Novel genetic recombination marker and use thereof

Abstract

Provided are a novel genetic recombination marker of Starmerella bombicola, and a method for using the same. An adenine-requirement selectable marker comprising a gene encoding a phosphoribosylglycinamide formyltransferase-like protein or an equivalent gene. A mutant strain of Starmerella bombicola in wich the expression of a phosphoribosylglycinamide formyltransferase-like protein or an equivalent protein is suppressed or inactivated.

Description

New markers for genetic recombination and their use

[0001] The present invention relates to a novel marker for genetic recombination and its use.

[0002] Sophorolipids are glycolipids produced by microorganisms, primarily yeast, consisting of long-chain hydroxy fatty acids and sophorose. Sophorolipids are amphiphilic lipids with strong surface activity and excellent biodegradability, and in recent years have attracted attention for their use as biosurfactants. Because sophorolipids are produced by microorganisms and primarily comprise nonionic components, they have good skin affinity and are therefore used as penetration enhancers for cosmetics. Furthermore, because sophorolipids are highly biodegradable and effective even with small amounts, they are increasingly being used in cleaning agents such as dishwashing detergents.

[0003] To improve the productivity of sophorolipids using microorganisms, it is necessary to enhance the activity of the microorganisms. Genetic recombination technology is a major method for such activity enhancement. In the genetic recombination of microorganisms, selection markers such as drug resistance genes and auxotrophy-related genes are often used, and the desired genetically modified microorganisms are selected using the drug resistance or auxotrophy traits lost or acquired by these markers as indicators. However, genetically modified microorganisms into which foreign genes not originally present in the microorganism have been introduced carry concerns such as the risk of the introduced foreign genes being horizontally transmitted to other microorganisms, which could have a negative impact on the ecosystem.

[0004] On the other hand, the Enforcement Regulations of the Law Concerning the Sustainable Use of Biological Diversity through Regulations on the Use of Living Modified Organisms (Cartagena Protocol) stipulate that even organisms obtained using genetic engineering techniques are exempt from the scope of the law if they are self-cloning or natural occurrences, and thus self-cloning or natural occurrences are not included in genetically modified organisms. Therefore, even if genetic engineering techniques are used to improve the productivity of sophorolipids using microorganisms, it is desirable that the resulting microorganisms be self-cloning or natural occurrences.

[0005] A well-known example of a sophorolipid-producing yeast is the non-pathogenic basidiomycete yeast Starmerella bombicola (formerly known as Candida bombicola). When modifying Starmerella bombicola, exogenous antibiotic resistance genes such as hygromycin resistance and nourseothricin resistance are often used as markers for selecting recombinants. The only known selection marker (self-marker) derived from an endogenous gene required for self-cloning is the ura3 gene (Non-Patent Document 1), and new self-markers are needed. Genes involved in the biosynthesis of amino acids, nucleic acids, etc. are generally considered as self-marker candidates, but it is difficult to establish host strains in which the genes are functionally defective and can be used for self-cloning.

[0006] (Non-Patent Document 1) Inge NA Van Bogaert et al., Yeast, 2007, 24: 201-208

[0007] The present invention relates to the following 1) to 7). 1) A Starmerella bombicola mutant strain in which the expression of a phosphoribosylglycine amidoformyltransferase-like protein or a protein equivalent thereto is suppressed or inactivated. 2) A method for producing a Starmerella bombicola mutant strain, comprising suppressing or inactivating the expression of a phosphoribosylglycine amidoformyltransferase-like protein or a protein equivalent thereto in Starmerella bombicola. 3) A method for transforming Starmerella bombicola, comprising using the mutant strain described in 1) as a host. 4) A transformant obtained by the method described in 3). 5) A method for producing glycolipids, comprising culturing the mutant strain described in 1) or the transformant described in 4). 6) An adenine-requiring selection marker consisting of a phosphoribosylglycine amidoformyltransferase-like protein gene or a gene equivalent thereto. 7) A vector or DNA fragment containing a phosphoribosylglycine amidoformyltransferase-like protein gene or a gene equivalent thereto.

[0008] Growth of a Starmerella bombicola mutant strain (T1 strain) having a mutation in the gene consisting of the nucleotide sequence shown in SEQ ID NO: 1 and the parent strain, Starmerella bombicola NBRC10243 strain, on (A) minimal agar + adenine medium and (B) minimal agar medium. Detailed Description of the Invention

[0009] If we can develop a new self-marker for genetic recombination that can be used in Starmerella bombicola and a genetic recombination technology using it, this could become a useful basic technology for producing substances such as glycolipids using Starmerella bombicola.

[0010] The present invention relates to providing a novel marker for genetic recombination in Starmerella bombicola and a method for using the same.

[0011] The present inventors have succeeded in obtaining a mutant strain that exhibits adenine auxotrophy as a result of the introduction of a mutation into a specific gene by continuous subculture of a type strain of Starmerella bombicola used in glycolipid production. Furthermore, the present inventors have found that it is possible to construct a transformation system for Starmerella bombicola using the mutant strain as a host, and further that, in this process, the specific gene can be used as a self-marker to efficiently select transformants based on the presence or absence of adenine auxotrophy.

[0012] The present invention provides a Starmerella bombicola mutant strain that exhibits adenine auxotrophy. By using the Starmerella bombicola mutant strain of the present invention as a host, efficient transformation of Starmerella bombicola can be performed using the presence or absence of adenine auxotrophy as an indicator.

[0013] (1. Definitions) In this specification, the identity of an amino acid sequence or a nucleotide sequence is calculated by the Lipman-Pearson method (Science, 1985, 227:1435-1441). Specifically, it is calculated by performing an analysis using the Search homology program in the genetic information processing software GENETYX Ver. 12, with the unit size to compare (ktup) set to 2.

[0014] As used herein, "at least 90% identity" with respect to an amino acid sequence or a nucleotide sequence means identity of 90% or more, preferably 95% or more, more preferably 97% or more, even more preferably 98% or more, and even more preferably 99% or more.

[0015] As used herein, "an amino acid sequence in which one or several amino acids have been deleted, substituted, added, or inserted" refers to an amino acid sequence in which 1 to 20, preferably 1 to 10, more preferably 1 to 8, even more preferably 1 to 5, and even more preferably 1 to 3 amino acids have been deleted, substituted, added, or inserted. Furthermore, "a nucleotide sequence in which one or several nucleotides have been deleted, substituted, added, or inserted" refers to a nucleotide sequence in which 1 to 60, preferably 1 to 30, more preferably 1 to 24, even more preferably 1 to 15, and even more preferably 1 to 9 nucleotides have been deleted, substituted, added, or inserted. As used herein, "addition" of an amino acid or nucleotide includes addition of an amino acid or nucleotide to one or both ends of a sequence.

[0016] As used herein, "upstream" and "downstream" in relation to a gene refer to upstream and downstream in the transcription direction of the gene. For example, "a gene located downstream of a promoter" means that the gene is located on the 3' side of the promoter on the DNA sense strand, and "upstream" of a gene means the 5' region of the gene on the DNA sense strand.

[0017] As used herein, the term "operably linked" between a gene and a regulatory region such as a promoter means that the gene and regulatory region are linked in such a way that the gene can be expressed under the control of the regulatory region. Procedures for "operably linking" a gene to a regulatory region are well known to those skilled in the art.

[0018] As used herein, the term "native" when used with respect to a cellular function, property, or trait is used to indicate that the function, property, or trait is inherently present in the cell. In contrast, the term "exogenous" is used to indicate that the function, property, or trait is not inherently present in the cell but is introduced from outside. For example, an "exogenous" gene or polynucleotide is a gene or polynucleotide that is introduced into a cell from outside. An exogenous gene or polynucleotide may be derived from the same organism as the cell into which it is introduced, or from a different organism (i.e., a heterologous gene or polynucleotide).

[0019] As used herein, "adenine auxotrophy" refers to the requirement of adenine supplied from an external source for cell growth. Adenine-auxotrophic microbial strains are substantially unable to grow in adenine-free media, but can grow in adenine-containing media. For example, under the conditions shown in the Examples below, adenine-auxotrophic microbial strains cannot grow in adenine-free minimal solid media, but can grow in adenine-containing minimal solid media.

