Polyene macrolide for use in methods for treatment of fungal infections

Compound 1 is administered intravenously at specific doses to treat invasive fungal infections, addressing resistance and kidney impairment, reducing adverse effects and enhancing treatment efficacy for drug-resistant pathogens.

WO2025253319A1PCT designated stage Publication Date: 2025-12-11BIOSERGEN
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/IB2025/055772
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-05
Filing Date
2025-06-04
Publication Date
2025-12-11

AI Technical Summary

Technical Problem

Invasive fungal infections caused by pathogens such as Aspergillus spp. and Candida spp. are severe and increasingly resistant to existing antifungal agents, leading to high morbidity and mortality rates, especially in subjects with compromised kidney function or those undergoing treatments that prohibit the use of conventional antifungals.

Method used

Administering Compound 1 or its pharmaceutically acceptable salt as an intravenous infusion at doses ranging from 0.1 to 3.0 mg/kg/day, tailored to the specific fungal infection and subject condition, including those with kidney impairment or concomitant medication use, to effectively treat invasive fungal infections.

Benefits of technology

The method reduces the risk of infusion-related reactions and nephrotoxicity, provides effective treatment for drug-resistant infections, and maintains kidney function, while avoiding interactions with other medications, thereby improving treatment outcomes for invasive fungal infections.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000002_0001
    Figure IMGF000002_0001
  • Figure IMGF000002_0002
    Figure IMGF000002_0002
  • Figure IMGF000003_0001
    Figure IMGF000003_0001
Patent Text Reader

Abstract

This invention relates to pharmaceutical compositions and methods featuring dosing regimens of Compound 1, or a pharmaceutical acceptable salt or neutral form thereof (e.g., Compound 1 acetate).
Need to check novelty before this filing date? Find Prior Art

Description

[0001] POLYENE MACROLIDE FOR USE IN METHODS FOR TREATMENT OF FUNGAL INFECTIONS

[0002] FIELD OF INVENTION

[0003] This invention relates to methods (e.g., dosing regimens) of Compound 1 , or a pharmaceutically acceptable salt thereof, for the treatment of fungal infections.

[0004] BACKGROUND

[0005] Invasive fungal infections (IFIs) are severe, systemic infections caused by fungal pathogens such as Aspergillus spp. and Candida spp. Invasive fungal infections continue to have a significant impact on human health and are associated with high morbidity and mortality rates. Thus, there is an urgent need to develop new methods using antifungal agents to treat these infections in light of the increasing prevalence of resistance to existing antifungals.

[0006] SUMMARY OF THE INVENTION

[0007] In one aspect, the disclosure features a method of treating a fungal infection in a subject, the method including administering to the subject Compound 1 :

[0008] Compound 1 or a pharmaceutically acceptable salt thereof, as an intravenous infusion in an amount of from about 0.1 to about 3.0 mg / kg / day, thereby treating the subject.

[0009] In another aspect, the disclosure features a method of treating a fungal infection in a subject suffering from compromised kidney function, the method including administering to the subject Compound 1 :

[0010] Compound 1 or a pharmaceutically acceptable salt thereof, as an intravenous infusion in an amount of from about 0.1 to about 3.0 mg / kg / day, thereby treating the subject.

[0011] In some embodiments of the above aspect, the subject has failed treatment with a first-line antifungal agent (e.g., an azole antifungal, an echinocandin antifungal, or a polyene macrolide). In some embodiments, the azole antifungal is fluconazole. In some embodiments, the echinocandin antifungal is caspofungin. In some embodiments, the polyene macrolide is amphotericin B. In some embodiments, the subject is experiencing nephrotoxicity with either a 1 .5 ± 0.15 mg / dL increase of creatinine levels from baseline or has a 50% increase in creatinine levels from baseline. In some embodiments, the subject has hypokalemia or hypomagnesemia. In some embodiments, the hypokalemia or hypomagnesemia is caused by treatment with amphotericin B. In some embodiments, the fungal infection is an invasive fungal infection. In some embodiments, the invasive fungal infection is resistant to first-line antifungal agents (e.g., an azole or a polyene macrolide). In some embodiments, the azole is fluconazole. In some embodiments, the polyene macrolide is amphotericin B. In some embodiments, the resistant invasive fungal infection is azole-resistant Candida auris (C. auris). In some embodiments, the subject is undergoing concomitant treatment with medications that prohibit the use of antifungal agents (e.g., polyene macrolides, azoles, and echinocandins). In some embodiments, the subject is undergoing concomitant treatment with rifampicin, rifabutin, phenytoin, carbamazepine, bedaquiline, and quetiapine.

[0012] In another aspect, the disclosure features a method of treating a fungal infection in a subject undergoing concomitant treatment with diuretics, the method including administering to the subject Compound 1 :

[0013] Compound 1 or a pharmaceutically acceptable salt thereof, as an intravenous infusion in an amount of from about 0.1 to about 3.0 mg / kg / day, thereby treating the subject. In another aspect, the disclosure features a method of treating a fungal infection in a subject undergoing concomitant treatment with muscle relaxants, the method including administering to the subject Compound 1 : Compound 1 or a pharmaceutically acceptable salt thereof, as an intravenous infusion in an amount of from about 0.1 to about 3.0 mg / kg / day, thereby treating the subject.

[0014] In another aspect, the disclosure features a method of treating a fungal infection in a subject undergoing concomitant treatment with digoxin, the method including administering to the subject Compound 1 :

[0015] Compound 1 or a pharmaceutically acceptable salt thereof, as an intravenous infusion in an amount of from about 0.1 to about 3.0 mg / kg / day, thereby treating the subject. In another aspect, the disclosure features a method of treating a fungal infection in a subject undergoing concomitant treatment with nephrotoxic medication, the method including administering to the subject Compound 1 :

[0016] Compound 1 or a pharmaceutically acceptable salt thereof, as an intravenous infusion in an amount of from about 0.1 to about 3.0 mg / kg / day, thereby treating the subject.

[0017] In some embodiments, the intravenous infusion is administered, consecutively or non- consecutively, on at least 3 days (e.g., 3, 4, 5, 6, or 7 days) over the course of each week over a period of at least two weeks (e.g., two, three, or four weeks).

[0018] In some embodiments, the intravenous infusion is administered daily over a period of at least two weeks.

[0019] In some embodiments, Compound 1 , or a pharmaceutically acceptable salt thereof, is administered daily for 28 days.

[0020] In some embodiments, the intravenous infusion is administered every other day or every third day over a period of at least two weeks (e.g., two, three, or four weeks).

[0021] In some embodiments, from 0.15 to 3.0 mg / kg / day of Compound 1 , or a pharmaceutically acceptable salt thereof, is administered.

[0022] In some embodiments, 0.15 ± 0.05, 0.2 ± 0.05, 0.3 ± 0.03, 0.4 ± 0.04, 0.5 ± 0.05, 0.6 ± 0.06, 0.7 ± 0.07, 0.8 ± 0.08, 0.9 ± 0.09, 1.0 ± 0.1 , 1.1 ± 0.1 1 , 1.2 ± 0.12, 1.3 ± 0.13, 1.4 ± 0.14, 1.5 ± 0.15, 1 .6 ± 0.16, 1 .7 ± 0.17, 1 .8 ± 0.18, 1 .9 ± 0.19, 2.0 ± 0.2, 2.1 ± 0.21 , 2.2 ± 0.22, 2.3 ± 0.23, 2.4 ± 0.24, 2.5 ± 0.25, or 2.75 ± 0.25 mg / kg of Compound 1 , or a pharmaceutically acceptable salt thereof, is administered. In some embodiments, 0.9 ± 0.09 mg / kg of Compound 1 , or a pharmaceutically acceptable salt thereof, is administered. In some embodiments, 1 .8 ± 0.09 mg / kg of Compound 1 , or a pharmaceutically acceptable salt thereof, is administered. In some embodiments, 1.9 ± 0.19 mg / kg of Compound 1 , or a pharmaceutically acceptable salt thereof, is administered.

