Dendriplex composed of PPI and RNA, pharmaceutical composition comprising such dendriplex, and such composition for use as a medicament and for use in cancer therapy

Abstract

The present invention provides a dendriplex composed of a polypropyleneimine (PPI) dendrimer and RNA, the surface of said dendrimer being modified with a sugar selected from maltotriose, lactose, mannose and glucose, or a basic amino acid selected from lysine, histidine and arginine, or a combination thereof. The present invention provides also a pharmaceutical composition comprising such a dendriplex and a pharmaceutically acceptable carrier, diluent or excipient. The present invention provides also such a dendriplex for use as a medicament. Furthermore, the present invention provides such a dendriplex and a composition for use in cancer therapy, preferably gene therapy.

Description

[0001] Dendriplex composed of PPI and RNA, pharmaceutical composition comprising such dendriplex, and such composition for use as a medicament and for use in cancer therapy

[0002] The present application provides a dendriplex composed of a polypropylene dendrimer (PPI), especially G4, and RNA, a pharmaceutical composition comprising such dendriplex, and its use as a medicament as well as for use in cancer therapy, including preferably gene therapy, especially alveolar rhabdomyosarcoma (abbreviation: ARMS).

[0003] Gene therapy of cancers and tumours is generally known in the field. Alveolar rhabdomyosarcoma is an aggressive type of soft tissue cancer in children and adolescents, characterised by the presence of the PAX3-FOXO1 fusion protein, a potent transcription factor.

[0004] Ways to silence gene expression in cells are generally known in the field. RNA interference (RNAi) is a mechanism that uses so-called small interfering RNA (siRNA) to specifically degrade mRNA and silence the expression of a selected gene. siRNA in the cell binds to a protein complex with ribonuclease activity, which in turn binds to an mRNA molecule complementary to siRNA and cuts it into pieces, thus preventing the formation of the protein it encodes.

[0005] Due to their high molecular weight, polyanionic and hydrophilic nature, RNA molecules require a suitable carrier to penetrate the cell. Used in vitro, lipofection or electroporation cannot be used on a living organism. Similarly, viral carriers causing significant immunisation of the organism are being abandoned.

[0006] Dendrimers are nanoparticles characterised by a central core, branching points (dendrons) composed of repeating monomers attached to the core, empty internal spaces (cavities) and numerous highly functional end groups on the surface. At the end of each monomer there is a branching point where at least two further monomers can be attached. Each layer of monomers forms one generation of dendrimer (Gl, G2, G3, etc.). The higher the generation, the larger, more branched and stiffer the dendrimer becomes. The numerous functional groups on the surface of dendrimers allow them to be modified in any way. Modification of dendrimers with sugar residues, e.g. coating with sugar residues such as maltotriose (M3) or lactose (Lac), removes the toxicity of cationic dendrimers associated with positive charge. The use of dendrimers in personalised therapy for leukaemia is described, for example, in Franiak-Pietryga I, Maciejewski H, Ostrowska K, Appelhans D, Voit B, Misiewicz M, Kowalczyk P, Bryszewska M, Borowiec M. Dendrimer-based nanoparticles for potential personalised therapy in chronic lymphocytic leukemia: Targeting the BCR-signaling pathway. International Journal of Biological Macromolecules 2016; 88, 156-161 (http: / / dx.doi.Org / 10.1016 / j.ijbiomac.2016.03.021).

[0007] Dendrimers modified with sugar residues are called glycodendrimers. The potential use of glycodendrimers in leukaemia therapy has been described for example in Franiak- Pietryga I, Ziemba B, Sikorska H, Jander M, Kuncman W, Danilewicz M, Appelhans D, Lewkowicz P, Ostrowska K, Bryszewska M, Borowiec M, Maltotriose-Modified Poly(Propylene Imine) Glycodendrimers as a Potential Novel Platform in the Treatment of Chronic Lymphocytic Leukemia. A Proof-of-Concept Pilot Study in the Animal Model of CLL. Toxicology and Applied Pharmacology, 2020; 403: 115139; Ziemba B, Sikorska

[0008] H, Jander M, Kuncman W, Danilewicz M, Appelhans D, Bryszewska M, Borowiec M, Franiak-Pietryga I. Anti-tumour Activity of Glycodendrimer Nanoparticles in a Subcutaneous MEC-1 Xenograft Model of Human Chronic Lymphocytic Leukemia. Anti-Cancer Agents in Medicinal Chemistry, 2020; 20(3): 325-334 and Franiak-Pietryga

[0009] I, Ostrowska K, Maciejewski H, Appelhans D, Misiewicz M, Ziemba B, Bednarek M, Bryszewska M, Borowiec M. PPLG4 glycodendrimers upregulates TRAIL-induced apoptosis in chronic lymphocytic leukemia cells. Macromolecular Bioscience 2016. DOI: 10.1002 / mabi.201600169 The positively charged surface facilitates interaction with nucleic acids, making cationic dendrimers a suitable tool for gene delivery. Complexes composed of dendrimers and attached nucleic acids have been termed dendriplexes.

[0010] Unlike the RNA molecule itself, dendriplexes are capable of crossing the cell membrane. The use of nanoparticles, as carriers or potential medicaments, was approved by the FDA in December 2017.

[0011] The use of dendriplex is an innovative strategy to eradicate cancer cells or to support conventional treatments such as surgery or radio- and chemotherapy.

[0012] From the prior art, the use of dendrimers complexed with a therapeutic agent for the treatment of cancer is known.

[0013] A publication by S^kowski et al. (Postepy Hig Med Dosw. 2008; 62: 725-733) describes various uses of dendrimer molecules in biomedical science and nanotechnology and points out the advantages of using these polymers, including the use of G3 -generation PPI complexes in gene therapies for cancer treatment.

[0014] The international application PCT / US2015 / 045104 discloses a composition comprising poly(amidoamine) (PAMAM) hydroxyl-terminated dendrimers covalently linked to at least one therapeutic, prophylactic or diagnostic agent for the treatment or alleviation of one or more brain tumour symptoms.

[0015] Furthermore, US patent 10,421,968 describes amphiphilic dendrimers complexed with Bcl3 siRNA. The invention provides a method of treating cancer, in particular nasopharyngeal cancer, by administering to an individual in need thereof a therapeutic amount of amphiphilic dendrimers complexed with Bcl3 siRNA.

[0016] However, the prior art still lacks effective cancer therapies, especially gene therapies, in particular for the treatment of cancer such as alveolar rhabdomyosarcoma. Therefore, there is still a need in the field for this type of solution enabling targeted delivery of nucleic acid or nucleic acids to cancer cells.

[0017] Accordingly, the objective of the present invention is to develop and provide a suitable agent for the treatment of cancer, in particular alveolar rhabdomyosarcoma, a pharmaceutical composition comprising such agent and its use as a medicament, for use in therapy, in particular gene therapy, for the treatment of cancer such as alveolar rhabdomyosarcoma.

[0018] These objectives have been achieved through the inventions defined in the attached patent claims, with preferred variants defined in dependent claims.

[0019] Brief description of the invention

[0020] The present invention provides is a dendriplex composed of a polypropyleneimine (PPI) dendrimer and RNA, wherein the surface of said dendrimer is modified with a sugar selected from maltotriose, lactose, mannose and glucose, or a basic amino acid selected from lysine, histidine and arginine, or a combination thereof.

[0021] Preferably, in the dendriplex according to the invention, the RNA is mRNA, shRNA, siRNA, miRNA, crRNA, tracrRNA, sgRNA or gRNA.

[0022] Preferably, in the dendriplex according to the invention, the RNA is an RNA specific for the fusion gene PAX3-FOXO1.

[0023] More preferably, in the dendriplex according to the invention, the RNA specific for the PAX3-FOXO1 fusion gene is an siRNA, even more preferably having nucleotide sequences selected from the group comprising pairs of sequences having SEQ ID NO 3 and 4, and SEQ ID NO 5 and 6. Preferably in the dendriplex according to the invention, the PPI dendrimer is a PPI glycodendrimer selected from generation 1 (Gl) to generation 4 (G4), preferably a PPI- G4 glycodendrimer.

[0024] Preferably in the dendriplex according to the invention, the dendrimer is a glycodendrimer modified with maltotriose, more preferably in the range of 10-90%, even more preferably in the range of 10-80%, especially 10-60%.

[0025] More preferably, in the dendriplex according to the invention, the glycodendrimer is modified with 20% or 50% maltotriose.

[0026] Preferably, in the dendriplex according to the invention, the dendrimer is a glycodendrimer modified with maltotriose, preferably in the range of 35-40%, and histidine, preferably in the range of 35-40%.

[0027] More preferably, in the dendriplex according to the invention, the glycodendrimer is modified with maltotriose at 37.5% and with histidine at 37.5%.

[0028] Preferably in the dendriplex according to the invention the dendrimer is a glycodendrimer modified with lactose, preferably in the range of 10-90%, more preferably in the range of 20-80%.

[0029] More preferably, in the dendriplex according to the invention, the glycodendrimer is modified with lactose at 27% or 70%.

[0030] The present invention provides furthermore a pharmaceutical composition comprising the dendriplex according to the invention as defined above and a pharmaceutically acceptable carrier, diluent or excipient.

[0031] Preferably, in the pharmaceutical composition according to the invention, the said carrier, diluent or excipient is sterile PBS.

[0032] Preferably, the pharmaceutical composition according to the invention is for topical or oral administration.

[0033] More preferably, the pharmaceutical composition according to the invention is for topical administration to a cancerous lesion, even more preferably to a tumour, in particular by injection, inhalation or in the form of drops.

[0034] Preferably, the pharmaceutical composition according to the invention is for administration intravenously, intraperitoneally or intramuscularly. The present invention provides also the dendriplex according to the invention as defined above or the pharmaceutical composition according to the invention as defined above for use as a medicament.

[0035] The present invention provides also the dendriplex according to the invention as defined above or the pharmaceutical composition according to the invention as defined above for use in cancer therapy, preferably gene therapy.

[0036] Preferably, such a dendriplex for use according to the invention is used in the treatment of alveolar rhabdomyosarcoma with a (2; 13)(q35;ql4) translocation leading to expression of the PAX3-FOXO1 fusion gene.

[0037] Preferably, such a dendriplex for use according to the invention is used in a therapy selected from a group comprising monotherapy and combination therapy.

[0038] Detailed description of the invention

[0039] In the first aspect of the present invention, there is provided a dendriplex composed of a polypropyleneimine (PPI) dendrimer and RNA, wherein the surface of said dendrimer is modified with a sugar selected from maltotriose, lactose, mannose and glucose, or a basic amino acid selected from lysine, histidine and arginine, or a combination thereof as defined in the claims.

[0040] According to the invention, the dendriplex molecule is composed of polycationic, highly branched nanoparticles, dendrimers, serving as a carrier for a polyanionic and hydrophilic RNA molecule, e.g. siRNA, which in the cell binds to a protein complex having ribonuclease activity. This complex, in turn, binds to the mRNA molecule complementary to siRNA and cuts it into pieces, thus preventing the formation of the protein it encodes. Unlike the RNA molecule itself, dendriplexes are capable of crossing the cell membrane.

[0041] The dendriplex molecule presented in the present application is composed of a polycationic polypropyleneimine (PPI) dendrimer, partially modified with a sugar, and / or an amino acid, serving as a carrier for a polyanionic and hydrophilic RNA molecule, such as siRNA. An example structure according to the invention is shown in Fig. 1.

[0042] In preferable embodiments, the dendriplexes according to the invention comprise glycodendrimers having a surface modified with sugar residues such as maltotriose (M3) or lactose (Lac), which removes the toxicity of cationic dendrimers associated with positive charge. The glycodendrimer provides a suitable carrier for the RNA molecule, which, due to its high molecular weight, polyanionic and hydrophilic nature, is unable to penetrate the cell.

[0043] In preferable embodiments, the dendriplexes according to the invention comprise dendrimers or glycodendrimers modified with a basic amino acid residue selected from lysine, histidine and arginine, preferably a histidine residue. Such modification facilitates the attachment of RNA and, in certain cases, the active transport of dendriplexes.

[0044] The dendriplex according to the invention provides an efficient RNA carrier, and a dendriplex comprising a glycodendrimer with the lowest degree of modification, i.e. PPI- Lac-27 and PPI-M3-20, is particularly preferable.

[0045] Dendriplexes according to the invention can be preferably used as a medicament, especially for the treatment of cancer, in particular, but not limited to, alveolar rhabdomyosarcoma with a (2;13)(q35;ql4) translocation leading to the expression of the fusion gene PAX3-FOXO1. In the present invention, two components act: RNA inhibits the expression of the defective gene responsible for the disease to be treated, exemplified, but not limited, by the PAX3-FOXO1 fusion gene, which is responsible for the cancer, alveolar rhabdomyosarcoma. Silencing of PAX3-FOXO1 gene expression inhibits ARMS cell growth both in vitro and in vivo. The dendrimer per se simultaneously induces apoptosis in cancer cells, which is well known e.g. from US 9,877,985, US10,022,395, P.401934 and P.401936. However, the dendriplexes according to the invention having a particular structure and the use of such dendriplexes in cancer treatment, especially in gene therapy, in particular ARMS, are new and innovative. So far, no negative features or limitations have been noticed in in vitro as well as in vivo studies. The solution according to the invention is very economical to produce and has no side effects comparable to traditional chemotherapy, which is still the treatment of choice immediately after surgical treatment.

[0046] In the second aspect, the invention provides a pharmaceutical composition comprising a glycodendrimer according to the invention and a pharmaceutically acceptable carrier or excipient. Such a composition is particularly suitable and effective for the administration of dendriplexes according to the invention.

[0047] Pharmaceutically acceptable carriers and excipients are generally known in the field. The pharmaceutically acceptable carrier or excipient in the composition according to the invention should be suitable for the route of administration for the pharmaceutical composition. For example, such a carrier may be sterile water or preferably sterile PBS, in particular when administered by the intravenous, intramuscular, intraperitoneal or tumour route. Particularly preferably, the composition according to the invention is subjected to a formulation for local administration to the cancerous lesion, e.g. injection into the tumour, but also by inhalation or in drop form, which is non-invasive and particularly convenient for the treated patient. Administration by drops or inhalation between cycles is to increase the therapeutic effect.

[0048] Methods of manufacturing pharmaceutical compositions comprising an active ingredient and a carrier or excipient are known in the field. Methods of formulating the composition for selected routes of administration are also known. The composition according to the invention can therefore be produced in a conventional way, e.g. by mixing the active ingredient(s) with a pharmaceutically acceptable carrier or excipient, and formulated for the respective route of administration.

[0049] Preferably, the composition according to the invention is for administration into the tumour, intravenously, intraperitoneally or intramuscularly.

[0050] In the third aspect, a pharmaceutical composition as defined above for use as a medicament is provided. It allows effective use of the dendriplexes according to the invention.

[0051] In the fourth aspect, a composition as defined above for use in cancer therapy, preferably gene therapy, is provided.

[0052] Preferably, the cancer is an alveolar rhabdomyosarcoma with a (2; 13)(q35;ql4) translocation leading to expression of the PAX3-FOXO1 fusion gene.

[0053] Preferably, the composition for such uses is formulated for administration by a route selected from: tumour delivery, intravenous, intraperitoneal or intramuscular administration. Such routes of administration are particularly suitable for gene therapy of cancer.

[0054] Preferably, the composition for such use can be used in monotherapy as well as in combination therapy, i.e. in combination with another drug or drugs, in particular a drug or drugs for the treatment of cancer, in particular alveolar rhabdomyosarcoma with translocation (2; 13)(q35 ;q 14), or in combination with other therapies for the treatment of a cancer, in particular for the treatment of alveolar rhabdomyosarcoma with translocation (2;13)(q35;ql4). The general way of generating dendriplexes

[0055] The production of dendriplexes according to the invention consists in dissolving the dendrimer or glycodendrimer and RNA in an appropriate volume of solvent or carrier, e.g., in sterile PBS, and then combining them together in any molar ratio selected from 1 : 1 to 1 :20. This is followed by incubation of the resulting mixture, e.g., for 60 minutes, at room temperature. The production of dendriplexes does not require special laboratory conditions, although to preserve the purity of the obtained dendriplex it is recommended to perform the operation in a laminar chamber under sterile conditions.

[0056] In preferable embodiments, the glycodendrimer complexed with the siRNA according to the invention produces the desired effect, i.e. it provides efficient transfection and effective action of the specific siRNA that silences the expression of the PAX3-F0X01 fusion gene. Furthermore, the glycodendrimer according to the invention additionally induces apoptosis in cancer cells.

[0057] The present invention will now be illustrated in the following figures and examples, which, however, are not intended to limit in any way the scope of the invention as defined in the patent claims.

[0058] Description of the figures

[0059] Fig. 1 schematically shows the steps of dendriplex generation.

[0060] Fig. 2 schematically shows the manufacture of the prototype dendriplexes according to the invention.

[0061] Fig. 3 shows the effect of dendrimers used to form dendriplexes on RH30 cell viability depending on the concentration used. Results are presented as mean + / - SD (n=3).

[0062] Fig. 4 shows the effect of dendrimers used to form dendriplexes on RH30 cell viability as a depending on the incubation time. A). Dendrimer concentration = 0.4 / / M; B). dendrimer concentration = 0.8 uM. Results are presented as mean + / - SD (n=3).

[0063] Fig. 5 shows the toxicity of dendrimers used to form dendriplexes at a concentration of 0.4 / / AT after 72 h of incubation with RH30 cells. Results are presented as mean + / - SD (n=3).

[0064] Fig. 6 shows the effect of dendrimers used to form dendriplexes on RH30 cells. (A) Viability of cells cultured with dendrimers at a concentration of 1.6 uM for 24 h (incubation) and without dendrimers for a further 24 h (post-incubation) (*p<0.03; **p<0.01; cell viability above 80%). Results are presented as mean + / - SD (n=3); (B) Cell morphology after 48 h of culture (24 h incubation and 24 h post-incubation); magnification 40x).

[0065] Fig. 7 shows transfection of RH30 cells with lipoplexes and dendriplexes.

[0066] (A) Transfection control. Negative control: siRNA_TYE563 (top panel); positive control: lipoplex siRNA_TYE563-Lipofectamine®2000 (middle panel: 4 h incubation with lipoplex, bottom panel: 24 h of incubation with lipoplex). Arrows indicate lipoplexes (small, white, scattered dots) inside the cells; (B) Transfection with siRNA_TYE563-PPI- Lac-27 dendriplexes. From top: untreated cells, 4 h incubation with dendriplexes, 24 h incubation with dendriplexes. Molar ratio of siRNA:PPI 1 : 10. Arrows indicate dendriplexes (small, white, scattered dots) inside cells. (C) Transfection of dendriplexes with siRNA_TYE563-PPI-M3-20 at different siRNA:PPI molar ratios. From top: 1 :2, 1 :5, 1 :20. Dendriplex generation time 1 h; 24 h incubation with cells. Arrows indicate dendriplexes (small, white, scattered dots) inside cells. (D) Transfection with siRNA_TYE563-PPI-M3-20 dendriplexes with different synthesis times. From top: 15 min, 1 h, 3 h. 24 h of incubation with cells; siRNA:PPI molar ratio 1 : 10. Arrows indicate dendriplexes (small, white, scattered dots) inside cells. siRNA_TYE563 - fluorescently labelled control siRNA, DAPI - stained cell nuclei, Merged - superimposed images of siRNA_TYE563 and DAPI.

[0067] Fig. 8 shows the effect of dendriplexes on RH30 cell viability depending on the incubation time. Dendriplexes at siRNA_0:PPI molar ratios of 1 :10 (0.04 uM siRNA, 0.4 / / ATPPI). Results are presented as mean + / - SD (n=3).

[0068] Fig. 9 A-B show the effect of dendriplexes on RH30 cell viability. Fig. 9 A shows the effect of siRNA l dendriplexes (dendriplexes at siRNA_l :PPI molar ratios of 1 : 10 or 1 :5). Fig. 9 B shows the effect of siRNA_2 dendriplexes (dendriplexes at siRNA_2:PPI molar ratios of 1 : 10 or 1 :5). Results are presented as mean + / - SD (n=3).

[0069] Fig. 10 shows the effect of dendriplexes on RH30 cells. (A) Viability of cells cultured with dendriplexes at a molar ratio of 1 :5 (0.32 LIM siRNA, 1.6 «A7 PPI) for 24 h and without dendriplexes for a further 24 h (post-incubation) (*p<0.02; **p<0.001; #p<0.032). Results are presented as mean + / - SD (n=3); (B) Cell morphology after 48 h of culture (24 h incubation and 24 h post-incubation; 40x magnification). Fig. 11 shows the gradual overgrowth of the scratch using two dendriplexes as an example: siRNA_0-PPI-Lac-27 and siRNA_0-PPI-M3-50 (molar ratio 1 :10; 0.04 uM siRNA; 0.4 / / A / PPI).

[0070] Fig. 12 shows a comparison of the scratch test results for siRNA_l- and siRNA_2- dendriplexes at two time points - immediately after scratching (0 h) and after 72 h. Cell cultures treated with dendriplexes at a molar ratio of 1 :5 (0.16 uM siRNA, 0.8 «A7 PPI) are shown.

[0071] Fig. 13 shows the induction of apoptosis by the tested dendrimers and dendriplexes in RH30 cells after 48 hours of incubation. siRNA - PAX3-FOXO1 siRNA O; Lip - Lipofectamine®2000; 1 : 10, 1 :5 molar ratio of siRNA:PPI. Ann- / PI+ - necrosis; Ann+ / PI+ - late apoptosis; Ann+ / PI- - early apoptosis; Ann- / PI- - viable cells.

[0072] Figs. 14 A-C show the effect of the siRNA_0-PPI-M3-50 dendriplex on the expression of selected genes. Fig. 14A shows the effect of the siRNA_0-PPI-M3-50 dendriplex on the expression of the PAX3-FOXO1 and JARID genes, Fig. 14B the effect of the siRNA_0-PPI-M3-50 dendriplex on the expression of the P53 and EGR1 genes, and Fig. 14C the effect of the siRNA_0-PPI-M3-50 dendriplex on the expression of the BAX gene.

[0073] Fig. 15 A-C show the effect of the CRISPR-Cas9-PPI-M3-50 dendriplex on the expression of selected genes. Fig. 15A shows the effect of the CRISPR-Cas9-PPI-M3-50 dendriplex on PAX3-FOXO1 and JARID gene expression, Fig. 15B the effect of the CRISPR-Cas9-PPI-M3-50 dendriplex on EGR1 and P53 gene expression, and Fig. 15C the effect of the CRISPR-Cas9-PPI-M3-50 dendriplex on BAX gene expression.

[0074] Fig.16. shows the changes in expression of selected genes under the influence of dendriplexes after 24 h incubation and 24 h post-incubation. (A) Decrease in expression of the PAX3-FOXO1 fusion gene. Cells were exposed to siRNA_0-PPI-M3-20 and siRNA_0-PPI-Lac-27 dendriplexes at molar ratios of 1 :10 (0.04 uM siRNA, 0.4 «A7 PPI) and 1 :5 (0.16 uM siRNA, 0.8 «A7 PPI) and lipoplex (0.04 «A7 siRNA). (B) Expression of selected genes under the influence of siRNA_0-PPI-M3-20 dendriplexes at molar ratios of 1 : 10 (0.04 uM siRNA, 0.4 uM PPI) and 1 :5 (0.16 uM siRNA, 0.8 uM PPI) and siRNA_0-PPI-Lac-27 at a molar ratio of 1 :5 (0.16 uM siRNA, 0.8 uM PPI). (C) Comparison of the expression of genes associated with myoblast differentiation {SNAIL, MYODI, MYOG, MYF5, MET) and genes identified as pro- (APAF1, BAX, TP50) and anti-apoptotic (BCL-2) under the dendriplexes siRNA_l-PPI-M3-20, siRNA_2-PPI-M3- 20 and siRNA_2-PPI-Lac-27 at a molar ratio of 1 :5 (0.32 uM siRNA, 1.6 «A7 PPI). Fig. 17 shows the growth of tumours under the influence of dendriplexes with siRNA O and cyclophosphamide (positive control; CP). Dots indicate days of substance administration.

[0075] Fig. 18 shows examples of tissues occupied or free of cancerous lesions. Arrows indicate pathological lesions in the tissues.

[0076] Fig. 19 shows the changes in the fluorescence level of siRNA O in the serum of mice from the test groups relative to the control (siRNA-free) sample.

[0077] Fig. 20 shows the effect of siRNA_2-PPI-Lac-27 dendriplex on tumour growth. (A) Tumour growth in three mice treated with siRNA_2-PPI-Lac-27 at a dose of 76 ug siRNA / kg bw in a volume of 0.4 ul g bw (7600 pmol siRNA / kg bw) administered twice a week for 18 days, followed by 5.2 pmol siRNA / mm3 tumour every other day for six days. For clarity, the graph shows tumour growth in one control mouse only. Dots on the scale indicate days of dendriplex and 0.9% NaCl administration in the control group. (B) The top panel shows mice from the control and test groups on the eighteenth day of the experiment. The middle panel shows the same mice on day 35 of the study. Arrows indicate tumours, in the treated mouse the tumour is not visible. The lower panel shows histological preparations showing the structure of the control tumour and the skin of the treated mouse at the primary tumour site - no pathological lesions.

[0078] Fig. 21 shows the growth of tumours under the influence of the siRNA_2-PPI-M3-20 and siRNA_2-PPI-Lac-27 dendriplexes.

[0079] Fig. 22 shows the changes in mean tumour volume under treatment with siRNA_2-PPI- M3-20 dendrimer, PPI-OS-M3-20 dendrimer (carrier) and without treatment (0.9% NaCl).

[0080] Fig. 23 shows a comparison of the volume (A) and weight (B) of tumours taken from dendriplex-treated (siRNA_2-PPI-M3-20, n=7) and dendrimer-treated (PPI-M3-20, n=5) mice to a control group (0.9% NaCl, n=5). (C) Comparison of the morphology of selected tumours taken from mice after the experiment.

[0081] Fig. 24 shows the expression of selected genes in cancer cells taken from mice from the test group and carrier compared to tumour weight.

[0082] Fig. 25 shows the differences in expression of selected genes in cancer cells taken from mice from the test and carrier groups.

[0083] Examples The invention is illustrated by the following examples, which do not constitute a limitation thereof. Unless otherwise indicated, the following examples use known and / or commercially available apparatus, methods, reaction conditions, reagents and kits, such as are commonly used in the field to which the present invention belongs and as recommended by the manufacturers of the respective reagents and kits.

