Alistipes and use thereof in inflammatory bowel disease treatment
By using pharmaceutical compositions or food products prepared with Alistipes hefeiibiome018 strain, the intestinal flora is regulated, which solves the problems of poor treatment effect and toxic side effects of enteritis, and achieves the effect of effectively relieving enteritis symptoms and improving survival rate.
Patent Information
- Application Number
- PCT/CN2025/093652
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-10
- Filing Date
- 2025-05-09
- Publication Date
- 2025-11-13
AI Technical Summary
Existing treatments for enteritis are either ineffective or have toxic side effects, failing to effectively relieve enteritis symptoms and improve patient survival rates.
Using Alistipes hefei ibiome018 strain, the intestinal flora is regulated and the symptoms of enteritis are improved by preparing a drug composition or food form and administering it to patients.
It significantly alleviates symptoms caused by enteritis, such as weight loss, shortened colon length, release of inflammatory factors, and abnormal crypt and gland structures, improves patient survival rate and reduces disease activity index, and has no toxic side effects.
Smart Images

Figure CN2025093652_13112025_PF_FP_ABST
Abstract
Description
A type of mycobacterium and its use in the treatment of enteritis Technical Field
[0001] This invention relates to the field of microbiology. Specifically, this invention relates to a novel *Alternaria* bacterium, a pharmaceutical composition comprising the *Alternaria* bacterium strain, and the use of the *Alternaria* bacterium strain or pharmaceutical composition in the treatment of enteritis. Background Technology
[0002] *Alistipes* is a genus of Gram-negative, obligate anaerobic bacteria belonging to the phylum Bacteroidetes. These bacteria are commensal in the gut, consisting of straight or slightly curved rod-shaped cells 0.2–0.9 µm in diameter and 0.5–4 µm in length, with rounded ends, and do not form spores. Cells usually occur singly or in pairs, occasionally as longer filaments. Taxonomically, *Alistipes* was described after its discovery in tissue samples from children with appendicitis in 2003. Ecologically, *Alistipes* is predominantly found in the gut of healthy individuals. *Alistipes* is closely associated with many diseases. For example, metagenomic sequences of fresh feces from healthy volunteers and patients with various types of cirrhosis in patients with both compensated and decompensated cirrhosis have shown increased *Alistipes* abundance in healthy controls compared to patients with cirrhosis. Another study showed that Alistipes had a protective effect in comparing the fecal microbiota of patients with decompensated cirrhosis and acute hepatic encephalopathy, and its decreased abundance was associated with an increased recurrence of hepatic encephalopathy. Therefore, a reduction in Alistipes is associated with the progression of cirrhosis to a decompensated state.
[0003] Decreased alistipes abundance has been observed in fibrotic diseases such as nonalcoholic fatty liver disease (NAFLD) and liver fibrosis patients. Alistipes produce acetate and propionic acid, and the concentrations of acetate and propionate in the feces of NAFLD patients with substantial fibrosis are decreased, while butyrate concentration shows no significant difference. This suggests that a decrease in alistipes promotes a reduction in short-chain fatty acids, which may exacerbate advanced fibrosis in these NAFLD patients. In recent years, the role of alistipes in disease has increasingly attracted attention.
[0004] Inflammatory Bowel Disease (IBD) is a chronic inflammatory disease. Traditional treatments for IBD include the use of anti-inflammatory drugs, immunosuppressants, and surgery.
[0005] However, traditional treatments for enteritis are either ineffective or have certain toxic side effects. Therefore, there is an urgent need in this field for technologies that can effectively treat enteritis without producing toxic side effects. Technical solutions
[0006] The purpose of this invention is to provide a probiotic that can effectively treat enteritis without producing toxic side effects.
[0007] Another object of the present invention is to provide a pharmaceutical composition prepared using the probiotics of the present invention, thereby effectively treating probiotics.
[0008] Another object of the present invention is to provide a method for treating enteritis by administering a therapeutically effective amount of the probiotic or pharmaceutical composition of the present invention to a subject in need of the treatment.
[0009] In a first aspect, the present invention provides a strain of the genus *Alistipes* having a 16S rRNA sequence that is at least 98.38%, 98.65%, 99%, 99.5%, 99.9%, or 100% identical to the sequence shown in SEQ ID NO: 1.
[0010] In a specific implementation, the strain is *Alistipes hefei*.
[0011] In a specific embodiment, the strain is Alistipes hefeiibiome018, which was deposited on March 27, 2024, at the China Center for Type Culture Collection (China Center for Type Culture Collection of Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province) with accession number CCTCC NO: M 2024571.
[0012] In a second aspect, the present invention provides a pharmaceutical composition comprising a strain of the genus *Alistipes* described in the first aspect, or an extract, culture, or processed product of said strain, and a pharmaceutically acceptable excipient.
[0013] In a preferred embodiment, the pharmaceutical composition is a capsule containing the strain or its extract, culture, or processed form; more preferably, microcapsules.
[0014] In a third aspect, the present invention provides a food, a fermentation agent, a functional microbial agent, or a nutritional composition comprising a strain of the genus Alistipes described in the first aspect, or an extract, culture, or processed product of said strain.
[0015] In a preferred embodiment, the food includes the strain, or extracts, cultures, or processed products of the strain, as well as auxiliary substances that enable the food function, and may be presented in forms including but not limited to "dietary supplements" or "fermented foods".
[0016] In a preferred embodiment, the dietary supplement comprises an extract, culture, or processed product of the strain, further processed with the addition of nutrients such as cellulose, vitamins, and minerals.
[0017] In a preferred embodiment, the fermented food includes dairy products, soy products, or fruit and vegetable products, etc.
[0018] In a preferred embodiment, the dairy product is milk, sour cream, or cheese, etc.
