Mutant microorganism for producing 1,3-propanediol and 1,3-propanediol production method using same

Abstract

The present invention relates to a mutant microorganism for producing 1,3-propanediol and a 1,3-propanediol production method using same. Specifically, the present invention has been recombined to enable producing 1,3-propanediol by enhancing the pentose phosphate (PP) pathway and the Entner-Doudoroff (ED) pathway by manipulating genes of the microorganism. Thus, by using the mutant microorganism according to the present invention, a high concentration of 1,3-propanediol may be produced.

Description

Mutant microorganism producing 1,3-propanediol and method for producing 1,3-propanediol using the same

[0001] The present invention relates to a mutant microorganism producing 1,3-propanediol and a method for producing 1,3-propanediol using the same.

[0002] 1,3-Propanediol is a polyhydric alcohol with the chemical formula C3H8O2. It is typically obtained by fermenting corn starch or sugar. In cosmetics, 1,3-propanediol is used as a solvent, skin softener, promotes preservation, improves product texture and homogeneity, and enhances absorbency. Compared to 1,2-propanediol, also known as propylene glycol (PG), its manufacturing process is environmentally friendly and its safety in cosmetics is excellent, making it an important player in the modern beauty industry.

[0003] Traditional production methods for 1,3-propanediol, a versatile chemical, primarily rely on chemical synthesis. These methods include the hydration of acrolein and the hydroformylation of ethylene oxide in the presence of phosphine. These chemical production methods are limited by their high cost and environmentally hazardous processes.

[0004] To overcome these limitations, methods for producing 1,3-propanediol using microorganisms are being developed, typically using glycerol or sugars to produce 1,3-propanediol. Microbial production of 1,3-propanediol has the disadvantage that while 1,3-propanediol is produced as a glycerol reduction metabolite, it also produces various by-products such as lactic acid, acetic acid, ethanol, and 2,3-butanediol through glycerol oxidation metabolism. Various attempts have been made to increase 1,3-propanediol production while reducing these by-products. However, much research is still needed to increase 1,3-propanediol production while suppressing by-product production.

[0005] One aspect of the present invention provides an Escherichia coli mutant microorganism having 1,3-propanediol production ability, comprising a dhaB gene, a gdrAB gene, and a yqhD gene.

[0006] Another aspect of the present invention provides a method for producing 1,3-propanediol, comprising the steps of: culturing an Escherichia coli mutant microorganism in a medium containing glucose; and recovering 1,3-propanediol from the medium in which the Escherichia coli mutant microorganism is cultured.

[0007] One aspect of the present invention provides an Escherichia coli mutant microorganism having 1,3-propanediol production ability, comprising a dhaB gene, a gdrAB gene, and a yqhD gene.

[0008] In one specific example, the Escherichia coli mutant microorganism may have one or more genes deleted from the group consisting of the ldhA gene, the poxB gene, the adhE gene, the pta gene, the ackA gene, and the yciA gene.

[0009] In one specific example, the Escherichia coli mutant microorganism may have an additional deletion of the pdhR gene.

[0010] In one specific example, the Escherichia coli mutant microorganism may have an additional deletion of the pgi gene.

[0011] In one specific example, the Escherichia coli mutant microorganism may have increased expression of the zwf gene and the gnd gene.

[0012] In one specific example, the Escherichia coli mutant microorganism may have increased expression of the zwf gene and a deletion of the gntR gene.

[0013] In one specific example, the Escherichia coli mutant microorganism may have increased expression of the edd gene.

[0014] Another aspect of the present invention provides a method for producing 1,3-propanediol, comprising the steps of: culturing an Escherichia coli mutant microorganism in a medium containing glucose; and recovering 1,3-propanediol from the medium in which the Escherichia coli mutant microorganism is cultured.

[0015] In one specific example, the step of culturing the microorganism may be culturing at 25°C to 35°C.

[0016] In one specific example, the step of culturing the microorganism may be to administer glycerol 2 to 5 hours after the start of culturing.

[0017] Using the mutant microorganism according to the present invention, high concentrations of 1,3-propanediol can be produced.

[0018] Figure 1 is a diagram schematically showing the pathway by which 1,3-propanediol is produced from glycerol or glucose.

[0019] Figure 2 is a schematic diagram showing the plasmid used to produce a strain that produces 1,3-propanediol in high concentrations.

[0020] Figure 3 is a diagram illustrating the process for culturing a strain and producing 1,3-propanediol, and is a drawing showing the Flask test method for confirming strain characteristics and the Fermentation test method for confirming the effectiveness by culturing in a fed-batch incubator.

[0021] Figure 4 is a graph comparing the growth, glucose usage, glycerol usage, pH change during culture, and production of succinate, lactate, acetate, pyruvate, and 1,3-propanediol of the W-D1Q1 strain and the K1-D1Q1 strain, which were produced to include the dhaB, gdrAB, and yqhD genes in the E. coli W strain and the E. coli K12 MG1655 strain.

[0022] Figure 5 is a graph comparing the growth, glucose usage, glycerol usage, pH change during culture, and production of succinate, lactate, acetate, pyruvate, and 1,3-propanediol of the modified K1-D1Q1 strain, K3-D1Q1 strain, and K6-D1Q1 strain from the E. coli K12 MG1655 strain.

[0023] Figure 6 is a graph comparing the growth, glucose usage, glycerol usage, pH change during culture, and production of succinate, lactate, acetate, pyruvate, and 1,3-propanediol of the modified K6-D1Q1 strain and the K8-D1Q1 strain from the E. coli K12 MG1655 strain.

[0024] Figure 7 is a graph comparing the growth, glucose usage, glycerol usage, pH change during culture, and production of succinate, lactate, acetate, pyruvate, and 1,3-propanediol of the K8-D1Q2 and K8-D1Q3 strains, which were produced by modifying the plasmid disclosed in Figure 2 in the E. coli K8-D1Q1 strain, with the existing K8-D1Q1 strain.

[0025] Figure 8 is a graph comparing the growth, glucose usage, glycerol usage, pH change during culture, and production of succinate, lactate, acetate, pyruvate, and 1,3-propanediol of the K11-D1Q1 and K12-D1Q1 strains produced by changing the promoter in the E. coli K8-D1Q1 strain with the existing K8-D1Q1 strain.

[0026] Figure 9 is a graph comparing the growth, glucose usage, glycerol usage, pH change during culture, and production of succinate, lactate, acetate, pyruvate, and 1,3-propanediol of the K13-D1Q1 strain, which was created by deleting the gene gntR from the E. coli K10-D1Q1 strain, and the K14-K1Q1 strain, which was created by changing the edd promoter from the K12-D1Q1 strain, with the existing K8-D1Q1 strain.

