White grape extract and uses of same
A white grape extract, obtained through acetone extraction and volatilization, addresses the need for safe and sustainable food preservatives by providing effective antimicrobial and antioxidant properties without flavor impact, suitable for diverse food applications.
Patent Information
- Application Number
- PCT/ES2025/070249
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-07
- Filing Date
- 2025-05-06
- Publication Date
- 2025-11-13
AI Technical Summary
There is a need for effective and safe natural preservatives derived from sustainable sources that do not negatively affect the flavor of food products, as existing synthetic preservatives like sulfites and antioxidants raise health concerns and have regulatory limitations.
A white grape extract is obtained using acetone extraction followed by volatilization, yielding an aqueous extract rich in polyphenols such as gallic acid and procyanidins, which exhibit antimicrobial and antioxidant properties suitable for food preservation.
The white grape extract provides stable and effective preservation without flavor alteration, offering broad-spectrum antimicrobial and antioxidant protection suitable for various food types, including beverages and solid foods.
Abstract
Description
[0001]WHITE GRAPE EXTRACT AND ITS USES Field of the Invention The present invention falls within the field of preservatives, particularly antioxidants and antimicrobials useful in food preservation. Background of the Invention More than 20% of all food produced worldwide is lost due to the action of microorganisms. Spoiled food can become extremely poisonous and harmful to consumers' health. An example of this is botulinum toxin, produced by the bacterium Clostridium botulinum, which is found in improperly sterilized preserves and sausages, as well as other packaged products. Preservatives used as food additives help maintain food in good condition. Among the preservatives are antimicrobials and antioxidants. Antimicrobials inhibit the growth of bacteria, yeasts, or molds, alter the permeability of cell membranes or walls,or directly destroy genetic material. Antioxidant preservatives slow the oxidation of fats by air or inhibit enzymatic processes that continue to occur in food after harvesting, processing, or packaging. Examples of antimicrobials include propionic acid, benzoates, parabens, and nitrites and nitrates. Propionic acid occurs naturally in strawberries, apples, violet leaves, cereals, and cheese, among other sources. This acid is effective against bread molds and the spores of the bacterium Bacillus mesentericus. Benzoates occur naturally in blueberries, among other sources. However, these compounds work best at a low pH, in a range that excludes bacterial growth, and are therefore primarily used as antifungals. Esters of p-hydroxybenzoic acid, also known as parabens,They are similar to benzoic acid but effective at a higher pH. For this reason, many beverages, jams, pickles, salads, cheeses, meats, and margarines contain benzoates or sorbates. Nitrites and nitrates are the food industry's primary chemical defense against the bacterium Clostridium botulinum. However, nitrites react with amino acids to form carcinogenic agents, nitrosamines. Sulfur dioxide is a commonly used preservative. Its related compounds, sulfites, are found in foods, alcoholic beverages (especially wines), and even medications. In addition to its antimicrobial action, sulfur dioxide inhibits spoilage reactions in fruits by blocking both enzymatic reactions (e.g., polyphenol oxidase, responsible for the dark color on the freshly cut surface of an apple) and non-enzymatic reactions between reducing sugars and amino acids. However,Approximately 1% to 2% of people will have an allergic reaction to sulfites, which can include nasal congestion and sneezing, hives or wheezing, and difficulty breathing. People with asthma and / or aspirin allergies are particularly sensitive to sulfites and could even have a severe anaphylactic reaction. Acids such as citric acid, ascorbic acid (vitamin C), and erythorbic acid also inhibit polyphenol oxidase by making the pH too low for the enzyme. On the other hand, there are metal chelating agents such as EDTA that can remove the metal cofactors that many enzymes need. Chelating agents also hinder the function of bacterial and fungal enzymes in plants. Fats and oils in contact with air,Humidity and certain temperatures cause changes over time in the chemical nature and organoleptic characteristics of foods. Lipid peroxidation is a form of food spoilage in general and is due to the oxidative degradation of lipids, also known as rancidity. These oxidative degradation processes are caused by the interaction between free radicals and the lipids present in food. This triggers a chain reaction that leads to the oxidation of fats. This process is accelerated in the presence of light, heat, moisture, other free fatty acids, and certain inorganic catalysts such as iron and copper salts. Fats that have undergone oxidation have an unpleasant taste and odor and appear to be slightly toxic to some people. Oxidative rancidity also destroys fat-soluble vitamins.particularly vitamins A and E (tocopherols). The use of antioxidants in products susceptible to lipid peroxidation allows for the interruption or control of this process. By stabilizing free radicals, antioxidants stop or reduce the lipid peroxidation process. Adding antioxidants to a substrate susceptible to oxidation is an effective procedure for interrupting or significantly reducing the lipid peroxidation process. Other antioxidants that can be added include butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), tert-butylhydroquinone (TBHQ), and propyl gallate (PG). However, legislation regulating food additives has established strict limits on the use of such antioxidants; furthermore, there is debate about their safety, as they appear to be carcinogenic, for example. For this reason,The development of food preservatives with naturally derived active ingredients is a promising approach. The use of antioxidants such as polyphenols (plant secondary metabolites) to improve food preservation and quality is desirable, and consequently, there is a need to identify inexpensive sources of polyphenols that can be applied on an industrial scale. Specifically, grape pomace, the pressed grapes comprising mainly the skin, residual pulp, seeds, and stems, is an important source of natural phytochemicals (WO2014013122A1). These phytochemicals are secondary metabolites that play a crucial role in plant defense mechanisms, including polyphenols. Polyphenols have antioxidant, anti-inflammatory, and antimicrobial properties, making them useful in the cosmetic, food, and pharmaceutical industries. Furthermore,Grape cultivation is one of the most abundant in the world, generating a large amount of waste that must be treated, disposed of, or reused. The documents Tamara Manso et al. (Pharmaceuticals, 2023, vol. 16 (7), 950), and Tamara Manso (“Evaluation of the antibacterial activity against clinical strains of a natural extract rich in polyphenols from Albariño white grape pomace”, Doctoral Thesis, 2023) disclose grape extracts obtained with ethyl lactate. These documents do not disclose the extraction method of the present invention, much less extracts with characteristics like those of the extracts of the present invention. As can be seen, there is a need in the art for other food preservatives, preferably those derived from natural products. An object of the present invention is to provide an effective and safe natural preservative that is stable and does not negatively affect the flavor of food products.Based on natural extracts from abundant and sustainable sources such as those of viticultural origin, with proven food safety. Brief description of the invention The inventors of the present invention have surprisingly discovered that it is possible to easily obtain extracts of white grape pomace using acetone as an extraction solvent which, after volatilization of the acetone, can be used as aqueous extracts that exhibit preservative activity. The inventors have thus developed formulations for food additives comprising white grape extracts. Therefore, a first aspect of the present invention relates to a white grape extract, characterized in that it comprises gallic acid, 2,4,6-trihydrobenzoic acid, caftaric acid, procyanidin B1, procyanidin B2, procyanidin C1, catechin, epigallocatechin gallate, epicatechin, epicatechin gallate, quercetin-3-glucuronide, quercetin-3-rutinoside, quercetin-3-glucoside,kaempferol and quercetin. A second aspect of the present invention relates to a process for obtaining a white grape extract characterized in that it comprises the steps of: a) Providing a mixture comprising white grape pomace and optionally a dispersant; b) Subjecting the mixture to elution with acetone; c) Collecting the white grape extract obtained after elution; and d) Removing the acetone. A third aspect of the present invention relates to a white grape extract characterized in that it is an extract obtainable according to the process of the invention. A fourth aspect of the present invention relates to a food additive characterized in that it comprises the white grape extract of the invention. A fifth aspect of the present invention relates to a food comprising the white grape extract of the invention.or comprising the food additive of the invention. A sixth aspect of the present invention relates to the use of the white grape extract of the invention as a food preservative. Detailed description of the invention White grape extract White grape pomace extracts are rich in polyphenols, exhibiting antimicrobial and antioxidant properties that can be used as preservatives in the food industry. The active ingredient of the invention is therefore a white grape extract. Thus, a first aspect of the present invention relates to a white grape extract, characterized in that it comprises gallic acid, 2,4,6-trihydrobenzoic acid, caftaric acid, procyanidin B1, procyanidin B2, procyanidin C1, catechin, epigallocatechin gallate, epicatechin, epicatechin gallate, quercetin-3-glucuronide, quercetin-3-rutinoside, quercetin-3-glucoside, kaempferol, and quercetin. In one particular embodiment,White grape extract is an extract of white grape pomace. Grape pomace, or grape must, is the main by-product of winemaking: the pressing of grapes comprising mainly the skin, residual pulp, seeds and stems. The extract used in the present invention is obtained by subjecting the pomace (and optionally spent pomace) to an extraction process, which is the process of the invention. In one particular embodiment, the white grape is selected from the group consisting of Albariño, Albillo, Arinto, Chardonnay, Chenin Blanc, Garnacha Blanca, Gewürztraminer, Godello or Gouveio, Loureira, Macabeo (or