[0019] In a preferred embodiment, the soy product is soy milk, fermented black beans, or soy sauce, etc.
[0020] In a preferred embodiment, the fruit and vegetable products are cucumber, carrot, beet, celery, or cabbage products, etc.
[0021] In a preferred embodiment, the fermentation agent or functional microbial agent includes a bacterial liquid prepared from the strain, or a powder or granule obtained by further processing the bacterial liquid.
[0022] In a preferred embodiment, the fermentation agent may also contain one or more non-antagonistic microbial agents.
[0023] In a preferred embodiment, the non-antagonistic microbial agents are prepared by selecting one or more of Kristensenella, Parabacterium, Akkermansia myxophilus, and Bacteroides polymorpha to obtain a compound microbial agent.
[0024] In a preferred embodiment, the effective microbial concentration or viable count in the fermenting agent or functional microbial agent is 10. 6 -10 14 CFU.
[0025] In a preferred embodiment, the fermenting agent or functional microbial agent can be used as a functional food or nutritional product.
[0026] In a preferred embodiment, the nutritional composition includes the strain, or an extract, culture, or processed product of the strain.
[0027] In a preferred embodiment, the nutritional composition is a nutritional product, supplement, probiotic, or symbiotic.
[0028] In a fourth aspect, the present invention provides the use of strains of the genus Alistipes or extracts, cultures or processed products of said strains or pharmaceutical compositions comprising said strains or extracts, cultures or processed products of said strains in the preparation of medicaments for the prevention or treatment of enteritis.
[0029] In a preferred embodiment, the strain is the strain described in the first aspect, and the pharmaceutical composition is the pharmaceutical composition described in the second aspect.
[0030] In a preferred embodiment, the pharmaceutical composition or drug can achieve one or more of the following effects: 1) improving weight loss caused by enteritis; 2) improving colonic shortening caused by enteritis; 3) improving crypt and glandular structural abnormalities caused by enteritis; 4) improving morphological changes of epithelial abnormalities caused by enteritis; 5) improving morphological changes of inflammatory infiltration caused by enteritis; 6) reducing the release of inflammatory factors (IL1β, IL6 and TNF-α); 7) improving the survival rate of patients with enteritis; and 8) reducing the disease activity index.
[0031] In specific implementations, the enteritis includes, but is not limited to, Crohn's disease and ulcerative colitis.
[0032] In a fifth aspect, the present invention provides strains of the genus Alistipes or extracts, cultures or processed products of said strains or pharmaceutical compositions comprising said strains or extracts, cultures or processed products of said strains for the prevention or treatment of enteritis.
[0033] In a specific embodiment, the strain is the strain described in the first aspect, and the pharmaceutical composition is the pharmaceutical composition described in the second aspect.
[0034] In specific implementations, the enteritis includes, but is not limited to, Crohn's disease and ulcerative colitis.
[0035] In a preferred embodiment, the strain or its extract, culture, or processed form, or pharmaceutical composition, can achieve one or more of the following effects: 1) improving weight loss caused by enteritis; 2) improving colonic shortening caused by enteritis; 3) improving crypt and glandular structural abnormalities caused by enteritis; 4) improving morphological changes of epithelial abnormalities caused by enteritis; 5) improving morphological changes of inflammatory infiltration caused by enteritis; 6) reducing the release of inflammatory factors (IL1β, IL6, and TNF-α); 7) improving the survival rate of patients with enteritis; and 8) reducing the disease activity index.
[0036] In a seventh aspect, the present invention provides a method for preventing or treating enteritis, the method comprising administering to a subject in need a therapeutically or preventively effective amount of a strain of Alistipes or an extract, culture or processed product of said strain or a pharmaceutical composition comprising said strain or an extract, culture or processed product of said strain.
[0037] In a preferred embodiment, the strain is the strain described in the first aspect, and the pharmaceutical composition is the pharmaceutical composition described in the second aspect.
[0038] In a preferred embodiment, the enteritis includes, but is not limited to, Crohn's disease and ulcerative colitis.
[0039] In a preferred embodiment, the object is a mammal; preferably a human.
[0040] In a preferred embodiment, the prevention or treatment of enteritis can achieve one or more of the following effects: 1) improving weight loss caused by enteritis; 2) improving colonic shortening caused by enteritis; 3) improving crypt and glandular structural abnormalities caused by enteritis; 4) improving morphological changes of epithelial abnormalities caused by enteritis; 5) improving morphological changes of inflammatory infiltration caused by enteritis; 6) reducing the release of inflammatory factors (IL1β, IL6 and TNF-α); 7) improving the survival rate of patients with enteritis; and 8) reducing the disease activity index.
[0041] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Beneficial effects
[0042] 1. This invention is the first to discover a new strain of Alistipes hefei ibiome018;
[0043] 2. The mycobacterium strain of the present invention significantly alleviates symptoms such as weight loss, shortened colon length, release of inflammatory factors, abnormal crypt and gland structure, abnormal morphological changes of epithelium, and morphological changes of inflammatory infiltration in patients with enteritis, thereby improving patient survival rate and reducing disease activity index.
[0044] 3. The *Mycobacterium* strain of the present invention does not have toxic side effects in relieving or treating enteritis;
[0045] 4. The *Mycobacterium* strain of the present invention can replace probiotics in other products for the treatment of enteritis;
[0046] 5. The Mycobacterium strain of the present invention can be used to prepare pharmaceutical compositions for relieving enteritis and fermented foods, etc., and has a very wide range of application prospects.