[0023] In some embodiments, from 0.1 mg / kg / day to 1 .0 mg / kg / day of Compound 1 , or a pharmaceutically acceptable salt thereof, is administered to the subject, and wherein the fungal infection is caused by Aspergillus, Candida, or Cryptococcus. In some embodiments, from 0.1 mg / kg / day to 1 .8 mg / kg / day of Compound 1 , or a pharmaceutically acceptable salt thereof, is administered to the subject, and wherein the fungal infection is Aspergillosis, Candidiasis, or Cryptococcosis. In some embodiments, 0.9 mg / kg / day of Compound 1 , or a pharmaceutically acceptable salt thereof, is administered to the subject. In some embodiments, 1 .8 mg / kg / day of Compound 1 , or a pharmaceutically acceptable salt thereof, is administered to the subject. In some embodiments, from 0.1 mg / kg / day to 1 .0 mg / kg / day of Compound 1 , or a pharmaceutically acceptable salt thereof, is administered to the subject, and wherein the fungal infection is Aspergillus, Candida, or Cryptococcus. In some embodiments, the Candida infection is invasive Candidiasis. In some embodiments, the Aspergillus infection is Aspergillosis. In some embodiments, the Aspergillosis is invasive pulmonary Aspergillosis.

[0024] In some embodiments, from 1 .5 mg / kg / day to 3.0 mg / kg / day of Compound 1 , or a pharmaceutically acceptable salt thereof, is administered to the subject, and wherein the fungal infection is Fusarium or Mucorales. In some embodiments, about 1 .9 mg / kg / day of Compound 1 , or a pharmaceutically acceptable salt thereof, is administered to the subject, and wherein the fungal infection is Mucorales.

[0025] In some embodiments, the methods of the invention treat mucormycosis. In some embodiments, the subject receives a dosing level of Compound 1 , or a pharmaceutically acceptable salt thereof, for a dosing period, the method further including the following steps:

[0026] (a) measuring a fungal burden in subject during or at the end of the dosing period; and

[0027] (b) based on the fungal burden measurement of step (a), (i) stopping the treatment at the end of the dosing period if the subject exhibits no fungal burden; or (ii) administering Compound 1 , or a pharmaceutically acceptable salt thereof, for a second dosing period if the subject exhibits a fungal burden.

[0028] In some embodiments, the method includes administering Compound 1 , or a pharmaceutically acceptable salt thereof, for a second dosing period if the subject exhibits a higher fungal burden, wherein the dosing level of Compound 1 , or a pharmaceutically acceptable salt thereof, is increased during the second dosing period.

[0029] In some embodiments, the method includes administering Compound 1 , or a pharmaceutically acceptable salt thereof, for a second dosing period if the subject exhibits a lower fungal burden, wherein the dosing level of Compound 1 , or a pharmaceutically acceptable salt thereof, is the same during the second dosing period.

[0030] In some embodiments, the fungal burden in a subject is measured by determining the amount of a fungal cell wall biomarker in a blood sample from the subject.

[0031] In some embodiments, the fungal cell wall biomarker is a mannan. In some embodiments, the mannan is galactomannan.

[0032] In some embodiments, the fungal cell wall biomarker is 1 ,3-beta-D-glucan.

[0033] In some embodiments, Compound 1 , or a pharmaceutically acceptable salt thereof, is administered as an aqueous pharmaceutical composition.

[0034] In some embodiments, the pharmaceutical composition has a pH of from 4.0 to 8.0 (e.g., a pH of 4.0, 5.0, 6.0, 7.0, or 8.0).

[0035] In some embodiments, the pharmaceutical composition has a pH of 5.0 ± 0.3 (e.g., a pH of 4.7, 4.8, 4.9, 5.0, 5.1 , 5.2, or 5.3).

[0036] In some embodiments, the salt of Compound 1 is Compound 1 acetate.

[0037] In some embodiments, Compound 1 , or a pharmaceutically acceptable salt thereof, is administered as an isotonic solution that is isotonic with body fluids to the subject, further including a nonionic tonicity agent. In some embodiments, the nonionic tonicity agent is 5% (w / v) glucose. In some embodiments, the isotonic solution is substantially free of saline.

[0038] In some embodiments, Compound 1 , or a pharmaceutically acceptable salt thereof, is administered in an infusion line that is substantially free of saline.

[0039] In some embodiments, Compound 1 , or a pharmaceutically acceptable salt thereof, is administered in an IV bag that is substantially free of saline.

[0040] In some embodiments, Compound 1 , or a pharmaceutically acceptable salt thereof, is administered in water for injection (WFI) that is substantially free of saline.

[0041] In some embodiments, the concentration of Compound 1 , or a pharmaceutically acceptable salt thereof, is 0.16 ± 0.016 mg / mL (e.g., 0.144, 0.16, or 0.176 mg / mL). In some embodiments, Compound 1 , or a pharmaceutically acceptable salt thereof, is administered over a time period of 120 ± 30 minutes (e.g., 90, 120, or 150 minutes) to 240 ± 30 minutes (e.g., 210, 240, or 270 minutes).

[0042] In some embodiments, the method further includes ECG monitoring of the subject to detect prolonged QT / QTc values after the administration of Compound 1 , wherein the administration of Compound 1 is discontinued if prolonged QT / QTc values are detected.

[0043] In some embodiments, the infection is an invasive fungal infection.

[0044] In some embodiments, the infection is caused by a Candida, Aspergillus, Cryptococcus, Fusarium, or Mucorales genus.

[0045] In some embodiments, the Candida species is selected from C. albicans, C. auris, C. glabrata, C. krusei, C. parapsilosis, or C. tropicalis.

[0046] In some embodiments, the Aspergillus species is selected from A. niger, A. fumigatus, A. flavus, A. nidulans, or A. terreus.

[0047] In some embodiments, the Cryptococcus species is C. neoformans var. grubii.

[0048] In some embodiments, the Fusarium species is selected from F. solan! or F. annulatum.

[0049] In some embodiments, the Mucorales species is selected from M. circinelloides, M. ramosissimus, or Rhizopus spp.

[0050] In some embodiments, the subject has failed treatment with an antifungal therapy.

[0051] In some embodiments, the subject has shown an intolerance to amphotericin B.

[0052] In some embodiments, the subject is undergoing concomitant treatment with medications that prohibit the use of antifungals (e.g., polyene macrolides, azoles, and echinocandins). In some embodiments, the subject is undergoing concomitant treatment with rifampicin, rifabutin, phenytoin, carbamazepine, bedaquiline, and quetiapine.

[0053] In another aspect, the invention features a method of treating a Candida infection in a subject including administering Compound 1 , or a pharmaceutically acceptable salt thereof, to the subject in an amount and for a duration sufficient to treat the Candida infection. In some embodiments, the Candida species is selected from C. albicans, C. auris, C. glabrata, C. krusei, C. parapsilosis, or C. tropicalis. In some embodiments, the C. auris infection is resistant to fluconazole and / or amphotericin B.

[0054] In another aspect, the invention features a method of treating an Aspergillus infection in a subject including administering Compound 1 , or a pharmaceutically acceptable salt thereof, to the subject in an amount and for a duration sufficient to treat the Aspergillus infection. In some embodiments, the Aspergillus species is selected from A. niger, A. fumigatus, A. flavus, A. nidulans, or A. terreus.