Viura), Malvasía, Muscat, Müller-Thurgau, Riesling, Roussanne, Palomino, Parellada, Pedro Ximénez, Pinot Blanc, Sauvignon Blanc, Silvaner, Semillon, Tocai, Trebbiano, Treixadura, Verdejo, Viognier, Xarel-lo, or mixtures. In a preferred embodiment, the grape is selected from the group consisting of Albariño, Arinto, Godello or Gouveio, Loureira, Treixadura,or blends. In an even more preferred embodiment, the grape is Albariño. In one particular embodiment, the white grape extract comprises a total polyphenol index of between 7000 and 45000 milligrams of gallic acid equivalents per liter of extract (mgGAE / L), preferably between 10000 and 45000 milligrams of gallic acid equivalents per liter of extract (mgGAE / L). In one particular embodiment, the white grape extract comprises at least one of the following: - a gallic acid concentration of between 8 and 30 mg / L of extract; - a 2,4,6-trihydrobenzoic acid concentration of between 1 and 35 mg / L of extract; - a caftaric acid concentration of between 0.05 and 4.00 mg / L of extract; - a procyanidin B1+B2+C1 concentration of between 90 and 280 mg / L of extract; - a catechin concentration of between 50 and 130 mg / L of extract; - an epigallocatechin gallate concentration of between 0.05 and 1,20 mg / L of extract; - an epicatechin concentration of between 10 and 150 mg / L of extract; - an epicatechin gallate concentration of between 5 and 50 mg / L of extract; - a quercetin-3-glucuronide concentration of between 25 and 65 mg / L of extract; - a quercetin-3-rutinoside concentration of between 1 and 5 mg / L of extract; - a quercetin-3-glucoside concentration of between 25 and 130 mg / L of extract; - a kaempferol concentration of between 0.1 and 2.5 mg / L of extract; and / or a quercetin concentration of between 0.1 and 15.0 mg / L of extract. Unless otherwise indicated, the concentrations of gallic acid, 2,4,6-trihydrobenzoic acid, caftaric acid, procyanidin B1, procyanidin B2, procyanidin C1, catechin, epigallocatechin gallate, epicatechin, epicatechin gallate, quercetin-3-glucuronide, quercetin-3-rutinoside, quercetin-3-glucoside,The kaempferol and quercetin indicated herein are obtained using liquid chromatography coupled to triple quadrupole tandem mass spectrometry (LC-MS / MS_QqQ). In one particular embodiment, the white grape extract comprises a gallic acid concentration of between 8 and 30 mg / L of extract, preferably between 10 and 20 mg / L of extract. In a preferred embodiment thereof, the white grape extract comprises a gallic acid concentration equal to or greater than 11 mg / L, more preferably equal to or greater than 13 mg / L of extract. In another preferred embodiment, compatible with the foregoing, the white grape extract comprises a gallic acid concentration equal to or less than 19 mg / L, more preferably equal to or less than 17 mg / L of extract. In one particular embodiment, the white grape extract comprises a 2,4,6-trihydrobenzoic acid concentration of between 1 and 35 mg / L of extract.preferably between 2 and 30 mg / L of extract. In a preferred embodiment of the foregoing, the white grape extract comprises a 2,4,6-trihydrobenzoic acid concentration equal to or greater than 3, more preferably equal to or greater than 4 mg / L of extract. In another preferred embodiment, compatible with the foregoing, the white grape extract comprises a 2,4,6-trihydrobenzoic acid concentration equal to or less than 10, more preferably equal to or less than 8 mg / L of extract. In a particular embodiment, the white grape extract comprises a caftaric acid concentration of between 0.05 and 4.00 mg / L of extract, preferably between 0.10 and 3.50 mg / L of extract. In a preferred embodiment of the foregoing, the white grape extract comprises a caftaric acid concentration equal to or greater than 0.20, more preferably equal to or greater than 0.40 mg / L of extract. In another preferred embodiment, compatible with the foregoing,The white grape extract comprises a caftaric acid concentration equal to or less than 3.00 mg / L, more preferably equal to or less than 2.00 mg / L of extract. In one particular embodiment, the white grape extract comprises a procyanidin concentration of B1+B2+C1 of between 90 and 280 mg / L of extract, preferably between 100 and 270 mg / L of extract. In a preferred embodiment of the foregoing, the white grape extract comprises a procyanidin concentration of B1+B2+C1 equal to or greater than 105 mg / L, more preferably equal to or greater than 110 mg / L of extract. In another preferred embodiment, compatible with the foregoing, the white grape extract comprises a procyanidin concentration of B1+B2+C1 equal to or less than 230 mg / L, more preferably equal to or less than 200 mg / L of extract. In another particular embodiment, the white grape extract comprises a catechin concentration of between 50 and 130 mg / L of extract,preferably between 50 and 125 mg / L of extract. In a preferred embodiment of the foregoing, the white grape extract comprises a catechin concentration equal to or greater than 55, more preferably equal to or greater than 60 mg / L of extract. In another preferred embodiment, compatible with the foregoing, the white grape extract comprises a catechin concentration equal to or less than 120, more preferably equal to or less than 115 mg / L of extract. In another particular embodiment, the white grape extract comprises an epigallocatechin gallate concentration of between 0.05 and 1.20 mg / L of extract, preferably between 0.05 and 1.00 mg / L of extract. In a preferred embodiment of the foregoing, the white grape extract comprises an epigallocatechin gallate concentration equal to or greater than 0.10, more preferably equal to or greater than 0.20 mg / L of extract. In another preferred embodiment, compatible with the foregoing,The white grape extract comprises an epigallocatechin gallate concentration equal to or less than 0.70 mg / L, more preferably equal to or less than 0.50 mg / L of extract. In another particular embodiment, the white grape extract comprises an epicatechin concentration of between 10 and 150 mg / L of extract, preferably between 10 and 140 mg / L of extract. In a preferred embodiment of the foregoing, the white grape extract comprises an epicatechin concentration equal to or greater than 30 mg / L, more preferably equal to or greater than 60 mg / L of extract. In another preferred embodiment, compatible with the foregoing, the white grape extract comprises an epicatechin concentration equal to or less than 130 mg / L, more preferably equal to or less than 125 mg / L of extract. In another particular embodiment, the white grape extract comprises an epicatechin gallate concentration of between 5 and 50 mg / L of extract.preferably between 5 and 45 mg / L of extract. In a preferred embodiment of the foregoing, the white grape extract comprises an epicatechin gallate concentration equal to or greater than 10, more preferably equal to or greater than 13 mg / L of extract. In another preferred embodiment, compatible with the foregoing, the white grape extract comprises an epicatechin gallate concentration equal to or less than 40, more preferably equal to or less than 35 mg / L of extract. In another particular embodiment, the white grape extract comprises a quercetin-3-glucuronide concentration of between 25 and 65 mg / L of extract, preferably between 28 and 60 mg / L of extract. In a preferred embodiment of the foregoing, the white grape extract comprises a quercetin-3-glucuronide concentration equal to or greater than 30, more preferably equal to or greater than 32 mg / L of extract. In another preferred embodiment, compatible with the foregoing,The white grape extract comprises a quercetin-3-glucuronide concentration of 55 mg / L of extract or less, more preferably 45 mg / L or less. In another particular embodiment, the white grape extract comprises a quercetin-3-rutinoside concentration of between 1 and 5 mg / L of extract, preferably between 2 and 5 mg / L of extract. In a preferred embodiment of the foregoing, the white grape extract comprises a quercetin-3-rutinoside concentration of 3 mg / L of extract or more. In another preferred embodiment, compatible with the foregoing, the white grape extract comprises a quercetin-3-rutinoside concentration of 4 mg / L of extract or less. In another particular embodiment, the white grape extract comprises a quercetin-3-glucoside concentration of between 25 and 130 mg / L of extract, preferably between 30 and 120 mg / L of extract. In a preferred embodiment of the foregoing,The white grape extract comprises a quercetin-3-glucoside concentration of 35 mg / L or higher, more preferably 40 mg / L or higher. In another preferred embodiment, compatible with the foregoing, the white grape extract comprises a quercetin-3-glucoside concentration of 100 mg / L or lower, more preferably 60 mg / L or lower. In another particular embodiment, the white grape extract comprises a kaempferol concentration of between 0.1 and 2.5 mg / L of extract, preferably between 0.2 and 2.0 mg / L of extract. In a preferred embodiment of the foregoing, the white grape extract comprises a kaempferol concentration of 0.3 mg / L or higher, more preferably 0.5 mg / L or higher. In another preferred embodiment, compatible with the foregoing, the white grape extract comprises a kaempferol concentration of 1.5 mg / L or lower, more preferably 1.0 mg / L of extract. In another particular embodiment, the white grape extract comprises a quercetin concentration of between 0.1 and 15.0 mg / L of extract, preferably between 0.3 and 15.0 mg / L of extract. In a preferred embodiment of the foregoing, the white grape extract comprises a quercetin concentration equal to or greater than 0.4 mg / L, more preferably equal to or greater than 0.5 mg / L of extract. In another preferred embodiment, compatible with the foregoing, the white grape extract comprises a quercetin concentration equal to or less than 12 mg / L, more preferably equal to or less than 5 mg / L of extract, and even more preferably equal to or less than 2 mg / L of extract. In a preferred embodiment,The white grape extract comprises: - a procyanidin concentration of between 90 and 280 mg / L of extract; - a catechin concentration of between 50 and 130 mg / L of extract; - an epicatechin concentration of between 10 and 150 mg / L of extract; and - an epicatechin gallate concentration of between 5 and 50 mg / L of extract. In another preferred embodiment, compatible with the above, the white grape extract comprises: - a procyanidin concentration of between 90 and 280 mg / L of extract; - a quercetin-3-glucuronide concentration of between 25 and 65 mg / L of extract; - a quercetin-3-rutinoside concentration of between 1 and 5 mg / L of extract; and a quercetin-3-glucoside concentration of between 25 and 130 mg / L of extract. In a more preferred embodiment,The white grape extract comprises: - a gallic acid