Perenniporia fraxinea heri-27 strain for producing leather-substitute material and method for producing leather-substitute material using same

Abstract

Disclosed are a novel mushroom strain for producing a leather substitute material, which exhibits enhanced mycelial growth ability, thereby significantly increasing the growth rate of mycelia in medium and the thickness of a mycelial mat used as a leather-substitute material, a method for producing a leather substitute material capable of efficiently obtaining a mycelium mat having such a significantly increased thickness, and a leather substitute material produced by the method. The present disclosure provides a (Perenniporia fraxinea) Heri-27 strain deposited under Accession No. KACC 83101BP for the production of a leather substitute material, a method for preparing a leather substitute material using same, and a leather substitute material produced by the method.

Description

HERI-27 strain of the acacia wood mushroom for manufacturing leather substitute materials and method for manufacturing leather substitute materials using the same

[0001] The present invention relates to a mushroom strain for producing a leather substitute material, and more specifically, to a mushroom strain of A. japonica for producing a leather substitute material and a method for producing a leather substitute material using the same.

[0002] This application claims priority to and the benefit of Republic of Korea Patent Application No. 10-2024-0066123, filed May 21, 2024, which is incorporated herein by reference in its entirety.

[0003] The global leather industry has recently shown significant growth, with 1.2 billion square feet of leather produced in Asian countries such as China, India, Vietnam, Korea, and Japan, and 6.3 billion square feet in European countries such as Italy, France, and the United Kingdom.

[0004] As global leather consumption increases, concerns are being raised about animal cruelty, including during the slaughter process for leather production, and concerns are growing about environmental pollution due to the large amount of livestock waste and carbon dioxide emissions generated by livestock farming for leather production.

[0005] Furthermore, the use of toxic substances like chromium in the leather manufacturing process poses health risks to manufacturers, and its discharge into wastewater contributes significantly to environmental pollution. For example, producing 200-250 kg of animal leather consumes 500 kg of heavy metal chemicals.

[0006] To address this issue of leather consumption, artificial leather, made from a blend of nonwoven fabric and polyurethane, has emerged. However, artificial leather is vulnerable to heat and moisture, resulting in a short lifespan. Furthermore, the production process produces hazardous chemicals, which can contribute to environmental pollution. Furthermore, polyurethane and polyvinyl chloride, two types of plastic used in artificial leather, decompose into microplastics, negatively impacting the environment and taking up to two hundred years to decompose.

[0007] Accordingly, interest in alternative leather using eco-friendly materials is growing to overcome problems such as environmental pollution, but research on this is still insufficient. Against this backdrop, Korean Patent No. 2578118 proposed a method for manufacturing a leather alternative material including Ganoderma lucidum mycelia. However, when using the Ganoderma lucidum strains (KMCC02846, KMCC02871) used in this patent, the thickness of the mycelia mat, i.e., the leather alternative material, produced is only 0.1 to 0.3 mm, which limits its use as an actual leather alternative material in manufacturing various high-quality leather products.

[0008] The present invention provides a novel mushroom strain for producing a leather substitute material, which has an improved mycelial growth ability and can significantly increase the mycelial growth rate in a medium and the thickness of a mycelial mat that becomes a leather substitute material, a method for producing a leather substitute material capable of efficiently obtaining a mycelial mat with such a significantly increased thickness, and a leather substitute material produced by the method.

[0009] In order to solve the above problem, the present invention provides a Perenniporia fraxinea Heri-27 strain for manufacturing a leather substitute material, deposited under the deposit number KACC 83101BP.

[0010] In order to solve the above-described further problem, the present invention provides a method for manufacturing a leather substitute material, comprising the steps of: (a) culturing the strain of claim 1 to prepare an inoculum; (b) mixing the inoculum with a medium containing sawdust and wheat bran and then culturing it; and (c) crushing the mycelia cultured in step (b) and then culturing it to form a mycelia mat.

[0011] In addition, the step (a) provides a method for manufacturing a leather substitute material, characterized in that it includes a step of culturing the mycelia by culturing the strain on a solid medium (PDA).

[0012] In addition, the above step (a) provides a method for manufacturing a leather substitute material, characterized in that it is performed at 26 to 32°C for 5 to 7 days.

