Rnai insecticide materials and methods for lepidopteran control

Abstract

Disclosed herein are methods for producing interfering RNA biopesticides, such as microbial host organisms engineered to produce interfering RNA (iRNA) molecules which selectively undermine the survival of lepidopteran insects, such as agricultural pest moths and larval (caterpillar) forms thereof. Such iRNA molecules selectively inhibit the expression of a gene in a specific insect population, such as a lepidopteran population, by RNA interference. Also disclosed herein are polynucleotides, such as expression cassettes encoding iRNA molecules and facilitating integration, such as stable integration into the genome of a host cell. Further disclosed herein are compositions including the disclosed nucleotide sequences and host organisms, along with methods of using the same to control lepidopteran populations.

Description

RNAI INSECTICIDE MATERIALS AND METHODS FOR LEPIDOPTERAN CONTROLFIELD OF THE INVENTION

[0001] This disclosure generally relates to biorational insecticide compositions, such as yeastbased delivery systems for interfering RNA, which can be deployed to selectively control Lepidopteran populations. The disclosure further relates to methods of making and using the biorational insecticide compositions.BACKGROUND

[0002] Moths of the order Lepidoptera, which encompasses a significant group of plantfeeding insects worldwide, play a crucial role in ecosystems. While most of the approximately 16,000 identified taxa contribute to ecological balance and serve as pollinators, some species pose substantial threats to agricultural productivity. Such lepidopterans cause extensive damage to crops, threatening global food security and incurring significant financial losses from crops such as com, soybeans, cotton, and tobacco. Lepidopteran larva, such as worms and caterpillars, are also known to cause major agricultural losses worldwide, e.g., the fall army worm Spodoptera frugiperda. Current strategies to control lepidopterans involve use of broad-spectrum chemical insecticides that can inflict harm on non-target organisms and negatively impact human health. An additional challenge to effective control of such insect pests is that insecticide resistance to chemical pesticides has emerged in many Lepidopteran species. Accordingly, there exists a need for insecticides that effectively and selectively control lepidopteran populations.

[0003] An emerging strategy involves facilitating exposure of pests to symbiotic or attractive microbes, such as yeast, engineered to produce insecticidal nucleic acid molecules, such as interfering RNA. Although some insect pests are susceptible to RNA interference (RNAi),Lepidopteran pests are notoriously insensitive to RNAi. Accordingly, there exists a need for improved pest control strategies involving iRNA and nucleic acids encoding the same, methods of engineering microbes to biosynthesize insecticidal nucleic acids, and compositions for the targeted control of Lepidopteran populations. Aspects of the invention disclosed herein address these needs.INCORPORATION BY REFERENCE

[0004] Each patent, publication, and non-patent literature cited in the application is hereby incorporated by reference in its entirety as if each was incorporated by reference individually, and as if each is fully set forth herein. However, where such reference is made, and whether to patents, publications, non-patent literature, or other sources of information, it is for the general purpose of providing context for discussing features of the invention. Accordingly, unless specifically stated otherwise, the reference is not to be construed as an admission that the document or underlying information, in any jurisdiction, is prior art, or forms part of the common general knowledge in the art.SUMMARY OF THE INVENTION

[0005] A first aspect of the invention includes interfering ribonucleic acid (iRNA) molecules, which are capable of inhibiting neuronal signaling pathways, including genes involved in the production of an ion channel protein, such as a potassium channel protein or a potassium voltagegated channel protein, in a lepidopteran by RNA interference.

[0006] A second aspect of the invention includes expression cassettes for the expression of disclosed iRNA molecules.

[0007] A third aspect of the invention includes vectors for the expression of disclosed iRNA molecules and expression cassettes containing nucleotide sequences encoding the same.

[0008] A fourth aspect of the invention includes microbial cells, such as host organisms, including any of the disclosed iRNA molecules, expression cassettes, vectors, and combinations thereof.

[0009] A fifth aspect of the invention includes compositions containing any of the disclosed iRNA molecules, expression cassettes, vectors, microbial cells, and combinations thereof.

[0010] A sixth aspect of the invention includes methods involving any of the disclosed iRNA molecules, expression cassettes, vectors, microbial cells, compositions, and combinations thereof, in the control of a Lepidopteran population.

[0011] A first embodiment is an interfering ribonucleic acid including a nucleotide sequence of 20 to 30 contiguous nucleotides, where the nucleotide sequence is partially or perfectly complementary to mRNA transcribed from a DNA sequence having at least 84%, 88%, 92%, 96%, or 100% sequence identity to the entire length of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO:10, SEQ ID NO:13, SEQ ID NO:16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46 and where the interfering RNA inhibits the production of a potassium voltage-gated channel protein in a lepidopteran insect by RNA interference.

[0012] A second embodiment is an interfering ribonucleic acid where the interfering RNA is an RNA construct, a double stranded RNA (dsRNA), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), or an anti-sense oligonucleotide.

[0013] A third embodiment is an interfering ribonucleic acid where the interfering RNA is an shRNA.

[0014] A fourth embodiment is an interfering ribonucleic acid where the lepidopteran insect is an Australian painted apple caterpillar or moth, armyworm caterpillar or moth, beet armyworm caterpillar or moth, cactus caterpillar or moth, carob caterpillar or moth, cotton bollworm caterpillar or moth, diamondback caterpillar or moth, codling caterpillar or moth, apple worm caterpillar or moth, pink bollworm caterpillar or moth, fall armyworm caterpillar or moth, Southern armyworm caterpillar or moth, com earworm caterpillar or moth, soybean looper caterpillar or moth, tobacco cutworm caterpillar or moth, fruit borer, pod borer, shoot borer, diamond bollworm, Asian corn borer, European corn borer, false codling moth, Western bean cutworm, or a velvetbean caterpillar or moth.

[0015] A fifth embodiment is an interfering ribonucleic acid where the lepidopteran insect is a species of Abrostola., Agrochola, Agrotis, Allophyes, Amphipoea, Anorthoa, Anticarsia, Apamea, Asteroscopus, Atethmia, Autograph., Brachlomia, Cactoblastis, Carastis, Chrysodeixis, Cosmia, Cydia, Dasypolia, Diachrysia, Diarsia, Dicycla, Diloba, Dryobota, Dryobotodes, Ectomyelois, Eremobia, Euplexia, Eupsilia, Fissipunctia, Globia, Gortyna, Griposia, Elecatera, Helicoverpa, Heliothis, Flerminia, Hoplodrina, Hydraecia, Hypena, Hyppa, Lacanobia, Laspeyria, Leucania, Lithophane, Lithosia, Luperina. Lymantria Mamestra, Melanchra, Mesoligia, Mythimna, Oligia spp., Omphaloscelis, Orthosia, Pectinophora, Pelosia, Plusia, Polia, Plutella, Polymixis, Protodeltot, Pyrrhia, Shargacucullia, Spodoptera, Subacronicta, Teia, Thalpophila, Tholera, Thaumatotibia, Tiliacea, or Xanthia.

[0016] A sixth embodiment is an expression cassette including a regulatory sequence operably linked to a nucleotide sequence which encodes the interfering RNA molecule of any of the preceding embodiments.

[0017] A seventh embodiment is an expression cassette including a regulatory sequence operably linked to a nucleotide sequence which encodes an interfering RNA molecule including a nucleotide sequence of 20 to 30 contiguous nucleotides, where the nucleotide sequence is partially or perfectly complementary to mRNA transcribed from a sequence having at least 84%, 88%, 92%, 96%, or 100% sequence identity to the entire length of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46, and where the interfering RNA inhibits the production of a potassium voltage-gated channel protein in a lepidopteran insect by RNA interference.

[0018] An eighth embodiment is an expression cassette where the nucleotide sequence of the interfering RNA molecule includes 25 nucleotides which are partially or perfectly complementary to mRNA transcribed from a sequence represented by SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO:10, SEQ ID NO:13, SEQ ID NO:16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46.

[0019] A ninth embodiment is an expression cassette including a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to the entire length of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NQ:20, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:26,SEQ ID NO:27, SEQ ID NO:29, SEQ ID NQ:30, SEQ ID NO:32, SEQ ID NO:33, SEQ IDNO:35, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO: 45, SEQ ID NO:47, or SEQ ID NO:48, or the complement thereof

[0020] A tenth embodiment is an expression cassette where the regulatory sequence includes a yeast promoter.

[0021] An eleventh embodiment is an expression cassette where the yeast promoter includes a nucleotide sequence that has at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to the entire length of SEQ ID NO:59.

[0022] A twelfth embodiment is an expression cassette where the expression cassette is integrated into the genomic DNA of a yeast cell.

[0023] A thirteenth embodiment is a vector including the expression cassette of any one of the preceding embodiments.

[0024] A fourteenth embodiment is a vector where the vector includes a nucleotide sequence that has at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to the entire length of SEQ ID NO:60.

[0025] A fifteenth embodiment is a microbial cell, algal cell, or plant cell including the expression cassette or the vector of any one of the preceding embodiments.

[0026] A sixteenth embodiment is a microbial cell, algal cell, or plant cell, where the expression cassette is integrated into the genomic DNA of the microbial cell, algal cell, or plant cell.

[0027] A seventeenth embodiment is a microbial cell of any preceding embodiments, where the microbe is Saccharomyces cerevisiae.

[0028] An eighteenth embodiment is a composition including the interfering RNA, the expression cassette, the vector, the microbial cell, algal cell, or plant cell of any preceding embodiment, or a combination thereof.

[0029] A nineteenth embodiment is a composition including an expression cassette including a promoter operably linked to a DNA sequence encoding an interfering RNA molecule which is partially or perfectly complementary to mRNA transcribed from a target gene, where the target gene encodes a potassium voltage-gated channel protein in a lepidopteran insect and the interfering RNA specifically inhibits expression of the target gene.

[0030] A twentieth embodiment is a composition where the interfering RNA is a double stranded RNA (dsRNA), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), or an anti-sense oligonucleotide.

[0031] A twenty-first embodiment is a composition, where the interfering RNA is a short hairpin RNA (shRNA).

[0032] A twenty-second embodiment is a composition, where the lepidopteran insect is an Australian painted apple caterpillar or moth, armyworm caterpillar or moth, beet armyworm caterpillar or moth, cactus caterpillar or moth, carob caterpillar or moth, cotton bollworm caterpillar or moth, diamondback caterpillar or moth, codling caterpillar or moth, apple worm caterpillar or moth, pink bollworm caterpillar or moth, fall armyworm caterpillar or moth, Southern armyworm caterpillar or moth, com earworm caterpillar or moth, soybean looper caterpillar or moth, tobacco cutworm caterpillar or moth, fruit borer, pod borer, shoot borer, diamond bollworm, Asian corn borer, European corn borer, false codling moth, Western bean cutworm, or a velvetbean caterpillar or moth.

[0033] Atwenty-third embodiment is a composition, where the lepidopteran insect is a species of Abrostola., Agrochola, Agrotis, Allophyes, Amphipoea, Anorthoa, Anticarsia, Apcimea, Asteroscopus, Atethmia, Autograph., Brachlomia, Cactoblastis, Carastis, Chrysodeixis, Cosmia, Cydia, Dasypolia, Diachrysia, Diarsia, Dicycla, Diloba, Dryobota, Dryobotodes, Ectomyelois, Eremobia, Euplexia, Eupsilia, Fissipunctia, Globia, Gortyna, Griposia, Elecatera, Helicoverpa, Heliothis, Herminia, Hoplodrina, Hydraecia, Efypena, Elyppa, Lacanobia, Laspeyria, Leucania, Lithophane, Lithosia, Luperina. Lymantria Mamestra, Melanchra, Mesoligia, Mythimna, Oligia spp., Omphaloscelis, Orthosia, Pectinophora, Pelosia, Plusia, Polia, Plutella, Polymixis, Protodeltot, Pyrrhia, Shargacucullia, Spodoptera, Subacronicta, Teia, Thalpophila, Tholera, Thaumatotibia, Tiliacea, or Xanthia.

[0034] A twenty-fourth embodiment is a composition, where the target gene includes a DNA sequence having at least about 84%, 88%, 92%, 96%, or 100% sequence identity to the entire length of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46, or the complement thereof.

[0035] A twenty -fifth embodiment is a composition, where the expression cassette includes a nucleotide sequence having at least about 80%, 85%, 90%, 95%, 98%, or 99% sequence identity to the entire length of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO: 18, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:32, SEQ IDNO:33, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:41,SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO: 45, SEQ ID NO:47, or SEQ ID NO:48, or the complement thereof.

[0036] A twenty-sixth embodiment is a composition, where the expression cassette includes the entire length of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO: 45, SEQ ID NO:47, or SEQ ID NO:48

[0037] A twenty-seventh embodiment is a composition, where the interfering RNA includes a nucleotide sequence of at least 25 contiguous nucleotides which are partially or perfectly complementary to mRNA transcribed from SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46, or the complement thereof; or a DNA sequence having at least about or 84%, 88%, 92%, 96%, orl00% sequence identity to the entire length of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46, or the complement thereof; and where the interfering RNA is capable of inhibiting expression of the potassium voltage-gated channel protein in the lepidopteran insect.

[0038] A twenty-eighth embodiment is a composition, where the expression cassette is integrated into the genome of a yeast cell.

[0039] A twenty-ninth embodiment is a composition, where the yeast cell is Saccharomyces cerevisicie.

[0040] A thirtieth embodiment is a composition where the yeast cell is spray-dried, heat-killed, lyophilized, or suspended in an aqueous medium.

[0041] A thirty-first embodiment is a composition further including a sugar bait.

[0042] A thirty-second embodiment is a composition where a trap includes the composition.

[0043] A thirty-third embodiment is a method for controlling a lepidopteran population, including contacting the lepidopteran population with the interfering RNA, the expression cassette, the vector, the microbial cell, algal cell, or plant cell, or the composition of any of the preceding embodiments, or a combination thereof, where contacting the lepidopteran population includes a lepidopteran insect in the lepidopteran population ingesting the interfering RNA, the expression cassette, the vector, the microbial cell, algal cell, or plant cell, or the composition, thereby controlling the lepidopteran population.

[0044] A thirty-fourth embodiment is a method for controlling a lepidopteran population, the method including contacting the lepidopteran population with an interfering RNA molecule including a nucleotide sequence that is partially or perfectly complementary to mRNA transcribed from a target gene and which specifically inhibits expression of the target gene in a lepidopteran insect in the lepidopteran population, thereby controlling the lepidopteran population, where the target gene encodes a potassium voltage-gated channel protein or an ortholog thereof.

[0045] A thirty-fifth embodiment is a method for controlling a lepidopteran population where the interfering RNA is a double stranded RNA (dsRNA), a small interfering RNA (siRNA), a short hairpin RNA(shRNA), or an anti-sense oligonucleotide.

[0046] A thirty-sixth embodiment is a method for controlling a lepidopteran population, where the interfering RNA is a short hairpin RNA (shRNA).

[0047] A thirty-seventh embodiment is a method for controlling a lepidopteran population, where the target gene includes a DNA sequence that has at least 84%, 88%, 92%, 96%, or 100% identity to the entire length of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46.

[0048] A thirty-eighth embodiment is a method for controlling a lepidopteran population, where the target gene includes a DNA sequence that has 100% identity to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46

[0049] Athirty-ninth embodiment is a method for controlling a lepidopteran population, where the interfering RNA is produced by a microbial cell, algal cell, or plant cell including an expression cassette including a regulatory sequence operably linked to a nucleotide sequence encoding the interfering RNA, where the expression cassette is integrated into the genome of the microbial cell.

[0050] A fortieth embodiment is a method for controlling a lepidopteran population, where the expression cassette includes a nucleotide sequence having at least about 80%, 85%, 90%, 95%, 98%, or 99% sequence identity to the entire length of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NQ:20, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:29, SEQ IDNO:30, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO: 45, SEQ ID NO:47, or SEQ ID NO:48, or the complement thereof.

[0051] A forty -first embodiment is a method for controlling a lepidopteran population, where the expression cassette includes the entire length of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO: 45, SEQ ID NO:47, or SEQ ID NO:48

[0052] A forty-second embodiment is a method for controlling a lepidopteran population, where the method includes contacting the lepidopteran insect in the lepidopteran population with the microbial cell, algal cell, or plant cell of any of the preceding embodiments.

[0053] A forty -third embodiment is a method for controlling a lepidopteran population, where the microbial cell, algal cell, or plant cell is dead or alive.

[0054] A forty-fourth embodiment is a method for controlling a lepidopteran population, where the microbial cell is a Saccharomyces cerevisiae cell.

[0055] A forty-fifth embodiment is a method for controlling a lepidopteran population, where the lepidopteran population includes an Australian painted apple caterpillar or moth, armyworm caterpillar or moth, beet armyworm caterpillar or moth, cactus caterpillar or moth, carob caterpillar or moth, cotton bollworm caterpillar or moth, diamondback caterpillar or moth, codling caterpillar or moth, apple worm caterpillar or moth, pink bollworm caterpillar or moth, fall armywormcaterpillar or moth, Southern armyworm caterpillar or moth, com earworm caterpillar or moth, soybean looper caterpillar or moth, tobacco cutworm caterpillar or moth, fruit borer, pod borer, shoot borer, diamond bollworm, Asian corn borer, European corn borer, false codling moth, Western bean cutworm, or a velvetbean caterpillar or moth.