[0020] As used herein, "self-cloning" refers to an organism obtained using recombinant DNA technology in which the donor and host of the inserted DNA in the recombinant belong to the same species. Furthermore, as used herein, "natural occurrence" refers to an organism obtained using recombinant DNA technology in which the donor and host of the inserted DNA in the recombinant are classified as different species, and it has been shown that gene exchange between them occurs in nature, and the donor and host of the inserted DNA in the recombinant belong to both species. Furthermore, as used herein, "mutation" refers to a change in genetic information, caused by errors during DNA replication, DNA damage by chemicals, replication errors, DNA or chromosomal damage due to radiation exposure, or gene disruption due to transposon transfer. Mutations that occur without artificial manipulation are specifically referred to as "spontaneous mutations."

[0021] (2. Starmerella bombicola mutant strain) The present inventors continued subculturing a type strain of Starmerella bombicola used in glycolipid production, and obtained a mutant strain in which a mutation was introduced into a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2, and which exhibited adenine auxotrophy. The amino acid sequence shown in SEQ ID NO: 2 is an amino acid sequence based on a specific ORF discovered as a result of ORF analysis conducted by the present inventors on Starmerella bombicola, for which ORF analysis had not been fully performed. As shown in the Examples below, a Starmerella bombicola mutant strain having a mutation in a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 can grow in an adenine-containing medium, but cannot grow in an adenine-free medium. Therefore, the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 is presumed to be a polypeptide involved in the adenine biosynthetic pathway of Starmerella bombicola. Furthermore, NCBI CD search revealed that it contains an FMT_core_GART domain, making it highly likely to be a polypeptide with phosphoribosylglycine amidoformyltransferase activity. Therefore, the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 was named the Starmerella bombicola phosphoribosylglycine amidoformyltransferase-like protein. When the expression of the phosphoribosylglycine amidoformyltransferase-like protein is suppressed in adenine-nonrequiring Starmerella bombicola or when the protein is inactivated by reducing or eliminating its function, adenine biosynthesis is impaired or impossible, thereby conferring adenine auxotrophy to the Starmerella bombicola. Conversely, if the expression of a phosphoribosylglycine amidoformyltransferase-like protein is suppressed or the function of the protein is reduced or eliminated, causing the protein to be inactivated and Starmerella bombicola to become adenine-requiring, then the adenine requirement of Starmerella bombicola can be relieved by normally expressing the protein.That is, the phosphoribosylglycine amidoformyltransferase-like protein of Starmerella bombicola is a protein that has the ability to remove the adenine requirement of adenine-requiring Starmerella bombicola, in other words, it is a protein that has the function of making adenine-requiring Starmerella bombicola non-requiring for adenine.

[0022] The present invention provides a Starmerella bombicola mutant strain (hereinafter referred to as the mutant strain of the present invention). In the mutant strain of the present invention, expression of a phosphoribosylglycine amidoformyltransferase-like protein or a protein equivalent thereto is suppressed or inactivated. The mutant strain of the present invention can be produced by suppressing or inactivating expression of a phosphoribosylglycine amidoformyltransferase-like protein or a protein equivalent thereto in Starmerella bombicola. The mutant strain of the present invention exhibits adenine auxotrophy due to suppression or inactivation of expression of a phosphoribosylglycine amidoformyltransferase-like protein or a protein equivalent thereto.

[0023] Here, the "phosphoribosylglycine amidoformyltransferase-like protein" refers to a phosphoribosylglycine amidoformyltransferase-like protein of Starmerella bombicola, and is preferably a polypeptide consisting of the amino acid sequence shown in SEQ ID NO:2.

[0024] Furthermore, a "protein equivalent to the phosphoribosylglycine amidoformyltransferase-like protein" refers to a protein having the same function as the phosphoribosylglycine amidoformyltransferase-like protein of Starmerella bombicola, and includes homologs, orthologs, or variants thereof of the phosphoribosylglycine amidoformyltransferase-like protein of Starmerella bombicola. A protein equivalent to the phosphoribosylglycine amidoformyltransferase-like protein is preferably a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 2. Examples of amino acid sequences having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 2 include amino acid sequences in which one or several amino acids have been deleted, substituted, added, or inserted relative to the amino acid sequence shown in SEQ ID NO: 2.

[0025] Preferably, the mutant strain of the present invention is a mutant strain in which the expression of a phosphoribosylglycine amidoformyltransferase-like protein or a protein corresponding thereto is suppressed compared to the strain before mutation (parent strain). In one embodiment, the mutant strain of the present invention may be a mutant strain in which the expression level of a phosphoribosylglycine amidoformyltransferase-like protein or a protein corresponding thereto is reduced to 50% or less, preferably 40% or less, more preferably 30% or less, even more preferably 20% or less, even more preferably 10% or less, and even more preferably 5% or less, compared to the parent strain. Even more preferably, the mutant strain of the present invention may be a mutant strain in which the expression level of a phosphoribosylglycine amidoformyltransferase-like protein or a protein corresponding thereto is reduced to an undetectable level (below the expression level of a negative control or background). The expression level of a protein or polypeptide can be measured by commonly used protein expression quantification methods, such as, but not limited to, colorimetry, fluorometry, Western blotting, ELISA, radioimmunoassay, etc.

[0026] Means for suppressing or inactivating the expression of Starmerella bombicola phosphoribosylglycine amidoformyltransferase-like proteins or proteins equivalent thereto include methods of deleting or inactivating the genes encoding them, methods of inactivating mRNA transcribed from the genes encoding them, methods of suppressing translation of mRNA of the genes encoding them by RNA interference using siRNA or the like, methods of mutating the genes encoding them to reduce the activity of the protein, methods of inactivating the protein with inhibitors such as aptamers or antibodies, etc. In a preferred embodiment, the mutant strain of the present invention is a mutant strain in which the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein or a gene equivalent thereto has been deleted or inactivated.

[0027] Here, the "gene encoding a phosphoribosylglycine amidoformyltransferase-like protein" refers to a gene encoding a phosphoribosylglycine amidoformyltransferase-like protein of Starmerella bombicola, and is preferably a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1.

[0028] Furthermore, a "gene equivalent to the gene encoding a phosphoribosylglycine amidoformyltransferase-like protein" is a gene encoding a protein equivalent to the above-mentioned phosphoribosylglycine amidoformyltransferase-like protein of Starmerella bombicola, preferably a gene consisting of a nucleotide sequence at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 1, more preferably a gene consisting of a nucleotide sequence at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 1, and encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or a polypeptide consisting of an amino acid sequence at least 90% identical to the amino acid sequence shown in SEQ ID NO: 2. Examples of nucleotide sequences at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 1 include nucleotide sequences in which one or several nucleotides have been deleted, substituted, added, or inserted relative to the nucleotide sequence shown in SEQ ID NO: 1.

[0029] Methods for deleting or inactivating a Starmerella bombicola gene include introducing a mutation (deletion, insertion, substitution, or addition) into one or more nucleotides in the nucleotide sequence of the target gene, substituting or inserting another nucleotide sequence into the nucleotide sequence, or deleting part or all of the nucleotide sequence. Alternatively, similar mutations or substitutions, insertions, or deletions of nucleotide sequences may be performed in a control region, such as the promoter region, of the target gene. For example, by introducing a mutation into the promoter that controls the expression of the target gene or replacing it with a promoter with a lower expression level, promoter activity can be reduced or eliminated, thereby reducing or eliminating mRNA transcription from the target gene, thereby inactivating the target gene.

[0030] Specific techniques for the above-mentioned mutagenesis, or substitution, insertion, or deletion of nucleotide sequences can be methods for genetic modification of microorganisms known in the art. Examples of such methods include, but are not limited to, ultraviolet irradiation, site-specific mutagenesis, homologous recombination using SOE-PCR (splicing by overlap extension PCR: Gene, 1989, 77:61-68), and genome editing using artificial DNA nucleases or programmable nucleases.

[0031] After the above-mentioned mutagenesis or substitution, insertion, or deletion of a nucleotide sequence, genetic analysis or evaluation of the expression level of mRNA or polypeptide encoded by the target gene can be performed to select cells having the desired mutation, thereby obtaining the mutant strain of the present invention.

[0032] Alternatively, when the gene deletion or inactivation method is a homologous recombination method using SOE-PCR, a drug resistance marker gene can be incorporated into a gene deletion DNA fragment to replace the target gene DNA, and cells into which the deletion DNA fragment has been introduced can be cultured on a drug-containing medium, and growing colonies can be isolated to obtain a mutant strain in which the target gene has been deleted. Furthermore, the mutation may be confirmed by the above-mentioned genetic analysis or evaluation of the expression level of the polypeptide. By the above procedure, the mutant strain of the present invention can be obtained in which a gene encoding a phosphoribosylglycine amidoformyltransferase-like protein or a gene corresponding thereto has been deleted or inactivated.

