Novel promoter and method for producing l-isoleucine by using same

Abstract

The present disclosure relates to a novel polynucleotide exhibiting promoter activity, and a method for producing L-isoleucine by using same. A microorganism into which the novel polynucleotide of the present disclosure, in which specific positions of promoter regions of an NCgl2412 gene, an NCgl2046 gene, and / or an NCgl1896 gene are mutated, is introduced has significantly increased L-isoleucine productivity, and thus the novel polynucleotide can be effectively used to efficiently produce L-isoleucine.

Description

Novel promoter and method for producing L-isoleucine using the same

[0001] This disclosure claims the benefit of priority to Republic of Korea Patent Application No. 10-2024-0066104, dated May 21, 2024, and Republic of Korea Patent Application No. 10-2024-0140712, dated October 15, 2024, the entire contents of which are incorporated herein by reference.

[0002] Numerous papers and patents are referenced and cited throughout this disclosure. The disclosures of these cited papers and patents are incorporated herein by reference in their entirety to provide a clearer understanding of the state of the art and the scope of the present invention.

[0003] The present disclosure relates to a novel promoter and a method for producing L-isoleucine using the same, and more particularly, to a novel polynucleotide having promoter activity, an expression cassette comprising the polynucleotide and a target gene operably linked thereto, a vector comprising the polynucleotide or the expression cassette, a microorganism comprising the polynucleotide or the expression cassette, and a method for producing L-isoleucine using the microorganism.

[0004]

[0005] L-isoleucine (Ile, I) is classified as an essential amino acid and is a type of branched-chain amino acid among the 20 essential amino acids. It is used in the manufacture of various products such as animal feed, food additives, and pharmaceuticals. Because L-isoleucine functions in post-metabolism energy production, hemoglobin production, blood sugar regulation, muscle building and repair, etc., its use is increasing not only in fluids, nutritional supplements, and sports nutrition, but also in animal feed.

[0006] Based on this trend, various attempts are being made to improve productivity in the production of L-isoleucine using various microorganisms, including microorganisms of the genus Corynebacterium (US6072083A).

[0007] Despite these efforts, the development of technologies to improve the production of L-isoleucine is still required.

[0008]

[0009] One object of the present disclosure is to provide a novel polynucleotide.

[0010] Another object of the present disclosure is to provide an expression cassette comprising the polynucleotide and a target gene.

[0011] Another object of the present disclosure is to provide a microorganism comprising the polynucleotide or the polynucleotide and a target gene operably linked thereto.

[0012] Another object of the present disclosure is to provide a method for producing L-isoleucine, comprising a step of culturing the microorganism in a medium.

[0013] Another object of the present disclosure is to provide a use of the microorganism for producing L-isoleucine.

[0014]

[0015] This is specifically described as follows. Meanwhile, each description and embodiment disclosed in this disclosure can also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this disclosure fall within the scope of this disclosure. Furthermore, the scope of this disclosure is not limited by the specific descriptions set forth below. Furthermore, those skilled in the art will recognize or ascertain, through routine experimentation alone, numerous equivalents to the specific embodiments of the present disclosure described herein. Furthermore, such equivalents are intended to be encompassed by this disclosure.

[0016] Additionally, numerous papers and patents are referenced and cited throughout this disclosure. The disclosures of these cited papers and patents are incorporated by reference into this disclosure in their entirety, thereby providing a clearer understanding of the technical field to which this disclosure pertains and the content of this disclosure.

[0017]

[0018] One aspect of the present disclosure is a nucleotide sequence in which the nucleotide at position 99 in the nucleotide sequence of SEQ ID NO: 54 is replaced with a nucleotide different from the original; a nucleotide sequence in which the nucleotide at position 217, the nucleotide at position 218, the nucleotide at position 219, the nucleotide at position 220, the nucleotide at position 221, the nucleotide at position 224, the nucleotide at position 226, and the nucleotide at position 228 in the nucleotide sequence of SEQ ID NO: 58 are each replaced with a nucleotide different from the original; Or, a polynucleotide is provided, which comprises a nucleotide sequence in which the nucleotide at the 155th position, the nucleotide at the 163rd position, the nucleotide at the 164th position, and the nucleotide at the 165th position in the nucleotide sequence of SEQ ID NO: 60 are each replaced with a nucleotide different from the original.

[0019] In the present disclosure, the nucleotide sequence of SEQ ID NO: 54, SEQ ID NO: 58, or SEQ ID NO: 60 can be found in the known database NCBI Genbank, and the nucleotide sequence of SEQ ID NO: 54, SEQ ID NO: 58, or SEQ ID NO: 60 may each be derived from Corynebacterium sp., specifically, may be derived from Corynebacterium glutamicum. The nucleotide sequence of SEQ ID NO: 54, SEQ ID NO: 58, or SEQ ID NO: 60 may be an example sequence for specifying a mutation position to be introduced for producing a polynucleotide of the present disclosure, and it is obvious that the mutation introduced into the polynucleotide of the present disclosure may be introduced into any sequence functionally corresponding to the nucleotide sequence of SEQ ID NO: 54, SEQ ID NO: 58, or SEQ ID NO: 60. In one example, the functionally corresponding sequence may be, but is not limited to, a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity with the nucleotide sequence of SEQ ID NO: 54, SEQ ID NO: 58, or SEQ ID NO: 60; and less than 100% homology or identity, or a nucleotide sequence having the homology or identity but having some sequences added, deleted, or modified.

[0020] Accordingly, in one example, the polynucleotide of the present disclosure may be composed of, consist essentially of, or include a nucleotide sequence having a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more, 99.1% or more, 99.2% or more, 99.3% or more, 99.35% or more, or 99.39% or more; and less than 100% homology or identity with the nucleotide sequence of SEQ ID NO: 54, or a nucleotide sequence having the homology or identity but having some sequences added, deleted, or modified. In another example, the polynucleotide of the present disclosure has a nucleotide sequence of SEQ ID NO: 58 in which the nucleotide at position 217, the nucleotide at position 218, the nucleotide at position 219, the nucleotide at position 220, the nucleotide at position 221, the nucleotide at position 224, the nucleotide at position 226, and the nucleotide at position 228 are each replaced with a different nucleotide from the original, and has at least 70%, 80%, 85%, 90%, 95%, 96%, 96.1%, 96.2%, 96.3%, 96.4%, 96.5%, 96.55%, or 96.59% or more of the nucleotide sequence of SEQ ID NO: 58; It may be composed of, essentially composed of, or include a nucleotide sequence having less than 100% homology or identity, or a nucleotide sequence having the homology or identity but with some sequences added, deleted, or modified.In another example, the polynucleotide of the present disclosure may be composed of, consist essentially of, or include a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 97.25%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, or 98% homology or identity with the sequence of SEQ ID NO: 60, or a nucleotide sequence having the homology or identity but having some sequences added, deleted, or modified.

[0021] In the present disclosure, the nucleotide sequence of SEQ ID NO: 54 may be a promoter sequence of the NCgl2412 gene or a part of the promoter sequence.

[0022] In one embodiment, the nucleotide at position 99 in the nucleotide sequence of SEQ ID NO: 54 may be, but is not limited to, guanine.

[0023] In one embodiment, the polynucleotide may be a polynucleotide in which the nucleotide at position 99 in the nucleotide sequence of SEQ ID NO: 54 is substituted with adenine, cytosine, or thymine, and more specifically, may be substituted with cytosine, but is not limited thereto.

