Method for producing genetically sterile fish and method for mass-producing genetically sterile fish

Abstract

The present invention provides a method for producing a genetically sterile fish, which reliably makes cultured fishes sterile, wherein edible parts of the cultured fishes are large and the flesh quality and the color of the cultured fishes are favorable, and a method for using the genetically sterile fish to mass-produce the genetically sterile fish. The present invention is a method for producing a genetically sterile fish by knocking out, by genome editing, a follicle-stimulating hormone receptor gene of a breeding target fish. The present invention is a method for mass-producing a genetically sterile fish, wherein: a next generation genetically sterile individual is produced, by transplanting, to a germ cell deficient individual, germ cells of the genetically sterile individual which has been obtained by the method for producing a genetically sterile fish; and then the germ cell deficient individual is produced by knocking out, by genome editing, a dead end gene.

Description

Method for producing genetically sterile fish and method for mass-producing genetically sterile fish

[0001] The present invention relates to a method for producing genetically sterile fish and a method for mass-producing genetically sterile fish. This application claims priority to Japanese Patent Application No. 2024-085879, filed on May 27, 2024, the contents of which are incorporated herein by reference.

[0002] In recent years, farmed fish with various added values ​​have been produced through selective breeding and genome editing, but the escape of farmed fish into the wild has become an issue. It is known that farmed fish populations have a declining genetic diversity and that farmed fish populations differ significantly genetically from wild fish populations. When farmed fish with different genetic backgrounds escape from farms and interbreed with wild fish, genetic disruption of wild fish populations occurs.

[0003] Sterilization of farmed fish is one way to fundamentally resolve the genetic disruption of wild fish populations caused by the escape of farmed fish. Traditionally, triploidization has been widely used in salmonids as a simple method for producing sterile fish. Triploidization involves subjecting eggs immediately after fertilization to temperature or pressure treatments, thereby preventing the release of the second polar body after fertilization and resulting in a triploid nucleus. Although triploid individuals retain germ cells that undergo somatic cell division, these cells undergo meiotic incompetence, preventing the formation of normal gametes and resulting in infertility.

[0004] While triploidization is a simple method for sterilizing large numbers of fish, it is known that a small number of fertile diploid individuals remain. For example, it has been reported that high-temperature treatment sterilizes 90.8% to 91.0% of rainbow trout, while pressure treatment sterilizes over 99% (Non-Patent Document 1). However, there have been cases where approximately 300,000 farmed fish escaped in a single year (Non-Patent Document 2). Even if triploidization treatment with a sterilization rate of 90% to 99% was performed on 300,000 farmed fish, the number of normally fertile diploid individuals would be calculated to be at least 3,000 and at most 30,000. Therefore, the escape of non-triploid individuals could potentially cause genetic disruption in wild fish populations.

[0005] Sawada Morinobu et al., "Creation of Triploid Rainbow Trout and Their Characteristics," Research Report of Tochigi Prefectural Fisheries Experimental Station, 1989. Norwegian Directorate of fisheries, Rommingsstatistikk. https: / / www.fiskeridir.no / Akvakultur / Tall-og-analyse / Roemmingsstatistikk, 2024. (Accessed March 2, 2024). Ota Isao et al., "Studies on the Maturation of Rainbow Trout - II: On the Testicular Development of One-Year-Old Fish," Journal of the Japanese Society of Fisheries Science, 1965, Vol. 31, No. 8, pp. 597-605. Yamamoto Kiichiro et al., "Studies on the Maturation of Rainbow Trout - I: On the Ovarian Development of One-Year-Old Fish," Journal of the Japanese Society of Fisheries Science, 1965, Vol. 31, No. 2, pp. 123-132.Hayashi M et al., “Establishment of novel monoclonal antibodies for identification of type A spermatogonia in teleosts”, Biology of Reproduction, Vol. 101, p. 478-491, 2019.Sawatari E et al., “A novel transforming growth factor-β superfamily member expressed in gonadal somatic cells enhances primordial germ cell and spermatogonial proliferation in rainbow trout (Oncorhynchus mykiss)”. Developmental Biology, Vol. 301, p. 266-275, 2007.Leal MC et al., “Histological and stereological evaluation of zebrafish (Danio rerio) spermatogenesis with an emphasis on spermatogonial generations”. Biology of Reproduction, Vol. 81, p. 177-187, 2009.Ichida K et al., “Visualization and tracking of live type a spermatogonia using a fluorescence-conjugated antibody in Salmo species”, Aquaculture. Vol. 533, 736096, 2021.。

[0006] As mentioned above, the use of triploids in large-scale aquaculture poses the challenge of fertile diploid individuals remaining, necessitating technology to ensure that all farmed fish are sterile. Furthermore, there is a constant demand for improved edible parts, meat quality, and body color in farmed fish for human consumption. However, as the gonads mature, the edible parts decrease, meat quality deteriorates, and body color darkens. Females, in particular, have poorer edible parts and meat quality after their gonads (ovaries) have matured. Therefore, there is a strong demand for sterile fish with immature gonads.

[0007] The present invention has been made in consideration of the above circumstances, and aims to provide a method for producing genetically sterile fish that are reliably infertile in cultured fish, have a large amount of edible parts, and have good meat quality and body color, and a method for mass-producing genetically sterile fish using the genetically sterile fish.

[0008] The present invention includes the following aspects: (1) A method for producing genetically sterile fish, comprising knocking out a follicle-stimulating hormone receptor gene in a breeding target fish by genome editing to produce a genetically sterile individual. (2) The method according to (1), wherein the breeding target fish is a salmonid or a mackerel. (3) The method according to (1) or (2), wherein the genetically sterile individual has undifferentiated germ cells. (4) The method according to any one of (1) to (3), wherein the mutation pattern of the genetically sterile individual is such that the number of deleted bases in both alleles is not a multiple of three, or the number of inserted bases in both alleles is 20 to 26. (5) A method for mass-producing genetically sterile fish, comprising transplanting germ cells from the genetically sterile individual obtained by the methods of (1) to (4) into a germ cell-deficient individual to produce a next-generation genetically sterile individual, and then knocking out a dead-end gene by genome editing to produce the genetically sterile individual. (6) The method according to (5), wherein the mutation pattern of the genetically sterile individual of the next generation is such that the number of deleted bases in both alleles is not a multiple of 3, or the number of inserted bases in both alleles is 20 to 26.

[0009] According to the present invention, it is possible to provide a method for producing genetically sterile fish that are reliably infertile and have a large amount of edible parts and good meat quality and body color, and a method for mass-producing genetically sterile fish using the genetically sterile fish.

