 above: 151 ppm). The resulting oligonucleotide was enzymatically decomposed according to the enzymatic method described above, and the resulting enzymatic decomposition product was measured by HPLC according to Measurement Method 2 described above, and the values ​​of [c], [e], and [g] were calculated. As a result, the value of [c] was 1.38%, the value of [e] was 0.71%, and the value of [g] was 35%. The results are shown in Table 11.

[0136] Comparative Example 9 An oligonucleotide of sequence (I) was obtained in the same manner as in Example 1, except that 1.07 μmol of zeolite was used as the solid support carrying the 2'-OTBS-U derivative, and a dichloroacetic acid:toluene ratio of 7.80:82.37 (weight ratio) was used as the deblocking solution (water content measured according to Measurement Method 4 above: 488 ppm). The resulting oligonucleotide was enzymatically decomposed according to the enzymatic method described above, and the resulting enzymatic decomposition product was subjected to HPLC measurement according to Measurement Method 2 described above, and the values ​​of [c], [e], and [g] were calculated. As a result, the value of [c] was 1.33%, the value of [e] was 0.68%, and the value of [g] was 33%. The results are shown in Table 11.

[0137] Comparative Example 10 An oligonucleotide of sequence (I) was obtained in the same manner as in Example 1, except that 1.02 μmol of zeolite was used as the solid support carrying the 2'-OTBS-U derivative, and a dichloroacetic acid:toluene ratio of 7.80:82.37 (weight ratio) was used as the deblocking solution (water content measured according to Measurement Method 4 above was 1255 ppm). The resulting oligonucleotide was enzymatically decomposed according to the enzymatic method described above, and the resulting enzymatic decomposition product was subjected to HPLC measurement according to Measurement Method 2 described above, and the values ​​of [c], [e], and [g] were calculated. As a result, the value of [c] was 1.40%, the value of [e] was 0.72%, and the value of [g] was 35%. The results are shown in Table 11.

[0138] The results of Examples 7, 16 to 17 and Comparative Examples 8 to 10 are shown in Table 11.

[0139]

[0140] The present invention provides an efficient method for producing an oligonucleotide by solid-phase synthesis, and an oligonucleotide in which the content ratio of 2',3' rearrangements in the oligonucleotide is a certain amount or less.

[0141] SEQ ID NOs: 1 to 14 in the sequence listing represent the base sequences of the oligonucleotides produced according to the production method of the present invention.

Claims

1. A method for producing an oligonucleotide by solid-phase synthesis, comprising the step of reacting an oligonucleotide, the hydroxyl group of which at the end of a chain elongation is protected with a protecting group that can be removed under acidic conditions, with a deblocking solution to remove the protecting group for the hydroxyl group at the end of the chain elongation, wherein the deblocking solution contains a base, an acid, and an aprotic solvent, and the base is a base whose conjugate acid has an acid dissociation constant (pKa) of 5 or more and 12 or less.

2. The method according to claim 1, wherein the base is a base whose conjugate acid has an acid dissociation constant (pKa) of 5 or more and 8 or less.

3. The method according to claim 1 or 2, wherein the base is a heterocyclic compound.

4. The method according to claim 1 or 2, wherein the base is at least one base selected from the group consisting of pyridine, 1-methylimidazole, and morpholine.

5. The method according to claim 1 or 2, wherein the base is pyridine.

6. The method according to any one of claims 1 to 5, wherein the acid has a pKa of 0 or more and 5 or less.

7. The method according to any one of claims 1 to 5, wherein the acid is at least one acid selected from dichloroacetic acid and trichloroacetic acid.

8. The method according to any one of claims 1 to 5, wherein the acid is dichloroacetic acid.

9. The production method according to any one of claims 1 to 8, wherein the aprotic solvent is at least one solvent selected from the group consisting of dichloromethane, acetonitrile, and aromatic hydrocarbon solvents.

10. The process of claim 9, wherein the aromatic hydrocarbon solvent is toluene.

11. The process according to any one of claims 1 to 10, wherein the base is pyridine, the acid is dichloroacetic acid, and the aprotic solvent is toluene.

12. The method according to any one of claims 1 to 11, wherein the molar ratio of base to acid is 0.001 or more and 0.9 or less.