[0033] Alternatively, the mutant strain of the present invention in which the expression of a phosphoribosylglycine amidoformyltransferase-like protein or a protein equivalent thereto is suppressed or inactivated can be obtained by confirming the adenine requirement of the mutant strain prepared by the above procedure.

[0034] Furthermore, the mutant strain of the present invention may be a spontaneous mutant strain in which the expression of a phosphoribosylglycine amidoformyltransferase-like protein or a protein corresponding thereto is suppressed or inactivated due to a spontaneous mutation that has occurred without artificial mutagenesis. The spontaneous mutant strain can be obtained, for example, by subculturing a parent strain using a culture method known in the art that does not involve artificial mutagenesis, and then performing genetic analysis or evaluating the expression level of mRNA or polypeptide encoded by the target gene on cells that have characteristics different from those of normal cells that arise during the culture, and selecting cells having the desired mutation, or by confirming adenine requirement.

[0035] A preferred example of the mutant strain of the present invention is the Starmerella bombicola T1 strain (hereinafter simply referred to as the T1 strain). The T1 strain was deposited on March 7, 2024, at the Patent Microorganisms Depositary of the National Institute of Technology and Evaluation (Room 122, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan) (Accession No. NITE BP-04096). As shown in the Examples below, the T1 strain was generated by subculturing the Starmerella bombicola NBRC10243 strain as a parent strain, and exhibits adenine auxotrophy as a result of a mutation in a gene encoding a phosphoribosylglycine amidoformyltransferase-like protein. The T1 strain was generated by subculturing without artificial mutation manipulation, and is therefore considered to be a strain that corresponds to a natural mutation.

[0036] (3. Transformation Method) The mutant strain of the present invention exhibits adenine auxotrophy due to suppression or inactivation of expression of a phosphoribosylglycine amidoformyltransferase-like protein or a protein equivalent thereto. A gene encoding a phosphoribosylglycine amidoformyltransferase-like protein or a gene equivalent thereto is a gene involved in the adenine auxotrophy of Starmerella bombicola and can function as an auxotrophic (adenine) selection marker (self-marker) derived from an endogenous gene of Starmerella bombicola. Therefore, the mutant strain of the present invention is useful as a host in a transformation method of Starmerella bombicola, particularly as a host in a transformation method of Starmerella bombicola in which transformants are selected using the presence or absence of adenine auxotrophy as an indicator. Therefore, the present invention also provides a transformation method of Starmerella bombicola, which comprises using the mutant strain of the present invention as a host.

[0037] In the transformation method of the present invention, the polynucleotide introduced into the host is not particularly limited and may be any polynucleotide. The polynucleotide may be derived from a microorganism of the same species as the host (i.e., Starmerella bombicola) into which it is introduced, or from a microorganism of a different species from the host. However, since the resulting transformant may be a self-cloning or natural occurrence, polynucleotides derived from a microorganism of the same species as the host or a microorganism of a different species from the host where genetic exchange between the two has been shown to occur in nature are preferred, and polynucleotides derived from a microorganism of the same species as the host are even more preferred. The polynucleotide may be isolated from nature, synthesized, or produced using genetic engineering techniques. The polypeptide may be in the form of single-stranded or double-stranded DNA, RNA, or artificial nucleic acid, or may be cDNA or intron-free chemically synthesized DNA. The polynucleotide may also be codon-optimized for the host species. Information on codons used by various organisms is available from the Codon Usage Database ([www.kazusa.or.jp / codon / ]).

[0038] The polynucleotide can be introduced into a host by, for example, introducing a vector or a DNA fragment containing the polynucleotide into the host.

[0039] The vector containing the polynucleotide may be a vector capable of autonomously replicating and replicating outside the chromosome, or may be a vector integrated into the chromosome. The type of vector is not particularly limited, and examples include plasmids, cosmids, phages, viruses, YACs, and BACs. Among these, plasmid vectors are preferred. Those skilled in the art can select a suitable vector depending on the type of host. Plasmid vectors may be prepared according to the host, or commercially available products may be used.

[0040] Examples of DNA fragments containing the above polynucleotides include PCR-amplified DNA fragments and restriction enzyme-cleaved DNA fragments.

[0041] The above-mentioned vectors or DNA fragments may further incorporate a selection marker such as an antibiotic resistance gene or an auxotrophy-related gene in order to select transformants into which the vector or DNA fragment has been appropriately introduced. Alternatively, the selection marker may be incorporated into the vector or DNA fragment as both a selection marker and a polynucleotide to be introduced into the host. The selection marker to be incorporated into the vector or DNA fragment is preferably a gene encoding a Starmerella bombicola phosphoribosylglycine amidoformyltransferase-like protein or a gene equivalent thereto, more preferably a gene encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or a polypeptide consisting of an amino acid sequence at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 2, even more preferably a gene consisting of the nucleotide sequence set forth in SEQ ID NO: 1 or a gene consisting of a nucleotide sequence at least 90% identical to the nucleotide sequence set forth in SEQ ID NO: 1, and even more preferably a gene consisting of the nucleotide sequence set forth in SEQ ID NO: 1.

[0042] When the polynucleotide to be introduced into a host contains a gene, the vector or DNA fragment preferably further contains, in addition to the gene, a control region operably linked to the gene. The control region is a sequence for expressing the gene in the host into which the vector or DNA fragment has been introduced, and examples thereof include expression regulatory regions such as promoters and terminators, origins of replication, and secretion signal regions for secreting the expressed protein extracellularly. The type of control region is not particularly limited, and commonly used promoters and secretion signal sequences can be appropriately selected and used depending on the host into which the vector or DNA fragment is introduced. For example, suitable examples of control sequences include promoters and secretion signal sequences derived from Starmerella bombicola.

[0043] The polynucleotide contained in the vector or DNA fragment to be introduced into a host may be introduced into the nucleus of the host, or may be introduced into the host genome. A method for introducing a polynucleotide into a genome includes homologous recombination.

[0044] The vector or DNA fragment can be introduced into a host by any commonly used method, such as electroporation, particle gun method, lithium acetate method, or heat treatment.

[0045] Transformants into which a vector or DNA fragment of interest has been introduced can be selected using a selection marker. For example, if the selection marker is an antibiotic resistance gene, transformants into which a vector or DNA fragment of interest has been introduced can be selected by culturing cells in a medium supplemented with the antibiotic. Furthermore, for example, if the selection marker is an auxotrophy-related gene, the vector or DNA fragment can be introduced into a host with a specific auxotrophy, and then the presence or absence of the auxotrophy can be used as an indicator to select transformants into which a vector or DNA fragment of interest has been introduced. Alternatively, the introduction of a vector or DNA fragment of interest can be confirmed by examining the DNA sequence of the transformant using PCR or the like.

[0046] In a preferred embodiment, the transformation method of the present invention uses a gene encoding a phosphoribosylglycine amidoformyltransferase-like protein of Starmerella bombicola or a gene equivalent thereto as a selection marker. This gene is involved in the adenine requirement of Starmerella bombicola. The mutant strain of the present invention used as a host in the transformation method of the present invention is adenine auxotrophic, but a transformant into which this gene has been introduced is relieved of its adenine requirement and becomes adenine-nonauxotrophic, and can grow in adenine-free medium. Therefore, by culturing cells in adenine-free medium, it is possible to select a transformant into which a vector or DNA fragment of interest has been introduced. Furthermore, because the gene functions as a self-marker for Starmerella bombicola, a transformant obtained by the transformation method of the present invention using the gene as a selection marker can be considered self-cloning as long as the host is a mutant strain of the present invention, preferably the T1 strain, that does not contain a foreign gene, and the polynucleotide introduced into the host is derived from a microorganism of the same species as the host (i.e., Starmerella bombicola). Alternatively, the transformant can be considered natural occurrence as long as the polynucleotide introduced into the host is derived from a microorganism of a different species from the host, where gene exchange between the two has been shown to occur in nature. Therefore, in a more preferred embodiment, the transformation method of the present invention uses a Starmerella bombicola phosphoribosylglycine amidoformyltransferase-like protein gene or a gene equivalent thereto as a selection marker, a mutant strain of the present invention that does not contain a foreign gene as a host, and a polynucleotide introduced into the host is derived from a microorganism of the same species as the host or a microorganism of a different species from the host, where gene exchange between the two has been shown to occur in nature, more preferably a polynucleotide derived from a microorganism of the same species as the host.