[0027] Figure 10 is a graph comparing the growth of the strain, glucose usage, glycerol usage, pH change during cultivation, and production of succinate, lactate, acetate, pyruvate, and 1,3-propanediol when glycerol induction time (hereinafter referred to as 'h') was administered at 0 h, 3 h, 9 h, and 15 h to determine the optimal conditions for cultivation in the E. coli K12-D1Q1 strain.

[0028] Figure 11 is a graph comparing the growth of the strain, glucose usage, glycerol usage, pH change during cultivation, and production of succinate, lactate, acetate, pyruvate, and 1,3-propanediol when cultured at 37°C and 30°C to determine the optimal conditions for cultivation in the E. coli K12-D1Q1 strain.

[0029] Figure 12 is a graph comparing the growth of the strain, the concentration of 1,3-propanediol, the amount of glucose and glycerol used, and the amount of 3-HP and acetic acid produced when the E. coli K12-D1Q1 strain was cultured in a fed-batch manner.

[0030] One aspect of the present invention provides an Escherichia coli mutant microorganism having 1,3-propanediol production ability, comprising a dhaB gene, a gdrAB gene, and a yqhD gene.

[0031] The above dhaB gene is a gene encoding glycerol dehydratase, and the protein expressed through the gene may be an enzyme that converts glycerol into 3-HPA (3-hydroxypropionaldehyde).

[0032] The above gdrAB gene is a gene encoding glycerol dehydratase reactivase, and the protein expressed through the gene may be an enzyme that converts glycerol into 3-HPA and then reactivates the inactivated glycerol dehydratase.

[0033] The above dhaB gene and gdrAB gene may be the genetic base sequence of Klebsiella pneumoniae.

[0034] The above yqhD gene is a gene encoding aldehyde reductase that converts 3-HPA into 1,3-PDO through a reduction reaction, and the protein expressed through the gene may be an enzyme that converts 3-HPA into 1,3-PDO through a reduction reaction.

[0035] The Escherichia coli mutant microorganism used in the present invention may be derived from the Escherichia coli K12 MG1655 strain.

[0036] In one specific example, the Escherichia coli mutant microorganism may have one or more genes deleted from the group consisting of the ldhA gene, the poxB gene, the adhE gene, the pta gene, the ackA gene, and the yciA gene.

[0037] The ldhA gene used in the present invention is a gene encoding a lactate dehydrogenase enzyme, and the lactate dehydrogenase is an enzyme that catalyzes the interconversion of pyruvate and lactic acid and the accompanying interconversion of NADH and NAD.

[0038] The poxB gene used in the present invention is a gene encoding pyruvate oxidase, which is an enzyme that converts pyruvate into acetic acid.

[0039] The adhE gene used in the present invention is a gene encoding a bifunctional aldehyde-alcohol dehydrogenase, and the aldehyde-alcohol dehydrogenase is an enzyme that oxidizes alcohol to aldehyde or reduces aldehyde to alcohol.

[0040] The pta gene used in the present invention is a gene encoding phosphate acetyltransferase, which is an enzyme that converts acetyl-CoA into acetyl phosphate.

[0041] The ackA gene used in the present invention is a gene encoding acetate kinase, which is an enzyme that converts acetyl phosphate and ADP into acetate and ATP.

[0042] The yciA gene used in the present invention is a gene encoding acyl-CoA thioesterase. Acyl-CoA thioesterase is an enzyme that breaks down acyl-CoA into an acyl group and CoA, and is an enzyme involved in intracellular energy production and fatty acid metabolism.

[0043] The above Escherichia coli mutant microorganism may most preferably be one in which the ldhA gene, poxB gene, adhE gene, pta gene, ackA gene, and yciA gene are all deleted.

[0044] The term "deletion" as used herein encompasses mutation, substitution, or deletion of part or all of a gene's bases, thereby rendering the protein encoded by the gene incapable of production or preventing the produced protein from exhibiting its intended activity. Gene deletion in the present invention blocks the reaction or pathway involved in the gene in the microorganism.

[0045] In one specific example, the Escherichia coli mutant microorganism may have an additional deletion of the pdhR gene.

[0046] The pdhR gene used in the present invention is a gene encoding a pyruvate dehydrogenase complex repressor, and the pyruvate dehydrogenase complex repressor suppresses the expression of pyruvate dehydrogenase. Pyruvate dehydrogenase converts pyruvate into acetyl-CoA, and acetyl-CoA enters the TCA cycle, one of the important metabolic pathways, or enters the fatty acid production pathway or the pathway that produces acetic acid.

[0047] In one specific example, the Escherichia coli mutant microorganism may have an additional deletion of the pgi gene.

[0048] The pgi gene used in the present invention is a gene encoding glucose-6-phosphate isomerase, which converts glucose-6-phosphate into fructose-6-phosphate. In the present invention, by deleting the pgi gene, glucose does not flow through the EMP (Embden-Meyerhof-Parnase) pathway, but flows through the PP (pentose phosphate) pathway and the ED (Entner-Doudoroff) pathway, thereby enabling the production of more reducing power.

[0049] In one specific example, the Escherichia coli mutant microorganism may have increased expression of the zwf gene and the gnd gene.

[0050] The above zwf gene is a gene encoding glucose-6-phosphate 1-dehydrogenase, an enzyme that catalyzes the oxidation of glucose 6-phosphate to 6-phosphogluconolactone.

[0051] Increasing the expression of the zwf gene may be a process that enhances carbon uptake into the ED (Entner-Doudoroff) pathway and the PP (pentose phosphate) pathway. Alternatively, increasing the expression of the zwf gene may be due to the replacement of the promoter with a stronger one.

[0052] The above gnd gene is a gene encoding 6-phosphogluconate dehydrogenase, which is an enzyme that converts 6-phosphogluconate into ribulose-5-phosphate, and is an enzyme that converts NADP+ into NADPH by performing an oxidative dehydrogenation reaction. Meanwhile, the expression of the gnd gene may be further enhanced by replacing the promoter with a strong promoter.

[0053] The promoter used in the present invention is a site on DNA where RNA polymerase binds to initiate transcription of a gene, and is located upstream of the mRNA transcription initiation site, i.e., 5' forward. For example, in the case of a prokaryotic cell as a host, strong promoters capable of initiating transcription include the pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter, and trc promoter, and the trc promoter is preferably used.

[0054] In one specific example, the Escherichia coli mutant microorganism may have increased expression of the zwf gene and a deletion of the gntR gene.

[0055] The above-mentioned gntR gene is a gene encoding a transcriptional regulatory protein of the ED pathway, and deletion of the above-mentioned gntR gene can lead to increased expression of the edd and eda genes of the ED pathway.

[0056] In one specific example, the Escherichia coli mutant microorganism may have increased expression of the edd gene.

[0057] The above-mentioned edd gene is a gene encoding phosphogluconate dehydratase, which is an enzyme that converts 6-phospho-D-gluconate into 2-dehydro-3-deoxy-6-phospho-D-gluconate. Increased expression of the above-mentioned edd gene may activate the ED pathway.