[0013] In addition, the step (b) provides a method for manufacturing a leather substitute material, characterized in that it is performed under conditions of 26 to 32°C in a medium in which the sawdust and wheat bran are mixed in a volume ratio of 5 to 15:1.

[0014] In addition, the above step (c) provides a method for manufacturing a leather substitute material, characterized in that it is performed at 24 to 30°C for 10 to 20 days.

[0015] In order to solve the above-mentioned further problem, the present invention provides a leather substitute material manufactured by the above-mentioned method.

[0016] According to the present invention, by presenting the Perenniporia fraxinea Heri-27 strain as a new strain for producing a leather substitute material, a Perenniporia fraxinea strain for producing a leather substitute material can be provided, which has improved mycelial growth ability and can significantly increase the mycelial growth rate and the thickness of a mycelial mat in a PDA medium and a sawdust medium.

[0017] In addition, a method for improving the productivity of mycelial mat production can be provided by culturing the new strain on a solid medium and then culturing it on a medium containing sawdust and wheat bran of a specific composition, thereby maximizing mycelial growth and rising speed.

[0018] Figure 1 is a process diagram showing a process for manufacturing a leather substitute material according to the present invention.

[0019] Figure 2 is a photograph showing the results of subculturing the Heri-27 strain according to the present invention on a PDA plate medium and confirming that it is a pure culture strain.

[0020] FIG. 3 is a drawing showing the ITS base sequence of the Perenniporia fraxinea Heri-27 strain according to the present invention.

[0021] Figure 4 is a photograph showing a mixture of a mixture of acacia mycelia and sawdust and wheat bran using the Heri-27 strain in an embodiment of the present invention.

[0022] Figure 5 is a photograph showing a mat of mycelial cells of the acacia wood mushroom formed after culturing in an embodiment of the present invention.

[0023] Figure 6 is a photograph showing a leather substitute material manufactured using a mycelial mat of the acacia mushroom in an embodiment of the present invention.

[0024] Figure 7 is a graph showing the results of measuring the height (thickness) of the raised mat for mycelial mats manufactured according to examples and comparative examples in the test examples of the present invention.

[0025] Figure 8 is a photograph showing the results of culture by inoculating the Perenniporia fraxinea Heri-27 strain on a PDA medium prepared by mixing 200 g of potato, 20 g of dextrose, 20 g of agar, and 30 g of sawdust in 1 L of water.

[0026] Hereinafter, the present invention will be described in detail through examples. Prior to this, it should be noted that the terms and words used in this specification and claims should not be interpreted as limited to their conventional or dictionary meanings. Based on the principle that the inventor can appropriately define the concept of a term to best explain his or her invention, they should be interpreted with meanings and concepts that conform to the technical spirit of the present invention. Therefore, the configurations of the embodiments described in this specification are merely the most preferred embodiments of the present invention and do not represent the entire technical spirit of the present invention. Therefore, it should be understood that various equivalents and modifications may be substituted for them at the time of filing this application.

[0027] In addition, the term “mycelium” in the present invention refers to a general term for hyphae that grow in a densely entangled state, and is observed in eukaryotic fungi and prokaryotic actinobacteria. In the case of mushroom mycelia, it is known that nutrients and medicinal ingredients are much richer than the fruiting body corresponding to the main body.

[0028] In addition, in the present invention, "Acacia mycelium" means something that can be produced by germination of spores of Acacia mycelium in a natural state, or by culturing an Acacia mycelium strain. In the case of the conventional Reishi mushroom strain, it has been produced by culturing it in a solid medium, a sawdust medium, or a sawdust medium / rice bran mixed medium.

[0029] In addition, the term "leather substitute material" in the present invention refers to leather made from non-animal raw materials, and is divided into artificial leather manufactured using synthetic leather and eco-friendly leather using plant-based raw materials. The leather substitute material in the present invention is a leather substitute material using plant-based raw materials, and is specifically a leather substitute material using mushroom mycelia, and more specifically a leather substitute material using acacia mycelia.