[0010] FIG. 1A is a diagram showing the change over time in the average standard body length of males in the follicle-stimulating hormone receptor gene (fshr gene) KO population (biallelic KO individuals, heterozygous KO individuals, wild-type individuals (WT)) in Example 2-1-1. FIG. 1B is a diagram showing the change over time in the average body weight of males in the fshr gene KO population in Example 2-1-1. FIG. 1C is a diagram showing the change over time in the average gonad weight of males in the fshr gene KO population in Example 2-1-1. FIG. 1D is a diagram showing the change over time in the average gonad weight index (GSI) of males in the fshr gene KO population in Example 2-1-1. FIG. 2A is a diagram showing the change over time in the average standard body length of females in the fshr gene KO population in Example 2-1-2. FIG. 2B is a diagram showing the change over time in the average body weight of females in the fshr gene KO population in Example 2-1-2. FIG. 2C is a diagram showing the change over time in the average body weight excluding ovary weight of females in the fshr gene KO population in Example 2-1-2. FIG. 2D is a diagram showing the change over time in the average gonad weight of females in the fshr gene KO population in Example 2-1-2. FIG. 2E is a diagram showing the change over time in the average GSI value of females in the fshr gene KO population in Example 2-1-2. FIG. 3(A) is a photograph showing an example of an HE-stained image of the testis of a 24-month-old biallelic KO individual in Example 2-2-1. FIG. 3(B) is a photograph showing an example of an HE-stained image of the testis of a 24-month-old wild-type individual (WT) in Example 2-2-1. Figure 4(A) is a photograph showing an example of an HE-stained image of the ovary of a 24-month-old biallelic KO individual in Example 2-2-2. Figure 4(B) is a photograph showing an example of an HE-stained image of the ovary of a 24-month-old wild-type individual (WT) in Example 2-2-2. Figure 5(A) is a photograph showing an example of an HE-stained image of the testis of a 24-month-old biallelic KO individual in Example 2-3-1. Figure 5(B) is a photograph showing an example of an immunohistochemically stained image in which germ cells were stained with the No. 189 antibody in Example 2-3-1. Figure 5(C) is a photograph showing an example of an immunostained image in which gonad somatic cells were stained with an anti-rainbow trout Gsdf antibody in Example 2-3-1.Figure 5 (D) is a photograph showing an example of a double immunohistochemical staining image of No. 189 antibody and anti-rainbow trout Gsdf antibody in Example 2-3-1. Figure 6 is a diagram showing the time course of the average plasma 11-ketotestosterone (11-KT) concentration in male biallelic KO individuals and male wild-type individuals (WT) in Example 2-4-1. Figure 7 is a diagram showing the time course of the average plasma estradiol-17β (E2) concentration in female biallelic KO individuals and female wild-type individuals (WT) in Example 2-4-2. Figure 8 (A) is a schematic diagram showing the site where abdominal wall thickness was measured in Example 2-5. Figure 8 (B) is a photograph showing an example of abdominal wall thickness in a 25.5-month-old female biallelic KO individual in Example 2-5. The bottom of Figure 8(B) is a photograph showing an example of the abdominal wall thickness of a 25.5-month-old female wild-type individual (WT) in Example 2-5. The top of Figure 8(C) is a photograph showing an example of the abdominal wall thickness of a 25.5-month-old female biallelic KO individual in Example 2-5. The bottom of Figure 8(C) is a photograph showing an example of the abdominal wall thickness of a 25.5-month-old female wild-type individual (WT) in Example 2-5. The top of Figure 8(D) is a photograph showing an example of the abdominal wall thickness of a 25.5-month-old female biallelic KO individual in Example 2-5. The bottom of Figure 8(D) is a photograph showing an example of the abdominal wall thickness of a 25.5-month-old female wild-type individual (WT) in Example 2-5. Figure 9 is a diagram showing the average abdominal wall thickness of a 25.5-month-old female biallelic KO individual and a wild-type individual (WT) in Example 2-5. FIG. 10 is a diagram showing the average lipid amounts of 24-month-old male biallelic KO individuals and wild-type individuals (WT) in Example 2-6-1. FIG. 11 is a diagram showing the average lipid amounts of 25.5-month-old female biallelic KO individuals and wild-type individuals (WT) in Example 2-6-2. FIG. 12(A) is a photograph showing an example of a fish body of a 24-month-old male biallelic KO individual in Example 2-7. FIG. 12(B) is a photograph showing an example of a fish body of a 24-month-old female biallelic KO individual in Example 2-7. FIG. 12(C) is a photograph showing an example of a fish body of a 24-month-old male wild-type individual in Example 2-7.FIG. 12(D) is a photograph showing an example of the body of a 24-month-old female wild-type individual in Example 2-7. FIG. 13(A) is a diagram showing the change over time in the average standard body length of biallelic KO individuals in Example 2-8. FIG. 13(B) is a diagram showing the change over time in the average body weight of biallelic KO individuals in Example 2-8. FIG. 14(A) is a photograph showing an example of the abdominal dissection state of a 24-month-old male biallelic KO individual in Example 2-8. FIG. 14(B) is a photograph showing an example of the abdominal dissection state of a 24-month-old male wild-type individual in Example 2-8. FIG. 15(A) is a photograph showing an example of the abdominal dissection state of a 24-month-old female biallelic KO individual in Example 2-8. FIG. 15(B) is a photograph showing an example of the abdominal dissection state of a 24-month-old female wild-type individual in Example 2-8. FIG. 16(A) is a photograph showing an example of the testis of a 24-month-old male biallelic KO individual in Example 2-8. FIG. 16(B) is a photograph showing an example of the testis of a 24-month-old male wild-type individual in Example 2-8. FIG. 17(A) is a photograph showing an example of the ovary of a 24-month-old female biallelic KO individual in Example 2-8. FIG. 17(B) is a photograph showing an example of the ovary of a 24-month-old female wild-type individual in Example 2-8. The top of FIG. 18 is a diagram showing the genomic sequence (SEQ ID NO: 1) and a portion of the waveform of the fshr gene of sperm obtained from a wild-type individual in Example 3-2. The bottom of FIG. 18 is a diagram showing the genomic sequence (SEQ ID NO: 2) and a portion of the waveform of the fshr gene of sperm obtained from a transplanted individual in Example 3-2. Figure 19(A) is a photograph showing an example of an expressed egg from a section in Example 3-3 where eggs from a wild-type individual were fertilized with sperm obtained from a transplanted individual. Figure 19(B) is a photograph showing an example of an expressed egg from a section in Example 3-3 where eggs from a wild-type individual were fertilized with sperm obtained from a transplanted individual. Figure 19(C) is a photograph showing an example of a surfaced fry from a section in Example 3-3 where eggs from a wild-type individual were fertilized with sperm obtained from a transplanted individual. Figure 19(D) is a photograph showing an example of a surfaced fry from a section in Example 3-3 where eggs from a wild-type individual were fertilized with sperm obtained from a wild-type individual.Figure 20 shows the genome sequence and waveform of the fshr gene of larvae heterozygous for a two-base deletion in Examples 3-4. Figure 21(A) shows the structure of the chub mackerel fshr gene (SEQ ID NO: 4). Figure 21(B) shows the base sequence of the first exon translation region of the chub mackerel shr gene (SEQ ID NO: 6) and the base sequences of crRNA designed using this base sequence as a target sequence (SEQ ID NOs: 8-12). Figure 22(A) shows an electrophoretic image of PCR amplification products derived from the chub mackerel fshr gene after cleavage in Example 4. Figure 22(B) shows the results of quantifying the fluorescence intensity of bands in the electrophoretic image in Example 4. Figure 23 is a photograph showing an electrophoretic image of PCR amplification products derived from chub mackerel larvae (17 fish) after treatment with T7 endonuclease in Example 5. The top of Figure 24(A) is a diagram showing a portion of the base sequence (SEQ ID NO: 6) of the fshr gene (first exon translated region) of sperm derived from a wild-type individual of chub mackerel in Example 6-1. The bottom of Figure 24(A) is a diagram showing a portion of the base sequence (SEQ ID NO: 7) of the fshr gene (first exon translated region) of sperm from a chub mackerel P1 individual in Example 6-1, in which an fshr gene mutation was detected. The top of Figure 24(B) is a diagram showing a portion of the amino acid sequence (SEQ ID NO: 21) of fshr of sperm from a wild-type individual of chub mackerel in Example 6-2. The bottom of Figure 24(B) is a diagram showing the amino acid sequence (SEQ ID NO: 22) of fshr of sperm from a chub mackerel P1 individual in Example 6-1, in which an fshr gene mutation was detected. Figure 25 is a photograph showing an example of the results of electrophoresis of PCR amplification products derived from individuals of the F1 generation of chub mackerel in Example 7-1. Figure 26 is a photograph showing an example of the results of subjecting PCR amplification products derived from heterozygous KO individuals of the F1 generation of chub mackerel to an electrophoretic image in Example 7-2. Figure 27 is a photograph showing an example of a fish body of an individual of the F2 generation of chub mackerel (wild-type individual (WT), heterozygous KO individual, homozygous KO individual) in Example 8-1. Figure 28(A) is a diagram showing the average standard body length of individuals of the F2 generation of chub mackerel in Example 8-1. Figure 28(B) is a diagram showing the average body weight of individuals of the F2 generation of chub mackerel in Example 8-1. Figure 29 is a photograph showing an example of the gonad of an individual of the F2 generation of chub mackerel in Example 8-1.Figure 30 is a diagram showing the average GSI value of individuals of the F2 generation of chub mackerel in Example 8-1. Figure 31 is a photograph showing an example of an HE-stained image of the gonads of individuals of the F2 generation of chub mackerel in Example 8-2. Figure 32 is a photograph showing an example of an HE-stained image of the gonads of individuals of the F2 generation of chub mackerel in Example 8-2. Figure 33 is a photograph showing an example of the thickness of the abdominal wall of individuals of the F2 generation of chub mackerel in Example 8-3. Figure 34 is a diagram showing the average value of the abdominal wall thickness of individuals of the F2 generation of chub mackerel in Example 8-3.

[0011] In the present invention and this specification, the term "comprising" means that components other than the target component may be included. The term "consisting of" means that components other than the target component are not included. The term "consisting essentially of" means that components other than the target component are not included in a form that exerts a special function (such as a form that completely loses the effect of the invention). In this specification, when "comprising" is used, it includes both an embodiment "consisting of" and an embodiment "consisting essentially of."

[0012] <Method for producing genetically sterile fish> The method for producing genetically sterile fish according to this embodiment involves knocking out the follicle-stimulating hormone receptor gene of the breeding target fish by genome editing to produce a genetically sterile individual, which is characterized by having insufficient somatic function of the gonads and being sterile in both sexes.

[0013] <<Fish to be bred>> Fish to be bred include, but are not limited to, fish belonging to the families Salmonidae, Percidae, Scombridae, Smelinidae, Carangidae, Sparidae, Clupeidae, Pleuronectidae, Flounder, Anguillididae, Pacific Saury, Cyprinidae, Mancharidae, Tetraodontidae, and Mullet.

[0014] Among the fish to be bred, salmonid fish and mackerel fish are preferred. Salmonid fish include salmon, Atlantic salmon, coho salmon, chinook salmon, sockeye salmon, pink salmon, cherry salmon, trout, rainbow trout, brook trout, brown trout, grayling, Arctic grayling, Arctic char, and Dolly Varden trout. Among salmonid fish, from the viewpoint of easier production of genetically sterile individuals, Atlantic salmon, rainbow trout, chinook salmon, coho salmon, and brown trout are preferred, with Pacific salmon and rainbow trout being more preferred, and rainbow trout being even more preferred. Scombridae fish include mackerel fish, Spanish mackerel fish, bonito fish, and tuna fish. More specifically, examples include chub mackerel, pied mackerel, Pacific mackerel, Pacific chub mackerel, Japanese mackerel, barracuda, Spanish mackerel, bonito, bonito, Spanish mackerel, skipjack tuna, skipjack tuna, albacore, yellowfin tuna, Atlantic tuna, bigeye tuna, bluefin tuna, southern bluefin tuna, Atlantic bluefin tuna, etc. Among fish of the Scombridae family, chub mackerel, pied mackerel, Pacific mackerel, and Pacific chub mackerel are preferred, with chub mackerel being more preferred, from the viewpoint of easier production of genetically sterile individuals.

[0015] <<Follicle-stimulating hormone receptor gene>> The follicle-stimulating hormone receptor gene (hereinafter also referred to as "fshr gene") is a gene involved in fertility, and is expressed in somatic cells of the gonads.

[0016] Genetically sterile individuals in the production method according to this embodiment are individuals in which the follicle-stimulating hormone receptor gene of a breeding target fish has been knocked out (hereinafter simply referred to as "KO") by genome editing. These genetically sterile individuals have insufficient gonadal somatic cell function and are sterile both when the individual is male and when it is female.

[0017] The genetically sterile individual can be produced, for example, by the following method: introducing gRNA targeting the fshr gene into a fertilized egg to produce an individual in which the fshr gene has been knocked out, crossbreeding the knocked out individual with an individual of a wild-type strain or with another knocked out individual to produce a heterozygous knocked out individual for the fshr gene, and crossbreeding the heterozygous knocked out individual with the knocked out individual or the heterozygous knocked out individual to produce an individual having mutations in the fshr gene in both alleles.

[0018] (Step of producing an individual in which the fshr gene has been knocked out) By introducing gRNA with the fshr gene as the target gene into a fertilized egg, an individual in which the Fshr gene has been knocked out can be produced. Introduction of a gene into a fertilized egg can be performed, for example, by microinjection of a CRISPR / Cas9 solution. This introduction can produce a P1 individual in which the fshr gene has been knocked out in a mosaic manner. Alternatively, after designing a gRNA with the fshr gene as the target gene, the gRNA may be introduced into a fertilized egg. The design of the gRNA will be described later.

[0019] (Step of Producing Heterozygous KO Individuals of the fshr Gene) By crossing the KO individual with a wild-type strain individual, or by crossing the KO individuals with each other, a heterozygous KO individual of the fshr gene can be produced. For example, by crossing sperm of the P1 individual with eggs of a wild-type female individual, an F1 population containing heterozygous KO individuals of the fshr gene can be produced.

[0020] When selecting only heterozygous KO individuals from the obtained F1 population, individuals are selected under the conditions that the number of deleted bases is not a multiple of 3 and that there are at least one male and one female individual to ensure the lineage, thereby establishing a heterozygous KO line. Alternatively, when selecting only heterozygous KO individuals from the obtained F1 population, individuals are selected under the conditions that the number of inserted bases is 20 to 26 and that there are at least one male and one female individual to ensure the lineage, thereby establishing a heterozygous KO line.

[0021] The method for selecting heterozygous KO individuals from the F1 population is not particularly limited, but a method for amplifying the fshr gene of the F1 individuals can be used. Specifically, PCR can be used. More specifically, the method described in Example 1 below can be used.