[0084] List of abbreviations and definitions le4 - number of cells corresponding to the number 10 to the power of 4 (10 thousand)

[0085] 5e4 - number of cells corresponding to 5 x 10 to the power of 4 (50 thousand)

[0086] 5e6 - number of cells corresponding to 5 x 10 to the power of 6 (5 million)

[0087] Ann - Annexin V

[0088] ARMS - Alveolar rhabdomyosarcoma

[0089] CP - Cyclophosphamide crRNA - spacer RNA - CRISPR 'intermittent' sequences are transcribed into short RNA (crRNA) sequences capable of directing the system to matching DNA sequences. Once the target DNA is found, the endonuclease Cas9, binds to the DNA and cuts it, deactivating the target gene.

[0090] DS - dense-shell dendrimer surface coating

[0091] FBS - Foetal Bovine Serum

[0092] FDA - Food and Drug Administration

[0093] G4 - Fourth generation dendrimer gRNAs - guide RNA - a short RNA sequence that acts as a guide for the Cas9 endonuclease or other Cas proteins that cross double-stranded DNA and can thus be used to edit information in the gene

[0094] His - Histidine i.p. - Intraperitoneal administration

[0095] KN - Negative control

[0096] Lac - Lactose

[0097] M3 - Maltotriose bw - Body weight miRNAs - Micro RNAs, short, non-coding, single-stranded RNA molecules 21-23 nucleotides long; regulate gene expression at the post-transcriptional level through RNA interference. mRNA - messenger RNA - a type of ribonucleic acid (RNA) whose function is to transfer genetic information about the sequence of individual polypeptides from genes to the translation apparatus.

[0098] MTT - Tetrazolium dye

[0099] NTC - Non-treated control (no treatment)

[0100] OS - open-shell dendrimer surface coating

[0101] PAMAM - Polyamidoamine dendrimer

[0102] PBS - phosphate-buffered saline

[0103] PI - Propidium iodide

[0104] PPI - Polypropyleneimine dendrimer

[0105] PPI-G4-OS-M3 50% - Generation 4 polypropyleneimine dendrimer coated at 50%with maltotriose

[0106] PPI-G4-OS-M3 20% - Generation 4 polypropyleneimine dendrimer at 20%coated with maltotriose

[0107] PPI-G4-OS-Lac 27% - Generation 4 polypropyleneimine dendrimer coated at 27% with lactose

[0108] PPI-G4-DS-Lac 70% - Generation 4 polypropyleneimine dendrimer coated at 70% with lactose

[0109] PPI-G4-OS-M3-His - Generation 4 polypropyleneimine dendrimer coated at 37.5%with maltotriose and at 37.5% with histidine

[0110] PPI-Lac-27 - Generation 4 polypropyleneimine dendrimer coated with 27% lactose; simplified abbreviation

[0111] PPI-Lac-70 - Generation 4 polypropyleneimine dendrimer coated at 70% with lactose; simplified abbreviation

[0112] PPI-M3-20 - Generation 4 polypropyleneimine dendrimer coated at 20%with maltotriose; simplified abbreviation PPI-M3-50 - Generation 4 polypropyleneimine dendrimer coated at 50%with maltotriose; simplified abbreviation

[0113] PPI-M3-His - Generation 4 polypropyleneimine dendrimer coated with maltotriose and histidine; simplified abbreviation

[0114] RNAi - RNA interference, e.g. using shRNA, siRNA, miRNA

[0115] RPMI 1640 - Cell culture medium sgRNA - Single guide RNA - a short RNA sequence, having the same function as gRNA shRNA - Short hairpin RNA (from short hairpin RNA) - optimised shRNA constructs enable efficient, durable, stable and long-term gene silencing through RNA interference siRNA - Small (short) interfering RNA (from small interfering RNA) - a double-stranded RNA molecule of about 20-25 base pairs in length that causes silencing of expression of genes with homologous sequence by RNA interference siRNA-PPI-G4-OS-M3 20% - Dendriplex composed of siRNA and a generation 4 polypropyleneimine dendrimer coated at 20% with maltotriose siRNA-PPI-M3-20 - Dendriplex composed of siRNA and a generation 4 polypropyleneimine dendrimer coated at 20% with maltotriose; simplified abbreviation tracrRNA - trans-activating CRISPR RNA (pronounced 'tracer RNA ') - in the CRISPR- Cas9 system, tracrRNA base pairs with crRNA to form a functional gRNA vg - Tumour volume

[0116] In the context of the present invention, the term gene therapy is to be understood as a therapy involving the introduction of genetic material, such as RNA, preferably mRNA, shRNA, siRNA, miRNA, crRNA, tracrRNA, sgRNA or gRNA, into cells, for the purpose of producing a specific therapeutic effect - removal or silencing of the function of an abnormal gene causing the disease to be treated.

[0117] In the context of the present invention, the term glycodendrimer is to be understood as a dendrimer modified with at least one sugar residue, preferably selected from maltotriose, lactose, mannose and glucose.

[0118] In the context of the present invention, the term RNA is to be understood as a ribonucleic acid which is preferably selected from mRNA, shRNA, siRNA, miRNA, crRNA, tracrRNA, sgRNA or gRNA . In the context of the present invention, a dendriplex is to be understood as a molecule composed of polycationic polypropyleneimine (PPI) dendrimers partially modified with at least one sugar and / or amino acid residue, serving as a carrier for the polyanionic and hydrophilic RNA molecule component of the dendriplex.

[0119] In the context of the present invention, the term PAX3-FOXO1 fusion gene should be understood as a fusion gene leading to the expression of the PAX3-FOXO1 fusion protein, which is a potent transcription factor found in alveolar rhabdomyosarcoma with translocation (2;13)(q35;ql4), an aggressive type of soft tissue cancer in children and adolescents. Silencing of PAX3-FOXO1 gene expression inhibits ARMS cell growth both in vitro and in vivo.

[0120] In the context of the present invention, the term monotherapy is to be understood as treatment of the cancer with a single therapeutic agent, in this case the dendriplex according to the invention.

[0121] In the context of the present invention, the term combination therapy is to be understood as a treatment of cancer using the dendriplex according to the invention and any other therapeutic agent for the treatment of cancer, for example, but not limited to, another anticancer drug or another anti-cancer therapy. In other words, a combination therapy is a treatment using a combination of the dendriplex according to the invention with another drug or drugs, in particular a drug or drugs for the treatment of cancer, in particular for the treatment of alveolar rhabdomyosarcoma, or in combination with other therapies for the treatment of cancer, in particular for the treatment of alveolar rhabdomyosarcoma.

[0122] In the context of the present invention, the term lipoplex is to be understood as a mixture of lipofectamine and siRNA. Lipofectamine is a substance for transfection (lipofection) of cells. The method involves coating an exogenous nucleic acid with lipids that spontaneously penetrate through the cell membrane into the cytoplasm of the cell.

[0123] In the context of the present invention, the term transfection is to be understood as the process of introducing foreign RNA into a eukaryotic cell.

[0124] Example 1 - Construction of a prototype dendriplex according to the invention

[0125] The prototype dendriplex according to contains:

[0126] Component 1 : siRNA: siRNA_0 (siRNA from the prior art; Kikuchi et al., Biochem Biophys Res

[0127] Commun; 2008;365:568-574) SEQ ID NO 1 : sense strand sequence (5' - 3') - CCUCUCACCUCAGAAUUCA

[0128] SEQ ID NO 2: Antisense strand sequence (51- 3') - AAUGAAUUCUGAGGUGAGG

[0129] • siRNA 1

[0130] SEQ ID NO 3: Sequence of sense strand (5' - 3')

[0131] CCUCUCAACCUCAAAGAAUUCAA

[0132] SEQ ID NO 4: Antisense strand sequence (5' - 3')

[0133] UUGAAUUCUUUGAGGUUGAGAGG

[0134] • siRNA 2

[0135] SEQ ID NO 5: sense strand sequence (5' - 3') - CCUCUCAACCUCAAA

[0136] SEQ ID NO 6: Antisense strand sequence (5' - 3') - UUUGAGGUUGAGAGG

[0137] Component 2: Generation 4 polypropyleneimine dendrimers, with a surface modified with:

[0138] • maltotriose at 50% (PPI-G4-OS-M3 50%; PPI-M3-50);

[0139] • maltotriose at 20% (PPI-G4-OS-M3 20%; PPI-M3-20);

[0140] • maltotriose at 37.5% and histidine at 37.5% (PPI-G4-OS-M3-His; PPI-M3-His);

[0141] • lactose at 27% (PPI-G4-OS-Lac 27%; PPI-Lac-27);

[0142] • lactose at 70% (PPI-G4-DS-Lac 70%; PPI-Lac-70)

[0143] Component 3: PBS sterile:

[0144] The components of prototype 1 and 2 are supplied in separate vials in lyophilizate form. Component 3 is supplied in a separate vial as a solution.

[0145] Generation of the dendriplex according to the invention:

[0146] The production of the test dendriplexes according to the invention consists in dissolving components 1 and 2 in a suitable volume of solvent in sterile PBS and then combining them together in a molar ratio of 1 : 10 or 1 :5 or any molar ratio chosen from 1 : 1 to 1 :20. This is followed by incubation of the mixture for 60 min at room temperature (Fig. 2). The generation of the dendriplex according to the invention does not require special laboratory conditions, although it is advisable to perform the steps in a laminar chamber to preserve the purity of the preparation. Example 2 - Toxicity of the dendriplex according to the invention

[0147] In this example, the highest non-toxic concentration of dendrimers used to generate the dendriplex was tested.

[0148] Test Method

[0149] Concentration less than 1 uM

[0150] RH30 cells were seeded in a 96-well plate at a density of le4 cells / well using RPMI 1640 complete culture medium (RPMI 1640 (CORNING, USA), 10% inactivated foetal bovine serum (FBS; Sigma-Aldrich, USA), 1% antibiotic and antimycotic solution (CAPRICORN (Germany)). Cells were incubated under standard culture conditions (37° C, 5%CO2, 95% humidity) for 24 h. After 24 h, the medium was replaced with fresh medium without antibiotic / antimycotic addition. Cells were cultured for a further 24, 48 and 72 h in the presence of PPI-Lac-27, PPI-Lac-70, PPI-M3-20, PPI-M3-50, PPI-M3- His dendrimers at concentrations of 0.05; 0.25; 0.4; 0.5; 0.8 and 1.0 lAL After the indicated time, samples were analysed spectrophotometrically using the MTT assay. A suspension of cells in culture medium was used as a negative control. The experiments were performed in three independent replicates.

[0151] Conclusions

[0152] The tested dendrimers used at concentrations below 1 pM show no significant toxicity to RH30 cells and can be used as siRNA carriers (Fig. 3-5).

[0153] Concentration 1.6 uM

[0154] Test Method

[0155] RH30 cells were seeded and incubated as indicated above. Cells were cultured for a further 24 h in the presence of PPI-Lac-27 and PPLM3-20 dendrimers at a concentration of 1.6 pM . After 24 h, the medium was replaced with fresh medium and the cells were cultured for a further 24 and 48 h. After the allotted time, samples were analysed spectrophotometrically using the MTT assay. A suspension of cells in culture medium was used as a negative control. The assays were performed in three independent replicates.

[0156] Conclusions

[0157] The tested dendrimers used at a concentration of 1.6 pM show no significant toxicity to RH30 cells and can be used as siRNA carriers (Fig. 6). Example 3 - Efficiency of penetration of dendriplexes according to the invention into cancer cells in vitro

[0158] Method of examination

[0159] Transfection efficiency was assessed using control siRNA_TYE563 fluorescently labelled with the TYE563 marker (TYE 563-labeled transfection control siRNA duplex; Integrated DNA Technologies). Dendriplexes at siRNA: dendrimer molar ratios of 1 :5 and 1 : 10 were synthesised 60 min at room temperature. RH30 cells were seeded on slides in a 24-well plate at a density of 5e4 cells / well using RPMI 1640 complete culture medium and incubated under standard culture conditions (37° C, 5%CO2, 95% humidity) for 24 h. After 24 h, the medium was replaced with fresh medium without antibiotic / antimycotic addition. Cells were treated with siRNA_TYE563-Lipofectamine®2000 lipoplex (positive control), dendriplexes: siRNA_TYE563-PPI-Lac-27, siRNA_TYE563-PPI- Lac-70, siRNA_TYE563-PPI-M3-20, siRNA_TYE563-PPI-M3-50, siRNA_TYE563- PPI-M3-His or siRNA_TYE563 alone for 4 or 24 h. The final concentration of siRNA in culture was 0.04 / / Af; concentrations of dendrimers: 0.2 uM (1 :5) and 0.4 uM (1 : 10). In addition, cells were treated with lipoplex and dendriplexes: siRNA_TYE563-PPI-Lac-27 and siRNA_TYE563-PPI-M3-20 at a ratio of 1 : 10 for 72 h. Cells in culture medium were used as a negative control. Fixed preparations were stained with DAPI to visualise the cell nucleus. The preparations were evaluated using a Leica DFC7000 T fluorescence microscope.

[0160] Conclusions

[0161] Each of the dendrimers tested is an effective siRNA carrier (Fig. 7-77). The best carriers are the dendrimers with the lowest degree of modification, i.e. PPLLac-27 and PPI-M3- 20 (Fig. 7).

[0162] Example 4 - Different dendriplex generation times and molar ratios siRNA TYE563PPI-M3-20

[0163] In this example, different options for dendriplex generation, resistance to external factors and storage time, and the best molar ratio of siRNA:PPI were examined. The examination was performed using the PPI-M3-20 dendrimer and siRNA_TYE563 fluorescently labelled with TYE563:

[0164] • in molar ratios of siRNA:PPI - 1 : 1, 1 :2, 1 :5, 1 : 10, 1 :20; dendriplex synthesis time - 60 min; dendriplex incubation time with cells - 24 h (Fig. 7). Dendrimer concentrations: 0.04 LIM = 0.316 ug ml (1 : 1); 0.08 LIM = 0.632 ug ml (1 :2); 0.2 uM = 1.58 pg / ml (1 :5); 0.4 uM = 3.16 ug m! (1 : 10); 0.8 uM = 6.32 ug m! (1 :20)

[0165] • siRNA:PPI molar ratio - 1 : 10; dendriplex synthesis time - 15 min; 30 min; 60 min; 24 h; dendriplex incubation time with cells - 24 h (Fig. 7).

[0166] Method of examination

[0167] RH30 cells were seeded and incubated as in Example 3. Cells were cultured for the indicated time in the presence of siRNA_TYE563-PPI-M3-20 dendriplexes. After the allotted time, the preparations were fixed and stained with DAPI to visualise the cell nucleus. The preparations were evaluated using a Leica DFC7000 T fluorescence microscope. Cells in culture medium were used as a negative control.

[0168] Conclusions

[0169] The optimal time for dendriplex synthesis - 60 min (Fig. 7).

[0170] The optimal molar ratio in the dendriplex molecule siRNA_0:PPI - 1 : 10 (Fig. 7).

[0171] Example 5 - Toxicity of dendriplexes

[0172] Ability of dendriplexes to reduce RH30 cell viability

[0173] Method of examination

[0174] The examination was performed using siRNA_0, siRNA_l and siRNA_2. Dendriplexes at siRNA: dendrimer molar ratios of 1 : 10 or 1 :5 were synthesised 60 min at room temperature.

[0175] RH30 cells were seeded and incubated as indicated in Example 2. Cells were then cultured for a further 24, 48 and 72 h in the presence of siRNA-Lipofectamine®2000 lipoplex (positive control), dendriplex: siRNA_0-PPI-Lac-27, siRNA_0-PPI-Lac-70, siRNA_0- PPI-M3-20, siRNA_0-PPI-M3-50, siRNA_0-PPI-M3-His (final concentration of siRNA_0: 0.04 uM, dendrimer concentrations: 0.4 uM), dendriplexes: siRNA_l / 2-PPI- Lac-27, siRNA_l / 2-PPI-M3-20 and siRNA_l / 2-PPI-M3-50 (final concentrations of siRNA: 0.04 / / AT, 0.08 / / AT, 0.32 / / AL; dendrimer concentrations: 0.4 / / AT, 0.16 uM. 3.2 / / AT). After the indicated time, samples were analysed spectrophotometrically by MTT assay. A suspension of cells in culture medium was used as a negative control. The experiments were carried out in three independent replicates. Conclusion

[0176] The siRNA_0 dendriplexes reduce RH30 cell viability, with the siRNA_0-PPI-M3-20 dendriplex showing the greatest effectiveness (Fig. 8).

[0177] The siRNA_2 dendriplexes reduce RH30 cell viability to a greater extent than the siRNA_l dendriplexes, with the siRNA-PPI-M3-20 dendriplex also showing some effectiveness against siRNA_l (Fig. 9).

[0178] The decrease in viability of RH30 cells treated with dendriplexes relative to that of untreated cells is a desired effect and demonstrates the efficacy of transfection and the effectiveness of the specific siRNA, especially siRNA_2 (Fig. JO).

[0179] Example 6 - Inhibition of RH30 cell proliferation and migration (in vitro)

[0180] Ability of dendriplexes to inhibit RH30 cell proliferation and migration.

[0181] Method of examination

[0182] The examination was performed using siRNA O. Dendriplexes at a molar ratio of 1 : 10 were synthesised 60 min at room temperature. Final concentration of siRNA= 0.04 uM, of dendrimer concentrations = 0.4 uM. A suspension of cells in culture medium was used as a negative control.

[0183] The examination was performed using siRNA l and siRNA_2. Dendriplexes at a molar ratio of 1 : 10 or 1 :5 were synthesised 60 min at room temperature. Final concentrations of siRNA_l : 0.16 uFI and 0.32 siRNA_2: 0.04 uFI and 0.16 uM. Dendrimer concentrations: 0.4 / / Al, 0.8 / / Aland 3.2 uM. A suspension of cells in culture medium was used as a negative control.

[0184] RH30 cells were seeded and incubated as in Example 2. After addition of siRNA alone, siRNA-Lipofectamine®2000 lipoplex (positive control), and the dendriplexes: siRNA- PPI-Lac-27, siRNA-PPI-Lac-70, siRNA-PPI-M3-20, siRNA-PPI-M3-50, siRNA-PPI- M3-His, layers of RH30 cells were scratched with a pipette tip. Immediately after scratching (time 0 h), the plates were photographed, the distance between the edges of the scratch area was measured and determined to be 100%. At 24, 48 and 72 h after scratching, the plates were photographed again and the distances between the edges of the scratch area were compared. After 72 h, migrating cells filled the entire scratch area in the control preparations. In most of the other preparations, migration was inhibited to varying degrees. Distances are presented as a percentage of the distance between the edges of the scratch area at time 0 h. Using the control example: time O h - distance between the edges of the scratch expressed as 100%, time 72 h - distance between the edges of the scratch expressed as 0% - migrating cells have filled the entire scratch area. The experimental results for dendriplexes with siRNA O are shown in Table 1 below. Fig. 11 shows selected images of scratching immediately after scratching and 24 and 72 h later.

[0185] The experimental results for dendriplexes with siRNA_l and siRNA_2 are shown in Fig. 12. Table 1. The ability of dendriplexes to inhibit cell proliferation.

[0186] ^Dendriplexes that most effectively inhibit RH 30 cell proliferation in vitro. Conclusions

[0187] Dendriplexes with siRNA O inhibit RH30 cell proliferation and migration in a range of 28% - 36% (except siRNA_0-PPI-M3-50), similar to or higher than the positive control, siRNA_0-Lipofectamine®2000 lipoplex.

[0188] The decrease in the proliferation rate of RH30 cells treated with dendriplexes compared to untreated cells or cells treated with siRNA alone is a desired effect and demonstrates the efficiency of transfection and the effectiveness of the specific siRNA.

[0189] Method of examination

[0190] Dendriplexes with siRNA l and siRNA_2 inhibit RH30 cell proliferation and migration in a range similar to the positive control, siRNA-Lipofectamine®2000 lipoplex.

[0191] The reduction in migration of RH30 cells treated with dendriplexes relative to untreated cells is a desirable effect and demonstrates the efficacy of transfection and the effectiveness of specific siRNAs, especially siRNA_2. Both dendriplexes, PPI-Lac-27 and PPI-M3-20, show similar effectiveness in inhibiting RH30 cell proliferation.

[0192] Example 7 - Effectiveness of induction of apoptosis in RH30 cells by dendriplexes according to the invention

[0193] In this example, the ability of dendriplexes to induce apoptosis in transfected cells was examined.

[0194] Method of examination

[0195] The examination was performed using siRNA O. Dendriplexes of siRNA_0-PPI-M3-50 at a molar ratio of 1 : 10 and siRNA_0-PPI-M3-20 and siRNA_0-PPI-M3-His at a molar ratio of 1 :5 were synthesised 60 min at room temperature.

[0196] RH30 cells were seeded in a 24-well plate at a density of 5e4 cells / well using RPMI 1640 complete culture medium. Cells were incubated under standard culture conditions (37° C, 5%CO2, 95% humidity) for 24 h. After 24 h, the medium was replaced with fresh medium without antibiotic / antimycotic addition. Cells were cultured for another 48 h in the presence of siRNA_0 alone (c=0.04 / / AT), dendrimers: PPI-M3-20 (c=0.2 / / AT), PPI- M3-50 (c=0.4 / / AT) and PPI-M3-His (c=0.2 / / AT), dendriplexes: siRNA_0-PPI-M3-20, siRNA_0-PPI-M3-50 and siRNA_0-PPI-M3-His, lipofectamine and siRNA_0- Lipofectamine®2000 lipoplex. Conclusion

[0197] Dendriplexes siRNA_0-PPI-M3-20 and siRNA_0-PPI-M3-50 induce apoptosis in RH30 cells to an extent similar to the positive control, siRNA-Lipofectamine®2000 lipoplex (Fzg. 13).

[0198] The decrease in viability of RH30 cells treated with dendriplexes relative to that of cells treated with dendrimers or siRNAs alone is a desired effect and demonstrates the efficiency of transfection and the effectiveness of the specific siRNA.

[0199] Example 8 - Effectiveness of decreasing the expression of selected genes (in vitro)

[0200] Method of examination

[0201] The examination was performed using siRNA O. Dendriplexes of siRNA_0-PPI-M3-20 and siRNA_0-PPI-M3-50 at a molar ratio of 1 :10 were synthesised for 60 min at room temperature.

[0202] The examination was performed using siRNA_l or siRNA_2. Dendriplexes of siRNA- PPI-M3-20 and siRNA-PPI-Lac-27 at a molar ratio of 1 :5 were synthesised 60 min at room temperature.

[0203] RH30 cells were seeded and incubated as in Example 7. Cells were cultured in the presence of dendriplexes: siRNA_l-PPI-M3-20, siRNA_2-PPI-M3-20, siRNA_l-PPI- Lac-27, siRNA_2-PPI-Lac-27, siRNA_0-PPI-M3-50 or siRNA_0-Lipofectamine®2000 lipoplex for another 24 h, after which the medium was replaced with fresh medium without dendriplexes and incubated for another 24 h or cells were cultured in the presence of dendriplexes: siRNA_0-PPI-M3-20 or siRNA_0-Lipofectamine®2000 lipoplex for 72 h. At the end of the incubation, the cells were lysed and RNA was isolated. On the matrix of the isolated RNA, cDNA was synthesised by reverse transcription reaction. Using the cDNA matrix, a qRT-PCR reaction was performed to assess the effect of dendriplexes on the expression levels of selected genes.

[0204] The desired result is a modification of the expression of anti-apoptotic and pro-apoptotic genes and genes responsible for muscle cell differentiation, whose expression directly or indirectly depends on the expression of the PAX3-F0X01 fusion gene (Figs. 14-16). Increased expression of the genes: P53, BAX, APAF1, MYF5, MYODI, MYOG and a decrease in the expression of PAX3-F0X01, BCL-2, SNAIL1 genes are expected. Conclusion

[0205] Dendriplexes with siRNA_2 based on PPI-G4-OS dendrimers modified with Lac-27 and M3-20 significantly modify gene expression in RH30 cells leading to decreased expression of the PAX3-FOXO1 fusion gene and increased expression of apoptotic genes thereby inducing RH30 cancer cell death. siRNA l shows a much weaker apoptotic effect.

[0206] Example 9 - Inhibition of tumour growth in vivo (Stage 1)

[0207] Examples 9-11 refer to studies using dendriplexes for which siRNA O was used to generate them.

[0208] Method of examination

[0209] 1. Implantation of RH30 cancer cells into NOD SCID gamma mice.

[0210] RH30 cells were suspended in sterile PBS without Mg2+and Ca2+ions . 10 mice were injected subcutaneously with 5e6 cells each in a volume of 0.1 ml. Animals were treated when tumours reached a size of 20-40 mm3, i.e. 10 or 12 days after implantation.

[0211] 2. Treatment

[0212] Each animal was weighed prior to substance administration. Test substances and saline were injected directly into the tumour (max. 30 « / ).

[0213] 3. Groups and dosage:

[0214] 1) Non-treated control (NTC)-without treatment;

[0215] 2) Negative control (KN) - sterile saline solution (0.9% NaCl) in a volume corresponding to the volume of complexes administered - 3 doses to the tumour;

[0216] 3) Positive control 1 (CPI) - cyclophosphamide at a dose of 150 mg / kg bw - single dose intragastrically;

[0217] 4) Positive control 2 (CP2) - cyclophosphamide at a dose of 250 mg / kg bw - single dose intragastrically;

[0218] 5) Test (M3-20 (1)) - siRNA_0-PPI-M3-20 dendriplex at a dose of 5 pg siRNA / kg bw in a 0, 2 and 5 day dosage regimen (day 0 corresponds to the tenth day after cell implantation) - 3 doses to the tumour;

[0219] 6) Test (M3-20 (2)) - siRNA_0-PPI-M3-20 dendriplex at a dose of 10 pg siRNA / kg bw in a 0, 2 and 5 day dosage regimen - 3 doses to the tumour; 7) Test (Lac-27 (1)) - siRNA_0-PPI-Lac-27 dendriplex at a dose of 5 siRNA / kg bw in a 0, 2 and 5 day dosage regimen - 3 doses to the tumour;

[0220] 8) Test (Lac-27 (2)) - siRNA_0-PPI-Lac-27 dendriplex at a dose of 10 pg siRNA / kg bw in a 0, 2 and 5 day dosage regimen - 3 doses to the tumour;

[0221] 9) Test (M3-20 (3)) - siRNA_0-PPI-M3-20 dendriplex at a dose of 5 pg siRNA / kg bw in a 0, 1, 2 day dosage regimen (day 0 corresponds to the twelfth day after cell implantation) - 3 doses to the tumour;

[0222] 10) Test (M3-20 (4)) - siRNA_0-PPI-M3-20 dendriplex at a dose of 10 pg siRNA / kg bw in a 0, 1, 2 day dosage regimen - 3 doses to the tumour.

[0223] Observation and measurement.

[0224] After the administration of the substance, observations of the animals were made for the appearance of adverse effects. Tumour sizes were measured each day for 5 or 7 days, then on the day of euthanasia (Fig. 17).