[0055] In another aspect, the invention features a method of treating a Candida infection in a subject who has failed treatment with an antifungal therapy, the method including administering Compound 1 , or a pharmaceutically acceptable salt thereof, to the subject in an amount and for a duration sufficient to treat the Candida infection. In some embodiments, the Candida species is selected from C. albicans, C. auris, C. glabrata, C. krusei, C. parapsilosis, or C. tropicalis. In some embodiments, the subject has failed treatment with an azole or a polyene macrolide. In some embodiments, the subject has failed treatment with fluconazole or amphotericin B.

[0056] In another aspect, the invention features a method of treating an Aspergillus infection in a subject who has failed treatment with an antifungal therapy, the method including administering Compound 1 , or a pharmaceutically acceptable salt thereof, to the subject in an amount and for a duration sufficient to treat the Aspergillus infection. In some embodiments, the Aspergillus species is selected from A. niger, A. fumigatus, A. flavus, A. nidulans, or A terreus. In some embodiments, the subject has failed treatment with amphotericin B or fluconazole.

[0057] In some embodiments, the subject has a mixed infection comprising a Mucor species and an Aspergillus species.

[0058] In some embodiments, the subject has a mixed infection comprising a Candida species and an Aspergillus species.

[0059] In some embodiments, the subject has a mixed infection comprising a Mucor species and an Candida species.

[0060] In some embodiments, the subject has a mixed infection comprising a Mucor species, a Candida species, and an Aspergillus species.

[0061] In some embodiments, the administration of Compound 1 , or a pharmaceutically acceptable salt thereof, produces: a) an average Cmax (maximum concentration) of 150 ± 15 to 170 ± 17 ng / mL; b) an average Tmax (time at maximum concentration) of 1 .97 ± 0.2 to 2.2 ± 0.2 h; c) an average AUCo - (extrapolated area under the plasma concentration time curve) of 1038 ± 104 mg«h / mL to 1 197 ± 120 mg«h / mL; and / or d) an average T1 / 2 (half-life) of 9.5 ± 0.95 h to about 1 1.1 ± 1.1 h.

[0062] In another aspect, the invention features a method of treating a fungal infection caused by a Candida species in a subject, the method including administering to the subject Compound 1 :

[0063] Compound 1 or a pharmaceutically acceptable salt thereof, as an intravenous infusion in an amount of from about 0.05 to about 0.6 mg / kg / day, thereby treating the subject. In some embodiments, the Candida species is selected from C. albicans, C. auris, C. glabrata, C. krusei, C. parapsilosis, or C. tropicalis. In some embodiments, the subject has candidiasis. In some embodiments, the subject has a mixed infection comprising a Candida species and a Mucor species. In some embodiments, the subject has a mixed infection comprising a Candida species and an Aspergillus species. In another aspect, the invention features a method of treating a fungal infection caused by a Aspergillus species in a subject, the method including administering to the subject Compound 1 :

[0064] Compound 1 or a pharmaceutically acceptable salt thereof, as an intravenous infusion in an amount of from about 0.6 to about 1 .5 mg / kg / day, thereby treating the subject. In some embodiments, the Aspergillus species is selected from A. niger, A. fumigatus, A. flavus, A. nidulans, or A terreus. In some embodiments, the subject has aspergillosis. In some embodiments, the subject has a mixed infection comprising an Aspergillus species and a Mucor species. In some embodiments, the subject has a mixed infection comprising a Candida species and an Aspergillus species.

[0065] In another aspect, the invention features a method of treating a fungal infection caused by a Aspergillus species in a subject, the method including administering to the subject Compound 1 :

[0066] Compound 1 or a pharmaceutically acceptable salt thereof, as an intravenous infusion in an amount of from about 0.6 to about 1 .8 mg / kg / day, thereby treating the subject. In some embodiments, the Aspergillus species is selected from A. niger, A. fumigatus, A. flavus, A. nidulans, or A terreus. In some embodiments, the subject has aspergillosis. In some embodiments, about 0.9 mg / kg of Compound 1 is administered to the subject. In some embodiments, about 1 .8 mg / kg / day of Compound 1 is administered to the subject. In some embodiments, the subject has a mixed infection comprising an Aspergillus species and a Mucor species. In some embodiments, the subject has a mixed infection comprising a Candida species and an Aspergillus species. In another aspect, the invention features a method of treating a fungal infection caused by a Aspergillus species in a subject, the method including administering to the subject Compound 1 :

[0067] Compound 1 or a pharmaceutically acceptable salt thereof, as an intravenous infusion in an amount of from about 1 .5 to about 1 .8 mg / kg / day, thereby treating the subject. In some embodiments, the Aspergillus species is selected from A. niger, A. fumigatus, A. flavus, A. nidulans, or A terreus. In some embodiments, about 1.8 mg / kg / day of Compound 1 is administered to the subject. In some embodiments, the subject has aspergillosis. In some embodiments, the subject has a mixed infection comprising an Aspergillus species and a Mucor species. In some embodiments, the subject has a mixed infection comprising a Candida species and an Aspergillus species.

[0068] In another aspect, the invention features a method of treating a fungal infection caused by a Mucor species in a subject, the method including administering to the subject Compound 1 :

[0069] Compound 1 or a pharmaceutically acceptable salt thereof, as an intravenous infusion in an amount of from about 1 .5 to about 1 .9 mg / kg / day, thereby treating the subject. In some embodiments, about 1 .9 mg / kg / day is administered. In some embodiments, the subject has mucormycosis. In some embodiments, the subject has a mixed infection comprising a Mucor species and an Aspergillus species. In some embodiments, the subject has a mixed infection comprising a Mucor species and a Candida species.

[0070] In any of the previous aspects or embodiments, the subject is dosed at a level less than 1 mg / kg, and the subject experiences reduced risk of infusion-related reactions compared to subjects dosed at a level more than 1 mg / kg. In some embodiments, the infusion-related reaction is fever, chills, stiffness, pain, swelling, erythema, or phlebitis.

[0071] In some embodiments, the subject is treated without transient or permanent impact on their kidney function. In some embodiments, the risk of hypomagnesemia or hyperkalemia in the subject is reduced compared to an equivalent dosage of amphotericin B liposomal injection. In some embodiments, the creatinine from baseline level in the subject is reduced in comparison to an equivalent dosage of amphotericin B liposomal injection.

[0072] DEFINITIONS

[0073] As used herein, the term “an amount sufficient” is meant the amount of an additive required to increase the oral bioavailability of a drug.

[0074] As used herein, the term “fungal infection” is meant the invasion of a subject by pathogenic fungi. For example, the infection may include the excessive growth of fungi that are normally present in or on the body of a human or growth of fungi that are not normally present in or on a human. More generally, a fungal infection can be any situation in which the presence of a fungal population(s) is damaging to a subject. Thus, the subject is “suffering” from a fungal infection when an excessive amount of a fungal population is present in or on the subject’s body, or when the presence of a fungal population^) is damaging the cells or other tissue of the person.

[0075] As used herein, the term “a drug-resistant fungal infection” refers to a fungal infection that is refractory to treatment with a drug, e.g., an antifungal drug. In such infections, the fungus that causes the infection is resistant to treatment with one or more antifungal drugs (e.g., an antifungal drugresistant strain of fungus (e.g., an antifungal drug-resistant strain of Candida spp.)). Antifungal drugs include, but are not limited to, echinocandins, polyene compounds, flucytosine, and azole compounds. Fungal infections may be caused by a fungus in the genus, e.g., Candida (e.g., C. albicans, C. auris, C. glabrata, C. krusei, C. parapsilosis, or C. tropicalis), Aspergillus (e.g., A. niger, A. fumigatus, A. flavus, A. nidulans, or A. terreus), Cryptococcus (e.g., C. neoformans var. grubii), Fusarium (e.g., F. solan! or F. annulatum), or Mucorales (e.g., M. circinelloides / ramosissimus or Rhizopus spp.).