[0022] (Step of producing an individual with a fshr gene mutation in both alleles) By crossing the heterozygous KO individual with an individual in which the fshr gene has been knocked out or the heterozygous KO individual, an individual with a fshr gene mutation in both alleles can be produced. For example, by crossing a heterozygous KO male with a P1 female, or a heterozygous KO male with a heterozygous KO female, a biallelic KO individual with a fshr gene mutation in both alleles (hereinafter also referred to as a "biallelic KO individual") can be produced. The biallelic KO individual may be a homozygous KO individual (hereinafter also referred to as a "homozygous KO individual") with a fshr gene mutation at the same location in both alleles.

[0023] As for the mutation pattern of biallelic KO individuals, the number of deleted bases in both alleles is preferably not a multiple of 3 or the number of inserted bases is preferably 20 to 26. More preferably, both alleles have two or five deleted bases, or both alleles have 22 to 24 inserted bases. Even more preferably, both alleles have two deleted bases, or both alleles have 23 inserted bases. An example of a two-base deletion in the case of rainbow trout is a deletion of TC at bases 433 to 434 of the fshr gene (SEQ ID NO: 1) (SEQ ID NO: 2). An example of a five-base deletion in the case of rainbow trout is a deletion of ACTTC at bases 428 to 432 of the fshr gene (SEQ ID NO: 1) (SEQ ID NO: 3). An example of a 23-base insertion in the case of chub mackerel is an insertion of GTGAGTTACAGCTGATGATACAA at base 365 of the fshr gene (SEQ ID NO: 4) (SEQ ID NO: 5). More specifically, an example is one in which GTGAGTTACAGCTGATGATACAA is inserted at the 144th base in the first exon translation region (SEQ ID NO: 6) of the fshr gene (SEQ ID NO: 4) (SEQ ID NO: 7).

[0024] The CRISPR / Cas9 solution contains a complementary strand of the target sequence, a gRNA that specifies the cleavage site, and a Cas9 protein that cleaves the DNA accordingly. Because the efficiency of mutagenesis varies depending on the target sequence, the design of the gRNA that specifies the target sequence is important. The form of the gRNA varies depending on the type of CRISPR / Cas9 solution, and includes forms that contain both crRNA and tracrRNA and forms that consist only of crRNA. Known techniques can be used to design and create gRNA. For example, a method for designing gRNA can be used using known gRNA design software. A method for creating gRNA can be to incorporate the target sequence into a commercially available gRNA vector and express it.

[0025] The gRNA can be targeted to the first exon region of the fshr gene. For example, in the case of chub mackerel, the first exon translation region (SEQ ID NO: 6) of the fshr gene (SEQ ID NO: 4) can be targeted. More specifically, examples of crRNA constituting the gRNA include the crRNAs shown in Table 1 below. In Table 1, the underlined sequences indicate protospacer adjacent motif (PAM) sequences.

[0026]

[0027] In particular, in the case of chub mackerel, as shown in the Examples below, from the viewpoint of superior mutagenesis efficiency, gRNAs containing crRNAs (Nos. 1 to 5) shown in SEQ ID NOs: 8 to 12 are preferred, crRNAs (Nos. 2 and 5) shown in SEQ ID NOs: 9 and 12 are more preferred, and crRNA (No. 5) shown in SEQ ID NO: 12 is even more preferred.

[0028] In the case of rainbow trout, examples of crRNA constituting gRNA include GGGTTCTACCTAACTTCTCCCGG (SEQ ID NO: 23), GTGGAGAGTCACGCCTTTAACGG (SEQ ID NO: 24), TAAAGCACGCGGAGGTCATCCGG (SEQ ID NO: 25), etc. Among them, GGGTTCTACCTAACTTCTCCCGG (SEQ ID NO: 23) is preferred.

[0029] In the method for producing genetically sterile fish according to this embodiment, the fshr gene expressed in the somatic gonad cells of the breeding target fish is knocked out by genome editing, which causes an abnormality in the function of the somatic gonad cells to grow and differentiate germ cells, thereby sterilizing the breeding target fish. By knocking out the fshr gene expressed in the somatic gonad cells by genome editing, the fish become sterile while retaining their germ cells. Retaining the germ cells enables the mass production of genetically sterile fish in the method for mass production of genetically sterile fish described below.

[0030] Furthermore, since genetically sterile individuals have mutations in the fshr gene in both alleles, both males and females are infertile. Because both males and females are infertile, genetically sterile fish can be mass-produced without much effort in the <method for mass-producing genetically sterile fish> described below. Specifically, when only females are infertile, the effort of masculinizing females and transplanting spermatogonia having XX chromosomes is required, but this effort is unnecessary when both males and females are infertile.

[0031] [Germ cells] Genetically sterile individuals have undifferentiated germ cells. For example, in the present embodiment, germ cells of genetically sterile male salmonid fish stop differentiation at the spermatogonia stage. Therefore, the resulting testes are immature and contain many undifferentiated type A spermatogonia. For example, in the present embodiment, germ cells of genetically sterile female salmonid fish stop differentiation at the yolk follicle stage, and no oocytes at subsequent differentiation stages are present. For example, in the present embodiment, germ cells of genetically sterile male mackerel fish stop differentiation at the spermatogonia stage. Therefore, the resulting testes are immature and contain many type B spermatogonia. For example, in the present embodiment, germ cells of genetically sterile female mackerel fish stop differentiation at the perinucleolus stage, and no oocytes at subsequent differentiation stages are present.

[0032] The methods for evaluating the state of germ cells and gonads of genetically sterile individuals include the same methods as those described in Examples 2-2 to 2-4 below.

[0033] [Breeding] The breeding method for genetically sterile individuals is not particularly limited, and can be adjusted appropriately depending on the growth state of the fish to be cultured.

[0034] [Age in Months] The age of genetically sterile individuals can be appropriately selected depending on the intended use. For example, in the case of genetically sterile rainbow trout individuals in this embodiment, from the viewpoint of a larger edible portion and better meat quality and body color, males are preferably 10 months of age or older, and females are preferably 20 months of age or older. For example, in the case of genetically sterile chub mackerel individuals in this embodiment, from the viewpoint of a larger edible portion, both males and females are preferably 12 months of age or older.

[0035] [Standard body length and weight] In populations where precocious individuals are present, genetically sterile individuals tend to have larger standard body length and weight after maturity than wild-type individuals. This difference in growth is due to the growth stagnation that occurs with maturation in wild-type individuals, and genetic sterilization can prevent this growth stagnation. When genetically sterile individuals are mixed with wild-type individuals, the standard body length and weight of the genetically sterile individuals at the immature stage grow to be similar to those of the wild-type individuals. Therefore, genetically sterile individuals exhibit superior growth rates and therefore have higher commercial value as farmed fish than wild-type individuals.

[0036] [Edible portion] Genetically sterile individuals can avoid gonadal hypertrophy, so the abdominal wall does not physically elongate at maturity and can maintain its thickness. Therefore, the genetically sterile individuals of this embodiment have a larger edible portion than wild-type individuals reared under the same conditions, and have higher commercial value as farmed fish. It is preferable that the edible portion of the genetically sterile individuals be particularly thick in the abdominal wall compared to wild-type individuals.

[0037] The method for measuring the edible portion may be the same as that described in Example 2-5 below.

[0038] [Meat quality] Genetically sterile individuals avoid gonadal hypertrophy, so meat quality does not decline with maturity. Therefore, genetically sterile individuals have a higher lipid content than wild-type individuals reared under the same conditions, making them more commercially valuable as farmed fish. In particular, those with a high lipid content in the ventral area are preferred.

[0039] Meat quality may be evaluated in the same manner as described in Example 2-6 below.

[0040] [Body Color] The body color of genetically sterile individuals remains silvery-white at maturity. This is because genetically sterile individuals according to this embodiment do not exhibit secondary sexual characteristics such as darkening of the body color and a protruding, curved snout at maturity. Therefore, by maintaining a silvery-white body color at maturity, genetically sterile individuals have a higher commercial value as farmed fish.

[0041] The body color may be evaluated by the same method as that described later in Example 2-7.

[0042] [External characteristics of males and females] The external characteristics of males and females of genetically sterile individuals are almost the same in terms of standard body length and weight, so it is impossible to distinguish between males and females based on external morphology alone. Although genetically sterile individuals have gonads, as described above in [Germ cells], they have undifferentiated germ cells, and therefore their gonads are immature compared to wild-type individuals.

[0043] The method for evaluating the external characteristics of males and females may be the same as that described in Example 2-8 below.

[0044] <Method for mass-producing genetically sterile fish> The method for mass-producing genetically sterile fish according to this embodiment is a method for mass-producing next-generation genetically sterile individuals by transplanting germ cells obtained from the genetically sterile individuals described in the above <Method for producing genetically sterile fish> into germ cell-deficient individuals. Note that in the present invention and this specification, "mass production" refers to mass production.

[0045] The method for mass-producing genetically sterile fish involves transplanting undifferentiated germ cells isolated from genetically sterile individuals into germ cell-deficient individuals of the same or closely related species, which allows the germ cell-deficient individuals to produce genetically sterile individuals. These genetically sterile individuals can then be crossed with each other to mass-produce genetically sterile individuals of the next generation.

[0046] <Germ Cells> The age of the genetically sterile individual (hereinafter also referred to as "donor individual") used in the mass production method of this embodiment is not particularly limited and can be selected as appropriate. For example, in the case of a rainbow trout donor individual, the donor individual is preferably 6 months of age or older, from the viewpoint of ease of transplantation into a germ cell-deficient individual. For example, in the case of a chub mackerel donor individual, the donor individual is preferably 8 months of age or older, from the viewpoint of ease of transplantation into a germ cell-deficient individual.

[0047] The method for obtaining germ cells from a donor individual is not particularly limited, and examples thereof include obtaining germ cells in the same manner as the method described in Example 3 below.

[0048] <<Germ Cell-Deficient Individual>> A germ cell-deficient individual is one in which a dead-end gene has been knocked out by genome editing, and it is sufficient that it has no germ cells and retains gonad somatic cells.

[0049] [Dead-end gene] A dead-end gene (hereinafter also referred to as "dnd gene") is a gene involved in the survival of germ cells. An individual in which the dnd gene is knocked out by genome editing becomes infertile due to the loss of germ cells.

[0050] Typically, unless a mutant strain created by genome editing becomes a lethal strain, it is possible to pass on its traits to all next-generation individuals by mating homozygous KO individuals. However, since germ cells are lost in the dnd gene KO strain, the only way to pass on the traits of the dnd gene KO strain is to breed fertile heterozygous KO individuals. In this case, according to Mendel's law, 25% of the resulting next-generation individuals will be infertile. In other words, the dnd gene KO strain cannot sterilize all individuals.

[0051] In the mass production method of this embodiment, since only individuals in which the dnd gene has been knocked out homozygously (hereinafter also referred to as "dnd gene homozygous KO individuals") are thought to lack endogenous germ cells and produce gametes derived only from the donor individual, it is preferable to analyze the genome of each dnd gene KO individual and select dnd gene homozygous KO individuals.