[0024] In the present disclosure, the nucleotide sequence of SEQ ID NO: 58 may be a promoter sequence of a gene encoding threonine ammonia-lyase IlvA (NCgl2046 gene, ilvA) or a part of the promoter sequence.

[0025] The above threonine ammonia-lyase IlvA, also called threonine dehydratase (EC 4.3.1.19), is an enzyme that produces 2-ketobutyrate from threonine and is encoded by the ilvA gene. Microorganisms of the genus Corynebacterium use pyruvate and 2-ketobutyrate as precursors to synthesize L-isoleucine through three intermediate metabolites.

[0026] In one embodiment, in the nucleotide sequence of SEQ ID NO: 58, the nucleotide at position 217 may be adenine, the nucleotide at position 218 may be adenine, the nucleotide at position 219 may be guanine, the nucleotide at position 220 may be adenine, the 221st nucleotide may be thymine, the 224th nucleotide may be cytosine, the nucleotide at position 226 may be cytosine, and / or the 228th nucleotide may be adenine, but is not limited thereto.

[0027] In a specific embodiment, the polynucleotide of the present disclosure may have the nucleotide at position 217 in the nucleotide sequence of SEQ ID NO: 58 substituted with cytosine, guanine, or thymine, more specifically, but not limited to, thymine.

[0028] In a specific embodiment, the polynucleotide of the present disclosure may have the nucleotide at position 218 in the nucleotide sequence of SEQ ID NO: 58 substituted with cytosine, guanine, or thymine, more specifically, but not limited to, guanine.

[0029] In a specific embodiment, the polynucleotide of the present disclosure may have the nucleotide at position 219 in the nucleotide sequence of SEQ ID NO: 58 substituted with adenine, cytosine, or thymine, more specifically, but not limited to, thymine.

[0030] In a specific embodiment, the polynucleotide of the present disclosure may have the nucleotide at position 220 in the nucleotide sequence of SEQ ID NO: 58 substituted with cytosine, guanine, or thymine, and more specifically, may be substituted with guanine, but is not limited thereto.

[0031] In a specific embodiment, the polynucleotide of the present disclosure may be one in which the nucleotide at position 221 in the nucleotide sequence of SEQ ID NO: 58 is substituted with adenine, cytosine or guanine, and more specifically, may be substituted with guanine, but is not limited thereto.

[0032] In a specific embodiment, the polynucleotide of the present disclosure may be one in which the nucleotide at position 224 in the nucleotide sequence of SEQ ID NO: 58 is substituted with adenine, guanine, or thymine, and more specifically, may be substituted with thymine, but is not limited thereto.

[0033] In a specific embodiment, the polynucleotide of the present disclosure may have the nucleotide at position 226 in the nucleotide sequence of SEQ ID NO: 58 substituted with adenine, guanine, or thymine, more specifically, but not limited to, adenine.

[0034] In a specific embodiment, the polynucleotide of the present disclosure may have the nucleotide at position 228 in the nucleotide sequence of SEQ ID NO: 58 substituted with cytosine, guanine or thymine, more specifically, but not limited to, guanine.

[0035] In the present disclosure, the nucleotide sequence of SEQ ID NO: 60 may be a promoter sequence of a gene (NCgl1896 gene, dapA) encoding 4-hydroxy-tetrahydrodipicolinate synthase (EC 4.3.3.7) or a part of the promoter sequence.

[0036] The above 4-hydroxy-tetrahydrodipicolinate synthase is an enzyme involved in catalyzing the condensation reaction of pyruvate and aspartate-semialdehyde to produce 4-hydroxy-2,3,4,5-tetrahydrodipicolinate (HTPA), and plays an important role in lysine biosynthesis.

[0037] In one embodiment, the nucleotide at position 155 in the nucleotide sequence of SEQ ID NO: 60 may be guanine, the nucleotide at position 163 may be thymine, the nucleotide at position 164 may be adenine, and / or the nucleotide at position 165 may be adenine, but is not limited thereto.

[0038] In a specific embodiment, the polynucleotide of the present disclosure may have the nucleotide at position 155 in the nucleotide sequence of SEQ ID NO: 60 substituted with adenine, cytosine, or thymine, more specifically, but not limited to, thymine.

[0039] In a specific embodiment, the polynucleotide of the present disclosure may have the nucleotide at position 163 in the nucleotide sequence of SEQ ID NO: 60 substituted with adenine, cytosine, or guanine, and more specifically, may be substituted with guanine, but is not limited thereto.

[0040] In a specific embodiment, the polynucleotide of the present disclosure may have the nucleotide at position 164 in the nucleotide sequence of SEQ ID NO: 60 substituted with cytosine, guanine, or thymine, more specifically, but not limited to, guanine.

[0041] In a specific embodiment, the polynucleotide of the present disclosure may have the nucleotide at position 165 in the nucleotide sequence of SEQ ID NO: 60 substituted with cytosine, guanine, or thymine, more specifically, but not limited to, guanine.

[0042] In one embodiment, the polynucleotide may comprise, consist essentially of, or consist of a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more, 99.1% or more, 99.2% or more, 99.3% or more, 99.35% or more, or 99.39% or more; and less than 100% homology or identity to the nucleotide sequence of SEQ ID NO: 54. More specifically, the polynucleotide may comprise, consist essentially of, or consist of a nucleotide sequence having a nucleotide sequence having a 99th position in the nucleotide sequence of SEQ ID NO: 54 replaced with cytosine (C), and having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more, 99.1% or more, 99.2% or more, 99.3% or more, 99.35% or more, or 99.39% or more; and less than 100% homology or identity with the nucleotide sequence of SEQ ID NO: 54.

[0043] In one embodiment, the polynucleotide comprises, consists essentially of, or consists of a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 96.1%, 96.2%, 96.3%, 96.4%, 96.5%, 96.55%, or 96.59% or more; less than 100% homology or identity to the nucleotide sequence of SEQ ID NO: 58. More specifically, the polynucleotide is a polynucleotide in which the nucleotide at position 217 in the nucleotide sequence of SEQ ID NO: 58 is substituted with thymine (T), the nucleotide at position 218 is substituted with guanine (G), the nucleotide at position 219 is substituted with thymine, the nucleotide at position 220 is substituted with guanine, the nucleotide at position 221 is substituted with guanine, the nucleotide at position 224 is substituted with thymine, the nucleotide at position 226 is substituted with adenine (A), and the nucleotide at position 228 is substituted with guanine, and has at least 70%, 80%, 85%, 90%, 95%, 96%, 96.1%, 96.2%, 96.3%, It may comprise, consist essentially of, or consist of a nucleotide sequence having at least 96.4%, 96.5%, 96.55%, or 96.59% homology or identity with the nucleotide sequence; or it may consist essentially of, or consist of, a nucleotide sequence having less than 100% homology or identity with the nucleotide sequence.

[0044] In one embodiment, the polynucleotide may comprise, consist essentially of, or consist of a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 97.25%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, or 98% or more; less than 100% homology or identity to the nucleotide sequence of SEQ ID NO: 60. More specifically, the polynucleotide may comprise, consist essentially of, or consist of a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 97.25%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, or 98% or more; less than 100% homology or identity with the nucleotide sequence of SEQ ID NO: 60, in which the nucleotide at position 155 is replaced with thymine, the nucleotide at position 163 is replaced with guanine, the nucleotide at position 164 is replaced with guanine, and the nucleotide at position 165 is replaced with guanine.