[0076] As used herein, the term “antifungal therapy” refers to treatment of a fungal infection using an antifungal drug. Antifungal drugs used in an antifungal therapy include, but are not limited to, echinocandins, polyene compounds, flucytosine, azole compounds, enfumafungin, and SCY-078, APX001 . As described herein, an aspect of the disclosure is a method of treating a fungal infection in a subject who has failed treatment with an antifungal therapy (e.g., an azole such as fluconazole and a polyene macrolide such as amphotericin B). The antifungal drugs used in the antifungal therapy in this aspect of the disclosure do not include Compound 1 , or a pharmaceutically acceptable salt thereof, or neutral form thereof.

[0077] The term “about,” as used herein, indicates a deviation of ± 10%.

[0078] As used herein, an average of recited a PK parameter (e.g., an average Cmax (maximum concentration), an average Tmax (time at maximum concentration), an average AU Co - (extrapolated area under the plasma concentration time curve), and / or an average T1 / 2 (half-life)) refers to an average of data from 10 or more human subjects.

[0079] The term “pharmaceutical composition,” as used herein, represents a composition formulated with a pharmaceutically acceptable excipient, and used as part of a therapeutic regimen for the treatment of a disease or ailment in a mammal. The term “pharmaceutically acceptable excipient,” as used herein, refers to any ingredient other than the active agent(s) described herein ( e.g., a vehicle capable of suspending or dissolving the active agent(s)) and having the properties of being substantially non-toxic and substantially noninflammatory in a patient. Excipients may include, e.g., antioxidants, dis integrants, dyes (colors), emollients, emulsifiers, fillers (diluents ), flavors, fragrances, preservatives, printing inks, sorbents, suspending or dispersing agents, sweeteners, liquid solvents, and buffering agents.

[0080] The term “pharmaceutically acceptable salt,” as use herein, represents those salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and animals without undue toxicity, irritation, allergic response and the like and are commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are known in the art. For example, pharmaceutically acceptable salts are described in: Berge et al., J Pharmaceutical Sciences 66: 1-19, 1977 and in Pharmaceutical Salts: Properties, Selection, and Use, (Eds. P.H. Stahl and C.G. Wermuth), Wiley-VCR, 2008. The salts can be prepared in situ during the final isolation and purification of the compounds described herein or separately by reacting the free base group with a suitable organic acid. Examples of suitable acids for the formation of such salts include acetic, aspartic, benzenesulfonic, benzoic, bicarbonic, bisulfuric, bitartaric, butyric, calcium edetate, camsylic, carbonic, chlorobenzoic, citric, edetic, edisylic, estolic, esyl, esylic, formic, fumaric, gluceptic, gluconic, glutamic, glycollylarsanilic, hexamic, hexylresorcinoic, hydrabamic, hydrobromic, hydrochloric, hydroiodic, hydroxynaphthoic, isethionic, lactic, lactobionic, maleic, malic, malonic, mandelic, methanesulfonic, methylnitric, methylsulfuric, mucic, muconic, napsylic, nitric, oxalic, p- nitromethanesulfonic, pamoic, pantothenic, phosphoric, monohydrogen phosphoric, dihydrogen phosphoric, phthalic, polygalactouronic, propionic, salicylic, stearic, succinic, sulfamic, sulfanilic, sulfonic, sulfuric, tannic, tartaric, teoclic, and toluenesulfonic.

[0081] The term “subject,” as used herein, represents a human or non-human animal (e.g., a mammal) that is suffering from, or is at risk of, disease, disorder, or condition, as determined by a qualified clinician with or without known in the art laboratory test(s) of sample(s) from the subject. Non-limiting examples of diseases, disorders, and conditions include fungal infections caused by a Candida species (e.g., C. albicans, C. auris, C. glabrata, C. krusei, C. parapsilosis, or C. tropicalis), by an Aspergillus species (e.g., A. niger, A. fumigatus, A. flavus, A. nidulans, or I. terreus), by a Cryptococcus species (e.g., C. neoformans var. grubii), by a Fusarium species (e.g., F. solan! or F. annulatum), by a Mucorales species (e.g., M. circinelloides / ramosissimus or Rhizopus spp.), or any other strain that is susceptible to Compound 1 .

[0082] “Treatment” and “treating,” as used herein, refer to the medical management of a subject with the intent to improve, ameliorate, stabilize, prevent or cure a disease, disorder, or condition. This term includes active treatment (treatment directed to improve the disease, disorder, or condition); causal treatment (treatment directed to the cause of the associated disease, disorder, or condition); palliative treatment (treatment designed for the relief of symptoms of the disease, disorder, or condition); preventative treatment (treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, disorder, or condition); and supportive treatment (treatment employed to supplement another therapy). The term “tonicity agent” as used herein denotes pharmaceutically acceptable tonicity agents that are used to modulate the tonicity of the formulation, so that, for example, the formulation is isotonic with respect to body fluids. The formulations of the present invention are preferably isosmotic, that is, the formulations have an osmotic pressure that is substantially the same as human blood serum. The tonicity agent used in the formulations are preferably non-ionic tonicity agents and are preferably selected from the group consisting of glucose, glycerin, mannitol, sucrose, glycerol, sorbitol, and trehalose. Preferably, the non-ionic tonicity agent is mannitol, e.g., D-mannitol, or glucose, e.g., D-glucose. The concentration of the tonicity agent will be dependent on the concentration of other components of the formulation, especially where the formulation is intended to be isosmotic.

[0083] As used herein, the term “substantially free of saline” denotes that there is less than 0.1% (w / w) (e.g., less than 0.09% (w / w), less than 0.08% (w / w), less than 0.07% (w / w), less than 0.06% (w / w), less than 0.05% (w / w), less than 0.04% (w / w), less than 0.03% (w / w), less than 0.02% (w / w), or less than 0.01% (w / w)) of a saline in the pharmaceutical composition, the intravenous infusion line, the IV bag, and the water for injection.

[0084] As used herein, the term “water for injection (WFI),” refers to pharmaceutical grade and sterilized water that is substantially free of saline. As used herein, WFI is used as an aqueous carrier for the reconstitution of a lyophilizate for intravenous administration in a subject in need thereof.

[0085] As used herein, the term “compromised kidney function,” refers to a subject having mild to moderate kidney impairment. Non-limiting examples of compromised kidney function include subjects with an acute kidney injury with estimated glomerular filtration rate (eGFR) of <30 mL / min and improving creatinine levels or subjects with elevated creatinine due to acute kidney injury or renal dysfunction.

[0086] As used herein, the term “fungal burden,” refers to the amount of fungal cells in a sample. Fungal burden may be measured in a tissue, blood, or plasma sample from a subject. In a non-limiting example, the fungal burden in a subject may be measured by determining the amount of a biomarker (e.g., fungal cell wall component) in a blood sample from a subject. In some embodiments, the fungal cell wall component includes galactomannan or 1 ,3-beta-D-glucan.