[0047] Biological Preservation Instructions
[0048] Alistipes hefei ibiome018, deposited on March 27, 2024, at the China Center for Type Culture Collection, Wuhan University, Bayi Road, Wuchang District, Wuhan, Hubei Province, China, accession number CCTCC NO: M 2024571. Attached Figure Description
[0049] Figure 1 shows a smear micrograph (40X) of the *Otherbacterium* of the present invention;
[0050] Figure 2 shows the colony morphology of the *Otherbacterium* of the present invention on a solid culture medium;
[0051] Figures 3 to 6 show the results of the sodium chloride, temperature, pH and bile salt tolerance experiments of the *Otherbacterium* of the present invention, respectively.
[0052] Figure 7 shows the improvement of body weight loss in mice with TNBS-induced enteritis by the *Alternariae* strain of the present invention; ** indicates P < 0.01;
[0053] Figure 8 shows the effect of the *Alternariae* strain of the present invention on colon length in mice with enteritis.
[0054] Figure 9 is a statistical graph showing the effect of the new strain of *Bacillus cereus* on the colon length of mice with enteritis. ** indicates P < 0.01.
[0055] Figure 10 is a statistical graph showing the effect of the new strain of *Bacillus cereus* on the expression of the inflammatory factor IL1β in mice with enteritis. *** indicates P < 0.001.
[0056] Figure 11 is a statistical graph showing the effect of the new strain of *Bacillus cereus* on the expression of the inflammatory factor IL6 in mice with enteritis. *** indicates P < 0.001.
[0057] Figure 12 is a statistical graph of the expression of the inflammatory factor TNF-α in mice with enteritis by the *Bacillus cereus* of the present invention. *** indicates P < 0.001.
[0058] Figure 13 is a statistical graph showing the effect of the new strain of *Bacillus cereus* on the survival rate of mice with enteritis. * indicates P < 0.05.
[0059] Figure 14 is a statistical chart of the disease activity index score of the *Bacillus cereus* of the present invention on mice with enteritis, ** indicates P < 0.01;
[0060] Figure 15 shows HE staining of the colonic segment of mice with enteritis by the *Alternariae* strain of the present invention;
[0061] Figure 16 shows the effect of the *Cephalomycin* strain of the present invention on TNF. △ARE Improvement in mouse body weight loss; ** indicates P < 0.01;
[0062] Figure 17 shows the effect of the *Cephalomycin* strain of the present invention on TNF. △ARE Effect of colon length on mice;
[0063] Figure 18 shows the effect of the *Cephalomycin* strain of the present invention on TNF. △ARE Statistical graph showing the effect of colon length on mice, ** indicates P < 0.01. Embodiments of the present invention
[0064] In the prior art, there are differing understandings regarding different species within the genus *Alistipes*. The effects of different species of *Alistipes* on organisms, especially humans, also vary significantly. For example, according to CN114601870A, *Alistipes* in the gut needs to be suppressed to regulate the gut microbiota; according to CN115364125A, *Alistipes* is a potential biomarker for colorectal cancer; in CN109745336A, *Alistipes*, as a harmful bacterium, needs to be downregulated; while in CN113197311A, *Alistipes* is considered a harmful genus in the characteristic gut microbiota of colitis.
[0065] However, through extensive and in-depth research, the inventors unexpectedly discovered that a new species of *Alternaria* can not only alleviate enteritis but also has no significant toxic side effects, thus serving as a microbial preparation as an alternative to drugs for regulating enteritis. Based on this, the present invention was completed. the term
[0066] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0067] As used herein, “containing,” “having,” or “including” includes “comprising,” “mainly composed of,” “substantially composed of,” and “composed of”; “mainly composed of,” “substantially composed of,” and “composed of” are subordinate concepts of “containing,” “having,” or “including.” Enteritis and its treatment
[0068] The term "enteritis" used in this article has the same meaning as "inflammatory bowel disease (IBD)," referring to a chronic inflammatory disease that primarily affects the gastrointestinal tract. Enteritis includes, but is not limited to, Crohn's disease or ulcerative colitis. The etiology of IBD may be related to infection, genetics, humoral immunity, and cellular immunity, and these factors interact to lead to the development of IBD. Environmental factors such as diet may also influence the pathogenesis of IBD.
[0069] Clinical manifestations of IBD include abdominal pain, diarrhea, abdominal mass, fistula formation, and intestinal obstruction, which may be accompanied by fever, anemia, malnutrition, and extraintestinal damage to joints, skin, eyes, oral mucosa, liver, etc. The disease can recur, is chronic, and difficult to cure completely. Specifically, Crohn's disease is a proliferative lesion that penetrates all layers of the intestinal wall, potentially affecting the mesentery and local lymph nodes. The lesions are confined to the small intestine (mainly the terminal ileum) and colon, and both can be involved simultaneously, often affecting the ileum and right colon. The lesions are segmentally distributed, interspersed with normal intestinal segments, with clear boundaries, exhibiting a skip region characteristic. Pathological changes are divided into the acute inflammatory phase, ulceration phase, stenosis phase, and fistula formation phase (perforation phase). The most common symptom in mild cases is diarrhea; other symptoms include abdominal cramps, bloody stools, fecal obstruction, fever, decreased body fluids, and loss of appetite. Severe cases may even lead to intestinal obstruction, intestinal perforation, and other acute and critical conditions. Traditional treatments for enteritis include the use of anti-inflammatory drugs, immunosuppressants, and surgery.
[0070] In recent years, probiotics have gained increasing attention in the treatment of enteritis. Probiotics are believed to alleviate enteritis symptoms and improve gut health by regulating the balance of gut microbiota, inhibiting pathogens, and improving the gut immune system and microecological balance. Using probiotics can effectively relieve enteritis symptoms such as abdominal pain, diarrhea, nausea, and vomiting. Simultaneously, probiotics can improve intestinal inflammatory responses, regulate the gut immune system, and reduce recurrence. Common types of probiotics include lactic acid bacteria, bifidobacteria, and lactobacillus acidophilus. Other probiotics have also been studied and applied in the treatment of enteritis. For example, Streptococcus thermophilus, Lactobacillus plantarum, and Lactobacillus brevis have also been found to have certain therapeutic effects on enteritis.