concentration of between 8 and 30 mg / L of extract; - a 2,4,6-trihydrobenzoic acid concentration of between 1 and 35 mg / L of extract; - a caftaric acid concentration of between 0.05 and 4.00 mg / L of extract; - a procyanidin B1+B2+C1 concentration of between 90 and 280 mg / L of extract; - a catechin concentration of between 50 and 130 mg / L of extract; - an epigallocatechin gallate concentration of between 0.05 and 1.20 mg / L of extract; - an epicatechin concentration of between 10 and 150 mg / L of extract; - an epicatechin gallate concentration of between 5 and 50 mg / L of extract; - a quercetin-3-glucuronide concentration of between 25 and 65 mg / L of extract; - a concentration of quercetin-3-rutinoside of between 1 and 5 mg / L of extract; - a concentration of quercetin-3-glucoside of between 25 and 130 mg / L of extract; - a concentration of kaempferol of between 0.1 and 2,5 mg / L of extract; and a quercetin concentration of between 0.1 and 15.0 mg / L of extract. In a particular embodiment of the white grape extract of the first aspect of the invention, it is characterized in that it comprises at least one organic acid selected from the group consisting of citric acid, quinic acid, malic acid, azelaic acid, ascorbic acid, maleic acid, and succinic acid. Preferably, the white grape extract comprises citric acid, quinic acid, malic acid, azelaic acid, ascorbic acid, maleic acid, and succinic acid. In one particular embodiment, the white grape extract comprises at least one of the following: - a citric acid concentration of between 13 and 15 mg / L of extract; - a quinic acid concentration of between 0.16 and 0.19 mg / L of extract; - a malic acid concentration of between 110 and 130 mg / L of extract; - an azelaic acid concentration of between 0.20 and 0.22 mg / L of extract; - an ascorbic acid concentration of between 0,835 and 0.840 mg / L of extract; - a maleic acid concentration of between 170 and 190 mg / L of extract; and / or - a succinic acid concentration of between 24.2 and 25 mg / L of extract. Unless otherwise indicated, the concentrations of citric acid, quinic acid, malic acid, azelaic acid, ascorbic acid, maleic acid, and succinic acid indicated herein are obtained using UHPLC-QTOF. In a particular embodiment of the white grape extract of the first aspect of the invention, it is characterized in that it comprises at least one sugar selected from the group consisting of glucose, sucrose, and sorbitol. Preferably, the white grape extract comprises at least glucose and sucrose. In one particular embodiment, the white grape extract comprises at least one of the following: - a glucose concentration of between 1810 and 2000 mg / L of extract; - a sucrose concentration of between 5.5 and 6.0 mg / L of extract; and / or a sorbitol concentration of between 8 and 11 mg / L of extract. Unless otherwise indicated, the glucose, sucrose, and sorbitol concentrations indicated herein are obtained using UHPLC-QTOF. In one particular embodiment, the grape extract of the invention is characterized in that it comprises linoleic acid and / or linolenic acid at a concentration of less than 0.10 mg / L, preferably less than 0.05 mg / L, and even more preferably less than 0.01 mg / L, using the UHPLC-QTOF technique. In another particular embodiment, the grape extract of the invention is characterized in that it does not comprise linoleic acid and / or linolenic acid, preferably not comprising linoleic acid and linolenic acid. In a more preferred embodiment, the grape extract of the invention is characterized in that it does not comprise an essential fatty acid. In the context of this paragraph,The expression “does not include” is to be understood as synonymous with the fact that these acids are not detected using the UHPLC-QTOF technique. In the present invention, the transitional expression “includes” is used as an open-ended expression, the interpretation of which is broader than when the closed-ended expression “consists of” is used. A claim that includes the expression “consists of” is limited solely to the technical elements defined in that claim and may not be interpreted as encompassing any other element. On the other hand, a claim that contains the open-ended expression “includes” must be interpreted in the broadest sense and may (or may not) include other technical elements not explicitly mentioned, in addition to those explicitly defined, which are the essential technical elements of the invention. In a particular embodiment of all aspects described herein, and unless expressly indicated otherwise,The term “comprises” may be replaced by “consists of,” in which case the considerations of the preceding paragraph would apply. In one particular embodiment, the white grape extract is characterized by the absence of anthocyanins. “Anthocyanins” refers to a group of flavonoid polyphenols comprising the group formed by anthocyanins and anthocyanidins, which also includes the oxide combinations of an anthocyanidin with a sugar. They are responsible for the bluish-red color of the skin of red grapes. In another particular embodiment, the white grape extract is characterized by a pH of between 2 and 8 measured in aqueous solution, preferably between 2 and 6, more preferably between 3 and 5, and even more preferably between 4 and 5. The grape extract of the invention has application as a preservative, preferably as a food preservative due to its antimicrobial and antioxidant properties. Thus, in one particular embodiment, the extract is in solution,in suspension, in emulsion, or in solid form, as a powder or a paste (obtainable, for example, by freeze-drying or spray-drying). In one particular embodiment, the extract exhibits an antioxidant activity (mmol TE / L) equal to or greater than 40, preferably equal to or greater than 50. In another particular embodiment, compatible with the foregoing, the extract exhibits an antioxidant activity (mmol TE / L) equal to or less than 100, preferably equal to or less than 95. In a preferred embodiment, the extract exhibits an antioxidant activity (mmol TE / L) between 40 and 100, preferably between 45 and 95, more preferably between 50 and 90, and even more preferably between 55 and 85. In the context of the present invention, “TE” means equivalents of the reagent “Trolox”, and the activity expressed in mmol TE / L is determined using the DPPH reagent following the method described in the literature (Symes, A.; Shavandi, A.; Zhang, H.; Ahmed, IAM; Al-Juhaimi, FY; Bekhit,AEDA Antioxidant Activities and Caffeic Acid Content in New Zealand Asparagus (Asparagus Officinalis) Root Extracts. Antioxidants (Basel, Switzerland) 2018, 7 (4)). In the acetone extraction process, water may be added optionally, but the grape pomace used as the raw material for the extraction already contains residual moisture. Thus, in a preferred embodiment, the grape extract of the invention is an aqueous extract. The organic solvent used in the extraction may evaporate, resulting in a white grape extract comprising water. Those skilled in the art will understand that the organic solvent may evaporate completely or partially. In this context, in a particular embodiment of the foregoing, the extract comprises no more than 20% organic solvent, no more than 10% organic solvent, no more than 5% organic solvent, no more than 1% organic solvent, and preferably no more than 0.5% organic solvent. In a more preferred embodiment, the grape extract of the invention is an extract that does not contain organic solvents. In an even more preferred embodiment, the grape extract of the invention is an extract that contains only water as a solvent. If no water is added during the process, the aqueous extract comprises water derived from the residual moisture of the pomace itself. Method of Obtaining The second aspect of the present invention relates to a method for obtaining a white grape extract characterized in that it comprises the steps of: a) Providing a mixture comprising white grape pomace and optionally a dispersant; b) Eluting the mixture with acetone; c) Collecting the white grape extract obtained after elution; and d) Removing the acetone. The extraction method for obtaining the extract of the invention is carried out according to the method described in WO 2014013122 A1.but using acetone. This adaptation exhibits two main advantages. On the one hand, the extract obtained comprises a different polyphenolic composition, which is very useful as a preservative. On the other hand, the extract obtained can be easily volatilized, resulting in an aqueous extract that can be used directly as a food additive. In the present invention, “dispersant” is a solid material that can optionally be mixed with the pomace. Mixing with a biological sample (such as pomace) allows its disruption and dispersion on its surface, so that the mechanical mixing disturbs the architecture of the sample, breaking the material into smaller pieces and increasing the release of the chemical compounds present inside the plant cells of the sample. In a particular embodiment of step (a), the white grape pomace is provided pre-crushed. In a particular embodiment,Step (a) of the process comprises providing a mixture comprising white grape pomace and a dispersant. Preferably, the dispersant is selected from the group consisting of sand, Florisil, C18, alumina, and silica gel. More preferably, the dispersant is sand, and even more preferably sand of natural origin. In one particular embodiment, the grain size of the dispersant is selected from between 100 µm and 1 mm, preferably from between 250 µm and 320 µm. In another preferred embodiment, from between 0.5 and 0.8 mm. In a particular embodiment, step (a) of the process comprises providing a mixture comprising white grape pomace and a dispersant, wherein the dispersant:pomace ratio (by mass) is between 0.5:1 and 1:10, preferably between 0.5:1 and 1:7, more preferably between 0.5:1 and 1:5, and even more preferably between 0.8:1 and 1:5. In the case of comprising a dispersant, the preparation of the mixture in step (a),The extraction of a mixture comprising white grape residue and a dispersant can be carried out using a mortar (glass, porcelain, agate), a blade disruptor, grinding equipment, a crusher, a rotary drum, or any other device that allows the mixture to be mechanically crushed and homogenized. In one particular embodiment, step (a) takes place within a temperature range of 10°C to 40°C. In another particular embodiment, step (a) takes place at atmospheric pressure. These embodiments allow for the avoidance of the risk of degradation of the compounds to be extracted. In one particular embodiment, the dispersant and the pomace are mixed at a temperature between 10°C and 40°C and / or at a pressure between 0.8 and 1.2 atm. In one particular embodiment, the solvent in step (b) is in a proportion of between 0.2 and 10 volumes of solvent relative to the weight