[0056] A forty-sixth embodiment is a method for controlling a lepidopteran population, where the lepidopteran insect population includes a species of Abrostola., Agrochola, Agrotis, Allophyes, Amphipoea, Anorthoa, Anticarsia, Apamea, Asteroscopus, Atethmia, Autograph., Brachlomia, Cactoblastis, Carastis, Chrysodeixis, Cosmia, Cydia, Dasypolia, Diachrysia, Diarsia, Dicycla, Diloba, Dryobota, Dryobotodes, Ectomyelois, Eremobia, Euplexia, Eupsilia, Fissipunctia, Globia, Gortyna, Griposia, Hecatera, Helicoverpa, Heliothis, Herminia, Hoplodrina, Hydraecia, Hypena, Hyppa, Lacanobia, Laspeyria, Leucania, Lithophane, Lithosia, Luperina. Lymantria Mamestra, Melanchra, Mesoligia, Mythimna, Oligia spp., Omphaloscelis, Orthosia, Pectinophora, Pelosia, Plusia, Polia, Plutella, Polymixis, Protodeltot, Pyrrhia, Shargacucullia, Spodoptera, Subacronicta, Teia, Thalpophila, Tholera, Thaumatotibia, Tiliacea, or Xanthia or a combination thereof.

[0057] A forty-seventh embodiment is a method for controlling a lepidopteran population, where the interfering RNA includes at least 25 contiguous nucleotides, where the nucleotide sequence is partially or perfectly complementary to mRNA transcribed from SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46, or a DNA sequence having at least about 70%, 75%, 80%, 85%, 90%, or 95% sequence identity to the entire length of SEQ IDNO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, SEQID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46, or the complement thereof; and where the interfering RNA is capable of inhibiting the expression of a potassium voltage-gated channel protein.A forty-eighth embodiment is a method for controlling a lepidopteran population, where the method further includes contacting the lepidopteran population with a sugar bait, a pheromone, an insecticide, or any combination thereof.BRIEF DESCRIPTION OF THE FIGURES

[0058] The accompanying drawings are included to provide a further understanding of the disclosure and are incorporated in and constitute a part of this specification, illustrate embodiments, and together with the description serve to explain the principles of the disclosure.

[0059] FIG. 1 is a bar graph showing percent mortality of S. frugiperda larvae following consumption of yeast strains Sh.712, Sh.713, or Sh.714. Results were compiled from eight replicate trials conducted on a total of 155 larvae subjected to each treatment. ***=P<0.001 vs. food control or a control yeast preparation.

[0060] FIG. 2 is a bar graph showing percent mortality induced by yeast strains expressing Dopl (Dop.724) and Rbfoxl (Fox.725 and Fox.726) shRNA. Results were compiled from three replicate trials (n=400 for control and 300 individuals for treatments).

[0061] FIG. 3 is a bar graph showing percent mortality induced by yeast strains expressing shRNA against Shaker (Sh.728), Serotonin Receptor-1 (HTR.729), and Dopamine 1 (Dop.732). Results were compiled from three replicate trials (n=450 for control and 225 per treatment)

[0062] FIG. 4 is a bar graph showing percent mortality induced by yeast strains expressing siRNA against Serotonin Receptor 1 (HTR.730 and HTR.731). Results were compiled from three replicate trials (n=225 for control or treatment).

[0063] FIG. 5 is a bar graph showing percent mortality induced by yeast strains expressing Shaker (Sh.748 and Sh.749) shRNA. Results were compiled from three replicate trials (n=250 individuals per control or treatment).DETAILED DESCRIPTION

[0064] Lepidoptera is an order of winged insects that includes butterflies and moths. Lepidopterans are characterized by scale-covered bodies, large wings, and a proboscis. The insects are notable for their complete metamorphosis cycle including a caterpillar larval stage. They play a crucial role in ecosystems as pollinators and primary consumers, yet caterpillars can be agricultural pests. While traditional pest control methods like spraying pesticides may provide temporary relief, they often fail to fully eliminate lepidopteran infestations and can expose off- target organisms and humans to harmful chemicals.

[0065] Many hundreds of lepidopteran species injure plants that are important sources of food, fabrics, fodder, and timber for humans. In the larval stage, caterpillars feed on leaves, stems, roots, fruits, or flowers of crops and plants. Major crop plants susceptible to lepidopteran pest damage include grains, sugar beets, sugarcane, cotton, tobacco, root crops, leaf crops, fruits, and timber / shade trees. Their feeding can cause defoliation, stunted growth, reduced yields, and even crop plant death depending on the severity of infestation.

[0066] Lepidopteran pests are responsible for major economic losses in agriculture and forestry due to the damage caused by their larvae. In addition to direct crop damage, some moth species like the greater wax moth can infest and damage beehives, impacting honey production.Additional lepidopteran pests include armyworms, cutworms, bollworms, cabbage loopers, codling moths, gypsy moths, and corn earworms. Current methods for controlling lepidopteran pests require cultural, biological and chemical control methods, which increase production costs.

[0067] An emerging strategy involves facilitating exposure of pests to symbiotic or attractive microbes, such as yeast, engineered to produce insecticidal nucleic acid molecules, such as interfering RNA. Given its sequence dependent mechanism of action, RNA interference provides a more selective alternative to broad-spectrum insecticides. However, identifying a suitable target gene for selective pesticidal activity, effective delivery of interfering RNA (iRNA), and implementation of iRNA into methods for controlling pests remain challenging.

[0068] Additionally, factors such nuclease activity specific to lepidopteran pests (Guan et al., J Biol Chem. 2018 Apr 20; 293(16): 6011-6021), iRNA degradation due to the activity of other dsRNAses, an unsuitable gut environment with a high gut pH, poor iRNA uptake, problems with iRNA endosomal entrapment, and inefficient iRNA machinery (Proc Zool Soc., 2023, 76:373-81) may contribute to RNAi insensitivity in lepidopterans. Overcoming at least the aforementioned challenges, Applicant has demonstrated effective biorational lepidopteran control by targeting a component of neuronal signaling with iRNA biopesticides. Mortality was induced in lepidopteran insects that ingested a sugar bait laced with insecticidal yeast engineered to express interfering RNA (iRNA) targeting Shaker, a gene encoding a subunit of a potassium-voltage gated ion channel.

[0069] In some examples, disclosed herein are iRNA biopesticides which target a component of the nervous system for gene suppression by RNA interference. Components of the lepidopteran nervous system include gustatory receptors, olfactory receptor neurons, and housing olfactoryreceptors. See, e g., Agnihotri et al., Insect Mol Biol. 2016 Oct;25(5):519-29 and Fouchier et al., Nat Commim. 2017; 8: 15709.

[0070] Exemplary target nervous systems components include ion channels and subunits thereof. Ion channels are protein structures embedded in cell membranes that form selective pores for the regulated ion transport across a membrane, enabling critical cellular processes like electrical signaling. In some examples, disclosed herein are iRNA biopesticides targeting an ion channel protein for gene suppression by RNA interference. Potassium ion channels, for example, are involved in the physiology and survival of insects. Reference to ion channels includes reference to voltage-gated ion channels. Voltage-gated potassium channels, for example, are membrane proteins that respond to membrane potential to selectively permeate potassium ions. Depending on the characteristics of the structure and the physiological function, voltage-gated potassium channels can be classified into a plurality of families, including Shaker type, EAG (ether-a-go-go) type, KvLQT, and others (Gutman et al., Pharmacol Rev. 2003 Dec; 55 (4): 583 -6)

[0071] The ion channel protein targeted by the disclosed iRNA biopesticides can be a component of a potassium ion channel. Additionally, an ion channel protein targeted by the disclosed iRNA biopesticides can be a component of a voltage-activated ion channel or a voltagegated ion channel. Voltage-gated ion channels open or close in response to changes in the membrane potential across the cell membrane. Such channels have a specialized voltage sensor domain that can detect alterations in the electrical field and trigger a conformational change, allowing ions to flow through the channel pore. An exemplary voltage-gated ion channel targeted by the disclosed polynucleotides, compositions, and methods is a potassium voltage-gated ion channel.

[0072] Disclosed iRNA biopesticides can threaten the survival of a variety of lepidopteran insects, including but not limited to an Australian painted apple caterpillar or moth, armyworm caterpillar or moth, beet armyworm caterpillar or moth, cactus caterpillar or moth, carob caterpillar or moth, cotton bollworm caterpillar or moth, diamondback caterpillar or moth, codling caterpillar or moth, apple worm caterpillar or moth, pink bollworm caterpillar or moth, fall armyworm caterpillar or moth, Southern armyworm caterpillar or moth, com earworm caterpillar or moth, soybean looper caterpillar or moth, tobacco cutworm caterpillar or moth, fruit borer, pod borer, shoot borer, diamond bollworm, Asian corn borer, European corn borer, false codling moth, Western bean cutworm, or a velvetbean caterpillar or moth.

[0073] For example, disclosed iRNA biopesticides can be used to control lepidopteran populations including A brostola spp., Agrochola spp., Agrotis spp., Allophyes spp., e.g., Allophyes oxyacanthae, Amphipoea spp., Anorthoa spp., e.g., Anorthoa munda, Anticar sia spp., e.g., Anticarsia gemmatalis, Apamea spp., Asteroscopus spp., Atethmia spp., e.g., Atethmia centrago, Autograph spp., Brachlomia spp., Brachlomia viminalis, Cactoblastis spp., e.g., Cactoblastis cactorun, Carastis spp., Chrysodeixis spp., e.g., Chrysodeixis includens, Cosmia spp., Cydia spp., e.g., Cydia pomonella, Dasypolia spp., e.g., Dasypolia templi, Diachrysia spp., e.g., Diachrysia chrysitis, Diarsia spp., Dicycla spp., Diloba spp., e.g., Diloba caeruleocephala, Dryobota spp., e.g., Dryobota labecula, Dryobotodes spp., e.g., Dryobotodes eremita, Ectomyelois spp., e.g., Ectomyelois ceratoniae, Eremobia spp., e.g., Eremobia ochroleuca, Euplexia spp., e.g., Euplexia lucipara, Eupsilia spp., e.g., Eupsilia transversa, Fissipunctia spp., e.g., Fissipunctia ypsillon, Globia spp., e.g., Globia sparganii, Gortyna spp., e.g., Gortyna flavago, Griposia spp., e.g., Griposia aprilina, Hecatera spp., e.g., Hecatera dysodea, Helicoverpa spp., e.g., Helicoverpa armigera and Helicoverpa zea, Heliothis spp., Herminia spp., e.g., Herminia starsipennalis,Hoplodrina spp., Hydr aecia spp., e.g., Hydraecia micacea, Hypena spp., e.g., Hypena proboscidalis, Hyppa spp., e.g., Hyppa rectilinea, Lacanobia spp., Laspeyria spp, e.g., Laspeyria flexula, Leucania spp., e.g., Leucania comma, Lithophane spp., e.g., Lithophane leautieri, Lithophane ornitopus, Lithophane semibrunnea, and Lithophane socia, Lithosia spp. e.g., Lithosia quadra, Luperina spp., e.g., Luperina nicker Hi, Lymantria spp., e.g., Lymantria dispar, Mamestra spp., e.g., Mamestra brassicae, Melanchra spp., e.g., Melanchra persicariae, Mesoligia spp., e.g., Mesoligia furuncula, Mythimna spp., e.g., Mythimna albipuncta, Oligia spp., Omphaloscelis spp., e.g., Omphaloscelis lunosa, Orthosia spp., Pectinophora spp., e.g., Pectinophora gossypiella, Pelosia spp., e.g., Pelosia muscerda, Plusia spp., e.g., Plusia festucae, Polia spp., e.g., Polia nebulosa, Plutella spp., Plutella xylostella, Polymixis spp., Protodeltot spp., e.g., Protodeltot pygarga, Pyrrhia spp., e.g., Pyrrhia umbra, Shargacucullia spp., e.g., Shargacucullia verbasci, Spodoptera spp., e.g., Spodoptera cosmioides, Spodoptera eridania, Spodoptera exigua, Spodoptera frugiper da, and Spodoptera litura, Subacronicta spp., e.g., Subacronicta megacephal, Teia spp., e.g., Leia anartoides, Thalpophila spp., e.g., Thalpophila matura, Tholera spp., e.g., Tholera decimalis, Thaumatotibia spp., e.g., Thaumatotibia leucotreta, Tiliacea spp., Xanthia spp., and combinations thereof.

[0074] Such yeast strains engineered to express insecticidal iRNA molecules may be interchangeably referred to as “yeast-based iRNA biopesticides,” “iRNA biopesticides,” “interfering RNA biopesticides,” and the like. “iRNA” biopesticides may interchangeably be referred to as “RNAi” biopesticides.

[0075] There is a need to provide biopesticides that selectively induce mortality in lepidopteran insects. An emerging strategy for lepidopteran control entails introducing, such as by the lepidopteran ingesting the interfering RNA (iRNA) that is effective to inhibit the expression ofgenes implicated in the fitness and / or survival by RNA interference (RNAi). One theoretical advantage of iRNA pesticides, which may also be referred to as iRNA biopesticides, is target specificity. That is, inhibiting expression of an organism-specific gene can result in selective toxicity for the target organism, such as a lepidopteran insect, without observable impact to nontarget organisms. Accordingly, such selectivity would not be expected to contribute to broadspectrum toxicity and selection of insecticide-resistant organisms.

[0076] RNA interference (RNAi) is activated when an organism recognizes double- stranded RNA (dsRNA) molecules and hydrolyzes them. In addition to their use of Argonaute family proteins, a common thread among RNAi-related pathways is their dependence on sequencespecific binding between short interfering RNAs (approximately 20 to 30 nucleotides) and target sequences (Obbard et al., Philos. Trans. R. Soc. Land. B. Biol. Sci. 2009; 364:99-115). Exogenous RNA constructs, such as dsRNA and small or short hairpin RNA (shRNA), are usually processed into 20-30 nucleotide duplexes by the ribonuclease III enzyme DICER. See, e.g., Kim & Rossi, Biotechniques. 2008 Apr; 44(5): 613-616 and Sheng et al., Front Bioeng Biotechnol. 2020 Aug 7; 8: 940. These nucleotide duplexes are then incorporated into the RNA induced silencing complex (RISC) by the catalytic component Argonaute. The two strands of RNA are unwound, and one strand is used as a guide strand, which binds to complementary mRNAs. The RISC complex will cleave the mRNA when base pair matching is perfectly complementary, or the complex can bind to the intact mRNA and suppress translation when there are mismatched base pairs, thereby mediating degradation or suppression of the endogenous transcript. Degradation or suppression of transcripts that code for essential genes in the insect may result in decreased amounts of critical gene products, reduced fitness, and increased mortality. See, e.g., Zotti & Smagghe, NeotropEntomol. 2015 Jun;44(3): 197-213 and Burand & Hunter, J Invertehr Pathol. 2013 Mar; 1 12 Suppl :S68-74.

[0077] Various strategies have been explored to deliver iRNA biopesticides to a desired target insect pest population. However, oral administration or absorption of iRNA, such as involving consumption or ingestion of the iRNA, in contrast to, e.g., injection, has clear advantages for delivery in the field. As examples, the feasibility of delivering iRNA to a target organism has been explored using naked double stranded RNA (dsRNA), dsRNA combined with a transfection reagent, and nucleic acid molecules mixed with an artificial diet. See, e.g., Taning et al., Journal of Ant Science April 2016;89:803-814.

[0078] Additional lepidopteran control strategies may also be combined with iRNA biopesticides, including attractive, phagostimulant, and insecticidal element. Herein, baits and attractants may be referred to interchangeably. In one example, attractive targeted sugar baits (ASBs or ATSBs) can be used to deliver iRNA biopesticides to provide compositions with excellent shelf life and residual activity, thereby reducing overall insecticide use. Together, disclosed are species-specific, cost-effective, scalable, user-friendly, and sustainable iRNA biopesticides targeting lepidopteran insects for control of a lepidopteran population.

[0079] Controlling a lepidopteran population can involve any of the management or regulation of lepidopteran insects to prevent them from causing harm or nuisance, limit their growth, spread, or presence, undermining the fitness and / or the survival of lepidopteran insects in a lepidopteran population. Controlling a lepidopteran population does not necessarily entail completely eliminating a population but may rather involve maintaining their population at a level that does not pose a significant threat to human health, safety, or the environment.

[0080] The term “iRNA” refers to ribonucleic acid (RNA) sequences and constructs that are able to operate within the RNA interference (RNAi) pathway by interfering with transcriptional or post-transcriptional gene expression resulting in reduced or inhibited expression of a specific gene. For purposes herein, the term “iRNA” refers to short interfering RNA (siRNA), short hairpin RNA (shRNA) and double stranded RNA (dsRNA) that operate within the RNAi pathway. In some instances, the iRNA is produced within a cell via a DNA construct that encodes said iRNA. The iRNA of the present invention are synthetic and can be expressed in a vector or host cell in which the iRNA is not normally expressed. For example, the siRNA may target an insect gene, e.g., a lepidopteran insect gene, and be expressed by an exogenous vector or expressed in a bacterial or yeast cell that does not naturally contain the target gene or target sequence to which the siRNA binds. The iRNA may be modified in a manner that facilitates exogenous expression by the host cell, e.g., the nucleic acid or the complementary sequence used to express the iRNA may be modified at its ends or incorporated into an exogenous sequence to allow for expression in the target host cell. In some embodiments, the nucleic acid encoding the iRNA is operably linked to an exogenous sequence that allows for its expression.

[0081] RNAi strategies typically employ a synthesized, non-naturally occurring “iRNA” or “iRNA molecule,” which typically comprises at least an RNA fragment against a target gene, a spacer sequence, and a second RNA fragment which is complementary to the first, so that a doublestranded RNA (dsRNA) structure can be formed. The introduced dsRNA takes advantage of the native RNAi pathways in the insect to trigger down -regulation of target genes that may lead to the cessation of feeding and / or growth, which may result in the death of the insect pest.