[0087] As used herein, the term “azole,” refers to antifungal compounds that contain an azole group, which is a five-membered heterocyclic ring having at least one N and one or more heteroatoms selected from N, O, or S. Antifungal azole compounds function by binding to the enzyme 14a- demethylase and disrupt, inhibit, and / or prevent its natural function. The enzyme 14a-demethylase is a cytochrome P450 enzyme that catalyzes the removal of the C-14 a-methyl group from lanosterol before lanosterol is converted to ergosterol, an essential component in the fungal cell wall. Therefore, by inhibiting 14a-demethylase, the synthesis of ergosterol is inhibited. Examples of azole compounds include, but are not limited to, VT-1161 , VT-1598, fluconazole, albaconazole, bifonazole, butoconazole, clotrimazole, econazole, efinaconazole, fenticonazole, isavuconazole, isoconazole, itraconazole, ketoconazole, luliconazole, miconazole, omoconazole, oxiconazole, posaconazole, pramiconazole, ravuconazole, sertaconazole, sulconazole, terconazole, tioconazole, and voriconazole. As used herein, the term “polyene macrolide,” refers to antibiotic or antifungal compounds that feature a macrocyclic lactone ring bonded to one or more deoxy sugars. Examples of polyene macrolides include, but are not limited to, amphotericin B, nystatin, and natamycin.

[0088] BRIEF DESCRIPTION OF THE DRAWINGS

[0089] FIG. 1 shows an outline of the dosing escalation clinical trial of Compound 1 in human subjects.

[0090] FIG. 2 is a graph showing murine plasma pharmacokinetics following a single intraperitoneal dose of Compound 1 . Each symbol represents data from a single animal.

[0091] FIG. 3 is a series of graphs showing the murine dose response studies in the neutropenic invasive candidiasis model. CA = C. albicans, CG = C. glabrata, AF = A. fumigates. Five drug dose levels were administered every 24 h for 96 h. Each data point represents the mean from four animals. The dashed horizontal line represents the organism burden at the start of therapy.

[0092] FIG. 4 are graphs showing murine dose response studies with C. albicans in the neutropenic disseminated candidiasis. The drug exposure is expressed as either the 24h AUC / MIC (left panel) or Cmax / M IC (right panel) . Each data point represents the mean from four animals. The dashed horizontal line represents the organism burden at the start of therapy. Data points below the line represent killing activity and points above the line represent net growth. The sigmoid line represents the best fit regression using the sigmoid maximal effect (Emax) model. ED50 = exposure associated with 50% effect, N = slope, and R2= coefficient of determination.

[0093] FIG. 5 is a graph showing murine dose response studies with C. auris in the neutropenic disseminated candidiasis. The drug exposure is expressed as either the 24h AUC / MIC (left panel) or Cmax / M IC (right panel). Each data point represents the mean from four animals. The dashed horizontal line represents the organism burden at the start of therapy. Data points below the line represent killing activity and points above the line represent net growth. The sigmoid line represents the best fit regression using the sigmoid maximal effect (Emax) model. ED50 = exposure associated with 50% effect, N = slope, and R2= coefficient of determination.

[0094] FIG. 6 is a graph showing murine dose response studies with C. glabrata in the neutropenic disseminated candidiasis. The drug exposure is expressed as either the 24h AUC / MIC (left panel) or Cmax / M IC (right panel). Each data point represents the mean from four animals. The dashed horizontal line represents the organism burden at the start of therapy. Data points below the line represent killing activity and points above the line represent net growth. The sigmoid line represents the best fit regression using the sigmoid maximal effect (Emax) model. ED50 = exposure associated with 50% effect, N = slope, and R2= coefficient of determination.

[0095] FIG. 7 is a graph showing murine dose response studies with A. fumigates in the neutropenic disseminated candidiasis. The drug exposure is expressed as either the 24h AUC / MIC (leftpanel) or Cmax / M IC (right panel). Each data point represents the mean from four animals. The dashed horizontal line represents the organism burden at the start of therapy. Data points below the line represent killing activity and points above the line represent net growth. The sigmoid line represents the best fit regression using the sigmoid maximal effect (Emax) model. ED50 = exposure associated with 50% effect, N = slope, and R2= coefficient of determination.

[0096] FIG. 8 is a series of Cma / MIC curves of A. fumigatus, C. albicans, C. glabrata, and C. auris.

[0097] DETAILED DESCRIPTION

[0098] The invention features methods for treating fungal infections by intravenously administering compound 1 to a subject in an amount of from 0.1 to about 3.0 mg / kg / day, thereby treating the subject. Specific dosing regimens can be utilized, depending upon the fungus causing the infection and / or the condition of the subject. In some embodiments, the treatment regimen is guided by monitoring one or more biomarkers of infection in the subject.

[0099] Synthesis of Compound 1

[0100] Compound 1

[0101] Methods of synthesizing Compound 1 are known in the art. WO 2009 / 004322 teaches methods of biosynthesizing Compound 1 and derivatives thereof by introducing site-specific mutations in the nystatin biosynthetic gene cluster in Streptomyces noursei (S. noursei). For example, Compound 1 can be biosynthesized in a S. noursei mutant having inactivated ER5 and NysN domains. To produce the S. noursei mutant, the pSOK201 nysN4.1-CL346ST and ER inactivation vectors were transformed to Escherichia coli ET12567 (pUZ8002) and the resulting recombinant strains were used for conjugation of inactivation vectors into S. noursei as described previously (Brautaset, T., et al., Chem Biol. 2000 June; 7(6):395-403). The S. noursei complemented recombinant strain was subjected to fermentation followed by DMSO extraction to isolate Compound 1.

[0102] Formulations for Intravenous Infusion

[0103] In general, pharmaceutical compositions of Compound 1 may include pharmaceutically acceptable excipients, such as stabilizers, which are antioxidants that prevent or reduce the oxidation of Compound 1 , and / or cryoprotectants, which are compounds that minimize damage caused by cold temperatures. Non-limiting examples of stabilizers include antioxidants, such as ascorbic acid (e.g., L- (+)-ascorbic acid), sodium bisulfite, sodium metabisulfite, and sodium thiosulfate. Preferably, the stabilizer is ascorbic acid.

[0104] Non-limiting examples of cryoprotectants may include a saccharide, e.g., furanose, pyranose, ribose, arabinose, xylose, lyxose, allose, altrose, glucose, mannose, maltose, gulose, iodose, galactose, talose, erythrose, or the like, or a complex carbohydrate, e.g., trehalose, sucrose, lactose, cellulose, chitin, starch, or the like. In some embodiments, the cryoprotectant is a sugar alcohol. In some embodiments, the sugar alcohol is mannitol (e.g., D-mannitol), sorbitol, isomalt, maltitol, lactitol, xylitol, or erythritol. In some embodiments, the cryoprotectant is mannitol.

[0105] The formulation may be a lyophilized pharmaceutical composition including Compound 1 , a stabilizer, and a cryoprotectant. In some embodiments, carriers may be used to reconstitute the lyophilized pharmaceutical composition. The carrier may be an aqueous carrier, such as water substantially free of saline. In some embodiments, the reconstituted pharmaceutical composition is further diluted with an isotonic solution that includes a nonionic tonicity agent. In some embodiments, the nonionic tonicity agent selected from glucose, glycerin, mannitol, sucrose, glycerol, sorbitol, and trehalose. In some embodiments, the nonionic tonicity agent is glucose. Preferably, the aqueous carrier is a 5% (w / v) glucose aqueous solution that is isotonic with body fluids.

[0106] In some embodiments of the methods of the invention, the formulation for intravenous infusion includes a sterile lyophilized composition that includes 15 mg of Compound 1 , 600 mg of mannitol, and 1.8 mg of ascorbic acid. In some embodiments, the lyophilized composition is reconstituted in water for injection to produce a reconstituted formulation. In some embodiments, the reconstituted formulation is further diluted with an isotonic solution that includes a nonionic tonicity agent. Preferably, the isotonic solution is a 5% (w / v) glucose aqueous solution.