[0052] The method for selecting dnd gene homozygous KO individuals is not particularly limited, but a method for amplifying KO-related genes of genomic genes can be used. Specifically, a method for amplifying KO-related genes of genomic genes using PCR can be used. More specifically, a method for amplifying genes in the same manner as the method described below in Example 3 can be used.

[0053] <<Transplantation Method>> The method for transplanting germ cells according to this embodiment is not particularly limited, but examples thereof include a transplantation method similar to the method described in <Example 3> below.

[0054] The timing for transplanting germ cells into a germ cell-deficient individual is preferably when the transplanted cell-deficient individual is a newly hatched larva.

[0055] Germ cells transplanted from a donor individual into a germ cell-deficient individual can differentiate into functional gametes derived from the fshr gene KO individual by being placed within normally functioning gonadal somatic cells, even though they lack the fshr gene.

[0056] Methods for evaluating the fertility of gametes derived from germ cell-deficient individuals (hereinafter also referred to as "transplanted individuals") into which germ cells from a donor individual have been transplanted include methods for evaluating at least one of the fertilization rate, eye development rate, hatching rate, and surfacing rate, similar to the method described below in <Example 3-3>.

[0057] <<Next-generation genetically sterile individuals>> Next-generation genetically sterile individuals are next-generation individuals derived from gametes in which the fshr gene has been knocked out, and have the same fshr gene mutation as the donor individual. By mating next-generation genetically sterile individuals with each other, it is possible to mass-produce only fshr gene homozygous knocked-out individuals. In other words, it is possible to mass-produce only genetically sterile individuals similar to those described in the above <Method for producing genetically sterile individuals>.

[0058] The method for analyzing the genomic DNA of the transplanted individual and the next-generation genetically sterile individual is not particularly limited, but the base sequence can be determined using the Sanger method or the Maxam-Gilbert method as the basic method. Furthermore, the base sequence can be determined by various instrumental analyses using PCR, etc., as necessary. More specifically, the analysis can be performed in the same manner as the direct sequence analysis described in Example 1 below.

[0059] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0060] [Test Fish] In Examples 1 to 3, fshr gene KO rainbow trout populations were used, reared at an average water temperature of 10.5 ° C. at the Oizumi Station Inland Water Production Field, Aquatic Science Field Education and Research Center, Tokyo University of Marine Science and Technology. The KO population was an fshr gene KO population obtained by mating two-year-old P1 female fish with one-year-old F1 hetero KO male fish, and is a population containing biallelic KO individuals, hetero KO individuals, and wild-type individuals. The two-year-old P1 female fish were arbitrarily selected from a P1 population in which the fshr gene was knocked out by mosaic. The P1 population was microinjected into fertilized eggs with gRNA targeting the fshr gene and Cas9 protein. The crRNA constituting the gRNA was GGGTTCTACCTAACTTCTCCCGG (SEQ ID NO: 23). The F1 heterozygous KO males of 1-year-old fish were obtained by artificially inseminating the sperm of a male P1 individual that had spermed at 1 year of age with eggs from a wild-type precocious strain female.

[0061] Example 1: Selection of fshr gene KO population To select the fshr gene KO population into biallelic KO individuals, heterozygous KO individuals, and wild-type individuals, all KO populations were subjected to screening using the following procedure. Specifically, when selecting each mutant type, caudal fin tissue was collected from each test fish, which was individually identified by PIT tag. Genomic DNA was prepared from the obtained caudal fin tissue fragments and subjected to base sequence analysis by direct sequencing.

[0062] [Individual Identification Using PIT Tags] Specifically, for individual identification using PIT tags, an incision of approximately 29 mm was made along the midline of the abdomen of the test fish (total length approximately 6 cm or more), cranially from the pelvic fin. The incision was made using a scalpel (replacement blade No. 11, manufactured by Feather Safety Razor Co., Ltd.) so as to reach the abdominal cavity. Next, a PIT tag (trade name "BIO12A", manufactured by Biomark) was disinfected in advance with 70% ethanol, and then immersed in aquatic isodine (manufactured by Mundipharma), and inserted into the abdominal cavity with the aquatic isodine still attached to the PIT tag. Subsequent rearing allowed for individual identification using a dedicated PIT tag reader, HPR Lite (manufactured by Biomark).

[0063] [Collection of caudal fin tissue] Specifically, the test fish was anesthetized with 2-phenoxyethanol (Sigma-Aldrich), and then a portion of the caudal fin tissue was cut off with scissors to be collected. The collected caudal fin tissue was used as a sample for genomic DNA extraction.

[0064] [Proteinase K Treatment] Proteins from the collected caudal fin tissue were digested to prepare for amplification by genomic PCR.

[0065] Specifically, preparations for genomic PCR amplification were made using any of Mighty Amp Kit (Nacalai Tesque), Tail Lysis Solution (Nacalai Tesque), MagExtractor-Genome (Toyobo Co., Ltd.), and Gentra Puregen Tissue Kit (Qiagen N.V.).

[0066] When using the Mighty Amp Kit, the collected caudal fin tissue was placed in a mixture of 50 μL of Proteinase K Buffer [20 mM Tris-HCl (pH 8.0), 100 mM NaCl, 5 mM EDTA, 0.1% SDS] and 0.5 μL of Proteinase K (20 mg / μL), and the mixture was incubated at 60°C for 2 to 16 hours to digest the protein. This solution was centrifuged at 20°C, 3,000 rpm, and 1 μL of the supernatant was used for PCR amplification.

[0067] When Tail Lysis Solution was used, the collected caudal fin tissue was placed in a mixed solution of 50 μL of Tail Lysis Solution and 1 μL of 20 mg / μL Proteinase K (Roche) and allowed to react at 60°C for approximately 2 to 16 hours to digest the protein. The digested solution was centrifuged in a centrifuge (product name "Model 6200", KUBOTA) at 20°C, 3,000 rpm, and 1 μL of the supernatant after centrifugation was used for PCR amplification.

[0068] When MagExtractor-Genome was used, the collected caudal fin tissue was placed in a mixed solution of 50 μL of Proteinase K Buffer and 0.5 μL of Proteinase K (20 mg / μL) and reacted at 60°C for approximately 2 to 16 hours to digest the protein. Genomic DNA was then extracted using MagExtractor-Genome according to the attached protocol and used for PCR amplification.

[0069] When the Gentra Puregen Tissue Kit was used, the collected caudal fin tissue was added to a mixed solution of 150 μL of Cell Lysis Solution SDS(−) [10 mM Tris-HCl (pH 8.0), 100 mM NaCl, 1 mM EDTA], 150 μL of Cell Lysis Solution SDS(+) [10 mM Tris-HCl (pH 8.0), 100 mM NaCl, 1 mM EDTA, 1% SDS], and 1.5 μL of Proteinase K (20 mg / μL), and the mixture was reacted at 60°C for approximately 2 to 16 hours to digest the proteins. To the digested solution, 100 μL of the protein precipitation solution included in the Gentra Puregen Tissue Kit was added. The subsequent steps were carried out according to the attached protocol, and genomic DNA was extracted and used for PCR amplification.

[0070] [PCR Amplification] PCR amplification was carried out using the solution treated with Proteinase K. In parallel, sex determination of each individual was also carried out.

[0071] When using a pretreatment solution prepared with the Mighty AmP Kit, 1 μL of the supernatant from the solution after Proteinase K treatment was used as the template. Next, PCR was performed in a 10 μL reaction system containing 0.3 μL each of forward primer P1 (SEQ ID NO: 13) and reverse primer P2 (SEQ ID NO: 14), both designed to sandwich the fshr gene mutation, and an Ex Taq kit (manufactured by Takara Bio Inc.). The reaction conditions included thermal denaturation at 98°C for 3 minutes at the start of the reaction, followed by 35 cycles of a series of reactions (94°C for 30 seconds, 62°C for 30 seconds, and 72°C for 30 seconds) to obtain a PCR amplification product. Details of each primer are shown in Table 2.

[0072]

[0073] When a pretreatment solution prepared using Tail Lysis Solution, MagExtractor-Genome, and Gentra Puregen Tissue Kit was used, PCR was performed in a 10-μL reaction system containing 0.3 μL each of forward primer P1 (SEQ ID NO: 13) and reverse primer P2 (SEQ ID NO: 14), both designed to sandwich a mutation in the fshr gene, as a template using 1 μL of the supernatant from the solution after Proteinase K treatment, and an Ex Taq kit (manufactured by Takara Bio Inc.). The reaction conditions included heat denaturation at 98°C for 3 minutes at the start of the reaction, followed by 35 cycles of a series of reactions (94°C for 30 seconds, 62°C for 30 seconds, and 72°C for 30 seconds) to obtain a PCR amplification product.

[0074] The primers used for sex determination, which was performed in parallel, were forward primer P3 (SEQ ID NO: 15) and reverse primer P4 (SEQ ID NO: 16), which correspond to the sdY gene, a male-determining gene in rainbow trout. The PCR conditions for sdY determination included heat denaturation at 98°C for 2 minutes at the start of the reaction, followed by a series of reactions (98°C for 10 seconds, 60°C for 15 seconds, and 68°C for 30 seconds) repeated 30 times. Details of each primer are shown in Table 3.

[0075]

[0076] After each reaction, 1 μL of each reaction solution was electrophoresed on a 1.5% agarose gel carrier prepared by adding Agarose S (Nippon Gene Co., Ltd.) to 0.5×TBE containing ethidium bromide, and the amplified products were confirmed by PCR. Note that, in this specification, the 0.5×TBE used was a mixture of 200 mL of 5×TBE (Tris:boric acid:0.5M EDTA (pH 8.0) = 54 g:27.5 g:20 mL, made up to 1 L with distilled water) and 60 μL of ethidium bromide, made up to 2 L with distilled water.

[0077] [Purification of PCR amplification products] The obtained PCR amplification products were purified using a FastGene Gel / PCR Extraction Kit (manufactured by Nippon Gene Co., Ltd.) according to the attached protocol. After purifying the PCR amplification products, 1 μL of each purified solution was subjected to electrophoresis using a 2% agarose gel as a carrier, and the DNA genome of the purified solution was confirmed. A microspectrophotometer (trade name "NanoDrop Lite", manufactured by Thermo) was used to confirm the purity and extraction amount of genomic DNA.

[0078] [Base sequence analysis by direct sequencing] The purified solution was mixed with 9.6 pmol of forward primer P1 (SEQ ID NO: 13), and the mixture was adjusted to 21 μL with distilled water, and then submitted to a DNA sequencing service (Eurofins Genomics). The data analyzed by the DNA sequencing service was read using CLC Main Workbench (QIAGEN) to analyze the mutation pattern.

[0079] As a result of direct sequencing analysis, it was revealed that the fshr gene KO population consisted of 17% biallelic KO individuals, 52% heterozygous KO individuals, and 31% wild-type individuals, as shown in Table 4. Among these biallelic KO individuals, it was also revealed that 6% of the entire fshr gene KO population were homozygous KO-like individuals in which the deletion patterns of bases inherited from the female parent (2-year-old P1 individual) and the male parent (1-year-old heterozygous KO F1 individual) were the same for both alleles.