[0071] Among the currently published literature, patents, or patent applications, ZL202110237827.4 discloses a Lactobacillus acidophilus JYLA-191 that can maintain the relief of experimental colitis, help restore normal and healthy weight, inhibit or kill pathogenic bacteria, and rebuild the intestinal microecological environment.
[0072] Patent ZL202110242478.5 discloses *Lactobacillus casei* L. Casei21, which can alleviate diarrhea in patients with ulcerative colitis (UC). The patent details state that products made from *Lactobacillus casei* L. Casei21, after ingestion, allow the bacteria to enter the intestines through the digestive tract, inhibiting pathogenic bacteria, colonizing the intestines, maintaining a balanced gut microbiota, improving diarrhea symptoms, and reducing the risk of recurrence. Patent ZL202110227019.X also discloses *Bifidobacterium longum* JBLC-141, which can scavenge excess free radicals in the body and prevent damage to intestinal cells caused by free radicals.
[0073] In summary, probiotics have broad application prospects in the treatment of enteritis. These patents or patent applications all share the common feature of relieving enteritis, but their effectiveness is limited and they have certain toxic side effects. The strains of the present invention
[0074] To address the shortcomings of existing technologies, this application provides a strain of the genus *Alistipes*. This strain exhibits a strong effect in relieving enteritis and also helps alleviate weight loss. Unlike other drugs that relieve enteritis, no toxic side effects have been found in this *Alistipes* strain. Therefore, the *Alistipes* strain of this invention can be used as a microbial preparation to regulate enteritis as an alternative to medication.
[0075] In a specific embodiment, the present invention provides a strain of the genus *Alistipes*, the strain having a 16S rRNA sequence that is at least 98.38%, 98.65%, 99%, 99.5%, 99.9%, or 100% identical to the sequence shown in SEQ ID NO: 1.
[0076] In a preferred embodiment, the strain is *Alistipes hefei*; more preferably, *Alistipes hefei* ibiome018, which was deposited on March 27, 2024, at the China Center for Type Culture Collection (CCCCC NO: M 2024571, Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province). Pharmaceutical compositions or food
[0077] Based on the Alistipes strains provided in this invention, those skilled in the art will understand that the strains or their active extracts, cultures, or processed products can be prepared into pharmaceutical compositions for the prevention or treatment of enteritis.
[0078] In a specific embodiment, the pharmaceutical composition comprises a strain of the genus *Alistipes* or an extract, culture, or processed product of the strain, and a pharmaceutically acceptable excipient.
[0079] In this specification, the term "extract" refers to one or more specific components isolated and extracted from bacteria. These components may include proteins, enzymes, metabolites, DNA, RNA, etc., and are used for various research and applications, such as drug development and biochemical research. The extraction process may involve steps such as cell disruption, centrifugation, filtration, and purification to obtain the desired high-purity component.
[0080] In this specification, the term "culture" refers to a population of *Alistipes* suspended in a culture medium under conditions suitable for the survival and / or growth of *Alistipes*. As will be readily apparent to those skilled in the art, in some aspects, these terms as used herein refer to a combination comprising a population of *Alistipes* and a culture medium in which the population is suspended. In other aspects, these terms as used herein also refer to the culture supernatant and culture components obtained after culturing the *Alistipes* of the present invention. In the present invention, the culture includes, but is not limited to: bacterial solutions, culture supernatants, or bacterial culture media obtained by inoculating or transplanting *Alistipes* into a culture medium of any form (liquid or solid).
[0081] In this specification, the term "processed product" refers to any product derived from a culture, without particular limitation, and can be obtained through processes such as concentration, gelatinization, spray drying, freeze drying, vacuum drying, drum drying, liquefaction, dilution, and pulverization of the culture. In these processes, well-known methods may be appropriately used.
[0082] In this invention, the microbial strains in the culture or the processed product can be live or dead bacteria.
[0083] In this specification, the term "strain" can refer to a strain obtained directly from a preserved strain, a progeny strain (offspring), or a strain cultured from the original strain (subclone strain).
[0084] Based on the teachings of this invention and common knowledge in the art, those skilled in the art will know how to formulate the pharmaceutical compositions of this invention into dosage forms suitable for various routes of administration. In a preferred embodiment, the pharmaceutical compositions of this invention can be formulated into oral dosage forms, such as capsules. To improve the therapeutic effect of probiotics, a "microencapsulation" technique can be used to encapsulate probiotics or their active extracts in tiny capsules, protecting the probiotics for survival and colonization in the intestine, thereby improving the therapeutic effect of probiotics.
[0085] The pharmaceutical compositions of the present invention may include a preventative or therapeutically effective amount of the strain of the present invention or an extract thereof. The effective amount is sufficient to improve or, in some way, alleviate symptoms associated with enteritis. Such an amount may be administered as a single dose or as part of an effective treatment regimen. The dosage may cure enteritis, but administration is often intended to improve enteritis symptoms, such as significantly alleviating weight loss, shortening of the colon, and release of inflammatory factors in the enteritis patient. The dosage may be determined by the clinician based on the patient's age, health and weight, the type of concurrent treatment, the frequency of treatment, and the desired therapeutic benefit.
[0086] The pharmaceutical formulations of this invention can be administered to any mammal, provided they can obtain the therapeutic effects of the compounds of this invention. Humans are the most important of these mammals.