[0082] The target nucleotide sequence may be selected from any suitable region or nucleotide sequence of the target gene or RNA transcript thereof. For example, the target nucleotide sequencemay be located within the 5'UTR or 3'UTR of the target gene or RNA transcript or within exonic or intronic regions of the gene. The skilled person will be aware of methods of identifying the most suitable target nucleotide sequences within the context of the full-length target gene. For example, multiple dsRNAs targeting different regions of the target gene can be synthesized and tested. Alternatively, digestion of the RNA transcript with enzymes such as RNAse H can be used to determine sites on the RNA that are in a conformation susceptible to gene silencing. Target sites may also be identified using in silico approaches, for example, the use of computer algorithms designed to predict the efficacy of gene silencing based on targeting different sites within the full- length gene.

[0083] The term “siRNA,” or “small interfering RNA,” refers to short interfering RNA or silencing RNA, which are short double-stranded RNA molecules of <30 base pairs in length, for example, about 19-30 base pairs in length that operate through the RNAi pathway. Each siRNA is unwound into two single-stranded RNAs (ssRNAs), one of which is incorporated into the RNA- induced silencing complex (RISC) leading to post-transcriptional gene silencing. siRNAs can be generated in several ways. In some cases, long dsRNA is introduced to a cell, either by a virus, endogenous RNA expression (i.e., microRNA), or exogenously delivered dsRNA. The enzyme DICER cleaves the long duplex RNAs into siRNAs. Another way to introduce siRNA into cells is to express small hairpin RNA (shRNA) from plasmid vectors. Alternatively, chemically synthesized siRNA duplexes, which mimic the structure of DICER-processed products, are commonly used in research for gene silencing. Chemically synthesized siRNAs simply bypass the DICER cleavage step. In some preferred embodiments, the siRNA is about 25 bp in length. While use of longer (300-400 bp) double stranded RNA (dsRNA) molecules is one approach forproducing iRNA, the short length (21-25 bp) of custom small interfering RNAs (siRNAs) facilitates the design of highly specific iRNA.

[0084] The terms “short hairpin RNA” and “small hairpin RNA” are encompassed by the term “shRNA.” shRNAs are artificial RNAs having a secondary structure such that a portion of the RNA strand forms a hairpin loop. Expression of shRNA in cells is typically accomplished by delivery of a DNA construct to the cell, e.g., through a recombinant vector having an expression cassette facilitating transcription of the encoding DNA and production of the shRNA. shRNA is transcribed under the control of RNA Pol-II or Pol-III promoters, and folds into a structure resembling a siRNA duplex. shRNAs are then processed by DICER into siRNAs.

[0085] The term “dsRNA” (double stranded RNA) refers to long double-stranded RNA molecules that are cleaved by the enzyme DICER into short double-stranded fragments of about 20-25 nucleotide siRNAs.

[0086] RNA interference (RNAi) or Post-Transcriptional Gene Silencing (PTGS) refers to the biological process in which RNA molecules interfere or inhibit the expression of specific genes with complementary nucleotide sequences to the iRNA (gene-specific suppression of gene expression). RNAi results in the degradation of mRNA after transcription, resulting in reduced translation and protein expression.

[0087] RNA interference techniques employ genetic constructs that encode iRNA molecules, such as dsRNA and shRNA. Typically, the RNA constructs comprise sense and anti-sense sequences which are placed in regions flanking an intron sequence in proper splicing orientation with donor and acceptor splicing sites. Alternatively, spacer sequences of various lengths can be employed to separate self-complementary regions of sequence in the construct. During processing of the gene construct transcript, intron sequences can be spliced-out, allowing sense and anti-sensesequences, as well as splice junction sequences, to bind forming double-stranded RNA. Alternatively, where secondary structure inhibits splicing machinery, the intron sequences are not spliced out and the dsRNA is supplied as a hairpin structure. When the dsRNA is expressed in a cell, ribonucleases bind to and cleave the double-stranded RNA, initiating a cascade of events leading to degradation of the target mRNA molecules, and thereby silencing such target genes. The phenomenon of RNA interference using shRNA is described in Sheng et al., Front Bioeng Biotechnol. 2020 Aug 7;8:940 and generally in Bass, Nature 411 : 428-29 (2001); Elbahir et al., Nature 411 : 494-98 (2001); and Fire et al., Nature 391 : 806-11 (1998); and WO 01 / 75164, where methods of making interfering RNA also are discussed.

[0088] The iRNA can hybridize with the full-length mRNA encoded by the target gene or hybridize to a fragment of the target RNA or DNA (the target sequence). For example, to reduce expression of a target gene in a lepidopteran insect using RNAi, an expression cassette encoding an iRNA having the sequence of an mRNA transcribed from the target gene, or a substantially identical sequence (including those engineered not to translate the protein), or fragment thereof, is introduced into a yeast cell. The resulting yeast cell can then be fed to the lepidopteran to determine its ability to inhibit expression of the target gene and / or inhibit growth of the lepidopteran. Although the sequence of the iRNA used for RNAi need not be completely identical to mRNA transcribed from the target sequence of the target gene, it is typically substantially identical, e.g., at least 70%, 80%, 90%, 95%, 98%, or more identical to mRNA transcribed from the target sequence. It is known in the art that dsRNA molecules that are not perfectly complementary to mRNA transcribed from the target sequence (for example, having only 95% identity to mRNA transcribed from the target sequence) are effective to control insect pests (see, for example, Narva et al., U.S. Pat. No. 9,012,722).

[0089] Target genes can be selected based on a number of criteria, including gene essentiality, midgut expression level, and divergence from related species sequences. In the case of lepidopteran insects, suitable target genes encode, for example, ion channel proteins. Exemplary ion channel proteins targeted for suppression or silencing by RNAi in accordance with disclosed methods include potassium channel protein and potassium voltage-gated channel proteins. Exemplary potassium voltage-gated channel target includes Shaker and orthologs thereof. In some examples, disclosed iRNA biopesticides target the Shaker gene and orthologs thereof in lepidopteran insects. Non-limiting exemplary ion channel targets for disclosed iRNA biopesticides include Spodoptera jrugiperda potassium voltage-gated channel protein Shaker (GenBank ID LOCI 18262972) and Spodoptera litura potassium voltage-gated channel protein Shaker (LOCI 11360719). Additional exemplary genomic sequences of potassium voltage-gated channel protein Shaker are available to one of skill in the art, e.g., by accessing tools provided by the National Center for Biotechnology (NCBI), such as GenBank.

[0090] Gene suppression” or “down-regulation of gene expression” or “inhibition or suppression of gene expression” are used interchangeably and refer to a measurable or observable reduction in gene expression or a complete abolition of detectable gene expression at the level of protein product (“gene silencing”), and / or mRNA product from the gene. In some embodiments, gene suppression results in gene silencing, referring to the ability of the iRNA to target mRNA for degradation, resulting in disrupted translation, which prevents protein expression. For example, the ability of the iRNA to suppress or down-regulate an ion channel protein can lead to the suppression or inhibition of a lepidopteran’ s growth and maturation or lead to the organism’s death. The downregulation or inhibition may occur at the translational or post-translational stageof expression of the gene of interest by promoting transcript turnover, cleavage, or disruption of translation.

[0091] Inhibition of target gene expression may be quantified by measuring either the endogenous target RNA or the protein produced by translation of the target RNA and the consequences of inhibition can be confirmed by examination of the outward properties of the cell or organism. Techniques for quantifying RNA and proteins are well known to one of ordinary skill in the art. Multiple selectable markers are available that confer resistance to ampicillin, bleomycin, chloramphenicol, gentamycin, hygromycin, kanamycin, lincomycin, methotrexate, phosphinothricin, puromycin, spectinomycin, rifampicin, and tetracyclin, and the like.

[0092] In addition to inhibiting gene expression the provided nucleic acids, host cells, such as microbial cells, compositions, and methods may additionally reduce the production of the protein product of a target gene. Methods of quantifying proteins, such as comparing the production of a specific protein, e.g., Shaker or an ortholog thereof, in a lepidopteran after exposure to a microbial cell engineered to produce disclosed iRNA targeting that specific protein compared to protein levels in a lepidopteran exposed to a microbial cell engineered to produce iRNA targeting a gene absent from the lepidopteran’ s genome are known in the art and include, e.g., ELISA and Western blot analysis. See, e.g., Jay et al., Proc Natl Acad Sci USA. 2021 Oct 26; 118(43): e2107427118, Chang & Lovett, Biochem Mol Biol Educ. 2011 Jul;39(4):291-7, and Spencer et al., Biochem Biophys Res Cornmun. 1993 Feb 26; 191 (l):201 -6.

[0093] The term “gene” refers to a polynucleotide sequence that comprises control and coding sequences necessary for production of a polypeptide (protein). The polypeptide can be encoded by a full-length coding sequence or by any portion of the coding sequence. A gene includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences(introns) between individual coding segments (exons). The leader, the trailer as well as the introns include regulatory elements that are necessary during the transcription and the translation of a gene (e.g., promoters, enhancers, etc.). A gene may be an uninterrupted coding sequence or may include one or more introns contained between splice junctions. As used herein, a gene may include variants of the gene, which include, but are not limited to, modifications such as mutations, insertions, deletions, or substitutions of one or more nucleotides. A “target gene” is the gene targeted for down-regulation or suppression by the iRNA of the present technology, such as a gene encoding an ion channel protein. An “RNA target sequence,” alternatively referred to as a “target RNA sequence” can be transcribed from a target gene. Exemplary gene products of the target gene include potassium ion channel proteins and potassium voltage-gated ion channel proteins, including Shaker and orthologs thereof. A “gene product” can refer to either the mRNA or protein expressed from a particular gene.

[0094] The terms “nucleic acid,” “polynucleotide,” and “oligonucleotide” refer to a single or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5' to the 3' end. The monomer is typically referred to as a nucleotide. Nucleic acids can include modified nucleotides that permit correct read through by a polymerase and do not significantly alter expression of a polypeptide encoded by that nucleic acid.

[0095] The phrase “nucleic acid sequence encoding” refers to a nucleic acid, such as DNA, which is the template for transcription of a specific RNA molecule, e.g., a shRNA, a dsRNA, or an mRNA that is translated into a protein. The nucleic acid sequences include both the full-length nucleic acid sequences as well as non-full-length sequences derived from the full-length sequences. A coding sequence can include degenerate codons (relative to the native sequence) or sequences that provide codon preference in a specific host cell.

[0096] The term “promoter” refers to regions or sequence located upstream and / or downstream from the start of transcription and which are involved in recognition and binding of RNA polymerase and other proteins to initiate transcription. A “yeast promoter” is a promoter capable of initiating transcription in yeast cells. A yeast promoter can be a nucleic acid sequence originally isolated from a yeast, but promoters not initially isolated from a yeast are also considered “yeast promoters” for the purposes of this disclosure.

[0097] An “expression cassette” refers to a nucleic acid construct, which when introduced into a host cell (e.g., a yeast cell), results in transcription of an RNA molecule (e.g., dsRNA or mRNA). An expression cassette typically includes a sequence to be expressed, and sequences necessary for expression of the sequence to be expressed, such as a promoter operably linked to the sequence. Generally, an expression cassette is inserted into an expression vector to be introduced into a host cell.

[0098] The words “complementary” or “complementarity” refer to the ability of a nucleic acid in a polynucleotide to form a base pair with another nucleic acid in a second polynucleotide. For example, the sequence A-G-T is complementary to the sequence T-C-A. Complementarity can be partial, in which only some of the nucleic acids match according to base pairing, or complete, such as fully complementary or perfectly complementary, where all the nucleic acids match according to base pairing.

[0099] The terms “protein,” “peptide,” and “polypeptide” are used interchangeably to denote an amino acid polymer or a set of two or more interacting or bound amino acid polymers. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer.

[0100] The term “amino acid” refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified.

[0101] The terms “identical” or percent “identity,” in the context of two or more nucleic acids or proteins of the invention, refer to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acids that are the same (i.e., about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region, when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters, or by manual alignment and visual inspection. See e.g., the NCBI web site at ncbi.nlm.nih.gov / BLAST / . For example, the sequence of a dsRNA of the invention can be compared using the above techniques to the sequence of a target gene in an insect pest, taking into account the presence of uracil in the dsRNA and thymidine in the DNA. Sequences that have at least about 90% sequence identity using the methods described above are said to be “substantially identical.” This definition also refers to, and can be applied to, the compliment of a test sequence. The definition also includes sequences that have deletions and / or additions, as well as those that have substitutions. Optimal alignment of such sequences can be carried out by any of the publicly available algorithms or programs for determining sequence identity and alignment, e.g., BLAST.

[0102] In some embodiments, the reduction, inhibition, or suppression of expression of an ion channel protein in the lepidopteran insect results in life cycle disruptions, such as reduced viability, growth, development, or reproduction. Such assessments are within the grasp of one of skill in theart and described in, e.g., US11252965B2, US1 1117938B2, US20210054379A1, and US11198868B2. In some embodiments, the reduction, inhibition, or suppression of target gene expression is determined relative to a wild-type lepidopteran insect. In some embodiments, the reduction, inhibition, or suppression of target gene expression is determined relative to a lepidopteran contacted with a wild-type yeast, such as wild type Saccharomyces cerevisiae. In some embodiments, the reduction, inhibition, or suppression of target gene expression is determined relative to a lepidopteran contacted with a yeast, such as Saccharomyces cerevisiae, engineered to express an iRNA molecule that does not target a lepidopteran gene, e.g., lacks complementarity to an mRNA molecule transcribed from a lepidopteran target gene. Exemplary effects include the inability of egg, larva (caterpillar), or pupa to mature to adult stages, reductions in fitness, such as reproductive fitness, including reduced capacity for sexual reproduction by the insect, inhibition of differentiation and development, e.g., growth inhibition, inhibited muscle, appendage formation, and death. In some embodiments, the target gene required for maturation and / or growth refers to a gene necessary for the survival, growth, or development of larvae into an adult and may ultimately result in death. In some embodiments, the gene may inhibit the ability of the eggs to develop into larva (caterpillar), larva to develop into pupa, pupa to develop into adults, or any intervening developmental step. In some instances, the inhibition or suppression of the target gene results in the inability of an adult insect to survive.

[0103] In some examples, downregulation or inhibition of gene expression in cells of a lepidopteran can be confirmed by phenotypic analysis of the cell or the whole lepidopteran insect, for example death of egg, larva (caterpillar), pupa, and adult lepidopteran insects (which can be quantitated, for example, as percent (%) mortality). Ingestion of the iRNA, including compositions thereof, provide a % mortality of at least about 50%, alternatively at least about 60%, alternativelyat least about 70%, alternatively at least about 75%, alternatively at least about 80%, at least about 90%, alternatively at least about 95%, alternatively at least about 98%, alternatively at least about 100% of lepidopteran insects in a lepidopteran population, wherein each range is inclusive and including any and all numerical values and ranges in between.

[0104] Other methods of confirming downregulation of the gene expression are known in the art, and include, but are not limited to, measurement of mRNA or protein expression using molecular techniques such as RNA solution hybridization, nuclease protection, Northern hybridization, reverse transcription, gene expression monitoring with a microarray, antibody binding, enzyme-linked immunosorbent assay (ELISA), Western blotting, radioimmunoassay (MA), other immunoassays, or fluorescence-activated cell analysis (FACS) and the like.

[0105] In some embodiments, the target sequences of disclosed iRNA biopesticides are conserved in multiple lepidopteran genera and species but not conserved in non-targeted species. Through the identification and use of multiple larval lethal genes and multiple target sequences to each gene, nucleic acids, compositions, and methods of the disclosure are able to reduce, inhibit or eliminate insecticide resistance arising from a point mutation in any one target sequence.

[0106] Suitably, the sequences and genes targeted by the present technology are specific to lepidopteran insects. Downregulation or inhibition of target gene expression is “specific” when downregulation or inhibition of the target gene occurs without resulting in any detrimental effects on other genes of the targeted organism or genes of other non-related organisms (e.g., humans, mammals, etc ). The targeted sequences selected were analyzed and determined to have little risk for targeting genes in humans. Methods of determining if sequences specifically target human genes are known in the art, and include, for example, assessing human risk empirically throughtoxicity testing on human cells in vitro and on animal models in vivo, and in silico methods to select only risk-reduced sequences for siRNA synthesis.

[0107] Interfering RNA (iRNA) and Other Nucleic Acid Molecules

[0108] In some aspects, provided herein are interfering RNA molecules (iRNA) effective to inhibit the expression of a gene in a lepidopteran, such as by RNA interference. In additional aspects, provided are nucleic acid sequences, such as DNA sequences, encoding the disclosed iRNA molecules. Also provided are nucleic acid constructs comprising the iRNA molecules and nucleic acid sequences encoding the same. In further aspects, provided are microbial host cells, such as a yeast cell, bacterial cell, plant cell, or algal cell comprising the disclosed iRNA and nucleic acid sequences encoding the same. Herein, the disclosed iRNA molecules may be referred to simply as “iRNA.”

[0109] Interfering RNA (iRNA)

[0110] In some aspects, provided is an iRNA molecule comprising at least one dsRNA, such as an shRNA, where the dsRNA is a region of double-stranded RNA comprising annealed strands that are either partially or fully complementary. In some embodiments, one strand of the dsRNA comprises a sequence of at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, at least 200, at least 210, at least 220, at least 230, at least 240, at least 250, at least 260, at least 270, at least 280, at least 290, or at least 300 contiguous nucleotides which is partially or fully complementary to a target nucleotide sequencewithin a lepidopteran target gene, such as a gene encoding a potassium ion channel protein, including a potassium voltage-gated ion channel protein.