[0045] In the present disclosure, the polynucleotide may comprise a nucleotide sequence of SEQ ID NO: 3, SEQ ID NO: 7, or SEQ ID NO: 9. In another embodiment, the polynucleotide of the present disclosure may consist essentially of a nucleotide sequence of SEQ ID NO: 3, SEQ ID NO: 7, or SEQ ID NO: 9. In yet another embodiment, the polynucleotide of the present disclosure may consist of a nucleotide sequence of SEQ ID NO: 3, SEQ ID NO: 7, or SEQ ID NO: 9.

[0046] As used herein, the term "polynucleotide" includes 2 or more, 5 or more, 10 or more, 13 or more, 20 or more, or 30 or more nucleotide monomers, wherein the nucleotide monomers may be covalently linked to form a chain.

[0047] The polynucleotide of the present disclosure may have promoter activity and may be used as a universal promoter.

[0048] In one embodiment, the polynucleotide may have promoter activity for expression of a target gene in microorganisms of the Corynebacterium genus.

[0049] A polynucleotide having the above promoter activity may be used interchangeably with a “variant promoter” in the present disclosure.

[0050] According to one embodiment, the polynucleotide of the present disclosure can be utilized as a synthetic promoter having strong expression-inducing activity.

[0051] As used herein, the term "promoter" may refer to a DNA region that includes a binding site for a polymerase and initiates transcription of a downstream target DNA. The promoter may be located upstream of the transcription start site. The promoter may be operably and / or regulatably (enhancing or weakening expression) linked upstream of the target DNA. For example, the promoter may be forwardly linked upstream of a target gene to strengthen (increase) the expression of the gene, or may be reversely linked downstream of the target gene to weaken (decrease) the expression of the gene. When a promoter is introduced in the reverse direction downstream of a target gene, for example, downstream of the stop codon, specifically between the stop codon and the transcription terminator, it may induce transcription in the opposite direction to the normal transcription direction of the gene, thereby causing the RNA polymerase complex to collide with the RNA polymerase complex in the normal direction during the transcription process, thereby weakening the expression of the gene.

[0052] The polymerase may be referred to as RNA polymerase, or DNA-dependent RNA polymerase, and may refer to an enzyme that synthesizes primary transcript RNA from DNA. The polymerase may be a prokaryotic RNA polymerase or a eukaryotic RNA polymerase (e.g., RNA polymerase I, RNA polymerase II, RNA polymerase III, RNA polymerase IV, or RNA polymerase V, etc.). The polynucleotide according to one embodiment may be natural or non-natural, and may be, for example, a non-natural synthesized chemically or recombinantly.

[0053] In this disclosure, the term “variation” means a genetically or non-genetically stable phenotypic change, and may be used interchangeably with “mutation” in this disclosure.

[0054] The polynucleotide (mutant promoter) of the present disclosure may have a promoter activity that is altered (increased or decreased) compared to a polynucleotide that does not contain the mutation (wild type or pre-mutant polynucleotide). The polynucleotide may regulate (increase or decrease) the expression of a target gene operably linked thereto or the expression or activity of a protein encoded by the target gene, and further may regulate the expression of genes other than the target gene.

[0055] The above "target gene" refers to a gene whose expression is to be controlled by the polynucleotide of the present disclosure, and in the case of a protein-coding gene, it may be used interchangeably with "gene encoding the target protein." The protein encoded by the target gene may be expressed as a "target protein," and the gene encoding the "target protein" may be expressed as a "target gene."

[0056] The amino acid coding sequence of the above target gene can be modified in various ways within a range that does not change the protein sequence encoded by the target gene, due to the degeneracy of the codon or in consideration of the codon usage frequency preferred in the organism that is to express the target gene.

[0057] The polynucleotide of the present disclosure may be introduced into a suitable host cell together with an operably linked target gene, and may have an activity that increases the host cell's ability to produce a target substance (production amount), for example, the ability to produce an amino acid (production amount).

[0058] In one embodiment, the polynucleotide may be for increasing the productivity (production amount) of amino acids, and specifically for increasing the productivity (production amount) of L-isoleucine.

[0059] In addition, the nucleotide sequence of the polynucleotide can be additionally modified by conventionally known mutagenesis methods, such as directed evolution and site-directed mutagenesis, within a range that maintains the corresponding biological activity (promoter activity) and / or the desired activity (e.g., activity of increasing production of a target substance in a host cell).

[0060] Accordingly, the polynucleotide of the present disclosure may comprise, consist essentially of, or consist of a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity with the nucleotide sequence of SEQ ID NO: 3, the nucleotide sequence of SEQ ID NO: 7, or the nucleotide sequence of SEQ ID NO: 9, or a nucleotide sequence having the homology or identity but having some sequences added, deleted, or modified.

[0061] As used herein, the terms 'homology' or 'identity' refer to the degree of similarity between two given amino acid sequences or nucleotide sequences, which may be expressed as a percentage. The terms homology and identity are often used interchangeably.

[0062] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences can generally hybridize with all or part of the sequence under moderate or high stringency conditions. It should be appreciated that hybridization also includes hybridization with polynucleotides containing common codons or codons that take codon degeneracy into account.

[0063] Whether any two polynucleotide or polypeptide sequences are homologous or identical can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example, as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as performed in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA / .](1988) SIAM J Applied Math 48: 1073). For example, homology or identity can be determined using BLAST or ClustalW of the National Center for Biotechnology Information Database.

[0064] Homology or identity of polynucleotides or polypeptides can be determined by comparing sequence information using a GAP computer program, such as that disclosed, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482, or in, for example, Needleman et al. (1970), J Mol Biol. 48:443. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program include (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and (2) a comparison matrix as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979), Gribskov et al. (1986) Nucl. Acids Res. 48:443. 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0065] In one example, a polynucleotide comprising a specific nucleotide sequence provided in the present disclosure may be interpreted to include not only the specific nucleotide sequence or a nucleotide sequence substantially equivalent thereto, but also a polynucleotide fragment comprising a nucleotide sequence complementary to the specific nucleotide sequence. Specifically, a polynucleotide having the above complementarity can be identified under the conditions described below: Such conditions are specifically described in known literature. For example, conditions in which genes with high complementarity of 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 98% or more, 99.5% or more, or 99.9% or more hybridize, and genes with lower complementarity do not hybridize, or washing conditions of conventional Southern hybridization: 60°C, 1x SSC (saline-sodium citrate buffer), and 0.1% (w / v) SDS (Sodium Dodecyl Sulfate); 60°C, 0.1x SSC, and 0.1% SDS; Or, conditions for washing once, specifically two to three times, at a salt concentration and temperature equivalent to 68°C, 0.1x SSC, and 0.1% SDS can be listed, but are not limited thereto. Hybridization requires that two nucleotides have complementary sequences, but some base mismatches may be tolerated depending on the stringency of hybridization. The term "complementary" can be used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenosine is complementary to thymine and cytosine is complementary to guanine. The stringency of hybridization between polynucleotides depends on the length and degree of complementarity of the polynucleotides, which is well known in the art (Sambrook et al., supra, 9.50-9.51, 11.7-11.8).

[0066] Furthermore, the polynucleotide of the present disclosure may be operably linked to a gene encoding a target protein, i.e., a target gene.

[0067] The term "operably linked" as used herein means that a polynucleotide having promoter activity of the present disclosure is functionally linked to a gene sequence to initiate and mediate transcription of the gene of interest. Operable linkages can be produced using genetic recombination techniques known in the art, and site-specific DNA cleavage and ligation can be produced using, but is not limited to, cleavage and ligation enzymes known in the art.