of the mixture comprising white grape pomace and, if present, the dispersant, preferably between 0,2 and 6. In one particular embodiment, step (b) includes keeping the solvent in contact with the mixture for between 1 and 72 hours, preferably between 24 and 72 hours, more preferably between 48 and 72 hours. In another particular embodiment, this step is carried out at a temperature between 10°C and 40°C. In another particular embodiment, the extraction solvent comprising acetone further comprises a solvent selected from the group consisting of water, alkyl alcohols, glycols, or mixtures thereof, preferably solvents having a boiling point not exceeding 80°C. In the present invention, “alkyl alcohol” refers to a substance with a linear or branched hydrocarbon chain containing a hydroxyl group, comprising between 1 and 12 carbon atoms, preferably between 1 and 6 carbon atoms. In one particular embodiment, the alkyl alcohol is selected from methanol, ethanol, isopropanol,and mixtures thereof. In the present invention, “glycols” refers to a substance with a linear or branched hydrocarbon chain containing two or more hydroxyl groups, of between 2 and 12 carbon atoms, preferably of between 2 and 8 carbon atoms, and optionally may contain one or more ether groups. In one particular embodiment, the glycol is selected from 1,2-ethanediol (ethylene glycol), propane-1,2-diol (propylene glycol), butane-1,4-diol (1,4-butylene glycol), butane-1,3-diol, 1,5-pentanediol (pentylene glycol), 2-methyl-2,4-pentanediol (hexylene glycol), 2-(2-ethoxyethoxy)ethanol (diethylene glycol monoethyl ether), 2,2'-dihydroxydipropyl ether (dipropylene glycol), and 1,2-octanediol (caprylyl glycol). In one particular embodiment, the solvent in step (b) may have a modified pH between 0.5 and 3. Thus, in one particular embodiment, the solvent in step (b) further comprises an organic or inorganic acid.preferably an acid selected from the group consisting of hydrochloric acid, acetic acid, phosphoric acid, formic acid, and mixtures thereof. In another particular embodiment, the eluates collected in step (c) are used to repeat the elution of the extract. Recirculating the eluates collected in step (c) allows for a reduction in the total volume of solvent used in the process. While not a necessary feature for the proper functioning of the invention, an additional advantage associated with recirculating the eluates is the potential increase in the amount of total polyphenols extracted from the white grape pomace. Thus, in one particular embodiment, step (c) comprises, in addition to collecting the eluates, recirculating said eluates through the mixture comprising the white grape pomace, repeating the elution with the solvent between 1 and 7 times, preferably 3, 4, or 5 times. In other words, in one particular embodiment,The process of the invention is characterized in that, after collecting the white grape extract, step (c) further comprises the recirculation of the eluate obtained through the mixture of step (a). This embodiment corresponds to the repetition of the method of step (b), but wherein the mixture of step (a) comprises grape pomace previously subjected at least once to elution with a solvent, and using a solvent that has already been used at least once in the elution. This embodiment is repeated in such a way that the solvent is recirculated through the mixture. The combination of the maceration and eluate recirculation steps allows for a more optimized process in terms of the yield of the extract obtained and the low consumption of solvents. The extraction process further comprises a step (d), characterized by being an acetone removal step. This removal can be partial or complete. In this step,The white grape extract obtained after the elution, or elutions, is subjected to concentration, i.e., a process to reduce the amount of acetone. In one particular embodiment, step (d) comprises the removal of acetone to a final amount of no more than 20% acetone, no more than 10% acetone, no more than 5% acetone, preferably no more than 1% acetone, and even more preferably no more than 0.5% acetone. In a preferred embodiment, step (d) is an acetone evaporation step, preferably a complete acetone evaporation step, such that the acetone is completely or essentially completely removed. In the context of the present invention, acetone evaporation is synonymous with acetone volatilization. In a further preferred embodiment, in step (d) the acetone is completely evaporated.thus obtaining an aqueous extract as a product. The process for removing acetone is known to those skilled in the art, for example, simply by leaving the extract at room temperature and atmospheric pressure, under a stream of nitrogen, with added heat, under vacuum, in a vacuum rotary evaporator, in a thin-film evaporator, among others. Extracts can also be obtained as a solid product. Thus, in another particular embodiment, the extraction process further comprises a freeze-drying step or a spray-drying step. This step can be an additional step after step (d), i.e., freeze-drying or spray-drying requires the removal of acetone as a prior step, or it can be step (d) itself, in which case freeze-drying or spray-drying directly removes the acetone. In a preferred embodiment of the above,When the procedure includes a freeze-drying step, this step is carried out after step (d), i.e., freeze-drying requires the removal of acetone as a preliminary step. In freeze-drying, it is possible to pre-freeze the collected eluates or the eluates after solvent evaporation. In one particular embodiment, freeze-drying is carried out between -50 °C and -20 °C, preferably between -45 °C and -35 °C. In one particular embodiment, freeze-drying is carried out between 1.31 × 10, -6 atm and 6.6 × 10 -6 atm (0.001 to 0.005 mmHg), preferably between 1.31 × 10 -6 atm and 1.31 × 10 -5atm (0.001 to 0.01 mmHg). The extract is stable, and the addition of stabilizers is not necessary during the freeze-drying stage. However, small amounts of sugars at a concentration ranging from 1% to 5% or other molecules acting as cryoprotectants and / or freeze-dryers may be added. In one particular embodiment, the sugars are selected from the group consisting of glucose, sucrose, trehalose, maltodextrin, gum arabic, and xanthan gum. The extract of the invention remains unchanged after freeze-drying. In spray drying, the collected eluates, or the eluates after solvent evaporation, are transformed into a dry powder by rapid drying with hot air or an inert gas. This method yields materials with a fine and consistent particle size. In one particular embodiment, spray drying is carried out with an air flow between 15000 and 60000 L / h.In another particular embodiment, spray drying is carried out with a feed flow rate between 1 L / h and 500 L / h, preferably between 1 L / h and 100 L / h, more preferably between 1 L / h and 20 L / h. In another particular embodiment, spray drying is carried out with an air pressure between 2 and 10 bar. In another particular embodiment, spray drying is carried out at a drying temperature between 150 and 200 °C and an inlet temperature between 15 and 35 °C. In one particular embodiment, the removal of acetone comprises recovering the solvent for subsequent reuse in step (b), the extraction step. The process of the invention allows obtaining a white grape pomace extract comprising polyphenols. Thus, a third aspect of the present invention relates to a white grape extract characterized in that it is obtainable according to the process of the invention.“Obtainable extract” or “obtained extract” means the product obtained as a result of applying the process of the invention, with the technical elements inherent to the process. The extract is obtained by using acetone as the extraction solvent. Thus, in one particular embodiment, the white grape extract obtainable according to the process of the invention is an extract comprising acetone. In a preferred embodiment, the acetone is completely evaporated, and the grape extract obtainable according to the process of the invention is an aqueous extract. All the embodiments described above for the process, and also for the extract, are applicable to this third aspect of the invention. Food additive. The process of the invention allows for the easy removal of the extraction solvent, since acetone is a low-boiling-point solvent.Upon evaporation of the acetone, the resulting extract is an aqueous extract, suitable for oral ingestion. Thus, a fourth aspect of the present invention relates to a food additive characterized in that it comprises the white grape extract of the invention. In a preferred embodiment, the food additive is characterized in that it comprises the white grape extract of the invention as a food preservative. In a particular embodiment, the white grape extract present in the food additive is either the white grape extract of the invention or the white grape extract obtained according to the process of the invention. In the context of the present invention, the term “preservative” is to be interpreted as a substance or composition exhibiting antioxidant and / or antimicrobial activity.In the context of the present invention, the term “food preservative” refers to a preservative that is compatible with any type of solid or liquid food, for human and / or animal consumption. The term “food” normally refers to any substance consumed orally to provide nutritional support to a living being. Foods are usually of plant, animal, or fungal origin and contain essential nutrients, such as carbohydrates, fats, proteins, vitamins, or minerals. The substance is ingested by an organism and assimilated by the organism's cells to provide energy, sustain life, or stimulate growth. However, in the present invention, “food” is to be interpreted more broadly to also cover substances that are ingested but do not provide nutritional value. This is because, in addition to nutritional purposes, human nutrition is associated with social, cultural, health, and psychological aspects.For example, alcoholic beverages in the human diet have no nutritional value, but they do provide enjoyment. Therefore, in the context of the present invention, substances that are ingested but do not provide nutritional value must also be considered as food. Thus, in a particular embodiment, food means any substance that is ingested, including generally any food and / or beverage. In a preferred embodiment, the extract of the invention is used as a food additive in wines. As mentioned above, the extract can be provided as an aqueous extract or as a solid. Thus, the food additive of the fourth aspect of the invention, comprising the extract of the invention, can be provided as a liquid or solid food additive. In the context of the present invention, as described above, the aqueous extract may comprise traces of an organic solvent, preferably acetone.In a particular