[0107] Biomarkers of Infection

[0108] The fungal burden in a subject may be measured by determining the amount of a biomarker (e.g., fungal cell wall component) in a blood sample from a subject. In some embodiments, the biomarker includes galactomannan or 1 ,3-beta-D-glucan. Serum levels of galactomannan can be measured by routine methods known in the art, e.g., a double-sandwich ELISA assay such as the Platelia™ Aspergillus immunoenzymatic sandwich microplate assay. Serum levels of 1 ,3-beta-D- glucan can be measured by routine methods known in the art, e.g., the Fungitell® assay.

[0109] Regimens for High Sensitivity Fungal Infections

[0110] The invention features dosing regimen methods for subjects infected with fungi that have high sensitivity to Compound 1 . In some embodiments, fungi that have high sensitivity to Compound 1 include Aspergillus, Candida, or Cryptococcus species. In some embodiments, 0.1 mg / kg / day to 1 .0 mg / kg / day of Compound 1 , or a pharmaceutically acceptable salt thereof, is administered to subject.

[0111] In some embodiments, the subject receives a dosing level of Compound 1 , or a pharmaceutically acceptable salt thereof, for a dosing period, wherein the method further includes the following steps:

[0112] (a) measuring a fungal burden in subject during or at the end of the dosing period; and (b) based on the fungal burden measurement of step (a), (i) stopping the treatment at the end of the dosing period if the subject exhibits no fungal burden; or (ii) administering Compound 1 , or a pharmaceutically acceptable salt thereof, for a second dosing period if the subject exhibits a fungal burden. In some embodiments, the method includes administering Compound 1 , or a pharmaceutically acceptable salt thereof, for a second dosing period if the subject exhibits a lower fungal burden, wherein the dosing level of Compound 1 , or a pharmaceutically acceptable salt thereof, is the same during the second dosing period.

[0113] Regimens for Low Sensitivity Fungal Infections

[0114] The invention features dosing regimen methods for subjects infected with fungi that have low sensitivity to Compound 1 . In some embodiments, fungi that have low sensitivity to Compound 1 include Fusarium or Mucorales species. In some embodiments, 1 .5 mg / kg / day to 3.0 mg / kg / day of Compound 1 , or a pharmaceutically acceptable salt thereof, is administered to the subject.

[0115] In some embodiments, the subject receives a dosing level of Compound 1 , or a pharmaceutically acceptable salt thereof, for a dosing period, wherein the method further includes the following steps:

[0116] (a) measuring a fungal burden in subject during or at the end of the dosing period; and (b) based on the fungal burden measurement of step (a), (i) stopping the treatment at the end of the dosing period if the subject exhibits no fungal burden; or (ii) administering Compound 1 , or a pharmaceutically acceptable salt thereof, for a second dosing period if the subject exhibits a fungal burden. In some embodiments, the method includes administering Compound 1 , or a pharmaceutically acceptable salt thereof, for a second dosing period if the subject exhibits a higher fungal burden, wherein the dosing level of Compound 1 , or a pharmaceutically acceptable salt thereof, is increased during the second dosing period.

[0117] Nephrotoxic medication

[0118] In an aspect, the invention features a method of treating an invasive fungal infection in a subject undergoing concomitant treatment with nephrotoxic medication, the method including administering to the subject Compound 1 :

[0119] Compound 1 or a pharmaceutically acceptable salt thereof, as an intravenous infusion in an amount of from about 0.1 to about 3.0 mg / kg / day. The utilization of the methods of the invention by subjects undergoing concomitant treatment with nephrotoxic medication can be advantageous in view of the safety of the claimed regimens relative to other antifungal therapies. In some embodiments, concomitant treatment with Compound 1 , or a pharmaceutically acceptable salt thereof, and nephrotoxic medication does not result in compromised kidney function in the subject. In some embodiments, nephrotoxic medication include loop diuretics, muscle relaxants, and digoxin. In some embodiments, nephrotoxic medications include medications that alter glomerular filtration rate (GFR), e.g., ACE inhibitors, angiotensin 2 receptor blockers, cyclosporins, NSAIDs, and tacrolimus. In some embodiments, nephrotoxic medications include medications that cause tubular cell toxicity, minoglycosides, amphotericin B, adefovir, cisplatin, and foscarnet. In some embodiments, nephrotoxic medications include medications that cause interstitial nephritis, e.g., analgesics, anticancer drugs, lithium, and calcineurin inhibitors. In some embodiments, nephrotoxic medications include medications that cause crystal nephropathy, e.g., antivirals (e.g., acyclovir) and antibiotics (e.g., ampicillin).

[0120] EXAMPLES

[0121] The following examples are merely illustrative and should not be construed as limiting the scope of this disclosure in any way as many variations and equivalents will become apparent to those skilled in the art upon reading the present disclosure. The contents of all references, patents, and patent applications cited throughout this application are expressly incorporated herein by reference.

[0122] Example 1 : Single and multiple ascending dose clinical trials of Compound 1 in human subjects

[0123] The study investigates the safety, tolerability, and pharmacokinetics (PK) of Compound 1 after a single dose and multiple IV infusions in healthy adult subjects.

[0124] In the single ascending dose (SAD) study, twenty-four subjects were enrolled in four cohorts. Subjects within each cohort of six subjects were randomized to receive Compound 1 or placebo in a 2:1 ratio (four subjects to Compound 1 and two subjects to placebo). Three sequential dose levels (single IV doses of 0.015, 0.035, and 0.1 mg / kg) were evaluated in the single ascending dose (SAD) cohorts. A single IV infusion of Compound 1 was administered to each subject on days 1 and 7. Dosing was escalated in a sequential fashion contingent on the safety and PK data review of the previous cohort. Sixteen subjects received a single infusion of Compound 1 , and eight subjects received placebo infusion. All 24 subjects completed the study up to the Day 7 follow-up visit. The PK results from the SAD study are summarized in Table 1 . At the end of the SAD study, it was determined that the infusion of Compound 1 at doses 0.015, 0.035, and 0.1 mg / kg was safe and without any impact on kidney function. A single infusion of Compound 1 at a dose ranging from 0.015 to 0.1 mg / kg exhibited a linear PK profile. able 1. Plasma pharmacokinetic parameters after single IV infusion of Compound 1 in healthy male subjects after a single IV infusion from SAD tudy.

[0125] PK Parameters 0.015 mg / kg 0.035 mg / kg 0.1 mg / kg 0.1 mg / kg

[0126] N Geo. Mean Geo. CV% N Geo. Mean Geo. CV% N Geo. Mean Geo. CV% N Geo. Mean Geo. CV%

[0127] Cmax (ng / mL) 4 58.3 10.1 4 116.2 18.9 4 387.1 13.7 4 318.2 16.3

[0128] Cmax / Dose 4 3886.2 10.1 4 3319.9 18.9 4 3870.8 13.7 4 3181.8 16.3

[0129] (ng / mL / (mg / kg) CEol (ng / mL) 4 58.3 10.1 4 116.2 18.9 4 387.1 13.7 4 286.4 5.8

[0130] AUC0-24hr 4 226.7 17.2 4 428.0 20.9 4 1613.7 18.2 4 1563.3 20.2

[0131] (h ng / mL) AUCo-inf (h ng / mL) 3 278.8 10.8 4 474.2 21.7 4 1821.6 18.5 4 1737.7 20.6

[0132] AUCO-inf / Dose 3 18589.8 10.8 4 13549.9 21.7 4 18215.9 18.5 4 17376.6 20.6

[0133] (h ng / mL / (mg / kg)) AUCo-last (h ng / mL) 4 229.3 17.2 4 432.2 20.9 4 1632.4 18.3 4 1590.4 20.3