[0087] The pharmaceutical compositions of the present invention can be manufactured using known methods. The pharmaceutical compositions of the present invention contain pharmaceutically acceptable excipients, such as sugars like lactose or sucrose, mannitol or sorbitol; cellulose preparations or calcium phosphates, such as tricalcium phosphate or calcium hydrogen phosphate; and binders, such as starch pastes, including corn starch, wheat starch, rice starch, potato starch, gelatin, astragalus gum, methylcellulose, hydroxypropyl methylcellulose, sodium carboxymethylcellulose, or polyvinylpyrrolidone. If desired, disintegrants, such as the starches mentioned above, as well as carboxymethyl starch, croscarmellose, agar, or alginate or its salts, such as sodium alginate, may be added. Excipients, particularly flow regulators and lubricants, such as silica, talc, stearates, such as calcium magnesium stearate, stearic acid, or polyethylene glycol, may be added. If desired, a suitable coating that resists gastric juices can be provided to the tablet core. For this purpose, a concentrated sugar solution can be applied. This solution may contain gum arabic, talc, polyvinylpyrrolidone, polyethylene glycol and / or titanium dioxide, lacquer solution, and suitable organic solvents or solvent mixtures. To prepare a gastric juice-resistant coating, a suitable cellulose solution, such as cellulose acetate phthalate or hydroxypropyl methylcellulose phthalate, can be used. Dyes or pigments may be added to the coating of the tablet or tablet core, for example, for identification or to characterize the dosage of the active ingredient.
[0088] In a preferred embodiment, the pharmaceutical composition of the present invention can be formulated into capsules; microcapsules are preferred.
[0089] Based on the strains of the present invention, those skilled in the art can also conceive of using the strains of the present invention or their extracts, cultures or processed products to prepare various foods, fermentation agents, functional microbial agents or nutritional compositions, which also have a relieving effect on enteritis.
[0090] The food includes the aforementioned microbial strains, cultures or processed products of the microbial strains, and auxiliary substances that enable the food to function, and may take forms including but not limited to "dietary supplements" and "fermented foods".
[0091] The dietary supplement comprises a culture or processed product of the aforementioned microbial strain, further processed with added nutrients such as cellulose, vitamins, and minerals.
[0092] The fermented foods include dairy products, soy products, or fruit and vegetable products. The dairy products include milk, sour cream, or cheese. The soy products include soy milk, fermented black beans, or soy sauce. The fruit and vegetable products include products made from cucumbers, carrots, beets, celery, or cabbage.
[0093] The fermentation agent or functional microbial agent includes a bacterial liquid prepared from the aforementioned microbial strains, or a powder or granule obtained through further processing; the fermentation agent may further contain one or more non-antagonistic microbial agents, selected from one or more of *Kristensenium*, *Parabacteroides*, *Ackermania*, *Bacteroides polymorpha*, etc., to prepare a compound microbial agent. In the fermentation agent or functional microbial agent, the effective microbial agent concentration and viable cell count are 10-1. 6 -10 14 CFU (Chemical Fuel Ingredient). Fermentation agents or functional microbial agents can also be used in functional foods and nutritional products.
[0094] The nutritional composition includes the aforementioned microbial strains, or cultures or processed products of the microbial strains. Preferably, the nutritional composition is a nutritional product, supplement, probiotic, or symbiotic.
[0095] The probiotics refer to live microorganisms that, when provided in appropriate amounts, are beneficial to the health of the host organism.
[0096] The symbiotic bacteria refer to foods containing a mixture of prebiotics and probiotics. They typically contain probiotic components that promote growth and / or metabolic activity, as well as, in general, probiotic effects in combination with, but not limited to, the aforementioned microbial strains and fructooligosaccharides or galactooligosaccharides. Methods for preventing or treating enteritis
[0097] Based on the strains or pharmaceutical compositions of the present invention, the present invention provides a method for preventing or treating enteritis (including, but not limited to, Crohn's disease and ulcerative colitis), the method comprising administering a therapeutically or preventively effective amount of the strain of the present invention, or an extract of said strain, or a pharmaceutical composition thereof, to a subject in need. The subject may be any mammal, preferably a human.
[0098] The dosage of medication during treatment can be determined by the clinician based on the patient's age, health and weight, the type of concurrent treatment, the frequency of treatment, and the desired therapeutic benefit.
[0099] Using the above-mentioned drug composition or drug to prevent or treat enteritis can achieve one or more of the following effects: 1) improving weight loss caused by enteritis; 2) improving colonic shortening caused by enteritis; 3) improving crypt and glandular structural abnormalities caused by enteritis; 4) improving epithelial morphological abnormalities caused by enteritis; 5) improving morphological changes of inflammatory infiltration caused by enteritis; 6) reducing the release of inflammatory factors (IL1β, IL6 and TNF-α); 7) improving the survival rate of patients with enteritis; 8) reducing the disease activity index.
[0100] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight. Example 1: Isolation and Identification of Microbial Strains
[0101] 1. Separation
[0102] Alistipes hefeiibiome018 was isolated from a fecal sample of a healthy Han Chinese female volunteer in Hefei, Anhui Province. The volunteer had not used antibiotics in the three months prior to sample collection. Normal saline was aliquoted into sterile 15 ml centrifuge tubes in a biosafety cabinet; 24 hours prior to collection, FAB blood agar plates (Solarbio, catalog number LA4550) and sterile normal saline were transferred to an anaerobic workbench.
[0103] Fecal samples were collected from healthy volunteers and stored in 80% (v / v) sterile glycerol buffer. The fecal samples were then serially diluted to 10⁻¹⁰ in an anaerobic workstation. 0.1 ml of the diluted bacterial solution was spread onto FAB blood agar plates and incubated at 37°C for 72 hours in an anaerobic workstation. Single colonies were then picked and cultured in GAM broth liquid medium.
[0104] 2. Identification
[0105] 2.1 16S rRNA sequencing
[0106] PCR amplification of Alistipes hefeiibiome018 was performed using universal 16S rRNA primers (upstream primer 27F: AGAGTTTG ATCCTGGCTCAG (SEQ ID NO: 2), downstream primer 1492R: GGTTA CCTTGTTACGACTT (SEQ ID NO: 3)).