embodiment of the foregoing, the extract comprises no more than 20% organic solvent, no more than 10% organic solvent, no more than 5% organic solvent, no more than 1% organic solvent, and preferably no more than 0.5% organic solvent. Depending on the desired end product, a person skilled in the art will know which form will be most suitable. Non-limiting examples of the form in which the food additive of the invention may be provided include liquid, gel, solid, paste, tablet, powder, among others. Furthermore, it is also contemplated that the food additive may be formulated as a solution, emulsion, suspension, dispersion, or any other form suitable for use as a food additive. The extract of the invention is stable, and it is also stable when formulated as a food additive, for at least 6 months, preferably for at least 12 months.Stable means that the active ingredient (the extract) and the excipients (if present) do not undergo significant degradation and the preservative effect is maintained at least 80% of the effect at the time of preparation of the additive, preferably at least 90% of the effect at the time of preparation of the additive, and more preferably at least 95% of the effect at the time of preparation of the additive. In a particular embodiment, the food additive comprises additional preservatives.Non-limiting examples of preservatives, antimicrobials, and / or antioxidants include benzalkonium chloride, benzethonium chloride, benzoic acid, chlorobutanol, m-cresol, methylparaben (E-218), propylparaben (E-216), butylparaben, nisin, natamycin, BHA, sodium sulfite, sodium bisulfite, other sulfurous acid salts (bisulfite, metabisulfite), vitamin E, BHT, tert-butylhydroquinone (TBHQ), propyl gallate, ascorbic acid, acetylcysteine, ascorbyl palmitate, sodium ascorbate, butylated hydroxytoluene, butylated hydroxyanisole, citric acid, monothioglycerol, methionine, sodium metabisulfite, potassium metabisulfite, cysteine hydrochloride, sodium dithionite, gentisic acid, and sodium glutamate. glutathione, thioglycerol, sodium formaldehyde sulfoxylate, thiourea, alpha tocopherol, and mixtures thereof. A preferred additional preservative is sulfur dioxide, which, when dissolved in water, gives rise to sulfites (comprising SO3). 2-In the context of the present invention, unless otherwise indicated, any reference to sulfur dioxide is to be understood as synonymous with sulfites used as preservatives in the food industry. In a preferred embodiment, the food additive of the invention does not comprise any other additional preservatives. In one particular embodiment, the food additive is for human consumption. In another particular embodiment, the food additive is for animal feed. In yet another particular embodiment, the food additive is characterized in that it is a preservative for wines. The winemaking process requires the addition of preservatives. One example is the use of sulfur dioxide as an antimicrobial agent (to reduce the growth of yeasts and bacteria) and as an antioxidant.In one particular embodiment, the food additive of the invention can be used to replace all or part of the preservatives present in wine, for example, sulfur dioxide. Additional Aspects: A fifth aspect of the present invention relates to a food comprising the white grape extract of the invention, or comprising the food additive of the invention. In a preferred embodiment, this food is wine. Those skilled in the art will know that all prior embodiments are compatible with this fifth aspect of the invention. A sixth aspect of the present invention relates to the use of the white grape extract of the invention as a food preservative. An alternative wording of this aspect is: A method for preserving a food comprising adding the white grape extract of the invention to said food.In one particular embodiment, the use according to the invention is characterized as a preservative in the winemaking process or for preserving bottled wine. In a preferred embodiment, the use according to the invention is characterized as a preservative in the winemaking process, wherein the extract is not in combination with any other preservatives. In another preferred embodiment, the use according to the invention is characterized as a preservative for preserving bottled wine, wherein the extract replaces at least a portion of the sulfites present in the wine. The expression "sulfites present in the wine" should be interpreted as the sulfites that are normally present due to the addition of this preservative during the winemaking process or prior to bottling. In one particular embodiment, the use according to the invention is characterized in that the extract is an antioxidant.In another particular embodiment, the use according to the invention is characterized in that said extract is antimicrobial. In another particular embodiment, the use according to the invention is characterized in that said extract does not comprise synthetic polyphenols. In another particular embodiment, the use according to the invention is characterized in that it replaces at least a portion of the sulfites present in a wine. A person skilled in the art will know that all prior embodiments for the foregoing aspects are also compatible with this aspect of the invention. Experimental Part These examples serve to illustrate embodiments of the invention, but in no case should they be considered limiting. Example 1. Preparation and analysis of the extracts. In this example, an extraction of the white grape residues of the Albariño variety was carried out by means of a larger-scale adaptation of the procedure described in WO2014013122A1.Acetone was used as a solvent, and the resulting liquid extract was subjected to an acetone volatilization process to obtain an aqueous extract. Using sand as a dispersant, it was mixed and ground with Albariño white grape pomace in a 1:5 ratio. This mixture was introduced into a suitably sized stainless steel column with a layer of dispersant at the bottom, which acts as a filter, and was lightly compacted. The amount of acetone used as the extraction solvent was 0.75 volumes relative to the volume of the extract mixture. After 48 hours of maceration, the corresponding eluate was obtained. Subsequently, this eluate was concentrated under vacuum until the residual acetone content was less than 0.5%. Example 2.Analytical characterization Total polyphenol index (TPI) The total polyphenol content of several white grape pomace extracts obtained according to the method described in Example 1 was determined by the Folin-Ciocalteu method following the protocol for microtiteration in 96-well plates adapted from Zhang et al. (Zhang Q, Zhang J, Shen J, Silva A, Dennis DA, Barrow CJ. A simple 96-well microplate method for estimation of total polyphenol content in seaweeds. J Appl Phycol. (2006) 18:445–50). Thus, 20 µL of diluted extract were mixed with 100 µL of the Folin-Ciocalteu reagent (1:10) and 80 µL of a sodium carbonate solution (7.5% w / w). The mixture was stirred in darkness for 30 minutes, and then measured at 760 nm on the SPECTROstar Nano microplate reader (BMG LABTECH, Ortenberg, Germany), which performs absorbance measurements in the 220-1000 nm wavelength range.Measurements were performed in 96-well polypropylene microplates with a volume of 300 µL. Gallic acid was used as a standard to express the total polyphenol index, with a concentration range of 12 levels between 30 and 200 mg / L (0.2–0.8 AU). The total polyphenol content of the samples was expressed as milligrams of gallic acid equivalents per liter of extract (mgGAE / L). The analysis was performed, and the obtained total polyphenol index range was between 7000 and 10000 mgGAE / L for the non-volatilized extracts (12 samples, average of 8699 mgGAE / L), and between 11000 and 43000 mgGAE / L for the volatilized extracts (33 samples, average of 27866 mgGAE / L). Identification of target polyphenols by Liquid Chromatography coupled to tandem mass spectrometry (LC-MS / MS)The volatilized extract was filtered through 0.22 µm PTFE syringe filters into a 2 mL glass vial for the corresponding analyses.The main polyphenols present in the extract of Example 1 were identified by liquid chromatography coupled to triple quadrupole tandem mass spectrometry (LC-MS / MS_QqQ). The optimal instrumental conditions for the detection of the target polyphenols were adapted from Celeiro, M.; Lamas, JP; Arcas, R.; Lores, M. Antioxidants Profiling of By-Products from Eucalyptus Greenboards Manufacture, Antioxidants. 2019, 8(8), 263. The LC-MS / MS analysis was performed using a Thermo Scientific instrument (San Jose, CA, USA) based on a TSQ Quantum UltraTM triple quadrupole mass spectrometer equipped with a HESI-II (heated electrospray ionization) source and an Accela Open autosampler with a 20 μL loop. Chromatographic separation was achieved on a Kinetex C18 column (2.6 μm, 100 × 2.1 mm) with a pre-column (SecurityGuardTM ULTRA Holder) obtained from Phenomenex (Torrance, CA, USA).The injection volume was 10 μL and the column temperature was set at 50 °C. The mobile phase consisted of water (A) and methanol (B), both containing 0.1% formic acid. The chromatographic gradient was from 5% B to 90% B in 11 min and was held constant for 3 min. Initial conditions were reached in 6 min. The mobile phase flow rate was 200 μL / min. -1The total run time for each injection was 20 min. The mass spectrometer and the HESI-II source operated simultaneously in positive and negative modes (see the ionization mode for each target compound in Table 1). Selected Reaction Monitoring (SRM) acquisition mode was implemented, monitoring 2 or 3 transitions per compound (see Table 1) for unambiguous identification of the target compounds. The system was managed using the Xcalibur 2.2 and Trace Finder™ 3.2 software programs. Table 1. Compounds studied by chromatography. Ionization mode, CAS number, retention time, and MS / MS transitions. Time Transitions MS / MS Ionization Compound CAS Retention (collision energy, (min) eV) -Gallic acid 149-91-7 2.25169.02 → 125.04 (17) 169.02 → 153.1 (15) 168.98 → 150.99 (17) +2-4-6-Trihydrobenzoic acid 487-70-7 3.23168.98 → 83.02 (23) 168.98 → 107.02 (22) -Caftaric acid 67879-58-7 4.21310.96→ 178.97 (17) 310.96 → 148.96 (14) 577.03 → 407.06 (26) -Procyanidin B1 20315-25-7 4.76577.03 → 288.93 (25) 577.03 → 424.97 (26) +Catechin 225937-10-0 5.02289.00 → 245.02 (17) 289.00 → 203.11 (22) 577.03 → 407.06 (26) -Procyanidin B2 29106-49-8 5.50577.03 → 288.93 (25) 577.03 → 424.97 (26) 457.15 → 169.05 (21) +Epigallocatechin gallate 989-51-5 6.00457.15 → 125.09 (42) 457.15 → 305.09 (21) 577.03 → 288.93 (25) -Procyanidin C1 37064-30-5 6.01577.03 → 407.06 (26) 577.03 → 424.97 (26) Epicatechin 490-46-0 6.11289.00 → 245.02 (17) 289.00 → 203.11 (22) 441.13 → 289.13 (30) +Epicatechin gallate 1257-08-5 7.13441.13 → 125.08 (42) 441.13 → 169.05 (24) +Quercetin-3-glucuronide 22688-79-5 9.21479.09 → 