[0068] When the above polynucleotide is operably linked to a target gene, some nucleotides may be added, deleted, and / or mutated for use with the above cleavage and ligation enzymes.

[0069]

[0070] In one embodiment, the target gene may be, but is not limited to, a gene encoding a protein involved in the production of L-isoleucine of the present disclosure. The protein involved in the production of L-isoleucine may be, but is not limited to, a protein involved in at least one process or step of an intracellular production pathway (e.g., biosynthesis, metabolism, bioconversion, etc.), intracellular transport, and / or extracellular excretion pathway of L-isoleucine, such as enzymes (various synthetases, catabolic enzymes, phosphatases, carboxylases (e.g., pyruvate carboxylase, etc.), reductases, oxidases, decarboxylases, dehydrogenases, dehydratase, transferases, epimerases, etc.), intermediates, transport proteins, membrane proteins (channels, etc.), etc., but is not limited thereto.

[0071] In one embodiment, the target gene may be, but is not limited to, the NCgl2412 gene.

[0072] In one embodiment, the target gene may be, but is not limited to, the NCgl2046 gene. The NCgl2046 gene may be a gene (ilvA) encoding threonine ammonia-lyase IlvA.

[0073] In one embodiment, the target gene may be, but is not limited to, the NCgl1896 gene. The NCgl1896 gene may be a gene (dapA) encoding 4-hydroxy-tetrahydrodipicolinate synthase.

[0074]

[0075] Another aspect of the present disclosure provides an expression cassette comprising a polynucleotide of the present disclosure and a gene of interest.

[0076] The polynucleotide and target gene are as described above.

[0077] As used herein, the term "expression cassette" refers to a unit cassette that includes a promoter and a target gene operably linked thereto, thereby enabling expression of the target gene downstream of the promoter. Various factors that can facilitate efficient expression of the target gene may be included internally or externally in such a gene expression cassette. The gene expression cassette may typically include, but is not limited to, a transcription termination signal, a ribosome binding site, and a translation termination signal in addition to a promoter operably linked to the target gene.

[0078]

[0079] Another aspect of the present disclosure provides a vector comprising a polynucleotide of the present disclosure; the polynucleotide and a target gene operably linked thereto; or the expression cassette.

[0080] The polynucleotide, target gene, and expression cassette are as described above. The vector may include a target gene operably linked to the polynucleotide.

[0081] As used herein, the term "vector" refers to a DNA construct containing a base sequence of a polynucleotide encoding a target protein operably linked to suitable regulatory sequences so as to enable expression of the target protein in a suitable host. The regulatory sequences may include a promoter capable of initiating transcription, an optional operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and / or a sequence regulating the termination of transcription and / or translation. After being transformed into a suitable host cell, the vector may be expressed independently of the genome (genome) of the host cell, or may be integrated into the genome of the host cell.

[0082] The vector usable in the present disclosure is not particularly limited as long as it is replicable in a host cell, and may be selected from all commonly used vectors. Examples of commonly used vectors include plasmids, cosmids, viruses, bacteriophages, etc., in a natural or recombinant state. For example, as the vector, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A, etc., can be used as a phage vector or a cosmid vector, and pDZ series, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series, etc., can be used as a plasmid vector. Specifically, examples include, but are not limited to, pDZ, pDC, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, pDCM2, and pDC24 vectors.

[0083] The vector usable in the present disclosure may be an expression vector or a vector for insertion into the host cell chromosome. Insertion of the target DNA into the host cell chromosome using the insertion vector may be accomplished by any method known in the art, such as, but not limited to, homologous recombination or the CRISPR system. The vector may further include a selection marker to determine whether the vector is transformed or further whether the target DNA is inserted into the chromosome. The selection marker may be selected from genes that confer a selectable phenotype, such as drug resistance, nutrient requirement, cytotoxic agent resistance, or expression of a surface protein. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, thereby allowing the selection of transformed cells.

[0084] As used herein, the term "transformation" refers to the introduction of a target polynucleotide into a host cell. The transformed polynucleotide may be integrated into the host cell's chromosome or located extrachromosomally. Furthermore, the polynucleotide may be DNA and / or RNA, and may be introduced in any form as long as it can be functionally introduced into the host cell. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, a genetic construct containing all elements necessary for autonomous expression, or in the form of a vector containing the same.

[0085] The above transformation method includes all methods for introducing the target polynucleotide into a cell, and can be performed by selecting an appropriate standard technique known in the art depending on the host cell. Examples include, but are not limited to, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method.

[0086]

[0087] Another aspect of the present disclosure provides a polynucleotide of the present disclosure, a microorganism (host cell) comprising the polynucleotide and a target gene operably linked thereto, or the expression cassette.

[0088] The polynucleotide, target gene, or expression cassette is as described above.

[0089] The polynucleotide, the polynucleotide and the target gene operably linked thereto, or the expression cassette may be introduced into a microorganism by transformation, but is not limited thereto.

[0090] In this disclosure, the term “microorganism” includes both wild-type microorganisms and microorganisms that have undergone genetic modification, either naturally or artificially, and is also a concept that includes microorganisms whose specific mechanisms are weakened or strengthened due to causes such as the insertion of external genes or the strengthening or weakening of the activity of endogenous genes.

[0091] The above microorganism may be a microorganism that naturally expresses a target gene or a microorganism that has the ability to produce a target product, or a microorganism that does not naturally express a target gene or a microorganism that has been given the ability to express a target gene or produce a target product to a parent strain that does not have the ability to produce a target product, but is not limited thereto. In one embodiment, the microorganism may be a microorganism that naturally produces an amino acid, specifically, produces L-isoleucine.

[0092] In the present disclosure, the term "target product" refers to a biologically active substance to be produced or the production of which is to be controlled (increased or decreased) using a polynucleotide provided in the present disclosure, the polynucleotide and a target gene operably linked thereto, an expression cassette comprising the polynucleotide and the target gene, a vector comprising the same, and / or a microorganism comprising the same, and is a concept that includes not only the biologically active substance to be ultimately produced but also the target protein that the microorganism can produce. For example, it may refer to the target protein itself encoded by the target gene, and / or all biologically active substances produced with the participation of the target protein.The above biologically active substance means all substances produced or derived from an organism (e.g., a cell) or having a certain function in a living body or in a cell, for example, amino acids (glycine, alanine, valine, leucine, isoleucine, threonine, serine, cysteine, glutamine, methionine, aspartic acid, asparagine, glutamic acid, lysine, arginine, histidine, phenylalanine, tyrosine, tryptophan, proline, O-acetyl homoserine, etc.), nucleic acids, vitamins (vitamins A, B (B1, B2, B3, B5, B6, B7, B9, B12, etc.), C, D, E, K, etc.), proteins (the target protein or other proteins, for example, hormones, growth factors, cytokines, immunoglobulins (antibodies), antigen proteins, receptors, ligands, functional fragments thereof (fragments having a target function), fusion proteins in which two or more are fused, etc.). Sugars (e.g., monosaccharides, disaccharides, polysaccharides, sugar alcohols, etc.), fatty acids (myristoleic acid, palitoleic acid, sapienic acid, oleic acid, elaidic acid, vaccenic acid, linoleic acid, linolenic acid, arachidonic acid, eicosapentaenoic acid (EPA), erucic acid, docosahexaenoic acid (DHA), etc.), organic acids (lactic acid, citric acid, oxalic acid, uric acid, butyric acid, stearic acid, propionic acid, etc.), etc., may be included in the target product, but are not limited thereto. In addition, if it is a substance produced by the target protein, in addition to the above substances, metabolites thereof (e.g., polyhydroxyalkanoates (PHAs), precursors thereof, derivatives thereof that maintain biological activity thereof, etc. may also be included in the target product.