[0111] In some embodiments, one strand of the dsRNA comprises a sequence of 15 to 30 contiguous nucleotides, 20 to 30 contiguous nucleotides, 25 to 35 contiguous nucleotides, 30 to 50 contiguous nucleotides, 45 to 75 contiguous nucleotides, 50 to 100 contiguous nucleotides, 65 to 125 contiguous nucleotides, 75 to 150 contiguous nucleotides, 85 to 120 contiguous nucleotides, 100 to 150 contiguous nucleotides, 125 to 175 contiguous nucleotides, 150 to 200 contiguous nucleotides, 300 to 600 contiguous nucleotides, 450 to 600 contiguous nucleotides, 500 to 650 contiguous nucleotides, or 550 to 750 contiguous nucleotides, wherein each range is inclusive, which is partially or fully complementary to a target nucleotide sequence within a lepidopteran target gene, such as a gene encoding an ion channel protein, such as a potassium voltage-gated ion channel protein.

[0112] In some embodiments, disclosed iRNA has at least 60% complementarity, at least 65% complementarity, at least 70% complementarity, at least 75% complementarity, at least 80% complementarity, at least 85% complementarity, at least 86% complementarity, at least 87% complementarity, at least 88% complementarity, at least 89% complementarity, at least 90% complementarity, at least 91% complementarity, at least 92% complementarity, at least 93% complementarity, at least 94% complementarity, at least 95% complementarity, at least 96% complementarity, at least 97% complementarity, at least 98% complementarity, at least 99% complementarity, or 100% complementarity to a messenger RNA (mRNA) transcript that has been transcribed from a target nucleotide sequence within a lepidopteran target gene, such as a gene encoding a potassium ion channel protein.

[0113] In some embodiments, the disclosed percent identity is to at least a 19, at least a 20, at least a 21, at least a 22, at least a 23, at least a 24, at least a 25, at least a 26, at least a 27, at least a 28, at least a 29, at least a 30, at least a 35, at least a 40, at least a 45, at least a 50, at least a 55, at least a 60, at least a 65, at least a 70, at least a 75, at least a 80, at least a 85, at least a 90, at least a 95, at least a 100, at least a 110, at least a 120, at least a 130, at least a 140, at least a 150, at least a 160, at least a 170, at least a 180, at least a 190, at least a 200, at least a 210, at least a 220, at least a 230, at least a 240, at least a 250, at least a 260, at least a 270, at least a 280, at least a 290, or at least a 300 contiguous nucleotide fragment of a target ant gene.

[0114] In some embodiments, the iRNA effective to inhibit the expression of a gene in a lepidopteran is a small interfering RNA (siRNA), a short hairpin RNA (shRNA), double stranded RNA (dsRNA), or RNA construct. In some embodiments, the siRNA, shRNA, dsRNA, or RNA construct is encoded by a DNA construct, such as a recombinant vector comprising an expression cassette, which allows for expression of the iRNA within a host cell, such as a yeast cell.

[0115] In some embodiments, disclosed iRNA inhibits the expression of an ion channel protein in any of an Australian painted apple caterpillar or moth, armyworm caterpillar or moth, beet armyworm caterpillar or moth, cactus caterpillar or moth, carob caterpillar or moth, cotton bollworm caterpillar or moth, diamondback caterpillar or moth, codling caterpillar or moth, apple worm caterpillar or moth, pink bollworm caterpillar or moth, fall armyworm caterpillar or moth, Southern armyworm caterpillar or moth, com earworm caterpillar or moth, soybean looper caterpillar or moth, tobacco cutworm caterpillar or moth, fruit borer, pod borer, shoot borer, diamond bollworm, Asian corn borer, European corn borer, false codling moth, Western bean cutworm, or a velvetbean caterpillar or moth.

[0116] For example, disclosed iRNA biopesticides can be used to control lepidopteran populations including A brostola spp., Agrochola spp., Agrotis spp., Allophyes spp., e.g., Allophyes oxyacanthae, Amphipoea spp., Anorthoa spp., e.g., Anorthoa munda, Anticarsia spp., e.g., Anticarsia gemmatalis, Apamea spp., Asteroscopus spp., Atethmia centrago, Autograph spp., Brachlomia spp., Brachlomia viminalis, Cactoblastis spp., e.g., Cactoblastis cactorun, Carastis spp., Chrysodeixis spp., e.g., Chrysodeixis includens, Cosmia spp., Cydia spp., e.g., Cydia pomonella, Dasypolia spp., e.g., Dasypolia templi, Diachrysia spp., e.g., Diachrysia chrysitis, Diarsia spp., Dicycla spp., Diloba spp., e.g., Diloba caeruleocephala, Dryobota spp., e.g., Dryobota labecula, Dryobotodes spp., e.g., Dryobotodes eremita, Ectomyelois spp., e.g., Ectomyelois ceratoniae, Eremobia spp., e.g., Eremobia ochroleuca, Euplexia spp., e.g., Euplexia lucipara, Eupsilia spp., e.g., Eupsilia transversa, Fissipunctia spp., e.g., Fissipunctia ypsillon, Globia spp., e.g., Globia sparganii, Gortyna spp., e.g., Gortyna flavago, Griposia spp., e.g., Griposia aprilina, Hecatera spp., e.g., Hecatera dysodea, Helicoverpa spp., e.g., Helicoverpa armigera and Helicoverpa zea, Heliothis spp., Herminia spp., e.g., Herminia starsipennalis, Hoplodrina spp., Hydr aecia spp., e.g., Hydrae ci a micacea, Hypena spp., e.g., Hypena proboscidalis, Hyppa spp., e.g., Hyppa rectilinea, Lacanobia spp., Laspeyria spp, e.g., Laspeyria flexula, Leucania spp., e.g., Leucania comma, Lithophane spp., e.g., Lithophane leautieri, Lithophane ornitopus, Lithophane semibrunnea, Lithophane socia, and Lithosia quadra, Luperina spp., e.g., Luperina nickerlii, Lymantria spp., e.g., Lymantria dispar, Mamestra spp., e.g., Mamestra brassicae, Melanchra spp., e.g., Melanchrapersicariae, Mesoligia spp., e.g., Mesoligia furuncula, Mythimna spp., e.g., Mythimna albipuncta, Oligia spp., Omphaloscelis spp., e.g., Omphaloscelis lunosa, Orthosia spp., Pectinophora spp., e.g., Pectinophora gossypiella, Pelosia spp., e.g., Pelosia muscerda, Plusia spp., e.g., Plusia festucae, Polia spp., e.g., Polia nebulosa,Plutella spp., Plutella xylostella, Polymixis spp., Protodeltot spp., e.g., Protodeltot pygarga, Pyrrhiaspp., e.g., Pyrrhia umbra, Shargacucullia spp., e.g., Shargacucullia verbasci, Spodoptera spp., e.g., Spodoptera cosmioides, Spodoptera eridania, Spodoptera exigua, Spodoptera frugiperda, and Spodoptera litura, Subacronicta spp., e.g., Subacronicta megacephal, Teia spp., e.g., Teia anartoides, Thalpophila spp., e.g., Thalpophila matura, Tholera spp., e.g., Tholera decimalis, Thaumatotibia spp., e.g., Thaumatotibia leucotreta, Tiliacea spp., Xanthia spp., and combinations thereof.

[0117] In some embodiments, the target gene includes a DNA sequence that is at least 80%, 84%, 88%, 90%, 92%, or 96% identical to any one of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46. In some embodiments, the target gene includes a DNA sequence having about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to any one of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46. In some embodiments, the target lepidopteran comprises a DNA target sequence represented by any one of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46.

[0118] In some embodiments, a disclosed iRNA molecule effective to inhibit the expression of an ion channel protein in a lepidopteran is partially complementary to mRNA transcribed fromany one of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO:10, SEQ ID NO:13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46, or a sequence that has at least 80%, 84%, 88%, 90%, 92%, or 96% identity to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46 In some embodiments, an iRNA molecule effective to inhibit the expression of an ion channel protein in a lepidopteran is fully complementary to mRNA transcribed from any one of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46, or a sequence that has at least 80%, 84%, 88%, 90%, 92%, or 96% identity to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO:10, SEQ ID NO:13, SEQ ID NO:16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46

[0119] In some embodiments, a disclosed iRNA molecule effective to inhibit the expression of a gene in a lepidopteran comprises a sequence of 20-30, 21-29, 22-28, 23-27, or 24-26 contiguous nucleotides that is complementary to mRNA transcribed from a target gene sequence, wherein each range is inclusive. In some embodiments, the iRNA molecule effective to inhibit the expression of a gene in a lepidopteran comprises 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 contiguous nucleotides that are partially or perfectly complementary to mRNA transcribed from a target gene in a lepidopteran. The target gene mayinclude a DNA sequence represented by SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO:10, SEQ ID NO:13, SEQ ID NO:16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46, or a sequence that has at least 80%, 84%, 88%, 90%, 92%, or 96% identity to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46.

[0120] In some embodiments, the iRNA is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% complementary to a portion of mRNA transcribed from the target gene. In some embodiments, the iRNA is about 70% to 99%, 75% to 95%, 80% to 90%, or 85% to 90% complementary to a portion of mRNA transcribed from the target gene, wherein each range is inclusive. In some embodiments, the iRNA is at least or about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary to a portion of mRNA transcribed from the target gene. In some embodiments, the iRNA is perfectly complementary to a portion of mRNA transcribed from the target gene. The target gene may include a DNA sequence represented by SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46, or a sequence that has at least 80%, 84%, 88%, 90%, 92%, or 96% identity to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ IDNO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46.

[0121] In some embodiments, the iRNA is an RNA construct, a double stranded RNA(dsRNA), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), or an anti-sense oligonucleotide. In preferred embodiments, the iRNA is an shRNA.

[0122] Nucleic Acid Sequences Encoding iRNA

[0123] In some aspects, provided herein are nucleic acid sequences, such as DNA sequences, encoding iRNA effective to inhibit the expression of a target gene in a lepidopteran. In some embodiments, an expression vector comprises the DNA sequence encoding iRNA effective to inhibit the expression of a gene in a lepidopteran. In some embodiments, a microbial cell, such as a yeast cell, comprises the expression vector. Herein, the term “expression vector” may be used interchangeably with “recombinant vector.”

[0124] Suitable DNA constructs will depend on the type of cell in which to express the RNA. In some embodiments, the DNA construct is a linear or a closed circular plasmid or expression vector. In some embodiments, the DNA constructs will be integrated into the host cell genome, for example, integrated into the genome of a microbial cell, algal cell, or plant cell.

[0125] In some embodiments, the DNA construct is a suitable expression vector. Sequences that encode the iRNA of the present technology can be inserted into a vector under the control of a suitable promoter that functions in one or more microbial hosts to drive expression of a linked coding sequence or other DNA sequence. Suitable vectors are known in the art and selecting the appropriate vector will depend on the size of the nucleic acid to be inserted into the vector and the particular host cell to be transformed with the vector. Vectors may include one, but are not limited to, one or more of the following: a signal sequence, an origin of replication, one or more selectable marker genes, terminators, enhancers and / or a constitutive or inducible promoter allowing expression of exogenous DNA. Vectors can also include viral vectors and the like.

[0126] Host cells, such as yeast cells, can be engineered to include such vectors, e.g., Saccharomyces cerevisiae. Suitable promoters for expression in yeast are well known and include, for example, the bacteriophage T7 promoter, promoters from GALI (which is induced by the presence of galactose), ADH1, the TEF1 promoter and the AOX promoter (a methanol inducible promoter), and the like. Various methods are available to transform S. cerevisiae cells with exogenous DNA and producing recombinant products. For example, transformed cells are selected by phenotype determined by a selectable marker, commonly drug resistance or the ability to grow in the absence of a particular nutrient (e.g., leucine).

[0127] In some embodiments, auxotrophic yeast strains are transformed with exogenous DNA encoding disclosed iRNA. Use of these strains relies on marker genes that encode key enzymes in various essential metabolic pathways. Examples include the URA, HIS3, LEU2, TRP1, and MET 15 marker genes, which encode essential enzymes for de novo synthesis of pyrimidines, 1- histidine, 1-leucine, 1-tryptophan, and 1-methionine, respectively. Yeast strains are auxotrophic for the nutrient in question due to the absence of a functional chromosomal copy of the marker gene. The auxotrophic yeast strains can thus be propagated only in media that contain the appropriate nutrients. Synthetic auxotrophs may also be engineered to require particular compounds.

[0128] In some embodiments, more than one iRNA may be expressed by a single recombinant vector introduced into a host cell. In some embodiments, more than one iRNA may be expressed by multiple recombinant vectors introduced into a host cell. In some embodiments, the recombinant vector comprises multiple expression sites, each site able to drive the expression of a different nucleotide sequence. By this method, multiple iRNAs can be expressed in a single cell, where the multiple iRNA can either target multiple sites on a single gene or target multiple geneswithin at least one lepidopteran species. The host cell can be a microbial cell, an algal cell, or a plant cell.

[0129] In some embodiments the vector is a plasmid. Other vectors include artificial chromosomes and linear nucleic acid molecules that are distinct from linearized plasmids. In some embodiments the vector is an integrating vector. In some embodiments the vector comprises an expression control element operably linked to a nucleic acid to be transcribed, e.g., DNA encoding disclosed iRNA. Three well known plasmid systems used for recombinant expression and replication in yeast cells include integrative plasmids, low-copy-number ARS-CEN plasmids, and high-copy-number 2p plasmids. See, e.g., Christianson et al., Gene. 1992;110: 119-22; Sikorski, "Extrachromosomal cloning vectors of Saccharomyces cerevisiae" , in Plasmid, A Practical Approach, Ed. K. G. Hardy, IRL Press, 1993; Parent, S.A., and Bostian, K.A., Recombinant DNA technology: yeast vectors, p. 121-178. In Wheals, A.E., et al. (eds.) The yeasts, vol. 6. Yeast genetics. Academic Press, Longon, UK (1995).

[0130] An example of integrating plasmids of use in budding yeast are Yip plasmids, which are maintained at one copy per haploid genome and inherited in Mendelian fashion. Such a plasmid, containing a nucleic acid of interest, a bacterial origin of replication and a selectable gene (typically an antibiotic- resistance marker), is typically produced in bacteria. The purified vector may be linearized and used to transform competent yeast cells. YCp plasmids, which contain the autonomous replicating sequence (ARSl) and a centromeric sequence (CEN4), are examples of low-copy- number ARS-CEN plasmids. These plasmids are usually present at 1-2 copies per cell. An example of the high-copy-number 2p plasmids are YEp plasmids, which contain a sequence approximately 1 kb in length (named the 2p sequence). The 2p sequence acts as a yeast replicon giving rise to higher plasmid copy number. These plasmids may require selection for maintenance.

[0131] In some embodiments, the recombinant vector comprises an expression cassette comprising a promoter operably linked to a DNA sequence encoding an iRNA molecule that specifically inhibits expression of a target gene in a lepidopteran, such as a gene encoding an ion channel protein, e.g., a potassium voltage-gated ion channel protein. In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter is an inducible promoter. In some embodiments, the promoter is a yeast promoter.

[0132] Yeast vectors, e.g., plasmids, described herein may also contain expression control sequences, e.g., promoter sequences. A "promoter" is a control sequence that is a region of a nucleic acid sequence at which initiation and rate of transcription are controlled. It may contain genetic elements at which regulatory proteins and molecules may bind, such as RNA polymerase and transcription factors, to initiate the transcription of a nucleic acid sequence. The phrase "operably linked" indicates that an expression control element, e.g., a promoter, is in an appropriate location and / or orientation in relation to a nucleic acid to control transcriptional initiation and / or expression of the nucleic acid.

[0133] A promoter may be one that is naturally associated with a nucleic acid sequence, as may be obtained by isolating the 5' non-coding sequences located upstream of the coding segment. Alternatively, a promoter may be a recombinant or heterologous promoter, which refers to a promoter that is not normally associated with a nucleic acid segment in its natural environment. Such promoters may include promoters of other genes and promoters that are not naturally occurring. An expression control element may be derived from a yeast of the species or strain in which RNAi is to be used or in which the RNAi pathway is to be engineered. For example, if RNAi is to be used in S. cerevisiae, it may be desirable to use a S. cerevisiae promoter to direct expressionof a dsRNA. However, any expression control element capable of directing transcription in the cell of interest may be used.

[0134] The promoters employed may be either constitutive or inducible. For example, various yeast-specific promoters may be employed to regulate the expression in yeast cells. Examples of inducible yeast promoters include GALI- 10, GALI, GALL, GALS, TET, CUP1, VP16 and VP16-ER. Examples of repressible yeast promoters include Met25. Examples of constitutive yeast promoters include glyceraldehyde 3 -phosphate dehydrogenase promoter (GPD), phosphoglycerate kinase (PGK), alcohol dehydrogenase promoter (ADH), translation- elongation factor- 1 -alpha promoter (TEF), cytochrome c-oxidase promoter (CYC1), and MRP7. Promoters containing steroid response elements (e.g., glucocorticoid response element) inducible by glucocorticoid or other steroid hormones can also direct expression in yeast. Yet other yeast constitutive or inducible promoters such as those of the genes for alpha factor, phosphate pathway genes (e.g., PH05), or alcohol oxidase may be used. In some embodiments, the vector comprises an expression control element known as an upstream activating sequence (UAS).