[0058] In one specific example, the Escherichia coli mutant microorganism may be a strain deposited with the Korea Research Institute of Bioscience and Biotechnology under the accession number KCTC15923BP.

[0059]

[0060] Another aspect of the present invention provides a method for producing 1,3-propanediol, comprising the steps of: culturing an Escherichia coli mutant microorganism in a medium containing glucose; and recovering 1,3-propanediol from the medium in which the Escherichia coli mutant microorganism is cultured.

[0061] The Escherichia coli mutant microorganism used in the present invention may be derived from the Escherichia coli K12 MG1655 strain.

[0062] In one specific example, the Escherichia coli mutant microorganism may include a dhaB gene, a gdrAB gene, and a yqhD gene.

[0063] In one specific example, the Escherichia coli mutant microorganism may have one or more genes deleted from the group consisting of the ldhA gene, the poxB gene, the adhE gene, the pta gene, the ackA gene, and the yciA gene.

[0064] In one specific example, the Escherichia coli mutant microorganism may have an additional deletion of the pdhR gene.

[0065] In one specific example, the Escherichia coli mutant microorganism may have an additional deletion of the pgi gene.

[0066] In one specific example, the Escherichia coli mutant microorganism may have increased expression of the zwf gene and the gnd gene.

[0067] In one specific example, the Escherichia coli mutant microorganism may have increased expression of the zwf gene and a deletion of the gntR gene.

[0068] In one specific example, the Escherichia coli mutant microorganism may have increased expression of the edd gene.

[0069] In one specific example, the Escherichia coli mutant microorganism may be a strain deposited with the Korea Research Institute of Bioscience and Biotechnology under the accession number KCTC15923BP.

[0070] According to one specific embodiment of the present invention, the medium must meet the requirements of a specific strain in an appropriate manner and can be appropriately modified by a person skilled in the art.

[0071] More specifically, the medium may include various carbon sources, nitrogen sources, and trace element components. The carbon sources include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These substances may be used individually or in mixtures, but are not limited thereto. The nitrogen sources may include peptone, yeast extract, meat juice, malt extract, corn steep liquor, soybean meal, and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. The nitrogen sources may also be used individually or in mixtures, but are not limited thereto. The source of the phosphorus may include, but is not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or a corresponding sodium-containing salt. Furthermore, the medium may contain, but is not limited to, metal salts necessary for growth, such as magnesium sulfate or iron sulfate. In addition, essential growth substances, such as amino acids and vitamins, may be included. Suitable precursors may also be used in the medium. The medium or individual components may be added to the culture medium in a batch or continuous manner during the culturing process, but are not limited to these.

[0072] According to one specific example, the step of culturing the microorganism may include the step of growing the microorganism; and the step of producing 1,3-propanediol.

[0073] According to one specific example, the medium in the step of growing the microorganism may include, but is not limited to, glucose, potassium phosphate dihydrogen (KH2PO4), sodium dihydrate (Na2HPO4*2H2O), magnesium sulfate (MgSO4), ammonium sulfate ((NH4)2SO4), trace solution, yeast extract, and antibiotics. In addition, the antibiotics may be, but are not limited to, chloramphenicol and kanamycin.

[0074] According to one specific example, the glucose may be included in the medium at 10 g / L to 30 g / L, 10 g / L to 25 g / L, 15 g / L to 30 g / L, and specifically, 15 g / L to 25 g / L.

[0075] According to one specific example, the potassium phosphate dibasic may be included in the medium at 1 g / L to 5 g / L, 1 g / L to 4 g / L, 1 g / L to 3 g / L, and specifically, 1 g / L to 2 g / L.

[0076] According to one specific example, the sodium dihydrate may be included in the medium at 2 g / L to 10 g / L, 2 g / L to 8 g / L, 3 g / L to 9 g / L, 4 g / L to 9 g / L, and specifically, 4 g / L to 8 g / L.

[0077] According to one specific example, the magnesium sulfate may be included in the medium at 0.1 g / L to 0.5 g / L, 0.1 g / L to 0.4 g / L, 0.1 g / L to 0.3 g / L, 0.2 g / L to 0.5 g / L, and specifically, 0.2 g / L to 0.3 g / L.

[0078] According to one specific example, the ammonium sulfate may be included in the medium at 1 g / L to 5 g / L, 1 g / L to 4 g / L, and specifically, 1 g / L to 3 g / L.

[0079] According to one specific example, the yeast extract may be included in the medium at 0.1 g / L to 2 g / L, 0.1 g / L to 1.5 g / L, 0.2 g / L to 2 g / L, 0.2 g / L to 1.5 g / L, and specifically, 0.3 g / L to 1 g / L.

[0080] According to one specific example, the antibiotic may be included in an amount of 0.05 g / L to 0.1 g / L, and one to five types of antibiotics may be combined and used, and a person skilled in the art may appropriately vary the amount depending on the medium.

[0081] According to one specific example, the trace solution may be added in an amount of 0.1 ml to 3 ml, specifically 0.5 ml to 1.5 ml.

[0082] According to one specific example, the medium of the step of producing the 1,3-propanediol may include, but is not limited to, glucose, potassium phosphate dihydrogen (KH2PO4), sodium dihydrate (Na2HPO4*2H2O or Na2HPO4*7H2O), magnesium sulfate (MgSO4), ammonium sulfate ((NH4)2SO4), trace solution, yeast extract, glycerol, antibiotics, IPTG, and coenzyme-B12. In addition, the antibiotics may be, but are not limited to, chloramphenicol and kanamycin.

[0083] According to one specific example, the glucose may be included in the medium at 10 g / L to 30 g / L, 10 g / L to 25 g / L, 15 g / L to 30 g / L, and specifically, 15 g / L to 25 g / L.

[0084] According to one specific example, the potassium phosphate dibasic may be included in the medium at 1 g / L to 8 g / L, 1 g / L to 6 g / L, 1 g / L to 5 g / L, and specifically, 1 g / L to 4 g / L.

[0085] According to one specific example, the sodium dihydrate can be used as Na2HPO4*2H2O or Na2HPO4*7H2O, and can be included in the medium at 3 g / L to 20 g / L, 3 g / L to 18 g / L, 4 g / L to 20 g / L, 4 g / L to 18 g / L, and specifically, can be included in the medium at 5 g / L to 15 g / L.

[0086] According to one specific example, the magnesium sulfate may be included in the medium at 0.1 g / L to 0.5 g / L, 0.1 g / L to 0.4 g / L, 0.1 g / L to 0.3 g / L, 0.2 g / L to 0.5 g / L, and specifically, 0.2 g / L to 0.3 g / L.

[0087] According to one specific example, the ammonium sulfate may be included in the medium at 1 g / L to 5 g / L, 1 g / L to 4 g / L, and specifically, 1 g / L to 3 g / L.