[0093] In one embodiment, a microorganism comprising a polynucleotide of the present disclosure and a target gene operably linked thereto may be a microorganism having increased ability to produce amino acids as a target product, and specifically, may be a microorganism having increased ability to produce L-isoleucine. The microorganism having increased ability to produce L-isoleucine may be a microorganism having increased ability to produce L-isoleucine compared to a microorganism that does not comprise the polynucleotide of the present disclosure, for example, a microorganism in which expression of the NCgl2412 gene, the NCgl2046 gene, or the NCgl1896 gene is regulated by the polynucleotide before introduction of a mutation, but is not limited thereto. The polynucleotide before introduction of the mutation may be a wild-type polynucleotide, and specifically, may be composed of a nucleotide sequence of SEQ ID NO: 54, SEQ ID NO: 58, or SEQ ID NO: 60.

[0094] In the present disclosure, the term "unmodified microorganism" does not exclude a strain that contains a mutation that may occur naturally in a microorganism, and may refer to a wild-type strain or a natural strain itself, or a strain before its characteristics are changed by genetic mutation caused by natural or artificial factors. For example, the unmodified microorganism may refer to a strain in which a mutant polynucleotide is not introduced or is introduced before the promoter region of the NCgl2412 gene, the NCgl2046 gene, or the NCgl1896 gene described in the present disclosure is introduced. The term "unmodified microorganism" may be used interchangeably with "pre-modified strain," "pre-modified microorganism," "unmutated strain," "unmodified microorganism," or "reference microorganism."

[0095] In one specific example, the microorganism as a host cell may be, but is not limited to, Corynebacterium glutamicum KCCM12739P (CA10-3101, US 2023-0098971 A1) or Corynebacterium glutamicum KCCM11248P (Korean Patent No. 10-1335789).

[0096] In one specific example, the microorganism (mutant microorganism or microorganism as a host cell) may be, but is not limited to, a microorganism whose biosynthetic pathway of L-isoleucine has been additionally strengthened to increase the production of L-isoleucine.

[0097] In one example, the microorganism may be a microorganism in which feedback inhibition of L-threonine dehydratase is relieved and / or feedback inhibition of homoserine dehydrogenase is relieved.

[0098] In one specific example, the microorganism may be a microorganism in which feedback inhibition of L-threonine dehydratase is released.

[0099] In the present disclosure, the term “threonine dehydratase (EC 4.3.1.19)” refers to an enzyme that produces 2-ketobutyrate from threonine, which is encoded by the ilvA gene and is known to be subject to feedback inhibition by L-isoleucine. Microorganisms of the genus Corynebacterium synthesize L-isoleucine through three intermediate metabolites using pyruvate and 2-ketobutyrate as precursors. The amino acid sequence of the threonine dehydratase can be obtained from the known database, NCBI’s GenBank or US 2023-0098971 A1 and US 10982244 B2.

[0100] In another embodiment, the microorganism may be one in which feedback inhibition of homoserine dehydrogenase is released.

[0101] As used herein, the term "homoserine dehydrogenase (EC: 1.1.1.3)" refers to an enzyme encoded by the hom gene that catalyzes the synthesis of homoserine. Homoserine dehydrogenase is known to be subject to feedback inhibition by isoleucine. The amino acid sequence of the homoserine dehydrogenase can be obtained from the known databases, such as NCBI's GenBank or US 10982244 B2.

[0102] In one specific example, the microorganism may be one in which feedback inhibition of aspartate kinase is released. The term “aspartate kinase (EC: 2.7.2.4)” in the present disclosure is encoded by the lysC gene, and the amino acid sequence of the aspartate kinase can be obtained from a known database such as NCBI’s GenBank or US 10662450 B2.

[0103] As used herein, the term, release of feedback inhibition, may mean that the activity of a polypeptide, protein or enzyme is increased or enhanced compared to its intrinsic activity, or that the activity is not inhibited compared to its intrinsic activity. In one specific example, the microorganism may be a microorganism that further includes, but is not limited to, any one or more mutations selected from the group consisting of additional introduction of a genetic mutation (R407H) into the hom gene (US 10982244 B2), additional introduction of a genetic mutation (T381A, F383A and / or V323A) into the ilvA gene (US 2023-0098971 A1, US 10982244 B2), and additional introduction of a genetic mutation (L377K) into the lysC gene encoding aspartokinase (US Registered Publication No. US 10662450 B2).

[0104] The microorganism of the present disclosure may include, without limitation, any microorganism into which the polynucleotide of the present disclosure is introduced and which can operate as a promoter.

[0105] In one embodiment, the microorganism may be, but is not limited to, a microorganism of the genus Corynebacterium sp., a microorganism of the genus Escherichia sp., or a microorganism of the genus Bacillus sp.

[0106] Specifically, the microorganism may be a microorganism of the genus Corynebacterium, and more specifically, may include, but is not limited to, Corynebacterium glutamicum, Corynebacterium stationis, Corynebacterium thermoaminogenes, Corynebacterium glutamicum, Brevibacterium flavum, Brevibacterium lactofermentum, and strains prepared therefrom. Specifically, the microorganism of the genus Corynebacterium may be Corynebacterium glutamicum.

[0107] In one embodiment, the microorganism may be, but is not limited to, Corynebacterium glutamicum in which a mutation has been introduced into the promoter of the NCgl2412 gene, the NCgl2046 gene, or the NCgl1896 gene.

[0108] In one embodiment, the microorganism with increased L-isoleucine productivity (production amount) of the present disclosure may have an L-isoleucine productivity (production amount) increased by about 5% or more, about 6% or more, about 8% or more, about 9% or more, about 10% or more, about 20% or more, about 30% or more, about 40% or more, about 45% or more, about 50% or more, about 60% or more, about 70% or more, about 75% or more, or about 80% or more (the upper limit is not particularly limited, and may be, for example, about 200% or less, about 150% or less, about 100% or less, or about 90% or less) compared to the parent strain before mutation or the unmodified microorganism, but is not limited thereto. In another embodiment, the microorganism having increased L-isoleucine productivity (production amount) of the present disclosure may have an L-isoleucine productivity (production amount) increased by about 1.05 times or more, about 1.06 times or more, about 1.08 times or more, about 1.09 times or more, about 1.1 times or more, about 1.2 times or more, about 1.3 times or more, about 1.4 times or more, about 1.45 times or more, about 1.5 times or more, about 1.6 times or more, about 1.7 times or more, about 1.75 times or more, or about 1.8 times or more (the upper limit is not particularly limited and may be, for example, about 10 times or less, about 5 times or less, about 3 times or less, about 2 times or less, or about 1.5 times or less), but is not limited thereto.

[0109] The term “about” above includes all ranges including ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, etc., and includes all ranges of values ​​equal to or similar to the value following the term “about,” but is not limited thereto.

[0110]

[0111] Another aspect of the present disclosure provides a composition for producing L-isoleucine, comprising at least one selected from the group consisting of a polynucleotide of the present disclosure, a target gene operably linked thereto, an expression cassette, a vector, and a microorganism. The polynucleotide, the target gene, the expression cassette, the vector, and the microorganism are as described above.