[0135] Additional yeast promoters which may be used in accordance with the present disclosure include RNA polymerase III promoters, e.g., SNR52 and the like. Further exemplary yeast promoters include pADHl, pTEFl, ScRNR2, pTEFl, pADHl, pTPIl, pHXT7, pTDH3, pPGKl, pPYKl, pHXT7, pGALl, and pGALlO. Such promoters are described, e.g., by Waterham et al., Gene. 1997 Feb 20;186(l):37-44, Partow et al., Yeast. 2010 Nov;27(l l):955-64, Microb Cell Fact. 2013 Sep 23: 12:82, Zha et al., PLoS One. 2013 Jul 2;8(7):e68317, Hector et al., N Biotechnol. 2019 Nov 25:53: 16-23, Sun et al., Biotechnol Bioeng. 2012 Aug;109(8):2082-92, and Silva & Srikrishnan, FEMS Yeast Res. 2012 Mar;12(2): 197-214.

[0136] Such elements, which are considered functional equivalents of metazoan enhancers, can activate gene transcription from remote positions, e.g., up to about 1,000 - 1,200 bp from the promoter. See, e.g., Petrascheck, M, et al., Nucleic Acids Res., 33(12): 3743-3750, 2005, for discussion. The level of expression achieved using an inducible promoter can be regulated, e.g., by controlling the amount of inducing agent or the length of exposure. Further, mutant promoters that result in lower expression levels than a wild type promoter can be used. In some embodiments, an expression control element originates from a species in which the expression control element is to be used to direct expression while in other embodiments the expression control element originates from a different species.

[0137] In some embodiments, the recombinant vector is a plasmid, such as an integrating plasmid. In some embodiments, the plasmid is a pRS plasmid (e.g., pRS3O3, pRS304, pRS305 or pRS306 or other integrative plasmids). In some embodiments, the plasmid is an extrachromosomal plasmid (e.g., pRS313, pRS314, pRS315, pRS316, pRS413, pRS414, pRS415, pRS416, pRS423, pRS424, pRS425, pRS426). In some embodiments the plasmid is a member of the YES™ Vector Collection, e.g., pYES (Invitrogen, Carlsbad, CA). In some embodiments, the plasmid is a Gateway plasmid. See, e g., Geiser. Biotechniques, 38:378-382 (2005); Van Mullem V, et al., Construction of a set of Saccharomyces cerevisiae vectors designed for recombinational cloning. See, e.g., Alberti et al., Yeast, 2007;24(10):913-9. Such vectors are described in, e.g., W02011031319A8.

[0138] In some embodiments, the recombinant vector comprises an expression cassette comprising a yeast promoter operably linked to a DNA sequence encoding an iRNA molecule that specifically inhibits expression of an ion channel protein in a lepidopteran. The ion channel proteincan include a potassium ion channel protein, a potassium voltage-gated channel protein, or a combination thereof.

[0139] In some embodiments, the expression cassette comprises a yeast promoter operably linked to a DNA sequence encoding an iRNA molecule, where the iRNA molecule is partially or perfectly complementary to mRNA transcribed from a DNA sequence represented by SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NQ:10, SEQ ID NO:13, SEQ ID NO:16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46, or a sequence having at least about 80%, 84%, 88%, 92%, or 96% identity to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46. In some embodiments, the expression cassette comprises a yeast promoter operably linked to a DNA sequence encoding an iRNA molecule, where the DNA sequence is represented by SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NQ:20, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO: 45, SEQ ID NO:47, or SEQ ID NO:48, or a DNA sequence having at least 70%, 75%, 80%, 85%, 90%, or 95% sequence identity to any of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NQ:20, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:24,SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO: 45, SEQ ID NO:47, or SEQ ID NO:48, or the complement thereof. In some embodiments, the yeast promoter is a GPD promoter, alternatively referred to as a GAP, GADPH, or TDH3 promoter. The GPD promoter is a strong constitutive yeast expression promoter from glyceraldehyde 3-phosphage dehydrogenase.

[0140] In one representative example, a pRS426 GPD vector may contain nucleic acid sequences encoding iRNA effective to inhibit the expression of a gene in a lepidopteran. An exemplary pRS426 sequence is represented by SEQ ID NO: 60, and a GPD promoter sequence is represented by SEQ ID NO:59. The pRS426 GPD yeast shuttle vector permits constitutive expression of inserts cloned into the multiple cloning sites downstream of a GPD promoter and upstream of a cycl terminator. See, e.g., Mumberg & Funk, Gene. 1995 Apr 14; 156(1): 119-22 and Mysore et al., Methods Moi Biol. 2019; 1858: 213-231.

[0141] In some embodiments, the pRS426 GPD vector comprises an expression cassette encoding iRNA effective to inhibit the expression of a potassium channel, a potassium voltagegated channel protein, or an ortholog thereof in a lepidopteran. In some embodiments, the pRS426 GPD vector comprises an expression cassette encoding iRNA effective to inhibit the expression of an ion channel protein, such as potassium voltage-gated channel protein Shaker or an ortholog thereof in a lepidopteran.

[0142] In some embodiments, the DNA sequence encoding disclosed iRNA includes a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identical to the entire length of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:17, SEQID NO:18, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO: 45, SEQ ID NO:47, or SEQ ID NO:48, or the complement thereof In some embodiments, the DNA sequence encoding disclosed iRNA has about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the entire length of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO: 45, SEQ ID NO:47, or SEQ ID NO:48, or the complement thereof. In some embodiments, the DNA sequence encoding disclosed iRNA includes a sequence that is 100% identical to the entire length of any of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO: 45, SEQ ID NO:47, or SEQ ID NO:48 In some embodiments, a DNA construct comprising DNA encoding disclosed iRNA has double stranded DNA that is identical (100% identity) to the entire length of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:17, SEQID NO:18, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO: 45, SEQ ID NO:47, or SEQ ID NO:48

[0143] Alternatively, techniques available to one of skill in the art may be used to achieve stable integration of the disclosed expression cassettes, such as stable transformation and expression into a host organism, e.g., Saccharomyces cerevisiae. Exemplary methods and techniques include transposon systems, e.g., PiggyBac, CRISPR, lithium acetate (LiAc)-based methodologies, electroporation, gene gun transformation, and protoplast transformation. Such methods are described in, e.g., Uetake & Niki, / / ? Vitro Cell Dev Biol Anim. 2011 Dec;47(10):689- 94, Kildegaard et al., Yeast. 2019 May; 36(5): 237-247.

[0144] In some embodiments, the iRNA is produced by a host cell which can express the iRNA from a DNA construct or expression vector comprising an expression cassette comprising DNA encoding the iRNA. Suitable cells include, but are not limited to, a bacterial, algal or yeast cell engineered to produce or express the iRNA from the encoding DNA sequence. Other suitable host cells, e.g., microorganism cells or plant cells, are known in the art. In some embodiments, the host cell expresses at least two unique iRNA molecules, alternatively at least three unique iRNA molecules, alternatively at least four unique iRNA molecules. In some embodiments, the host cell expresses from 1 to 10 unique iRNA molecules.

[0145] Host Cells Containing iRNA and Nucleic Acid Sequences Encoding the Same

[0146] In some aspects, provided herein are host cells comprising iRNA effective to inhibit the expression of a gene in a lepidopteran. In some embodiments, the host cell comprises an expression vector comprising nucleic acid sequences, such as DNA sequences, encoding iRNAeffective to inhibit the expression of a gene in a lepidopteran. In some embodiments, the host cell is a yeast cell, bacterial cell, algal cell, or plant cell. In some embodiments, the host cell is alive. In some embodiments, the host cell is dead.

[0147] In some embodiments, the host cell expresses at least one iRNA which targets a gene of interest for inhibition. In some embodiments, the host cell expresses at least two, three, four, or five iRNA molecules which target a gene of interest for inhibition. In some embodiments, the microbial host cell expresses any of from 1 to 15, 1 to 10, or 1 to 5 iRNA which target a gene of interest for inhibition. The iRNA molecules can be identical or distinct.

[0148] In some embodiments, the host cell expresses at least two unique iRNA that target a single gene, alternatively at least three unique iRNA that target a single gene, alternatively at least four RNA that target a single gene. In some embodiments, the host cell expresses at least two unique iRNA that target two different genes, alternatively at least three unique iRNA that target at least two different genes, alternatively at least three unique iRNA that target at least two different genes, alternatively at least three unique iRNA that target at least two different genes.

[0149] In one representative example, a microbial cell, such as a yeast cell, expresses at least two unique iRNA molecules that target an ion channel protein, including Shaker and orthologs thereof. In some embodiments, a host cell expresses at least three unique iRNA molecules that target an ion channel protein, including Shaker and orthologs thereof. In some embodiments, a host cell expresses at least three unique iRNA molecules that target an ion channel protein, including Shaker and orthologs thereof. In some embodiments, a microbial cell expresses at least four unique iRNA molecules that target an ion channel protein, including Shaker and orthologs thereof.

[0150] In some embodiments, the host cells are stably transformed with nucleic acid sequences encoding iRNA. In some embodiments, a disclosed expression cassette is integrated into the genomic DNA of the microbial host cell, such as Saccharomyces cerevisiae. In some embodiments, DNA encoding disclosed iRNA is integrated into the genomic DNA of the microbial host cell, such as Saccharomyces cerevisiae. Stable transformants may be produced by incorporating a DNA construct comprising a nucleotide sequence encoding iRNA into the host cell genome. Methods of forming stable transformants of host cells are known in the art and include, e.g., transformation of integrative plasmids.

[0151] In some embodiments, a yeast cell comprises iRNA effective to inhibit the expression of a target gene in a lepidopteran. In some embodiments, a bacterial cell comprises iRNA effective to inhibit the expression of a target gene in a lepidopteran. In some embodiments, the bacterial cell is Escherichia coli, Bacillus thuringiensis israelensis, or Lactobacillus spp., among others. In some embodiments, an algal cell comprises iRNA effective to inhibit the expression of a target gene in a lepidopteran. In some embodiments, a plant cell comprises iRNA effective to inhibit the expression of a target gene in a lepidopteran.

[0152] In some embodiments, a yeast cell comprises a DNA sequence encoding iRNA effective to inhibit the expression of a target gene in a lepidopteran. In some embodiments, a bacterial cell comprises a DNA sequence encoding iRNA effective to inhibit the expression of a target gene in a lepidopteran. In some embodiments, the bacterial cell is Escherichia coli. In some embodiments, an algal cell comprises a DNA sequence encoding iRNA effective to inhibit the expression of a target gene in a lepidopteran. In some embodiments, a plant cell comprises a DNA sequence encoding iRNA effective to inhibit the expression of a target gene in a lepidopteran.

[0153] In some embodiments, a yeast cell comprises iRNA effective to inhibit the expression of a target gene in a lepidopteran. In some embodiments, the yeast cell is a species of Saccharomyces . In some embodiments, the yeast cell is Saccharomyces cerevisiae. In some embodiments, a Saccharomyces cerevisiae cell comprises iRNA effective to inhibit the expression of a target gene in a lepidopteran. Other suitable host cells will be evident to one of skill in the art. The host cell may be alive or dead. In some embodiments, the host cell is spray-dried, heat-killed, lyophilized, or suspended in an aqueous medium.

[0154] In some embodiments, a host cell includes a DNA sequence encoding iRNA effective to inhibit the expression of an ion channel protein, such as potassium voltage-gated channel protein Shaker and orthologs thereof, in a lepidopteran. In some embodiments, the target gene includes a DNA sequence represented by any one of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO:10, SEQ ID NO:13, SEQ ID NO:16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO: 43, or SEQ ID NO: 46, or a sequence having at least 84%, 88%, 92%, or 96% sequence identity to the entire length of any one of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO:10, SEQ ID NO:13, SEQ ID NO:16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46

[0155] In some embodiments, a host cell contains an expression vector including a DNA sequence encoding iRNA effective to inhibit the expression of an ion channel protein, such as potassium voltage-gated channel protein Shaker or ortholog thereof, in a lepidopteran. In some embodiments, the expression vector encodes at least one iRNA molecule that is partially or completely complementary to mRNA transcribed from SEQ ID NO:1, SEQ ID NO:2, or SEQID NO:3, SEQ ID NO:10, SEQ ID NO:13, SEQ ID NO:16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46, or a sequence having at least 84%, 88%, 92%, or 96% sequence identity to the entire length of any one of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO:10, SEQ ID NO:13, SEQ ID NO:16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46

[0156] In some embodiments, the host cell contains an expression vector that includes an expression cassette containing a DNA sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity to the entire length of any one of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO: 45, SEQ ID NO:47, or SEQ ID NO:48, or the complement thereof operably linked to a promoter. In some embodiments, the expression vector contains an expression cassette including a DNA sequence represented by the entire length of any of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO: 45, SEQ ID NO:47, or SEQ IDNO:48, operably linked to a promoter. In some embodiments, the expression vector comprises double stranded DNA that is identical (100% identity) to the entire length of SEQ ID NO:4 and SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:9, SEQ ID NO: 11 and SEQ ID NO: 12, SEQ ID NO: 14 and SEQ ID NO: 15, SEQ ID NO: 17 and SEQ ID NO: 18, SEQ ID NO:20 and SEQ ID NO:21, SEQ ID NO:23 and SEQ ID NO:24, SEQ ID NO:26 and SEQ ID NO:27, SEQ ID NO:29 and SEQ ID NO:30, SEQ ID NO:32 and SEQ ID NO:33, SEQ ID NO:35 and SEQ ID NO:36, SEQ ID NO:38 and SEQ ID NO:39, SEQ ID NO:41 and SEQ ID NO:42, SEQ ID NO:44 and SEQ ID NO: 45, or SEQ ID NO:47 and SEQ ID NO:48. A non-limiting embodiment of a recombinant vector is a pRS426 vector. The pRS426 vector may contain a GPD promoter. The host cell can be spray-dried, heat-killed, lyophilized, or suspended in an aqueous medium

[0157] In order to avoid introducing the replicating host cells or live microorganisms into the environment, host cells may be killed or inactivated, e.g., unable to grow and / or replicate, before being incorporated into the compositions described herein. Host cells are preferably killed or inactivated in a manner that maintains the ability of the host cell to act as a larvicide, i.e., the inactivation does not disrupt the iRNA molecules contained within said host cell. In some embodiments, the iRNA can be purified from the host cell before incorporating into the compositions. Suitable methods of killing or inactivating the host cell are known in the art, and include, but are not limited to, heat-inactivation, high pressure, plasma treatment at atmospheric pressure, sonication, low-amperage electric treatment, or dense phase carbon dioxide processing. Concerns about introducing live organisms into treated sites can be ameliorated by using heat- killed microbial host cells, which retain insecticidal potency.

[0158] Compositions

[0159] In some aspects, provided herein are compositions comprising iRNA effective to inhibit the expression of a gene in a lepidopteran. In additional aspects, provided are compositions comprising nucleic acid sequences, such as DNA sequences, encoding iRNA effective to inhibit the expression of a gene in a lepidopteran. In further aspects, provided are compositions comprising microbial cells comprising disclosed iRNA and nucleic acid sequences encoding the same. Also provided are compositions further comprising an attractant, a phagostimulant, an insecticide, or a combination thereof, in addition to the disclosed iRNA, nucleic acid sequences encoding the iRNA, and microbial host cells comprising the same.

[0160] In some embodiments, a disclosed composition comprises two or more unique iRNA molecules, wherein the two or more iRNA molecules are present on, such as encoded by, the same nucleic acid construct, on different nucleic acid constructs, or any combination thereof. In some embodiments, a disclosed composition comprises two or more nucleic acid sequences, such as DNA sequences, wherein the two or more nucleic acid sequences each encode a different interfering RNA molecule.

[0161] In some embodiments, a disclosed composition comprises bacterial cells, yeast cells, algal cells, or a combination thereof. In some embodiments, a disclosed composition comprises nanoparticles, e.g., chitosan nanoparticles. In some embodiments, a disclosed composition is suitable for larval soaking. In some embodiments, a disclosed composition is suitable for sugar feeding. In some embodiments, a disclosed composition is provided in a trap, such as a lepidopteran trap. In some embodiments, a disclosed composition is provided in the form of a dried tablet. In some embodiments, a disclosed composition is suitable for topical application, such as application on areas or surfaces where lepidopteran insects are likely to encounter the compositions. Other suitable methods of delivery are known in the art. Thus, compositions mayinclude the necessary components to deliver the iRNA to insects, such as lepidopteran insects. For example, compositions may comprise nanoparticles, bacterial cells, yeast cells, algal cells and the like that contain or express the iRNA.

[0162] Microbial Host Cell Compositions

[0163] In some aspects, provided are compositions comprising a microbial cell containing an expression cassette comprising a promoter operably linked to a DNA sequence encoding an iRNA molecule that specifically inhibits expression of a target gene in a lepidopteran. In some embodiments, the microbial cell is a yeast cell, a bacterial cell, a plant cell, or an algal cell. In preferred embodiments, the microbial cell is a yeast cell.

[0164] In some embodiments, the composition comprises a yeast cell engineered to produce iRNA effective to inhibit expression of a target gene in a lepidopteran. In some embodiments, the composition comprises a bacterial cell engineered to produce iRNA effective to inhibit expression of a target gene in a lepidopteran. In some embodiments, the composition comprises an algal or plant cell engineered to produce iRNA effective to inhibit expression of a target gene in a lepidopteran, where the target gene encodes an ion channel protein, such as potassium voltagegated channel protein Shaker or an ortholog thereof.

[0165] In some embodiments, a target sequence is represented by any one of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46, or a sequence having at least 84%, 88%, 92%, or 96% sequence identity to the entire length of any one of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, SEQ IDNO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46.

[0166] In some embodiments, any of the yeast, bacterial, algal, or plant cell are alive. In other embodiments, any of the yeast, bacterial, algal, or plant cell are dead. In additional embodiments, any of the yeast, bacterial, algal, or plant cell is killed by heat, such as heat-killed, and / or lyophilized. In some embodiments, any of the yeast, bacterial, algal, or plant cell is synthesized into a ready -to use dry formulation.