[0088] According to one specific example, the yeast extract may be included in the medium at 0.1 g / L to 2 g / L, 0.1 g / L to 1.5 g / L, 0.2 g / L to 2 g / L, 0.2 g / L to 1.5 g / L, and specifically, 0.3 g / L to 1 g / L.

[0089] According to one specific example, the glycerol may be included in the medium at 5 g / L to 15 g / L, 5 g / L to 10 g / L, 7 g / L to 15 g / L, 7 g / L to 13 g / L, and specifically, 7 g / L to 10 g / L.

[0090] According to one specific example, the antibiotic may be included in an amount of 0.05 g / L to 0.1 g / L, and one to five types of antibiotics may be combined and used, and a person skilled in the art may appropriately vary the amount depending on the medium.

[0091] According to one specific example, the trace solution may be added in an amount of 0.1 ml to 3 ml, specifically 0.5 ml to 1.5 ml.

[0092] According to one specific example, IPTG may be added in an amount of 0.1 ml to 3 ml, specifically 0.5 ml to 1.5 ml.

[0093] According to one specific example, the initial concentration of coenzyme-B12 may be added in the range of 100 ul to 500 ul, 200 ul to 400 ul, and specifically 250 ul to 400 ul.

[0094] For the above glucose, glycerol, and coenzyme-B12, additional administration may be required as needed.

[0095] According to one specific example, the step of culturing the microorganism may be culturing at 25°C to 35°C, and specifically, culturing at 27°C to 33°C, 29°C to 31°C.

[0096] According to one specific example, the step of culturing the microorganism may be to administer glycerol 2 to 5 hours after the start of culturing, 2 to 4 hours, or 2.5 to 3.5 hours after. The administration of glycerol may refer to an induction process for producing 1,3-propanediol.

[0097] According to one specific example, the step of recovering 1,3-propanediol can include removing solids by low-speed centrifugation of the culture medium and separating the obtained supernatant through ion exchange chromatography.

[0098] According to one specific example, the step of recovering the 1,3-propanediol may include a process of purifying the 1,3-propanediol.

[0099] Hereinafter, one or more specific examples will be described in more detail through examples. However, these examples are intended to exemplify one or more specific examples, and the scope of the present invention is not limited to these examples.

[0100]

[0101] Example 1: Materials and Methods

[0102] All restriction enzymes, DNA polymerases, and other DNA modifying enzymes for gene cloning were purchased from New England Bio-Labs (Beverly, MA, USA). Plasmid isolation, DNA extraction, and purification were performed using a mini plasmid isolation kit, DNA gel extraction kit, and genomic DNA isolation kit purchased from Cosmotech Co. Ltd. (Seoul) and Promega (Madison, WI, USA), respectively. The RNA isolation kit was purchased from Qiagen (Mannheim, Germany). The iScript cDNA Synthesis Kit and SyBr green RT-PCR master mix were purchased from BioRad (Seoul, Korea). Oligonucleotide synthesis and DNA sequencing were performed by Macrogen Co. Ltd. (Seoul, Korea). Tryptone and yeast extract were purchased from Difco (Becton Dickinson, Franklin Lakes, NJ, USA). Glycerol, glucose and all other chemicals and enzymes were purchased from Sigma-Aldrich (St. Louis, MO, USA) unless otherwise specified herein.

[0103]

[0104] Example 2: Production of recombinant strains

[0105] The 1,3-propanediol production process is as shown in Figure 1. A recombinant strain was created considering the 1,3-propanediol production pathway.

[0106] Recombinant strains were prepared and used, including existing strains and plasmids, as shown in Table 1 below. Genetic recombination was performed using the following method. Escherichia coli DH5α was used for the development of overexpression and deletion plasmids. Chromosomal genetic manipulation was performed using the in-frame tagged deletion / insertion method. Briefly, 500 bp of the upstream (upstream fragment, A) and downstream (downstream fragment, B) regions of the target gene were PCR amplified and ligated using the overlapping PCR method. Fragments AB were then cloned into the pKOV vector at the NotI and XbaI or BamHI restriction sites. The resulting plasmids were used to delete the target gene from chromosomal DNA by homologous recombination. Finally, deletion mutant strains were screened using PCR and sequenced to confirm their identity. To replace all target genes, the target gene was first deleted, and then the gene of interest was inserted using a similar in-frame tagging method.

[0107] To produce a recombinant strain that produces high levels of 1,3-propanediol, a plasmid was used as shown in Fig. 2.

[0108] The strains recombined using the above plasmid are shown in Table 1 below. In Table 1 below, "Δ" indicates a deletion of a gene. In addition, in Table 1 below, "::" indicates a manipulation of the base sequence of a gene. For example, "ΔPedd::Ptrc" means that the existing promoter of the edd gene was deleted and replaced with the promoter trc.

[0109] Strain nameGenetic traitPlasmid 1Plasmid 2K1-D1Q1E.Coli K12 MG1655pDK7-dhaB123-gdrAB(D1)pQE80L-yqhD(Q1)W-D1Q1E.Coli WpDK7-dhaB123-gdrAB(D1)pQE80L-yqhDK3-D1Q1K1 & ΔldhAΔpoxBΔadhEΔpta-ackApDK7-dhaB123-gdrABpQE80L-yqhDK6-D1Q1K3 & ΔyciApDK7-dhaB123-gdrABpQE80L-yqhDK8-D1Q1K6 & ΔpdhRpDK7-dhaB123-gdrABpQE80L-yqhDK10-D1Q1K8 & ΔpgipDK7-dhaB123-gdrABpQE80L-yqhDK11-D1Q1K8 & ΔPzwf::PtrcpDK7-dhaB123-gdrABpQE80L-yqhDK12-D1Q1K11 & ΔPgnd::PtrcpDK7-dhaB123-gdrABpQE80L-yqhDK8-D1Q2K8pDK7-dhaB123-gdrABpQE80L-yjgBK8-D1Q3K8pDK7-dhaB123-gdrABpQE80L-yahKK13-D1Q1K11 & ΔgntRpDK7-dhaB123-gdrABpQE80L-yqhDK14-D1Q1K13 & ΔPedd::PtrcpDK7-dhaB123-gdrABpQE80L-yqhD

[0110] Information on restriction enzymes, related genes, and proteins and enzymes related to the genes used to modify the above genes are as shown in Table 2 below, and the primer sequences used to replace and delete the genes are as shown in Table 3 below.