[0134] AUCO-last / Dose 4 15287.7 17.2 4 12348.6 20.9 4 16324.3 18.3 4 15903.9 20.3

[0135] (h ng / mL / (mg / kg)) AUC%extrap (%) 4 10.3 23.7 4 8.8 7.5 4 10.3 10.6 4 8.4 8.7 tmax (h)[aI 4 1 / 1 31.08-1.18 4 1.17 1.12-1.20 4 1.12 1.10-1.15 4 1.7476 1.50-2.03

[0136] CL (mL / h) / kg) 3 53.8 10.8 4 73.8 21.7 4 54.9 18.5 4 57.5 20.6

[0137] Ke| ( / h) 3 7.292 11.9 4 8.664 8.6 4 8. 890 8.0 4 8.868 14.2 tl / 2 (h) 3 9.5 11.9 4 8.0 8.6 4 7.8 8.0 4 7.8 14.2

[0138] VZ (mL / kg) 3 737.7 9.7 4 851.8 17.1 4 617.5 18.0 4 648.9 29.3

[0139] Abbreviations: Abbreviations: AUCo-last = area under the concentration-time curve (AUC) from time 0 to last measurable concentration, AUCo-inf = AUC from time 0 extrapolated to infinity, AUCo-24hr = AUC during a dosing interval (dosing interval of 24 hours), AUC%extrap = percentage of total AUCo-inf obtained from extrapolation, Cmax = maximum plasma concentration, CEol = single dose plasma concentration atthe end of the infusion, CL = total plasma clearance, CV% = percent coefficient of variation, Geo = geometric, Kel = elimination rate constant, ti / 2 = apparent terminal phase half-life, tmax = time to maximum plasma concentration, Vz = volume of distribution. Notes:[aIfortmax, median and range were reported in place of Geo. Mean and Geo. CV%, respectively.

[0140] Lower Limit of Quantification = 1 ng / mL. For the purposes of PK parameter calculations, BLQ values prior to the first quantifiable value were set to zero and missing for the remaining time points.

[0141] In the multiple ascending dose (MAD) study, fifteen subjects were enrolled in two cohorts and randomized to receive Compound 1 or placebo in a 2:1 ratio. Two sequential dose levels (once daily [QD] IV doses of 0.035 and 0.5 mg / kg for 7 days) were evaluated in multiple ascending dose (MAD) cohorts. Daily infusion of Compound 1 was administered to each subject for seven days. Dosing was escalated in a sequential fashion contingent on the safety and PK data review of the previous cohort. One of the randomized subjects withdrew consent to participate in the study and did not receive any infusion. Therefore, nine subjects received at least one infusion of Compound 1 and five subjects received at least one infusion of placebo. Fourteen subjects completed the study up to the Day 7 Follow-up visit. The PK results from the SAD study are summarized in Table 2. At the end of the MAD study, it was determined that multiple infusions of Compound 1 at doses of 0.035 and 0.05 mg / kg were safe and without any impact on kidney function. Following multiple infusions of Compound 1 at 0.035 and 0.05 mg / kg, PK profiles remained similar on Day 1 and Day 7 with very small systemic accumulation of Compound 1.

[0142]

[0143] CEol (ng / mL) 4 142.5 8.8 5 153.2 5.7 3 149.9 13.2 3 167.3 14.7

[0144] AUC0-24hr / AUCtau 4 721.1 5.5 5 830.7 14.2 3 1037.5 3.6 3 1197.0 7.9

[0145] (h ng / mL)

[0146] AUCo-inf (h ng / mL) 4 809.0 8.3 3 995.2 13.2 2 1284.4 0.5 0 N / A N / A

[0147] AUCO-inf / Dose 4 23114.1 8.3 3 19903.4 13.2 2 36696.2 0.5 0 N / A N / A

[0148] (h ng / mL / (mg / kg)) AUCo-last (h ng / mL) 4 720.0 5.5 5 845.7 12.3 3 1037.9 3.6 3 1197.0 7.9

[0149] AUCO-last / Dose (h ng / mL / (mg / kg)) 4 20570.4 5.5 5 16913.4 12.3 3 29654.2 3.6 3 23940.3 7.9

[0150] AUC%extrap (%) 4 10.7 26.1 5 9.6 11.6 3 18.8 13.4 3 21.4 6.3 tmax (h)[aI 4 1 991.97-2.05 5 2.07 2.00-2.13 3 1.97 1.97-1.98 3 2.00 1.45-2.02

[0151] CL / CLss (mL / h) / kg) 3 43.3 8.3 3 50.2427 13.2 3 33.7 3.6 3 41.8 7.9

[0152] Ke| ( / h) 4 0.877 2130.4 3 0.473 2351.6 3 7.26 4.7 3 6.22 8.7

[0153] Rac N / A N / A N / A N / A 3 1.4 2.8 3 1.4 14.7 t1 / 2 (h) 4 7.91 18.9 3 6.80 14.6 3 9.5 4.7 3 11.1 8.7

[0154] VZ / Vzss (mL / kg) 4 493.5 13.2 3 493.3 5.5 3 464.6 8.3 3 671.2 15.3

[0155] Abbreviations: AUCo-last = area under the concentration-time curve (AUC) from time 0 to last measurable concentration, AUCo-inf = AUC from time 0 extrapolated to infinity, AUCo-24hr = AUC during a dosing interval (dosing interval of 24 hours), AUC%extrap = percentage of total AUCo-inf obtained from extrapolation, AUCtau = AUC during dosing interval at steady-state, Cmax = maximum plasma concentration, Cmax.ss = maximum plasma concentration at steady-state, CEol = single dose plasma concentration at the end of the infusion, CL = total plasma clearance, CLss = total plasma clearance at steady-state, CV% = percent coefficient of variation, Geo = geometric, Kel = elimination rate constant, N / A = not applicable, Rac = ratio of accumulation, ti / 2 = apparent terminal phase half-life, tmax = time to maximum plasma concentration, Vz = volume of distribution, Vzss = volume of distribution at steady-state. otes:[alfortmax median and range were reported in place of Geo. Mean and Geo. CV%, respectively.

[0156] Example 2: Dosing escalation clinical trial of Compound 1 in human subjects

[0157] The study is a single arm, multi-center, open-label, dose-escalation study to assess the safety and efficacy of intravenous Compound 1 in human subjects with an invasive fungal infection. LIST OF ABBREVIATIONS