[0030]

[0031] The present inventors faced the problem of the limitation of producing a mycelial mat with a thin thickness in the case of conventionally produced mycelial mats using mushroom strains, and secured samples from various mountains across the country to discover a mushroom strain that can improve the mycelial growth rate on PDA media and sawdust media and significantly increase the thickness of the mycelial mat. Among them, the Heri-27 strain isolated from Maebongsan Mountain in Daejeon Metropolitan City was secured, and the purely isolated fungus was identified as Perenniporia fraxinea as a result of ITS base sequence analysis in order to perform molecular biological and morphological identification. The strain has been confirmed to be able to significantly increase the thickness of the mycelial mat with high productivity through the superior characteristic of showing rapid floating on a culture due to enhanced mycelial growth ability, leading to the present invention.

[0032] Accordingly, the present invention provides a Perenniporia fraxinea Heri-27 strain for manufacturing a leather substitute material, deposited under the deposit number KACC 83101BP.

[0033] Perenniporia fraxinea is known to have anticancer, immune-boosting, and sedative effects, and is used as a medicinal herb and as an ingredient in various health teas.

[0034] In the present invention, in manufacturing a leather substitute material using the Heri-27 strain, the strain is cultured on a solid medium and then cultured on a medium containing sawdust and wheat bran of a specific composition, thereby maximizing the mycelial growth and mat rising speed, thereby manufacturing a mycelial mat with significantly increased thickness and high productivity.

[0035] Figure 1 is a process diagram showing a process for manufacturing a leather substitute material according to the present invention.

[0036] Referring to FIG. 1, the method for manufacturing a leather substitute material according to the present invention includes (a) a step of culturing the strain to prepare an inoculum; (b) a step of mixing the inoculum into a medium containing sawdust and wheat bran and then culturing it; and (c) a step of crushing the mycelia cultured in step (b) and then culturing it to form a mycelia mat.

[0037] In the above step (a), the culturing may include a step of culturing the strain on a solid medium (potato dextrose agar, PDA) to cultivate mycelia.

[0038] Here, it is preferable that the cultivation in the step (a) is performed at 26 to 32°C for 5 to 7 days to maximize mycelial growth in the subsequent step (b).

[0039] The above step (b) is a step of culturing mycelia by mixing the inoculum cultured in the above step (a) into a medium containing sawdust and wheat bran, and can induce significantly improved mycelia growth compared to the case of culturing in a medium containing only sawdust or a mixture of sawdust and rice bran or rice husk.

[0040] At this time, the content ratio of the sawdust and wheat bran is preferably a volume ratio of 5 to 15:1, and more preferably a volume ratio of 8 to 12:1. In addition, it is preferable that the sawdust is oak sawdust.

[0041] The step (c) above is a step of forming a mycelial mat by crushing the mycelia cultured in the step (b) and then culturing them. For example, the mycelia cultured in the step (b) are crushed and placed in a wide box with an open top to be cultured, so that the mycelia float on the crushed culture in the form of a mat to form a mycelial mat. The cultivation is preferably performed at 24 to 30°C, and more preferably at 26 to 28°C. The cultivation can be performed for 10 to 20 days, preferably 15 to 20 days, so that a mycelial mat in the form of a mat having a thickness of 10 to 30 mm, preferably 15 to 20 mm, is formed.

[0042] Hereinafter, the present invention will be described in more detail by way of examples.

[0043]

[0044] Isolation of the Heri-27 strain of Perenniporia fraxinea

[0045] In the present invention, in order to select a mushroom strain with improved mycelial growth ability for effective production of mushroom leather substitute materials, as shown in the strain collection information in Table 1 below, acacia mushrooms growing wild in Maebongsan, Daejeon in 2023 were collected, cultured, and identified. In order to isolate the pure strain of the acacia mushroom, a portion of the fruiting body was taken, plated on a PDA (containing 200 g of potato, 20 g of dextrose, and 20 g of agar) medium, and the grown fungi were cultured in an incubator at 26 to 32°C. Subculture was repeated several times until a pure strain was isolated from the cultured acacia mushrooms, and the acacia mushroom Heri-27 strain was isolated. In addition, other acacia mushroom strains, longicorn mushroom strains, and Sanghwang mushroom strains collected from various regions as shown in Table 1 below were purified using the same method as described above.