[0225] Conclusions

[0226] A continuous gradual tumour growth was observed in NC mice, while in CPI and CP2 mice the initial tumour growth was followed by a reduction in tumour volume until complete disappearance in the case of CPI mice. It is to be noted that the dose of cyclophosphamide was 15,000 to 30,000 times the dose of gene therapy. The dose was chosen based on literature data (Hingorani et al, Cancer Chem other Pharmacol; 2009;64:733-740; Shim et al, Int J Immunopathol Pharmacol; 2007;20:487-497)

[0227] For the test groups, gradual tumour growth was observed up to day 17 after cell implantation (day 8 after the first and day 2 after the last dose in the 0, 2, 5 dosage regimen; day 6 after the first and day 3 after the last dose in the 0, 1, 2 dosage regimen). On the last day of the experiment, a decrease in tumour volume was observed in most of the mice, except in M3 -20 mice (4). A particularly large increase followed by tumour reduction was observed in M3-20 (1) and M3-20 (3) mice, although metastasis occurred in M3 -20 (3 and 4) mice in the 0, 1, 2 dosage regimen. The effectiveness of treatment with M3-20 (2) and Lac-27 (1) dendriplexes in the 0, 2, 5 dosage regimen was observed.

[0228] Example 10 - Analysis of histopathological preparations to assess the presence of pathological lesions in organs and tissues

[0229] Method of examination The animals were euthanised 7 days after the end of treatment. Once death was declared, dissection and resection of selected internal organs was performed: brain, lungs, heart, spleen, liver, kidneys, stomach and tumours. The organs and tissues, after weighing, were placed in a 10% formalin solution and submitted for histopathological examination. Histopathological evaluation of the tissues was performed to confirm / fmd any pathological lesions (Table 2; Fig. 18).

[0230] Conclusions

[0231] The presence of a primary tumour was excluded in cyclophosphamide-treated (CP) mice and in M3-20 mice (3). No other cancerous lesions were also observed in CP mice (1 and 2). Despite the absence of a primary tumour in M3-20 mice (3), the presence of pathological lesions in the peritoneum, on the liver and on the adrenal gland was demonstrated.

[0232] In the three mice in which the primary tumours reached the largest size (M3-20 (1), M3- 20 (2), Lac-27 (1)), no pathological lesions were observed in the internal organs. Only in M3-20 (1) mice was a small tumour 0.5 cm cephalad from the primary tumour observed and confirmed. In the remaining mice, clear abdominal metastases (except in NTC mice) and vascular embolism were observed. Treatment with M3-20 (2) and Lac-27 (1) dendriplexes was found to be effective in a dosage regimen of 0, 2, 5. siRNA gene therapy requires a higher dose than those used in this example.

[0233] Table 2. Summary of resections and histopathology examination of selected groups. nt - not applicable; dendriplex composed of siRNA 0 and the corresponding glycodendrimers given in the table.

[0234] Example 11 - Analysis of histopathological preparations to assess the presence of dendriplexes in organs and tissues

[0235] Method of examination

[0236] Twenty-four, 48 and 72 hours after the last dose of the substance and after seven days, the animals had their blood drawn. The dendriplexes administered to the mice were fluorescently labelled to detect their presence in the blood serum. Serum was isolated from the blood, which was diluted 1 :2 with PBS and the fluorescence of the dendriplexes present was measured.

[0237] Serum fluorescence levels were checked to determine whether and to what extent siRNA escapes from the tumour and penetrates other organs (Fig. 19).

[0238] After death was declared, selected internal organs were dissected and resected: brain, lungs, heart, spleen, liver, kidney and stomach, as well as tumours. After weighing, the organs and tissues were placed in a 10% formalin solution, and microscope preparations were prepared. Dendriplexes administered to mice were fluorescently labelled to detect their possible presence in tissues. Microscopic analysis of the unstained preparations was performed to localise the labelled dendriplexes in the tumour tissue.

[0239] Conclusions

[0240] Dendriplexes are found in blood serum up to 48 h after the end of dosing. After 72 h and 7 days after the end of therapy, the presence of complexes in blood was questionable. In collected tissues, including tumour tissue and organs, no fluorescence associated with dendriplexes was observed. From these observations, it can be concluded that within a week after the last administration, the dendriplexes were excreted from the body.

[0241] Example 12 - Tumour growth inhibition In vivo I (Stage 2)

[0242] Examples 13-19 refer to studies using dendriplexes for which siRNA_2 was used to generate them.

[0243] Method of examination

[0244] 1. Implantation of RH30 cancer cells into NOD SCID gamma mice.

[0245] RH30 cells were suspended in sterile PBS without Mg2+and Ca2+ions . 10 mice were injected subcutaneously with 5e6 cells each in a volume of 0.1 ml. Animals were treated when tumours reached a size between 30-60 mm3.

[0246] 2. Treatment

[0247] Each animal was weighed before the substance was administered.

[0248] In the first phase, the test substances and saline were injected twice a week directly into the tumour at a dose of 76 pg siRNA_2 / kg bw in a volume of 0.4 pl / g bw (7600 pmol siRNA_2 / kg bw) (max. 11 « / ).

[0249] In the second phase, after a one-week break, the test substances and saline were injected every other day directly into the tumour at a dose of 5.2 pmol siRNA_2 / mm3tumour volume (vg) at 0.1 pl / mm3vg (0.052 pg siRNA_2 / mm(3)) (max. 50 pl).

[0250] 3. Groups and dosage:

[0251] 1) Negative control (KN) - sterile saline solution (0.9% NaCl) in a volume corresponding to the volume of complexes administered - 8 doses to the tumour;

[0252] 2) Test (1) - siRNA_2-PPI-Lac-27 dendriplex - max 6 doses to the tumour (no break), euthanised 9 days after last dose;

[0253] 3) Test (2) - siRNA_2-PPI-Lac-27 dendriplex - 9 doses to the tumour (max 6 doses before break, max 4 doses after break), euthanised two days after last dose;

[0254] 4) Test i.p. - siRNA_2-PPI-Lac-27 dendriplex at 5.2 pmol siRNA / mm3vg - 5 doses intraperitoneally every other day. Observation and measurement

[0255] After the administration of the substance, observations of the animals were made for the appearance of adverse effects. Tumour sizes were measured twice a week, before substance administration, then on the day of euthanasia (Fig. 20).

[0256] Conclusions

[0257] When the dose of dendriplexes was increased from 10 ug siRNA / kg bw to 76 ug siRNA / kg bw, a 50% effectiveness in tumour reduction was achieved (3 / 6 mice - tumour significantly reduced or disappeared completely);

[0258] A continuous gradual growth of tumours was observed in KN (control) mice.

[0259] For the test group (1), gradual tumour growth was observed up to day 31 after cell implantation (day 23 after the first and day 9 after the last dose).

[0260] For the test group (2):

[0261] 1) In one mouse, gradual tumour growth was observed up to day 35 after cell implantation until the end of the experiment.

[0262] 2) In one mouse, tumour growth inhibition was observed until the end of the first phase of treatment, after 5 doses (day 22 after cell implantation). On the seventh day after the end of the first phase, significant tumour growth was observed. After the first dose in the second phase, a decrease in tumour volume and inhibition of tumour growth was noted.

[0263] 3) In the last mouse, tumour growth inhibition was observed until the end of the first phase of treatment, after six doses (day 22 after cell implantation). On the third day after the end of the first phase, tumour atrophy was observed; on the seventh day, relapse was noted. After two doses in the second phase, the tumour was completely reduced (Fig. 20).

[0264] In mice in the i.p. route group, consistent tumour growth was observed from the first to the last administration (150% increase).

[0265] After both intra-tumour and intraperitoneal administration, no systemic side effects were observed. No neurotoxicity. No significant weight loss was noted, survival rate was 100%.

[0266] Mice with the smallest tumours at the start of treatment had the slowest tumour growth (Test (2)). These mice received the highest doses of dendriplexes per tumour volume. After administration of the substance at a dose determined as the amount of siRNA per 1 mm3of tumour, tumour reduction was again noted in two of the three mice in the second phase of the study.

[0267] Too large tumour volume hinders the distribution of dendriplexes to all cancer cells.

[0268] Example 13 - Analysis of histopathological preparations to assess the presence of pathological lesions in organs and tissues

[0269] Method of examination

[0270] Animals were euthanised 9 days (test (1)) or 2 days (test (2), SC i.p.) after treatment. After death was declared, dissection and resection of selected internal organs were performed: brain, lungs, heart, spleen, liver, kidney, femur and tumours. The organs and tissues, after weighing, were placed in a 10% formalin solution and submitted for histopathological examination. Histopathological evaluation of the tissues was performed to find any pathological lesions.

[0271] Conclusions

[0272] None of the mice showed pathological lesions in internal organs. Only one mouse in the KN group was found to have a simple cyst on the kidney (it is not known whether the lesion developed during treatment or was present before treatment).

[0273] One mouse from the KN group and one mouse from the test group (1) each had two tumours at the site of tumour cell implantation.

[0274] In contrast to the phase 1 study, no secondary tumour lesions were observed in the abdominal cavity during the autopsy (no tumour metastases).

[0275] Example 14: Tumour growth inhibition. Selection of the dendriplex for the final stage of research (Stage 3)

[0276] Given the only partial cure in the phase 2 in vivo study, another treatment trial was undertaken to isolate the most effective dose and best candidate for this gene therapy.

[0277] Method of examination

[0278] 1. Treatment

[0279] Once the tumour reached a size of 30-40 mm3, the animals were assigned to one of two groups. Each animal was weighed and the size of the tumours was measured before the substance was administered. 2. Groups and dosage:

[0280] 1) Test (1) dendriplex siRNA_2-PPI-M3-20 at a dose of 5.2 pmol siRNA / mm3tumour in a volume of 0.1 pl / mm3; once daily directly into the tumour in a 2-day regimen for 2 weeks;

[0281] 2) Test (2) dendriplex siRNA_2-PPI-Lac-27 at a dose of 5.2 pmol siRNA / mm3tumour in a volume of 0.1 pl / mm3; once daily directly into the tumour in a 2-day regimen for 2 weeks.

[0282] During treatment, the dose of dendriplex was increased from 5.2 to 7.0 pmol / mm3of tumour.

[0283] Observation and measurement

[0284] After the administration of the substance, observations of the animals were made for the appearance of adverse effects. Tumour sizes were measured every other day, always before substance administration and after dosing until the day of euthanasia (Fig. 21).

[0285] The animals were euthanised 1 week after the last administration of the test substance.

[0286] Conclusions

[0287] In the test group (1), it was observed:

[0288] (1) tumour reduction and growth inhibition during and after treatment;

[0289] (2) inhibition of tumour growth during and after treatment;

[0290] (3) tumour growth inhibition during treatment and tumour growth after treatment.

[0291] In the test group (2), slow tumour growth was observed during and after treatment.

[0292] Weight gain was noted in both groups, and no adverse effects or signs of neurotoxicity of the preparations were observed.

[0293] For the final stage of the study (Stage 4), siRNA_2-PPI-M3-20 was selected at a dose of 7.0 pmol / mm3of the tumour. Example 15. Evaluation of the effectiveness of anti-cancer therapy using siRNA_2- PPI-M3-20 dendriplex and the effect of the carrier (PPI-M3-20 dendrimer) on tumour growth (Stage 4)

[0294] Method of examination

[0295] 1. Treatment.

[0296] Once the tumour reached a size of 30-40 mm3, the animals were assigned to one of two groups. Each animal was weighed and the size of the tumours was measured before the substance was administered.

[0297] 2 Groups and dosage:

[0298] 1) Test - siRNA_2-PPI-M3-20 at a dose of 7 pmol siRNA / mm3tumour in a volume of 0.1 pl / mm3tumour;

[0299] 2) Carrier control - PPI-M3-20 at a dose equivalent to the amount of carrier in the dendriplex in a volume of 0.1 pl / mm3of tumour;

[0300] 3) Negative control - sterile saline (0.9% NaCl) in a volume of 0.1 pl / mm3of tumour.

[0301] Substances were administered once daily directly into the tumour in a two-day regimen for 2 weeks.

[0302] Observation and measurement

[0303] After administration of the substance, the animals were observed for the appearance of adverse effects. Tumour sizes were measured every other day, always before substance administration and after dosing until the day of euthanasia (Fig. 22).

[0304] Conclusions

[0305] There was a gradual increase in body weight in each group, no changes in animal behaviour; no signs of toxicity, including neurotoxicity (p>0.05).

[0306] Inhibition of tumour growth in the test group (siRNA_2- PPI-M3-20) relative to the negative control (Fig. 23; p<0.0005);

[0307] Inhibition of tumour growth in the carrier group (PPI-M3-20) relative to the negative control (Fig. 23; p<0.001);

[0308] Slower tumour growth in the test group (siRNA_2- PPI-M3-20) relative to the carrier (PPI-M3-20) (Fig. 23; p>0.05); Once the tumour has been completely reduced, treatment should be continued for some time to prevent recurrence.

[0309] Example 16. Assessment of the effect of dendriplexes on morphotic elements and blood biochemistry

[0310] Method of examination

[0311] On the day of euthanasia, morphology and blood biochemistry were performed: alanine aminotransferase (ALT), aspartate aminotransferase (AspAT), alkaline phosphatase (ALP), creatinine, glucose.

[0312] Conclusions

[0313] Liver enzyme values in each group are within normal limits; no signs of liver damage (Table 3).

[0314] Creatinine levels normal in each group; no signs of kidney damage (Table 3).

[0315] Blood glucose levels below / at the lower limit of the normal in the test and carrier groups with normal levels in the control group (Table 3).

[0316] Maintained normal levels of white blood cells (WBC), haemoglobin (HGB) and haematocrit (HTC) in the test and carrier groups with levels below or at the lower limit of normal in the control group (Table 4f

[0317] Maintained normal platelet (PLT) levels in the test and carrier groups with below-normal levels in the control group (Table 4f

[0318] An increase in the percentage of lymphocytes (LYMP%) and a decrease in the percentage of granulocytes (GRAN%) in the blood smear in each group (Table 4).

[0319] Table 3. Biochemical results of blood of mice treated with siRNA 2-PPI-M3-20 dendriplexes

[0320] Table 4. Blood morphology results of mice treated with siRNA 2-PPI-M3-20 dendriplexes

[0321] Example 17. Analysis of histopathological preparations to assess the presence of pathological lesions in organs and tissues

[0322] Method of examination

[0323] Animals were euthanised 1 week after the last administration of the test substance or when the tumour reached 1300 mm in size3. Once death was declared, selected internal organs and tissues were dissected and resected: brain, lung, heart, spleen, liver, kidney, muscle and tumours. The organs and tissues, after weighing, were placed in 10% formalin solution and submitted for histopathological examination.

[0324] Conclusions

[0325] Reduction in mean tumour weight in the test group relative to controls by 69% (p<0.05; Fig- 23);

[0326] Reduction in mean tumour weight in the carrier group relative to controls by 50% (p<0.05; Fig. 23);

[0327] Reduction in mean tumour weight in the test group relative to the carrier group by 37% (p>0.05; Fig. 23).

[0328] No pathological lesions were found in in internal organs of any of the mice.

[0329] Two tumours each were noted at the site of tumour cell implantation in two mice from the control group and two mice from the carrier group (Fig. 23).

[0330] Example 18. Assessment of the effect of dendriplexes on the expression of selected genes in cells isolated from tumours

[0331] Method of examination

[0332] Tumour fragments were homogenised and RNA was isolated. On the matrix of the isolated RNA, cDNA was synthesised by reverse transcription reaction. Using the cDNA matrix, a qRT-PCR reaction was performed to assess the effect of dendriplexes and dendrimers on the expression levels of selected genes. Conclusions

[0333] A decrease in the expression of the fusion gene and fusion-dependent genes (PAX3- F0X01, SNAIL, MRF4), as well as an increase in the expression of proapoptotic genes (BAX, CASP9, FAS) in dendriplex-treated mouse cancer cells were observed. Changes in the expression of genes responsible for myogenesis (MYOG and MYODI) were also observed. These changes are particularly noticeable in three of the five samples tested. No significant changes in PAX3-F0X01 gene expression were noted in dendrimer-treated mice. In the mice with the largest tumour, expression of the anti-apoptotic gene BAX decreased significantly, while expression of SNAIL1, responsible for ARMS cell proliferation, increased. Selected results are shown in Fig. 24 and 25.

[0334] SEQUENCE LISTING

[0335] <?xml version=" 1.0" encoding="UTF-8"?> <!DOCTYPE ST26SequenceListing PUBLIC "- / / WIPO / / DTD Sequence Listing 1.3 / / EN" "ST26SequenceListing_Vl_3.dtd">

[0336] 5 <ST26SequenceListing dtdVersion="Vl_3" fileName="17P52444PL00 xml.xml" softwareName="WLPO Sequence" softwareVersion="2.3.0" productionDate="2024-01-16">

[0337] <ApplicantFileReference>17P52444PL00< / ApplicantFileReference> <ApplicantName languageCode="pl">Uniwersytet Medyczny w Lodzi < / ApplicantName> <ApplicantNameLatin>Uniwersytet Medyczny w Lodzi < / ApplicantNameLatin> 0 <InventionTitle languageCode="pl">Glikodendrymer PPLG4 skompleksowany z siRNA swoistym dla genu fuzyjnego PAX3-FOXO1, kompozycja farmaceutyczna zawierajqca taki glikodendrymer oraz jej zastosowanie w terapii genowej mipsniakomipsaka prazkowanokomorkowego typu p§cherzykowego< / InventionTitle>

[0338] <SequenceTotalQuantity>6< / SequenceTotalQuantity> <SequenceData sequencelDNumber- ' 1 "> 5 <lNSDSeq>

[0339] <IN SD S eq_l ength> 19< / IN SD Seq l ength> <IN SD Seq_moltype>RNA< / IN SD Seq_moltype> <IN SD S eq_divi si on>P AT < / IN SD Seq_di vi si on> <INSDSeq_feature-table> 0 <INSDFeature>

[0340] <IN SDF eature_key>source< / IN SDF eature_key>

[0341] <IN SDF eature_location> 1..19< / IN SDF eature_location>

[0342] <INSDSeq>

[0343] <IN SD S eq_l ength>21 < / IN SD Seq J ength>

[0344] <IN SD Seq_moltype>RNA< / IN SD Seq _moltype>

[0345] <IN SD S eq_divi si on>P AT < / IN SD Seq_di vi si on>

[0346] 5 <INSDSeq_feature-table>

[0347] <INSDFeature>

[0348] <IN SDF eature_key>source< / IN SDF eature_key>

[0349] <IN SDF eature_location> 1..21 < / IN SDF eature_location>

[0350] <IN SDF eature qual s> 0 <INSDQualifier>

[0351] <INSDQualifier name>mol type< / INSDQualifier name>

[0352] <INSDQualifier_value>other RNA< / INSDQualifier_value>

[0353] < / INSDQualifier>

[0354] <IN SDQualifier id~"q6"> 5 <INSDQualifier_name>note< / INSDQualifier _name>

[0355] <INSDQualifier value> Sequence of antisense strand (5' -

[0356] 3')< / INSDQualifier_value>

[0357] < / INSDQualifier>

[0358] <INSDQualifier id~"q5"> 0 <INSDQualifier_name>organism< / INSDQualifier_name>

[0359] <IN SDQualifier value>synthetic construct< / IN SDQualifier value>

[0360]

[0361]

[0362] IT) o

[0363] (S <INSDFeature>

[0364] <IN SDF eature_key>source< / IN SDF eature_key>

[0365] <INSDFeature_location>l . ,23< / INSDFeature_location>

[0366] <IN SDF eature qual s>

[0367] 5 <INSDQualifier>

[0368] <INSDQualifier name>mol type< / INSDQualifier name>

[0369] <INSDQualifier_value>other RNA< / INSDQualifier_value>

[0370] < / INSDQualifier>

[0371] <INSDQualifier id="ql2"> 0 <INSDQualifier_name>note< / INSDQualifier_name>

[0372] <INSDQualifier value> Sequence of antisense strand (5' -

[0373] 3')< / INSDQualifier_value>

[0374] < / INSDQualifier>

[0375] <INSDQualifier id="ql 1 "> 5 <INSDQualifier_name>organism< / INSDQualifier_name>

[0376] <INSDQualifier value>synthetic construct< / INSDQualifier _value> < / INSDQualifier>

[0377]

[0378] < / IN SDF eature> 0 < / IN SDSeq_feature-table>

[0379] <INSDSeq sequence>ttgaattctttgaggttgagagg< / INSDSeq sequence>

[0380] < / INSDSeq>

[0381] < / SequenceData>

[0382] <SequenceData sequenceIDNumber="5">

[0383] <INSDSeq>

[0384] 5 <INSDSeq_length>l 5< / INSDSeq_length>

[0385] <IN SD Seq moltype>RNA< / IN SD Seq moltype>

[0386] <IN SD S eq_divi si on>P AT < / IN SD Seq_di vi si on>

[0387] <INSDSeq_feature-table>

[0388] <INSDFeature> 0 <1 N SDF eature_key >source< / IN SDF eature_key >

[0389] <IN SDF eature location> 1..15< / IN SDF eature location>

[0390] <IN SDF eature qual s>

[0391] <INSDQualifier>

[0392] <INSDQualifier_name>mol_type< / INSDQualifier_name>5 <INSDQualifier_value>other RNA< / INSDQualifier_value>

[0393] < / INSDQualifier>

[0394] <INSDQualifier id="ql5">

[0395] <INSDQualifier _name>note< / INSDQualifier_name>

[0396] <INSDQualifier_value>Sequence of antisense strand (5' -0 3')< / INSDQualifier_value>

[0397] < / INSDQualifier>

[0398] <INSDQualifier name>mol type< / INSDQualifier name>

[0399] <INSDQualifier_value>other RNA< / INSDQualifier_value>

[0400] < / INSDQualifier>

[0401] <INSDQualifier id="ql 8">

[0402] 5 <INSDQualifier_name>note< / INSDQualifier_name>

[0403] <INSDQualifier value> Sequence of antisense strand (5' -

[0404] 3')< / INSDQualifier_value>

[0405] < / INSDQualifier>

[0406] <INSDQualifier id="ql7"> 0 <INSDQualifier_name>organism< / INSDQualifier_name>

[0407] <INSDQualifier value>synthetic construct< / INSDQualifier _value>

[0408] < / INSDQualifier>

[0409] < / IN SDF eature_qual s>

[0410] < / IN SDF eature> 5 < / IN SDSeq_feature-table>

[0411] <INSDSeq sequence>tttgaggttgagagg< / INSDSeq sequence>

[0412] < / INSDSeq>

[0413] < / SequenceData>

[0414] < / S T26 S equenceLi sting>

[0415] V ARI ANT < / IN SDF eature key >

[0416] <IN SDF eature_location>7< / IN SDF eature_location>

[0417] <IN SDF eature_quals>

[0418] <INSDQualifier id="q32">

[0419] <INSDQualifier _name>note< / INSDQualifier _name>

[0420] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0421] < / INSDQualifier>

[0422] < / IN SDF eature_quals>

[0423] < / INSDFeature>

[0424] <INSDFeature>

[0425] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[0426] <IN SDF eature_location>8< / IN SDF eature_location>

[0427] <IN SDF eature_quals>

[0428] <INSDQualifier id="q33">

[0429] <INSDQualifier_name>note< / INSDQualifier_name>

[0430] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0431] < / INSDQualifier>

[0432] < / IN SDF eature_quals>

[0433] < / INSDFeature>

[0434] <INSDFeature>

[0435] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[0436] <IN SDF eature_location>9< / IN SDF eature_location>

[0437] <IN SDF eature_quals>

[0438] <INSDQualifier id="q34">

[0439] <INSDQualifier_name>note< / INSDQualifier_name>

[0440] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0441] < / INSDQualifier>

[0442] < / IN SDF eature_quals>

[0443] < / INSDFeature>

[0444] <INSDFeature>

[0445] <IN SDF eature_key>source

[0446] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[0447] <IN SDF eature_quals>

[0448] <INSDQualifier>

[0449] <INSDQualifier _name>mol_type< / INSDQualifier_name>

[0450] <INSDQualifier_value>protein< / INSDQualifier_value>

[0451] < / INSDQualifier>

[0452] <INSDQualifier id="q351">

[0453] <INSDQualifier _name>organism< / INSDQualifier_name>

[0454] <INSDQualifier_value>synthetic construct< / IN SDQualifier_value>

[0455] < / INSDQualifier>

[0456] < / IN SDF eature_quals>

[0457] < / INSDFeature>

[0458] < / IN SD S eq feature-tabl e>

[0459] <IN SD S eq seq uen ce>X Q EEGX XX X R< / 1 N SD S eq_sequence>

[0460] < / INSDSeq>

[0461] < / SequenceData>

[0462] < S equenceData sequencelDNumb er= " 6 " >

[0463] <INSDQualifier_value>Peptyd rozk adaj cy kryszta y pirofosforanu wapnia< / INSDQualifier_value>

[0464] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location> 1 < / IN SDF eature_location> F eature_quals>

[0465] <INSDQualifier id="q37">

[0466] <IN SDQualifi er_name>note< / IN SDQualifi er_name>

[0467] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0468] < / INSDQualifier>

[0469] < / IN SDF eature_quals>

[0470] < / INSDFeature>

[0471] <INSDFeature>

[0472] <IN SDF eature key > V ARI ANT < / IN SDF eature key > aminokwas< / INSDQualifier_value>

[0473] < / INSDQualifier>

[0474] < / IN SDF eature_quals>

[0475] < / INSDFeature>

[0476] <INSDFeature>

[0477] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[0478] <IN SDF eature_location>7< / IN SDF eature_location>

[0479] <IN SDF eature_quals>

[0480] <INSDQualifier id="q39">

[0481] <INSDQualifier _name>note< / INSDQualifier _name>

[0482] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0483] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>8< / IN SDF eature_location> F eature_quals>

[0484] <INSDQualifier id="q40">

[0485] <INSDQualifier_name>note< / INSDQualifier_name>

[0486] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0487] < / INSDQualifier>

[0488] < / INSDF eature_quals>

[0489] < / INSDFeature>

[0490] <INSDFeature>

[0491] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[0492] <IN SDF eature_location>9< / IN SDF eature_location>

[0493] <IN SDF eature_quals>

[0494] <INSDQualifier id="q41">

[0495] <INSDQualifier_name>note< / INSDQualifier_name>

[0496] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0497] < / INSDQualifier>

[0498] < / IN SDF eature_quals>

[0499] < / INSDFeature>

[0500] <INSDFeature>

[0501] <IN SDF eature_key>source< / IN SDF eature_key>

[0502] <INSDFeature_location>l ..10< / INSDFeature_location>

[0503] <IN SDF eature_quals>

[0504] <INSDQualifier>

[0505] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0506] <INSDQualifier_value>protein< / INSDQualifier_value>