[0080]

[0081] Example 2: Phenotype analysis by time-course sampling Sampling To evaluate the phenotype in each mutant section of the fshr gene KO population, biallelic KO individuals, heterozygous KO individuals, and wild-type individuals were sampled over time. Males were sampled at 9, 11, 13, 19, and 24 months of age, and females were sampled at 9, 12, 15, 18, 21, and 24 months of age. For both sexes, four individuals were sampled per section except for the 24-month age group. At the 24-month age group, six males and eight females were sampled per section.

[0082] Example 2-1: Changes over time in standard body length, body weight, gonad weight, and gonad weight index of fshr gene KO population Test fish of each age were anesthetized with 2-phenoxyethanol, and then standard body length and body weight were measured. In Example 2-4 described below, after blood collection, the individuals were abdominally opened, the gonads were removed, and the gonad weight was measured. The gonadosomatic index (hereinafter also referred to as "GSI") was calculated using the following formula: GSI (%) = gonad weight (g) / body weight (g) × 100

[0083] Example 2-1-1: Changes over time in standard body length, body weight, gonad weight, and GSI of males in the fshr gene KO population As shown in Figures 1A and 1B, the standard body length and body weight of male biallelic KO individuals tended to be larger than the standard body length and body weight of male wild-type individuals at 13 and 19 months of age.

[0084] As shown in Figure 1C, male gonad weights of biallelic KO individuals tended to be smaller than those of heterozygous KO individuals and wild-type individuals at 9, 11, 13, and 19 months of age. Furthermore, male gonad weights of biallelic KO individuals were significantly smaller than those of heterozygous KO individuals and wild-type individuals at 24 months of age.

[0085] As shown in Figure 1D, the GSI of male biallelic KO individuals tended to be smaller than that of heterozygous KO individuals and wild-type individuals at 9, 11, and 19 months of age. Furthermore, at 13 months of age, the GSI of male biallelic KO individuals and heterozygous KO individuals was significantly smaller than that of wild-type individuals. Furthermore, at 24 months of age, the GSI of male biallelic KO individuals was significantly smaller than that of heterozygous KO individuals and wild-type individuals.

[0086] Example 2-1-2: Changes over time in standard body length, body weight, body weight excluding ovary weight, gonad weight, and GSI of females in the fshr gene KO population As shown in Figures 2A to 2C, no significant differences were observed in the standard body length, body weight, and body weight excluding ovary weight of female biallelic KO individuals compared to those of heterozygous KO individuals and wild-type individuals at any age.

[0087] As shown in Figure 2D, female gonad weights of biallelic KO individuals were not significantly different from those of heterozygous KO individuals and wild-type individuals at 9 and 15 months of age. However, at 12 months of age, gonad weights of heterozygous KO individuals were significantly greater than those of biallelic KO individuals and wild-type individuals. Furthermore, at 18 months of age, gonad weights of biallelic KO individuals were significantly smaller than those of wild-type individuals. Furthermore, at 21 months of age, gonad weights of biallelic KO individuals were significantly smaller than those of heterozygous KO individuals. Furthermore, at 24 months of age, gonad weights of biallelic KO individuals were significantly smaller than those of heterozygous KO individuals and wild-type individuals.

[0088] As shown in Figure 2E, the GSI of female biallelic KO individuals was not significantly different from that of heterozygous KO individuals and wild-type individuals at 9, 12, and 15 months of age. However, at 18 months of age, the GSI of biallelic KO individuals was significantly smaller than that of wild-type individuals. Furthermore, at 21 and 24 months of age, the GSI of biallelic KO individuals was significantly smaller than that of heterozygous KO individuals and wild-type individuals.

[0089] Example 2-2: Analysis of gonad tissue by HE staining After measuring the gonad weight, the gonads were fixed in Bouin's solution (picric acid:formalin:acetic acid = 15:5:1 (volume ratio)) at 4°C for 6 to 48 hours for histological analysis. The fixed gonads were then replaced with 70% ethanol and stored at 4°C until being embedded in paraffin. The fixation time for the preovulatory ovaries of 24-month-old rats was adjusted appropriately within the range of 3 to 7 days for each tissue so that they would be in a fixed state that could be easily sliced ​​using a rotary microtome (manufactured by Leica Microsystems, product name "RM2235") in the process described below (preparation of paraffin sections).

[0090] For ovaries from 15 months of age or older, when the diameter of germ cells increases, they were fixed in Bouin's solution, then replaced with 30%, 50%, and 70% ethanol in that order for the same amount of time as the fixation time in Bouin's solution, and then stored at 4°C until paraffin embedding.

[0091] [Creation of Paraffin Blocks] Using a semi-automatic tissue processor (manufactured by Leica Microsystems, product name "TP1020"), the tissue was dehydrated in an ethanol series, then cleared with xylene (manufactured by Fujifilm Wako Pure Chemical Industries, Ltd.), and infiltrated with paraffin (manufactured by AS ONE Corporation). A paraffin-embedded block was then created using a paraffin embedding device (manufactured by Leica Microsystems, product name "EG1150H"). The created paraffin block was stored at 4°C until use.

[0092] [Creation of Paraffin Sections] After trimming the paraffin block to the size of the sample, it was sliced ​​into 4 μm-thick slices using a rotary microtome (Leica Microsystems, product name "RM2235"). The sliced ​​slices were placed on MAS-GP type A coated glass (Matsunami Glass Industry Co., Ltd.), and DEPC-treated water was allowed to penetrate into the gap between the tissue slice and the slide glass. The tissue was then stretched and dried by incubating for 4 hours to overnight on a paraffin stretcher (AS ONE Corporation, product name "EC-4030") preheated to 42°C.

[0093] [Deparaffinization and Hydrophilic Treatment] The slides with the attached tissue sections were placed in a staining basket and subjected to deparaffinization and hydrophilic treatment as follows: After immersion in xylene for 10 minutes twice, the slides were immersed in 100% ethanol for 5 minutes. The slides were then immersed in 95% ethanol, 90% ethanol, 80% ethanol, 70% ethanol, and 50% ethanol for 2 minutes each. The slides were then gently rinsed with distilled water to remove the paraffin from the tissue sections and to subject them to hydrophilic treatment.

[0094] [Hematoxylin-eosin staining, dehydration, and mounting] After the hydrophilic treatment, hematoxylin-eosin staining (hereinafter also referred to as "HE staining") was performed. After HE staining, the slide glass was immersed in 70% ethanol, 80% ethanol, 90% ethanol, 95% ethanol, and 99.5% ethanol for 3 to 5 seconds each. Next, the slide glass was immersed in 100% ethanol for 3 minutes, which was repeated twice. Next, the slide glass was immersed in xylene for 3 minutes, which was repeated twice. Next, the slide glass after dehydration was mounted using "Entellan new" (product name, manufactured by Merck KGaA), air-dried overnight, and then stored in a dark place at room temperature until detection by fluorescence microscopy, which will be described later.

[0095] Example 2-2-1: Testis tissue analysis by HE staining Testis tissues of biallelic KO individuals and wild-type individuals were observed using HE staining. The differentiation stages of germ cells were determined based on the differentiation stages described in Non-Patent Document 3. The results are shown in Figures 3(A) and 3(B).

[0096] As a result, it was confirmed that wild-type individuals differentiated normally from spermatogonia to sperm, whereas biallelic KO individuals showed that differentiation stopped at spermatogonia and no differentiated cells beyond spermatocytes were present.

[0097] Example 2-2-2: Ovarian tissue analysis by HE staining The ovarian tissues of biallelic KO individuals and wild-type individuals were observed by HE staining. The differentiation stages of germ cells were determined based on the differentiation stages described in Non-Patent Document 4. The results are shown in Figures 4(A) and 4(B).

[0098] As a result, it was confirmed that wild-type individuals differentiated normally, whereas biallelic KO individuals stopped differentiating at the yolk follicle stage, and no oocytes at subsequent differentiation stages were present.

[0099] Example 2-3: Immunohistochemical staining using testicular tissue from 24-month-olds Immunohistochemical staining was performed to determine whether the spermatogonia were undifferentiated type A spermatogonia or differentiated type B spermatogonia.

[0100] To determine whether the spermatogonia in the testicular tissue of a 24-month-old biallelic KO individual (body length: 31.0 cm, body weight: 546.5 g, gonad weight: 0.20 g) were undifferentiated type A spermatogonia or differentiated type B spermatogonia, the specimen was subjected to immunohistochemical staining using rainbow trout anti-germ cell antibody No. 189 antibody (antibody described in Non-Patent Document 5) and anti-rainbow trout Gsdf antibody (antibody described in Non-Patent Document 6).

[0101] Specifically, a 1x Histo VTone solution (manufactured by Nacalai Tesque, Inc.) diluted with distilled water was heated to 90°C in advance to become cloudy. Next, the slide glass deparaffinized and hydrophilized as described above (Deparaffinization and Hydrophilization) was immersed in the Histo VTone solution and treated at 90°C for 20 minutes.

[0102] The treated slide glass was then washed with distilled water for 2 minutes, and this washing was repeated three times. It was then washed once with 0.1% Tween 20 / PBS for 2 minutes. In this example, 20x PBST contained 28.4 g of Na ２ P.O. ４ and 175 g of NaCl were dissolved in ion-exchanged water, adjusted to pH 7.5 with phosphoric acid, and 20 mL of Tween 20 was added, followed by distilled water to make up to 1 L. For 0.1% Tween 20 / PBS, 100 mL of 20x PBST was diluted with 2 L of ion-exchanged water to make up to 1 L.

[0103] Next, the tissue was bordered with Liquid Blocker Super PAP Pen (manufactured by Daido Sangyo Co., Ltd.), and then 4% Block Ace (manufactured by DS Pharma Co., Ltd.) was added dropwise, followed by blocking treatment in a humidified box at room temperature for about 30 minutes to 1 hour.

[0104] In this example, double immunohistochemical staining was performed, and therefore two types of antibodies were used in combination as the primary and secondary antibodies.

[0105] The primary antibody solution used was an anti-rainbow trout No. 189 antibody and an anti-Gsdf antibody diluted 1000-fold and 5000-fold with Can Get Signalimmunostain solution B (Toyobo Co., Ltd.). The primary antibody solution was added dropwise to the blocked sample, which was then placed in a humidified box and left to stand on a shaker at 4°C for 16 to 18 hours to allow for a primary antigen-antibody reaction. The primary antibody solution was then removed, and the sample was washed three times with 0.1% Tween 20 / PBS for 5 minutes.

[0106] The secondary antibody solution used was Alexa Fluor 488 Anti-mouse IgG and Alexa Fluor 546 Anti-rabbit IgG (manufactured by Toyobo Co., Ltd.), each diluted 200-fold with Can Get Signal Immunostain Solution A (manufactured by Toyobo Co., Ltd.), and reacted on a shaker at room temperature for 1 hour.