[0111] Gene restriction enzymes Proteins & Enzymes (Enzyme)ackANotI and XbaIAcetate kinaseadhENotI and XbaIBifunctional aldehyde-alcohol dehydrogenaseatoBNotI and XbaIAcetyl-CoA acetyltransferaseedhaB123NdeI and HindIIIGlycerol dehydrataseedaNotI and XbaI2-keto-3-deoxygluconate 6-phosphate aldolaseEddNotI and XbaIPhosphogluconate dehydratasegdrABNdeI and HindIIIGlycerol dehydratase reactivaseGndNotI and XbaI6-phosphogluconate dehydrogenasegntRNotI and XbaIGluconate operon transcriptional repressorldhANotI and XbaID-Lactate dehydrogenasepdhRNotI and XbaIPyruvate dehydrogenase complex repressorpgiNotI and XbaIGlucose-6-phoshate isomerasepoxBNotI and XbaIPyruvate oxidaseptaNotI and dehydrogenasezwfNotI and XbaIGlucose-6-phoshate 1-dehydrogenase

[0112]

[0113] 유전자서열번호프라이머 서열ackA1FP: GATCGCGGCCGCCTGCATCGGCAGGCTCAGCGCAAACAG2RP: CTAGAGGATCCGCGGACTGAATAGCGATTTCCGCCAGadhE3FP: CGGGGATCGCGGCCGCTACATAAAACGCCAATGGCTTATATG4RP: GGTCGACTCTAGACATCAGCCCGGATGGGCAAAGCCGdhaB1235FP: GGCGAAAATGAGACGTTGATCATATGATATTGGTCGTATGAATGTG6RP: CTATTAACGGCATGCTGaCCTCCgCTTAGCTTCCTTTACGCAGCTTATGCCGCTGCatoB7FP: ATCTAAGCGGCCGCCACCTTACCGTTATGGGTGTTTTC8RP: CTGAAGGATCCAGTCTATTTCTTTGTTGGCGCACTGGeda9FP: CCCGGGGATCGCGGCCGCACCACAAACATAACCTGCAAATCAC10RP: GAAATTGAGTTGTCGCGGCGCTGTTTCCTGTGTGAAATTGTTATCCEdd11FP: CCCGGGGATCGCGGCCGCACCACAAACATAACCTGCAAATCAC12RP: GAAATTGAGTTGTCGCGGCGCTGTTTCCTGTGTGAAATTGTTATCCgdrAB13FP: GGAAGCTAAGcGGAGGtCAGCATGCCGTTAATAGCCGGGATTG14RP: CCGCCAAAACAGCCAAGCTTTCTAGATCAGTTTCTCTCACTTAACGnd15FP: CCCGGGGATCGCGGCCGCCCCGCTTATTCGCACCTTCCTTAATAAAAC16RP: CATTCTCCGGTCGACTCTAGAGTCGGTTGGAGTGGCGATGATGACATAATCgntR17FP: GTACCCGGGGATCGCGGCCGCCAAACAGCTGGTGCTCTCGCC18RP: CATTCTCCGGTCGACTCTAGAAGGCGGCTTTCAATCACATCAAAATCldhA19FP: CTACGGATCCTCGCTTCCGCCAGCCTCGGACATTTCCTG20RP:AACAGCGGCCGCGTTTTCCGTCAGATCGACCTGCGCACCCTCpdhR21FP: GGTACCCGGGGATCGCGGCCGCATGCGTGTGTAAGTTTGCAATTCCG22RP: CATTCTCCGGTCGACTCTAGAAAGACTGGAAGGACGCCATATGGCpgi23FP: CGGTACCCGGGGATCGCGGCCGCTTTTCAGCCTTGGCACAAGGGAAG24RP: CCATTCTCCGGTCGACTCTAGAATAACAATTTCCCTTCATTGAATGAATGGpoxB25FP: ATCTAAGCGGCCGCCACCTTACCGTTATGGGTGTTTTC26RP: CTGAAGGATCCAGTCTATTTCTTTGTTGGCGCACTGGpta27FP: GATCGCGGCCGCCTGCATCGGCAGGCTCAGCGCAAACAG28RP: CTAGAGGATCCGCGGACTGAATAGCGATTTCCGCCAGyahK29FP: CCATCACCATCACGGATCCATGAAGATCAAAGCTGTTGGTGC30RP: GCTCAGCTAATTAAGCTTTCAGTCTGTTAGTGTGCGATTATCGyciA31FP: CCCGGGGATCGCGGCCGCAAGATGGCCCTGATCACTTTTGTTC32RP: GTCGACTCTAGATGGTCATTGAAAAGCCGAAGCCGAAACCyjgB33FP: CCATCACCATCACGGATCCATGTCGATGATAAAAAGCTATGCCGC34RP:CCAAGCTCAGCTAATTAAGCTTTCAAAAATCGGCTTTCAACACCACGyqhD35FP: CCATCACCATCACGGATCCATGAACAACTTTAATCTGCACAC36RP: CAAGCTCAGCTAATTAAGCTTTTAGCGGGCGGCTTCGTATATACzwf37FP: GTACCCGGGGATCGCGGCCGCTCTAGGGCGGCGGATTTGTCC38RP: CCATTCNCCGGTCGACTCTAGACTGGATTCTCACCAATAAAAAACG

[0114]

[0115] Example 3: Culture conditions for strain growth and 1,3-propanediol production

[0116] The strain manufactured in Example 1 was cultured and cultured according to the process shown in Fig. 3 to produce 1,3-propanediol. Basically, the culture was performed using the Flask test method to confirm the growth of the strain, byproducts, and the concentration of 1,3-propanediol, and the strain producing the highest concentration of 1,3-propanediol was finally cultured using the Fermentation test method to confirm that it produced 1,3-propanediol at a high concentration through the culture medium.

[0117]

[0118] 3-1. Flask test method cultivation

[0119] The strain growth medium was prepared with the composition shown in Table 4 below, and the fermentation medium for producing 1,3-propanediol was prepared with the composition shown in Table 5 below and cultured.

[0120] The culture conditions were 37°C and 220 rpm, glycerol administration was performed 3 hours after incubation, 100 mM of glucose and glycerol were added 15 hours after inoculation, and 6.6 ul of co-enzyme B12 was added every 3 hours.

[0121]

[0122] Chemical(Growth media)g / L1Glucose202KH2PO41.63Na2HPO4*2H2O6.64MgSO4(x1000-250g / L)0.255(NH4)2SO4(500g / L)26Trace solution1ml7Yeast extract(250g / L)0.58Antibiotics(kanamycin)0.059Antibiotics(chloramphenicol)0.025

[0123]

[0124] Chemical(Production media)g / L1Glucose202KH2PO41.63Na2HPO4*2H2O6.64MgSO4(x1000-250g / L)0.255(NH4)2SO4(500g / L)26Trace solution1 ml7Yeast extract(250g / L)0.58Glycerol9.29Antibiotics(kanamycin)0.0510Antibiotics(chloramphenicol)0.02511IPTG(59.57g / L:0.25M)1 ml12Coenzyme-B12(6,000ug / L)330 ul

[0125]

[0126] 3-2. Fermentation test method

[0127] The strain growth medium was prepared with the composition of Table 4 above, and the fermentation medium for producing 1,3-propanediol was prepared with the composition of Table 6 below and cultured.