[0507] < / INSDQualifier>

[0508] <INSDQualifier id="q352">

[0509] <INSDQualifier_name>organism< / INSDQualifier_name>

[0510] <INSDQualifier_value>synthetic construct< / IN SDQualifier_value>

[0511] < / INSDQualifier>

[0512] < / IN SDF eature_quals>

[0513] < / INSDFeature>

[0514] < / INSDSeq_feature-table>

[0515] <IN SD S eq seq uen ce>X Q ED A X X X X R

[0516] eature key > V ARI ANT < / IN SDF eature key > eature_location> 1 < / IN SDF eature_location> eature_quals> INSDQualifier id="q44">

[0517] <INSDQualifier_name>note< / INSDQualifier_name>

[0518] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0519] < / INSDQualifier>

[0520] < / IN SDF eature_quals>

[0521] < / INSDFeature>

[0522] <INSDFeature>

[0523] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[0524] <IN SDF eature_location>6< / IN SDF eature_location>

[0525] <IN SDF eature_quals>

[0526] <INSDQualifier id="q45">

[0527] <INSDQualifier_name>note< / INSDQualifier_name>

[0528] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0529] < / INSDQualifier>

[0530] < / IN SDF eature_quals>

[0531] < / INSDFeature>

[0532] <INSDFeature>

[0533] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[0534] <IN SDF eature_location>7< / IN SDF eature_location>

[0535] <IN SDF eature_quals>

[0536] <INSDQualifier id="q46">

[0537] <INSDQualifier_name>note< / INSDQualifier_name>

[0538] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0539] < / INSDQualifier>

[0540] < / IN SDF eature_quals>

[0541] e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>8< / IN SDF eature_location> F eature_quals>

[0542] <INSDQualifier id="q47">

[0543] <INSDQualifier _name>note< / INSDQualifier _name>

[0544] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0545] < / INSDQualifi er>

[0546] < / IN SDF eature_quals>

[0547] < / INSDFeature>

[0548] <INSDFeature>

[0549] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[0550] <IN SDF eature_location>9< / IN SDF eature_location>

[0551] <IN SDF eature_quals>

[0552] <INSDQualifier id="q48">

[0553] <INSDQualifier_name>note< / INSDQualifier_name>

[0554] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0555] < / INSDQualifier>

[0556] < / IN SDF eature_quals>

[0557] < / INSDFeature>

[0558] <INSDFeature>

[0559] <IN SDF eature_key>source< / IN SDF eature_key>

[0560] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[0561] <IN SDF eature_quals>

[0562] <INSDQualifier>

[0563] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0564] <INSDQualifier_value>protein< / INSDQualifier_value>

[0565] < / INSDQualifier>

[0566] <INSDQualifier id="q353">

[0567] <INSDQualifier_name>organism< / INSDQualifier_name>

[0568] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0569] < / INSDQualifier>

[0570] < / IN SDF eature_quals>

[0571] < / INSDFeature>

[0572] < / INSDSeq_feature-table>

[0573] <IN S D Seq sequen ce>XQEDGXXXXH

[0574] < / INSDSeq>

[0575] < / SequenceData>

[0576] < S equenceData sequencelDNumb er= " 8 " >

[0577] <INSDSeq>

[0578] <IN SD S eq_l ength> 10< / 1 N SD S eq_l ength>

[0579] <IN SD Seq_moltype> AA< / IN SD Seq_moltype>

[0580] <IN SD S eq di vi si on>P AT

[0581] <IN SD S eq feature-tabl e>

[0582] <IN SDF eature_location> 1 < / IN SDF eaturej ocati on>

[0583] <IN SDF eature_quals>

[0584] <INSDQualifier id="q51 ">

[0585] <INSDQualifier _name>note< / INSDQualifier _name>

[0586] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0587] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>6< / IN SDF eature_location> F eature_quals>

[0588] <INSDQualifier id="q52">

[0589] <INSDQualifier_name>note< / INSDQualifier_name>

[0590] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0591] < / INSDQualifier>

[0592] < / IN SDF eature_quals>

[0593] < / INSDFeature>

[0594] <INSDFeature>

[0595] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[0596] <IN SDF eature_location>7< / IN SDF eature_location>

[0597] <IN SDF eature_quals>

[0598] <INSDQualifier id="q53">

[0599] <INSDQualifier_name>note< / INSDQualifier_name>

[0600] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0601] < / INSDQualifier>

[0602] < / IN SDF eature_quals>

[0603] < / INSDFeature>

[0604] <INSDFeature>

[0605] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[0606] <IN SDF eature_location>8< / IN SDF eature_location>

[0607] <IN SDF eature_quals>

[0608] <INSDQualifier id="q54">

[0609] <INSDQualifier _name>note< / INSDQualifier _name>

[0610] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0611] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>9< / IN SDF eature_location> F eature_quals>

[0612] <INSDQualifier id="q55">

[0613] <INSDQualifier _name>note< / INSDQualifier _name>

[0614] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0615] <IN SDQualifi er_value>synthetic construct< / IN SDQualifier_value>

[0616] < / INSDQualifier>

[0617] < / IN SDF eature_quals>

[0618] < / INSDFeature>

[0619] < / INSDSeq_feature-table>

[0620] <IN S D Seq sequen ce>XQEDGXXXXK

[0621] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[0622] <IN SDF eature_location> 1 < / IN SDF eature_location>

[0623] <IN SDF eature_quals>

[0624] <INSDQualifier id="q58">

[0625] <INSDQualifier _name>note< / INSDQualifier _name>

[0626] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0627] < / INSDQualifier>

[0628] < / IN SDF eature_quals>

[0629] e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>6< / IN SDF eature_location> F eature_quals>

[0630] <INSDQualifier id="q59">

[0631] <INSDQualifier _name>note< / INSDQualifier _name>

[0632] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0633] < / INSDQualifier>

[0634] < / IN SDF eature_quals>

[0635] < / INSDFeature>

[0636] <INSDFeature>

[0637] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[0638] <IN SDF eature_location>7< / IN SDF eature_location>

[0639] <IN SDF eature qual s>

[0640] <INSDQualifier id="q60">

[0641] <INSDQualifier_name>note< / INSDQualifier_name>

[0642] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0643] < / INSDQualifier>

[0644] < / IN SDF eature_quals>

[0645] < / INSDFeature>

[0646] <INSDFeature>

[0647] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[0648] <IN SDF eature_location>8< / IN SDF eature_location>

[0649] <IN SDF eature_quals>

[0650] <INSDQualifier id="q61">

[0651] <INSDQualifier_name>note< / INSDQualifier_name>

[0652] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0653] < / INSDQualifier>

[0654] F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>9< / IN SDF eature_location> F eature_quals>

[0655] <INSDQualifier id="q62">

[0656] <INSDQualifier _name>note< / INSDQualifier _name>

[0657] <INSDQualifier_value>X oznacza dowolny aminokwas< / IN SDQualifi er_value>

[0658] < / INSDQualifier>

[0659] < / IN SDF eature_quals>

[0660] < / INSDFeature>

[0661] <INSDFeature>

[0662] <IN SDF eature_key>source< / IN SDF eature_key>

[0663] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[0664] <IN SDF eature_quals>

[0665] <INSDQualifier>

[0666] <INSDQualifier _name>mol_type< / INSDQualifier _name>

[0667] <INSDQualifier_value>protein< / INSDQualifier_value>

[0668] < / INSDQualifier>

[0669] <IN SDQualifi er id="q355">

[0670] <INSDQualifier_name>organism< / INSDQualifier_name>

[0671] <INSDQualifier_value>synthetic construct< / IN SDQualifier_value>

[0672] < / INSDQualifier>

[0673] < / IN SDF eature_quals>

[0674] < / INSDFeature>

[0675] < / INSDSeq_feature-table>

[0676] <IN SD Seq_sequence>XNDDGXXXXR< / IN SD Seq_sequence>

[0677] < / INSDSeq>

[0678] < / SequenceData>

[0679] <SequenceData sequenceIDNumber=" 10">

[0680] <INSDSeq>

[0681] <IN SD S eq_l ength> 10< / 1 N SD S eq_l ength>

[0682] <IN SD Seq_moltype> A A

[0683] <IN SD S eq di vi si on>P AT < / 1 N SD S eq di vi si on>

[0684] <INSDSeq_feature-table>

[0685] <INSDFeature>

[0686] REGION

[0687] <IN SDF eature_location> 1..10

[0688]

[0689] <INSDQualifier id="q64">

[0690] <INSDQualifier_name>note< / INSDQualifier_name>

[0691] <INSDQualifier_value>Peptyd rozk adaj cy kryszta y pirofosforanu wapnia< / INSDQualifier_value>

[0692] < / INSDQualifier>

[0693] < / IN SDF eature_quals>

[0694] < / INSDFeature>

[0695] <INSDFeature>

[0696] V ARI ANT < / IN SDF eature key >

[0697] <IN SDF eature_location> 1 < / IN SDF eature_location>

[0698] <IN SDF eature_quals>

[0699] <INSDQualifier id="q65">

[0700] <INSDQualifier _name>note< / INSDQualifier _name>

[0701] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0702] < / INSDQualifier>

[0703] < / IN SDF eature_quals>

[0704] < / INSDFeature>

[0705] <INSDFeature>

[0706] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[0707] <IN SDF eature_location>6< / IN SDF eature_location>

[0708] <IN SDF eature_quals>

[0709] <INSDQualifier id="q66">

[0710] <INSDQualifier _name>note< / INSDQualifier _name>

[0711] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0712] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>7< / IN SDF eature_location> F eature_quals>

[0713] <INSDQualifier id="q67">

[0714] <INSDQualifier _name>note< / INSDQualifier _name>

[0715] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0716] < / INSDQualifier>

[0717] < / IN SDF eature_quals>

[0718] < / INSDFeature>

[0719] <INSDFeature>

[0720] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[0721] <IN SDF eature_location>8< / IN SDF eature_location>

[0722] <IN SDF eature_quals>

[0723] <INSDQualifier id="q68">

[0724] <INSDQualifier_name>note< / INSDQualifier_name>

[0725] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0726] < / INSDQualifier>

[0727] < / IN SDF eature_quals>

[0728] < / IN SDF eature>

[0729] <INSDFeature>

[0730] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[0731] <IN SDF eature_location>9< / IN SDF eature_location>

[0732] <IN SDF eature_quals>

[0733] <INSDQualifier id="q69">

[0734] <INSDQualifier_name>note< / INSDQualifier_name>

[0735] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQiialifier_value>

[0736] < / INSDQualifier>

[0737] < / IN SDF eature_quals>

[0738] < / INSDFeature>

[0739] <INSDFeature>

[0740] <IN SDF eature_key>source< / IN SDF eature_key>

[0741] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[0742] <IN SDF eature_quals>

[0743] <INSDQualifier>

[0744] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0745] <INSDQualifier_value>protein< / INSDQualifier_value>

[0746] < / INSDQualifier>

[0747] <INSDQualifier id="q356">

[0748] <INSDQualifier_name>organism< / INSDQualifier_name>

[0749] <INSDQualifier_value>synthetic construct< / IN SDQualifier_value>

[0750] < / INSDQualifier>

[0751] < / INSDF eature_quals>

[0752] < / INSDFeature>

[0753] < / INSDSeq_feature-table>

[0754] <IN SD S eq seq uen ce>X N EEGX XX X R< / 1 N SD S eq_sequence>

[0755] < / INSDSeq>

[0756] < / SequenceData>

[0757] <SequenceData sequenceIDNumber=" 11 ">

[0758] <INSDSeq>

[0759] <IN SD S eq_l ength> 10< / 1 N SD S eq_l ength>

[0760] <IN SD Seq_moltype> AA< / IN SD Seq_moltype>

[0761] <IN SD S eq di vi si on>P AT

[0762] <INSDSeq_feature-table>

[0763] <INSDFeature>

[0764] REGION

[0765] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[0766] <IN SDF eature_quals>

[0767] <INSDQualifier id="q71">

[0768] <INSDQualifier _name>note< / INSDQualifier _name>

[0769] <INSDQualifier_value>Peptyd rozk adaj cy kryszta y pirofosforanu wapnia< / INSDQiialifier_value>

[0770] < / INSDQualifier>

[0771] < / IN SDF eature_quals>

[0772] < / INSDFeature>

[0773] <INSDFeature>

[0774] V ARI ANT < / IN SDF eature key >

[0775] <IN SDF eature_location> 1 < / IN SDF eature_location>

[0776] <IN SDF eature qual s>

[0777] <INSDQualifier id="q72">

[0778] <INSDQualifier _name>note< / INSDQualifier _name>

[0779] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0780] < / INSDQualifier>

[0781] < / IN SDF eature_quals>

[0782] < / INSDFeature>

[0783] <INSDFeature>

[0784] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[0785] <IN SDF eature_location>6< / IN SDF eature_location>

[0786] <IN SDF eature_quals>

[0787] <INSDQualifier id="q73 ">

[0788] <IN SDQualifier_name>note< / IN SDQualifier_name>

[0789] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0790] < / INSDQualifier>

[0791] F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>7< / IN SDF eature_location> F eature_quals>

[0792] <INSDQualifier id="q74">

[0793] <INSDQualifier _name>note< / INSDQualifier _name>

[0794] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0795] < / INSDQualifier>

[0796] < / IN SDF eature_quals>

[0797] < / INSDFeature>

[0798] <INSDFeature>

[0799] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[0800] <IN SDF eature_location>8< / IN SDF eature_location>

[0801] <IN SDF eature_quals>

[0802] <INSDQualifier id="q75">

[0803] <INSDQualifier_name>note< / INSDQualifier_name>

[0804] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0805] < / INSDQualifier>

[0806] < / IN SDF eature_quals>

[0807] < / INSDFeature>

[0808] <INSDFeature>

[0809] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[0810] <IN SDF eature_location>9< / IN SDF eature_location>

[0811] <IN SDF eature_quals>

[0812] <INSDQualifier id="q76">

[0813] <INSDQualifier_name>note< / INSDQualifier_name>

[0814] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0815]

[0816] <INSDQualifier id="q78">

[0817] <INSDQualifier_name>note< / INSDQualifier_name>

[0818] <INSDQualifier_value>Peptyd rozk adaj cy kryszta y pirofosforanu wapnia< / INSDQualifier_value>

[0819] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location> 1 < / IN SDF eature_location> F eature_quals>

[0820] <INSDQualifier id="q79">

[0821] <INSDQualifier _name>note< / INSDQualifier _name>

[0822] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0823] < / INSDQualifier>

[0824] < / IN SDF eature_quals>

[0825] < / INSDFeature>

[0826] <INSDFeature>

[0827] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[0828] <IN SDF eature_location>6< / IN SDF eature_location>

[0829] <IN SDF eature_quals>

[0830] <INSDQualifier id="q8O">

[0831] <INSDQualifier_name>note< / INSDQualifier_name>

[0832] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0833] < / INSDQualifier>

[0834] < / IN SDF eature_quals>

[0835] < / INSDFeature>

[0836] <INSDFeature>

[0837] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[0838] <IN SDF eature_location>7< / IN SDF eature_location>

[0839] <IN SDF eature_quals>

[0840] <INSDQualifier id="q81 ">

[0841] <INSDQualifier_name>note< / INSDQualifier_name>

[0842] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0843] < / INSDQualifier>

[0844] < / IN SDF eature_quals>

[0845] < / INSDFeature>

[0846] <INSDFeature>

[0847] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[0848] <IN SDF eature_location>8< / IN SDF eature_location>

[0849] <IN SDF eature_quals>

[0850] <INSDQualifier id="q82">

[0851] <INSDQualifier _name>note< / INSDQualifier _name>

[0852] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0853] < / INSDQualifier>

[0854] < / IN SDF eature_quals>

[0855] < / INSDFeature>

[0856] <INSDFeature>

[0857] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[0858] <IN SDF eature_location>9< / IN SDF eature_location>

[0859] <IN SDF eature_quals>

[0860] <INSDQualifier id="q83">

[0861] <INSDQualifier_name>note< / INSDQualifier_name>

[0862] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0863] < / INSDQualifier>

[0864] < / IN SDF eature_quals>

[0865] < / INSDFeature>

[0866] <INSDFeature>

[0867] <IN SDF eature_key>source< / IN SDF eature_key>

[0868] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[0869] <IN SDF eature_quals>

[0870] <INSDQualifier>

[0871] <INSDQualifier _name>mol_type< / INSDQualifier _name>

[0872] <INSDQualifier_value>protein< / INSDQualifier_value>

[0873] < / INSDQualifier>

[0874] <INSDQualifier id="q358">

[0875] <INSDQualifier_name>organism< / INSDQualifier_name>

[0876] <INSDQualifier_value>synthetic construct< / IN SDQualifier_value>

[0877] < / INSDQualifier>

[0878] < / IN SDF eature_quals>

[0879] < / INSDFeature>

[0880] < / INSDSeq_feature-table>

[0881] <INSDSeq_sequence>XNFDGXXXXH< / INSDSeq_sequence>

[0882] < / INSDSeq>

[0883] < / SequenceData>

[0884] <SequenceData sequencelDNumber- ' 13 ">

[0885] F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location> 1 < / IN SDF eature_location> F eature_quals>

[0886] <INSDQualifier id="q86">

[0887] <INSDQualifier_name>note< / INSDQualifier_name>

[0888] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0889] < / INSDQualifier>

[0890] < / IN SDF eature_quals>

[0891] < / INSDFeature>

[0892] <INSDFeature>

[0893] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[0894] <IN SDF eature_location>6< / IN SDF eature_location>

[0895] <IN SDF eature_quals>

[0896] <INSDQualifier id="q87">

[0897] <INSDQualifier_name>note< / INSDQualifier_name>

[0898] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0899] < / INSDQualifier>

[0900] < / IN SDF eature_quals>

[0901] < / INSDFeature>

[0902] <INSDFeature>

[0903] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[0904] <IN SDF eature_location>7< / IN SDF eature_location>

[0905] <IN SDF eature_quals>

[0906] <INSDQualifier id="q88">

[0907] <INSDQualifier_name>note< / INSDQualifier_name>

[0908] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0909] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>8< / IN SDF eature_location> F eature_quals>

[0910] <INSDQualifier id="q89">

[0911] <INSDQualifier _name>note< / INSDQualifier _name>

[0912] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0913] < / INSDQualifier>

[0914] < / IN SDF eature_quals>

[0915] < / INSDFeature>

[0916] <INSDFeature>

[0917] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[0918] <IN SDF eature_location>9< / IN SDF eature_location>

[0919] <IN SDF eature_quals>

[0920] <INSDQualifier id="q90">

[0921] <INSDQualifier_name>note< / INSDQualifier_name>

[0922] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0923] < / INSDQualifier>

[0924] < / IN SDF eature_quals>

[0925] < / INSDFeature>

[0926] <INSDFeature>

[0927] <IN SDF eature_key>source< / IN SDF eature_key>

[0928] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[0929] <IN SDF eature_quals>

[0930] <INSDQualifier>

[0931] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0932] <INSDQualifier_value>protein< / INSDQualifier_value>

[0933] < / INSDQualifier>

[0934] <INSDQualifier id="q359">

[0935] <INSDQualifier_name>organism< / INSDQualifier_name>

[0936] <INSDQualifier_value>synthetic construct< / IN SDQualifier_value>

[0937] < / INSDQualifier>

[0938] < / IN SDF eature_quals>

[0939] < / INSDFeature>

[0940] < / INSDSeq_feature-table>

[0941] <INSDSeq_sequence>XNEDGXXXXI<< / INSDSeq_seqiience>

[0942] < / INSDSeq>

[0943] < / SequenceData>

[0944] <SequenceData sequenceIDNumber=" 14">

[0945] <INSDSeq>

[0946] <IN SD S eq_l ength> 10< / 1 N SD S eq_l ength>

[0947] <IN SDSeq_moltype> AA< / IN SD Seq_moltype>

[0948] <IN SD S eq di vi si on>P AT

[0949] <INSDSeq_feature-table>

[0950] <INSDFeature>

[0951] REGION

[0952] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[0953] <IN SDF eature_quals>

[0954] <INSDQualifier id="q92">

[0955] <INSDQualifier_name>note< / INSDQualifier_name>

[0956] <INSDQualifier_value>Peptyd rozk adaj cy kryszta y pirofosforanu wapnia< / INSDQualifier_value>

[0957] < / INSDQualifier>

[0958] < / IN SDF eature_quals>

[0959] < / INSDFeature>

[0960] <INSDFeature>

[0961] V ARI ANT < / IN SDF eature key >

[0962] <IN SDF eature_location> 1 < / IN SDFeature_location>

[0963] <IN SDF eature_quals>

[0964] <INSDQualifier id="q93 ">

[0965] <INSDQualifier_name>note< / INSDQualifier_name>

[0966] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0967] < / INSDQualifier>

[0968] < / IN SDF eature_quals>

[0969] < / INSDFeature>

[0970] <INSDFeature>

[0971] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[0972] <IN SDF eature_location>6< / IN SDF eature_location>

[0973] <IN SDF eature_quals>

[0974] <INSDQualifier id="q94">

[0975] <INSDQualifier _name>note< / INSDQualifier _name>

[0976] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0977] < / INSDQualifier>

[0978] < / IN SDF eature_quals>

[0979] < / INSDFeature>

[0980] <INSDFeature>

[0981] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[0982] <IN SDF eature_location>7< / IN SDF eature_location>

[0983] <IN SDF eature_quals>

[0984] <INSDQualifier id="q95">

[0985] <INSDQualifier_name>note< / INSDQualifier_name>

[0986] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0987] < / INSDQualifier>

[0988] < / IN SDF eature_quals>

[0989] < / INSDFeature>

[0990] <INSDFeature>

[0991] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[0992] <IN SDF eature locati on>8< / IN SDF eature_location>

[0993] <IN SDF eature_quals>

[0994] <INSDQualifier id="q96">

[0995] <INSDQualifier_name>note< / INSDQualifier_name>

[0996] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[0997] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>9< / IN SDF eature_location> F eature_quals>

[0998] <INSDQualifier id="q97">

[0999] <INSDQualifier _name>note< / INSDQualifier _name>

[1000] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1001] < / INSDQualifier>

[1002] < / IN SDF eature_quals>

[1003] < / INSDFeature>

[1004] <INSDFeature>

[1005] <IN SDF eature_key>source< / IN SDF eature_key>

[1006] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[1007] <IN SDF eature_quals>

[1008] <INSDQualifier>

[1009] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1010] <INSDQualifier_value>protein< / INSDQualifier_value>

[1011] < / INSDQualifier>

[1012] <INSDQualifier id="q360">

[1013] <INSDQualifier_name>organism< / INSDQualifier_name>

[1014] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[1015] < / INSDQualifier>

[1016] < / IN SDF eature_quals>

[1017] < / INSDFeature>

[1018] < / INSDSeq_feature-table>

[1019] <IN SD S eq seq uen ce>X Q DEGX X X X R F eature qual s> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location> 1 < / IN SDF eature_location> F eature_quals>

[1020] <INSDQualifier id="ql00">

[1021] <INSDQualifier _name>note< / INSDQualifier _name>

[1022] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1023] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature locati on>6< / IN SDFeature_location> F eature_quals>

[1024] <INSDQualifier id="ql01">

[1025] <INSDQualifier _name>note< / INSDQualifier _name>

[1026] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1027] < / INSDQualifier>

[1028] < / IN SDF eature qual s>

[1029] < / INSDFeature>

[1030] <INSDFeature>

[1031] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1032] <IN SDF eature_location>7< / IN SDF eature_location>

[1033] <IN SDF eature_quals>

[1034] <INSDQualifier id="ql02">

[1035] <INSDQualifier_name>note< / INSDQualifier_name>

[1036] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1037] < / INSDQualifier>

[1038] < / IN SDF eature_quals>

[1039] < / INSDFeature>

[1040] <INSDFeature>

[1041] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1042] <IN SDF eature_location>8< / IN SDF eature_location>

[1043] <IN SDF eature_quals>

[1044] <INSDQualifier id="qlO3">

[1045] <INSDQualifier_name>note< / INSDQualifier_name>

[1046] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1047] < / INSDQualifier>

[1048] < / IN SDF eature_quals>

[1049] < / INSDFeature>

[1050] <INSDFeature>

[1051] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1052] <IN SDF eature_location>9< / IN SDF eature_location>

[1053] <IN SDF eature_quals>

[1054] <INSDQualifier id="ql04">

[1055] <INSDQualifier _name>note< / INSDQualifier _name>

[1056] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1057] < / INSDQualifier>

[1058] < / IN SDF eature_quals>

[1059] < / INSDF eature>

[1060] <INSDFeature>

[1061] <IN SDF eature_key>source< / IN SDF eature_key>

[1062] <IN SDF eature_location> 1..10< / IN SDFeature_location>

[1063] <IN SDF eature_quals>

[1064] <INSDQualifier>

[1065] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1066] <INSDQualifier_value>protein< / INSDQualifier_value>

[1067] < / INSDQualifier>

[1068] <INSDQualifier id="q361">

[1069] <INSDQualifier_name>organism< / INSDQualifier_name>

[1070] <INSDQualifier_value>synthetic construct< / IN SDQualifier_value>

[1071] < / INSDQualifier>

[1072] < / IN SDF eature_quals>

[1073] < / INSDFeature>

[1074] < / INSDSeq_feature-table>

[1075] <IN SD S eq_sequence>XQDD AXXXXR< / IN SD S eq_sequence>

[1076] < / INSDSeq>

[1077] < / SequenceData>

[1078] <SequenceData sequenceIDNumber=" 16">

[1079] <INSDSeq>

[1080] <IN SD S eq_l ength> 10< / 1 N SD S eq_l ength>

[1081] <IN SD Seq_moltype> A A

[1082] <IN SD S eq di vi si on>P AT < / 1 N SD S eq di vi si on>

[1083] <INSDSeq_feature-table>

[1084] <INSDFeature>

[1085] REGION

[1086] <IN SDF eature_location> 1..10

[1087]

[1088] <INSDQualifier id="ql06">

[1089] <INSDQualifier_name>note< / INSDQualifier_name>

[1090] <INSDQualifier_value>Peptyd rozk adaj cy kryszta y pirofosforanu wapnia< / INSDQualifier_value>

[1091] < / INSDQualifier>

[1092] < / IN SDF eature_quals>

[1093] < / INSDFeature>

[1094] <INSDFeature>

[1095] V ARI ANT < / IN SDF eature key >

[1096] <IN SDF eature_location> 1 < / IN SDF eature_location>

[1097] <IN SDF eature_quals>

[1098] <INSDQualifier id="ql07">

[1099] <INSDQualifier _name>note< / INSDQualifier _name>

[1100] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1101] < / INSDQualifier>