[0047] A gene encoding a Starmerella bombicola phosphoribosylglycine amidoformyltransferase-like protein or a gene equivalent thereto as a self-marker can be prepared from Starmerella bombicola harboring the gene by extracting genomic DNA using standard methods, or by extracting RNA and synthesizing cDNA by reverse transcription. For example, a gene encoding a Starmerella bombicola phosphoribosylglycine amidoformyltransferase-like protein can be prepared from the Starmerella bombicola NBRC10243 strain. A gene equivalent to the gene encoding a Starmerella bombicola phosphoribosylglycine amidoformyltransferase-like protein can be prepared by modifying a gene encoding a Starmerella bombicola phosphoribosylglycine amidoformyltransferase-like protein using various known mutagenesis techniques. Alternatively, a gene encoding a phosphoribosylglycine amidoformyltransferase-like protein of Starmerella bombicola or a gene equivalent thereto can be prepared by genetic engineering or chemically synthesizing a corresponding nucleotide sequence based on the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity thereto.

[0048] (4. Method for Producing Glycolipids) Starmerella bombicola is known to produce glycolipids using hydrocarbon chains of various chain lengths, fatty acids, etc. as substrates. Therefore, by culturing the mutant strain of the present invention described in 2 above or the transformant obtained by the transformation method of the present invention described in 3 above (hereinafter referred to as the transformant of the present invention) together with a substrate of an appropriate chain length, glycolipids containing constituent hydrocarbon chains, fatty acids, etc. of a desired chain length can be efficiently produced. Therefore, the present invention also provides a method for producing glycolipids, which comprises culturing the mutant strain of the present invention or the transformant of the present invention.

[0049] The glycolipid is not particularly limited as long as it can be produced by the mutant strain or transformant of the present invention, but preferably includes a glycolipid containing glucose or an acetylated form thereof as the sugar constituting the sugar or sugar chain, more preferably includes a glycolipid containing glucose, sophorose, cellobiose or an acetylated form thereof as the sugar or sugar chain, even more preferably includes sophorolipid, Bola-type sophorolipid, Bola-type sophoroside, alkylsophoroside, alkylglucoside, Bola-type glucoside, acidic glucolipid and cellobioselipid, and even more preferably includes sophorolipid, Bola-type sophoroside, and alkylsophoroside.

[0050] The transformant used in the method for producing glycolipids of the present invention is not particularly limited, as long as it is a transformant obtained by the transformation method of the present invention. For example, a transformant modified to improve the glycolipid-producing ability of Starmerella bombicola is preferably used. Examples of transformants modified to improve the glycolipid-producing ability of Starmerella bombicola include a transformant in which the expression of a polypeptide involved in suppressing the ability to produce a target glycolipid in Starmerella bombicola is suppressed or inactivated, a transformant in which the expression of a polypeptide involved in improving the ability to produce a target glycolipid in Starmerella bombicola is enhanced, and a transformant in which the expression of various enzymes required to produce a target glycolipid is enhanced in Starmerella bombicola.

[0051] In a preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which the expression of a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 23 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 23 has been suppressed or inactivated by the transformation method of the present invention. The polypeptide comprising the amino acid sequence shown in SEQ ID NO: 23 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 23 is a putative transcription factor protein, more preferably a putative transcription factor protein having two Zinc Finger C2H2-type DNA-binding domains. The presence or absence of a Zinc Finger C2H2-type DNA-binding domain in a certain polypeptide can be confirmed by analyzing the amino acid sequence using, for example, NCBI CD search, although the method for analyzing the presence or absence of the domain is not limited thereto. The transformant is preferably a transformant in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO:23 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO:23 has been deleted or inactivated, more preferably a transformant in which a gene encoding the nucleotide sequence shown in SEQ ID NO:22 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO:22 has been deleted or inactivated, and even more preferably a transformant in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO:22 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO:22 and consisting of the amino acid sequence shown in SEQ ID NO:23 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO:23 has been deleted or inactivated. Here, it has been reported that the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 23 is encoded by the nucleotide sequence shown in SEQ ID NO: 22 in Starmerella bombicola, and that a Starmerella bombicola mutant strain in which the expression of the polypeptide is suppressed or inactivated has improved sophorolipid production ability compared to the parent strain (Japanese Patent No. 6725506).A specific example of the transformant is the Starmerella bombicola T1Δseq1::ade strain shown in the Examples below. The T1Δseq1::ade strain is a self-cloning strain because, through transformation using the T1 strain, which is thought to be a spontaneous mutant strain, as a host, a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1 present in the genome of the Starmerella bombicola NBRC10243 strain has been inserted in place of the gene consisting of the nucleotide sequence shown in SEQ ID NO: 22 present in the genome of the T1 strain.

[0052] In another preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which expression of FAO1 (fatty alcohol oxidase 1) or a protein equivalent thereto has been suppressed or inactivated by the transformation method of the present invention. Here, "FAO1" refers to Starmerella bombicola FAO1, a polypeptide having fatty alcohol oxidase activity, and preferably a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 35. Furthermore, "a protein equivalent to FAO1" refers to a protein having the same function as Starmerella bombicola FAO1, and includes homologs, orthologs, or variants thereof of Starmerella bombicola FAO1. The protein equivalent to FAO1 is preferably a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 35. Examples of amino acid sequences having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 35 include amino acid sequences in which one or several amino acids have been deleted, substituted, added, or inserted relative to the amino acid sequence shown in SEQ ID NO: 35. The transformant is preferably a transformant in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 35 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 35 has been deleted or inactivated, more preferably a transformant in which a gene consisting of the nucleotide sequence shown in SEQ ID NO: 34 or a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 34 has been deleted or inactivated, and even more preferably a transformant in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 34 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 34 and consisting of the amino acid sequence shown in SEQ ID NO: 35 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 35 has been deleted or inactivated.It has been reported that a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 35 is encoded in Starmerella bombicola by the nucleotide sequence shown in SEQ ID NO: 34, and that a Starmerella bombicola mutant strain in which the expression of this polypeptide is suppressed or inactivated is capable of producing Bola-type sophorosides, alkylsophorosides, alkylglucosides, and Bola-type glucosides (Appl Microbiol Biotechnol. 2016 Nov;100(22):9519-9528). A specific example of the above transformant is the Starmerella bombicola T1Δfao1::ade strain shown in the Examples below. The T1Δfao1::ade strain is considered to be a self-cloning strain because, through transformation using the T1 strain, which is considered to be a spontaneous mutant strain, as a host, a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1 present in the genome of Starmerella bombicola NBRC10243 strain has been inserted in place of the fao1 gene consisting of the nucleotide sequence shown in SEQ ID NO: 34 present in the genome of the T1 strain.

[0053] In the method for producing glycolipids of the present invention, the mutant strain of the present invention or the transformant of the present invention is cultured in a medium containing substrates such as fatty acids, fatty acid alkyl esters, triacylglycerols, diacylglycerols, monoacylglycerols, fats and oils, alkanes, alkenes, alkynes, alcohols, etc. Glycolipids can be produced by recovering them from the medium after the culture and purifying them as necessary.

[0054] The medium used for the above-mentioned culture can be a conventional medium containing a carbon source, a nitrogen source, inorganic salts, and, if necessary, organic trace nutrients such as amino acids and vitamins. The medium may be either a synthetic medium or a natural medium.

[0055] The carbon and nitrogen sources contained in the medium may be of any type that can be utilized by the mutant or transformant being cultured. Examples of carbon sources include sugars such as glucose, glycerol, fructose, sucrose, maltose, mannose, galactose, starch hydrolysates, and molasses; organic acids such as acetic acid and citric acid; and alcohols such as ethanol. These carbon sources can be used alone or in combination of two or more. Examples of nitrogen sources include ammonia; ammonium salts such as ammonium sulfate, ammonium carbonate, ammonium chloride, ammonium phosphate, and ammonium acetate; nitrates; and urea.

[0056] Examples of the inorganic salts include phosphates, magnesium salts, calcium salts, iron salts, manganese salts, etc. Examples of the organic trace nutrients include amino acids, vitamins, fatty acids, nucleic acids, and peptones containing these, casamino acids, yeast extract, soy protein hydrolysates, etc. When using an auxotrophic mutant or transformant that requires amino acids or the like for growth, the required nutrients may be supplemented.