[0046] Collection area, collection year, isolation source, isolation strain, Maebongsan, Daejeon Metropolitan City, 2023, Plant - Acacia wood mushroom, Heri-27, Seolbongsan, Icheon-si, Gyeonggi-do, 2021, Plant - Cloud mushroom, Cloud mushroom (Trametes versicolor), Gubongsan, Seo-gu, Daejeon Metropolitan City, 2020, Plant - Longevity mushroom, Longevity mushroom (Fomitella fraxinea), Gubongdaesan, Yeongwol-gun, Gangwon-do, 2022, Plant - Phellinus baumii, Phellinus baumii

[0047]

[0048] Identification of Perenniporia fraxinea Heri-27 strain

[0049] Figure 2 is a photograph showing the results of confirming that the Heri-27 strain according to the present invention is a pure culture strain by subculturing it on a PDA plate medium. In order to perform molecular biological identification of the purely isolated Acacia wood mushroom strain as shown in Figure 2, the ITS (Internal Transcribed Spacer) base sequence was analyzed, and the results are shown in Figure 3 (SEQ ID NO: 1). The primers used are as shown in Table 2 below.

[0050] Primer Name Forward (5'-3') Primer Sequence Primer Name Reverse (5'-3') Primer Sequence ITS 5CCTCAGCTGACTGCGGAGACATITS 4AACCGGGGTGTCTACCTGATTT

[0051]

[0052] As a result of using NCBI's base sequence identification service for the ITS base sequence, the Heri-27 strain was identified as having a 99% identity with Perenniporia fraxinea. In addition, based on the results of morphological observations such as fruiting bodies and spores that appeared when the mushroom grew, the strain was named Perenniporia fraxinea Heri-27 strain and deposited with the Korean Agricultural Culture Collection (KACC) of the National Institute of Agricultural Sciences on May 3, 2024, and assigned the accession number KACC 83101BP.

[0053]

[0054] Example

[0055] (1) Production of mycelial mat using Heri-27 strain

[0056] The strain Perenniporia fraxinea Heri-27 isolated and identified in Examples 1 and 2 above was cultured on PDA medium in an incubator at 28 to 30°C for 6 days to culture mycelia. Thereafter, the cultured PDA was cut and cultured in a mixed medium of sawdust and wheat bran mixed at a volume ratio of 10:1, 10:0.5, and 10:0.3, respectively (see Fig. 4 (mixed medium at 10:1 volume ratio)). The cultured culture was crushed, pressed into a flat surface in a plastic square box sterilized with 70% ethanol, and cultured at 28°C for 20 days. Then, a mycelial mat formed by floating on the culture was prepared and collected. The prepared mycelial mat is shown in Fig. 5 (using a mixed medium at a volume ratio of 10:1).

[0057] (2) Manufacturing of leather substitute material using the mycelia of the acacia mushroom

[0058] In the example, a leather substitute material was manufactured using the cultured mycelial mat. Specifically, the manufactured Acacia japonica mycelial mat was washed in running water, then tanned by immersing it in a dye containing tannin for 10 hours. After tanning, the mycelial mat was dried at room temperature, treated with polyethylene glycol 400 (PEG 400), and then dried to manufacture a leather substitute material. The manufactured leather substitute material is shown in Fig. 6 (using a mixed medium with a volume ratio of 10:1).

[0059]

[0060] Comparative example

[0061] In the examples, mycelial mats were prepared in the same manner as in the examples, except that the Trametes versicolor strain, the Fomitella fraxinea strain, and the Phellinus baumii strain from Table 1 were used instead of the Heri-27 strain. In addition, mycelial mats were prepared in the same manner as in the examples, except that a mixed medium of sawdust and rice bran, or sawdust and rice husk, was used for each strain.

[0062]

[0063] Test Example 1

[0064] The height (thickness) of the raised mats of the mycelium mats manufactured according to the above examples and comparative examples was measured, and the results are shown in Table 3 and Fig. 7 below. The test results were expressed as the average value of three repeated experiments and three repeated values ​​(total of nine).