[1102] < / IN SDF eature_quals>

[1103] < / INSDFeature>

[1104] <INSDFeature>

[1105] V ARI ANT < / IN SDF eature key >

[1106] <IN SDF eature_location>6< / IN SDF eature_location>

[1107] <IN SDF eature_quals>

[1108] <INSDQualifier id="qlO8">

[1109] <INSDQualifier _name>note< / INSDQualifier _name>

[1110] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1111] < / INSDQualifier>

[1112] < / IN SDF eature_quals>

[1113] < / INSDFeature>

[1114] <INSDFeature>

[1115] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1116] <IN SDF eature_location>7< / IN SDFeature_location>

[1117] <IN SDF eature_quals>

[1118] <INSDQualifier id="ql09">

[1119] <INSDQualifier_name>note< / INSDQualifier_name>

[1120] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1121] < / INSDQualifier>

[1122] < / IN SDF eature_quals>

[1123] < / INSDFeature>

[1124] <INSDFeature>

[1125] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1126] <IN SDF eature_location>8< / IN SDF eature_location>

[1127] <IN SDF eature_quals>

[1128] <INSDQualifier id="ql 10">

[1129] <INSDQualifier_name>note< / INSDQualifier_name>

[1130] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1131] < / INSDQualifier>

[1132] < / IN SDF eature_quals>

[1133] < / INSDFeature>

[1134] eature key > V ARI ANT < / IN SDF eature key > eature_location>9< / IN SDF eature_location> eature_quals> INSDQualifier id="ql 11 ">

[1135] <INSDQualifier _name>note< / INSDQualifier _name>

[1136] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1137] < / INSDQualifier>

[1138] < / IN SDF eature_quals>

[1139] < / INSDFeature>

[1140] <INSDFeature>

[1141] <IN SDF eature_key>source< / IN SDF eature_key>

[1142] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[1143] <IN SDF eature_quals>

[1144] <INSDQualifier>

[1145] <INSDQualifier _name>mol_type< / INSDQualifier _name>

[1146] <INSDQualifier_value>protein< / INSDQualifier_value>

[1147] < / INSDQualifier>

[1148] <INSDQualifier id="q362">

[1149] <INSDQualifier _name>organism< / INSDQualifier _name>

[1150] <INSDQualifier_value>synthetic construct< / IN SDQualifier_value>

[1151] < / INSDQualifier>

[1152] < / IN SDF eature_quals>

[1153] < / INSDFeature>

[1154] < / INSDSeq_feature-table>

[1155] <IN SD Seq_sequence>XQDDGXXXXH< / IN SD Seq_sequence>

[1156] < / INSDSeq>

[1157] < / SequenceData>

[1158] <SequenceData sequenceIDNumber=" 17">

[1159] <INSDSeq>

[1160] <IN SD S eq_l ength> 10< / 1 N SD S eq_l ength>

[1161] <IN SD Seq_moltype> A A

[1162] <IN SD S eq di vi si on>P AT < / 1 N SD S eq di vi si on>

[1163] <INSDSeq_feature-table>

[1164] <INSDFeature>

[1165] REGION

[1166] <INSDFeature_location>l .. 10< / INSDFeature_location>

[1167]

[1168] <INSDQualifier id="ql 13 ">

[1169] <INSDQualifier_name>note< / INSDQualifier_name>

[1170] <INSDQualifier_value>Peptyd rozk adaj cy kryszta y pirofosforanu wapnia< / INSDQualifier_value>

[1171] < / INSDQualifier>

[1172] < / IN SDF eature_quals>

[1173] < / INSDFeature>

[1174] <INSDFeature>

[1175] V ARI ANT < / IN SDF eature key >

[1176] <IN SDF eature_location> 1 < / IN SDF eature_location>

[1177] <IN SDF eature_quals>

[1178] <INSDQualifier id="ql 14">

[1179] <IN SDQualifier_name>note< / IN SDQualifier_name>

[1180] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1181] < / INSDQualifier>

[1182] < / IN SDF eature_quals>

[1183] < / INSDFeature>

[1184] <INSDFeature>

[1185] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1186] <IN SDF eature_location>6< / IN SDF eature_location>

[1187] <IN SDF eature_quals>

[1188] <INSDQualifier id="ql 15">

[1189] <INSDQualifier_name>note< / INSDQualifier_name>

[1190] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1191] < / INSDQualifier>

[1192] < / IN SDF eature_quals>

[1193] < / INSDFeature>

[1194] <INSDFeature>

[1195] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1196] <IN SDF eature_location>7< / IN SDF eature_location>

[1197] <IN SDF eature_quals>

[1198] <INSDQualifier id="ql 16">

[1199] <INSDQualifier_name>note< / INSDQualifier_name>

[1200] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1201] < / INSDQualifier>

[1202] < / IN SDF eature_quals>

[1203] < / INSDFeature>

[1204] <INSDFeature>

[1205] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1206] <IN SDF eature_location>8< / IN SDF eature_location>

[1207] <IN SDF eature_quals>

[1208] <INSDQualifier id="ql 17">

[1209] <INSDQualifier_name>note< / INSDQualifier_name>

[1210] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1211] < / INSDQualifier>

[1212] < / IN SDF eature_quals>

[1213] < / INSDFeature>

[1214] <INSDFeature>

[1215] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1216] <IN SDF eature_location>9< / IN SDF eature_location>

[1217] <IN SDF eature_quals>

[1218] <INSDQualifier id="ql 18">

[1219] <INSDQualifier_name>note< / INSDQualifier_name>

[1220] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1221] < / INSDQualifier>

[1222] < / IN SDF eature_quals>

[1223] < / INSDFeature>

[1224] <INSDFeature>

[1225] <IN SDF eature_key>source< / IN SDF eature_key>

[1226] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[1227] <IN SDF eature_quals>

[1228] <INSDQualifier>

[1229] <INSDQualifier _name>mol_type< / INSDQualifier _name>

[1230] <INSDQualifier_value>protein< / INSDQualifier_value>

[1231] < / INSDQualifier>

[1232] <INSDQualifier id="q363">

[1233] <INSDQualifier _name>organism< / INSDQualifier _name>

[1234] <INSDQualifier_value>synthetic construct< / IN SDQualifier_value>

[1235] < / INSDQualifier>

[1236] < / IN SDF eature_quals>

[1237] < / INSDFeature>

[1238] < / INSDSeq_feature-table>

[1239] <IN SD Seq_sequence>XQDDGXXXXK< / IN SD Seq_sequence>

[1240] < / INSDSeq>

[1241] < / SequenceData>

[1242] <SequenceData sequenceIDNumber=" 18">

[1243] <INSDSeq>

[1244] <IN SD S eq_l ength> 10< / IN SD S eq_l ength>

[1245] <IN SD Seq_moltype> AA< / IN SD Seq_moltype>

[1246] <IN SD S eq di vi si on>P AT < / IN SD S eq di vi si on>

[1247] <INSDSeq_feature-table>

[1248] <INSDFeature>

[1249] REGION

[1250] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[1251] <IN SDF eature_quals>

[1252] <INSDQualifier id="ql20">

[1253] <INSDQualifier_name>note< / INSDQualifier_name>

[1254] <INSDQualifier_value>Peptyd rozk adaj cy kryszta y pirofosforanu wapnia< / INSDQualifier_value>

[1255] < / INSDQualifier>

[1256] < / IN SDF eature_quals>

[1257] < / INSDFeature>

[1258] <INSDFeature>

[1259] V ARI ANT < / IN SDF eature key >

[1260] <IN SDF eature_location> 1 < / IN SDFeature_location>

[1261] <IN SDF eature_quals>

[1262] <INSDQualifier id="ql21">

[1263] <INSDQualifier _name>note< / INSDQualifier _name>

[1264] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1265] < / INSDQualifier>

[1266] < / IN SDF eature qual s>

[1267] < / INSDFeature>

[1268] <INSDFeature>

[1269] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1270] <IN SDF eature_location>6< / IN SDF eature_location>

[1271] <IN SDF eature_quals>

[1272] <INSDQualifier id="ql22">

[1273] <INSDQualifier_name>note< / INSDQualifier_name>

[1274] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1275] < / INSDQualifier>

[1276] < / IN SDF eature_quals>

[1277] < / INSDFeature>

[1278] <INSDFeature>

[1279] <IN SDF eatur e key > V ARI ANT < / IN SDF eatur e key >

[1280] <IN SDF eature_location>7< / IN SDF eature_location>

[1281] <IN SDF eatur e_quals>

[1282] <INSDQualifier id="ql23">

[1283] <INSDQualifier_name>note< / INSDQualifier_name>

[1284] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1285] < / INSDQualifier>

[1286] < / IN SDF eature_quals>

[1287] < / INSDF eatur e>

[1288] <INSDFeature>

[1289] <IN SDF eature key > V ARI ANT < / IN SDF eatur e key >

[1290] <IN SDF eature_location>8< / IN SDF eature_location>

[1291] <IN SDF eatur e_quals>

[1292] <INSDQualifier id="q!24">

[1293] <INSDQualifier_name>note< / INSDQualifier_name>

[1294] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1295] < / INSDQualifier>

[1296] < / IN SDF eature_quals>

[1297] < / INSDF eatur e>

[1298] <INSDFeature>

[1299] <IN SDF eature key > V ARI ANT < / IN SDF eatur e key >

[1300] <IN SDF eature_location>9< / IN SDFeature_location>

[1301] <IN SDF eatur e_quals>

[1302] <INSDQualifier id="ql25">

[1303] <INSDQualifier_name>note< / INSDQualifier_name>

[1304] <INSDQualifier_value>X oznacza dowolny aminokwas< / IN SDQualifi er_value>

[1305] < / INSDQualifier>

[1306] < / IN SDF eature qual s>

[1307] construct< / IN SDQualifier_value>

[1308] < / INSDQualifier>

[1309] < / IN SDF eature_quals>

[1310] < / INSDF eature>

[1311] < / INSDSeq_feature-table>

[1312] <IN SD S eq seq uen ce>X Q EE AX XX X R< / 1 N SD S eq_sequence>

[1313] <INSDQualifier_value>Peptyd rozk adaj cy kryszta y pirofosforanu wapnia< / INSDQualifier_value>

[1314] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location> 1 < / IN SDF eature_location> F eature_quals>

[1315] <INSDQualifier id="ql28">

[1316] <IN SDQualifi er_name>note< / IN SDQualifi er_name>

[1317] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1318] < / INSDQualifier>

[1319] < / IN SDF eature_quals>

[1320] < / INSDFeature>

[1321] <INSDFeature>

[1322] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1323] <IN SDF eature_location>6< / IN SDFeature_location>

[1324] <IN SDF eature_quals>

[1325] <INSDQualifier id="ql29">

[1326] <INSDQualifier_name>note< / INSDQualifier_name>

[1327] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1328] < / INSDQualifier>

[1329] < / IN SDF eature qual s>

[1330] < / INSDFeature>

[1331] <INSDFeature>

[1332] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1333] <INSDQualifier_name>note< / INSDQualifier_name>

[1334] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1335] < / INSDQualifier>

[1336] < / IN SDF eature_quals>

[1337] < / INSDFeature>

[1338] <INSDFeature>

[1339] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1340] <IN SDF eature locati on>8< / IN SDFeature_location>

[1341] <IN SDF eature_quals>

[1342] <INSDQualifier id="ql31">

[1343] <INSDQualifier _name>note< / INSDQualifier _name>

[1344] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1345] < / INSDQualifier>

[1346] < / IN SDF eature qual s>

[1347] < / INSDFeature>

[1348] <INSDFeature>

[1349] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1350] <IN SDF eature_location>9< / IN SDF eature_location>

[1351] <IN SDF eature_quals>

[1352] <INSDQualifier id="ql32">

[1353] <INSDQualifier_name>note< / INSDQualifier_name>

[1354] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1355] < / INSDQualifier>

[1356] < / IN SDF eature_quals>

[1357] < / INSDFeature>

[1358] <INSDFeature>

[1359] <IN SDF eature_key>source< / IN SDF eature_key>

[1360] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[1361] <IN SDF eature_quals>

[1362] <INSDQualifier>

[1363] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1364] <INSDQualifier_value>protein< / INSDQualifier_value>

[1365] < / INSDQualifier>

[1366] <INSDQualifier id="q365">

[1367] <INSDQualifier_name>organism< / INSDQualifier_name>

[1368] <INSDQualifier_value>synthetic construct< / IN SDQualifier_value>

[1369] < / INSDQualifier>

[1370] < / IN SDF eature_quals>

[1371] < / INSDFeature>

[1372] < / INSDSeq_feature-table>

[1373] <IN SD S eq seq uen ce>X Q EEGX XX X H< / 1 N SD S eq_sequence>

[1374] <INSDFeature>

[1375] <IN SDF eatur e key > V ARI ANT < / IN SDF eatur e key >

[1376] <IN SDF eature_location> 1 < / IN SDF eature_location>

[1377] <IN SDF eatur e_quals>

[1378] <INSDQualifier id="ql35">

[1379] <INSDQualifier_name>note< / INSDQualifier_name>

[1380] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1381] < / INSDQualifier>

[1382] < / IN SDF eature_quals>

[1383] < / INSDF eatur e>

[1384] <INSDFeature>

[1385] <IN SDF eature key > V ARI ANT < / IN SDF eatur e key >

[1386] <IN SDF eature ure_location>

[1387] <IN SDF eatur e

[1388] <INSD note< / INSDQualifier_name> X oznacza dowolny aminokwas< / INSDQualifier_value>

[1389] < / INSDQualifier>

[1390] < / IN SDF eature_quals>

[1391] < / INSDF eatur e>

[1392] <INSDFeature>

[1393] <IN SDF eature key > V ARI ANT < / IN SDF eatur e key >

[1394] <IN SDF eature_location>7< / IN SDF eature_location>

[1395] <IN SDF eatur e_quals>

[1396] <INSDQualifier id="ql37">

[1397] <INSDQualifier_name>note< / INSDQualifier_name>

[1398] <INSDQualifier_value>X oznacza dowolny aminokwas< / IN SDQualifi er_value>

[1399] < / INSDQualifier>

[1400] < / IN SDF eature_quals>

[1401] e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>8< / IN SDF eature_location> F eature_quals>

[1402] <INSDQualifier id="ql38">

[1403] <INSDQualifier _name>note< / INSDQualifier _name>

[1404] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1405] < / INSDQualifi er>

[1406] < / IN SDF eature_quals>

[1407] < / INSDFeature>

[1408] <INSDFeature>

[1409] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1410] <IN SDF eature_location>9< / IN SDF eature_location>

[1411] <IN SDF eature_quals>

[1412] <INSDQualifier id="ql39">

[1413] <INSDQualifier_name>note< / INSDQualifier_name>

[1414] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1415] < / INSDQualifier>

[1416] < / IN SDF eature_quals>

[1417] < / INSDFeature>

[1418] <INSDFeature>

[1419] <IN SDF eature_key>source< / IN SDF eature_key>

[1420] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[1421] <IN SDF eature_quals>

[1422] <INSDQualifier>

[1423] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1424] <INSDQualifier_value>protein< / INSDQualifier_value>

[1425] < / INSDQualifier>

[1426] <INSDQualifier id="q366">

[1427] <INSDQualifier_name>organism< / INSDQualifier_name>

[1428] <INSDQualifier_value>synthetic construct< / IN SDQualifi er_value>

[1429] < / INSDQualifier>

[1430] < / IN SDF eature_quals>

[1431] < / INSDFeature>

[1432] < / INSDSeq_feature-table>

[1433] <IN SD S eq seq uen ce>X Q EEGX XX X K

[1434] < / INSDSeq>

[1435] < / SequenceData>

[1436] <SequenceData sequenceIDNumber="21 ">

[1437] <INSDSeq>

[1438] <IN SD S eq_l ength> 10< / 1 N SD S eq_l ength>

[1439] <INSD Seq_moltype> AA< / INSD Seq_moltype>

[1440] <IN SD S eq di vi si on>P AT < / 1 N SD S eq di vi si on>

[1441] <IN SD S eq feature-tabl e>

[1442] <INSDFeature>

[1443] REGION

[1444] <IN SDF eature_location> E .10

[1445]

[1446] <INSDQualifier id="ql41">

[1447] <INSDQualifier _narne>note< / IN SDQualifi er _name>

[1448] <INSDQualifier_value>Peptyd rozk adaj cy kryszta y pirofosforanu wapnia< / INSDQualifier_value>

[1449] < / INSDQualifier>

[1450] < / IN SDF eature_quals>

[1451] < / INSDFeature>

[1452] <INSDFeature>

[1453] V ARI ANT < / IN SDF eature key >

[1454] <IN SDF eature_location> 1 < / IN SDF eature_location>

[1455] <IN SDF eature_quals>

[1456] <INSDQualifier id="q!42">

[1457] <INSDQualifier _name>note< / INSDQualifier _name>

[1458] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1459] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>6< / IN SDF eature_location> F eature_quals>

[1460] <INSDQualifier id="ql43">

[1461] <INSDQualifier _name>note< / INSDQualifier _name>

[1462] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1463] < / INSDQualifier>

[1464] < / IN SDF eature_quals>

[1465] < / INSDFeature>

[1466] <INSDFeature>

[1467] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1468] <IN SDF eature_location>7< / IN SDF eature_location>

[1469] <IN SDF eature_quals>

[1470] <INSDQualifier id="ql44">

[1471] <INSDQualifier_name>note< / INSDQualifier_name>

[1472] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1473] < / INSDQualifier>

[1474] < / IN SDF eature_quals>

[1475] < / INSDFeature>

[1476] <INSDFeature>

[1477] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1478] <IN SDF eature_location>8< / IN SDF eature_location>

[1479] <IN SDF eature_quals>

[1480] <INSDQualifier id="ql45">

[1481] <INSDQualifier _name>note< / INSDQualifier _name>

[1482] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1483] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>9< / IN SDF eature_location> F eature_quals>

[1484] <INSDQualifier id="ql46">

[1485] <INSDQualifier _name>note< / INSDQualifier _name>

[1486] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1487] <IN SDF eature qual s>

[1488] <INSDQualifier>

[1489] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1490] <INSDQualifier_value>protein< / INSDQualifier_value>

[1491] < / INSDQualifier>

[1492] <INSDQualifier id="q367">

[1493] <INSDQualifier_name>organism< / INSDQualifier_name>

[1494] <IN SDQualifi er_value>synthetic construct< / IN SDQualifier_value>

[1495] < / INSDQualifier>

[1496] < / IN SDF eature_quals>

[1497] < / INSDFeature>

[1498] < / INSDSeq_feature-table>

[1499] <IN SD Seq_sequence>XQED AXXXXH< / IN SD Seq_sequence>

[1500] < / INSDSeq>

[1501] < / SequenceData>

[1502] < S equenceData sequencelDNumb er= " 22 " >

[1503] <INSDQualifier_value>Peptyd rozk adaj cy kryszta y pirofosforanu wapnia< / INSDQualifier_value>

[1504] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location> 1 < / IN SDF eature_location> F eature_quals>

[1505] <INSDQualifier id="ql49">

[1506] <INSDQualifier _name>note< / INSDQualifier _name>

[1507] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1508] < / INSDQualifier>

[1509] < / IN SDF eature_quals>

[1510] e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>6< / IN SDF eature_location> F eature_quals>

[1511] <INSDQualifier id="ql50">

[1512] <INSDQualifier _name>note< / INSDQualifier _name>

[1513] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1514] < / INSDQualifier>

[1515] < / IN SDF eature_quals>

[1516] < / INSDFeature>

[1517] <INSDFeature>

[1518] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1519] <IN SDF eature_location>7< / IN SDF eature_location>

[1520] <IN SDF eature_quals>

[1521] <INSDQualifier id="ql 51 ">

[1522] <INSDQualifier_name>note< / INSDQualifier_name>

[1523] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1524] < / INSDQualifier>

[1525] < / IN SDF eature_quals>

[1526] < / INSDFeature>

[1527] <INSDFeature>

[1528] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1529] <IN SDF eature_location>8< / IN SDF eature_location>

[1530] <IN SDF eature_quals>

[1531] <INSDQualifier id="ql52">

[1532] <INSDQualifier_name>note< / INSDQualifier_name>

[1533] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1534] < / INSDQualifier>

[1535] F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>9< / IN SDF eature_location> F eature_quals>

[1536] <INSDQualifier id="ql53">

[1537] <INSDQualifier _name>note< / INSDQualifier _name>

[1538] <INSDQualifier_value>X oznacza dowolny aminokwas< / IN SDQualifi er_value>

[1539] < / INSDQualifier>

[1540] < / IN SDF eature_quals>

[1541] < / INSDFeature>

[1542] <INSDFeature>

[1543] <IN SDF eature_key>source< / IN SDF eature_key>

[1544] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[1545] <IN SDF eature_quals>

[1546] <INSDQualifier>

[1547] <INSDQualifier _name>mol_type< / INSDQualifier _name>

[1548] <INSDQualifier_value>protein< / INSDQualifier_value>

[1549] < / INSDQualifier>

[1550] <INSDQualifier id="q368">

[1551] <INSDQualifier _name>organism< / INSDQualifier _name>

[1552] <INSDQualifier_value>synthetic construct< / IN SDQualifier_value>

[1553] < / INSDQualifier>

[1554] < / IN SDF eature_quals>

[1555] < / INSDFeature>

[1556] < / INSDSeq_feature-table>

[1557] <IN SD Seq_sequence>XQED AXXXXK< / IN SD Seq_sequence>

[1558] < / INSDSeq>

[1559] < / SequenceData>

[1560] <SequenceData sequenceIDNumber="23 ">

[1561] <INSDSeq>

[1562] <IN SD S eq_l ength> 10< / 1 N SD S eq_l ength>

[1563] <IN SD Seq_moltype> A A

[1564] <IN SD S eq di vi si on>P AT < / 1 N SD S eq di vi si on>

[1565] <INSDSeq_feature-table>

[1566] <INSDFeature>

[1567] REGION

[1568] <IN SDF eature_location> 1..10

[1569]

[1570] <INSDQualifier id="ql55">

[1571] <INSDQualifier_name>note< / INSDQualifier_name>

[1572] <INSDQualifier_value>Peptyd rozk adaj cy kryszta y pirofosforanu wapnia< / INSDQualifier_value>

[1573] < / INSDQualifier>

[1574] < / IN SDF eature_quals>

[1575] < / INSDFeature>

[1576] <INSDFeature>

[1577] V ARI ANT < / IN SDF eature key >

[1578] <IN SDF eature_location> 1 < / IN SDF eature_location>

[1579] <IN SDF eature_quals>

[1580] <INSDQualifier id="ql56">

[1581] <INSDQualifier _name>note< / INSDQualifier _name>

[1582] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1583] < / INSDQualifier>

[1584] < / IN SDF eature_quals>

[1585] < / INSDFeature>

[1586] <INSDFeature>

[1587] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1588] <IN SDF eature_location>6< / IN SDF eature_location>

[1589] <IN SDF eature_quals>

[1590] <INSDQualifier id="ql57">

[1591] <INSDQualifier_name>note< / INSDQualifier_name>

[1592] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1593] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>7< / IN SDF eature_location> F eature_quals>

[1594] <INSDQualifier id="ql58">

[1595] <INSDQualifier _name>note< / INSDQualifier _name>

[1596] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1597] < / INSDQualifier>

[1598] < / IN SDF eature_quals>

[1599] < / INSDFeature>

[1600] <INSDFeature>

[1601] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1602] <IN SDF eature_location>8< / IN SDF eature_location>

[1603] <IN SDF eature_quals>

[1604] <INSDQualifier id="ql59">

[1605] <INSDQualifier_name>note< / INSDQualifier_name>

[1606] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1607] < / INSDQualifier>

[1608] < / IN SDF eature_quals>

[1609] < / INSDFeature>

[1610] <INSDFeature>

[1611] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1612] <IN SDF eature_location>9< / IN SDF eature_location>

[1613] <IN SDF eature_quals>

[1614] <INSDQualifier id="ql60">

[1615] < IN SDQualifier_name>note< / IN SDQualifier_name>

[1616] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1617] < / INSDQualifier>

[1618] < / IN SDF eature_quals>

[1619] < / INSDFeature>

[1620] <INSDFeature>

[1621] <IN SDF eature_key>source< / IN SDF eature_key>

[1622] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[1623] <IN SDF eature_quals>

[1624] <INSDQualifier>

[1625] <INSDQualifier _name>mol_type< / INSDQualifier _name>

[1626] <INSDQualifier_value>protein< / INSDQualifier_value>

[1627] < / INSDQualifier>

[1628] <INSDQualifier id="q369">

[1629] <INSDQualifier _name>organism< / INSDQualifier _name>

[1630] <INSDQualifier_value>synthetic construct< / IN SDQualifier_value>

[1631] < / INSDQualifier>

[1632] < / IN SDF eature_quals>

[1633] < / INSDFeature>

[1634] < / INSDSeq_feature-table>

[1635] <IN SD S eq_sequence>XNDEGXXXXR< / IN SD S eq_sequence>

[1636] < / INSDSeq>

[1637] < / SequenceData>

[1638] < S equenceData sequencelDNumb er= " 24 " >

[1639] <INSDSeq>

[1640] <IN SD S eq_l ength> 10< / IN SD S eq_l ength>

[1641] <IN SD Seq_moltype> AA< / IN SD Seq_moltype>

[1642] <IN SD S eq di vi si on>P AT < / IN SD S eq di vi si on>

[1643] <INSDSeq_feature-table>

[1644] <INSDFeature>

[1645] REGION

[1646] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[1647] <IN SDF eature_quals>

[1648] <INSDQualifier id="ql62">

[1649] <INSDQualifier_name>note< / INSDQualifier_name>

[1650] <INSDQualifier_value>Peptyd rozk adaj cy kryszta y pirofosforanu wapnia< / INSDQualifier_value>

[1651] < / INSDQualifier>

[1652] < / IN SDF eature_quals>

[1653] < / INSDFeature>

[1654] <INSDFeature>

[1655] V ARI ANT < / IN SDF eature key >

[1656] <IN SDF eature_location> 1 < / IN SDF eature_location>

[1657] <IN SDF eature qual s>

[1658] <INSDQualifier id="ql63">

[1659] <INSDQualifier _name>note< / INSDQualifier _name>

[1660] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1661] < / INSDQualifier>

[1662] < / IN SDF eature_quals>

[1663] < / INSDFeature>

[1664] <INSDFeature>

[1665] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1666] <IN SDF eature_location>6< / IN SDF eature_location>

[1667] <IN SDF eature_quals>

[1668] <INSDQualifier id="ql64">

[1669] <INSDQualifier_name>note< / INSDQualifier_name>

[1670] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1671] < / INSDQualifier>

[1672] F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>7< / IN SDF eature_location> F eature_quals>

[1673] <INSDQualifier id="ql65">

[1674] <INSDQualifier _name>note< / INSDQualifier _name>

[1675] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1676] < / INSDQualifier>