[0107] The secondary antibody solution was then removed, and the tissue sections were washed three times with 0.1% Tween / PBS for 5 minutes each while shielded from light. After that, a cover glass was placed on the tissue sections, and fluorescent cells were detected under a fluorescence microscope (product name "BX53", manufactured by Olympus Corporation). After microscopic examination, the tissue sections were lightly rinsed with distilled water and then subjected to HE staining.

[0108] Non-Patent Document 7 describes that type A spermatogonia are characterized as large spermatogonia that exist singly surrounded by gonad somatic cells. In this example, type A spermatogonia in tissues were identified using this characteristic as an index.

[0109] Observation of testicular tissue sections obtained by immunohistochemical staining revealed numerous large, single germ cells surrounded by gonadal somatic cells, as indicated by the arrowheads in Figures 5(A) to (D).

[0110] From the above results, it was revealed that the testes of 24-month-old biallelic KO individuals contained a large number of type A spermatogonia.

[0111] Example 2-4: Measurement of 11-ketotestosterone and estradiol-17β concentrations by ELISA To measure the production amounts of 11-ketotestosterone (hereinafter also referred to as "11-KT") in males and estradiol-17β (hereinafter also referred to as "E2") in females, the concentrations of 11-KT and E2 in plasma were measured by ELISA using biallelic KO individuals and wild-type individuals.

[0112] [Extraction of steroid hormones] Blood used for measuring 11-KT and E2 concentrations by ELISA was collected from the caudal peduncle of test fish aged 9 to 25.5 months using a syringe (Terumo Corporation). The collected blood was mixed with 5 μL of 1000 U / mL heparin sodium (Fujifilm Wako Pure Chemical Industries, Ltd.) and then centrifuged at 4°C, 13,200 rpm, and 10 minutes in a refrigerated centrifuge (Kubota Shoji Co., Ltd.) to obtain plasma. The plasma was stored at -20°C until use in steroid hormone analysis.

[0113] 10 μL of frozen plasma was thawed, and 90 μL of PBS(-) was added, followed by 500 μL of diethyl ether. The mixture was vortexed at 20° C. for 30 minutes, after which the aqueous layer was frozen at −80° C. and the ether layer was collected. 500 μL of diethyl ether was added to the thawed aqueous layer, and the mixture was vortexed at 20° C. for 30 minutes, after which the aqueous layer was frozen at −80° C. and the ether layer was collected, thereby extracting steroid hormones contained in the plasma.

[0114] [Measurement of 11-KT and E2 Concentrations] The ether layers from which the steroid hormones were extracted were mixed and then air-dried at room temperature. The air-dried mixture was subjected to ELISA using an 11-keto Teststerone ELISA Kit (manufactured by Cayman Chemical Co.) and an Estradiol ELISA Kit (manufactured by Cayman Chemical Co.) according to the protocol attached to the kits to measure the amounts of 11-KT and E2 contained in the plasma.

[0115] Example 2-4-1: Measurement of 11-KT concentration by ELISA As shown in FIG. 6, the plasma 11-KT concentration of males was measured, and it was revealed that the plasma 11-KT concentration was significantly lower in biallelic KO individuals than in wild-type individuals at 24 months of age.

[0116] Example 2-4-2: Measurement of E2 concentration by ELISA As shown in FIG. 7, the plasma E2 concentration of female mice was measured, and it was revealed that the plasma E2 concentration was significantly lower in biallelic KO mice than in wild-type mice at the ages of 9, 18, and 25.5 months.

[0117] Example 2-5: Abdominal wall thickness in spawning females In order to evaluate phenotypes other than fertility in biallele KO individuals, abdominal wall thickness was measured using spawning female individuals.

[0118] For the test fish, ovulated wild-type individuals were selected, and biallelic KO individuals of similar size to wild-type individuals were selected based on standard body length for comparison. Specifically, three 25.5-month-old female biallelic KO individuals (body length: 32.4 ± 1.2 cm, body weight: 598.5 ± 77.4 g, gonad weight: 0.83 ± 0.08 g) and their siblings, three 25.5-month-old female wild-type individuals (body length: 33.5 ± 2.3 cm, body weight: 704.0 ± 121.2 g, gonad weight: 86.52 ± 13.48 g) were used for measurements.

[0119] To measure the abdominal wall thickness of 25.5-month-old females, the fish was sliced ​​just behind the pectoral fin as shown in Figure 8(A), and the thickness of the abdominal wall at two points on the left and right of the end of the abdominal bone observed from the cross section was measured using an electronic caliper (trade name "Digital Carbon Caliper BM-803" (manufactured by Ito Corporation)). Representative examples of abdominal wall thickness in female individuals during the spawning period are shown in Figures 8(B) to (D).

[0120] The results of measuring abdominal wall thickness using female individuals at the spawning stage are shown in Figure 9. As a result, the abdominal wall thickness of females at 25.5 months of age was 3.6 ± 0.1 mm for biallelic KO individuals and 2.9 ± 0.2 mm for wild-type individuals. In other words, it was revealed that the abdominal wall of female biallelic KO individuals at the spawning stage was significantly thicker than that of female wild-type individuals at the spawning stage.

[0121] Example 2-6: Analysis of lipids in muscle To evaluate phenotypes other than fertility in biallelic KO individuals, the amount of lipids in muscle was analyzed.

[0122] As male test fish, six male biallelic KO individuals and six male wild-type individuals at 24 months of age used in the above (Sampling) were used. As female test fish, three female biallelic KO individuals and three female wild-type individuals at 25.5 months of age used in the above <Example 2-5> were used.

[0123] For 24-month-old males, lipid analysis was performed on muscle strips measuring approximately 10-15 g from the dorsal fin cranial to the spine. For 25.5-month-old females, muscle strips cut cranial to the dorsal fin were separated into dorsal and ventral sections from the spine, and lipid analysis was performed on muscle strips measuring approximately 20-30 g from each section. Lipid analysis was commissioned to the Japan Food Research Laboratories, and lipid content was calculated using the Soxhlet extraction method.

[0124] Example 2-6-1: Lipid analysis in muscle of 24-month-old males As shown in FIG. 10, analysis of the lipid content of dorsal muscle slices from 24-month-old males showed a tendency for biallelic KO individuals to have a higher lipid content than wild-type individuals.

[0125] Example 2-6-2: Lipid analysis in muscle of 25.5-month-old females As shown in Figure 11 (A), analysis of the lipid content of dorsal muscle slices from 25.5-month-old females revealed a tendency for biallelic KO individuals to have higher lipid content than wild-type individuals. On the other hand, as shown in Figure 11 (B), analysis of the lipid content of ventral muscle slices from 25.5-month-old females revealed that biallelic KO individuals had significantly higher lipid content than wild-type individuals.

[0126] Example 2-7: Evaluation of body color To evaluate phenotypes other than fertility in biallelic KO individuals, body color was evaluated.

[0127] The test fish were the same as the 24-month-old biallelic KO individuals and wild-type individuals described in the above [Sampling], and six individuals of each sex were used, and the body color of the fish was visually evaluated.

[0128] 12(A) to (D), it was revealed that all 24-month-old biallelic KO individuals (n=6) of both sexes were silvery. Example 2-8: External characteristics of males and females To evaluate phenotypes other than fertility in biallelic KO individuals, external characteristics of males and females were evaluated.

[0129] The test fish were 24-month-old biallelic KO individuals and wild-type individuals described in the above [Sampling], six individuals of each sex, and their standard body length and weight were measured, and the maturity of their gonads was visually evaluated.

[0130] As shown in Figures 13(A) and 13(B), both individuals showed similar growth in standard body length and weight, making it impossible to distinguish between males and females based on external morphology alone. As shown in Figures 14(A) and 14(B) and Figures 15(A) and 15(B), it was revealed that although female and male biallelic KO individuals retained testes and ovaries, their gonads were immature compared to wild-type individuals.

[0131] Example 3 Germ Cell Transplantation Experiment To verify whether germ cells in which the fshr gene was knocked out can differentiate into gametes in the gonads of germ cell-deficient individuals, a germ cell transplantation experiment was carried out using testicular cells from biallelic KO individuals as donor spermatogonia.

[0132] [Test fish] Six 14-month-old male biallelic KO individuals (body length: 18.5 ± 0.5 cm, body weight: 100.9 ± 7.6 g) were used as donor individuals. The mutation pattern of all donor individuals used was standardized to two-base deletion in both alleles (SEQ ID NO: 2). 32-day-old hatched larvae of dnd gene KO rainbow trout were used as germ cell deletion individuals.

[0133] [Preparation of donor spermatogonia] After anesthetizing donor individuals in a 2-phenoxyethanol solution, the abdomen was opened and the testes were removed. The average weight and GSI of the removed testes were 35.8±3.7 mg and 0.035±0.001%, respectively. Testis fragments were then prepared by finely cutting them using Weckel scissors (trade name "MB-41", manufactured by Natsume Seisakusho Co., Ltd.). The obtained testis fragments were treated in a cell dispersion enzyme solution at 20°C for 2 hours, and the cells were dispersed until they reached a single-cell state. During the enzyme treatment, pipetting was performed every 30 minutes to promote dissociation of the testis fragments. In this example, the cell dispersion enzyme solution used was a mixture of 850 μL of 1×PBS(+) (pH 8.2), 100 μL of 8.55 unit / μL trypsin solution (manufactured by Worthington), 50 μL of FBS, and 10 μL of 15 unit / μL DNase I solution.

[0134] After the enzyme treatment, the cell dispersion solution was centrifuged at 200 × g at 10°C for 10 minutes and washed with L-15 solution (250 mL, pH 7.8) containing 4.122 g of L15 powder, 1.8 g of HEPES, 300 μL of Stpeptmyzin, and 300 μL of Ampicillin.

[0135] The cell dispersion solution was washed twice with L-15 solution and then filtered through a 42 μm nylon mesh to remove incompletely dissociated cell aggregates. The cell solution was recovered to obtain a testicular cell suspension containing spermatogonia.

[0136] Next, the number of dispersed cells was counted using a hemocytometer (Hirschmann), and 500,000 dispersed cells were dispensed to count the type A spermatogonia present in the dispersed cells. No. 95 Mouse IgM-Alexa488 antibody (the antibody described in Non-Patent Document 8) was used to count the type A spermatogonia.

[0137] The dispensed solution containing 500,000 dispersed cells was centrifuged at 10°C, 200 x g, for 10 minutes, and the supernatant was removed. Next, an antibody solution containing 99 µL of L-15 solution and 1 µL of No. 95 antibody was added to the solution containing 500,000 dispersed cells after the supernatant was removed, and the solution was left standing at 4°C for 30 minutes in the dark. Furthermore, 1 mL of L-15 solution was added to the solution containing 500,000 dispersed cells, and the solution was centrifuged at 10°C, 200 x g, for 10 minutes. This procedure was repeated twice.