[0107] Experimental methods:
[0108] PCR system (20 μL): 2 × Taq Master Mix: 10 μL; Primer 1 (27F): 1 μL; Primer 2 (1492R): 1 μL; ddH2O: 7 μL; Bacterial culture: 1 μL.
[0109] PCR reaction program: 95℃ for 10 min; 95℃ for 15 s, 58℃ for 30 s, 72℃ for 40 s, step 2-4 30-35×; 72℃ for 5 min.
[0110] The PCR product of the 16S rRNA gene was sequenced, and the results are shown in SEQ ID NO: 1.
[0111] Comparison revealed that the similarity to the species with the highest sequence similarity was only 98.37%, lower than the generally accepted 98.65% (Kim M, et al. Towards a taxonomic coherence between average nucleotide identity and 16S rRNA gene sequence similarity for species demarcation of prokaryotes. International Journal of Systematic and Evolutionary Microbiology, 2014 Feb;64(Pt 2):346-351. doi: 10.1099 / ijs.0.059774-0.).
[0112] 2.2 Microscopic examination of smears
[0113] The ibiome018 smear was examined under a microscope at 40X, and the microscopic image shown in Figure 1 was obtained. As can be seen from the figure, ibiome018 is Gram-negative, appears as short rods or spheres, and has no spores or flagellar movement.
[0114] 2.3 Single colony photographs
[0115] After anaerobic culture of ibiome018 on FAB medium for 72 hours, a single colony photo was taken. The single colony photo is shown in Figure 2. The colony is white, round, with neat edges and a moist surface.
[0116] 2.4 Catalase test and detection of biochemical reactions in sugar alcohol fermentation
[0117] The ibiome018 cultured in liquid was purified by streaking on FAB solid medium, and single colonies were picked for catalase test and sugar alcohol fermentation biochemical reaction detection.
[0118] Catalase test: Add 2-3 drops of catalase reaction reagent (purchased from Qingdao Haibo Biotechnology, catalog number HB8650) to the ibiome018 colony. The presence of bubbles indicates a positive result. However, the catalase test results of the model bacteria Alistipes finegoldii, Alistipes onderdonkii, Alistipes shahii, Alistipes ihummi, and Alistipes inops reported in the literature (Parker BJ, et al. The GenusAlistipes: Gut Bacteria With Emerging Implications to Inflammation, Cancer, and Mental Health. Front Immunol. 2020 Jun 9;11:906. doi: 10.3389 / fimmu.2020.00906. hereinafter the same) were all negative.
[0119] Biochemical detection of sugar alcohol fermentation: 60 μL of bacterial culture was added to commercially available bacterial biochemical detection ampoules (purchased from Qingdao Haibo Biotechnology, catalog numbers GB007, GB014, GB054, GB055, GB056, GB057, GB060, GB062, GB102-1, GB112, GB177, GB178, GB188, GB195, GB196, GB199, GB200, GB202, GB203, GS001, GB033, GS004). After inoculation, the ampoules were anaerobically cultured at 37℃ for 48 h. The detection results were interpreted according to the kit instructions, as shown in Table 1.
[0120] Table 1. Biochemical identification results of Alistipes hefeiibiome018
[0121] Test Items and Results Mannitol - D-Mannose - Salicylic Acid - D-Maltose - D-Ribose - L-Arabinose - D-Arabinose - D-Sucrose + Lactose - Aesculin + Cellobiose - D-Glucose - Sorbitol - D-Galactose - Gluconate - Amygdalin - Trehalose - D-Fructose - L-Rhamnose + Peptone Water (Tryptophan Broth) + Nitrate Broth - Urease -
[0122] Note: + indicates positive; - indicates negative.
[0123] 3. Sodium chloride, temperature, pH, and bile salt tolerance test
[0124] 3.1 Sodium chloride tolerance test
[0125] A sodium chloride tolerance test was conducted on ibiome018 cultured in liquid at an inoculum size of 10%. At regular intervals, 200 μL of the bacterial culture was collected and the OD value was measured using a microplate reader. 600 The results are shown in Figure 3, indicating that the bacteria can grow in a 1% NaCl concentration.
[0126] 3.2 Temperature tolerance test
[0127] Temperature tolerance experiments were conducted on ibiome018 cultured in liquid at an inoculum size of 10%. At regular intervals, 200 μL of bacterial culture was collected and the OD value was measured using a microplate reader. 600 The results are shown in Figure 4. The bacteria can grow in a temperature range of 30℃-42℃, with the optimal growth temperature being 37℃.
[0128] 3.3 pH tolerance test
[0129] A pH tolerance test was conducted on ibiome018 cultured in liquid at an inoculum size of 10%. At regular intervals, 200 μL of the bacterial culture was collected and the OD value was measured using a microplate reader. 600 The results are shown in Figure 5. The bacteria can grow in the pH range of 7-8, with the optimal growth pH being 7-8.
[0130] 3.4 Bile salt tolerance test
[0131] A bile salt tolerance test was conducted on ibiome018 cultured in liquid at an inoculum size of 10%. At regular intervals, 200 μL of bacterial culture was collected and the OD value was measured using a microplate reader. 600 The results, as shown in Figure 6, indicate that this bacterium can tolerate 0.05% bile salts. In contrast, the model bacteria *Alistipes putredinis* and *Alistipes indistinctus* reported in the literature do not exhibit bile salt tolerance. Example 2: Mycobacterium synoviae alleviates TNBS-induced enteritis and weight loss in mice
[0132] C57BL / 6J (10 weeks old, male) SPF-grade mice were purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd. After one week of acclimatization, the mice were fed standard sterilized feed. The experiment was divided into two groups:
[0133] (1) Control group: 0.2 μL of PBS was administered by gavage;
[0134] (2) Experimental group: 10 gavage 9 CFU ibiome018.