[0112] In one example, the composition for producing L-isoleucine may further comprise any suitable excipient commonly used in compositions for producing L-isoleucine, such excipients may be, for example, but are not limited to, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizers, or isotonic agents.

[0113]

[0114] Another aspect of the present disclosure provides a use for producing L-isoleucine, comprising at least one selected from the group consisting of a polynucleotide of the present disclosure, the polynucleotide and a target gene operably linked thereto, the expression cassette, the vector, and the microorganism. The polynucleotide, the target gene, the expression cassette, the vector, and the microorganism are as described above.

[0115]

[0116] According to another aspect of the present disclosure, there is provided a use for producing a composition for producing L-isoleucine, comprising at least one selected from the group consisting of a polynucleotide of the present disclosure, the polynucleotide and a target gene operably linked thereto, the expression cassette, the vector, and the microorganism. The polynucleotide, the target gene, the expression cassette, the vector, and the microorganism are as described above.

[0117]

[0118] Another aspect of the present disclosure provides a method for producing a target product, comprising the step of culturing a microorganism comprising a polynucleotide of the present disclosure, the polynucleotide and a target gene operably linked thereto, the expression cassette or the vector in a medium.

[0119] The polynucleotide, target gene, expression cassette, vector, microorganism, and target product are as described above.

[0120] In one embodiment, the target product may be an L-amino acid. Specifically, the target product may be L-isoleucine.

[0121] The above method may further include, after the culturing step, a step of recovering a target product from the cultured microorganism, the culture, or both.

[0122] The term "cultivation" as used herein refers to growing microorganisms under appropriately artificially controlled environmental conditions. The culturing process of the present disclosure can be performed using any suitable medium and culture conditions known in the art. Such culturing process can be easily adjusted and used by those skilled in the art depending on the selected strain. Specifically, the culturing process may be batch, continuous, and / or fed-batch, but is not limited thereto. Various such methods are disclosed, for example, in "Biochemical Engineering" (James M. Lee, Prentice-Hall International Editions, pp. 138-176, 1991).

[0123] In the present disclosure, the term “medium” refers to a material containing nutrients as a main component necessary for culturing the microorganisms of the present disclosure, and supplies nutrients and growth factors, including water essential for survival and growth. Specifically, the medium and other culture conditions used for culturing the microorganisms of the present disclosure may be any medium used for culturing general microorganisms without particular limitation, but the microorganisms of the present disclosure may be cultured under aerobic conditions while controlling temperature, pH, etc. in a general medium containing an appropriate carbon source, nitrogen source, phosphorus, inorganic compounds, amino acids, and / or vitamins. Specifically, culture media for microorganisms can be found in literature ["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington DC, USA, 1981)], etc.

[0124] The culture medium must suitably meet the requirements of the specific strain. For example, culture can be performed under aerobic conditions, controlling temperature, pH, etc., in a conventional medium containing appropriate carbon sources, nitrogen sources, amino acids, vitamins, etc. Carbon sources include carbohydrates such as glucose, fructose, and sucrose, and amino acids such as glutamic acid and cysteine. Specifically, natural organic nutrients such as starch hydrolysate and molasses can be used, and carbohydrates such as glucose, fructose, and sterilized pretreated molasses (i.e., molasses converted to reducing sugar) can be used. Other appropriate carbon sources can be used in various amounts without limitation, but are not limited thereto. Nitrogen sources include inorganic nitrogen sources such as ammonia; amino acids such as glutamic acid and cysteine; and organic nitrogen sources such as peptone, meat extract, and yeast extract. These nitrogen sources can be used alone or in combination, but are not limited thereto. The media may include, but are not limited to, phosphoric acid, potassium dihydrogen phosphate, or dipotassium hydrogen phosphate or their corresponding sodium-containing salts as the personnel. Inorganic compounds may include, but are not limited to, magnesium sulfate, iron sulfate, manganese sulfate, and calcium chloride, and other compounds may include amino acids, vitamins, and appropriate precursors. These media or precursors may be added to the culture in batch or continuous fashion, but are not limited to these.

[0125] During cultivation, compounds such as potassium hydroxide, ammonia, and phosphoric acid can be appropriately added to the culture to adjust the pH of the culture. Furthermore, foaming agents such as fatty acid polyglycol esters can be used to suppress foaming during cultivation. Furthermore, oxygen or an oxygen-containing gas can be injected into the culture to maintain an aerobic state. The culture temperature ranges from 27°C to 37°C, specifically from 30°C to 33°C. The cultivation period can continue until the desired amount of useful substances is obtained, and is typically 10 to 160 hours.

[0126] As used herein, the term "culture" refers to a substance containing a medium in which microorganisms are growing or have completed growth under appropriately artificially controlled environmental conditions. In a narrow sense, the culture does not include the grown microorganisms themselves, but in a broader sense, it may include them. The "culture" may include various target substances released into the medium by the microorganisms during growth, along with medium components formulated for microbial culture.

[0127] In the culture of the present disclosure, the culture temperature may be maintained at 20°C to 45°C, specifically 25°C to 40°C, 25°C to 40°C, 25°C to 37°C, 25°C to 35°C, 27°C to 40°C, 27°C to 37°C, 27°C to 35°C, 30°C to 40°C, 30°C to 37°C, or 30°C to 35°C, and the culture may be performed for about 10 to 160 hours, 20 to 100 hours, 30 to 90 hours, or 50 to 70 hours, but is not limited thereto.

[0128] The target product produced by the culture of the present disclosure may be secreted into the medium or remain within the cells.

[0129] The step of recovering the above target product may be to collect the target product using a suitable method known in the art according to a culture method, such as a batch, continuous or fed-batch culture method. For example, various chromatography methods such as centrifugation, filtration, treatment with a crystallized protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC or a combination thereof may be used, but is not limited thereto, and the target product may be recovered from a medium or microorganism using a suitable method known in the art.

[0130] Additionally, the method for producing the target product of the present disclosure may additionally include a purification step. The purification may be performed using any suitable method known in the art. In one example, if the method for producing the target product of the present disclosure includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially (or sequentially) regardless of the order, or may be performed simultaneously or integrated into a single step, but is not limited thereto.

[0131]

[0132] Another aspect of the present disclosure provides a method for increasing the productivity of a target product, comprising the step of culturing a microorganism comprising a polynucleotide of the present disclosure, the polynucleotide and a target gene, or an expression cassette comprising the polynucleotide and the target gene in a medium.

[0133] The polynucleotide, target gene, expression cassette, microorganism, and target product are as described above.

[0134]

[0135]

[0136] Another aspect of the present disclosure provides a method for producing a microorganism having increased production capacity of a target product, comprising the step of introducing into the microorganism a polynucleotide of the present disclosure, the polynucleotide and a target gene, or an expression cassette comprising the polynucleotide and a target gene.

[0137] The polynucleotide, target gene, expression cassette, microorganism, and target product are as described above.

[0138]

[0139] In another aspect of the present disclosure, the present disclosure provides a composition, method, product, process, or use characterized by one or more elements disclosed in the present disclosure.

[0140]

[0141] The present disclosure relates to a novel polynucleotide having promoter activity and a method for producing L-isoleucine using the same. Since a microorganism into which the novel polynucleotide of the present disclosure is introduced has a significantly increased ability to produce L-isoleucine, the novel polynucleotide can be usefully utilized for efficiently producing L-isoleucine.