[0167] In some embodiments, disclosed compositions comprise Saccharomyces cerevisiae comprising an expression vector comprising DNA sequences encoding iRNA effective to inhibit the expression of a target gene encoding an ion channel protein, such as potassium voltage-gated channel protein Shaker and orthologs thereof. In some embodiments, the target gene includes a DNA sequence represented by any one of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO:10, SEQ ID NO:13, SEQ ID NO:16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46, or a sequence having at least 84%, 88%, 92%, or 96% sequence identity to the entire length of any one of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO:10, SEQ ID NO:13, SEQ ID NO:16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46

[0168] In some embodiments, disclosed compositions comprise Saccharomyces cerevisiae comprising an expression vector which includes an expression cassette comprising a DNA sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity to the entire length of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ IDNO:9, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:17, SEQID NO:18, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO: 45, SEQ ID NO:47, or SEQ ID NO:48, or the complement thereof operably linked to a promoter. In some embodiments, the expression vector comprises an expression cassette comprising SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO: 45, SEQ ID NO:47, or SEQ ID NO:48, or the complement thereof operably linked to a promoter. In some embodiments, the recombinant vector is an extrachromosomal plasmid, such as a pRS426 vector. In some embodiments, the extrachromosomal plasmid has a GPD promoter. In some embodiments, the S. cerevisiae cell is heat-killed and / or lyophilized.

[0169] In some embodiments, disclosed compositions further comprise at least one suitable carrier, excipient, or diluent, such as an agriculturally acceptable carrier, excipient, or diluent. In some embodiments, disclosed compositions further comprise an attractant, phagostimulant, or an insecticide. In preferred embodiments, disclosed compositions further comprise an attractant, e.g., a sugar bait, such as an attractive sugar targeted bait.

[0170] In some embodiments, disclosed compositions are insecticidal. In some embodiments, upon contact with a target organism, such as an organism having a species-specific target geneencoding an ion channel protein, e.g., Shaker or an ortholog thereof, the disclosed compositions result in a percent (%) mortality of at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, or at least about 100% mortality, including any and all numerical values and ranges in between.

[0171] In some embodiments, the target organism is a caterpillar, moth, or butterfly, including but not limited to an Australian painted apple caterpillar or moth, armyworm caterpillar or moth, beet armyworm caterpillar or moth, cactus caterpillar or moth, carob caterpillar or moth, cotton bollworm caterpillar or moth, diamondback caterpillar or moth, codling caterpillar or moth, apple worm caterpillar or moth, pink bollworm caterpillar or moth, fall armyworm caterpillar or moth, Southern armyworm caterpillar or moth, com earworm caterpillar or moth, soybean looper caterpillar or moth, tobacco cutworm caterpillar or moth, fruit borer, pod borer, shoot borer, diamond bollworm, Asian corn borer, European corn borer, false codling moth, Western bean cutworm, or a velvetbean caterpillar or moth, or other lepidopteran pest.

[0172] In some embodiments, disclosed compositions are capable of controlling a population of lepidopteran insects. Exemplary members of the lepidopteran population may include but are not limited to Abrostola spp., Agrochola spp., Agrotis spp., Allophyes spp., e.g., Allophyes oxyaccmthae, Amphipoea spp., Anorthoa spp., e.g., Anorthoa munda, Anticarsia spp., e.g., Anticar sia gemmatalis, Apamea spp., Asteroscopus spp., Atethmia centrago, Autograph spp., Brachlomia spp., Brachlomia viminalis, Cactoblastis spp., e.g., Cactoblastis cactorun, Carastis spp., Chrysodeixis spp., e.g., Chrysodeixis includens, Cosmia spp., Cydia spp., e.g., Cydia pomonella, Dasypolia spp., e.g., Dasypolia templi, Diachrysia spp., e.g., Diachrysia chrysitis, Diarsia spp., Dicycla spp., Diloba spp., e.g., Diloba caendeocephala, Dryobota spp., e.g., Dryobota labecula, Dryobotodes spp., e.g., Dryobotodes eremita, Ectomyelois spp., e.g.,Ectomyelois ceratoniae, Eremobia spp., e.g., Eremobia ochroleuca, Euplexia spp., e.g., Euplexia lucipara, Eupsilia spp., e.g., Eupsilia transversa, Fissipunctia spp., e.g., Fissipunctia ypsillon, Globia spp., e.g., Globia sparganii, Gortyna spp., e.g., Gortyna flavago, Griposia spp., e.g., Griposia aprilina, Hecatera spp., e.g., Hecatera dysodea, Helicoverpa spp., e.g., Helicoverpa armigera and Helicoverpa zea, Heliothis spp., Herminia spp., e.g., Herminia starsipennalis, Hoplodrina spp., Hydr aecia spp., e.g., Hydrae cia micacea, Hypena spp., e.g., Hypena proboscidalis, Hyppa spp., e.g., Hyppa rectilinea, Lacanobia spp., Laspeyria spp, e.g., Laspeyria flexula, Leucania spp., e.g., Leucania comma, Lithophane spp., e.g., Lithophane leautieri, Lithophane ornitopus, Lithophane semibrunnea, Lithophane socia, and Lithosia quadra, Luperina spp., e.g., Luperina nickerlii, Lymantria spp., e.g., Lymantria dispar, Mamestra spp., e.g., Mamestra brassicae, Melanchra spp., e.g., Melanchra persicariae, Mesoligia spp., e.g., Mesoligia furuncula, Mythimna spp., e.g., Mythimna albipuncta, Oligia spp., Omphaloscelis spp., e.g., Omphaloscelis lunosa, Orthosia spp., Pectinophora spp., e.g., Pectinophora gossypiella, Pelosia spp., e.g., Pelosia muscerda, Plusia spp., e.g., Plusia festucae, Polia spp., e.g., Polia nebulosa, Plutella spp., Plutella xylostella, Polymixis spp., Protodeltot spp., e.g., Protodeltot pygarga, Pyrrhiaspp., e.g., Pyrrhia umbra, Shargacucullia spp., e.g., Shargacucullia verbasci , Spodoptera spp., e.g., Spodoptera cosmioides, Spodoptera eridania, Spodoptera exigua, Spodoptera frugiperda, and Spodoptera litura, Subacronicta spp., e.g., Subacronicta megacephal, Leia spp., e.g., Leia anartoides, Thalpophila spp., e.g., Phalpophila matura, Tholera spp., e.g., Tholera decimalis, Thaumatotihia spp., e.g., Thaumatotibia leucotreta, Tiliacea spp., Xanthia spp., and combinations thereof.

[0173] Attractants, Phagostimulants, and Insecticides

[0174] In some embodiments, the disclosed compositions are effective to inhibit expression of a target gene in a lepidopteran by RNA interference (RNAi). In some embodiments, the compositions comprise any of disclosed iRNA, nucleic acid sequences encoding said iRNA, constructs comprising the iRNA and nucleic acid sequences encoding the same, expression vectors comprising the nucleic acid sequences, expression cassette comprising the nucleic acid sequences operably linked to a promoter, and microbial cells containing the preceding in any combination. In some embodiments, a disclosed composition further comprises an attractant, phagostimulant, insecticide, or a combination thereof. In some embodiments, a disclosed composition further comprises at least one suitable carrier, excipient, or diluent, such as an agriculturally acceptable carrier, excipient, or diluent.

[0175] In some embodiments, the compositions further comprising an attractant, phagostimulant, insecticide, or a combination thereof are insecticidal. In some embodiments, upon contact with an organism having a target gene, such as a target organism, the disclosed compositions result in a percent (%) mortality of at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, or at least about 100% mortality, including any and all numerical values and ranges in between.

[0176] In some embodiments, a disclosed composition further comprises a bait and / or a trap. In some embodiments, the bait comprises an attractant. In some embodiments, the attractant is sugar. In some embodiments, the bait is an attractive targeted sugar bait or an attractive toxic sugar bait (ATSB). Attractive targeted sugar baits typically contain an attractant, including a form of sugar, such as a fruit syrup, and a toxic agent, such as a chemical insecticide. See, e.g., Wongthangsiri et al., Agriculture and Natural Resources, 2018;52(4):393-398.

[0177] Bait stations, gel traps, and lure traps are commonly used to attract and kill lepidopteran insects. Design and use of such traps are well known to those of skill in the art. A lure trap of the invention can be any device into which the recombinant yeast of the invention are placed, and that prevents the insect pest from escaping once the insect pest has come into contact with the trap. The traps can be of various sizes, shapes, colors, and materials. Traps may be designed and manufactured specifically for use as an insect trap, or can be a container converted and adapted from other uses such as, for example, a glass Petri dish, a metal coffee can, a cardboard box, or any ordinary plastic, metal, fiberglass, composite or ceramic container.

[0178] Disclosed compositions may further contain an insecticide, such as a chemical insecticide. The insecticide can include abamectin, clothianidin, deltamethrin, fipronil, hydramethylnon, indoxacarb, among other pesticides capable of causing mortality in lepidopterans, including combinations thereof.

[0179] In some embodiments, disclosed compositions further include an attractant, such as a bait. In some embodiments, the attractant comprises sugar, an octanol, a plant extract, a fruit oil, a pheromone, such as a lepidopteran sex pheromone, e.g., a polyene hydrocarbon, an epoxide, or a combination thereof. In some embodiments, the attractant comprises acetic acid, 3-methyl-l- butanol (AAMB), phenylacetaldehyde, P-myrcene, methyl salicylate, methyl-2-methoxybenzoate, or a combination thereof. Lepidopteran baits, attractants, and insecticides that can be included in accordance with the present disclosure are described by, e.g., Booij & Voerman, Journal of Chemical Ecology 1985;! 1 (10): 1333-9, Millar, Ann Rev Entomol. 2000;45:575-604, and Landolt et al., Annals of the Entomological Society of America 2011;104(3):498-506.

[0180] In some embodiments, the bait is a sugar bait, such as an attractive targeted sugar bait or an attractive toxic sugar bait (ASB). ASBs, which are known in the art and commerciallyavailable, may include a sugar bait and a toxic agent, e.g., an insecticide. ATSBs are described in, e.g., WO 1996 / 017515 Al, PCT / US1995 / 015566, US 2020 / 0323190 Al, WO2020185583A1, W02009150254A1, Hapairai et al., Insect Biochem Mol Biol. 2020 May; 120: 103359, Mysore et al., PLoS Negl Prop Dis. 2020 Jul; 14(7): e0008479, Wongthangsiri et al., Agric.Nat. Resour. 2018;52(4):393-398, Khan etal., 7’Zo5Owe. 2013 Sep 24;8(9):e77225, Fraser et al., Malar J. 2021 Mar 17;20(l):15.

[0181] Methods

[0182] In some aspects, provided herein are methods of using a disclosed polynucleotide, expression cassette, host organism, such as an interfering RNA biopesticide composition, or a combination thereof, in the control of lepidopteran populations. In some embodiments, disclosed methods involve contacting a lepidopteran with a disclosed polynucleotide, expression cassette, host organism, composition, or a combination thereof, such that contacting the lepidopteran leads to consumption by the lepidopteran. The terms “control,” “controlling,” and the like, refer to, e.g., preventing proliferation and / or survival of lepidopteran populations and / or preventing or treating lepidopteran infestations. In some embodiments, the method comprises contacting the lepidopteran with a microbial cell comprising the nucleic acid sequence that is or is capable of producing an iRNA effective to inhibit expression of a target gene in the lepidopteran.

[0183] Herein, reference to a lepidopteran generally includes reference to different stages of life, such as egg, larva (caterpillar), pupa, and adult phases thereof. However, in specific embodiments, disclosed methods involve contacting lepidopteran egg, larva (caterpillar), pupa, and adult with a disclosed polynucleotide, expression cassette, host organism, composition, or a combination thereof. In other embodiments, disclosed methods involve contacting an adult lepidopteran with a disclosed polynucleotide, expression cassette, host organism, composition, ora combination thereof. Additionally, herein, contacting a lepidopteran can encompass consumption of the disclosed polynucleotide, expression cassette, host organism, composition, or a combination thereof by the lepidopteran or feeding of the same to the lepidopteran.

[0184] Methods and cells delivering disclosed iRNA for contact with an insect include, but are not limited to, e.g. larval soaking, nanoparticles (e.g., chitosan nanoparticles), bacterial cells, yeast cells, algal cells, ovitraps, dried tablets, sugar feeding, and topical applications, among others. Thus, compositions may include the necessary components to deliver the iRNA to the targeted lepidopteran population. For example, compositions may comprise nanoparticles, bacterial cells, yeast cells, algal cells and the like that contain or express the iRNA.

[0185] In some embodiments, the disclosed methods comprise contacting the lepidopteran with a microbial cell comprising a nucleic acid sequence that is or is capable of producing an iRNA effective to inhibit expression of a target gene in the lepidopteran. In some embodiments, the microbial cell is a yeast cell, a bacterial cell, a plant cell, or an algal cell. In preferred embodiments, the microbial cell is a yeast cell.

[0186] In some embodiments, the disclosed methods comprise contacting a lepidopteran with a yeast cell engineered to produce iRNA effective to inhibit expression of a target gene in a lepidopteran. In some embodiments, the disclosed methods comprise contacting a lepidopteran with a bacterial cell engineered to produce iRNA effective to inhibit expression of a target gene in a lepidopteran. In some embodiments, the disclosed methods comprise contacting a lepidopteran with an algal or plant cell engineered to produce iRNA effective to inhibit expression of a target gene in a lepidopteran.

[0187] In some embodiments, the lepidopteran insect is a caterpillar, moth, or butterfly, such as an Australian painted apple caterpillar or moth, army worm caterpillar or moth, beet army wormcaterpillar or moth, cactus caterpillar or moth, carob caterpillar or moth, cotton bollworm caterpillar or moth, diamondback caterpillar or moth, codling caterpillar or moth, apple worm caterpillar or moth, pink bollworm caterpillar or moth, fall armyworm caterpillar or moth, Southern armyworm caterpillar or moth, com earworm caterpillar or moth, soybean looper caterpillar or moth, tobacco cutworm caterpillar or moth, fruit borer, pod borer, shoot borer, diamond bollworm, Asian corn borer, European corn borer, false codling moth, Western bean cutworm, or a velvetbean caterpillar or moth, or other lepidopteran pest.

[0188] Disclosed methods can be used to control lepidopteran populations including but not limited to the following representative genera and species: Abrostola spp., Agrochola spp., Agrotis spp., Allophyes spp., e.g., Allophyes oxyacanthae, Amphipoea spp., Anorthoa spp., e.g., Anorthoa munda, Anticarsia spp., e.g., Anticarsia gemmatalis, Apamea spp., Asteroscopus spp., Atethmia centrago, Autograph spp., Brachlomia spp., Brachlomia viminalis, Cactoblastis spp., e.g., Cactoblastis cactorun, Carastis spp., Chrysodeixis spp., e.g., Chrysodeixis includens, Cosmia spp., Cydia spp., e.g., Cydia pomonella, Dasypolia spp., e.g., Dasypolia templi, Diachrysia spp., e.g., Diachrysia chrysitis, Diarsia spp., Dicycla spp., Diloba spp., e.g., Diloba caeruleocephala, Dryobotaspp., e.g., Dryobota labecula, Dryobotodes spp., e.g., Dryobotodes eremita, Ectomyelois spp., e.g., Ectomyelois ceratoniae, Eremobia spp., e.g., Eremobia ochroleuca, Euplexia spp., e.g., Euplexia lucipara, Eupsilia spp., e.g., Eupsilia transversa, Fissipunctia spp., e.g., Fissipunctia ypsillon, Globia spp., e.g., Globia sparganii, Gortyna spp., e.g., Gortyna flavago, Griposia spp., e.g., Griposia aprilina, Hecateraspp., e.g., H ecater a dysodea, Helicoverpa spp., e.g., Helicoverpa armigera and Helicoverpa zea, Heliothis spp., Herminia spp., e.g., Herminia starsipennalis, Hoplodrina spp., Hydr aecia spp., e.g., Hydrae cia micacea, Hypena spp., e.g., Hypena proboscidalis, Hyppa spp., e.g., Hyppa rectilinea, Lacanobia spp., Laspeyria spp, e.g., Laspeyriaflexula, Lencania spp., e.g., Leucemia comma, Lithophane spp., e.g., Lithophane leautieri, Lithophane ornitopus, Lithophane semibrunnea, Lithophane socia, and Lithosia quadra, Luperina spp., e.g., Luperina nickerlii, Lymantria spp., e.g., Lymantria dispar, Mamestra spp., e.g., Marne str a brassicae, Melanchra spp., e.g., Melanchra persicariae, Mesoligia spp., e.g., Mesoligia furuncula, Mythimna spp., e.g., Mythimna albipuncta, Oligia spp., Omphaloscelis spp., e.g., Omphaloscelis lunosa, Orthosia spp., Pectinophora spp., e.g., Pectinophora gossypiella, Pelosia spp., e.g., Pelosia muscerda, Plusia spp., e.g., Plusia festucae, Polia spp., e.g., Polia nebulosa, Plutella spp., Plutella xylostella, Polymixis spp., Protodeltot spp., e.g., Protodeltot pygarga, Pyrrhiaspp., e.g., Pyrrhia umbra, Shargacucullia spp., e.g., Shargacucullia verbasci, Spodoptera spp., e.g., Spodoptera cosmioides, Spodoptera eridania, Spodoptera exigua, Spodoptera frugiperda, and Spodoptera litura, Subacronicta spp., e.g., Subacronicta megacephal, Teia spp., e.g., Teia anartoides, Thalpophila spp., e.g., Thalpophila matura, Tholera spp., e.g., Tholera decimalis, Thaumatotibia spp., e.g., Thaumatotibia leucotreta, Tiliacea spp., Xanthia spp., and combinations thereof.