[0128] The culture conditions were 30°C and 200–800 rpm, glycerol administration was performed after 3 hours of culture, and glucose and glycerol were added intermittently to maintain the concentration at 30–250 mM. Co-enzyme B12 was added at 500 μl every 3 hours.

[0129] Chemical(Fermentor media)g / L1Glucose202KH2PO43.23Na2HPO4*7H2O13.24MgSO4(x1000-250g / L)0.255(NH4)2SO4(500g / L)76Trace solution1 ml7Yeast extract(250g / L)0.58Glycerol9.29Antibiotics(kanamycin)0.0510Antibiotics(chloramphenicol)0.02511IPTG(59.57g / L:0.25M)1 ml12Coenzyme-B12(6,000ug / L)330 ul

[0130]

[0131] Example 4: Comparison of production amounts of 1,3-propanediol producing strains using basic E. coli (E. coliW strain) and E. coli K12 (E. coliK12 MG1655)

[0132] The production of 1,3-PDO from glycerol in E. coli requires three reactions: (1) conversion of glycerol to 3-HPA, (2) reactivation of the inactivated glycerol dehydratase enzyme after converting glycerol to 3-HPA, and (3) conversion of 3-HPA to 1,3-PDO through a reduction reaction. The enzymes that carry out these three reactions are (1) glycerol or diol dehydratase enzyme, which converts glycerol to 3-HPA, (2) glycerol dehydratase reactivase enzyme, which reactivates the inactivated glycerol dehydratase enzyme after converting glycerol to 3-HPA, and (3) aldehyde reductase enzyme, which converts 3-HPA to 1,3-PDO through a reduction reaction. Among the three reactions above, reaction (2) requires ATP and Co-enzyme B12, and reaction (3) requires NADPH or NADH as reducing power.

[0133] The first enzyme, glycerol dehydratase (DhaB protein) encoded by dhaB of Klebsiella pneumoniae (hereinafter, Kp_dhaB), the second enzyme, glycerol dehydratase reactivase (GdrAB protein) encoded by gdrAB of Klebsiella pneumoniae (hereinafter, Kp_gdrAB), and the third enzyme, aldehyde reductase (YqhD protein) encoded by yqhD of E. coli (hereinafter, Ec_yqhD), were selected and introduced into the basic E. coli strains (E. coliW and E. coliK12 MG1655).

[0134] As shown in Fig. 2, two recombinant plasmids, D1 and Q1, were constructed and introduced into E. coli K12 MG1655 and E. coli W to produce 1,3-PDO. D1, derived from the pDK7 plasmid with a medium copy number, was constructed to express Kp_dhaB and Kp_gdrAB under the control of the Ptac promoter, and Q1, derived from the pQE80L plasmid with a high copy number, was constructed to express Ec_yqhD under the control of the Pt5 promoter. These two plasmids were then introduced into wild-type E. coli K12 MG1655 and E. coli W, and the strains were designated K1-D1Q1 and W-D1Q1, respectively.

[0135] K1-D1Q1 and W-D1Q1 were cultured to determine the strain growth rate, production of 1,3-propanediol, pH changes, and the amounts of glucose, glycerol, and by-products used.

[0136]

[0137] As a result, as shown in Fig. 4 and Table 7 below, it was confirmed that the K1-D1Q1 strain had a slower growth rate and 1,3-propanediol production rate than the W-D1Q1 strain, but produced more 1,3-propanediol over 24 hours. In addition, it was confirmed that the K1-D1Q1 strain consumed more glycerol and less glucose in the beginning. In addition, it was confirmed that the byproducts succinate, lactate, acetate, and pyruvate were present at lower concentrations in the K1-D1Q1 strain than in the W-D1Q1 strain.

[0138] Accordingly, it was confirmed that the K1-D1Q1 strain was more suitable for 1,3-propanediol production.

[0139] Strain name 1,3-PDO(mM)W-D1Q177.8K1-D1Q192.8

[0140]

[0141] Example 5: Increasing 1,3-propanediol productivity by eliminating competing metabolite pathways.

[0142] Using the recombinant strain shown in Table 1 of Example 2 above, in this example, we attempted to confirm whether the productivity of 1,3-propanediol increased or decreased by deleting genes related to the competitive metabolite pathway.

[0143] In order to confirm whether the productivity of 1,3-PDO increases or decreases depending on the presence or absence of genes involved in the pathway of competitive metabolites, E. coli K12 strain (K1-D1Q1) was used as a control, and K3-D1Q1 strains and K6-D1Q1 strains were produced as described in Example 2. Specifically, the genes deleted in the K3-D1Q1 strain were genes encoding lactate dehydrogenase (ldhA), alcohol dehydrogenase (adhE), pyruvate oxidase (poxB), and enzymes involved in acetate production (pta and ackA), respectively, and the genes were deleted to prevent the loss of pyruvate, acetyl-CoA, and cofactor (NAD), respectively, and to facilitate future separation and purification. The above K6-D1Q1 strain is a strain in which the yciA gene has been additionally deleted from the above K3-D1Q1 strain. yciA mainly plays a role in decomposing acyl-CoA into acyl groups and CoA in fatty acid metabolism, but was deleted to exclude the possibility of producing acetate by decomposing acetyl and CoA from acetyl-CoA.

[0144] As a result, the results shown in Fig. 5 and Table 8 below were confirmed.

[0145] Specifically, when comparing the K3-D1Q1 strain with the K1-D1Q1 strain, a significant decrease in lactate production was observed, while a significant decrease in acetate production was observed. However, despite the reduction in by-products, no positive effect on 1,3-PDO production was observed.

[0146] Despite the deletion of pta-ackA in the K3-D1Q1 strain, acetate was produced. It was predicted that acetate would be produced by the removal of CoA from acetyl CoA by various thioesterases of E. coli. Therefore, the K6-D1Q1 strain was constructed by deleting the yciA gene encoding acyl-CoA thioesterase in E. coli.

[0147] Compared to the K3-D1Q1 strain, the K6-D1Q1 strain, in which the yciA gene was deleted, effectively reduced acetate production, but succinate and pyruvate were accumulated. In addition, the concentration of 1,3-PDO in the K6-D1Q1 strain was rather reduced (Table 8). This suggests that glycerol dehydratase, the first enzyme converting 1,3-PDO, was inhibited by the accumulated pyruvate, which reduced the production rate of 1,3-PDO.

[0148] Strain name 1,3-PDO (mM) K1-D1Q192.8 K3-D1Q188.1 K6-D1Q177.1

[0149] Although the K6-D1Q1 strain, which lacks the yciA gene in the K3-D1Q1 strain, was not effective in increasing 1,3-PDO production, it was confirmed to effectively reduce acetate production, a byproduct. Therefore, it was expected that preventing pyruvate accumulation would reduce glycerol dehydratase inhibition and effectively produce 1,3-PDO, and further research was conducted based on the K6-D1Q1 strain.

[0150]

[0151] Example 6: Inducing increased production of 1,3-PDO by increasing the activity of pyruvate dehydrogenase.