[0142]

[0143] Hereinafter, the present application will be described in more detail through examples. These examples are intended solely to illustrate the present application more specifically, and it will be apparent to those skilled in the art that the scope of the present application is not limited by these examples, in accordance with the gist of the present application.

[0144]

[0145] Example

[0146]

[0147] (Throughout this specification, "%" used to indicate the concentration of a particular substance is (weight / weight) % for solid / solid, (weight / volume) % for solid / liquid, and (volume / volume) % for liquid / liquid, unless otherwise stated.)

[0148] Hereinafter, the present invention will be described in more detail with reference to the following examples. However, these examples are only intended to illustrate the present invention, and the scope of the present invention is not limited by these examples.

[0149]

[0150] Example 1: Selection of a mutant strain with increased isoleucine production through artificial mutation.

[0151] Example 1-1: Random mutagenesis through UV irradiation

[0152] To select mutant strains with increased isoleucine production, the isoleucine-producing strain, Corynebacterium glutamicum KCCM12739P, was spread on a nutrient medium containing agar and cultured at 30°C for 16 hours. Hundreds of colonies obtained in this way were irradiated with UV (Ultraviolet mutation) at room temperature to induce random mutations in the genome of the strain.

[0153]

[0154] Nutrient medium (pH 7.2)

[0155] 10g glucose, 5g meat extract, 10g polypeptone, 2.5g sodium chloride, 5g yeast extract, 20g agar, 2g urea (per 1 liter of distilled water)

[0156]

[0157] Example 1-2: Selection of strains with improved L-isoleucine production

[0158] In order to select mutant strains with increased isoleucine production compared to the parent strain KCCM12739P, the KCCM12739P strain and the mutant strains in which random mutations were induced were cultured using the following method.

[0159] The above strains were each inoculated into a 96-Deep Well Plate-Dome (Bioneer) containing 400 μl of seed medium and cultured in a plate shaking incubator (TAITEC) at 32°C and 1200 rpm for approximately 48 hours. The isoleucine concentrations of approximately 3,000 cultured strains were individually confirmed using a near-infrared (NIR) spectrophotometer, and the top five mutant strains with enhanced isoleucine production compared to the parent strain KCCM12739P were selected.

[0160] <Seed medium (pH 7.0)>

[0161] Glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4·7H2O 0.5 g, biotin 100 μg, thiamine HCl 1000 μg, calcium-pantothenic acid 2000 μg, nicotinamide 2000 μg (based on 1 liter of distilled water)

[0162] To finally select strains with reproducibly increased L-isoleucine production among the five selected mutant strains, they were cultured and evaluated using the following method. The parent strain and the mutant strains were inoculated into 250 mL corner-buffered flasks containing 25 mL of isoleucine production medium, and then cultured with shaking at 200 rpm for 60 hours at 32°C. After culture was completed, the L-isoleucine concentration in the culture medium was analyzed using HPLC, and the L-isoleucine production concentration of each mutant strain is shown in Table 1 below.

[0163] <Production medium (pH 7.2)>

[0164]

[0165] Glucose 10%, yeast extract 0.2%, ammonium sulfate 1.6%, potassium phosphate monobasic 0.1%, magnesium sulfate heptahydrate 0.1%, iron sulfate heptahydrate 10 mg / ℓ, manganese sulfate monohydrate 10 mg / ℓ, biotin 200 μg / ℓ (based on 1L of distilled water)

[0166] Strain nameL-isoleucine (g / L)KCCM12739P2.0KCCM12739P_mt12.8KCCM12739P_mt22.6KCCM12739P_mt32.7KCCM12739P_mt43.6KCCM12739P_mt52.5

[0167] Among the five selected mutant strains, KCCM12739P_mt4 was finally selected as the strain with significantly improved L-isoleucine production.

[0168]

[0169] Example 2: Mutation identification through whole-genome sequencing (WGS)

[0170] Whole-genome sequencing (WGS) was performed on the KCCM12739P_mt4 strain selected in the above Example 1-2 to analyze the sequence, and by comparing it with the parent strain KCCM12739P (SEQ ID NO: 52 to SEQ ID NO: 61), mutations occurring in 10 promoter regions were confirmed, and the sequences of the promoter variants including the mutations are as shown in Table 2 below.

[0171]

[0172]

[0173] In the examples below, the effect of each promoter variant listed in Table 2 on the L-isoleucine production ability of a Corynebacterium genus microorganism was evaluated to identify effective factors affecting the L-isoleucine production ability.

[0174]

[0175] Example 3: Production of an L-isoleucine-producing strain with a mutant promoter.

[0176] Example 3-1: Construction of a recombinant vector for introducing a mutant promoter

[0177] To insert each of the mutant promoters of the NCgl0867, NCgl1062, NCgl2412, NCgl1224, NCgl2581, NCgl2658, NCgl2046, NCgl0780, NCgl1896, and NCgl2356 genes in Table 2 above into KCCM12739P, a vector including the target mutation was constructed.

[0178] Specifically, the genomic DNA of the KCCM12739P_mt4 strain was extracted using a G-spin Total DNA extraction mini kit (Intron, Cat. No. 17045) according to the protocol provided in the kit, and PCR was performed using the genomic DNA as a template. The polymerase was Solg TM Pfu-X DNA polymerase was used, and the PCR conditions were as follows: denaturation at 95°C for 4 minutes; 27 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and polymerization at 72°C for 50 seconds; and polymerization reaction was performed at 72°C for 5 minutes. Each PCR result was obtained using SEQ ID NO: 12 and SEQ ID NO: 13; or SEQ ID NO: 14 and SEQ ID NO: 15; or SEQ ID NO: 16 and SEQ ID NO: 17; or SEQ ID NO: 18 and SEQ ID NO: 19; or SEQ ID NO: 20 and SEQ ID NO: 21; or SEQ ID NO: 22 and SEQ ID NO: 23; or SEQ ID NO: 24 and SEQ ID NO: 25; or SEQ ID NO: 26 and SEQ ID NO: 27; or SEQ ID NO: 28 and SEQ ID NO: 29; or SEQ ID NO: 30 and SEQ ID NO: 31. The primer sequences used in the above experiment are as shown in Table 3 below.

[0179] The obtained mutation introduction fragment and the pDC24 vector (SEQ ID NO: 11) treated with the restriction enzyme smaI were cloned using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) to obtain recombinant plasmids, and the vectors pDC24-Pn*_NCgl0867, pDC24-Pn*_NCgl1062, pDC24- Pn*_NCgl2412, pDC24- Pn*_NCgl1224, pDC24- Pn*_NCgl2581, pDC24- Pn*_NCgl2658, pDC24- Pn*_NCgl2046, pDC24- Pn*_NCgl0780, pDC24- They were named Pn*_NCgl1896 and pDC24- Pn*_NCgl2356.