[0189] In some embodiments, the target gene includes a DNA sequence represented by any one of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO:16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46, or a sequence having at least 84%, 88%, 92%, or 96% sequence identity to the entire length of any one of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO:10, SEQ ID NO:13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31,SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46

[0190] In some embodiments, disclosed methods comprise contacting a lepidopteran with a yeast cell comprising an expression cassette comprising a nucleotide sequence encoding iRNA. In some embodiments, the iRNA is perfectly or partially complementary to a portion of mRNA sequence having at least 84%, 88%, 92%, or 96% sequence identity to the entire length of any one of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46 In some embodiments, the iRNA is perfectly or partially complementary to a portion of mRNA represented by any one of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46

[0191] In some embodiments, the disclosed methods comprise contacting a lepidopteran with a yeast cell comprising an expression cassette comprising a DNA sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity to the entire length of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NQ:20, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NQ:30, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO: 45, SEQ ID NO:47, or SEQ ID NO:48, or the complement thereof, operably linked to a promoter. In some embodiments, the disclosed methods comprise contacting a lepidopteran with a yeast cell comprising an expression cassette comprising SEQ ID NO:4, SEQ ID NO:5, SEQID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO: 15, SEQ ID NO:17, SEQ ID NO: 18, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO: 45, SEQ ID NO:47, or SEQ ID NO:48, or the complement thereof operably linked to a promoter. In some embodiments, the expression cassette is integrated into the genome of the yeast cell. In some embodiments, the expression cassette is included in a recombinant vector, e.g., a pRS426 vector. The recombinant vector can include a GPD promoter.

[0192] In some embodiments, the disclosed methods comprise contacting a lepidopteran, such that contacting the lepidopteran insect involves consumption or ingestion by the lepidopteran, such as a larva (caterpillar), pupa, or adult thereof, with a dead microbial host cell as disclosed herein, as a microbial host that has been spray-dried, heat-killed, lyophilized, or suspended in an aqueous medium. In some embodiments, contacting the lepidopteran comprises consumption by mouth of the microbial host cell the by the lepidopteran. In some embodiments, it is preferred that the microbial host cell is heat inactivated to reduce or eliminate the ability of the microbial host cell to grow once released into a treatment area. In some embodiments, a yeast cell for contacting a lepidopteran is spray-dried, heat-killed, lyophilized, or suspended in an aqueous medium to reduce or eliminate the ability of the yeast to grow once released into a treatment area. In some embodiments, the yeast is synthesized into a ready-to use dry formulation. In some embodiments, the yeast is suspended in an aqueous medium comprising water. In some embodiments, the yeast is S'. cerevisiae.

[0193] In some embodiments, the disclosed methods further comprise contacting the lepidopteran with a bait, such as a sugar bait. In some embodiments, the bait is present within a trap, such as a lure trap. In some embodiments, the bait and / or the trap comprises any of the nucleic acids, engineered microbial host cell, or compositions disclosed herein. In some embodiments, the attractant comprises any of an attractive microbe, such as an attractive symbiont microbe, sugar, or a combination thereof.

[0194] In some embodiments, the disclosed methods comprise contacting a lepidopteran with an attractant containing sugar, e.g., sucrose, fructose, glucose, or any combination thereof and / or a sugar substitute. In some embodiments, the attractant comprises any one or more of corn syrup, fruit, fruit puree, and fruit juice.

[0195] In some embodiments, the bait is a sugar bait, such as an attractive targeted sugar bait or an attractive toxic sugar bait (ATSB). In some embodiments, the sugar bait comprises sugar and any one or more of at least one pheromone, at least one attractive symbiont, and at least one insecticide. ATSB’s, which are known in the art and commercially available, may include a sugar bait and a toxic agent, e.g., an insecticide. ATSBs are described in, e.g., WO2020185583A1, W02009150254A1, Hapairai et al., Insect Biochem Mol Biol. 2020 May; 120: 103359, Mysore et al., PLoS Negl Trap Dis. 2020 Jul; 14(7): e0008479, Wongthangsiri et al., Agric. Nat. Resour. 2018;52(4):393-398, Khan <A., PLoSOne. 2013 Sep 24;8(9):e77225, Fraser et al., Malar J. 2021 Mar 17;20(l):15.

[0196] In some embodiments, disclosed methods comprise contacting a lepidopteran with disclosed nucleic acids, engineered microbial host cells, compositions, or any combination thereof, which has been dispersed onto a surface in close proximity to a lepidopteran colony. In one example, contacting a lepidopteran with any of the disclosed nucleic acids, engineered microbialhost cells, compositions, or any combination thereof, dispersed onto the surface is useful to exert larvicidal activity.

[0197] In some embodiments, disclosed methods include contacting a lepidopteran with a yeast cell comprising an expression vector comprising DNA sequences encoding iRNA effective to inhibit the expression of an ion channel protein, e.g., potassium voltage-gated channel protein Shaker or an ortholog thereof, dopamine receptor 1 -like sequence, or an amine-associated receptor, tyramine / octopamine receptor, or RNA binding protein fox-1 homolog, in lepidopteran, where the yeast cell is spray-dried, heat-killed, lyophilized, or suspended in an aqueous medium. In some embodiments, the yeast cell is a Saccharomyces cerevisiae cell. As noted in the present disclosure, contacting a lepidopteran with the yeast cell can involve the lepidopteran consuming or otherwise ingesting the yeast cell.

[0198] In some embodiments, the target gene contains a DNA sequence represented by any of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46, or a sequence having at least 84%, 88%, 92%, or 96% sequence identity to the entire length of any one of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO:10, SEQ ID NO: 13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46. In some embodiments, the target gene sequence is represented by SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO:10, SEQ ID NO:13, SEQ ID NO:16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46, or a nucleotide sequence having about 84%, 88%,92%, or 96% sequence identity to the entire length of any one of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ IDNO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37,SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46

[0199] The sequences identified herein are highly conserved among lepidopteran species. For example, ss set forth in Table 1, the Rbfox target sequences set forth in SEQ ID NO: 25 is highly conserved among numerous Lepidopteran species. Target sequences set forth in SEQ ID NO: 28, 31, 34, and 37 showed similar levels of conservation among Lepidopteran species.

[0200] Table 1: Rbfox SEQ ID NO:25 across multiple Lepidopteran species.

[0201] In some embodiments, the expression vector comprises an expression cassette comprising any of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO: 45, SEQ ID NO:47, or SEQ ID NO:48 or the complement thereof, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99%identity to the entire length of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO: 45, SEQ ID NO:47, or SEQ ID NO:48, or the complement thereof.

[0202] In some embodiments, disclosed methods further comprise contacting the lepidopteran with an additional attractant, such as a bait. In some embodiments, the additional attractant comprises sugar, an octanol, a plant extract, a fruit oil, a pheromone, e g., such as a lepidopteran sex pheromone, e g., a polyene hydrocarbon, an epoxide, or a combination thereof. In some embodiments, the attractant comprises acetic acid, 3 -methyl- 1 -butanol (AAMB), phenylacetaldehyde, 0-myrcene, methyl salicylate, methyl-2-methoxybenzoate, or a combination thereof. Lepidopteran baits, attractants, and insecticides that can be included in accordance with the present disclosure are described by, e.g., Booij & Voerman, Journal of Chemical Ecology 1985; 11(10): 1333-9, Millar, Annu Rev Entomol. 2000;45:575-604, and Landolt et al., Annals of the Entomological Society of America 2011;104(3):498-506.

[0203] Disclosed methods may further comprise contacting the lepidopteran with an insecticide, such as a chemical insecticide. The insecticide can include abamectin, clothianidin, deltamethrin, fipronil, hydramethylnon, indoxacarb, among other pesticides capable of causing mortality in lepidopterans, including combinations thereof.

[0204] In some embodiments, the disclosed methods result in a percent (%) mortality of at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, atleast about 90%, at least about 95%, at least about 98%, or at least about 100% mortality of lepidopteran insects in a lepidopteran population, including any and all numerical values and ranges in between.EXAMPLES

[0205] Example 1: Identification of an Exemplary iRNA Biopesticide Target Site

[0206] Target Site selection: Exemplary lepidopteran potassium channel genes were identified. Shaker genes within various sequenced genomes of lepidopteran pests were aligned to identify putative RNAi target sites within sequences that were conserved among various Lepidopteran insects, yet not well -conserved in non-target organisms. Putative selections were evaluated through BLAST to assess the number of lepidopteran species in which they were conserved, and shRNA expression cassettes were designed on the basis of the BLAST studies. Exemplary target sites and shRNA expression cassette sequences include the following.

[0207] SEQ ID NO:1 - Sh.712 Target Site:5 ’ -AC AAGAAACAGAATAGTGGT AAA-3 ’

[0208] Sh. 712 Hairpin expression cassette

[0209] SEQ ID NO: 4 - Forward strand:5 ’ - GATCCACAAGAAAC AGAATAGTGGTAAATTCAAGAGATTTACC ACTATTCTGTTT CTTGTTTTTTTC - 3’

[0210] SEQ ID NO: 5 - Reverse strand:5’ - TCGAGAAAAAAACAAGAAACAGAATAGTGGTAAATCTCTTGAATTTACCACTA TTC TGTTTCTTGTG- 3’

[0211] SEQ ID NO:2 - Sh.713 Target Site:5 ’-GGTAAATTGTGAATTACTCAAGTTG-3’

[0212] Sh. 713 Hairpin expression cassette

[0213] SEQ ID NO: 6 - Forward strand:5’ GATCCGGTAAATTGTGAATTACTCAAGTTGTTCAAGAGACAACTTGAGTAATTCACAATTTACCTTTTTTC - 3’

[0214] SEQ ID NO: 7 - Reverse strand:5’ - TCGAGAAAAAAGGTAAATTGTGAATTACTCAAGTTGTCTCTTGAACAACTTGAGTAATTCACAATTTACCG - 3’

[0215] SEQ ID NO:3 - Sh.714 Target Site:5 ’ -GCTC AGTATTATTAGTTGATATTTC-3 ’

[0216] Sh. 714 Hairpin expression cassette

[0217] SEQ ID NO: 8 - Forward strand:5’ - GATCCGCTCAGTATTATTAGTTGATATTTCTTCAAGAGAGAAATATCAACTAATAATACTGAGCTTTTTTC- 3’

[0218] SEQ ID NO: 9 - Reverse strand:5’ - TCGAGAAAAAAGCTCAGTATTATTAGTTGATATTTCTCTCTTGAAGAAATATCAACTAATAATACTGAGCG- 3’

[0219] All three target sites were conserved in S. frugiperda. BLAST results revealed the conservation of the Sh.712, Sh.713, and Sh.714 target sites within various lepidopteran insect species. Conservation of the Sh.712, Sh.713, or Sh.714 target sites in representative Lepidoptera follows.

[0220] Chrysodeixis inchidens (Soybean looper; soybean pest): Sh.712, Sh.713, Sh.714.

[0221] Helicoverpa armigera (Cotton bollworm; major cotton pest, but it is a polyphagous species with many other host crops): Sh.713, Sh.714.

[0222] Helicoverpa zea (Corn earworm; a major agricultural pest with many host species, including corn, cotton, and tomatoes): Sh.712, Sh.713, Sh.714.

[0223] Lymantria dispar (Spongy / Gypsy moth; polyphagous species that defoliates trees): Sh.712

[0224] Spodoptera exigua (Beet armyworm; it has many hosts, including beets, asparagus, and a variety of vegetables): Sh.712, Sh.713, Sh.714

[0225] Spodoptera litura (Tobacco cutworm; hosts include tobacco, cotton, and many other plants): Sh.712, Sh.713, Sh.714

[0226] Example 2: Yeast iRNA biopesticide strains induce mortality in the fall armyworm (Spodoptera frugiperda)

[0227] Exemplary heat-killed iRNA biopesticides were evaluated in lepidopterans for their effects on insect survival. Exemplary lepidopteran S. frugiperda ingested disclosed iRNA biopesticides and effects on larval mortality were monitored.

[0228] Yeast preparation: The Sh.712, Sh.713, and Sh.714 shRNA expression cassettes were cloned into the pRS426 GPD vector, and yeast was prepared as described (Mysore et al., Methods Mol Biol. 2019:1858:213-231). In summary, custom-synthesized DNA oligonucleotides were obtained from Invitrogen Life Technologies (Carlsbad, CA, USA). The oligonucleotides were then cloned into the non-integrating pRS426 GPD yeast shuttle vector (Mumberg et al., Gene. 1995 Apr 14; 156(1): 119-22) downstream of a GPD promoter. The sequence of the hairpin expression cassette was confirmed by sequencing, and S. cerevisiae strain CEN.PK yeast (genotype MATa / o. ura3-52 / ura3-52 trpl-289 / trp 1-289 leu2-3_l 12 / leu2-3_l 12 his3 Al / his3 Al MAL2-8C / MAL2-8C SUC2 / SUC2 was transformed with the URA3+ marked plasmid, with transformants selected through growth on uracil-deficient minimal media. The S. cerevisiae strain CEN.PK yeast has beendescribed, e g., by van Dijken et al., Enzyme Microb Technol. 2000;26(9-10):706-14. Following strain construction, the yeasts were cultured and heat-killed as described (Mysore et al., Methods Mol Biol. 2019: 1858:213-231), and pelleted yeast was then lyophilized using a Labconco FreeZone 6 L Console Freeze Dryer (Labconco, Kansas City, MO, USA). Control yeast from a previously constructed strain (Hapairai et al., Sci Rep. 2017 Oct 16;7(1): 13223) was prepared in a similar manner. The lyophilized yeasts were utilized in insecticide assays following the procedure described below.

[0229] Preparation of yeast-food mixture: For trials with 25 larvae, 200 mg of Sh.712, Sh.713, Sh.714, or control yeast was added to 200 pl of 10% sucrose containing 4.5% red food dye and mixed to create a thick paste. This paste was spread uniformly across the surface of 50 oz trial cups (with lids) that contained moth larval food (Benzon Research, Carlisle, PA) prepared according to the manufacturer’s instructions. An additional container (food control) was prepared with the larval food alone. For trials with 10 larvae, the yeast and food amounts were reduced by one-half.

[0230] Laboratory Insecticide Trial Methodologies: 5. frugiperda were procured from Benzon Research (Carlisle, PA). The insects were housed in incubators set to 26°C. A mosquito attractive targeted sugar bait (ATSB) protocol (Mysore et al., Insects. 2021 Nov 2; 12(11):986) was modified and used to evaluate the prospective insecticidal yeast strains. In the first two replicate trials, 105. frugiperda were added to each trial container. 25 S. frugiperda larvae were added to each container in the subsequent six trials. Larvae were placed in incubators set to a temperature of 26°C and permitted to feed ad libitum. The larvae were then monitored for 14 days, during which time mortality was observed and recorded. Trial data were analyzed via ANOVA.

[0231] Larvicide Trials: FIG. 1 shows the mortality rates resulting from S. frugiperda consumption of Sh.712, Sh.713, or Sh.714 vs. control treatment. Although negligible larval mortality was observed following treatment with control yeast (Control) or the larval food, consumption of Sh.712, Sh.713, and Sh.714 induced significant mortality (P<0.001). Consumption of the yeast was confirmed through presence of the red dye marker in the abdomen of the larvae.

[0232] FIG. 2 shows the mortality induced by yeast strains expressing Dopl and Rbfoxl shRNA. Yeast strains Dop.724, Fox.725 and Fox.726 induce significant mortality (P<0.001 vs. control; one-way ANOVA) in larvae of the moth Phitella xylostella. Results were compiled from three replicate trials (n=400 for control and 300 individuals for treatments). 200 mg of yeast expressing either control shRNA or Dop.724, Fox.725 and Fox.726 was provided as a paste smeared on the food containers for moth larval rearing and monitored until adulthood for mortality.

[0233] FIG. 3 shows the mortality induced by yeast strains expressing shRNA against Shaker, Serotonin Receptor-1 and Dopamine 1. Yeast strains Sh.728, HTR.729 and Dop.732 induce significant mortality (P<0.001 vs. control; one-way ANOVA) in larvae of the moth Trichophisia ni. Results were compiled from three replicate trials (n=450 for control and 225 per treatment). 200 mg of yeast expressing either control shRNA or Sh.728, HTR.729 and Dop.732 was provided as a paste smeared on the food containers for moth larval rearing and monitored until adulthood.

[0234] FIG. 4 shows the mortality induced by yeast strains expressing siRNA against Serotonin Receptor-1 . Yeast strains HTR.730 and HTR.731 induce significant mortality (P<0.001 vs. control; one-way ANOVA) in larvae of moth Argotis ipsilon. Results were compiled from three replicate trials (n=225 for control or treatment). 200 mg of yeast expressing either control shRNAor Sh.728, HTR.729 and Dop.732 was provided as a paste smeared on the food containers for moth larval rearing and monitored until adulthood.

[0235] FIG. 5 shows the mortality induced by yeast strains expressing Shaker shRNA. Yeast strains Sh.748 and Sh.749 induce significant mortality (P<0.001 vs. control; one-way ANOVA) in larvae of moth Cydia pomonella. Results were compiled from three replicate trials (n=250 individuals per control or treatment). 200 mg of yeast expressing either control shRNA or Sh.748 or Sh.749 was provided as a paste smeared on the food containers for moth larval rearing and monitored until adulthood.

[0236] Example 3: Leaf delivery of yeast iRNA biopesticide strains

[0237] Disclosed iRNA biopesticide is dispersed onto the leaves of a host plant. The host plant is any one corn, cabbage, chili pepper, tomato, grain, beet, cotton, tobacco, fruit, or a cruciferous crop, such as cauliflower, mustard, and broccoli. Lepidopteran larvae ingest iRNA biopesticide. Mortality of lepidopteran larvae is assessed.