[0135] 1% TNBS solution: Mix acetone and olive oil in a volume ratio of 4:1, then mix 4 volumes of acetone / olive oil with 1 volume of 5% (wt / vol) TNBS solution to obtain 1% (wt / vol) TNBS.
[0136] 2.5% TNBS solution: Mix 1 volume of 5% (wt / vol) TNBS solution with 1 volume of anhydrous ethanol to obtain a 2.5% TNBS solution.
[0137] Before the experiment, the mice were divided into groups. First, 2cm of tissue was shaved off the backs of the mice. 2 The area of fur was measured, and a 1% TNBS solution was applied to the back of the mice. The mice were then weighed. The control group was administered 200 μL of PBS solution by gavage. The experimental group was administered 200 μL of 10 μL of TNBS solution resuspended in PBS by gavage. 9 CFU of *Ibiome018* was administered via gavage every two days. After 7 days, 100 μL of 2.5% TNBS solution was injected into the colon 4 cm from the anus. Body weight was recorded daily for 7 days. The rate of change in mouse body weight is shown in Figure 7. It can be seen that the control group mice began to lose weight from day 1, with the final weight change rate being approximately 90% of the initial value. The experimental group mice showed a final weight change of approximately 110% of the initial value, a significant difference (P < 0.01), indicating that gavage administration of *Ibiome018* can significantly alleviate the weight loss in mice with TNBS-induced enteritis, and the weight loss is no different from that in normal mice. Example 3: Mycobacterium synoviae alleviates TNBS-induced enteritis and shortens colon length in mice
[0138] On day 7, after recording the mice's weight, the cecum-colon junction was removed and photographed to record its length. The colon lengths of the mice are shown in Figures 8 and 9. It can be seen that the colon length of the control group mice was approximately 7 cm, while that of the experimental group mice was approximately 7.6 cm, showing a significant difference (P < 0.01). This indicates that gavage administration of *Alternaria alternata* can significantly alleviate the shortening of colon length in mice with TNBS-induced enteritis. Example 4: Mycobacterium synoviae reduces the relative expression of inflammatory factors in mice with TNBS-induced enteritis.
[0139] (1) Take a 2 cm segment of mouse colon tissue, add 0.5 mL of Trizol, 0.1 mL of chloroform, and beans, and crush. Centrifuge at 10000 × g for 10 min at 4℃. Transfer the aqueous layer to a new tube, add 0.1 mL of isopropanol, and incubate at room temperature for 10 minutes. Centrifuge at 10000 × g for 10 min at 4℃, and discard the supernatant.
[0140] (2) Add 100 μL of 75% ethanol (prepared with DEPC water) to wash, centrifuge and discard the supernatant (12000 rpm, 4℃, 5 min), centrifuge again and remove the remaining liquid.
[0141] (3) After evaporation for 5-10 min, add DEPC water (about 15-150 μL) according to the size of the precipitate;
[0142] (4) Concentration measurement: Take 2 μL for measurement (set as blank control DEPC);
[0143] (5) DNA removal: Total 8 μL - Calculate template addition amount (μL) based on the detected RNA concentration = 500 / RNA concentration (ng / μL). Add water (addition amount = 6 μL - sample addition amount), add 2 μL of 4 x gDNA Eraser, incubate at 42℃ for 2 min, then maintain at 4℃;
[0144] (6) Reverse transcription: Add 2 μL of 5x reverse transcription reagent to a total volume of 10 μL and perform reverse transcription reaction. The program is as follows: 37℃, 15 min, 85℃, 5 s, 4℃.
[0145] (7) Perform qPCR: Calculate the required mix, each system is 6 μL, containing 3 μL of SYBR green, 0.24 μL of F, 0.24 μL of R, and 2.52 μL of template. Perform RT-qPCR reaction.
[0146] Primers for IL1β, IL6 and TNF-α are shown in Table 2.
[0147] Table 2. RT-qPCR primer sequences
[0148] GeneForwardReverseIL1βAGGCAGTATCACTCATTGTGG (SEQ ID NO: 4)ACGAGGCTTTTTTGTTGTTC (SEQ ID NO: 5)IL6CACAGAGGATACCACTCCCAACAGA (SEQ ID NO: 6)ACAATCAGAATTGCCATTGCACAAC (SEQ ID NO: 7)TNF-αGCCTATGTCTCAGCCTCTTCT (SEQ ID NO: 8)TTGTGAGTGTGAGGGTCTGG (SEQ ID NO: 9)
[0149] As shown in Figures 10-12, oral administration of *Alternaria solani* ibiome018 reduced the relative expression levels of inflammatory factors IL1β, IL6, and TNF-α, and the reduction was statistically significant (P < 0.001). Example 5: Mycobacterium synoviae improves survival rate in mice with TNBS-induced enteritis
[0150] The number of mice that died was recorded daily for a total of 7 days. As shown in Figure 13, on day 7, the survival rate of mice in the control group was 50%, while the survival rate of mice in the experimental group that were administered Mycobacterium tumefaciens by gavage was 70%, showing a significant difference in survival rate (P < 0.05). This indicates that administration of Mycobacterium tumefaciens by gavage can significantly improve the reduced survival rate of mice with TNBS-induced enteritis. Example 6: Mycobacterium synoviae reduces the disease activity index in TNBS-induced enteritis mice
[0151] The Disease Activity Index (DAI) assesses and scores three aspects: weight, stool viscosity, and fecal occult blood. The DAI score is the sum of these three indicators.