461.50 (14) 479.09 → 302.96 (18) 609.18 → 270.92 (96) -Quercetin-3-rutinoside 207671-50-9 9.39609.18 → 178.87 (44) 609.18 → 300.01 (37) +Quercetin-3-glucoside 482-35-9 9.41465.07 → 256.90 (41) 465.07 → 302.97 (14) -Kaempferol 520-18-3 12.27285.07 → 184.91 (30) 285.07 → 239.12 (35) The main polyphenols present in the extracts were determined by liquid chromatography coupled to triple quadrupole tandem mass spectrometry (LC-MS / MS_QqQ) using the method described above. The results are shown in Table 2. Table 2. Ranges of polyphenols present in white grape extracts obtained after extraction of 12 samples with acetone. Values expressed in ppm (mg / L). Polyphenols Acetone extract Gallic acid 8-30 2,4-6-trihydrobenzoic acid 1-30 Caftaric acid 0.1-4 Procyanidins B1+B2+C1 100-280 Catechin 60-130 Epigallocatechin gallate 0.1-1.2 Epicatechin 10-150 Epicatechin gallate 15-50 Quercetin-3-glucuronide 30-65 Quercetin-3-rutinoside 2-5 Quercetin-3-glucoside 30-120 Kaempferol 0.1-2.5 Quercetin 0.1-15 Example 3.Antioxidant Activity Methodology The antioxidant activity (AA) of white grape pomace extracts obtained according to Example 1, as well as their average inhibitory concentration IC50 (amount of extract needed to neutralize half of the free radicals present), were determined using the DPPH reagent following the method described in the literature (Symes, A.; Shavandi, A.; Zhang, H.; Ahmed, IAM; Al-Juhaimi, FY; Bekhit, AEDA Antioxidant Activities and Caffeic Acid Content in New Zealand Asparagus (Asparagus Officinalis) Roots Extracts. Antioxidants (Basel, Switzerland) 2018, 7 (4)). Briefly, the volatilized extract from Example 1 was filtered (0.22 µm PTFE filter) and sequentially diluted with ultrapure water (MiliQ®) in a microwell plate. This serial dilution procedure generates dilutions between 40 and 5120. Likewise, for the preparation of the standard trolox curve, trolox concentration points between 3 and 31 mg / L were prepared.In the DPPH blank determination, 100 μL of ultrapure water were added to an 8-well column. Subsequently, 100 μL of DPPH reagent at a concentration of 140 mg / L in methanol was added to each well (sample, standard, and blank). The plate was shaken and incubated in the dark for 10 minutes, after which its absorbance was measured at 515 nm using a microplate spectrophotometer. Results: The antioxidant activity obtained for an average of 23 extracts was 67 mmol TE⋅L. -1 , for a range of values between 49 and 95 mmolTE⋅L -1 For comparison, the common antioxidants BHA, bisulfite, vitamin E, and BHT exhibit this same antioxidant activity at concentrations (in mg / L) of 9.8, 17.5, 27.6, and 257.5, respectively. The mean inhibitory concentration (IC50) of the samples was also measured and referred to the total polyphenolic content (mg GAE⋅L). -1) present in the extract. The IC50 obtained for the extract of Example 1 was 7.75 mg / L (value referring to the polyphenolic content, therefore it is expressed in mgGAE⋅L -1For comparison, the antioxidants BHA, bisulfite, Vitamin E, and BHT exhibit IC50 values at concentrations (in mg / L) of 13, 28, 41, and 345, respectively. The data indicate that the aqueous extract of the invention neutralizes 50% of DPPH free radicals with a polyphenol concentration of 7.75 mgGAE / L. For bisulfite, the IC50 is obtained at a concentration of 28 mg / L. Considering the overall content of the extract, a concentration of 480 mg / L of extract is required for 50% inhibition of free radicals. The density of the extract is very close to that of water (1 g / mL), so approximately 0.48 mL of the extract of the invention is added to one liter of water to achieve the IC50. Example 4.Antimicrobial Activity: The objective of this assay was to evaluate the in vitro antimicrobial activity of the polyphenol-rich grape pomace extract of the invention described in Example 1 against four groups of microorganisms present in the winemaking process, to compare it with the antimicrobial capacity of sodium bisulfite, and to evaluate the synergy between this extract and the bisulfite concentration typically used by the winery, in order to reduce or eliminate the amount of this chemical in the winemaking process. Methodology: The antimicrobial tests were performed according to EUCAST recommendations, using the Alamar-Blue colorimetric / fluorometric method and reading the plates by fluorometry. The methodology involves incubating the cells in Müller-Hinton broth supplemented with different concentrations (ranging from 0.625% to 20%) of the antimicrobial substance to be evaluated and the appropriate amount of resazurin.This non-fluorescent molecule is converted into the fluorescent molecule resorufin in the presence of metabolically active cells. This reaction allows for the quantification of the number of live cells by measuring the fluorescence released by the resorufin produced during the process. This protocol provides Minimum Bactericidal Concentrations (MBC) values, so the Minimum Inhibitory Concentration (MIC) is calculated as the average between the MBC and the immediately preceding concentration tested. IC50 values (the extract concentration that inhibits the growth of half of an inoculum of the tested bacteria) were obtained using the IC50 calculator program (AAT Bioquest).The three groups of microorganisms used were: - Saccharomyces cerevisiae, the strain used to initiate fermentation; - Non-Saccharomyces yeasts: Lachancea thermotolerans, Metschnikowia pulcherrima, and Debaromyces hansenii; and - Lactic acid bacteria: Lactiplantibacillus plantarum ATCC 14917 and Lacticaseibacillus rhamnosus CECT 275. For comparative purposes, the antimicrobial activity of sodium bisulfite was also tested as a reference for the food additive that is intended to be replaced or supplemented. In addition, the antimicrobial activity of the extract of the invention, combined with 50 ppm of sulfite, was also evaluated. The values were compared with the MIC values of the extract alone (*M. pulcherrima required concentrations of 250 ppm of sulfite combined with the extract to achieve the MIC). Results The antimicrobial activity of the extract of the invention compared with that of sodium bisulfite is summarized in Table 3.This table also describes the antimicrobial activity of a formulation comprising the extract of the invention in combination with sodium bisulfite. Table 3. Antimicrobial activity (values expressed in ppm) of the extract of the invention, sodium bisulfite, and their combination against different microorganisms. IC50 is the concentration of extract responsible for 50% bacterial inhibition. MIC (minimum inhibitory concentration) is the lowest concentration of extract that inhibits bacterial growth after incubation.Sodium bisulfite Extract of the invention (E) + Sodium bisulfite (S) IC50 MIC IC50 MIC MIC Saccharomyces cerevisiae 817.51 > 2000 < 6250 ≤ 6250 12500 (E) + 50 (S) Lachancea thermotolerans 360.52 ≤ 2000 < 6250 ≤ 6250 6250 (E) + 50 (S) Metschnikowia pulcherrima 412.09 ≤ 2000 40800 ≤ 50000 50000 (E) + 250 (S) Debaromyces hansenii 635.28 > 2000 < 6250 ≤ 6250 12500 (E) + 50 (S)Lactiplantibacillus plantarum564.33 ≤ 2000 11600 ≤ 12500 6250 (E) + 50 (S)Lacticaseibacillus rhamnosus525.62 ≤ 2000 < 6250 ≤ 6250 6250 (E) + 50 (S)The yeast M. pulcherrima does not respond well to treatment with the extract or with bisulfite, but this data is favorable since its activity is desirable in the winemaking process.Although the quantities of extract needed to control bacterial and yeast populations during winemaking are higher than those of sulfite, the right-hand column shows that using the extract of the invention allows for a significant reduction in the amount of sodium bisulfite (or even its elimination, as shown in Table 3). These results demonstrate that the extract of the invention allows for a reduction in the negative effects associated with the use of bisulfites, such as their health effects, as an additive in winemaking. Example 5. Winemaking from Tempranillo grapes. The objective of this trial was to evaluate the ability of the extract of the invention to replace sulfites as a preservative in the winemaking process of a wine obtained using Tempranillo grapes. After weekly ripening checks, Tempranillo grapes were harvested with a potential yield of 11.24%.The grapes were harvested in crates at the Valdegón Estate (Agoncillo, La Rioja), owned by the Government of La Rioja, and transported to the ICVV Experimental Winery (Logroño, La Rioja). Once at the winery, each crate was unloaded and weighed, yielding a total weight of approximately 300 kg of Tempranillo grapes. The grapes were destemmed and crushed, and then distributed into nine 30 L tanks to carry out each of the three trials in triplicate. Once the must was homogenized, the yeast Saccharomyces cerevisiae, SafŒno™ SC-22, was inoculated directly onto the must at the manufacturer's recommended dose of 20 g / hL. One hour later, the additives to be tested—SO2 and the liquid extract (LE)—were added according to the invention.Three trials were conducted, all in triplicate: - Control (adding 50 mg / L of SO2) - Liquid extract (LE) (adding 1.7 mL / L) - SO2 + LE (adding 25 mg / L of SO2 + 0.85 mL / L of LE). The tanks were left to ferment in the cellar at a constant temperature of approximately 21-22 °C. Daily fermentation monitoring was performed to track alcoholic fermentation, recording the density and temperature of each tank. After seven days, with a glucose + fructose concentration of less than 2.5 g / L, the wines were pressed. The following day, the glucose + fructose content was analyzed again, and once the wines were dry, alcoholic fermentation was considered complete. The wines were then transferred to nine 12 L tanks for malolactic fermentation, inoculated with the bacterium Oenococcus oeni, Viniflora CH11, at a dose of 1 g / hL. The tanks were placed in a chamber at a temperature of 20 ºC.Fermentation was monitored weekly, and malic and lactic acid levels in the wines were analyzed. Two weeks later, the wines completed malolactic fermentation (malic acid concentration < 0.25 g / L), and samples were taken for general wine parameter analysis. Samples were taken at five different time points during the winemaking process for each wine: at the beginning after must inoculation (T0), after 24 hours of fermentation (T1), after one week of fermentation (T2), at the start of malolactic fermentation (T3), and at the end of malolactic fermentation (T4). Genomic DNA from the samples was obtained using the EZNA® Stool DNA Kit, following the manufacturer's instructions (final elution volume 100 µL). The volume processed per sample was 1 mL. In the determination by groups of microorganisms, the pairs AAB (for acetobacteria), SC (for S.cerevisiae), Lac (for Lactobacillus) and WLAB (for lactic acid bacteria, mainly Oenococcus oeni). Table 4. Sequences and PCR conditions used (annealing at 60 °C). Name Sequence Cycle AAB-F