[0238] Example 4: Evaluation of biopesticide toxicity to a non-target organism

[0239] Disclosed iRNA biopesticide is provided for oral consumption by a non-target organism, alternatively referred to as an off-target organism. When the genetic target of the iRNA biopesticide is not harbored by the non-target organism, for example humans or insects that are not pests, mortality is not induced in a non-target organism, indicating selectivity of the disclosed iRNA biopesticide.EQUIVALENTS AND SCOPE

[0240] Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation many equivalents to the specific embodiments described herein. The scope of thepresent invention is not intended to be limited to the above, but rather is as set forth in the appended claims.

[0241] In the claims articles such as “a,” “an,” and “the” may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include “or” between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process.

[0242] Furthermore, it is to be understood that the invention encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses and descriptive terms, from one or more of the listed claims is introduced into another claim. For example, any claim that is dependent on another claim can be modified to include one or more limitations found in any other claim that is dependent on the same base claim.

[0243] Where elements are presented as lists, e.g., in Markush group format, it is to be understood that each subgroup of the elements is also disclosed, and any element(s) can be removed from the group. It should be understood that, in general, where the invention, or aspects of the invention is / are referred to as comprising particular elements, features, etc., certain embodiments of the invention or aspects of the invention consist, or consist essentially of, such elements, features, etc. For purposes of simplicity, those embodiments have not been specificallyset forth in haec verba herein. It is also noted that the term “comprising” is intended to be open and permits the inclusion of additional elements or steps.

[0244] Where ranges are given, endpoints are included. Furthermore, it is to be understood that unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranged can assume any specific value or subrange within the stated ranges in different embodiments of the invention, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.

[0245] The term “about” or “approximately” means within an acceptable error range for the particular value as determined by one of the ordinary skill in the art, which will depend in part on how the value is measured or determined, e.g., the limitations of the measurement system. For example, “about” can mean within 1 or more than 1 standard deviation, per the practice in the art. Alternatively, “about” can mean a range of up to 20%, up to 10%, up to 5% or up to 1% of a given value. Alternatively, the term can mean within an order of magnitude, for example within 5-fold, or within 2-fold, of a value. Where particular values are described in the application and claims, unless otherwise stated the term “about” meaning within an acceptable error range for the particular value should be assumed.

[0246] In addition, it is to be understood that any particular embodiment of the present invention that falls within the prior art may be explicitly excluded from any one or more of the claims. Because such embodiments are deemed to be known to one of ordinary skill in the art, they may be excluded even if the exclusion is not set forth explicitly herein. Any particular embodiment of the method of the invention can be excluded from any one or more claims, for any reason, whether or not related to the existence of prior art.

[0247] Sequence Table

Claims

CLAIMSI claimClaim 1. An intefering ribonucleic acid comprising a nucleotide sequence of 20 to 30 contiguous nucleotides, wherein the nucleotide sequence is partially or perfectly complementary to mRNA transcribed from a DNA sequence having at least 84%, 88%, 92%, 96%, or 100% sequence identity to the entire length of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO:10, SEQ ID NO:13, SEQ ID NO:16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46; and wherein the interfering RNA inhibits the production of a potassium voltage-gated channel protein in a lepidopteran insect by RNA interference.Claim 2. The interfering RNA of claim 1, wherein the interfering RNA is an RNA construct, a double stranded RNA (dsRNA), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), or an anti-sense oligonucleotide.Claim 3. The interfering RNA of claim 1 or claim 2, wherein the interfering RNA is an shRNA.Claim 4. The interfering RNA of any one of claims 1 to 3, wherein the lepidopteran insect is an Australian painted apple caterpillar or moth, armyworm caterpillar or moth, beet armyworm caterpillar or moth, cactus caterpillar or moth, carob caterpillar or moth, cotton bollworm caterpillar or moth, diamondback caterpillar or moth, codling caterpillar or moth, apple wormcaterpillar or moth, pink bollworm caterpillar or moth, fall armyworm caterpillar or moth, Southern armyworm caterpillar or moth, corn earworm caterpillar or moth, soybean looper caterpillar or moth, tobacco cutworm caterpillar or moth, fruit borer, pod borer, shoot borer, diamond bollworm, Asian corn borer, European corn borer, false codling moth, Western bean cutworm, or a velvetbean caterpillar or moth.Claim 5. The interfering RNA of any one of claims 1 to 4, wherein the lepidopteran insect is a species of Abrostola, Agrochola, Agrotis, Allophyes, Amphipoea, Anorthoa, Anticarsia, Apamea, Asteroscopus, Atethmia, Autograph., Brachlomia, Cactoblastis, Carastis, Chrysodeixis, Cosmia, Cydia, Dasypolia, Diachrysia, Diarsia, Dicycla, Diloba, Dryobota, Dryobotodes, Ectomyelois, Eremobia, Euplexia, Eupsilia, Fissipunctia, Globia, Gortyna, Griposia, Hecatera, Helicoverpa, Eleliothis, Herminia, Hoplodrina, Hydraecia, Elypena, Elyppa, Lacanobia, Laspeyria, Leucania, Lithophane, Lithosia, Luperina. Lymantria Mamestra, Melanchra, Mesoligia, Mythimna, Oligia spp., Omphaloscelis, Orthosia, Pectinophora, Pelosia, Phisia, Polia, Plutella, Polymixis, Protodeltot, Pyrrhia, Shargacucullia, Spodoptera, Subacronicta, Teia, Thalpophila, Tholera, Thaumatotibia, Tiliacea, or Xanthia.Claim 6. An expression cassette comprising a regulatory sequence operably linked to a nucleotide sequence which encodes the interfering RNA molecule of any one of claims 1 to 5.Claim 7. An expression cassette comprising a regulatory sequence operably linked to a nucleotide sequence which encodes an interfering RNA molecule comprising a nucleotide sequence of 20 to 30 contiguous nucleotides,wherein the nucleotide sequence is partially or perfectly complementary to mRNA transcribed from a sequence having at least 84%, 88%, 92%, 96%, or 100% sequence identity to the entire length of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO: 10, SEQ IDNO: 13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46, and wherein the interfering RNA inhibits the production of a potassium voltage-gated channel protein in a lepidopteran insect by RNA interference.Claim 8. The expression cassette of claim 7, wherein the nucleotide sequence of the interfering RNA molecule comprises 25 nucleotides which are partially or perfectly complementary to mRNA transcribed from a sequence represented by SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO:10, SEQ ID NO:13, SEQ ID NO:16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46.Claim 9. The expression cassette of claim 7 or claim 8, comprising a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to the entire length of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:41,SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO: 45, SEQ ID NO:47, or SEQ ID NO:48, or the complement thereof.Claim 10. The expression cassette of any one of claims 7 to 9, wherein the regulatory sequence comprises a yeast promoter.Claim 11. The expression cassette of claim 10, wherein the yeast promoter comprises a nucleotide sequence that has at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to the entire length of SEQ ID NO:59.Claim 12. The expression cassette of any one of claims 7 to 11, wherein the expression cassette is integrated into the genomic DNA of a yeast cell.Claim 13. A vector comprising the expression cassette of any one of claims 6 to 12.Claim 14. The vector of claim 13, wherein the vector comprises a nucleotide sequence that has at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to the entire length of SEQ ID NO:60.Claim 15. A microbial cell, algal cell, or plant cell comprising the expression cassette or the vector of any one of claims 7 to 14.Claim 16. The microbial cell, algal cell, or plant cell of claim 15, wherein the expression cassette is integrated into the genomic DNA of the microbial cell, algal cell, or plant cell.Claim 17. The microbial cell of claim 15 or claim 16, wherein the microbe is Saccharomyces cerevisiae or Escherichia coli.Claim 18. A composition comprising the interfering RNA of any one of claims 1 to 6, the expression cassette of any one of claims 7 to 12, the vector of claim 13 or 14, the microbial cell, algal cell, or plant cell of any one of claims 15 to 17, or a combination thereof.Claim 19. A composition comprising an expression cassette comprising a promoter operably linked to a DNA sequence encoding an interfering RNA molecule which is partially or perfectly complementary to mRNA transcribed from a target gene, wherein the target gene encodes a potassium voltage-gated channel protein in a lepidopteran insect and the interfering RNA specifically inhibits expression of the target gene.Claim 20. The composition of claim 19, wherein the interfering RNA is a double stranded RNA (dsRNA), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), or an antisense oligonucleotide.Claim 21. The composition of claim 19 or claim 20, wherein the interfering RNA is a short hairpin RNA (shRNA).Claim 22. The composition of any one of claims 19 to 21, wherein the lepidopteran insect is an Australian painted apple caterpillar or moth, armyworm caterpillar or moth, beet armyworm caterpillar or moth, cactus caterpillar or moth, carob caterpillar or moth, cotton bollworm caterpillar or moth, diamondback caterpillar or moth, codling caterpillar or moth, apple worm caterpillar or moth, pink bollworm caterpillar or moth, fall armyworm caterpillar or moth, Southern armyworm caterpillar or moth, com earworm caterpillar or moth, soybean looper caterpillar or moth, tobacco cutworm caterpillar or moth, fruit borer, pod borer, shoot borer, diamond bollworm, Asian corn borer, European corn borer, false codling moth, Western bean cutworm, or a velvetbean caterpillar or moth.Claim 23. The composition of any one of claims 19 to 22, wherein the lepidopteran insect is a species of Abrostola., Agrochola, Agrotis, Allophyes, Amphipoea, Anorthoa, Anticar sia, Apamea, Asteroscopus, Atethmia, Autograph., Brachlomia, Cactoblastis, Carastis, Chrysodeixis, Cosmia, Cydia, Dasypolia, Diachrysia, Diarsia, Dicycla, Diloba, Dryobota, Dryobotodes, Ectomyelois, Eremobia, Euplexia, Eupsilia, Fissipunctia, Globia, Gortyna, Griposia, Hecatera, Helicoverpa, Heliothis, Herminia, Hoplodrina, Hydraecia, Hypena, Hyppa, Lacanobia, Laspeyria, Leucania, Lithophane, Lithosia, Luperina. Lymantria Mamestra, Melanchra, Mesoligia, Mythimna, Oligia spp., Omphaloscelis, Orthosia, Pectinophora, Pelosia, Plusia, Polia, Plutella, Polymixis, Protodeltot, Pyrrhia, Shargacucullia, Spodoptera, Subacronicta, Teia, Thalpophila, Tholera, Thaumatotibia, Tiliacea, or Xanthia.Claim 24. The composition of any one of claims 19 to 23, wherein the target gene comprises a DNA sequence having at least about 84%, 88%, 92%, 96%, or 100% sequence identity to theentire length of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO: 10, SEQ IDNO: 13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46, or the complement thereof.Claim 25. The composition of any one of claims 19 to 24, wherein the expression cassette comprises a nucleotide sequence having at least about 80%, 85%, 90%, 95%, 98%, or 99% sequence identity to the entire length of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO: 45, SEQ ID NO:47, or SEQ ID NO: 48, or the complement thereof.Claim 26. The composition of any one of claims 19 to 25, wherein the expression cassette comprises the entire length of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO: 45, SEQ ID NO:47, or SEQ ID NO:48Claim 27. The composition of any one of claims 19 to 26, wherein the interfering RNA comprises a nucleotide sequence of at least 25 contiguous nucleotides which are partially or perfectly complementary to mRNA transcribed from SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46, or the complement thereof; or a DNA sequence having at least about or 84%, 88%, 92%, 96%, or 100% sequence identity to the entire length of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46, or the complement thereof; and wherein the interfering RNA is capable of inhibiting expression of the potassium voltagegated channel protein in the lepidopteran insect.Claim 28. The composition of any one of claims 19 to 27, wherein the expression cassette is integrated into the genome of a yeast cell.Claim 29. The composition of claim 28, wherein the yeast cell is Saccharomyces cerevisiae.Claim 30. The composition of claim 28 or claim 29, wherein the yeast cell is spray-dried, heat-killed, lyophilized, or suspended in an aqueous medium.Claim 31 . The composition of any one of claims 19 to 30, further comprising a sugar bait.Claim 32. The composition of any one of claims 19 to 31, wherein a trap comprises the composition.Claim 33. A method for controlling a lepidopteran population, comprising contacting the lepidopteran population with the interfering RNA of any one of claims 1 to 6, the expression cassette of any one of claims 7 to 12, the vector of claim 13 or 14, the microbial cell, algal cell, or plant cell of any one of claims 15 to 17, or the composition of any one of claims 18 to 32, wherein contacting the lepidopteran population comprises a lepidopteran insect in the lepidopteran population ingesting the interfering RNA, the expression cassette, the vector, the microbial cell, algal cell, or plant cell, or the composition, thereby controlling the lepidopteran population.Claim 34. A method for controlling a lepidopteran population, the method comprising contacting the lepidopteran population with an interfering RNA molecule comprising a nucleotide sequence that is partially or perfectly complementary to mRNA transcribed from a target gene and which specifically inhibits expression of the target gene in a lepidopteran insect in the lepidopteran population, thereby controlling the lepidopteran population, wherein the target gene encodes a potassium voltage-gated channel protein or an ortholog thereof.Claim 35. The method of claim 34, wherein the interfering RNA is a double stranded RNA (dsRNA), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), or an anti-sense oligonucleotide.Claim 36. The method of claim 34 or 35, wherein the interfering RNA is a short hairpin RNA (shRNA).Claim 37. The method of any one of claims 34 to 36, wherein the target gene comprises a DNA sequence that has at least 84%, 88%, 92%, 96%, or 100% identity to the entire length of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO: 13, SEQ IDNO: 16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46.Claim 38. The method of any one of claims 34 to 37, wherein the target gene comprises a DNA sequence that has 100% identity to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46Claim 39. The method of any one of claims 34 to 37, wherein the interfering RNA is produced by a microbial cell, algal cell, or plant cell comprising an expression cassette comprising a regulatory sequence operably linked to a nucleotide sequence encoding theinterfering RNA, wherein the expression cassette is integrated into the genome of the microbial cell.Claim 40. The method of claim 39, wherein the expression cassette comprises a nucleotide sequence having at least about 80%, 85%, 90%, 95%, 98%, or 99% sequence identity to the entire length of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO: 45, SEQ ID NO:47, or SEQ ID NO:48, or the complement thereof.Claim 41. The method of claim 39 or 40, wherein the expression cassette comprises the entire length of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO: 45, SEQ ID NO:47, or SEQ ID NO:48Claim 42. The method of any one of claims 39 to 41, wherein the method comprises contacting the lepidopteran insect in the lepidopteran population with the microbial cell, algal cell, or plant cell.Claim 43. The method of any one of claims 39 to 42, wherein the microbial cell, algal cell, or plant cell is dead or alive.Claim 44. The method of any one of claims 39 to 43, wherein the microbial cell is a Saccharomyces cerevisiae cell.Claim 45. The method of any one of claims 34 to 44, wherein the lepidopteran population comprises an Australian painted apple caterpillar or moth, armyworm caterpillar or moth, beet armyworm caterpillar or moth, cactus caterpillar or moth, carob caterpillar or moth, cotton bollworm caterpillar or moth, diamondback caterpillar or moth, codling caterpillar or moth, apple worm caterpillar or moth, pink bollworm caterpillar or moth, fall armyworm caterpillar or moth, Southern armyworm caterpillar or moth, corn earworm caterpillar or moth, soybean looper caterpillar or moth, tobacco cutworm caterpillar or moth, fruit borer, pod borer, shoot borer, diamond bollworm, Asian corn borer, European corn borer, false codling moth, Western bean cutworm, or a velvetbean caterpillar or moth.Claim 46. The method of any one of claims 34 to 45, wherein the lepidopteran insect population comprises a species of Abrostola, Agrochola, Agrotis, Allophyes, Amphipoea, Anorthoa, Anticarsia, Apamea, Asteroscopus, Atethmia, Autograph., Brachlomia, Cactoblastis,Carastis, Chrysodeixis, Cosmia, Cydia, Dasypolia, Diachrysia, Diarsia, Dicycla, Diloba, Dryobota, Dryobotodes, Ectomyelois, Eremobia, Euplexia, Eupsilia, Fissipunctia, Globia, Gortyna, Griposia, Hecatera, Helicoverpa, Heliothis, Herminia, Hoplodrinci, Hydraecia, Hypena, Hyppa, Lacanobia, Laspeyria, Leucemia, Lithophane, Lithosia, Luperina. Lymantria Mamestra, Melanchra, Mesoligia, Mythimna, Oligia spp., Omphaloscelis, Orthosia, Pectinophora, Pelosia, Plusia, Polia, Plutella, Polymixis, Protodeltot, Pyrrhia, Shargacucullia, Spodoptera, Subacronicta, Teia, Thalpophila, Tholera, Thaumatotibia, Tiliacea, or Xanthia, or a combination thereof.Claim 47. The method any one of claims 34 to 46, wherein the interfering RNA comprises at least 25 contiguous nucleotides, wherein the nucleotide sequence is partially or perfectly complementary to mRNA transcribed from SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO:10, SEQ ID NO:13, SEQ ID NO:16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46, or a DNA sequence having at least about 70%, 75%, 80%, 85%, 90%, or 95% sequence identity to the entire length of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO: 37, SEQ ID NO: 40, SEQ ID NO:43, or SEQ ID NO: 46, or the complement thereof; and wherein the interfering RNA is capable of inhibiting the expression of a potassium voltage-gated channel protein.Claim 48. The method of any one of claims 34 to 47, wherein the method further comprises contacting the lepidopteran population with a sugar bait, a pheromone, an insecticide, or any combination thereof.

Images