[0057] Preferred examples of substrates that can be contained in the medium include C12-22 fatty acids and their alkyl esters, triacylglycerols containing C12-22 fatty acids or their alkyl esters, diacylglycerols and monoacylglycerols, oils and fats containing C12-22 fatty acids or their alkyl esters, C12-22 alkanes, C12-22 alkenes, C12-22 alkynes, and C12-22 alcohols. More preferred examples include C12-18 fatty acids and their alkyl esters, triacylglycerols containing C12-18 fatty acids or their alkyl esters, diacylglycerols and monoacylglycerols, oils and fats containing C12-18 fatty acids or their alkyl esters, C12-18 alkanes, C12-18 alkenes, C12-18 alkynes, and C12-18 alcohols. Even more preferred examples include C12-18 fatty acids and their alkyl esters, and C12-18 alcohols.

[0058] More specific examples of the substrate include, but are not limited to, the C12-22 fatty acids, which may be saturated or unsaturated, and may be straight-chain or branched, such as lauric acid, tridecylic acid, myristic acid, pentadecylic acid, palmitic acid, margaric acid, stearic acid, isostearic acid, nonadecylic acid, arachidic acid, behenic acid, palmitoleic acid, oleic acid, linoleic acid, α-linolenic acid, γ-linolenic acid, arachidonic acid, eicosapentaenoic acid, and docosahexaenoic acid; the alkyl esters of the C12-22 fatty acids include alkyl esters of the above-listed fatty acids having 1 to 4 carbon atoms, preferably methyl esters and ethyl esters; and the fats and oils containing the C12-22 fatty acids or alkyl esters thereof include coconut oil, palm oil, palm kernel oil, olive oil, rapeseed oil, rice bran oil, soybean oil, castor oil, and mahua oil.

[0059] The C12-22 alkanes may be straight-chain or branched, and examples thereof include dodecane, tridecane, tetradecane, pentadecane, hexadecane, hexadecene, heptadecane, octadecane, nonadecane, icosane, henicosane, and docosane; the C12-22 alkenes may be straight-chain or branched, and examples thereof include 1-dodecene, 1-tridecene, 1-tetradecene, 1-pentadecene, and 1-hexadecane. Examples of the C12-22 alkyne include decene, 1-heptadecene, 1-octadecene, 1-nonadecene, 1-icosene, 1-heneicosene, and 1-docosene; the C12-22 alkyne may be linear or branched, and examples thereof include 1-dodecyne, 1-tridecyne, 1-tetradecyne, 1-pentadecyne, 1-hexadecyne, 1-heptadecyne, 1-octadecyne, 1-nonadecyne, 1-icosine, 1-heneicosine, and 1-docosine.

[0060] The C12-22 alcohol may be a saturated or unsaturated alcohol, and may be a straight-chain or branched-chain alcohol, and examples thereof include lauryl alcohol, tridecyl alcohol, myristyl alcohol, pentadecyl alcohol, cetyl alcohol, heptadecyl alcohol, stearyl alcohol, isostearyl alcohol, nonadecyl alcohol, arachidyl alcohol, behenyl alcohol, palmitoleyl alcohol, oleyl alcohol, linoleyl alcohol, and linolenyl alcohol.

[0061] The substrates listed above can be used alone or in combination of two or more. Preferably, fatty acids or alkyl esters thereof with a chain length of C12 to C18, or triacylglycerols, diacylglycerols, monoacylglycerols, or fats and oils containing them, or alkanes, alkenes, alkynes, or alcohols with a chain length of C12 to C18 are used. More preferably, fatty acids or alkyl esters thereof with a chain length of C12 to C18, or alcohols with a chain length of C12 to C18 are used. Even more preferably, fatty acids or alkyl esters thereof with a chain length of C16 to C18, or alcohols with a chain length of C16 to C18, are used. Even more preferably, C18 fatty acids or alkyl esters thereof, or C18 alcohols are used. Even more preferably, oleic acid or alkyl esters thereof, or oleyl alcohol are used. Rapeseed oil, whose main component is triacylglycerol containing a large amount of oleic acid as a constituent fatty acid, is also preferably used.

[0062] The content of the substrate that can be contained in the medium (at the time of adding the substrate) is preferably 1% by mass or more, more preferably 3% by mass or more, even more preferably 5% by mass or more, and preferably 30% by mass or less, more preferably 20% by mass or less, even more preferably 15% by mass or less, or preferably 1 to 30% by mass, 1 to 20% by mass, 1 to 15% by mass, 3 to 30% by mass, 3 to 20% by mass, 3 to 15% by mass, 5 to 30% by mass, 5 to 20% by mass, or 5 to 15% by mass.

[0063] The culture conditions may be any conditions that allow the mutant strain or transformant of the present invention to produce glycolipids by fermentation. Culturing is preferably carried out under aerobic conditions, and common methods such as aeration and agitation culture and shaking culture can be applied. The culture temperature is preferably 20 to 33°C, more preferably 25 to 30°C, and even more preferably 28 to 30°C. The initial pH of the medium (30°C) is preferably 2 to 7, more preferably 3 to 6. The culture time is preferably about 24 to 200 hours, and more preferably 50 to 200 hours.

[0064] In the above-mentioned culture, the mutant strain of the present invention or the transformant of the present invention may be cultured under conditions in which the cells grow, thereby producing glycolipids by fermentation, or the mutant strain of the present invention or the transformant of the present invention may be cultured in a resting cell state, i.e., in a state in which growth and proliferation have stopped, thereby producing glycolipids by fermentation.

[0065] The method for recovering glycolipids from the culture medium after cultivation is not particularly limited, and may be performed according to a known recovery method. For example, glycolipids in the culture medium can be recovered or purified by solvent extraction using ethyl acetate, butanol, etc., fractional precipitation, liquid-liquid partitioning, column chromatography, high-performance liquid chromatography, etc., either alone or in combination as appropriate.

[0066] The following compositions, manufacturing methods, uses, and methods are further disclosed herein as exemplary embodiments of the present invention, but the present invention is not limited to these embodiments.

[0067] [1] A Starmerella bombicola mutant strain in which the expression of a phosphoribosylglycine amidoformyltransferase-like protein or a protein corresponding thereto is suppressed or inactivated. [2] The mutant strain of [1], in which the phosphoribosylglycine amidoformyltransferase-like protein is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2, and the protein corresponding to the phosphoribosylglycine amidoformyltransferase-like protein is a polypeptide consisting of an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 2. [3] The mutant strain of [1] or [2], in which a gene encoding the phosphoribosylglycine amidoformyltransferase-like protein or a gene corresponding thereto is deleted or inactivated. [4] The mutant strain of [3], in which the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of the nucleotide sequence set forth in SEQ ID NO: 1, and the gene corresponding to the phosphoribosylglycine amidoformyltransferase-like protein gene is a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence set forth in SEQ ID NO: 1. [5] The mutant strain according to any one of [1] to [4], which is adenine auxotrophic. [6] The mutant strain according to any one of [1] to [5], which is Starmerella bombicola T1 strain (accession number NITE BP-04096).

[0068] [7] A method for producing a Starmerella bombicola mutant, which comprises suppressing or inactivating the expression of a phosphoribosylglycine amidoformyltransferase-like protein or a protein equivalent thereto in Starmerella bombicola. [8] The method of [7], wherein the phosphoribosylglycine amidoformyltransferase-like protein is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2, and the protein equivalent to the phosphoribosylglycine amidoformyltransferase-like protein is a polypeptide consisting of an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2. [9] The method of [7] or [8], which comprises deleting or inactivating a gene encoding a phosphoribosylglycine amidoformyltransferase-like protein or a gene equivalent thereto.

[10] The method according to [9], wherein the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of the nucleotide sequence set forth in SEQ ID NO: 1, and the gene corresponding to the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence set forth in SEQ ID NO: 1.

[11] The method according to any one of [7] to

[10] , which is a method for producing an adenine-requiring Starmerella bombicola mutant.

[0069]

[12] A method for transforming Starmerella bombicola, comprising using the mutant strain according to any one of [1] to [6] as a host.

[13] The method according to

[12] , further comprising introducing a gene encoding a phosphoribosylglycine amidoformyltransferase-like protein or a gene corresponding thereto into the host as an adenine-requiring selection marker.

[14] The method according to

[13] , wherein the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of the nucleotide sequence set forth in SEQ ID NO: 1, and the gene corresponding to the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence set forth in SEQ ID NO: 1.

[15] The method according to any one of

[12] to

[14] , further comprising selecting transformants using the presence or absence of adenine auxotrophy as an indicator.

[16] The method according to any one of

[12] to

[15] , wherein the mutant strain is a mutant strain containing no foreign gene, preferably Starmerella bombicola T1 strain, and a polynucleotide derived from a microorganism of the same species as the host or a microorganism of a different species from the host, where gene exchange between the host and the different species has been shown to occur in nature, preferably a polynucleotide derived from a microorganism of the same species as the host, is introduced into the host.