[0065]

[0066] Classification KACC 83101BP (Acacia wood mushroom) Cloud mushroom Longevity mushroom Sanghwang mushroom Mixing ratio (volume ratio) Mat height (mm) Mixing ratio (volume ratio) Mat height (mm) Mixing ratio (volume ratio) Mat height (mm) Mixing ratio (volume ratio) Mat height (mm) Sawdust: Wheat bran 10:129 10:15 10:119 10:19 10:0.5 17 10:0.53 10:0.5 14 10:0.5 4 10:0.3 9 10:0.3 110:0.3 1210:0.31 Sawdust:Rice Bran 10:124 10:14 10:110 10:17 10:0.5 1210:0.5 210:0.5 510:0.5 410:0.3 ...

[0067]

[0068] Referring to Table 3 and FIG. 7, the thickness of the mycelial mat produced in a mixed medium containing sawdust and wheat bran using the new strain Perenniporia fraxinea Heri-27 according to the present invention is 9 to 29 mm, which shows a very excellent mycelial growth ability compared to other mushroom strains. In addition, when the mycelia are cultured in a mixed medium containing sawdust and wheat bran at a specific composition ratio (volume ratio of 10:1), the thickness of the formed mycelial mat is maximized.

[0069] Meanwhile, when culturing in a mixed medium composed of conventional sawdust and rice bran or rice husk, it can be seen that there is a limit to the increase in the thickness of the mycelial mat formed even when the new strain according to the present invention is used.

[0070]

[0071] Test Example 2

[0072] In order to confirm in another way whether the Perenniporia fraxinea Heri-27 strain according to the present invention has superior mycelial growth ability compared to other mushroom strains, the strains in Table 1 were inoculated onto the PDA medium and soybean meal agar medium having the compositions shown in Table 4 below, respectively, and cultured in an incubator at 26℃ for 1 week, and the mycelial growth length was measured, and the results are shown in Table 4 below. Figure 8 shows the results of culture by inoculating the Perenniporia fraxinea Heri-27 strain onto a PDA medium prepared by mixing 200 g of potato, 20 g of dextrose, 20 g of agar, and 30 g of sawdust in 1 L of water. The test results were expressed as the average value of 3 repeated experiments and 3 repeated values ​​(total 9 times).

[0073]

[0074]

[0075]

[0076] Referring to Table 4, it can be confirmed that the new strain of the present invention, Perenniporia fraxinea Heri-27, exhibits a very superior mycelial growth ability compared to other mushroom strains.

[0077]

[0078] The preferred embodiments of the present invention described above have been disclosed to solve technical problems, and those skilled in the art to which the present invention pertains will be able to make various modifications, changes, additions, etc. within the spirit and scope of the present invention, and such modifications, changes, etc. should be considered to fall within the scope of the following patent claims.

[0079]

[0080] [Accession number]

[0081] Name of depositor: National Institute of Agricultural Sciences, Rural Development Administration, Microbial Bank (KACC)

[0082] Accession number: KACC 83101BP

[0083] Date of acceptance: 20240503

[0084]

[0085]

Claims

1. Perenniporia fraxinea Heri-27 strain for manufacturing leather substitute materials, deposited under the accession number KACC 83101BP. 2.(a) Step of culturing the strain of paragraph 1 and preparing it as an inoculum; (b) a step of mixing the inoculum into a medium containing sawdust and wheat bran and then culturing it; and (c) a step of crushing the mycelia cultured in step (b) and then culturing them to form a mycelia mat; A method for manufacturing a leather substitute material comprising:

3. In paragraph 2, A method for manufacturing a leather substitute material, characterized in that the step (a) comprises a step of culturing the strain on a solid medium (PDA) to cultivate mycelia.

4. In paragraph 3, A method for manufacturing a leather substitute material, characterized in that the above step (a) is performed at 26 to 32°C for 5 to 7 days.

5. In paragraph 2, A method for manufacturing a leather substitute material, characterized in that the step (b) is performed at a temperature of 26 to 32°C in a medium in which the sawdust and wheat bran are mixed in a volume ratio of 5 to 15:

1.

6. In paragraph 2, A method for manufacturing a leather substitute material, characterized in that the step (c) above is performed at 24 to 30°C for 10 to 20 days.

7. A leather substitute material manufactured by any one of the methods in paragraphs 2 through 6.

Images