[1677] < / IN SDF eature_quals>

[1678] < / INSDFeature>

[1679] <INSDFeature>

[1680] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1681] <IN SDF eature_location>8< / IN SDF eature_location>

[1682] <IN SDF eature_quals>

[1683] <INSDQualifier id="ql66">

[1684] <INSDQualifier_name>note< / INSDQualifier_name>

[1685] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1686] < / INSDQualifier>

[1687] < / IN SDF eature_quals>

[1688] < / INSDFeature>

[1689] <INSDFeature>

[1690] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1691] <IN SDF eature_location>9< / IN SDF eature_location>

[1692] <IN SDF eature_quals>

[1693] <INSDQualifier id="ql67">

[1694] <INSDQualifier_name>note< / INSDQualifier_name>

[1695] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1696] construct< / IN SDQualifier_value>

[1697] < / INSDQualifier>

[1698] < / IN SDF eature_quals>

[1699] < / INSDFeature>

[1700] < / INSDSeq_feature-table>

[1701] <IN SD S eq seq uen ce>X N D D AX X X X R< / 1 N SD S eq_sequence>

[1702] < / INSDSeq>

[1703] < / SequenceData>

[1704] < S equenceData sequencelDNumb er= " 25 " >

[1705] <INSDQualifier id="ql69">

[1706] <INSDQualifier_name>note< / INSDQualifier_name>

[1707] <INSDQualifier_value>Peptyd rozk adaj cy kryszta y pirofosforanu wapnia< / INSDQualifier_value>

[1708] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location> 1 < / IN SDF eature_location> F eature_quals>

[1709] <INSDQualifier id="ql70">

[1710] <INSDQualifier _name>note< / INSDQualifier _name>

[1711] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1712] < / INSDQualifier>

[1713] < / IN SDF eature_quals>

[1714] < / INSDFeature>

[1715] <INSDFeature>

[1716] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1717] <IN SDF eature_location>6< / IN SDF eature_location>

[1718] <IN SDF eature_quals>

[1719] <INSDQualifier id="ql71">

[1720] <INSDQualifier_name>note< / INSDQualifier_name>

[1721] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1722] < / INSDQualifier>

[1723] < / IN SDF eature_quals>

[1724] < / INSDFeature>

[1725] <INSDFeature>

[1726] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1727] <IN SDF eature_location>7< / IN SDFeature_location>

[1728] <IN SDF eatur e_quals>

[1729] <INSDQualifier id="ql72">

[1730] <INSDQualifier_name>note< / INSDQualifier_name>

[1731] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1732] < / INSDQualifier>

[1733] < / IN SDF eature_quals>

[1734] < / INSDFeature>

[1735] <INSDFeature>

[1736] <IN SDF eatur e key > V ARI ANT < / IN SDF eatur e key >

[1737] <IN SDF eature_location>8< / IN SDF eature_location>

[1738] <IN SDF eatur e_quals>

[1739] <INSDQualifier id="ql73">

[1740] <INSDQualifier_name>note< / INSDQualifier_name>

[1741] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1742] < / INSDQualifier>

[1743] < / IN SDF eature_quals>

[1744] < / INSDF eatur e>

[1745] <INSDFeature>

[1746] <IN SDF eature key > V ARI ANT < / IN SDF eatur e key >

[1747] <IN SDF eature_location>9< / IN SDF eature_location>

[1748] <IN SDF eatur e_quals>

[1749] <INSDQualifier id="ql74">

[1750] <INSDQualifier_name>note< / INSDQualifier_name>

[1751] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1752] < / INSDQualifier>

[1753] < / IN SDF eature_quals>

[1754] < / INSDF eatur e>

[1755] <INSDFeature>

[1756] <IN SDF eature_key>source< / IN SDF eature_key>

[1757]

[1758] F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location> 1 < / IN SDF eature_location> F eature_quals>

[1759] <INSDQualifier id="ql77">

[1760] <INSDQualifier _name>note< / INSDQualifier _name>

[1761] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1762] < / INSDQualifier>

[1763] < / IN SDF eature_quals>

[1764] < / INSDFeature>

[1765] <INSDFeature>

[1766] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1767] <IN SDF eature_location>6< / IN SDFeature_location>

[1768] <IN SDF eature_quals>

[1769] <INSDQualifier id="ql78">

[1770] <INSDQualifier_name>note< / INSDQualifier_name>

[1771] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1772] < / INSDQualifier>

[1773] < / IN SDF eature qual s>

[1774] < / INSDFeature>

[1775] <INSDFeature>

[1776] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1777] <IN SDF eature_location>7< / IN SDF eature_location>

[1778] <IN SDF eature_quals>

[1779] <INSDQualifier id="ql79">

[1780] <INSDQualifier_name>note< / INSDQualifier_name>

[1781] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1782] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature locati on>8< / IN SDFeature_location> F eature_quals>

[1783] <INSDQualifier id="ql80">

[1784] <INSDQualifier _name>note< / INSDQualifier _name>

[1785] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1786] < / INSDQualifier>

[1787] < / IN SDF eature_quals>

[1788] < / INSDFeature>

[1789] <INSDFeature>

[1790] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1791] <IN SDF eature_location>9< / IN SDF eature_location>

[1792] <IN SDF eature_quals>

[1793] <INSDQualifier id="ql 81 ">

[1794] <INSDQualifier_name>note< / INSDQualifier_name>

[1795] <INSDQualifier_value>X oznacza dowolny aminokwas< / IN SDQualifi er_value>

[1796] < / INSDQualifier>

[1797] < / IN SDF eature_quals>

[1798] < / INSDFeature>

[1799] <INSDFeature>

[1800] <IN SDF eature_key>source< / IN SDF eature_key>

[1801] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[1802] <IN SDF eature_quals>

[1803] <INSDQualifier>

[1804] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1805] <INSDQualifier_value>protein< / INSDQualifier_value>

[1806]

[1807] <IN SDF eature_quals>

[1808] <INSDQualifier>

[1809] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1810] <INSDQualifier_value>protein< / INSDQualifier_value>

[1811] < / INSDQualifier>

[1812] <INSDQualifier id="q373">

[1813] <INSDQualifier_name>organism< / INSDQualifier_name>

[1814] <INSDQualifier_value>synthetic construct< / IN SDQualifier_value>

[1815] < / INSDQualifier>

[1816] < / IN SDF eature_quals>

[1817] < / INSDFeature>

[1818] < / INSDSeq_feature-table>

[1819] <IN SDSeq_sequence>XNEEGXXXXH< / IN SD Seq_sequence>

[1820] < / INSDSeq>

[1821] < / SequenceData>

[1822] < S equenceData sequencelDNumb er= " 28 " >

[1823] e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location> 1 < / IN SDFeature_location> F eature_quals>

[1824] <INSDQualifier id="ql86">

[1825] <INSDQualifier _name>note< / INSDQualifier _name>

[1826] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1827] < / INSDQualifier>

[1828] < / IN SDF eature qual s>

[1829] < / INSDFeature>

[1830] <INSDFeature>

[1831] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1832] <IN SDF eature_location>6< / IN SDF eature_location>

[1833] <IN SDF eature_quals>

[1834] <INSDQualifier id="ql87">

[1835] <INSDQualifier_name>note< / INSDQualifier_name>

[1836] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1837] < / INSDQualifier>

[1838] < / IN SDF eature_quals>

[1839] < / INSDFeature>

[1840] <INSDFeature>

[1841] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1842] <IN SDF eature_location>7< / IN SDFeature_location>

[1843] <IN SDF eature_quals>

[1844] <INSDQualifier id="ql88">

[1845] <INSDQualifier_name>note< / INSDQualifier_name>

[1846] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1847] < / INSDQualifier>

[1848] F eature qual s> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>8< / IN SDF eature_location> F eature_quals>

[1849] <INSDQualifier id="ql89">

[1850] <INSDQualifier _name>note< / INSDQualifier _name>

[1851] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1852] < / INSDQualifier>

[1853] < / IN SDF eature_quals>

[1854] < / INSDFeature>

[1855] <INSDFeature>

[1856] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1857] <IN SDF eature_location>9< / IN SDF eature_location>

[1858] <IN SDF eature_quals>

[1859] <INSDQualifier id="ql90">

[1860] <INSDQualifier_name>note< / INSDQualifier_name>

[1861] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1862] < / INSDQualifier>

[1863] < / IN SDF eature_quals>

[1864] < / INSDFeature>

[1865] <INSDFeature>

[1866] <IN SDF eature_key>source< / IN SDF eature_key>

[1867] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[1868] <IN SDF eature_quals>

[1869] <INSDQualifier>

[1870] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1871] <INSDQualifier_value>protein< / INSDQualifier_value>

[1872] < / INSDQualifier>

[1873] <INSDQualifier id="q374">

[1874] <INSDQualifier_name>organism< / INSDQualifier_name>

[1875] <INSDQualifier_value>synthetic construct< / IN SDQualifier_value>

[1876] < / INSDQualifier>

[1877] < / IN SDF eature_quals>

[1878] < / INSDFeature>

[1879] < / INSDSeq_feature-table>

[1880] <IN SD S eq seq uen ce>X N EEGX XX X K F eature qual s> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location> 1 < / IN SDF eature_location> F eature_quals>

[1881] <INSDQualifier id="ql93">

[1882] <INSDQualifier _name>note< / INSDQualifier _name>

[1883] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1884] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>6< / IN SDF eature_location> F eature_quals>

[1885] <INSDQualifier id="ql94">

[1886] <INSDQualifier _name>note< / INSDQualifier _name>

[1887] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1888] < / INSDQualifier>

[1889] < / IN SDF eature_quals>

[1890] < / INSDFeature>

[1891] <INSDFeature>

[1892] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1893] <IN SDF eature_location>7< / IN SDF eature_location>

[1894] <IN SDF eature_quals>

[1895] <INSDQualifier id="ql95">

[1896] <INSDQualifier_name>note< / INSDQualifier_name>

[1897] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1898] < / INSDQualifier>

[1899] < / IN SDF eature_quals>

[1900] < / IN SDF eature>

[1901] <INSDFeature>

[1902] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1903] <IN SDF eature_location>8< / IN SDF eature_location>

[1904] <IN SDF eature_quals>

[1905] <INSDQualifier id="ql96">

[1906] <INSDQualifier_name>note< / INSDQualifier_name>

[1907] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1908] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>9< / IN SDF eature_location> F eature_quals>

[1909] <INSDQualifier id="ql97">

[1910] <INSDQualifier_name>note< / INSDQualifier_name>

[1911] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1912] < / INSDQualifier>

[1913] < / IN SDF eature_quals>

[1914] < / INSDFeature>

[1915] <INSDFeature>

[1916] <IN SDF eature_key>source< / IN SDF eature_key>

[1917] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[1918] <IN SDF eature_quals>

[1919] <INSDQualifier>

[1920] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1921] <INSDQualifier_value>protein< / INSDQualifier_value>

[1922] < / INSDQualifier>

[1923] <INSDQualifier id="q375">

[1924] <INSDQualifier_name>organism< / INSDQualifier_name>

[1925] <INSDQualifier_value>synthetic construct< / IN SDQualifier_value>

[1926] < / INSDQualifier>

[1927] < / IN SDF eature_quals>

[1928] < / INSDFeature>

[1929] < / INSDSeq_feature-table>

[1930] <IN SD S eq_sequence>XNED AXXXXH< / IN SD S eq_sequence>

[1931] < / INSDSeq>

[1932] < / SequenceData>

[1933] < S equenceData sequencelDNumb er= " 30 " >

[1934] <INSDSeq>

[1935] <IN SD S eq_l ength> 10< / 1 N SD S eq_l ength>

[1936] <IN SD Seq_moltype> AA< / IN SD Seq_moltype>

[1937] <IN SD S eq di vi si on>P AT

[1938] <INSDSeq_feature-table>

[1939] <INSDFeature>

[1940] REGION

[1941] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[1942] <IN SDF eature_quals>

[1943] <INSDQualifier id="ql99">

[1944] <INSDQualifier_name>note< / INSDQualifier_name>

[1945] <INSDQualifier_value>Peptyd rozk adaj cy kryszta y pirofosforanu wapnia< / INSDQualifier_value>

[1946] < / INSDQualifier>

[1947] < / IN SDF eature_quals>

[1948] < / INSDFeature>

[1949] <INSDFeature>

[1950] V ARI ANT < / IN SDF eature key >

[1951] <IN SDF eature_location> 1 < / IN SDFeature_location>

[1952] <IN SDF eature_quals>

[1953] <INSDQualifier id="q200">

[1954] <INSDQualifier _name>note< / INSDQualifier _name>

[1955] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1956] < / INSDQualifier>

[1957] F eature qual s> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>6< / IN SDF eature_location> F eature_quals>

[1958] <INSDQualifier id="q201 ">

[1959] <INSDQualifier _name>note< / INSDQualifier _name>

[1960] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1961] < / INSDQualifier>

[1962] < / IN SDF eature_quals>

[1963] < / INSDFeature>

[1964] <INSDFeature>

[1965] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1966] <IN SDF eature_location>7< / IN SDFeature_location>

[1967] <IN SDF eature_quals>

[1968] <INSDQualifier id="q202">

[1969] <INSDQualifier_name>note< / INSDQualifier_name>

[1970] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1971] < / INSDQualifier>

[1972] < / IN SDF eature_quals>

[1973] < / INSDFeature>

[1974] <INSDFeature>

[1975] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[1976] <IN SDF eature_location>8< / IN SDF eature_location>

[1977] <IN SDF eature_quals>

[1978] <INSDQualifier id="q203">

[1979] <INSDQualifier_name>note< / INSDQualifier_name>

[1980] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1981] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>9< / IN SDF eature_location> F eature_quals>

[1982] <INSDQualifier id="q204">

[1983] <INSDQualifier _name>note< / INSDQualifier _name>

[1984] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[1985] < / INSDQualifier>

[1986] < / IN SDF eature_quals>

[1987] < / INSDFeature>

[1988] <INSDFeature>

[1989] <IN SDF eature_key>source< / IN SDF eature_key>

[1990] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[1991] <IN SDF eature_quals>

[1992] <INSDQualifier>

[1993] <INSDQualifier _name>mol_type< / INSDQualifier _name>

[1994] <INSDQualifier_value>protein< / INSDQualifier_value>

[1995] < / INSDQualifier>

[1996] <INSDQualifier id="q376">

[1997] <INSDQualifier _name>organism< / INSDQualifier _name>

[1998] <INSDQualifier_value>synthetic construct< / IN SDQualifier_value>

[1999] < / INSDQualifier>

[2000] < / IN SDF eature_quals>

[2001] < / INSDFeature>

[2002] < / INSDSeq_feature-table>

[2003] <IN SD Seq_sequence>XNED AXXXXK< / IN SD Seq_sequence>

[2004] < / INSDSeq>

[2005] < / SequenceData>

[2006] <SequenceData sequenceIDNumber="31 ">

[2007] <INSDSeq>

[2008] <IN SD S eq_l ength> 10< / 1 N SD S eq_l ength>

[2009] <IN SD Seq_moltype> A A

[2010] <IN SD S eq di vi si on>P AT < / 1 N SD S eq di vi si on>

[2011] <INSDSeq_feature-table>

[2012] <INSDFeature>

[2013] REGION

[2014] <IN SDF eature_location> 1..10

[2015]

[2016] <INSDQualifier id="q206">

[2017] <INSDQualifier_name>note< / INSDQualifier_name>

[2018] <INSDQualifier_value>Peptyd rozk adaj cy kryszta y pirofosforanu wapnia< / INSDQualifier_value>

[2019] < / INSDQualifier>

[2020] < / IN SDF eature_quals>

[2021] < / INSDFeature>

[2022] <INSDFeature>

[2023] V ARI ANT < / IN SDF eature key >

[2024] <IN SDF eature_location> 1 < / IN SDF eature_location>

[2025] <IN SDF eature_quals>

[2026] <INSDQualifier id="q207">

[2027] <INSDQualifier_name>note< / INSDQualifier_name>

[2028] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2029] < / INSDQualifier>

[2030] < / IN SDF eature_quals>

[2031] < / INSDFeature>

[2032] <INSDFeature>

[2033] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2034] <IN SDF eature_location>6< / IN SDF eature_location>

[2035] <IN SDF eature_quals>

[2036] <INSDQualifier id="q208">

[2037] <INSDQualifier_name>note< / INSDQualifier_name>

[2038] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2039] < / INSDQualifier>

[2040] < / IN SDF eature_quals>

[2041] < / INSDFeature>

[2042] <INSDFeature>

[2043] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2044] <IN SDF eature_location>7< / IN SDF eature_location>

[2045] <IN SDF eature_quals>

[2046] <INSDQualifier id="q209">

[2047] <INSDQualifier_name>note< / INSDQualifier_name>

[2048] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2049] < / INSDQualifier>

[2050] < / IN SDF eature_quals>

[2051] < / INSDFeature>

[2052] <INSDFeature>

[2053] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2054] <IN SDF eature_location>8< / IN SDF eature_location>

[2055] <IN SDF eature_quals>

[2056] <INSDQualifier id="q210">

[2057] <INSDQualifier_name>note< / INSDQualifier_name>

[2058] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2059] < / INSDQualifier>

[2060] < / IN SDF eature_quals>

[2061] < / INSDFeature>

[2062] <INSDFeature>

[2063] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2064] <IN SDF eature locati on>9< / IN SDF eature_location>

[2065] <IN SDF eature_quals>

[2066] <INSDQualifier id="q211">

[2067] <INSDQualifier_name>note< / INSDQualifier_name>

[2068] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value> construct< / IN SDQualifier_value>

[2069] < / INSDQualifier>

[2070] < / IN SDF eature_quals>

[2071] < / INSDFeature>

[2072] < / INSDSeq_feature-table>

[2073] <IN SD S eq seq uen ce>X N EE AX XX X R< / 1 N SD S eq_sequence>

[2074] < / INSDSeq>

[2075] < / SequenceData>

[2076] < S equenceData sequencelDNumb er= " 32 " >

[2077] <INSDSeq>

[2078] <IN SD S eq_l ength> 10< / 1 N SD S eq_l ength>

[2079] <IN SD Seq_moltype> AA< / IN SD Seq_moltype>

[2080] <IN SD S eq divi sion>P AT < / IN SD S eq divi sion>

[2081] <INSDSeq_feature-table>

[2082] <INSDFeature>

[2083] REGION

[2084] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[2085] <IN SDF eature_quals>

[2086] <INSDQualifier id="q213">

[2087] <INSDQualifier_name>note< / INSDQualifier_name>

[2088] <INSDQualifier_value>Peptyd rozk adaj cy kryszta y pirofosforanu wapnia< / INSDQualifier_value>

[2089] < / INSDQualifier>

[2090] < / IN SDF eature_quals>

[2091] < / INSDFeature>

[2092] <INSDFeature>

[2093] V ARI ANT < / IN SDF eature key >

[2094] <IN SDF eature l ocati on> 1 < / IN SDF eature l ocati on>

[2095] <IN SDF eature_quals>

[2096] <INSDQualifier id="q214">

[2097] <INSDQualifier _name>note< / INSDQualifier _name>

[2098] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2099] < / INSDQualifier>

[2100] < / IN SDF eature_quals>

[2101] < / INSDFeature>

[2102] <INSDFeature>

[2103] <IN SDF eature key > V ARI ANT < / IN SDF eature key > aminokwas< / INSDQualifier_value>

[2104] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>7< / INSDF eature_location> F eature_quals>

[2105] <INSDQualifier id="q216">

[2106] <INSDQualifier _name>note< / INSDQualifier _name>

[2107] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2108] < / INSDQualifier>

[2109] < / IN SDF eature_quals>

[2110] < / INSDFeature>

[2111] <INSDFeature>

[2112] <IN SDF eature_key> V ARI ANT < / IN SDF eature_key>

[2113] <IN SDF eature_location>8< / IN SDF eature_location>

[2114] <IN SDF eature_quals>

[2115] <INSDQualifier id="q217">

[2116] <INSDQualifier_name>note< / INSDQualifier_name>

[2117] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2118] < / INSDQualifier>

[2119] < / IN SDF eature_quals>

[2120] < / INSDFeature>

[2121] <INSDFeature>

[2122] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2123] <IN SDF eature_location>9< / IN SDF eature_location>

[2124] <IN SDF eature_quals>

[2125] <INSDQualifier id="q218">

[2126] <INSDQualifier_name>note< / INSDQualifier_name>

[2127] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2128] < / INSDQualifier>

[2129] < / IN SDF eature_quals>

[2130] < / INSDFeature>

[2131] <INSDFeature>

[2132] <IN SDF eature_key>source< / IN SDF eature_key>

[2133] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[2134] <IN SDF eature_quals>

[2135] <INSDQualifier>

[2136] <INSDQualifier _name>mol_type< / INSDQualifier _name>

[2137] <INSDQualifier_value>protein< / INSDQualifier_value>

[2138] < / INSDQualifier>

[2139] <INSDQualifier id="q378">

[2140] <INSDQualifier _name>organism< / INSDQualifier _name>

[2141] <INSDQualifier_value>synthetic construct< / IN SDQualifier_value>

[2142] < / INSDQualifier>

[2143] < / IN SDF eature_quals>

[2144] < / INSDFeature>

[2145] < / INSDSeq_feature-table>

[2146] <IN SD S eq_sequence>XQDE AXXXXR< / IN SD S eq_sequence>

[2147] < / INSDSeq>

[2148] < / SequenceData>

[2149] <SequenceData sequenceIDNumber="33 ">

[2150] <INSDSeq>

[2151] <IN SD S eq_l ength> 10< / IN SD S eq_l ength>

[2152] <IN SD Seq_moltype> AA< / IN SD Seq_moltype>

[2153] <IN SD S eq di vi si on>P AT < / IN SD S eq di vi si on>

[2154] <INSDSeq_feature-table>

[2155] <INSDFeature>

[2156] <IN SDF eature_key>REGION< / IN SDF eature_key>

[2157] <INSDFeature_location>l .. 10< / INSDFeature_location>

[2158] <IN SDF eature_quals>

[2159] <INSDQualifier id="q220">

[2160] <INSDQualifier_name>note< / INSDQualifier_name>

[2161] <INSDQualifier_value>Peptyd rozk adaj cy kryszta y pirofosforanu wapnia< / INSDQualifier_value>

[2162] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location> 1 < / IN SDF eature_location> F eature_quals>

[2163] <INSDQualifier id="q221 ">

[2164] <INSDQualifier_name>note< / INSDQualifier_name>

[2165] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2166] < / INSDQualifier>

[2167] < / IN SDF eature_quals>

[2168] < / INSDFeature>

[2169] <INSDFeature>

[2170] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2171] <IN SDF eature_location>6< / IN SDF eature_location>

[2172] <IN SDF eature_quals>

[2173] <INSDQualifier id="q222">

[2174] <INSDQualifier_name>note< / INSDQualifier_name>

[2175] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2176] < / INSDQualifier>

[2177] < / IN SDF eature_quals>

[2178] < / INSDFeature>

[2179] <INSDFeature>

[2180] V ARI ANT < / IN SDF eature key >

[2181] <IN SDF eature_location>7< / IN SDF eature_location>

[2182] <IN SDF eature_quals>

[2183] <INSDQualifier id="q223">

[2184] <INSDQualifier_name>note< / INSDQualifier_name>

[2185] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2186] < / INSDQualifier>

[2187] < / IN SDF eature_quals>

[2188] < / INSDFeature>

[2189] <INSDFeature>

[2190] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2191] <IN SDF eature_location>8< / IN SDF eature_location>

[2192] <IN SDF eature_quals>

[2193] <INSDQualifier id="q224">

[2194] <INSDQualifier_name>note< / INSDQualifier_name>

[2195] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2196] < / INSDQualifier>

[2197] < / IN SDF eature_quals>

[2198] < / INSDFeature>

[2199] <INSDFeature>

[2200] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2201] <IN SDF eature_location>9< / IN SDF eature_location>

[2202] <IN SDF eature_quals>

[2203] <INSDQualifier id="q225">

[2204] <INSDQualifier_name>note< / INSDQualifier_name>

[2205] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2206] < / INSDQualifier>

[2207] < / IN SDF eature_quals>

[2208] < / INSDFeature>

[2209] construct< / IN SDQualifier_value>

[2210] < / INSDQualifier>

[2211] < / IN SDF eature_quals>

[2212] < / INSDFeature>

[2213] < / IN SD S eq feature-tabl e>

[2214] <IN SD S eq_sequence>XQDD AXXXXH< / IN SD S eq_sequence>

[2215] < / INSDSeq>

[2216] < / SequenceData>

[2217] < S equenceData sequencelDNumb er= " 34 " >

[2218] <lNSDQualif'ier_value>Peptyd rozk adaj cy kryszta y pirofosforanu wapnia< / INSDQualif'ier_value>

[2219] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location> 1 < / IN SDF eature_location> F eature_quals>

[2220] <INSDQualifier id="q228">

[2221] <IN SDQualifi er _name>note< / IN SDQualifi er_name>

[2222] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2223] < / INSDQualifier>

[2224] < / IN SDF eature_quals>

[2225] < / INSDFeature>

[2226] <INSDFeature>

[2227] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2228] <IN SDF eature_location>6< / IN SDF eature_location>

[2229] <IN SDF eature_quals>

[2230] <INSDQualifier id=’’q229”>

[2231] <INSDQualifier_name>note< / INSDQualifier_name>

[2232] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2233] < / INSDQualifier>

[2234] < / IN SDF eature_quals>

[2235] < / INSDFeature>

[2236] <INSDFeature>

[2237] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2238] <IN SDF eature_location>7< / IN SDF eature_location>

[2239] <IN SDF eature_quals>

[2240] <INSDQualifier id="q230">

[2241] <INSDQualifier _name>note< / INSDQualifier _name>

[2242] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2243] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>8< / IN SDF eature_location> F eature_quals>

[2244] <INSDQualifier id="q231 ">

[2245] <INSDQualifier _name>note< / INSDQualifier _name>

[2246] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2247] < / INSDQualifier>

[2248] < / IN SDF eature_quals>

[2249] < / INSDFeature>

[2250] <INSDFeature>

[2251] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2252] <IN SDF eature_location>9< / INSDF eature_location>

[2253] <IN SDF eature_quals>

[2254] <INSDQualifier id="q232">

[2255] <INSDQualifier_name>note< / INSDQualifier_name>

[2256] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2257] < / INSDQualifier>

[2258] < / IN SDF eature_quals>

[2259] < / INSDFeature>

[2260] <INSDFeature>

[2261] <IN SDF eature_key>source< / IN SDF eature_key>

[2262] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[2263] <IN SDF eature_quals>

[2264]

[2265] <INSDFeature>

[2266] <IN SDF eatur e key > V ARI ANT < / IN SDF eatur e key >

[2267] <IN SDF eature_location> 1 < / IN SDF eature_location>

[2268] <IN SDF eatur e_quals>

[2269] <INSDQualifier id="q235">

[2270] <INSDQualifier_name>note< / INSDQualifier_name>

[2271] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2272] < / INSDQualifier>