[17] The method according to any one of

[12] to

[16] , wherein a transformant capable of growing in an adenine-free medium is selected.

[0070]

[18] A transformant obtained by the method according to any one of

[12] to

[17] .

[19] The transformant according to

[18] , in which the expression of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO:23 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO:23 is suppressed or inactivated.

[20] The transformant according to

[19] , in which the gene consisting of the nucleotide sequence shown in SEQ ID NO:22 or a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO:22 is deleted or inactivated.

[21] The transformant according to

[18] , in which the expression of FAO1 or a protein corresponding thereto is suppressed or inactivated.

[22] The transformant according to

[21] , in which the FAO1 is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO:35, and the protein corresponding to FAO1 is a polypeptide consisting of an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO:35.

[23] The transformant according to

[18] , in which the fao1 gene or a gene corresponding thereto is deleted or inactivated.

[24] A transformant described in

[23] , wherein the fao1 gene is a gene consisting of the nucleotide sequence shown in SEQ ID NO: 34, and the gene corresponding to the fao1 gene is a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 34.

[0071]

[25] A method for producing a glycolipid, comprising culturing the mutant strain according to any one of [1] to [6] or the transformant according to any one of

[18] to

[24] .

[26] The method according to

[25] , wherein the glycolipid is selected from sophorolipids, Bola-type sophorolipids, Bola-type sophorosides, alkylsophorosides, alkylglucosides, Bola-type glucosides, acidic glucolipids, and cellobioselipids, preferably sophorolipids, Bola-type sophorosides, and alkylsophorosides.

[27] The method according to

[25] or

[26] , wherein the culture medium for the culture contains the following substrates: at least one substrate selected from the group consisting of C12 to C22 fatty acids and alkyl esters thereof, triacylglycerols containing C12 to C22 fatty acids or alkyl esters thereof, diacylglycerols and monoacylglycerols, fats and oils containing C12 to C22 fatty acids or alkyl esters thereof, C12 to C22 alkanes, C12 to C22 alkenes, C12 to C22 alkynes, and C12 to C22 alcohols; At least one substrate selected from the group consisting of C12 to C18 fatty acids and alkyl esters thereof, triacylglycerols containing C12 to C18 fatty acids or alkyl esters thereof, diacylglycerols and monoacylglycerols, fats and oils containing C12 to C18 fatty acids or alkyl esters thereof, C12 to C18 alkanes, C12 to C18 alkenes, C12 to C18 alkynes, and C12 to C18 alcohols; or at least one substrate selected from the group consisting of C12 to C18 fatty acids and alkyl esters thereof, and C12 to C18 alcohols.

[28] The method according to

[27] , wherein the content of the substrate in the medium is preferably 1% by mass or more, more preferably 3% by mass or more, even more preferably 5% by mass or more, and preferably 30% by mass or less, more preferably 20% by mass or less, even more preferably 15% by mass or less, or preferably 1 to 30% by mass, 1 to 20% by mass, 1 to 15% by mass, 3 to 30% by mass, 3 to 20% by mass, 3 to 15% by mass, 5 to 30% by mass, 5 to 20% by mass, or 5 to 15% by mass.

[29] The method according to any one of

[25] to

[28] , further comprising recovering glycolipids from the medium after the culture.

[0072]

[30] An adenine-requiring selectable marker consisting of a gene encoding a phosphoribosylglycine amidoformyltransferase-like protein or a gene equivalent thereto.

[31] The adenine-requiring selectable marker according to

[30] , wherein the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of the nucleotide sequence set forth in SEQ ID NO: 1, and the gene equivalent to the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence set forth in SEQ ID NO: 1.

[32] Use of a phosphoribosylglycine amidoformyltransferase-like protein gene or a gene equivalent thereto as an adenine-requiring selectable marker.

[33] The use according to

[32] , wherein the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of the nucleotide sequence set forth in SEQ ID NO: 1, and the gene equivalent to the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence set forth in SEQ ID NO: 1.

[34] A vector or DNA fragment containing a phosphoribosylglycine amidoformyltransferase-like protein gene or a gene corresponding thereto.

[35] The vector or DNA fragment according to

[34] , wherein the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1, and the gene corresponding to the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 1.

[0073] The present invention will be described in more detail below using examples, but the technical scope of the present invention is not limited to the following examples.

[0074] Example 1 Obtaining a Starmerella bombicola mutant (1) Obtaining the T1 strain Using the NBRC10243 strain (ATCC22214 strain) as the type strain of Starmerella bombicola, semi-continuous culture for the purpose of glycolipid production was carried out. One loopful of NBRC10243 strain glycerol stock was inoculated into YPD agar medium (1% glucose, 1% yeast extract, 1% tryptone, 1.5% agar) and subjected to static culture at 30 ° C. Next, one loopful of the grown cells was inoculated into 75 mL of YPD medium (1% glucose, 1% yeast extract, 1% tryptone) in a Sakaguchi flask and subjected to shaking culture at 30 ° C. and 120 rpm for 42 hours. To 1.2 L of glycolipid production medium 1 (0.1% urea, 2% yeast extract, 10% ethyl palmitate, 10% glucose), 24 mL of the aforementioned seed culture was added, and the mixture was cultured in a 2 L jar fermenter at 30°C with stirring. After this, aeration, agitation, and temperature control were stopped, and the mixture was allowed to stand for 1 hour. The glycolipid layer was then removed. To the remaining aqueous layer, 120 g of ethyl palmitate and 120 g of glucose were added, and sterilized water was added to bring the volume to 1.2 L. After this, aeration, agitation, and 30°C control were resumed. The above procedure was repeated, and the culture solution cultured for 15 days was appropriately diluted, and single colonies were isolated on YPD agar medium. The isolated colonies were again cultured and evaluated on glycolipid production medium 1. Colonies whose characteristics during culture differed from those of normal colonies were designated as Starmerella bombicola T1 strain. The T1 strain is a spontaneous mutant, and analysis of its genome confirmed that a mutation had been introduced into the gene set forth in SEQ ID NO:1.

[0075] (2) Confirmation of Mutation in T1 Strain Using single colonies of NBRC10243 and T1 strains as templates, PCR was performed using primers (SEQ ID NO: 3: ATGTCGATAGTTGTGCTGATTTCG, SEQ ID NO: 4: CTAGATGCCCTTGTGAATGCGTG) to confirm the presence or absence of amplification of the nucleotide sequence shown in SEQ ID NO: 1. As a control, PCR was performed using primers (SEQ ID NO: 6: ATGCAGGACGATCAGTACGCTTTG, SEQ ID NO: 7: TTAGGGACAGCGGCGGTGGAC) designed to amplify the nucleotide sequence of the actin gene shown in SEQ ID NO: 5. As a result, amplification of the nucleotide sequence shown in SEQ ID NO: 1 and the nucleotide sequence shown in SEQ ID NO: 5 was confirmed in NBRC10243 strain, while amplification of the nucleotide sequence shown in SEQ ID NO: 5 was confirmed in T1 strain, but amplification of the nucleotide sequence shown in SEQ ID NO: 1 was not confirmed. These results indicate that the T1 strain has a deletion or mutation of the sequence shown in SEQ ID NO: 1.

[0076] (3) Confirmation of adenine requirement of T1 strain The NBRC10243 strain and the T1 strain were inoculated into minimal agar medium (0.7% yeast nitrogen base (amino acid-free), 2% glucose, 1.5% agar) and minimal agar + adenine medium (0.03% adenine sulfate, 0.7% yeast nitrogen base (amino acid-free), 2% glucose, 1.5% agar), respectively, and subjected to static culture at 30°C. As a result, growth of the NBRC10243 strain was observed in both media, whereas growth of the T1 strain was observed in minimal agar + adenine medium but not in minimal agar medium (Figure 1). Therefore, it was confirmed that the T1 strain is adenine-requiring.

[0077] Example 2 Preparation of transformant and production of glycolipid 1 (1) Extraction of genomic DNA from NBRC10243 strain Genomic DNA was extracted and purified from the NBRC10243 strain using GenToru-kun (for yeast) High Recovery (Takara Bio Inc.) according to the attached protocol.