[0152]

[0153] Pyruvate is a crucial metabolic intermediate or precursor that links metabolic pathways such as glycolysis, the TCA cycle, and 1,3-BDO biosynthesis. Pyruvate accumulation generally indicates a malfunction in the pathways downstream of pyruvate production. As pyruvate accumulates, the upstream pathways that convert glucose to pyruvate are blocked, ultimately halting both initial glucose uptake and catabolism.

[0154] In addition, it is known that glycerol dehydratase, an enzyme that converts glycerol into 3-HPA, is inhibited by pyruvate. In addition, pyruvate accumulation activates the expression of the pdhR gene, and the protein of this gene suppresses the expression of the pdh operon, thereby reducing the activity of pyruvate dehydrogenase, an enzyme that converts pyruvate into acetyl-CoA. Since pyruvate accumulation is judged to have a negative effect on 1,3-PDO production, pdhR, a transcriptional repressor of pdhC, was deleted to increase the activity of pyruvate dehydrogenase, thereby creating the K8-D1Q1 strain of Example 2.

[0155] As a result of comparing the K6-D1Q1 strain and the K8-D1Q1 strain, the results shown in Fig. 6 and Table 9 below were confirmed.

[0156] In the K8-D1Q1 strain, where pdhR was deleted, pyruvate accumulation was not observed, and 100 mM of 1,3-PDO was produced, which was higher than that of the K6-D1Q1 strain. This suggests that the absence of pyruvate accumulation may have resulted in the inhibition of glycerol dehydratase activity, which converts glycerol to 1,3-propanediol. This suggests that the K8-D1Q1 strain produces 1,3-PDO more rapidly than the K6-D1Q1 strain.

[0157] Strain name 1,3-PDO(mM)K6-D1Q177.1K8-D1Q1100

[0158]

[0159] Example 7: Comparison of 1,3-propanediol production according to aldehyde reductase activity.

[0160] In this example, the aldehyde reductase that converts 3-hydroxypropionic acid (3-HPA) to 1,3-propanediol was modified to compare the production of 1,3-propanediol. Based on the K8-D1Q1 strain produced in Example 5, the Q1, Q2, and Q3 plasmids disclosed in FIG. 2 were used to modify the gene encoding aldehyde reductase. Based on this, the K8-D1Q1 strain, the K8-D1Q2 strain, and the K8-D1Q3 strain were produced as disclosed in Example 2.

[0161] The production and comparative results of 1,3-propanediol of the K8-D1Q1 strain, the K8-D1Q2 strain, and the K8-D1Q3 strain are shown in Fig. 7 and Table 10 below. In conclusion, it was confirmed that the K8-D1Q1 strain, into which yqhD of E. coli was introduced, had a high production of 1,3-PDO.

[0162] Strain name 1,3-PDO (mM) K8-D1Q1100 K8-D1Q268.2 K8-D1Q385.4

[0163]

[0164] Example 8: Comparison of 1,3-propanediol production according to changes in the glycolytic metabolic pathway.

[0165] NADPH is used as a coenzyme for various enzymes during cellular growth and metabolism, and a sufficient supply of NADPH is crucial for maintaining cellular and enzyme activity. Furthermore, in intracellular redox reactions, the rate of enzyme reaction is often limited by the availability or regeneration rate of cofactors such as NADH and NADPH, rather than the amount of enzyme itself.

[0166] The stoichiometry for the production of 1,3-PDO from glycerol is as follows.

[0167]

[0168] [Chemical Formula 1]

[0169] 1 glycerol +1 ATP+1 NADPH + 1 Co-enzyme B12 -> 1 1,3-PDO + 1 ADP + 1 NADP+ 1 H2O + Co-enzyme B12*

[0170]

[0171] The production of 1,3-propanediol requires one mole of ATP and one mole of NADPH, which are produced through glucose metabolism in E. coli. Specifically, a lack of NADPH limits the rate of conversion of 3-HPA to 1,3-propanediol, leading to an accumulation of 3-HPA, which negatively impacts cell growth and 1,3-propanediol production.

[0172] Meanwhile, since the amount of NADPH that can be obtained through the EMP pathway is lower than that that can be obtained through the ED pathway and PP pathway, it was determined that activating the ED or PP pathway rather than the EMP pathway was more efficient in producing NADPH using glucose. Therefore, in order to change the glycolytic metabolic pathway, we first suppressed the EMP pathway and deleted the pgi gene encoding phosphoglucose isomerase, an enzyme that converts G6P (glucose-6-phosphate) to F6P (fructose-6-phoshate), to create the K10-D1Q1 strain.

[0173] In addition, to enhance carbon uptake into the ED pathway and PP pathway, the K11-D1Q1 strain was constructed by replacing the native promoter of the zwf gene encoding glucose-6-phoshate 1-dehydrogenase, an enzyme that converts G6P to 6-phoshogluconate (6PG), with a stronger trc promoter to up-regulate the zwf gene in the K10-D1Q1 strain.

[0174] In addition, to enhance carbon influx into the PP pathway, the gnd gene encoding 6-phosphogluconate dehydrogenase, an enzyme that converts 6-phosphogluconate (6PG) to ribulose-5-phosphate (Ru5P), was up-regulated by replacing the native promoter of the gnd gene with a stronger trc promoter to create the K12-D1Q1 strain.

[0175] The results of the production of 1,3-PDO produced by culturing the strains produced above are shown in Fig. 8 and Table 11. Specifically, in the case of the K10-D1Q1 strain, the process from G6P to F6P was weakened due to the removal of pgi, so that the consumption of glucose and the strain growth were slow initially, but the concentration of 1,3-propanediol after 24 hours was confirmed to be similar to that of the K8-D1Q1 strain.

[0176] In the case of the K11-D1Q1 strain, the first step of the pathway to the ED pathway and PP pathway was strengthened, but the second step to the ED pathway or PP pathway was not strengthened. Therefore, it was determined that the balance of carbon inflow toward the ED pathway and PP pathway was not achieved normally, which had a negative effect on NADPH production and 1,3-PDO production.

[0177] In the case of the K12-D1Q1 strain, the influx from G6P to F6P was reduced due to the deletion of the pgi gene, which initially slowed glucose consumption and strain growth. However, after 9 hours, as the PP pathway was activated, the glucose consumption rate increased and the strain growth rate also rapidly increased. In addition, it was confirmed that the imbalance was resolved due to the effect of the activated PP pathway, and the production rate of 1,3-propanediol rapidly increased.

[0178] Strain name1,3-PDO(mM)K8-D1Q1107.6K10-D1Q1100.8K11-D1Q146.2K12-D1Q1126.2

[0179]

[0180] Example 9: Comparison of 1,3-propanediol production according to changes in the glycolytic metabolic pathway.