[2273] < / IN SDF eature_quals>

[2274] < / INSDF eatur e>

[2275] <INSDFeature>

[2276] <IN SDF eature key > V ARI ANT < / IN SDF eatur e key >

[2277] <IN SDF eature_location>6< / INSDF eature_location>

[2278] <IN SDF eatur e_quals>

[2279] <INSDQualifier id="q236">

[2280] <INSDQualifier_name>note< / INSDQualifier_name>

[2281] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2282] < / INSDQualifier>

[2283] < / IN SDF eature_quals>

[2284] < / INSDF eatur e>

[2285] <INSDFeature>

[2286] <IN SDF eature key > V ARI ANT < / IN SDF eatur e key >

[2287] <IN SDF eature_location>7< / IN SDF eature_location>

[2288] <IN SDF eatur e_quals>

[2289] <INSDQualifier id="q237">

[2290] <INSDQualifier_name>note< / INSDQualifier_name>

[2291] <INSDQualifier_value>X oznacza dowolny aminokwas< / IN SDQualifi er_value>

[2292] < / INSDQualifier>

[2293] < / IN SDF eature_quals>

[2294] e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>8< / IN SDF eature_location> F eature_quals>

[2295] <INSDQualifier id="q238">

[2296] <INSDQualifier _name>note< / INSDQualifier _name>

[2297] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2298] < / INSDQualifier>

[2299] < / IN SDF eature_quals>

[2300] < / INSDFeature>

[2301] <INSDFeature>

[2302] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2303] <IN SDF eature_location>9< / IN SDF eature_location>

[2304] <IN SDF eature_quals>

[2305] <INSDQualifier id="q239">

[2306] <INSDQualifier_name>note< / INSDQualifier_name>

[2307] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2308] < / INSDQualifier>

[2309] < / INSDF eature_quals>

[2310] < / INSDFeature>

[2311] <INSDFeature>

[2312] <IN SDF eature_key>source< / IN SDF eature_key>

[2313] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[2314] <IN SDF eature_quals>

[2315] <INSDQualifier>

[2316] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[2317] <INSDQualifier_value>protein< / INSDQualifier_value>

[2318] < / INSDQualifier>

[2319] <INSDQualifier id="q381">

[2320] <INSDQualifier_name>organism< / INSDQualifier_name>

[2321] <INSDQualifier_value>synthetic construct< / IN SDQualifier_value>

[2322] < / INSDQualifier>

[2323] < / IN SDF eature_quals>

[2324] < / INSDFeature>

[2325] < / INSDSeq_feature-table>

[2326] <IN SD Seq_sequence>XQDEGXXXXH< / IN SD Seq_sequence>

[2327] < / INSDSeq>

[2328] < / SequenceData>

[2329] < S equenceData sequencelDNumb er= " 36 " >

[2330] <INSDSeq>

[2331] <IN SD S eq_l ength> 10< / 1 N SD S eq_l ength>

[2332] <IN SD Seq_moltype> AA< / IN SD Seq_moltype>

[2333] <IN SD S eq di vi si on>P AT < / 1 N SD S eq di vi si on>

[2334] <IN SD S eq feature-tabl e>

[2335] <1 N SDF eature key > V ARI ANT < / IN SDF eature key >

[2336] <IN SDF eature_location> 1 < / IN SDF eature_location>

[2337] <IN SDF eature_quals>

[2338] <INSDQualifier id="q242">

[2339] <INSDQualifier _name>note< / INSDQualifier _name>

[2340] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2341] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>6< / IN SDF eature_location> F eature_quals>

[2342] <INSDQualifier id="q243">

[2343] <INSDQualifier _name>note< / INSDQualifier _name>

[2344] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2345] < / INSDQualifier>

[2346] < / IN SDF eature_quals>

[2347] < / INSDFeature>

[2348] <INSDFeature>

[2349] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2350] <IN SDF eature_location>7< / IN SDF eature_location>

[2351] <IN SDF eature_quals>

[2352] <INSDQualifier id="q244">

[2353] <INSDQualifier_name>note< / INSDQualifier_name>

[2354] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2355] < / INSDQualifier>

[2356] < / IN SDF eature_quals>

[2357] < / INSDFeature>

[2358] <INSDFeature>

[2359] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2360] <IN SDF eature_location>8< / IN SDF eature_location>

[2361] <IN SDF eature_quals>

[2362] <INSDQualifier id="q245">

[2363] <INSDQualifier_name>note< / INSDQualifier_name>

[2364] <INSDQualif'ier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2365] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>9< / IN SDF eature_location> F eature_quals>

[2366] <INSDQualifier id="q246">

[2367] <INSDQualifier _name>note< / INSDQualifier _name>

[2368] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2369] < / INSDQualifier>

[2370] < / IN SDF eature_quals>

[2371] < / INSDFeature>

[2372] <INSDFeature>

[2373] <IN SDF eature_key>source< / IN SDF eature_key>

[2374] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[2375] <IN SDF eature_quals>

[2376] <INSDQualifier>

[2377] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[2378] <INSDQualifier_value>protein< / INSDQualifier_value>

[2379] < / INSDQualifier>

[2380] <INSDQualifier id="q382">

[2381] <INSDQualifier_name>organism< / INSDQualifier_name>

[2382] <INSDQualifier_value>synthetic construct< / IN SDQualifier_value>

[2383] < / INSDQualifier>

[2384] < / IN SDF eature_quals>

[2385] < / INSDFeature>

[2386] < / INSDSeq_feature-table>

[2387] <IN SD Seq_sequence>XQDEGXXXXK< / IN SD Seq_sequence>

[2388] < / INSDSeq>

[2389] < / SequenceData>

[2390] < S equenceData sequencelDNumb er= " 37 " >

[2391] <INSDSeq>

[2392] <IN SD S eq_l ength> 10< / 1 N SD S eq_l ength>

[2393] <IN SD Seq_moltype> A A

[2394] <IN SD S eq di vi si on>P AT < / 1 N SD S eq di vi si on>

[2395] <INSDSeq_feature-table>

[2396] <INSDFeature>

[2397] REGION

[2398] <IN SDF eature_location> 1..10< / 1 N SDF eature_location>

[2399]

[2400] <INSDQualifier id="q248">

[2401] <INSDQualifier_name>note< / INSDQualifier_name>

[2402] <INSDQualifier_value>Peptyd rozk adaj cy kryszta y pirofosforanu wapnia< / INSDQualifier_value>

[2403] < / INSDQualifier>

[2404] < / IN SDF eature_quals>

[2405] < / INSDFeature>

[2406] <INSDFeature>

[2407] V ARI ANT < / IN SDF eature key >

[2408] <IN SDF eature_location> 1 < / IN SDF eature_location>

[2409] <IN SDF eature_quals>

[2410] <INSDQualifier id="q249">

[2411] <INSDQualifier _name>note< / INSDQualifier _name>

[2412] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2413] < / INSDQualifier>

[2414] < / IN SDF eature_quals>

[2415] e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>6< / IN SDFeature_location> F eature_quals>

[2416] <INSDQualifier id="q250">

[2417] <INSDQualifier _name>note< / INSDQualifier _name>

[2418] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2419] < / INSDQualifier>

[2420] < / IN SDF eature_quals>

[2421] < / INSDFeature>

[2422] <INSDFeature>

[2423] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2424] <IN SDF eature_location>7< / IN SDF eature_location>

[2425] <IN SDF eature_quals>

[2426] <INSDQualifier id="q251 ">

[2427] <INSDQualifier_name>note< / INSDQualifier_name>

[2428] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2429] < / INSDQualifier>

[2430] < / IN SDF eature_quals>

[2431] < / INSDFeature>

[2432] <INSDFeature>

[2433] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2434] <IN SDF eature_location>8< / IN SDF eature_location>

[2435] <IN SDF eature_quals>

[2436] <INSDQualifier id="q252">

[2437] <INSDQualifier_name>note< / INSDQualifier_name>

[2438] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2439] < / INSDQualifier>

[2440] F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>9< / IN SDF eature_location> F eature_quals>

[2441] <INSDQualifier id="q253">

[2442] <INSDQualifier _name>note< / INSDQualifier _name>

[2443] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2444] < / INSDQualifier>

[2445] < / IN SDF eature_quals>

[2446] < / INSDFeature>

[2447] <INSDFeature>

[2448] <IN SDF eature_key>source< / IN SDF eature_key>

[2449] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[2450] <IN SDF eature_quals>

[2451] <INSDQualifier>

[2452] <INSDQualifier _name>mol_type< / INSDQualifier _name>

[2453] <INSDQualifier_value>protein< / INSDQualifier_value>

[2454] < / INSDQualifier>

[2455] <INSDQualifier id=”q383 ”>

[2456] <INSDQualifier _name>organism< / INSDQualifier _name>

[2457] <INSDQualifier_value>synthetic construct< / IN SDQualifier_value>

[2458] < / INSDQualifier>

[2459] < / IN SDF eature_quals>

[2460] < / INSDFeature>

[2461] < / INSDSeq_feature-table>

[2462] <IN SD Seq_sequence>XQEEAXXXXH< / IN SD S eq_sequence>

[2463] < / INSDSeq>

[2464] < / SequenceData>

[2465] < S equenceData sequencelDNumb er= " 38 " >

[2466] <INSDSeq>

[2467] <IN SD S eq_l ength> 10< / 1 N SD S eq_l ength>

[2468] <IN SD Seq_moltype> A A

[2469] <IN SD S eq di vi si on>P AT < / 1 N SD S eq di vi si on>

[2470] <INSDSeq_feature-table>

[2471] <INSDFeature>

[2472] REGION

[2473] <IN SDF eature_location> 1..10

[2474]

[2475] <INSDQualifier id="q255">

[2476] <INSDQualifier_name>note< / INSDQualifier_name>

[2477] <INSDQualifier_value>Peptyd rozk adaj cy kryszta y pirofosforanu wapnia< / INSDQualifier_value>

[2478] < / INSDQualifier>

[2479] < / IN SDF eature_quals>

[2480] < / INSDFeature>

[2481] <INSDFeature>

[2482] V ARI ANT < / IN SDF eature key >

[2483] <IN SDF eature_location> 1 < / IN SDF eature_location>

[2484] <IN SDF eature_quals>

[2485] <INSDQualifier id="q256">

[2486] <INSDQualifier _name>note< / INSDQualifier _name>

[2487] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2488] < / INSDQualifier>

[2489] < / IN SDF eature_quals>

[2490] < / INSDFeature>

[2491] <INSDFeature>

[2492] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2493] <IN SDF eature_location>6< / IN SDF eature_location>

[2494] <IN SDF eature_quals>

[2495] <INSDQualifier id="q257">

[2496] <INSDQualifier _name>note< / INSDQualifier _name>

[2497] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2498] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>7< / IN SDFeature_location> F eature_quals>

[2499] <INSDQualifier id="q258">

[2500] <INSDQualifier _name>note< / INSDQualifier _name>

[2501] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2502] < / INSDQualifier>

[2503] < / IN SDF eature qual s>

[2504] < / INSDFeature>

[2505] <INSDFeature>

[2506] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2507] <IN SDF eature_location>8< / IN SDF eature_location>

[2508] <IN SDF eature_quals>

[2509] <INSDQualifier id="q259">

[2510] <INSDQualifier_name>note< / INSDQualifier_name>

[2511] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2512] < / INSDQualifier>

[2513] < / IN SDF eature_quals>

[2514] < / IN SDF eature>

[2515] <INSDFeature>

[2516] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2517] <IN SDF eature_location>9< / IN SDF eature_location>

[2518] <IN SDF eature_quals>

[2519] <INSDQualifier id="q260">

[2520] <INSDQualifier _name>note< / INSDQualifier _name>

[2521] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value> construct< / IN SDQualifier_value>

[2522] < / INSDQualifier>

[2523] < / IN SDF eature_quals>

[2524] < / INSDFeature>

[2525] < / INSDSeq_feature-table>

[2526] <IN SD S eq_sequence>XQEE AX XX X K

[2527] < / INSDSeq>

[2528] < / SequenceData>

[2529] < S equenceData sequencelDNumb er= " 39 " >

[2530] <INSDSeq>

[2531] <IN SD S eq_l ength> 10< / 1 N SD S eq_l ength>

[2532] <IN SD Seq_moltype> AA< / IN SD Seq_moltype>

[2533] <IN SD S eq di vi si on>P AT

[2534] <INSDSeq_feature-table>

[2535] <INSDFeature>

[2536] REGION

[2537] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[2538] <IN SDF eature_quals>

[2539] <INSDQualifier id="q262">

[2540] <INSDQualifier_name>note< / INSDQualifier_name>

[2541] <INSDQualifier_value>Peptyd rozk adaj cy kryszta y pirofosforanu wapnia< / INSDQualifier_value>

[2542] < / INSDQualifier>

[2543] < / IN SDF eature_quals>

[2544] < / INSDFeature>

[2545] <INSDFeature>

[2546] V ARI ANT < / IN SDF eature key >

[2547] <IN SDF eature_location> 1 < / IN SDF eature_location>

[2548] <IN SDF eature qual s>

[2549] <INSDQualifier id="q263">

[2550] <INSDQualifier _name>note< / INSDQualifier _name>

[2551] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2552] < / INSDQualifier>

[2553] < / IN SDF eature_quals>

[2554] < / INSDFeature>

[2555] <INSDFeature>

[2556] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2557] <IN SDF eature_location>6< / IN SDF eature_location>

[2558] <IN SDF eature_quals>

[2559] <INSDQualifier id="q264">

[2560] <INSDQualifier_name>note< / INSDQualifier_name>

[2561] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2562] < / INSDQualifier>

[2563] F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>7< / IN SDF eature_location> F eature_quals>

[2564] <INSDQualifier id="q265">

[2565] <INSDQualifier _name>note< / INSDQualifier _name>

[2566] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2567] < / INSDQualifier>

[2568] < / IN SDF eature_quals>

[2569] < / INSDFeature>

[2570] <INSDFeature>

[2571] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2572] <IN SDF eature_location>8< / IN SDF eature_location>

[2573] <IN SDF eature_quals>

[2574] <INSDQualifier id="q266">

[2575] <INSDQualifier_name>note< / INSDQualifier_name>

[2576] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2577] < / INSDQualifier>

[2578] < / IN SDF eature_quals>

[2579] < / INSDFeature>

[2580] <INSDFeature>

[2581] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2582] <IN SDF eature_location>9< / IN SDF eature_location>

[2583] <IN SDF eature_quals>

[2584] <INSDQualifier id="q267">

[2585] <INSDQualifier_name>note< / INSDQualifier_name>

[2586] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2587] < / INSDQualifier>

[2588] < / IN SDF eature_quals>

[2589] < / INSDFeature>

[2590] <INSDFeature>

[2591] <IN SDF eature_key>source

[2592] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[2593] <IN SDF eature_quals>

[2594] <INSDQualifier>

[2595] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[2596] <INSDQualifier_value>protein< / INSDQualifier_value>

[2597] < / INSDQualifier>

[2598] <INSDQualifier id="q385">

[2599] <INSDQualifier_name>organism< / INSDQualifier_name>

[2600] <INSDQualifier_value>synthetic construct< / IN SDQualifier_value>

[2601] < / INSDQualifier>

[2602] < / IN SDF eature_quals>

[2603] < / INSDFeature>

[2604] < / INSDSeq_feature-table>

[2605] <IN SD S eq seq uen ce>X N DE A X X X X R

[2606] <INSDQualifier id="q269">

[2607] <INSDQualifier_name>note< / INSDQualifier_name>

[2608] <INSDQualifier_value>Peptyd rozk adaj cy kryszta y pirofosforanu wapnia< / INSDQualifier_value>

[2609] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location> 1 < / IN SDF eature_location> F eature_quals>

[2610] <INSDQualifier id="q270">

[2611] <INSDQualifier _name>note< / INSDQualifier _name>

[2612] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2613] < / INSDQualifier>

[2614] < / IN SDF eature_quals>

[2615] < / INSDFeature>

[2616] <INSDFeature>

[2617] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2618] <IN SDF eature_location>6< / IN SDF eature_location>

[2619] <IN SDF eature_quals>

[2620] <INSDQualifier id="q271">

[2621] <INSDQualifier_name>note< / INSDQualifier_name>

[2622] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2623] < / INSDQualifier>

[2624] < / IN SDF eature_quals>

[2625] < / INSDFeature>

[2626] <INSDFeature>

[2627] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2628] <IN SDF eature_location>7< / IN SDF eature_location>

[2629] <IN SDF eature_quals>

[2630] <INSDQualifier id="q272">

[2631] <INSDQualifier_name>note< / INSDQualifier_name>

[2632] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQiialifier_value>

[2633] < / INSDQualifier>

[2634] < / IN SDF eature_quals>

[2635] < / INSDFeature>

[2636] <INSDFeature>

[2637] <IN SDF eature_key> V ARI ANT < / IN SDF eature_key>

[2638] <IN SDF eature_location>8< / IN SDF eature_location>

[2639] <IN SDF eature_quals>

[2640] <INSDQualifier id="q273">

[2641] <INSDQualifier _name>note< / INSDQualifier _name>

[2642] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2643] < / INSDQualifier>

[2644] < / IN SDF eature_quals>

[2645] < / INSDFeature>

[2646] <INSDFeature>

[2647] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2648] <INSDF eature_location>9< / INSDF eature_location>

[2649] <IN SDF eature_quals>

[2650] <INSDQualifier id="q274">

[2651] <INSDQualifier_name>note< / INSDQualifier_name>

[2652] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2653] < / INSDQualifier>

[2654] < / IN SDF eature_quals>

[2655] < / INSDFeature>

[2656] <INSDFeature>

[2657] <IN SDF eature_key>source< / IN SDF eature_key>

[2658]

[2659] F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location> 1 < / IN SDF eature_location> F eature_quals>

[2660] <INSDQualifier id="q277">

[2661] <INSDQualifier _name>note< / INSDQualifier _name>

[2662] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2663] < / INSDQualifier>

[2664] < / IN SDF eature_quals>

[2665] < / INSDFeature>

[2666] <INSDFeature>

[2667] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2668] <IN SDF eature_location>6< / IN SDF eature_location>

[2669] <IN SDF eature_quals>

[2670] <INSDQualifier id="q278">

[2671] <INSDQualifier_name>note< / INSDQualifier_name>

[2672] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2673] < / INSDQualifier>

[2674] < / IN SDF eature_quals>

[2675] < / INSDFeature>

[2676] <INSDFeature>

[2677] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2678] <IN SDF eature_location>7< / IN SDF eature_location>

[2679] <IN SDF eature_quals>

[2680] <INSDQualifier id="q279">

[2681] <INSDQualifier_name>note< / INSDQualifier_name>

[2682] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2683] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>8< / IN SDF eature_location> F eature_quals>

[2684] <INSDQualifier id="q280">

[2685] <INSDQualifier _name>note< / INSDQualifier _name>

[2686] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2687] < / INSDQualifier>

[2688] < / IN SDF eature_quals>

[2689] < / INSDFeature>

[2690] <INSDFeature>

[2691] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2692] <IN SDF eature_location>9< / IN SDF eature_location>

[2693] <IN SDF eature_quals>

[2694] <INSDQualifier id="q281 ">

[2695] <INSDQualifier_name>note< / INSDQualifier_name>

[2696] <INSDQualifier_value>X oznacza dowolny aminokwas< / IN SDQualifi er_value>

[2697] < / INSDQualifier>

[2698] < / IN SDF eature_quals>

[2699] < / INSDFeature>

[2700] <INSDFeature>

[2701] <IN SDF eature_key>source< / IN SDF eature_key>

[2702] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[2703] <IN SDF eature_quals>

[2704] <INSDQualifier>

[2705] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[2706] <INSDQualifier_value>protein< / INSDQualifier_value>

[2707] < / INSDQualifier>

[2708] <INSDQualifier id="q387">

[2709] <INSDQualifier_name>organism< / INSDQualifier_name>

[2710] <INSDQualifier_value>synthetic construct< / IN SDQualifier_value>

[2711] < / INSDQualifier>

[2712] < / IN SDF eature_quals>

[2713] < / INSDFeature>

[2714] < / INSDSeq_feature-table>

[2715] <IN SD Seq sequen ce>X N DEGXXXXK

[2716] < / INSDSeq>

[2717] < / SequenceData>

[2718] < S equenceData sequencelDNumb er= " 42 " >

[2719] <INSDSeq>

[2720] <IN SD S eq_l ength> 10< / 1 N SD S eq_l ength>

[2721] <IN SDSeq_moltype> AA< / IN SD Seq_moltype>

[2722] <IN SD S eq di vi si on>P AT

[2723] <INSDSeq_feature-table>

[2724] <INSDFeature>

[2725] REGION

[2726] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[2727] <IN SDF eature_quals>

[2728] <INSDQualifier id="q283">

[2729] <INSDQualifier_name>note< / INSDQualifier_name>

[2730] <INSDQualifier_value>Peptyd rozk adaj cy kryszta y pirofosforanu wapnia< / INSDQualifier_value>

[2731] < / INSDQualifier>

[2732] < / IN SDF eature_quals>

[2733] < / INSDFeature>

[2734] <INSDFeature>

[2735] V ARI ANT < / IN SDF eature key >

[2736] <IN SDF eature_location> 1 < / IN SDF eature_location>

[2737] <IN SDF eature_quals>

[2738] <INSDQualifier id="q284">

[2739] <INSDQualifier_name>note< / INSDQualifier_name>

[2740] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2741] < / INSDQualifier>

[2742] < / IN SDF eature_quals>

[2743] < / INSDFeature>

[2744] <INSDFeature>

[2745] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2746] <IN SDF eature_location>6< / IN SDF eature_location>

[2747] <IN SDF eature_quals>

[2748] <INSDQualifier id="q285">

[2749] <INSDQualifier_name>note< / INSDQualifier_name>

[2750] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2751] < / INSDQualifier>

[2752] < / IN SDF eature_quals>

[2753] < / INSDFeature>

[2754] <INSDFeature>

[2755] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2756] <IN SDF eature_location>7< / IN SDF eature_location>

[2757] <IN SDF eature_quals>

[2758] <INSDQualifier id="q286">

[2759] <INSDQualifier_name>note< / INSDQualifier_name>

[2760] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2761] < / INSDQualifier>

[2762] < / IN SDF eature_quals>

[2763] < / INSDFeature>

[2764] <INSDFeature>

[2765] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2766] <IN SDF eature locati on>8< / IN SDF eature_location>

[2767] <IN SDF eature_quals>

[2768] <INSDQualifier id="q287">

[2769] <INSDQualifier_name>note< / INSDQualifier_name>

[2770] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2771] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>9< / INSDF eature_location> F eature_quals>

[2772] <INSDQualifier id="q288">

[2773] <INSDQualifier _name>note< / INSDQualifier _name>

[2774] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2775] < / INSDQualifier>

[2776] < / IN SDF eature_quals>

[2777] < / INSDFeature>

[2778] <INSDFeature>

[2779] <IN SDF eature_key>source< / IN SDF eature_key>

[2780] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[2781] <IN SDF eature_quals>

[2782] <INSDQualifier>

[2783] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[2784] <INSDQualifier_value>protein< / INSDQualifier_value>

[2785] < / INSDQualifier>

[2786] <INSDQualifier id="q388">

[2787] <INSDQualifier_name>organism< / INSDQualifier_name>

[2788] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[2789] < / INSDQualifier>

[2790] < / IN SDF eature_quals>

[2791] < / INSDFeature>

[2792] < / INSDSeq_feature-table>

[2793] <INSD Seq_sequence>XNDD AXXXXH< / INSD Seq_sequence>

[2794] < / INSDSeq>

[2795] < / SequenceData>

[2796] <SequenceData sequenceIDNumber="43 ">

[2797] <INSDSeq>

[2798] <IN SD S eq_l ength> 10< / 1 N SD S eq_l ength>

[2799] <IN SD Seq_moltype> AA< / IN SD Seq_moltype>

[2800] <IN SD S eq di vi si on>P AT < / 1 N SD S eq di vi si on>

[2801] <INSDSeq_feature-table>

[2802] <INSDFeature>

[2803] REGION

[2804] <INSDFeature_location>l .. 10< / INSDFeature_location>

[2805]

[2806] <INSDQualifier id="q290">

[2807] <INSDQualifier_name>note< / INSDQualifier_name>

[2808] <INSDQualifier_value>Peptyd rozk adaj cy kryszta y pirofosforanu wapnia< / INSDQualifier_value>

[2809] < / INSDQualifier>

[2810] < / IN SDF eature_quals>

[2811] < / INSDFeature>

[2812] <INSDFeature>

[2813] V ARI ANT < / IN SDF eature key >

[2814] <IN SDF eature_location> 1 < / IN SDF eature_location>

[2815] <IN SDF eature_quals>

[2816] <INSDQualifier id="q291 ">

[2817] <INSDQualifier _name>note< / INSDQualifier _name>

[2818] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2819] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>6< / IN SDF eature_location> F eature_quals>

[2820] <INSDQualifier id="q292">

[2821] <INSDQualifier _name>note< / INSDQualifier _name>

[2822] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2823] < / INSDQualifier>

[2824] < / IN SDF eature_quals>

[2825] < / INSDFeature>

[2826] <INSDFeature>

[2827] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2828] <IN SDF eature_location>7< / IN SDF eature_location>

[2829] <IN SDF eature_quals>

[2830] <INSDQualifier id="q293">

[2831] <INSDQualifier_name>note< / INSDQualifier_name>

[2832] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2833] < / INSDQualifier>

[2834] < / IN SDF eature_quals>

[2835] < / INSDFeature>

[2836] <INSDFeature>

[2837] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2838] <IN SDF eature_location>8< / IN SDF eature_location>

[2839] <IN SDF eature_quals>

[2840] <INSDQualifier id="q294">

[2841] <INSDQualifier_name>note< / INSDQualifier_name>

[2842] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2843] < / INSDQualifier>

[2844] < / IN SDF eature_quals>

[2845] < / INSDFeature>

[2846] <INSDFeature>

[2847] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2848] <IN SDF eature_location>9< / IN SDF eature_location>

[2849] <IN SDF eature_quals>

[2850] <INSDQualifier id="q295">

[2851] <INSDQualifier _name>note< / INSDQualifier _name>

[2852] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2853] < / INSDQualifier>

[2854] < / IN SDF eature_quals>

[2855] < / INSDF eature>

[2856] <INSDFeature>

[2857] <IN SDF eature_key>source< / IN SDF eature_key>

[2858] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[2859] <IN SDF eature_quals>

[2860] <INSDQualifier>

[2861] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[2862] <INSDQualifier_value>protein< / INSDQualifier_value>