[0078] (2) Amplification of a genomic DNA fragment containing the nucleotide sequence shown in SEQ ID NO: 1 Unless otherwise specified, PrimeSTAR Max DNA Polymerase (Takara Bio Inc.) was used for all PCRs performed hereinafter. A DNA fragment containing the nucleotide sequence shown in SEQ ID NO: 1 was amplified using primers (SEQ ID NO: 8: CCTCTTACCAATTGAACTATGGAAATTAATGAAGAATTGGGCTG and SEQ ID NO: 9: TCGGACAACAATTCATCTGCAGACATAGCCGAAATTCTACTGTGAG) with the genomic DNA of the NBRC10243 strain as a template.

[0079] (3) Amplification of 1 kbp upstream and 1 kbp downstream genomic DNA fragments of the seq1 gene Similarly, using the genomic DNA of the NBRC10243 strain as a template, a 1 kbp DNA fragment upstream of the seq1 gene was amplified with primers (SEQ ID NO: 10: GCCAAGCTTGCATGCTCCAATTTCTAAGGCGCAAGCGACGCTTCTAG, and SEQ ID NO: 11: TCAATTGGTAAGAGGGAACGCGTAG), and a 1 kbp DNA fragment downstream of the seq1 gene was amplified with primers (SEQ ID NO: 12: TGAATTGTTGTCCGAATGCTCTGC, and SEQ ID NO: 13: AGAGTCGACCTGCAGCCCAACGCCTTGACAAGCTTTCCAAATAGAG).

[0080] (4) Amplification of Vector Fragment Using pHSG298 (Takara Bio Inc.) as a template and primers (SEQ ID NO: 14: GCATGCAAGCTTGGCACTGGCCGTC and SEQ ID NO: 15: CTGCAGGTCGACTCTAGAGGATCCCCG), a vector DNA fragment was amplified.

[0081] (5) Preparation of template plasmid pbJK8 for introduced DNA fragments. Each DNA fragment was purified from the four PCR products described in (2), (3), and (4) using NucleoSpin Gel and PCR Clean-up (Takara Bio Inc.), and then ligated using an In-Fusion HD cloning kit (Clontech). The resulting plasmid solution was used to transform ECOS Competent E. coli DH5α strain (Nippon Gene Co., Ltd.), and the cell suspension was spread on LB agar medium containing kanamycin and allowed to stand overnight at 37°C. Colony PCR was performed using the obtained colonies as templates and Sapphire Amp (Takara Bio Inc.) as the enzyme. Introduction of the target DNA fragment was confirmed using primers (SEQ ID NO: 16: CTCTTCGCTATTACGCCAGC, and SEQ ID NO: 17: CACTTTATGCTTCCGGCTCG). A transformant carrying the plasmid in which gene introduction was confirmed was inoculated into 2 mL of LB liquid medium containing kanamycin and cultured overnight at 37° C. The plasmid was purified from this culture using NucleoSpin Plasmid EasyPure (Takara Bio Inc.), yielding plasmid pbJK8 containing a DNA fragment containing 1 kbp upstream of the seq1 gene and the nucleotide sequence shown in SEQ ID NO: 1, and a DNA fragment containing 1 kbp downstream of the seq1 gene ligated thereto.

[0082] (6) Preparation of DNA fragment to be introduced Plasmid pbJK8 was used as a template, and primers (SEQ ID NO: 18: TCCAATTTCTAAGGCGCAAGCGAC and SEQ ID NO: 19: CCCAACGCCTTGACAAGCTTTCC) were used to amplify a DNA fragment containing 1 kbp upstream of the seq1 gene, a DNA sequence containing SEQ ID NO: 1, and 1 kbp downstream of the seq1 gene. The resulting PCR product was treated with DpnI (Takara Bio Inc.), and the DNA fragment was purified using NucleoSpin Gel and PCR Clean-up (Takara Bio Inc.). The resulting DNA fragment was sequenced, and it was confirmed that the entire DNA fragment was composed of gene sequences present in the genome of the NBRC10243 strain.

[0083] (7) Insertion of DNA Fragment into T1 Strain and Creation of T1Δseq1::ade Strain The T1 strain was transformed by electroporation (Nepa Gene) using the DNA fragment obtained in (6), which contained 1 kbp upstream of the seq1 gene, a DNA sequence containing SEQ ID NO: 1, and 1 kbp downstream of the seq1 gene. The transformed cell sap was spread on minimal agar medium and allowed to stand at 30°C for 3 days. PCR was performed using the resulting colonies as templates and primers (SEQ ID NO: 20: CATGATTGAGTGACGTACGATG and SEQ ID NO: 21: CACAGTTCCATACAAGCCAG), and the amplified fragment was sequenced. After confirming that the introduced DNA fragment had been incorporated into the genome, this strain was designated the Starmerella bombicola T1Δseq1::ade strain. This strain has a DNA sequence containing the nucleotide sequence shown in SEQ ID NO: 1 inserted into its genome, replacing the seq1 gene. It has been reported that deletion or inactivation of the seq1 gene (SEQ ID NO: 22) improves sophorolipid productivity compared to the parent strain (Japanese Patent No. 6725506).

[0084] (8) Confirmation of adenine requirement of T1Δseq1::ade strain The T1Δseq1::ade strain obtained in (7) and the host strain T1 were inoculated onto minimal agar medium and subjected to static culture at 30°C. As a result, growth of the T1 strain on minimal agar medium was not observed, whereas growth of the obtained T1Δseq1::ade strain was observed, confirming that adenine requirement was relieved by insertion of the nucleotide sequence shown in SEQ ID NO: 1. The above results indicate that the adenine requirement of the T1 strain is due to the introduction of a mutation into the gene shown in SEQ ID NO: 1, and that the gene shown in SEQ ID NO: 1 is the gene involved in adenine requirement.

[0085] (9) Confirmation of glycolipid productivity of the T1Δseq1::ade strain The host strain T1 and the T1Δseq1::ade strain obtained in (8) were inoculated into glycolipid production medium 2 (0.1% urea, 2% yeast extract, 5% oleic acid, 12.5% ​​glucose) and cultured with shaking at 30°C. After 72 hours of culture, 5 mL of culture medium was collected, and 4 mL of hexane was added and stirred for 5 seconds. After centrifugation at 3000 rpm and 25°C for 5 minutes, the supernatant hexane fraction was removed. Next, 6 mL of ethyl acetate was added to the remaining solution and stirred for 5 seconds. After centrifugation at 3000 rpm and 25°C for 5 minutes, the entire ethyl acetate fraction was collected. The collected ethyl acetate fraction was volatilized by spraying nitrogen gas, and the dissolved sophorolipids were precipitated. The weight of the precipitated sophorolipid was measured, and the sophorolipid concentration in the culture medium was calculated. The results are shown in Table 1. It was confirmed that sophorolipid was produced in each strain.

[0086]

[0087] Example 3 Preparation of transformants and production of glycolipids 2 (1) Amplification of genomic DNA fragment containing the nucleotide sequence shown in SEQ ID NO: 1 Unless otherwise specified, PrimeSTAR Max DNA Polymerase (Takara Bio Inc.) was used for PCR in all subsequent steps. A DNA fragment containing the nucleotide sequence shown in SEQ ID NO: 1 was amplified using primers (SEQ ID NO: 24: TCCGGAATTGACACAACTATGGAAATTAATGAAGAATTGGGCTG and SEQ ID NO: 25: TAAATCTAGATATCTGCAGACATAGCCGAAATTCTACTGTGAG) with the genomic DNA of the NBRC10243 strain as a template.

[0088] (2) Amplification of 1 kbp upstream and 1 kbp downstream genomic DNA fragments of the fao1 gene Similarly, using the genomic DNA of the NBRC10243 strain as a template, a 1 kbp upstream DNA fragment of the fao1 gene was amplified with primers (SEQ ID NO: 26: GCCAAGCTTGCATGCGAAGGGGCTCTCCGAAGTACATCACTG, and SEQ ID NO: 27: TGTGTCAATTCCGGAAAAACGACAGAAAAGTG), and a 1 kbp downstream DNA fragment of the fao1 gene was amplified with primers (SEQ ID NO: 28: TATCATCTAGATTTATATCACAAGTCACTATTTAC, and SEQ ID NO: 29: AGAGTCGACCTGCAGCTCAATGAACTGAGACAGCAGCTTGTCAC).

[0089] (3) Amplification of Vector Fragment Using pHSG298 (Takara Bio Inc.) as a template and primers (SEQ ID NO: 14: GCATGCAAGCTTGGCACTGGCCGTC and SEQ ID NO: 15: CTGCAGGTCGACTCTAGAGGATCCCCG), a vector DNA fragment was amplified.