TGAGAGGATGATCAGCCACACT AAB-R TCACACACGCGGCATTGSC1 GAAAACTCCACAGTGTGTTG 95°C 5s, SC2 GCTTAAGTGCGCGGTCTTG 60°C 15s, Lac1 AGCAGTAGGGAATCTTCCA 72°C 50s, Lac2 ATTTCACCGCTACACATG 40 cycles WLAB1 TCCGGATTTATTGGGCGTAAAGCGA WLAB2 TCGAATTAAACCACATGCTCCA Ct values were obtained using the Sansure SLAN-96P RT qPCR instrument and its associated software. The qPCR mold used was 1 µL of a 1 / 3 dilution of the extracts in a final reaction volume of 15 µL and the Forget-Me-Not-EvaGreen qPCR (Low ROX) master mix. The remaining conditions were adjusted according to the master mix manufacturer's specifications.The study of the relative concentration of microorganisms in the wine samples using the techniques described above revealed no significant differences between the treatments for S. cerevisiae, Lactobacillus, and lactic acid bacteria (mainly the species Oenococcus oeni). Finally, from the start of malolactic fermentation (T3), no acetobacteria were detected in any of the three treatments. The physicochemical characterization of the wines consisted of the analysis of alcoholic strength (% v / v), pH, total acidity (g / L), volatile acidity (g / L), and free and total SO2, according to the official methods of the OIV (2003). The Miura One enzymatic autoanalyzer (Tecnología Difusión Ibérica (TDI), Barcelona) was used to determine acetic acid, malic acid, lactic acid, and nitrogen fractions (ammoniacal, amine, and readily assimilable nitrogen (FAN)).The study of the oenological parameters of the wines at the end of malolactic fermentation also revealed that the use of the extract of the invention did not affect the properties of the wine in the vinification process, as can be seen from the values expressed in the table below: Table 5. Physicochemical characterization of the wines. C. ontrol EL SO2+ELAlcohol content (% v / v) 11.87 ± 0.50 12.12 ± 0.53 11.90 ± 0.17 pH 4.18 ± 0.06 4.16 ± 0.04 4.16 ± 0.03 Total acidity (g / L)* 4.21 ± 0.03 4.31 ± 0.07 4.23 ± 0.30 Volatile acidity (g / L)** 0.48 ± 0.05 0.52 ± 0.02 0.50 ± 0.02 Acetic acid (g / L) 0.29 ± 0.03 0.33 ± 0.02 0.29 ± 0.01 Malic acid (g / L) 0.04 ± 0.01 0.03 ± 0.02 0.05 ± 0.02Lactic acid (g / L) 1.66 ± 0.12 1.70 ± 0.02 1.78 ± 0.03Ammoniacal nitrogen (mg N / L) 31.46 ± 1.19 34.06 ± 1.62 32.76 ± 2.06Amino nitrogen (mg N / L) 37.84 ± 4.40 33.44 ± 0.88 36.08 ± 4.03NFA (mg N / L) 69.30 ± 3.24 67.50 ± 2.48 68.84 ± 5.91*Expressed as g / L of tartaric acid. **Expressed as g / L of acetic acid. NFA: Easily assimilable nitrogen. Values are expressed as the average of three repetitions and their standard deviation (n = 3). These conclusions are also applicable to the study of the colorimetric parameters of wines at the end of malolactic fermentation, as can be seen from the values expressed in the table below.Regarding color parameters, total phenols and anthocyanins were also quantified using the TDI Miura One autoanalyzer. The total polyphenol index (TPI) was determined by diluting the sample 1:100 and measuring the absorbance at 280 nm with a spectrophotometer (Cary 60, Agilent, Palo Alto, CA, USA). Signals were recorded at wavelengths of 420 nm (yellow), 520 nm (red), and 620 nm (blue) using the same spectrophotometer, and their sum yielded the color intensity (CI). Finally, a special program was used to measure the CIELab coordinates on the spectrophotometer (Cary 60). CIELab and CIECh are color spaces defined by the International Commission on Illumination (CIE) to communicate and express color objectively.In the L*a*b* color space, also referred to as CIELAB, L* indicates lightness, a* indicates red / green coordinates (+a indicates red, -a indicates green), and b* indicates yellow / blue coordinates (+b indicates yellow, -b indicates blue). In the L*C*h color space, L* indicates lightness, C* represents chroma or saturation, and h* is the hue angle. Table 6. Color parameters, phenols, and total anthocyanins quantified by TDI's Miura One. C. ontrol EL SO2+ELTotal phenols (mg / L) 2553.23 ± 150.06 2598.83 ± 326.08 2552.30 ± 191.65 Total anthocyanins (mg / L) 534.67 ± 50.72 478.33 ± 32.62 525.67 ± 38.00 IPT 49.99 ± 3.78 47.19 ± 1.39 49.13 ± 2.94 A 420 nm 0.25 ± 0.01a 0.30 ± 0.01ab 0.32 ± 0.05b% Yellow color 35.28 ± 0.63a 37.41 ± 0.41ab 38.36 ± 2.18bA 520 nm 0.36 ± 0.02 0.39 ± 0.02 0.40 ± 0.02% Red color 50.79 ± 0.47b 48.72 ± 0.59ab 48.06 ± 1.84aA 620 nm 0.10 ± 0.01 0.11 ± 0.01 0.11 ± 0.01% Blue color 13.93 ± 0.66 13.87 ± 0.25 13.58 ± 0.46IC 0.71 ± 0.05a 0.80 ± 0.04ab 0.84 ± 0.08bCIELab L17.48 ± 2.27 14.93 ± 0.93 14.34 ± 1.12a 47.85 ± 2.23b 45.01 ± 0.74ab 44.61 ± 1.09ab 24.52 ± 2.25 23.83 ± 1.16 22.97 ± 1.67C 53.77 ± 3.00 50.93 ± 1.20 50.18 ± 1.73h 27.09 ± 1.08 27.89 ± 0.77 27.21 ± 1.14Red hueRed hueRed hueViolet violet violet IPT: Polyphenol Index totals; IC: color intensity. Values are expressed as the average of three repetitions and their standard deviation (n = 3).For each parameter, different lowercase letters (“a”, or “b”) indicate significant differences between samples (p ≤0.05), while “ab” means that there are no significant differences between that sample and the others. Example 5. Bottled Wine The objective of this trial was to evaluate the ability of the extract of the invention to replace sulfites as a preservative in bottled wine, obtained from Tempranillo wine grapes. After the malolactic fermentation of the previous example was completed, half the concentration of the previously added additives (SO2 and EL) was added to the wines prepared as described in that previous example before they were placed in the cold chamber (10 ºC) for the stabilization stage.One month after the end of malolactic fermentation, seven bottles from each treatment and replicate were bottled and placed in the bottle rack of the ICVV Experimental Winery at 16°C and 50-60% humidity. A complete analysis of the wines was performed seven weeks after bottling, analyzing all the physicochemical parameters previously described in the characterization of the wines after malolactic fermentation. The bottles will remain in the ICVV winery's bottle rack for six to twelve months under the previously described controlled conditions until the final physicochemical and sensory analyses are carried out.Three trials were carried out, all in triplicate: -Control (adding 50 mg / L SO2 to the initial must, followed by 25 mg / L SO2 after malolactic fermentation) -Liquid extract (LI) (adding 1.7 mL / L to the initial must, followed by 850 µL / L after malolactic fermentation) -SO2+LI (adding 25 mg / L of SO2 + 850 µL / L of LI to the initial must, followed by 12.5 mg / L SO2 + 0.425 mL / L SO2 after malolactic fermentation) For each of them, samples were taken after 7 weeks in the bottle (2 bottles per treatment and repeat). The study of the oenological parameters of the wines at the end of 7 weeks in the bottle revealed that the use of the extract of the invention allows the need to use the preservative SO2 to be reduced by half, as can be seen from the values expressed in the table below: Table 7. Physicochemical characterization of the wines at the end of 7 weeks in the bottle. C. ontrol EL SO2+ELAlcoholic strength (% v / v) 4.30 ± 0.05b 4.22 ± 0.04a 4.25 ± 0.03abpH 4.47 ± 0.11a 5.41 ± 0.86b 4.34 ± 0.13aTotal acidity (g / L)* 0.57 ± 0.05a 2.04 ± 1.10b 0.55 ± 0.02aVolatile acidity (g / L)** 0.27 ± 0.04a 0.77 ± 0.23b 0.29 ± 0.02aAcetic acid (g / L) 1.75 ± 0.10b 1.43 ± 0.21a 1.81 ± 0.07bMalic acid (g / L) 27.30 ± 12.97 34.19 ± 15.81 32.24 ± 14.89Lactic acid (g / L) 91.96 ± 23.78 79.93 ± 14.99 88.88 ± 17.85Ammoniacal nitrogen (mg N / L) 119.26 ± 24.60 114.12 ± 21.54 121.12 ± 22.20Amino nitrogen (mg N / L) 4.30 ± 0.05b 4.22 ± 0.04a 4.25 ± 0.03abNFA (mg N / L) 4.47 ± 0.11a 5.41 ± 0.86b 4.34 ± 0.13a*Expressed as g / L of tartaric acid. **Expressed as g / L of acetic acid. NFA: Easily assimilable nitrogen. Values are expressed as the average of three replicates and two bottles per replicate and their standard deviation (n = 6).For each parameter, different lowercase letters (“a”, or “b”) indicate significant differences between samples (p ≤ 0.05), while “ab” means that there are no significant differences between that sample and the others. These conclusions are also applicable to the study of the colorimetric parameters of the wines at the end of 7 weeks in the bottle, as can be seen from the values shown in the table below. Table 8. Color parameters, phenols, and total anthocyanins quantified by TDI's Miura One of the wines at the end of 7 weeks in the bottle. C. ontrol EL SO2+ELTotal phenols (mg / L) 2552.00 ± 369.31 2519.40 ± 67.94 2751.78 ± 273.68 Total anthocyanins (mg / L) 481.50 ± 41.97b 401.67 ± 23.15a 463.83 ± 26.54bIPT 47.46 ± 3.29 44.45 ± 1.33 45.90 ± 2.71A 420 nm 0.23 ± 0.01a 0.30 ± 0.01b 0.29 ± 0.02b% Yellow color 36.33 ± 0.25a 37.14 ± 0.49b 37.00 ± 0.32bA 520 nm 0.32 ± 0.02a 0.39 ± 0.02b 0.37 ± 0.02b% Color red 49.22 ± 0.31b 48.06 ± 0.59a 48.24 ± 0.41aA 620 nm 0.09 ± 0.01a 0.12 ± 0.00b 0.11 ± 0.01b% Blue color 14.45 ± 0.43 14.80 ± 0.15 14.76 ± 0.25IC 0.64 ± 0.04a 0.81 ± 0.04b 0.77 ± 0.05bCIELab L18.82 ± 2.01b 13.17 ± 0.69a 14.25 ± 1.47aa 48.01 ± 1.58b 42.75 ± 0.37a 43.83 ± 1.38ab 24.68 ± 1.09b 21.13 ± 0.79a 21.97 ± 1.63aC 53.99 ± 1.86b 47.69 ± 0.67a 49.03 ± 1.96ah 27.20 ± 0.48 26.30 ± 0.68 26.58 ± 1.00Global Red Hue Hue red Reddish-purple hue IPT: total polyphenol index; IC: color intensity.Values are expressed as the average of three replicates and two bottles per replicate, and their standard deviation (n = 6). For each parameter, different lowercase letters (“a”, or “b”) indicate significant differences between samples (p ≤ 0.05). Example 8. Further characterization of the extracts according to the invention and of comparative extracts, by non-targeted analysis (UHPLC-QTOF). The model profile analysis of the volatilized acetone extract (AC) obtained according to the invention was performed by UHPLC-QTOF (Ultra-High Performance Liquid Chromatography coupled with Quadrupole Time-of-Flight Mass Spectrometry), which has enabled the precise characterization of the compounds present in the extracts, allowing detailed information to be obtained on their chemical profile, including the determination of molecular structures, exact masses, and possible fragmentations.The same analysis was performed for comparative extracts obtained with ethyl lactate / water and ethanol / water. Table 9. Compositional profile obtained by targeted UHPLC-QTOF analysis of the extracts acetone (AC), Ethyl Lactate:water (EL:W), Ethanol:water 50:50 (ET50V) and Evaporated Ethanol (ET100V). Values expressed in ppm (mg / L). Ethyl lactate extract EtOH / water Organic acids Citric acid 14.0 25.34 11.27 Quinic acid 0.17 0.09 0.11 Malic acid 122 92 81 Ascorbic acid 0.837 0.922 0.855 Maleic acid 180 141 130 Succinic acid 24.6 16.2 23.0 Azelaic acid 0.212 - 0.059 Sugars Glucose 1818 1301 1798 Sucrose 5.88 7.98 3.63 Sorbitol 10 4.1 3.7 Essential fatty acids Linoleic acid - 6.39 0.49 Linolenic acid - 3.09 -.