[2863] < / INSDQualifier>

[2864] <INSDQualifier id="q389">

[2865] <INSDQualifier_name>organism< / INSDQualifier_name>

[2866] <INSDQualifier_value>synthetic construct< / IN SDQualifier_value>

[2867] < / INSDQualifier>

[2868] < / IN SDF eature_quals>

[2869] < / INSDFeature>

[2870] < / INSDSeq_feature-table>

[2871] <IN SD S eq seq uen ce>X N D D A X X X X I< < / 1 N SD S eq_sequence>

[2872] < / INSDSeq>

[2873] < / SequenceData>

[2874] < S equenceData sequencelDNumb er= " 44 " >

[2875] <INSDSeq>

[2876] <IN SD S eq_l ength> 10< / 1 N SD S eq_l ength>

[2877] <IN SD Seq_moltype> A A

[2878] <IN SD S eq di vi si on>P AT

[2879] <INSDSeq_feature-table>

[2880] <INSDFeature>

[2881] REGION

[2882] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[2883] <IN SDF eature_quals>

[2884] <INSDQualifier id="q297">

[2885] <INSDQualifier_name>note< / INSDQualifier_name>

[2886] <INSDQualifier_value>Peptyd rozk adaj cy kryszta y pirofosforanu wapnia< / INSDQualifier_value>

[2887] < / INSDQualifier>

[2888] < / IN SDF eature_quals>

[2889] < / INSDFeature>

[2890] <INSDFeature>

[2891] V ARI ANT < / IN SDF eature key >

[2892] <IN SDF eature_location> 1 < / IN SDFeature_location>

[2893] <IN SDF eature_quals>

[2894] <INSDQualifier id="q298">

[2895] <INSDQualifier _name>note< / INSDQualifier _name>

[2896] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2897] < / INSDQualifier>

[2898] < / IN SDF eature qual s>

[2899] < / INSDFeature>

[2900] <INSDFeature>

[2901] V ARI ANT < / IN SDF eature key >

[2902] <IN SDF eature_location>6< / IN SDF eature_location>

[2903] <IN SDF eature_quals>

[2904] <INSDQualifier id="q299">

[2905] <INSDQualifier _name>note< / INSDQualifier _name>

[2906] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2907] < / INSDQualifier>

[2908] < / IN SDF eature_quals>

[2909] < / INSDFeature>

[2910] <INSDFeature>

[2911] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2912] <IN SDF eature_location>7< / IN SDF eature_location>

[2913] <IN SDF eature_quals>

[2914] <INSDQualifier id="q3OO">

[2915] <INSDQualifier_name>note< / INSDQualifier_name>

[2916] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2917] < / INSDQualifier>

[2918] < / IN SDF eature_quals>

[2919] < / INSDFeature>

[2920] <INSDFeature>

[2921] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2922] <IN SDF eature_location>8< / IN SDF eature_location>

[2923] <IN SDF eature_quals>

[2924] <INSDQualifier id="q3Ol">

[2925] <INSDQualifier_name>note< / INSDQualifier_name>

[2926] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2927] < / INSDQualifier>

[2928] < / IN SDF eature_quals>

[2929] < / INSDFeature>

[2930] eature key > V ARI ANT < / IN SDF eature key > eature_location>9< / INSDFeature_location> eature_quals> INSDQualifier id="q302">

[2931] <INSDQualifier _name>note< / INSDQualifier _name>

[2932] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2933] < / INSDQualifier>

[2934] < / IN SDF eature_quals>

[2935] < / INSDFeature>

[2936] <INSDFeature>

[2937] <IN SDF eature_key>source< / IN SDF eature_key>

[2938] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[2939] <IN SDF eature_quals>

[2940] <INSDQualifier>

[2941] <INSDQualifier _name>mol_type< / INSDQualifier _name>

[2942] <INSDQualifier_value>protein< / INSDQualifier_value>

[2943] < / INSDQualifier>

[2944] <INSDQualifier id="q390">

[2945] <INSDQualifier _name>organism< / INSDQualifier _name>

[2946] <INSDQualifier_value>synthetic construct< / IN SDQualifier_value>

[2947] < / INSDQualifier>

[2948] < / IN SDF eature_quals>

[2949] < / INSDFeature>

[2950] < / INSDSeq_feature-table>

[2951] <IN SD S eq_sequence>XNEE AXXXXH< / IN SD S eq_sequence>

[2952] < / INSDSeq>

[2953] < / SequenceData>

[2954] < S equenceData sequencelDNumb er= " 45 " >

[2955] <INSDSeq>

[2956] <IN SD S eq_l ength> 10< / 1 N SD S eq_l ength>

[2957] <IN SD Seq_moltype> A A

[2958] <IN SD S eq di vi si on>P AT < / 1 N SD S eq di vi si on>

[2959] <INSDSeq_feature-table>

[2960] <INSDFeature>

[2961] REGION

[2962] <IN SDF eature_location> 1..10

[2963]

[2964] <INSDQualifier id="q304">

[2965] <INSDQualifier_name>note< / INSDQualifier_name>

[2966] <INSDQualifier_value>Peptyd rozk adaj cy kryszta y pirofosforanu wapnia< / INSDQualifier_value>

[2967] < / INSDQualifier>

[2968] < / IN SDF eature_quals>

[2969] < / INSDFeature>

[2970] <INSDFeature>

[2971] V ARI ANT < / IN SDF eature key >

[2972] <IN SDF eature_location> 1 < / IN SDF eature_location>

[2973] <IN SDF eature_quals>

[2974] <INSDQualifier id="q305">

[2975] <IN SDQualifier_name>note< / IN SDQualifier_name>

[2976] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2977] < / INSDQualifier>

[2978] < / IN SDF eature_quals>

[2979] < / INSDFeature>

[2980] <INSDFeature>

[2981] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2982] <IN SDF eature_location>6< / IN SDF eature_location>

[2983] <IN SDF eature_quals>

[2984] <INSDQualifier id="q306">

[2985] <INSDQualifier_name>note< / INSDQualifier_name>

[2986] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2987] < / INSDQualifier>

[2988] < / IN SDF eature_quals>

[2989] < / INSDFeature>

[2990] <INSDFeature>

[2991] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[2992] <IN SDF eature_location>7< / IN SDF eature_location>

[2993] <IN SDF eature_quals>

[2994] <INSDQualifier id="q307">

[2995] <INSDQualifier _name>note< / INSDQualifier _name>

[2996] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[2997] < / INSDQualifier>

[2998] < / IN SDF eature_quals>

[2999] < / INSDFeature>

[3000] <INSDFeature>

[3001] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[3002] <IN SDF eature locati on>8< / IN SDFeature_location>

[3003] <IN SDF eature_quals>

[3004] <INSDQualifier id="q308">

[3005] <INSDQualifier_name>note< / INSDQualifier_name>

[3006] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[3007] < / INSDQualifier>

[3008] < / IN SDF eature qual s>

[3009] < / INSDFeature>

[3010] <INSDFeature>

[3011] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[3012] <IN SDF eature_location>9< / IN SDF eature_location>

[3013] <IN SDF eature_quals>

[3014] <INSDQualifier id="q309">

[3015] <INSDQualifier_name>note< / INSDQualifier_name>

[3016] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[3017] < / INSDQualifier>

[3018] < / IN SDF eature_quals>

[3019] < / INSDFeature>

[3020] <INSDFeature>

[3021] <IN SDF eature_key>source< / IN SDF eature_key>

[3022] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[3023] <IN SDF eature_quals>

[3024] <INSDQualifier>

[3025] <INSDQualifier _name>mol_type< / INSDQualifier _name>

[3026] <INSDQualifier_value>protein< / INSDQualifier_value>

[3027] < / INSDQualifier>

[3028] <INSDQualifier id="q391">

[3029] <INSDQualifier _name>organism< / INSDQualifier _name>

[3030] <INSDQualifier_value>synthetic construct< / IN SDQualifier_value>

[3031] < / INSDQualifier>

[3032] < / IN SDF eature_quals>

[3033] < / INSDFeature>

[3034] < / INSDSeq_feature-table>

[3035] <IN SD Seq_sequence>XNEEAXXXXK< / IN SD S eq_sequence>

[3036] < / INSDSeq>

[3037] < / SequenceData>

[3038] <SequenceData sequenceIDNumber="46">

[3039] <INSDSeq>

[3040] <IN SD S eq_l ength> 10< / IN SD S eq_l ength>

[3041] <IN SD Seq_moltype> AA< / IN SD Seq_moltype>

[3042] <IN SD S eq di vi si on>P AT < / IN SD S eq di vi si on>

[3043] <INSDSeq_feature-table>

[3044] <INSDFeature>

[3045] REGION

[3046] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[3047] <IN SDF eature_quals>

[3048] <INSDQualifier id="q311 ">

[3049] <INSDQualifier_name>note< / INSDQualifier_name>

[3050] <INSDQualifier_value>Peptyd rozk adaj cy kryszta y pirofosforanu wapnia< / INSDQualifier_value>

[3051] < / INSDQualifier>

[3052] < / IN SDF eature_quals>

[3053] < / INSDFeature>

[3054] <INSDFeature>

[3055] V ARI ANT < / IN SDF eature key >

[3056] <IN SDF eature_location> 1 < / IN SDF eature_location>

[3057] <IN SDF eature_quals>

[3058] <INSDQualifier id="q312">

[3059] <INSDQualifier _name>note< / INSDQualifier _name>

[3060] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[3061] < / INSDQualifier>

[3062] < / IN SDF eature_quals>

[3063] < / INSDFeature>

[3064] <INSDFeature>

[3065] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[3066] <IN SDF eature_location>6< / IN SDF eature_location>

[3067] <IN SDF eature_quals>

[3068] <INSDQualifier id="q313 ">

[3069] <INSDQualifier_name>note< / INSDQualifier_name>

[3070] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[3071] < / INSDQualifier>

[3072] < / IN SDF eature_quals>

[3073] < / INSDFeature>

[3074] <INSDFeature>

[3075] <IN SDF eatur e key > V ARI ANT < / IN SDF eatur e key >

[3076] <IN SDF eature_location>7< / IN SDF eature_location>

[3077] <IN SDF eatur e_quals>

[3078] <INSDQualifier id="q314">

[3079] <INSDQualifier_name>note< / INSDQualifier_name>

[3080] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[3081] < / INSDQualifier>

[3082] < / IN SDF eature_quals>

[3083] < / INSDF eatur e>

[3084] <INSDFeature>

[3085] <IN SDF eature key > V ARI ANT < / IN SDF eatur e key >

[3086] <IN SDF eature_location>8< / IN SDF eature_location>

[3087] <IN SDF eatur e_quals>

[3088] <INSDQualifier id="q315">

[3089] <INSDQualifier_name>note< / INSDQualifier_name>

[3090] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[3091] < / INSDQualifier>

[3092] < / IN SDF eature_quals>

[3093] < / INSDF eatur e>

[3094] <INSDFeature>

[3095] <IN SDF eature key > V ARI ANT < / IN SDF eatur e key >

[3096] <IN SDF eature_location>9< / IN SDFeature_location>

[3097] <IN SDF eatur e_quals>

[3098] <INSDQualifier id="q316">

[3099] <INSDQualifier_name>note< / INSDQualifier_name>

[3100] <INSDQualifier_value>X oznacza dowolny aminokwas< / IN SDQualifi er_value>

[3101] < / INSDQualifier>

[3102] < / IN SDF eature qual s>

[3103]

[3104] <INSDQualifier_value>Peptyd rozk adaj cy kryszta y pirofosforanu wapnia< / INSDQualifier_value>

[3105] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location> 1 < / IN SDF eature_location> F eature_quals>

[3106] <INSDQualifier id="q319">

[3107] <IN SDQualifi er_name>note< / IN SDQualifi er_name>

[3108] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[3109] < / INSDQualifier>

[3110] < / IN SDF eature_quals>

[3111] < / INSDFeature>

[3112] <INSDFeature>

[3113] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[3114] <IN SDF eature_location>6< / IN SDFeature_location>

[3115] <IN SDF eature_quals>

[3116] <INSDQualifier id="q320">

[3117] <INSDQualifier_name>note< / INSDQualifier_name>

[3118] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[3119] < / INSDQualifier>

[3120] < / IN SDF eature qual s>

[3121] < / INSDFeature>

[3122] <INSDFeature>

[3123] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[3124] <IN SDF eature_location>7< / IN SDF eature_location>

[3125] <IN SDF eature_quals>

[3126] <INSDQualifier id="q321 ">

[3127] <INSDQualifier _name>note< / INSDQualifier _name>

[3128] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[3129] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>8< / IN SDF eature_location> F eature_quals>

[3130] <INSDQualifier id="q322">

[3131] <INSDQualifier _name>note< / INSDQualifier _name>

[3132] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[3133] < / INSDQualifier>

[3134] < / IN SDF eature_quals>

[3135] < / INSDFeature>

[3136] <INSDFeature>

[3137] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[3138] <IN SDF eature_location>9< / IN SDF eature_location>

[3139] <IN SDF eature_quals>

[3140] <INSDQualifier id="q323">

[3141] <INSDQualifier_name>note< / INSDQualifier_name>

[3142] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[3143] < / INSDQualifier>

[3144] < / IN SDF eature_quals>

[3145] < / INSDFeature>

[3146] <INSDFeature>

[3147] <IN SDF eature_key>source< / IN SDF eature_key>

[3148] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[3149] <IN SDF eature_quals>

[3150]

[3151] <INSDFeature>

[3152] <IN SDF eatur e key > V ARI ANT < / IN SDF eatur e key >

[3153] <IN SDF eature_location> 1 < / IN SDF eature_location>

[3154] <IN SDF eatur e_quals>

[3155] <INSDQualifier id="q326">

[3156] <INSDQualifier_name>note< / INSDQualifier_name>

[3157] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[3158] < / INSDQualifier>

[3159] < / IN SDF eature_quals>

[3160] < / INSDF eatur e>

[3161] <INSDFeature>

[3162] <IN SDF eature key > V ARI ANT < / IN SDF eatur e key >

[3163] <IN SDF eature_location>6< / IN SDF eature_location>

[3164] <IN SDF eatur e_quals>

[3165] <INSDQualifier id="q327">

[3166] <INSDQualifier_name>note< / INSDQualifier_name>

[3167] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[3168] < / INSDQualifier>

[3169] < / IN SDF eature_quals>

[3170] < / INSDF eatur e>

[3171] <INSDFeature>

[3172] <IN SDF eature key > V ARI ANT < / IN SDF eatur e key >

[3173] <IN SDF eature_location>7< / IN SDF eature_location>

[3174] <IN SDF eatur e_quals>

[3175] <INSDQualifier id="q328">

[3176] <INSDQualifier_name>note< / INSDQualifier_name>

[3177] <INSDQualifier_value>X oznacza dowolny aminokwas< / IN SDQualifi er_value>

[3178] < / INSDQualifier>

[3179] < / IN SDF eature_quals>

[3180] e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>8< / IN SDF eature_location> F eature_quals>

[3181] <INSDQualifier id="q329">

[3182] <INSDQualifier _name>note< / INSDQualifier _name>

[3183] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[3184] < / INSDQualifi er>

[3185] < / IN SDF eature_quals>

[3186] < / INSDFeature>

[3187] <INSDFeature>

[3188] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[3189] <IN SDF eature_location>9< / IN SDF eature_location>

[3190] <IN SDF eature_quals>

[3191] <INSDQualifier id="q33O">

[3192] <INSDQualifier_name>note< / INSDQualifier_name>

[3193] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[3194] < / INSDQualifier>

[3195] < / IN SDF eature_quals>

[3196] < / INSDFeature>

[3197] <INSDFeature>

[3198] <IN SDF eature_key>source< / IN SDF eature_key>

[3199] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[3200] <IN SDF eature_quals>

[3201] <INSDQualifier>

[3202] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[3203] <INSDQualifier_value>protein< / INSDQualifier_value>

[3204] < / INSDQualifier>

[3205] <INSDQualifier id="q394">

[3206] <INSDQualifier_name>organism< / INSDQualifier_name>

[3207] <INSDQualifier_value>synthetic construct< / IN SDQualifier_value>

[3208] < / INSDQualifier>

[3209] < / IN SDF eature_quals>

[3210] < / INSDFeature>

[3211] < / INSDSeq_feature-table>

[3212] <IN S D Seq sequen ce>X N DE AXXXXH

[3213] < / INSDSeq>

[3214] < / SequenceData>

[3215] <SequenceData sequenceIDNumber="49">

[3216] <INSDSeq>

[3217] <IN SD S eq_l ength> 10< / 1 N SD S eq_l ength>

[3218] <IN SD Seq_moltype> AA< / IN SD Seq_moltype>

[3219] <IN SD S eq di vi si on>P AT

[3220] <IN SD S eq feature-tabl e>

[3221] <INSDFeature>

[3222] REGION

[3223] <IN SDF eature_location> E .10< / IN SDF eature_location>

[3224] <IN SDF eature_quals>

[3225] <INSDQualifier id="q332">

[3226] <INSDQualifier_name>note< / INSDQualifier_name>

[3227] <INSDQualifier_value>Peptyd rozk adaj cy kryszta y pirofosforanu wapnia< / INSDQualifier_value>

[3228] < / INSDQualifier>

[3229] < / IN SDF eature_quals>

[3230] < / INSDFeature>

[3231] <INSDFeature>

[3232] V ARI ANT < / IN SDF eature key >

[3233] <IN SDF eature_location> 1 < / IN SDF eature_location>

[3234] <IN SDF eature_quals>

[3235] <INSDQualifier id="q333">

[3236] <INSDQualifier _name>note< / INSDQualifier _name>

[3237] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[3238] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>6< / IN SDF eature_location> F eature_quals>

[3239] <INSDQualifier id="q334">

[3240] <INSDQualifier _name>note< / INSDQualifier _name>

[3241] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[3242] < / INSDQualifier>

[3243] < / IN SDF eature_quals>

[3244] < / INSDFeature>

[3245] <INSDFeature>

[3246] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[3247] <IN SDF eature_location>7< / IN SDF eature_location>

[3248] <IN SDF eature_quals>

[3249] <INSDQualifier id="q335">

[3250] <INSDQualifier_name>note< / INSDQualifier_name>

[3251] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[3252] < / INSDQualifier>

[3253] < / IN SDF eature_quals>

[3254] < / INSDFeature>

[3255] <INSDFeature>

[3256] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[3257] <IN SDF eature_location>8< / IN SDF eature_location>

[3258] <IN SDF eature_quals>

[3259] <INSDQualifier id="q336">

[3260] <INSDQualifier_name>note< / INSDQualifier_name>

[3261] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[3262] < / INSDQualifier> F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>9< / IN SDF eature_location> F eature_quals>

[3263] <INSDQualifier id="q337">

[3264] <INSDQualifier _name>note< / INSDQualifier _name>

[3265] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[3266] < / INSDQualifier>

[3267] < / IN SDF eature_quals>

[3268] < / INSDFeature>

[3269] <INSDFeature>

[3270] <IN SDF eature_key>source< / IN SDF eature_key>

[3271] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[3272] <IN SDF eature_quals>

[3273] <INSDQualifier>

[3274] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[3275] <INSDQualifier_value>protein< / INSDQualifier_value>

[3276] < / INSDQualifier>

[3277] <INSDQualifier id="q395">

[3278] <INSDQualifier_name>organism< / INSDQualifier_name>

[3279] <INSDQualifier_value>synthetic construct< / IN SDQualifier_value>

[3280] < / INSDQualifier>

[3281] < / IN SDF eature_quals>

[3282] < / INSDFeature>

[3283] < / INSDSeq_feature-table>

[3284] <IN SD Seq_sequence>XNDE AXXXXK< / IN SD Seq_sequence>

[3285] < / INSDSeq>

[3286] < / SequenceData>

[3287] < S equenceData sequencelDNumb er= " 50 " >

[3288] <INSDSeq>

[3289] <IN SD S eq_l ength> 10< / 1 N SD S eq_l ength>

[3290] <IN SD Seq_moltype> A A

[3291] <IN SD S eq di vi si on>P AT < / 1 N SD S eq di vi si on>

[3292] <INSDSeq_feature-table>

[3293] <INSDFeature>

[3294] REGION

[3295] <IN SDF eature_location> 1..10

[3296]

[3297] <INSDQualifier id="q339">

[3298] <INSDQualifier_name>note< / INSDQualifier_name>

[3299] <INSDQualifier_value>Peptyd rozkladajacy krysztaly pirofosforanu wapnia< / INSDQualifier_value>

[3300] < / INSDQualifier>

[3301] < / IN SDF eature_quals>

[3302] < / INSDFeature>

[3303] <INSDFeature>

[3304] V ARI ANT < / IN SDF eature key >

[3305] <IN SDF eature_location> 1 < / IN SDF eature_location>

[3306] <IN SDF eature_quals>

[3307] <INSDQualifier id="q340">

[3308] <INSDQualifier _name>note< / INSDQualifier _name>

[3309] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[3310] < / INSDQualifier>

[3311] < / IN SDF eature_quals>

[3312] e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>6< / IN SDF eature_location> F eature_quals>

[3313] <INSDQualifier id="q341 ">

[3314] <INSDQualifier _name>note< / INSDQualifier _name>

[3315] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[3316] < / INSDQualifier>

[3317] < / IN SDF eature_quals>

[3318] < / INSDFeature>

[3319] <INSDFeature>

[3320] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[3321] <IN SDF eature_location>7< / IN SDF eature_location>

[3322] <IN SDF eature_quals>

[3323] <INSDQualifier id="q342">

[3324] <INSDQualifier_name>note< / INSDQualifier_name>

[3325] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[3326] < / INSDQualifier>

[3327] < / IN SDF eature_quals>

[3328] < / INSDFeature>

[3329] <INSDFeature>

[3330] <IN SDF eature key > V ARI ANT < / IN SDF eature key >

[3331] <IN SDF eature_location>8< / IN SDF eature_location>

[3332] <IN SDF eature_quals>

[3333] <INSDQualifier id="q343">

[3334] <INSDQualifier_name>note< / INSDQualifier_name>

[3335] <INSDQualifier_value>X oznacza dowolny aminokwas< / INSDQualifier_value>

[3336] < / INSDQualifier>

[3337] F eature_quals> e> > F eature key > V ARI ANT < / IN SDF eature key > F eature_location>9< / IN SDF eature_location> F eature_quals>

[3338] <INSDQualifier id="q344">

[3339] <INSDQualifier_name>note< / INSDQualifier_name>

[3340] <INSDQualifier_value>X oznacza dowolny aminokwas< / IN SDQualifier_value>

[3341] < / INSDQualifier>

[3342] < / IN SDF eature_quals>

[3343] < / INSDFeature>

[3344] <INSDFeature>

[3345] <IN SDF eature_key>source< / IN SDF eature_key>

[3346] <IN SDF eature_location> 1..10< / IN SDF eature_location>

[3347] <IN SDF eature_quals>

[3348] <INSDQualifier>

[3349] <INSDQualifier _name>mol_type< / INSDQualifier _name>

[3350] <INSDQualifier_value>protein< / INSDQualifier_value>

[3351] < / INSDQualifier>

[3352] <INSDQualifier id="q396">

[3353] <INSDQualifier _name>organism< / INSDQualifier _name>

[3354] <INSDQualifier_value>synthetic construct< / INSDQualifier_valu

[3355] < / INSDQualifier>

[3356] < / IN SDF eature_quals>

[3357] < / INSDFeature>

[3358] < / INSDSeq_feature-table>

[3359] <IN SD Seq_sequence>XQEDGXXXXR< / IN SD S eq_sequence>

[3360] < / INSDSeq>

[3361] < / SequenceData>

[3362] < / ST26SequenceListing>

Claims

1. Patent claims1. A dendriplex composed of a polypropyleneimine (PPI) dendrimer and RNA, with the surface of said dendrimer modified with a sugar selected from maltotriose, lactose, mannose and glucose, or a basic amino acid selected from lysine, histidine and arginine, or a combination thereof.

2. The dendriplex according to claim 1, wherein the RNA is mRNA, shRNA, siRNA, miRNA, crRNA, tracrRNA, sgRNA or gRNA.

3. The dendriplex according to claim 1 or 2, wherein the RNA is an RNA specific to the PAX3-FOXO1 fusion gene.

4. The dendriplex according to claim 3, wherein the RNA specific to the PAX3-FOXO1 fusion gene is an siRNA, preferably having nucleotide sequences selected from the group consisting of pairs of sequences having SEQ ID NO 3 and 4, and SEQ ID NO 5 and 6.

5. The dendriplex according to any one of claims 1 to 4, wherein the PPI dendrimer is a PPI glycodendrimer selected from generation 1 (Gl) to generation 4 (G4), preferably a PPI-G4 glycodendrimer.

6. The dendriplex according to any one of claims 1 to 5, wherein the dendrimer is a glycodendrimer modified with maltotriose, preferably in the range of 10- 90%, more preferably in the range of 10-80%, especially 10-60%.

7. The dendriplex according to claim 6, wherein the glycodendrimer is modified at 20% or 50% with maltotriose.

8. The dendriplex according to any one of claims 1 to 6, wherein the dendrimer is a glycodendrimer modified with maltotriose, preferably in the range of 35- 40%, and histidine, preferably in the range of 35-40%.

9. The dendriplex according to claim 8, wherein the glycodendrimer is modified with maltotriose at 37.5% and histidine at 37.5%.

10. The dendriplex according to any one of claims 1 to 5, the dendrimer being a glycodendrimer modified with lactose, preferably in the range of 10-90%, more preferably in the range of 20-80%.

11. The dendriplex according to claim 10, wherein the glycodendrimer is modified at 27% or 70% with lactose.

12. A pharmaceutical composition comprising the dendriplex as defined in any one of claims 1 to 11 and a pharmaceutically acceptable carrier, diluent or excipient.

13. The pharmaceutical composition according to claim. 12, wherein said carrier, diluent or excipient is sterile PBS.

14. The pharmaceutical composition according to claim. 12 or 13, wherein the composition is for topical or oral administration.

15. The pharmaceutical composition according to claim 14, wherein the composition is for topical administration to a cancerous lesion, preferably to a tumour, more preferably by injection, inhalation or in the form of drops.

16. The pharmaceutical composition according to claim 14, wherein the composition is for intravenous, intraperitoneal or intramuscular administration.

17. The dendriplex as defined in any one of claims 1 to 11 or the composition as defined in any one of claims 12 to 16 for use as a medicament.

18. The dendriplex as defined in any one of claims 1 to 11 or the composition as defined in any one of claims 12 to 16 for use in cancer therapy, preferably gene therapy.

19. The dendriplex or composition for use according to claim 18, wherein the tumour is an alveolar rhabdomyosarcoma.

20. The dendriplex or composition for use according to any one of claims 18 to 20, wherein the therapy is selected from the group comprising monotherapy and combination therapy.

Images