[0090] (4) Preparation of template plasmid pbJK8-2 for introduced DNA fragments. Each DNA fragment was purified from the four PCR products described in (1), (2), and (3) using NucleoSpin Gel and PCR Clean-up (Takara Bio Inc.), and then ligated using an In-Fusion HD cloning kit (Clontech). The resulting plasmid solution was used to transform ECOS Competent E. coli DH5α strain (Nippon Gene Co., Ltd.), and the cell suspension was spread on LB agar medium containing kanamycin and allowed to stand overnight at 37°C. Using the resulting colonies as templates, colony PCR was performed using Sapphire Amp (Takara Bio Inc.) as the enzyme. Introduction of the target DNA fragment was confirmed using primers (SEQ ID NO: 16: CTCTTCGCTATTACGCCAGC, and SEQ ID NO: 17: CACTTTATGCTTCCGGCTCG). The transformant carrying the plasmid in which gene introduction was confirmed was inoculated into 2 mL of LB liquid medium containing kanamycin and cultured overnight at 37° C. The plasmid was purified from this culture using NucleoSpin Plasmid EasyPure (Takara Bio Inc.), and plasmid pbJK8-2 was obtained, which contains a DNA fragment in which 1 kbp upstream of the fao1 gene and a DNA fragment containing SEQ ID NO: 1 are ligated with 1 kbp downstream of the fao1 gene.

[0091] (5) Preparation of DNA fragment to be introduced Plasmid pbJK8-2 was used as a template, and primers (SEQ ID NO: 30: GAAGGGCTCTCCGAAGTACATCACTG and SEQ ID NO: 31: CTCAATGAACTGAGACAGCAGCTTGTCAC) were used to amplify a DNA fragment containing 1 kbp upstream of the fao1 gene, a DNA sequence containing SEQ ID NO: 1, and 1 kbp downstream of the fao1 gene. The resulting PCR product was treated with DpnI (Takara Bio Inc.), and the DNA fragment was purified using NucleoSpin Gel and PCR Clean-up (Takara Bio Inc.). The resulting DNA fragment was sequenced, and it was confirmed that the entire DNA fragment was composed of gene sequences present in the genome of the NBRC10243 strain.

[0092] (6) Insertion of DNA Fragment into T1 Strain and Creation of T1Δfao1::ade Strain The T1 strain was transformed by electroporation (Nepa Gene) with the DNA fragment obtained in (5), which contained a 1 kbp upstream region of the fao1 gene, a DNA sequence containing SEQ ID NO: 1, and a 1 kbp downstream region of the fao1 gene. The transformed cell sap was spread on minimal agar medium and allowed to stand at 30°C for 3 days. PCR was performed using the resulting colonies as templates and primers (SEQ ID NO: 32: CTAAGGCCAGTACAAGAGATC and SEQ ID NO: 33: CTAAAGCTCGAATTAATAGAGACACG), and the amplified fragment was sequenced. After confirming that the introduced DNA fragment had been integrated into the genome, this strain was designated the Starmerella bombicola T1Δfao1::ade strain. This strain has a DNA sequence containing the nucleotide sequence shown in SEQ ID NO: 1 integrated into its genome, replacing the fao1 gene. It has been reported that when the fao1 gene (SEQ ID NO: 34) is deleted or inactivated, Bola-type sophorosides and alkyl polyglycosides are mainly produced when alcohols are used as substrates (Appl Microbiol Biotechnol. 2016 Nov;100(22):9519-9528, etc.).

[0093] (7) Confirmation of adenine requirement of T1Δfao1::ade strain The T1Δfao1::ade strain obtained in (6) and the host strain T1 were inoculated into a minimal agar medium and subjected to static culture at 30° C. As a result, growth of the T1 strain on the minimal agar medium was not observed, whereas growth of the obtained T1Δfao1::ade strain was observed, confirming that the adenine requirement was relieved by insertion of the nucleotide sequence shown in SEQ ID NO: 1.

[0094] (8) Confirmation of glycolipid productivity of the T1Δfao1::ade strain. The T1Δfao1::ade strain obtained in (7) was inoculated into glycolipid production medium 3 (0.5% trisodium citrate dihydrate, 0.4% yeast extract, 0.15% ammonium chloride, 0.07% magnesium sulfate heptahydrate, 0.05% sodium chloride, 0.027% calcium chloride dihydrate, 0.1% potassium dihydrogen phosphate, 0.016% dipotassium hydrogen phosphate, 15% glucose) and cultured with shaking at 30°C. After one day of culture, oleyl alcohol was added as a substrate. After four days of culture, 3 mL of the culture medium was collected, and 3 mL of hexane was added and mixed by stirring for 5 seconds. After 5 minutes of centrifugation at 3000 rpm and 25°C, the hexane fraction of the supernatant was removed. Next, 3 mL of butanol was added to the remaining solution and mixed by stirring for 5 seconds. After 5 minutes of centrifugation at 3000 rpm and 25°C, the entire butanol fraction was recovered. An additional 3 mL of butanol was added to the remaining solution, and the same procedure was repeated to recover the entire butanol fraction. The recovered butanol fraction was volatilized by spraying nitrogen gas, and the weight of the dissolved precipitate was measured and defined as the Bola-type sophoroside concentration in the culture medium. As a result, it was confirmed that 37.7 g / L of Bola-type sophoroside was produced in the T1Δfao1::ade strain.

Claims

1. A Starmerella bombicola mutant strain in which the expression of a phosphoribosylglycine amidoformyltransferase-like protein or a protein equivalent thereto is suppressed or inactivated.

2. The mutant strain described in claim 1, wherein the phosphoribosylglycine amidoformyltransferase-like protein is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2, and the protein corresponding to the phosphoribosylglycine amidoformyltransferase-like protein is a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO:

2.

3. The mutant strain according to claim 1 or 2, in which the gene encoding a phosphoribosylglycine amidoformyltransferase-like protein or a gene corresponding thereto is deleted or inactivated.

4. A mutant strain described in claim 3, wherein the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1, and the gene corresponding to the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO:

1.

5. The mutant strain according to any one of claims 1 to 4, which is adenine auxotrophic.

6. The mutant strain according to any one of claims 1 to 5, which is Starmerella bombicola T1 strain (accession number NITE BP-04096).

7. A method for producing a Starmerella bombicola mutant, which comprises suppressing or inactivating the expression of a phosphoribosylglycine amidoformyltransferase-like protein or a protein equivalent thereto in Starmerella bombicola.

8. The method of claim 7, wherein the phosphoribosylglycine amidoformyltransferase-like protein is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2, and the protein corresponding to the phosphoribosylglycine amidoformyltransferase-like protein is a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence set forth in SEQ ID NO:

2.

9. A method according to claim 7 or 8, which comprises deleting or inactivating a gene encoding a phosphoribosylglycine amidoformyltransferase-like protein or a gene corresponding thereto.

10. The method described in claim 9, wherein the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1, and the gene corresponding to the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO:

1.

11. The method according to any one of claims 7 to 10, which is a method for producing an adenine-requiring Starmerella bombicola mutant.

12. A method for transforming Starmerella bombicola, which comprises using the mutant strain according to any one of claims 1 to 6 as a host.

13. The method of claim 12, further comprising introducing into said host a gene encoding a phosphoribosylglycine amidoformyltransferase-like protein or a gene equivalent thereto as an adenine-requiring selectable marker.

14. The method of claim 13, wherein the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of the nucleotide sequence set forth in SEQ ID NO: 1, and the gene corresponding to the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence set forth in SEQ ID NO:

1.

15. The method according to claim 13 or 14, further comprising selecting a transformant based on the presence or absence of adenine auxotrophy.

16. A transformant obtained by the method according to any one of claims 12 to 15.

17. The transformant according to claim 16, in which the expression of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 23 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 23 is suppressed or inactivated.

18. The transformant according to claim 16, in which FAO1 or a protein corresponding thereto is suppressed or inactivated.

19. A method for producing glycolipids, comprising culturing the mutant strain according to any one of claims 1 to 6 or the transformant according to any one of claims 16 to 18.

20. The method of claim 19, wherein the glycolipid is selected from sophorolipids, Bola-type sophorolipids, Bola-type sophorosides, alkyl sophorosides, alkyl glucosides, Bola-type glucosides, acid glucolipids, and cellobioselipids.

21. An adenine-requiring selectable marker consisting of a gene encoding a phosphoribosylglycine amidoformyltransferase-like protein or a gene equivalent thereto.

22. A vector or DNA fragment containing a gene encoding a phosphoribosylglycine amidoformyltransferase-like protein or a corresponding gene.

Images