[0152] Score: Percentage of weight loss; Stool viscosity; Stool occult blood: 0% (normal, negative); 1.1-5% (soft, light blue); 2.5-10% (mucous, blue); 3.1-20% (loose, dark blue); 4. >20% (visible blood in stool).
[0153] As shown in Figure 14, on day 7, gavage administration of *Alternaria alternatae* significantly reduced the disease activity index in mice (P < 0.01), indicating that gavage administration of *Alternaria alternatae* can significantly reduce the increase in disease activity index caused by TNBS-induced enteritis in mice.
[0154] Example 7: Mycobacterium synoviae alleviates TNBS-induced enteritis and abnormal colon morphology in mice
[0155] Colonic segments from two groups of mice were preserved in 4% paraformaldehyde, sectioned in paraffin, cut into 5 μm thick pieces, and stained with H&E. Structural changes in the colon were observed under a microscope. The results are shown in Figure 15. Compared with the PBS group, gavage with *Alternaria alternatae* restored crypt and glandular structures and reduced inflammatory infiltration.
[0156] Example 8: Mycobacterium synoviae alleviates TNF △ARE Mouse (spontaneous enteritis) weight loss
[0157] TNF ΔAREThe mouse model is a mutant mouse model that carries a deletion of an AU-rich element (ARE) at the 3'-UTR of the TNFα gene. This deletion enhances the stability of TNFα mRNA and systematically increases the production of its translational products, resulting in systemic TNFα overexpression, which in turn leads to progressive spontaneous arthritis and inflammatory bowel disease. This model is commonly used in observational studies related to the development and treatment of IBD and similar diseases.
[0158] Select TNF△ ARE Mice (6 weeks old, male) were divided into two groups for the experiment:
[0159] (1) Control group: 0.2 μL of PBS was administered by gavage;
[0160] (2) Experimental group: 10 gavage 9 CFU ibiome018.
[0161] Before the experiment, the mice were divided into groups of 6. The mice were then weighed. The control group was administered 200 μL of PBS solution by gavage. The experimental group was administered 200 μL of PBS resuspended in 10 μL of water by gavage. 9 CFU of *Ibiome018* was administered via gavage every two days. Mouse weight was recorded daily for 30 days. The rate of weight change in mice is shown in Figure 16. It can be seen that both groups of mice began to lose weight from day 1. The final weight change rate of the control group mice was approximately 85% of the initial weight, while the final weight change rate of the experimental group mice was approximately 95% of the initial weight, showing a significant difference (P < 0.01). This indicates that gavage administration of *Ibiome018* can significantly alleviate the weight loss in mice with spontaneous enteritis.
[0162] Example 9: Mycobacterium synoviae alleviates TNF △ARE Shortened colon length in mice
[0163] On day 30, after recording the mice's weight, the cecum-colon junction was removed and photographed to record its length. The colon lengths of the mice are shown in Figures 17 and 18. It can be seen that the colon length of the control group mice was approximately 5 cm, while that of the experimental group mice was approximately 7 cm, showing a significant difference (P < 0.01).
[0164] In conclusion, oral administration of *Alternaria alterniflora* significantly alleviated TNBS-induced enteritis and TNF-α-induced TNF-α-induced enteritis. △ARE In mice, reduced body weight, shortened colon, and release of inflammatory factors improved survival and reduced disease activity index. The *Cephalomycin* strain of this invention is a potential functional strain for treating enteritis.
[0165] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.
Claims
1. A strain of the genus *Alistipes*, said strain having a 16S rRNA sequence that is at least 98.38%, 98.65%, 99%, 99.5%, 99.9%, or 100% identical to the sequence shown in SEQ ID NO:
1.
2. The strain according to claim 1, characterized in that, The strain in question is *Alistipes hefei*.
3. The strain according to claim 1 or 2, characterized in that, The strain is Alistipes hefeiibiome018, which was deposited on March 27, 2024, at the China Center for Type Culture Collection (CCCCC NO: M 2024571, Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province).
4. A pharmaceutical composition comprising a strain of Alistipes according to any one of claims 1-3, or an extract, culture, or processed product of said strain, and a pharmaceutically acceptable excipient.
5. A food, fermentation agent, functional microbial agent, or nutritional composition comprising a strain of Alistipes according to any one of claims 1-3, or an extract, culture, or processed product of said strain.
6. Use of strains of the genus *Alistipes*, or extracts, cultures, or processed products of said strains, or pharmaceutical compositions comprising said strains, or extracts, cultures, or processed products of said strains, in the preparation of a medicament for the prevention or treatment of enteritis.
7. The use as described in claim 6, characterized in that, The enteritis mentioned includes, but is not limited to: Crohn's disease and ulcerative colitis.
8. A strain of Alistipes or an extract, culture or processed product of said strain, or a pharmaceutical composition comprising said strain or an extract, culture or processed product of said strain, for the prevention or treatment of enteritis.
9. The strain or extract, culture, or processed product of the strain or pharmaceutical composition used according to claim 8, characterized in that, The strain is the strain according to any one of claims 1-3, and the pharmaceutical composition is the pharmaceutical composition according to claim 4.
10. The strain or extract, culture, or processed product of the strain or pharmaceutical composition used as described in claim 8 or 9, characterized in that, The enteritis mentioned includes, but is not limited to: Crohn's disease and ulcerative colitis.
Citation Information
Patent Citations
Determination of microorganism operational taxonomic unit and sequence-assisted separation
CN106055924A
Anti-bacterial composition against Th1 cell-inducing bacteria
CN110891583A
Application of Alistipes putredinis bacteria in preparation of medicine for preventing and treating inflammatory bowel disease
CN114569639A
Illesiella shavicola and application thereof in preparation of medicine for preventing and treating inflammatory bowel disease
CN115433700A
Anomycobacterium and application thereof in treating asthma
CN118685294A