13. The method of any one of claims 1 to 12, wherein the oligonucleotide in which the hydroxyl group at the chain extension terminal is protected with a protecting group removable under acidic conditions is an oligonucleotide having a chain length of 2 to 400 mer.

14. An oligonucleotide in which the hydroxyl group at the end of the chain extension is protected with a protecting group that can be removed under acidic conditions is represented by the formula (1): (In the formula, G 1 represents a protecting group that can be removed under acidic conditions from the hydroxyl group at the end of the chain extension; 2 represents a protecting group for a hydroxyl group, a are each independently the same or different and represent a nucleobase which may be protected with a protecting group; R are each independently the same or different and represent a protected hydroxyl group, hydrogen atom, fluorine atom, methoxy group, 2-methoxyethyl group, or OQ' group; Q' are each independently the same or different and represent a methylene group bonded to the 4' carbon atom of ribose, an ethylene group bonded to the 4' carbon atom of ribose, or an ethylidene group bonded to the 4' carbon atom of ribose; Y are each independently the same or different and represent an oxygen atom or a sulfur atom; n represents an integer of 1 to 399; W1 represents an OZ group and X1 represents an R group, or W1 represents an OV group and X1 represents an OZ group; V represents a protecting group for a hydroxyl group; Z is a group having a structure consisting of a solid phase carrier and a linking group, and when n is an integer of 2 or more, a non-nucleotide linker may be incorporated between each nucleotide, and the oligonucleotide from which the protecting group of the hydroxyl group at the chain extension terminal has been removed is represented by formula (2): (In the formula, G 2 , B a , R, Y, n, W1 and X1 are as defined above, and a non-nucleotide linker may be incorporated between each nucleotide as defined in formula (1).

15. The oligonucleotide represented by formula (2) is subjected to a cleavage and deprotection step to obtain the oligonucleotide represented by formula (2'): (Wherein, Y and n are as defined in formula (1), B c are each independently the same or different and represent a nucleic acid base; 4 are each independently the same or different and represent a hydrogen ion, an alkali metal ion, an ammonium ion, an alkylammonium ion, or a hydroxyalkylammonium ion; R' are each independently the same or different and represent a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group; Q' is as defined in formula (1); and X3 and W3 each independently represent a hydroxyl group, or X3 represents an R' group and W3 represents a hydroxyl group; and as defined in formula (1), a non-nucleotide linker may be incorporated between each nucleotide.

16. The protecting group for the hydroxyl group at the end of the chain extension is represented by formula (3): (In the formula, R 1 , R 2 and R 3 and each independently represent a hydrogen atom or an alkoxy group, and may be the same or different.

17. R 1 and R 2 is a methoxy group, and R 3 The method according to claim 16 , wherein is a hydrogen atom.

18. The method of any one of claims 1 to 17, wherein the oligonucleotide is an oligonucleotide containing ribonucleic acid (RNA).

19. The method of any one of claims 1 to 18, wherein the oligonucleotide is an oligonucleotide containing ribonucleic acid (RNA), and the protecting group for the hydroxyl group at the 2'-position of the ribose is a 2'-tert-butyldimethylsilyl (TBS) group.

20. The method of any one of claims 1 to 19, wherein the oligonucleotide obtained has a chain length of 50 mer or more and 400 mer or less.

21. The method according to any one of claims 1 to 20, wherein the solid support used in the solid phase synthesis is an inorganic porous support.

22. The method according to claim 21, wherein the inorganic porous carrier is controlled pore glass (CPG).

23. The manufacturing method according to any one of claims 1 to 22, wherein the deblocking solution has a water content of 300 ppm or more and 3% or less.

24. The method of any one of claims 1 to 23, wherein the method of producing an oligonucleotide is a method of producing an oligonucleotide by the phosphoramidite method.

25. An oligonucleotide produced by solid phase synthesis, having a chain length of 50 mer or more and 400 mer or less, and having a content ratio of 2',3' rearrangements in the oligonucleotide of 20% or less.

26. A deblocking solution containing a base, an acid, and an aprotic solvent, wherein the base is a base whose conjugate acid has an acid dissociation constant (pKa) of 5 or more and 12 or less.

27. Use of a deblocking solution containing a base, an acid, and an aprotic solvent, wherein the base is a base whose conjugate acid has an acid dissociation constant (pKa) of 5 or more and 12 or less, in the synthesis of an oligonucleotide.

Images