[0181] To confirm the effect of enhanced carbon flow into the ED pathway, the gntR gene, a transcriptional regulatory protein of the ED pathway, was deleted from the K11-D1Q1 strain, thereby generating the strain K13-D1Q1, which enhanced the expression of the edd and eda genes of the ED pathway. In addition, to further activate the ED pathway in the K13-D1Q1 strain, the edd gene, which encodes phosphogluconate dehydratase, an enzyme that converts 6PG to 2-keto-3-deoxy-6-P-gluconate (KDPG), was upregulated, and for this purpose, the native promoter of the edd gene was replaced with the stronger trc promoter, generating the K14-D1Q1 strain.

[0182] The results of culturing the above-mentioned strains for the production of 1,3-PDO are shown in Fig. 9 and Table 12 below. Specifically, in the case of the K13-D1Q1 strain, in which the transcriptional regulatory protein of the ED pathway, gntR, was deleted to enhance carbon flow into the ED pathway, the 1,3-propanediol concentration was improved compared to the K11-D1Q1 strain. This was determined to be due to the imbalance being resolved by the activation of the ED pathway, leading to a smooth increase in NADPH production and 1,3-PDO production.

[0183] Meanwhile, in the case of the K14-D1Q1 strain produced by up-regulating the edd gene, a trend almost similar to that of the K13-D1Q1 strain before up-regulating the edd gene was confirmed. On the other hand, it was confirmed that the 1,3-PDO production was lower than that of the K12-D1Q1 strain with the PP pathway strengthened.

[0184] Based on these results, it was confirmed that a smooth supply of NADPH is required to produce 1,3-propanediol from glycerol, and that NADPH production through the PP pathway is more effective than the ED pathway.

[0185]

[0186] Strain name 1,3-PDO (mM) K8-D1Q1107.6 K13-D1Q1113.0 K14-D1Q1114.7

[0187]

[0188] Example 10: Optimization of strain culture conditions

[0189] Based on the results of Examples 8 and 9 above, the K12-D1Q1 strain, which suppresses the EMP pathway and strengthens the PP pathway, was determined to be the optimal strain for producing 1,3-propanediol.

[0190] Accordingly, the K12-D1Q1 strain was deposited with the Korea Research Institute of Bioscience and Biotechnology on June 5, 2024, and was assigned the accession number KCTC 15923BP. In addition, to optimize the culture conditions of this strain, the optimal induction time and temperature conditions were identified.

[0191]

[0192] 10-1. Confirmation of strain growth and 1,3-propanediol production according to glycerol induction time.

[0193] In this example, the growth of the strain, the amount of by-products produced, and the amount of 1,3-propanediol produced were confirmed according to the glycerol induction time, and the results are shown in Fig. 10 and Table 13 below.

[0194] As shown in Table 13, the highest 1,3-propanediol production and rapid strain growth were observed when glycerol induction was performed 3 hours after initial cultivation, while the lowest 1,3-propanediol production and strain growth were observed when glycerol induction was performed 15 hours later. These results confirmed that maintaining a balance between strain growth and enzyme expression in the 1,3-propanediol production pathway is a critical factor.

[0195] Glycerol administration time 1,3-PDO (mM) 0 H90.43 H110.69 H80.115 H64.7

[0196]

[0197] 10-2. Confirmation of strain growth and 1,3-propanediol production by culture temperature

[0198] To confirm the effect of temperature on the production of 1,3-propanediol, the culture temperature of the 1,3-propanediol-producing strain was set to 37℃ and 30℃, and the strain growth, by-products, and production amount of 1,3-propanediol were confirmed.

[0199] As a result, as shown in Fig. 11 and Table 14, the strain grew the fastest when cultured at 37°C, and it was confirmed that glucose was consumed quickly, but there was no significant difference compared to the culture at 30°C. However, a significant difference was observed in glycerol consumption and 1,3-propanediol production, and it was confirmed that a greater amount of 1,3-propanediol was produced when cultured under temperature conditions of 30°C.

[0200] Incubation temperature 1,3-PDO (mM) 30℃ 166.5 37℃ 116.3

[0201]

[0202] Example 11: Confirmation of 1,3-propanediol production in fed-batch culture

[0203] Based on the results of Examples 9 and 10, the selected strain K12-D1Q1 was fermented in a fed-batch fermenter to determine the growth of the strain, the amount of glucose and glycerol used, the production of 3-HP and acetate, and the production of 1,3-propanediol. The fermentation result of the K12-D1Q1 strain with an enhanced PP pathway confirmed the production of 842.7 mM of 1,3-propanediol, and it was confirmed that the K12-D1Q1 strain steadily produced 1,3-propanediol even though the fermentation was performed after 30 hours when the growth of the strain ceased. From these fed-batch fermentation results, it was confirmed that the recombinant strain could successfully mass-produce 1,3-propanediol in a fermenter, similar to the flask experiment (Fig. 12).

[0204]

[0205] Name of depositor: Korea Research Institute of Bioscience and Biotechnology

[0206] Accession number: KCTC15923BP

[0207] Date of acceptance: 20240605

Claims

1. An Escherichia coli mutant microorganism having the ability to produce 1,3-propanediol, comprising the dhaB gene, the gdrAB gene, and the yqhD gene.

2. In paragraph 1, The above Escherichia coli mutant microorganism has one or more genes deleted from the group consisting of ldhA gene, poxB gene, adhE gene, pta gene, ackA gene, and yciA gene. A mutant Escherichia coli microorganism capable of producing 1,3-propanediol.

3. In paragraph 2, The above Escherichia coli mutant microorganism has an additional deletion of the pdhR gene. Escherichia coli mutant microorganism capable of producing 1,3-propanediol.

4. In paragraph 3, The above Escherichia coli mutant microorganism has an additional deletion of the pgi gene. Escherichia coli mutant microorganism capable of producing 1,3-propanediol.

5. In paragraph 3, The above Escherichia coli mutant microorganism has increased expression of the zwf gene and gnd gene. Escherichia coli mutant microorganism capable of producing 1,3-propanediol.

6. In paragraph 3, The above Escherichia coli mutant microorganism has increased expression of the zwf gene and deleted the gntR gene. Escherichia coli mutant microorganism capable of producing 1,3-propanediol.

7. In paragraph 6, The above Escherichia coli mutant microorganism has increased expression of the edd gene. Escherichia coli mutant microorganism capable of producing 1,3-propanediol.

8. A method for producing 1,3-propanediol, comprising: a step of culturing the Escherichia coli mutant microorganism of items 1 to 7 in a medium containing glucose; and a step of recovering 1,3-propanediol from the medium in which the Escherichia coli mutant microorganism is cultured.

9. In paragraph 8, The step of culturing the above microorganism is to culture at 25°C to 35°C. Method for producing 1,3-propanediol.

10. In paragraph 8, The step of culturing the above microorganism is to administer glycerol 2 to 5 hours after the start of culturing. Method for producing 1,3-propanediol.

Images