[0180]

[0181]

[0182]

[0183]

[0184]

[0185] Example 3-2: Production of an L-isoleucine-producing strain with a mutant promoter

[0186] The 10 vectors produced in Example 3-1 were transformed into KCCM12739P, an isoleucine-producing strain, by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), and strains in which the vectors were inserted into the chromosome by recombination of homologous sequences were selected through kanamycin medium. Thereafter, transformants in which secondary recombination was completed were selected as the target strains having sequences of SEQ ID NO: 32 and SEQ ID NO: 33; SEQ ID NO: 34 and SEQ ID NO: 35; or SEQ ID NO: 36 and SEQ ID NO: 37; or SEQ ID NO: 38 and SEQ ID NO: 39; or SEQ ID NO: 40 and SEQ ID NO: 41; or SEQ ID NO: 42 and SEQ ID NO: 43; or SEQ ID NO: 44 and SEQ ID NO: 45; or SEQ ID NO: 46 and SEQ ID NO: 47; or SEQ ID NO: 48 and SEQ ID NO: 49; Alternatively, a strain into which a mutant promoter was introduced was confirmed through PCR using primers of sequence numbers 50 and 51. PCR was performed in the same manner as in Example 3-1. The above recombinant strains were KCCM12739P△Pn::Pn*_NCgl0867, KCCM12739P△Pn::Pn*_NCgl1062, KCCM12739P△Pn::Pn*_NCgl2412, KCCM12739P△Pn::Pn*_NCgl1224, KCCM12739P△Pn::Pn*_NCgl2581, KCCM12739P△Pn::Pn*_NCgl2658, KCCM12739P△Pn::Pn*_NCgl2046, KCCM12739P△Pn::Pn*_NCgl0780, KCCM12739P△Pn::Pn*_NCgl1896 and It was named KCCM12739P△Pn::Pn*_NCgl2356. The primer pairs used for confirmation are as shown in Table 4 below.

[0187] Sequence number name sequence (5'->3') 32pNCgl0867_FAATCAATCTTCGCACTCG33pNCgl0867_RTCTCTTGCTCGATGAACG34pNCgl1062_FACTCGAATTCACCGAAAC35pNCgl1062_RCTCATCCACGTCTACTGT36pNCgl2412_FCTACGGACACATGGAATA37 pNCgl2412_RTCTTCCACATCCATCGTC38pNCgl1224_FTAAAGACCGAAACACTCG39pNCgl1224_RCGTTGGTGAAGATTTCTG40pNCgl2581_FCTTATCGACGTCTCCCTT41pNCgl2581_RTGGGAGCGAGTTCTTGGA42pNC gl2658_FATTGATGACACTTCAGG43pNCgl2658_RCAACACCATAACGGATCA44pNCgl2046_FACGCAGAGTCTGCTTGAAC45pNCgl2046_RACAGGAACATAGATGCG46pNCgl0780_FGTCCCTAGTACGAGAGGACC47pNCgl 0780_RTTATGCGGCGAATTAACGAT48pNCgl1896_FCAAGTCCCGTTTCTTTGATC49pNCgl1896_RCCGCCATTTTTCCTTCTCTC50pNCgl2356_FTAGCTCGACTTGGCGCTGAA51pNCgl2356_RGTTTTTATTGGGCGTGGTGA

[0188]

[0189] Example 4. Evaluation of isoleucine production ability of L-isoleucine producing strain with introduced mutant promoter

[0190] In order to confirm the L-isoleucine production ability of the strain produced in Example 3-2 above at the flask level, it was cultured and evaluated using the following method. After inoculating the parent strain and the mutant strain into a 250 mL corner-bottom flask containing 25 mL of isoleucine production medium, the flask was cultured with shaking at 200 rpm at 32°C for 60 hours.

[0191] After the culture was completed, the amount of L-isoleucine produced was measured using high-performance liquid chromatography (HPLC), and the analysis results are shown in Table 5 below.

[0192] <Production medium (pH 7.2)>

[0193] Glucose 10%, yeast extract 0.2%, ammonium sulfate 1.6%, potassium phosphate monobasic 0.1%, magnesium sulfate heptahydrate 0.1%, iron sulfate heptahydrate 10 mg / ℓ, manganese sulfate monohydrate 10 mg / ℓ, biotin 200 μg / ℓ (based on 1L of distilled water)

[0194] Comparison of isoleucine production ability of L-isoleucine producing strains with introduced mutant promoters (flask titer evaluation, 60 hours) Strain name L-isoleucine concentration (g / L) KCCM12739P2.0 KCCM12739P△Pn::Pn*_NCgl08672.2 KCCM12739P△Pn::Pn*_NCgl10622.1 KCCM12739P△Pn::Pn*_NCgl24122.9 KCCM12739P△Pn::Pn*_NCgl12242.0 KCCM12739P△Pn::Pn*_N Cgl25812.0KCCM12739P△Pn::Pn*_NCgl26582.0KCCM12739P△Pn::Pn*_NCgl20463.4KCCM12739P △Pn::Pn*_NCgl07802.3KCCM12739P△Pn::Pn*_NCgl18962.6KCCM12739P△Pn::Pn*_NCgl23562.2

[0195] As a result, as shown in Table 5 above, the isoleucine production ability of the strains into which the mutant promoter was introduced was increased or showed an equivalent level compared to the parent strain. In particular, it was confirmed that 'KCCM12739P△Pn::Pn*_NCgl2412', 'KCCM12739P△Pn::Pn*_NCgl2046', and 'KCCM12739P△Pn::Pn*_NCgl1896' showed significantly improved isoleucine production ability compared to the parent strain KCCM12739P.

[0196] Through this, it was confirmed that L-isoleucine can be produced more efficiently by introducing a mutant of the promoter that controls the expression of the NCgl2412 gene, a mutant of the promoter that controls the expression of the NCgl2046 gene, and / or a mutant of the promoter that controls the expression of the NCgl1896 gene.

[0197]

[0198] From the above description, those skilled in the art will understand that the present application can be implemented in other specific forms without altering its technical concept or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of this application should be interpreted to include all changes or modifications derived from the meaning and scope of the following claims and their equivalents, rather than the detailed description above.

Claims

1. A nucleotide sequence in which the nucleotide at position 99 in the nucleotide sequence of sequence number 54 is replaced with cytosine (C); A nucleotide sequence in which the nucleotide at position 217 in the nucleotide sequence of SEQ ID NO: 58 is substituted with thymine (T), the nucleotide at position 218 is substituted with guanine (G), the nucleotide at position 219 is substituted with thymine, the nucleotide at position 220 is substituted with guanine, the nucleotide at position 221 is substituted with guanine, the nucleotide at position 224 is substituted with thymine, the nucleotide at position 226 is substituted with adenine (A), and the nucleotide at position 228 is substituted with guanine; or A polynucleotide comprising a nucleotide sequence in which the nucleotide at position 155 in the nucleotide sequence of SEQ ID NO: 60 is substituted with thymine, the nucleotide at position 163 is substituted with guanine, the nucleotide at position 164 is substituted with guanine, and the nucleotide at position 165 is substituted with guanine.

2. In the first paragraph, the polynucleotide is a polynucleotide having promoter activity.

3. In the first paragraph, the polynucleotide has a sequence identity of 80% or more and less than 100% with the nucleotide sequence of SEQ ID NO: 54, SEQ ID NO: 58, or SEQ ID NO: 60, respectively.

4. In the first paragraph, the polynucleotide comprises a nucleotide sequence of SEQ ID NO: 3, a nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence of SEQ ID NO:

9.

5. An expression cassette comprising the polynucleotide of paragraph 1 and the target gene.

6. A polynucleotide according to any one of claims 1 to 4; or A microorganism of the genus Corynebacterium sp., comprising the polynucleotide and a target gene operably linked thereto.

7. In the 6th paragraph, the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.

8. A method for producing L-isoleucine, comprising a step of culturing the microorganism of clause 6 in a medium.

9. A method for producing L-isoleucine, wherein the method further comprises a step of recovering L-isoleucine from a cultured medium or microorganism in accordance with paragraph 8.

10. Use of the microorganism of paragraph 6 or 7 for producing L-isoleucine.

Images