[0138] Next, the number of type A spermatogonia was counted using a counting chamber under a fluorescence microscope. After counting the number of type A spermatogonia, 1 mM Rock inhibitor (trade name "Y-27632", Sigma-Aldrich) was added to the donor testis cell suspension to a final concentration of 50 μM, and the suspension was left to stand overnight at 4°C.

[0139] Immediately before use in transplantation, the donor testis cell suspension was centrifuged at 10°C, 200 xg, for 10 minutes, and after removing the supernatant, L-15 solution was added to adjust the concentration of the cell suspension.

[0140] [Transplantation of spermatogonia] After anesthetizing a germ cell-deficient individual with 2-phenoxyethanol, a donor testicular cell suspension containing 20,000 to 40,000 type A spermatogonia was aspirated with a transplant needle under a stereomicroscope and inserted into the abdominal cavity of the germ cell-deficient individual for microinjection. After transplantation, the germ cell-deficient individual was transferred to a recovery tank filled with an isotonic solution and reared overnight. Thereafter, the individual was reared in running water at 10.5°C. In this example, the isotonic solution was a mixture of 9.02 g of NaCl and 0.34 g of CaCl 2H ２0 and 0.24 g of KCl, and the mixture was diluted to 1 L with distilled water.

[0141] For cell transplantation, a stereomicroscope (product name: "SMZ-10A," manufactured by Nikon Corporation) and a microinjector (product name: "IM-9A," manufactured by Narishige Scientific Instruments Laboratory Co., Ltd.) were used. Furthermore, a glass capillary (product name: "G-1," manufactured by Narishige Scientific Instruments Laboratory Co., Ltd.) was processed with a puller (product name: "PW-6," manufactured by Narishige Scientific Instruments Laboratory Co., Ltd.) and a polisher (product name: "EG-44," manufactured by Narishige Scientific Instruments Laboratory Co., Ltd.) to create a pipette with a tip outer diameter of 60 to 80 μm, which was used for cell transplantation.

[0142] [Selection of germ cell-deficient individuals] Since it is believed that only individuals in the host population with a homozygous knockout of the dnd gene lack endogenous germ cells and produce only donor-derived gametes, germ cell-deficient individuals were selected using PCR.

[0143] (Collection of Caudal Fin Tissue) Collection of caudal fin tissue from germ cell-deficient individuals was carried out in the same manner as described in Example 1 above.

[0144] (Proteinase K Treatment) Proteinase K treatment of the collected caudal fin tissue was carried out in the same manner as described in Example 1 above.

[0145] (Amplification by PCR) Using the Proteinase K-treated solution, a PCR amplification product was obtained in the same manner as in the method described in Example 1 above.

[0146] Specifically, when a pretreatment solution prepared using the Mighty AmP Kit was used, 1 μL of the supernatant of the solution after treatment with Proteinase K was used as a template. Next, 0.3 μL each of forward primer P5 (SEQ ID NO: 17) and reverse primer P6 (SEQ ID NO: 18), which were designed to sandwich the mutation in the dnd gene, was added to the Mighty AmP kit. ＴＭPCR was performed by adding the mixture to 10 μL of a reaction system containing DNA Polymerase Ver. 3 (manufactured by Takara Bio Inc.). After thermal denaturation at 98°C for 2 minutes at the start of the reaction, a series of cycles (98°C for 10 seconds, 60°C for 15 seconds, 68°C for 30 seconds) was repeated 35 times.

[0147] When using a pretreatment solution prepared using Tail Lysis Solution, MagExtractor-Genome, and Gentra Puregen Tissue Kit, 1 μL of the supernatant from the solution after Proteinase K treatment was used as the template. Next, 0.3 μL each of forward primer P5 (SEQ ID NO: 17) and reverse primer P6 (SEQ ID NO: 18), designed to sandwich the dnd gene mutation, was added to a 10 μL reaction system containing an Ex Taq kit (Takara Bio Inc.) for PCR. The reaction conditions included heat denaturation at 98°C for 3 minutes at the start of the reaction, followed by a series of reactions (94°C for 30 seconds, 60°C for 30 seconds, and 72°C for 30 seconds) repeated 35 times. Details of each primer are shown in Table 5.

[0148]

[0149] In parallel, the sex of each individual was determined in the same manner as in Example 1.

[0150] After each reaction was completed, PCR amplification products were confirmed in the same manner as in Example 1 above, and individuals lacking germ cells were selected.

[0151] [Analysis of Genomic DNA] The genomic DNA of the collected sperm or fry was analyzed using the following method.

[0152] (Extraction of Genomic DNA) Specifically, collected sperm or a portion of the tissue of the juvenile fish was added to 150 μL of Cell Lysis Solution SDS(-) [10 mM Tris-HCl (pH 8.0), 100 mM NaCl, 1 mM EDTA]. In the case of sperm, the mixture was stirred thoroughly until the aggregates dissolved. Next, Cell Lysis Solution SDS(+) [10 mM Tris-HCl (pH 8.0), 100 mM NaCl, 1 mM EDTA, 1% SDS] and 1.5 μL of Proteinase K (20 mg / μL) were added, stirred thoroughly, and then allowed to stand at 60°C for 16 hours.

[0153] To the obtained cell lysate, 100 μL of protein precipitation solution included in the Gentra Puregen Tissue Kit (manufactured by Qiagen N.V.) was added. The subsequent steps involved extracting genomic DNA according to the protocol attached to the kit.

[0154] (Amplification by PCR) Using the post-extraction genomic DNA solution, a PCR amplification product was obtained in the same manner as in the method described in Example 1 above.

[0155] (Purification of PCR amplification products) Purification of PCR amplification products was carried out in the same manner as described in Example 1 above.

[0156] (Base sequence analysis by direct sequencing) Using the purified solution, the mutation pattern was analyzed in the same manner as in the method described in Example 1 above.

[0157] Example 3-1: Verification of gamete production ability after transplantation of testicular cells from biallelic KO individuals into dnd gene knockout individuals

[0158] The prepared testicular cell suspension (2,029,000 type A spermatogonia obtained by cell dispersion) was transplanted into the abdominal cavity of 97 germ cell-deficient individuals. As a result, 42 of the transplanted individuals were alive at 8 months of age.

[0159] Homozygous KO individuals were selected from the surviving transplanted individuals using PCR. As a result of the selection, it was confirmed that out of 42 transplanted individuals, 8 were homozygous KO individuals, of which 5 were male and 3 were female. Furthermore, spermation was confirmed in one of the male homozygous KO individuals at 10 months of age.

[0160] Example 3-2 Analysis of Sperm Genomic DNA Obtained from Transplanted Individuals To verify whether the sperm discharged from the homozygous KO individuals were exclusively donor-derived sperm, sperm genomic DNA was subjected to direct sequence analysis.

[0161] As a result, it was confirmed that the sperm obtained from the transplanted individuals had a two-base deletion (SEQ ID NO: 2) in the fshr gene (SEQ ID NO: 1), as shown in Figure 18. Furthermore, the waveform of the obtained sequence was a single peak, and considering that the donor individuals were all homozygous KO individuals with the two-base deletion, it was revealed that all of the sperm obtained from the transplanted individuals were derived from donor germ cells.

[0162] Example 3-3: Verification of fertilizing ability of sperm obtained from transplanted individuals In order to verify the functionality of sperm obtained from transplanted individuals, a mating experiment was carried out.

[0163] Sperm collected from the transplanted individuals were mated by artificial insemination with eggs collected from wild-type individuals (hereinafter also referred to as the "transplant group"). At the same time, as a control group, eggs collected from wild-type individuals were mated by artificial insemination with sperm from wild-type individuals. Gametes were collected by a known extraction method, and fertilization was carried out by washing the eggs by a known isotonic egg washing method, followed by fertilization with a known 1.1% NaHCO solution. ３ Fertilized eggs were obtained by immersion insemination. Twelve hours after fertilization, 24 randomly selected fertilized eggs were checked for cleavage to determine the fertilization rate.

[0164] The fertilized eggs were then left under running water (10.5°C) until they developed eyes, after which the number of eyed eggs was recorded and the eggs were again reared under running water (10.5°C). After hatching, the hatching rate and the floating rate were recorded to evaluate post-hatching development.

[0165] As shown in Table 6, the fertilized eggs obtained by mating the sperm of the transplanted individuals with the eggs of wild-type individuals showed the same fertilization rate, eye development rate, hatching rate, and emergence rate as the fertilized eggs obtained by mating between wild-type individuals.

[0166]

[0167] The morphology of the fertilized eggs, eyed eggs, and emerged fry obtained by mating the sperm of transplanted individuals with the eggs of wild-type individuals is shown in Figures 19(A) to (D). As a result, no significant differences were observed in the morphology of the fertilized eggs, eyed eggs, and emerged fry compared to the fertilized eggs obtained by mating wild-type individuals.

[0168] These results demonstrate that the sperm of transplanted individuals have the same fertilizing ability as the sperm of wild-type individuals.

[0169] Example 3-4: Genomic DNA analysis of next generation individuals derived from transplanted individuals In order to verify whether the individuals obtained by fertilization were next generation individuals derived from the transplanted individuals, 10 individuals were randomly selected from the fry that had emerged, and the genomic DNA of each fry was analyzed using direct sequencing.

[0170] As a result, as shown in Figure 20, it was revealed that 10 out of 10 randomly selected fry were heterozygous KO individuals having a two-base deletion (sequence number 2) in the fshr gene in only one allele.

[0171] These results demonstrate that the next generation of genetically sterile individuals can be mass-produced by transplanting germ cells obtained from genetically sterile individuals into germ cell-deficient individuals.

[0172] Example 4: Design of gRNA with high cleavage efficiency Five types of gRNA were designed to target the first exon translation region (SEQ ID NO: 6) immediately after the start of transcription in the fshr gene of chub mackerel (SEQ ID NO: 4, FIG. 21(A)), and their cleavage efficiency was evaluated.

[0173] The designed gRNAs (No. 1 to No. 5) are shown in Figure 21 (B) and Table 7. SEQ ID NOs: 8 to 12 indicate the crRNAs (No. 1 to No. 5) that make up the gRNAs (No. 1 to No. 5), respectively. In Table 6, the underlined sequences indicate the protospacer adjacent motif (PAM) sequences.

[0174]

[0175] A PCR product was obtained by amplifying a gene fragment of fshr containing the target sequence using PCR in the same manner as described in Example 1 above, except that forward primer P7 (SEQ ID NO: 19) and reverse primer P8 (SEQ ID NO: 20), which were designed to flank the mutation in the fshr gene, were used. Details of each primer are shown in Table 8.