Claims
CLAIMS 1. White grape extract, characterized in that it comprises gallic acid, 2,4,6-trihydrobenzoic acid, caftaric acid, procyanidin B1, procyanidin B2, procyanidin C1, catechin, epigallocatechin gallate, epicatechin, epicatechin gallate, quercetin-3-glucuronide, quercetin-3-rutinoside, quercetin-3-glucoside, kaempferol and quercetin.
2. Extract according to claim 1, characterized in that it comprises: - a gallic acid concentration of between 8 and 30 mg / L of extract; - a 2,4,6-trihydrobenzoic acid concentration of between 1 and 35 mg / L of extract; - a caftaric acid concentration of between 0.05 and 4.00 mg / L of extract; - a procyanidin B1+B2+C1 concentration of between 90 and 280 mg / L of extract; - a catechin concentration of between 50 and 130 mg / L of extract; - an epigallocatechin gallate concentration of between 0.05 and 1.20 mg / L of extract; - an epicatechin concentration of between 10 and 150 mg / L of extract;- an epicatechin gallate concentration of between 5 and 50 mg / L of extract; - a quercetin-3-glucuronide concentration of between 25 and 65 mg / L of extract; - a quercetin-3-rutinoside concentration of between 1 and 5 mg / L of extract; - a quercetin-3-glucoside concentration of between 25 and 130 mg / L of extract; - a kaempferol concentration of between 0.1 and 2.5 mg / L of extract;and / or - a quercetin concentration of between 0.1 and 15.0 mg / L of extract.
3. Extract according to any of claims 1 or 2, characterized in that it comprises: - a concentration of procyanidins B1+B2+C1 of between 90 and 280 mg / L of extract.
4. Extract according to any of claims 1 to 3, characterized in that it comprises: - a concentration of quercetin-3-glucuronide of between 25 and 65 mg / L of extract.
5. Extract according to any of claims 1 to 4, characterized in that it comprises: - a concentration of quercetin-3-rutinoside of between 1 and 5 mg / L of extract.
6. Extract according to any of claims 1 to 5, characterized in that it comprises: - a concentration of quercetin-3-glucoside of between 25 and 130 mg / L of extract.
7. Extract according to any of claims 1 to 6, characterized in that it comprises: - a concentration of procyanidins B1+B2+C1 of between 90 and 280 mg / L of extract;- a concentration of quercetin-3-glucuronide of between 25 and 65 mg / L of extract; - a concentration of quercetin-3-rutinoside of between 1 and 5 mg / L of extract; and - a concentration of quercetin-3-glucoside of between 25 and 130 mg / L of extract.
8. Extract according to claim 7, characterized in that it comprises: - a concentration of procyanidins B1+B2+C1 of between 90 and 280 mg / L of extract; - a concentration of catechin of between 50 and 130 mg / L of extract; - a concentration of epicatechin of between 10 and 150 mg / L of extract; and - a concentration of epicatechin gallate of between 5 and 50 mg / L of extract.
9. Extract according to any one of claims 1 to 8, characterized in that it comprises: - a gallic acid concentration of between 8 and 30 mg / L of extract; - a 2,4,6-trihydrobenzoic acid concentration of between 1 and 35 mg / L of extract; - a caftaric acid concentration of between 0.05 and 4.00 mg / L of extract; - a procyanidin B1+B2+C1 concentration of between 90 and 280 mg / L of extract; - a catechin concentration of between 50 and 130 mg / L of extract; - an epigallocatechin gallate concentration of between 0.05 and 1,20 mg / L of extract; -an epicatechin concentration of between 10 and 150 mg / L of extract;- an epicatechin gallate concentration of between 5 and 50 mg / L of extract;- a quercetin-3-glucuronide concentration of between 25 and 65 mg / L of extract;- a quercetin-3-rutinoside concentration of between 1 and 5 mg / L of extract;- a quercetin-3-glucoside concentration of between 25 and 130 mg / L of extract;- a kaempferol concentration of between 0.1 and 2.5 mg / L of extract; and- a quercetin concentration of between 0.1 and 15.0 mg / L of extract.
10. Extract according to any of claims 1 to 9, characterized in that it is an aqueous extract.
11. Extract according to any one of claims 1 to 10, characterized in that it is an aqueous extract comprising no more than 20% of organic solvents, preferably no more than 5%, even more preferably no more than 1%.
12. Extract according to any one of claims 1 to 11,characterized in that it exhibits an antioxidant activity (mmol TE / L) equal to or greater than 40.
13. Extract according to any of claims 1 to 12, characterized in that it comprises at least one of the following: - a malic acid concentration of between 100 and 210 mg / L of extract; and / or - a maleic acid concentration of between 150 and 240 mg / L of extract.
14. Process for obtaining a white grape extract as defined in any of claims 1 to 13, characterized in that it comprises the steps of: a) Providing a mixture comprising white grape pomace and optionally a dispersant; b) Subjecting the mixture to an elution with acetone; c) Collecting the white grape extract obtained after the elution; and d) Removing the acetone.
15. Process according to claim 14, characterized in that a dispersant is used in step (a).
16. Method according to any one of claims 14 to 15,characterized in that in step (a) a dispersant selected from the group consisting of sand, Florisil, C18, alumina and silica gel is used.
17. Process according to claims 14 to 16, characterized in that in step (b) water is also used.
18. Process according to any one of claims 14 to 17, characterized in that, after collecting the white grape extract, step (c) further comprises recirculating the eluate obtained from the mixture of step (a).
19. Process according to any one of claims 14 to 18, characterized in that step (d) comprises an evaporation, freeze-drying and / or spray-drying step.
20. Process according to any one of claims 14 to 19, characterized in that step (d) comprises removing acetone to a final amount of not more than 20% acetone, preferably not more than 1% acetone.
21. Method according to any one of claims 14 to 20,characterized in that step (d) comprises an acetone evaporation step, followed by a freeze-drying and / or spray-drying step, thereby producing the solid extract.
22. White grape extract characterized in that it is an extract obtainable according to any one of claims 14 to 21.
23. Food additive characterized in that it comprises the white grape extract defined in any one of claims 1 to 13, or defined in claim 22.
24. Food additive according to claim 23, characterized in that it is a food preservative.
25. Food additive according to any one of claims 23 to 24, characterized in that it is a preservative for wines.
26. A food additive according to any one of claims 23 to 25, characterized in that it also comprises an additional preservative.
27. A food additive according to claim 26, characterized in that said additional preservative is a sulfite.
28. A food comprising the white grape extract defined in any one of claims 1 to 13, or 22, or comprising the food additive according to any one of claims 23 to 27.
29. A food according to claim 28, characterized in that it is a wine.
30. A use of the white grape extract defined in any one of claims 1 to 13, or 22, characterized in that it is a use as a food preservative.
31. A use according to claim 30, characterized in that it is a use as a preservative in a winemaking process, or for preserving a wine in a bottle.
32. A use according to any one of claims 30 or 31, characterized in that said extract is an antioxidant. 33.Use according to any of claims 30 or 31, characterized in that said extract is antimicrobial.
34. Use according to any of claims 30 to 33, characterized in that said extract does not comprise synthetic polyphenols.
35. Use according to any of claims 30 to 34, characterized in that it replaces at least a portion of the sulfites present in a wine.
Citation Information
Patent Citations
Polyphenol extract from white-grape residue
ES2443547A1