[0176]

[0177] Next, the PCR amplification product was cleaved using each gRNA (No. 1 to 5) and Cas9 protein. The cleaved PCR amplification product was then subjected to electrophoresis. The cleavage efficiency was calculated using the fluorescence intensity of the band obtained by electrophoresis and the following formula: Cleavage efficiency (%) = fluorescence intensity of the cleaved band / fluorescence intensity of all bands

[0178] As shown in Figures 22(A) and (B), among the five types of gRNAs, No. 5 showed the highest cleavage efficiency (88.2%).

[0179] Example 5: Introduction of mutation into the fshr gene of chub mackerel

[0180] Using gRNA No. 5, which was the most efficient at cleaving PCR amplification products in vitro (Example 4), we investigated the efficiency of introducing mutations into the fshr gene of chub mackerel using a CRISPR / Cas9 solution to determine whether highly efficient mutagenesis is also possible in vivo.

[0181] Gonadotropin-releasing hormone analogue (GnRHa) was administered to mackerel parent fish (male and female) to induce spawning. Then, gRNA No. 5 and Cas9 protein were microinjected into the resulting fertilized eggs (1-2 cell stage).

[0182] The microinjected fertilized eggs were then hatched to obtain larvae. DNA was extracted from the larvae (17 fish) and subjected to PCR in the same manner as described in Example 1. The resulting PCR amplified products were then subjected to T7 endonuclease I analysis. T7 endonuclease I is an enzyme that cleaves mismatches in double-stranded DNA. When the PCR amplified products were treated with T7 endonuclease I and subjected to electrophoresis, only a 126 bp band was observed because the unmutated wild-type fragment was not cleaved. On the other hand, when a mutant fragment with a mutation introduced into fshr was subjected to electrophoresis, two cleaved bands (approximately 70 bp and approximately 50 bp) were observed on the low molecular weight side.

[0183] As shown in Figure 23, 17 microinjected individuals were subjected to T7 endonuclease I analysis, and two cleaved bands were confirmed in 14 of the 17 tails. That is, the mutation introduction efficiency was 82.4%. From this, it became clear that microinjection of CRISPR / Cas9 can introduce mutations into the fshr gene of chub mackerel with high efficiency.

[0184] Example 6: Production of Chub Mackerel P1 Individuals By microinjecting gRNA No. 5 and Cas9 protein into fertilized eggs of chub mackerel in the same manner as described in Example 5, a total of 1,341 fertilized eggs were produced in addition to the fertilized eggs obtained in Example 5. The fertilized eggs were hatched and reared until 30 days old. As a result, 71 fish survived. Furthermore, as a result of rearing the chub mackerel until they reached 1 year of age, when both males and females mature, 25 fish survived. The rearing was carried out at the Tokyo University of Marine Science and Technology Aquatic Science Field Education and Research Center Inland Water Production Field Tateyama Station, at an average water temperature of 23 ° C.

[0185] Example 6-1: Confirmation of Mutation Introduction The microinjected individuals have a mosaic of cells with a mutation in the fshr gene and cells without the mutation. Therefore, if the mutation in the fshr gene is not introduced into the gametes responsible for producing the next generation, heterozygous KO individuals cannot be obtained even when crossed with wild-type individuals. Therefore, in order to reliably produce heterozygous KO individuals, it is important to confirm that the mutation in the fshr gene has been introduced into the gametes.

[0186] Therefore, sperm were collected from the microinjected male individuals (1 year old), and DNA extracted from the sperm was subjected to T7 endonuclease I analysis. T7 endonuclease I analysis was performed in the same manner as described in Example 5. As a result, a mutation in the fshr gene was detected in the sperm of one of the eight males. The DNA of this sperm was subjected to direct sequencing analysis in the same manner as described in Example 1, except that the above-mentioned forward primer P7 (SEQ ID NO: 19) and reverse primer P8 (SEQ ID NO: 20) were used. As a result, as shown in FIG. 24(A), it was revealed that this sperm contained a mutant sequence (SEQ ID NO: 7) in which 23 bases were inserted into the target sequence of CRISPR / Cas9 in the first exon translation region (SEQ ID NO: 6) of the fshr gene.

[0187] <Example 6-2: Functional Deficiency of Mutant fshr> Next, we investigated whether the mutant fshr detected from the sperm was functionally defective. Specifically, the nucleotide sequence of the mutant fshr (SEQ ID NO: 5) was translated. As a result, as shown in Figure 24(B), while the wild-type fshr is a protein of 728 residues (SEQ ID NO: 21), the mutant fshr had a stop codon at the 49th residue, significantly shortening it to 48 residues (SEQ ID NO: 22). These results clearly demonstrate that functional defects of fshr can be expected.

[0188] Example 7: Production of F1 generation chub mackerel using mutant chub mackerel sperm An attempt was made to produce F1 generation individuals by crossbreeding the chub mackerel sperm into which the fshr gene mutation had been introduced with wild-type chub mackerel eggs. The crossbreeding was carried out in the same manner as described in Example 3-3. As a result, 44,906 larvae were successfully produced. The F1 individuals were reared until they were 7 months old, and 406 survived. The rearing was carried out under the same conditions as described in Example 6.

[0189] Example 7-1: Selection of Heterogeneous KO Individuals from a Population of F1 Generation Chub Mackerel DNA was extracted from the fins of the F1 individuals and subjected to PCR in the same manner as described in Example 1, except that the forward primer P7 (SEQ ID NO: 19) and reverse primer P8 (SEQ ID NO: 20) described above were used. When the PCR product was subjected to electrophoresis, in the case of a wild-type without mutation, only an 87 bp band could be confirmed. On the other hand, in the case of a mutant with a 23-base insertion in the fshr gene, two bands of 87 bp and 110 bp could be confirmed. As described above, heterogeneous KO individuals can be selected from a population of F1 generation individuals using PCR.

[0190] Figure 25 shows an example of the results of selecting heterozygous KO individuals from the F1 population. As shown in the frame, two bands of 87 bp and 110 bp were confirmed, making it clear that heterozygous KO individuals can be selected from the F1 population. By similar analysis, we succeeded in selecting 34 heterozygous KO individuals from a total of 406 F1 populations.

[0191] <Example 7-2: Sperm of Heterozygous KO Individuals> When the presence or absence of spermatogenesis of the 7-month-old heterozygous KO individuals was confirmed, spermatogenesis was confirmed, and it was revealed that the sperm had motility. Next, DNA was extracted from the sperm and subjected to PCR in the same manner as described in <Example 7-1>. As a result, as shown in Figure 26, it was also revealed that a 23-base insertion mutation was introduced into the fshr gene of the sperm of this individual.

[0192] Example 8: Production of F2 generation mackerel GnRHa was administered to male and female heterozygous KO individuals (1 year old) of the F1 generation mackerel to induce spawning, thereby attempting to produce F2 generation mackerel individuals. F2 generation individuals obtained by mating heterozygous KO individuals were reared until 8 months of age. Rearing was carried out in the same manner as in Example 6, and animals were reared together regardless of genotype.

[0193] The genotypes and sex frequencies of individuals that survived to 8 months of age were then investigated. Genotypes were selected using PCR in the same manner as described in Example 1. As a result, as shown in Table 9, genotypes emerged according to Mendel's laws, and no differences in survival rates were observed. The sex ratio of homozygous KO individuals was 1:1, and no cases of genotypic sex reversal and phenotypic sex reversal were observed.

[0194]

[0195] Example 8-1: Appearance, standard body length, weight, gonad maturity, and gonad weight index

[0196] The test fish used were 13-month-old F2 generation individuals of the above-mentioned chub mackerel (homozygous KO individuals, heterozygous KO individuals, and wild-type individuals), five males and five females of each sex. Standard body length, body weight, and GSI were evaluated in the same manner as described in Example 2-1. Appearance and maturity of the gonads were evaluated by visual observation.

[0197] As shown in Figures 27, 28(A), and 28(B), it was confirmed that the appearance, standard body length, and weight were similar in each group. In other words, the F2 generation individuals of chub mackerel showed almost the same growth, making it clear that they cannot be distinguished by external morphology alone.

[0198] 29 and 30, the gonads of both males and females in homozygous KO individuals were smaller than those in wild-type individuals, and the GSI was also significantly smaller. In other words, although female and male homozygous KO individuals retained testes and ovaries, their gonads were less mature than those in wild-type individuals.

[0199] Example 8-2: Analysis of gonad tissue by HE staining Similar to the method described in Example 2-2, the gonads of the above-mentioned F2 generation mackerel individuals (homozygous KO individuals, heterozygous KO individuals, and wild-type individuals) at 13 months of age were subjected to histological analysis, and testicular and ovarian tissues were observed. The differentiation stages of germ cells were determined based on the differentiation stages described in Non-Patent Documents 3 and 4. Representative results are shown in Figures 31 and 32. As shown in Figures 31 and 32, while normal differentiation was confirmed in wild-type individuals, differentiation of male homozygous KO individuals was arrested at type B spermatogonia, and differentiation of female homozygous KO individuals was arrested at peripheral nucleolar oocytes.

[0200] Example 8-3: Abdominal wall thickness The abdominal wall thickness was measured using the above-mentioned F2 generation individuals of mackerel in the same manner as described in Example 2-5. Five male and five female individuals of the above-mentioned F2 generation individuals of mackerel (homozygous KO individuals, heterozygous KO individuals, and wild-type individuals) were used as test fish. The homozygous KO individuals and heterozygous KO individuals were selected to be approximately the same size as wild-type individuals based on the standard body length. Representative examples of abdominal wall thickness in homozygous KO individuals and wild-type individuals are shown in Figures 33(A) and (B).

[0201] As shown in Figure 34, it was revealed that the abdominal wall of male homozygous KO individuals was thicker than that of male wild-type individuals, and that the abdominal wall of female homozygous KO individuals was significantly thicker than that of female wild-type individuals.

[0202] According to the present invention, it is possible to provide a method for producing genetically sterile fish that are reliably infertile and have a large amount of edible parts and good meat quality and body color, and a method for mass-producing genetically sterile fish using the genetically sterile fish.

Claims

1. A method for producing genetically sterile fish by knocking out the follicle-stimulating hormone receptor gene of the target fish through genome editing, thereby producing genetically sterile individuals.

2. The method according to claim 1, wherein the fish to be bred is a salmonid or mackerel.

3. The method according to claim 1 or 2, wherein the genetically infertile individual has undifferentiated germ cells.

4. The method according to claim 1 or 2, wherein the mutation pattern of the genetically sterile individual is such that the number of deleted bases in both alleles is not a multiple of 3, or the number of inserted bases in both alleles is 20 to 26.

5. A method for mass-producing genetically sterile fish, comprising: transplanting germ cells of the genetically sterile individual obtained by the method of claim 1 into a germ cell-deficient individual to produce next-generation genetically sterile individuals; and knocking out the dead-end gene by genome editing to produce the germ cell-deficient individual.

6. The method according to claim 5, wherein the mutation pattern of the next generation genetically sterile individuals is such that the number of deleted bases in both alleles is not a multiple of 3, or the number of inserted bases in both alleles is 20 to 26.

Images