[0158] AE Adverse event

[0159] AmB Amphotericin B or any of its formulations

[0160] APACHE Acute Physiology and Chronic Health Evaluation

[0161] BLQ Below the limit of quantification

[0162] Cl Confidence interval

[0163] COVID-19 Coronavirus disease 2019 eCRF Electronic Case Report Form

[0164] CV Coefficient of variation

[0165] DSRC Data Safety Review Committee

[0166] ECG Electrocardiogram

[0167] ED Early discontinuation

[0168] EDC Electronic Data Capture eGFR Estimated Glomerular Filtration Rate

[0169] EoS End-of-study

[0170] EoT End-of-treatment

[0171] FDA Food and Drug Administration

[0172] FSH Follicle Stimulating Hormone

[0173] GCP Good Clinical Practices

[0174] GLP Good Laboratory Practice

[0175] HRT Hormone replacement therapy

[0176] IB Investigator’s Brochure

[0177] ICF Informed Consent Form

[0178] ICH International Conference on Harmonisation

[0179] ICU Intensive Care Unit

[0180] IEC Independent Ethics Committee

[0181] IFI Invasive fungal infection

[0182] IRB Institutional Review Board

[0183] IV Intravenous

[0184] MFC Minimum Fungicidal Concentration

[0185] MIC Minimum Inhibitory Concentrations

[0186] MTD Maximum Tolerated Dose

[0187] NOAEL No Observed Adverse Effect Level

[0188] OST Overall survival time

[0189] PD Protocol Deviations

[0190] PK Pharmacokinetic(s) SAE Serious Adverse Event

[0191] SAD Single Ascending Dose

[0192] SAP Statistical Analysis Plan

[0193] SoA Schedule of Assessments

[0194] SUSAR Suspected Unexpected Serious Adverse Reaction

[0195] TEAE Treatment-Emergent Adverse Event

[0196] WMA World Medical Association

[0197] WOCBP Woman of Childbearing Potential

[0198] Protocol Synopsis

[0199] Invasive fungal infection (IFI) is a severe, systemic infection caused by fungal pathogens such as Aspergillus spp. and Candida spp. Invasive fungal infections continue to have a significant impact on human health and are associated with high morbidity and mortality rates. Compound 1 is a drug for IFI, which belongs to the polyene macrolide class of drugs and is produced by Streptomyces Noursei G7 ER5-NysN-n1 ,72.cr. Preclinical studies of Compound 1 have indicated a potential for higher potency and improved safety - including an absence of kidney toxicity - than currently used antifungal agents. The safety and tolerability of Compound 1 have been evaluated in a first-in-human study. The safety results from the study show that Compound 1 is safe. A dosing escalation protocol is shown in FIG. 1.

[0200] Background

[0201] The investigative new drug Compound 1 belongs to the same polyene macrolide class of drugs as AmB. Amphotericin B is a well-established and widely used antifungal agent for the treatment of severe IFI. The mechanism of action of AmB is based on the binding of the AmB molecule to ergosterol, a sterol found in cell membranes of fungi. The binding results in an aggregate that creates a transmembrane channel, allowing the cytoplasmic contents to leak out, leading to fungal cell death. The activity of AmB has been demonstrated in vitro against a wide variety of clinical fungal isolates, including most Candida spp., Aspergillus spp., the Mucorales, all the endemic mycoses, and most hyaline and brown-black molds.

[0202] Although AmB is an effective treatment against various fungal infections, its use is normally reserved for patients who have severe, life-threatening IFI because of toxicities associated with its use at therapeutic doses. Furthermore, anemia and thrombocytopaenia are side effects in up to 75% of patients treated with AmB. AmB administration is also limited by infusion-related acute toxicity, an effect postulated to result from proinflammatory cytokine production. The acute toxicity reactions also include nausea, vomiting, rigors, fever, hypertension or hypotension, and hypoxia. In the liver, increased levels of liver enzymes are common (approximately 20% of patients) and even serious cases of hepatotoxicity (up to and including fulminant liver failure) are occasionally reported. Serious cardiac arrhythmias (including ventricular fibrillation), and even frank cardiac failure have been reported. Skin reactions, including serious forms, are also possible. Thus, an important unmet medical need to develop a new antifungal treatment with better safety profile still exists. Compound 1 has in vitro antifungal activity against a wide variety of fungal pathogens and, like AmB, exerts its antifungal effect by disruption of fungal cell wall synthesis and formation of pores. However, genetic engineering of certain gene clusters has made Compound 1 more potent and less toxic compared to other polyene class drugs such as nystatin and AmB.

[0203] Supportive Nonclinical Data

[0204] Pharmacology

[0205] In a large in vitro test program at the Mycology Center, Case Western University, USA, more than 200 different fungal strains were tested and included Candida strains with known elevated minimum inhibitory concentrations (MICs) to other available antifungals (AmB, caspofungin, fluconazole, and voriconazole).

[0206] Both Compound 1 and AmB were fungicidal with a similar minimum fungicidal concentration (MFC50) and MFC90 toward most strains, with concentration values between 0.25 and 2.0 pg / mL. For the Aspergillus strains tested, the overall Compound 1 MIC90 was equivalent to AmB, caspofungin, and voriconazole. Compound 1 and AmB were the only antifungals with activity against the Mucoromycete strains tested. Of the 17 Candida strains with elevated MICs against non-polyenes, Compound 1 had MICs in the range 0.5 - 2.0 pg / mL, which was lower than that of comparators, and Compound 1 was fungicidal in all but one strain.

[0207] Results from investigation of Eurofins Panlabs panel of 44 human biomolecule targets for binding and enzyme inhibition assays indicated that Compound 1 has a low risk of off-target safety issues.

[0208] The in vivo effect was tested at the Mycology Center in a standardized immune compromised mouse model toward Candida albicans SC5314 and Aspergillus fumigatus AF91 infection. Compound 1 demonstrated antifungal activities at doses corresponding to only 28% of the maximum tolerated dose (MTD) for Compound 1 (4.48 mg / kg / day), as compared to 62% MTD dose for AmB (2.01 mg / kg / day).

[0209] Toxicology

[0210] In a non-good laboratory practice (GLP) 14-day dose range-finding study of 1 , 4, or 7 mg / kg Compound 1 administered by 2-hour IV infusion in Wistar Han rats, difficulties were encountered with the infusion at the infusion sites (jugular vein cannulation site and / or tail vein), so the 4 mg / kg dose was reduced to 2 mg / kg. The MTD was determined to be 2 mg / kg.

[0211] A non-GLP repeat dose toxicity study (Study No: 64303-17-278) of 2-hour daily infusion of 0, 1 , or 3 mg / kg Compound 1 for 5 days in Wistar Han rats demonstrated that pathologies were associated with the IV infusion and slight body weight decreases for animals given 3 mg / kg / day.

[0212] A non-GLP maximum tolerated dose and 7-day dose range-finding study of Compound 1 following IV administration in Wistar Han rats determined that the MTD was 3 mg / kg / day via 30- minute IV infusion. A non-GLP MTD and 14 day repeat dose toxicity study of Compound 1 in Beagle dogs undertaken in 2 phases using different doses of Compound 1 in a 2-hour IV infusion determined that the MTD was 5 mg / kg / day.

[0213] A GLP 28-day toxicity and toxicokinetic study of 30-minute daily infusion of vehicle, 0.25, 1 .0, or 2.0 mg / kg, followed by 28-day recovery period was conducted in Wistar Han rats. At the 2 mg / kg dose, liver necrosis was seen after 28 days of dosing in both Compound 1 and control groups. Although it could be due to sepsis after a long period of IV catheter use, it cannot be ruled out that it was related to the test drug. At the examination after the recovery period, there were no changes attributed to the test drug. Compound 1 administration was not associated with alterations in kidney function parameters or histology. The no observed adverse effect level (NOAEL) was 1 .0 mg / kg / day.

[0214] A GLP 28-day toxicity and toxicology study of 2-hour daily infusion of vehicle, 0.3, 1 .0, or 3.0 mg / kg Compound 1 in Beagle dogs for 28 days followed by 28-day recovery period found there was minimal increase in liver enzyme levels, which normalized during the recovery period. There were no alterations of kidney function parameters. The NOAEL was determined to be 1 .0 mg / kg / day.

[0215] Genetic Toxicology

[0216] The potential genotoxicity of Compound 1 was assessed both in vitro and in vivo by a bacterial reverse mutation (Ames) assay, a cytogenetic evaluation of chromosomal damage, as well as a micronucleus assay in the rat. All GLP study procedures were based on the International Conference for Harmonisation (ICH) S2(R1) guideline (ICH, 2012). The results for all the above studies met the criteria for a negative response.

[0217] Nonclinical Pharmacokinetics

[0218] The PK / toxicokinetics of Compound 1 was studied as part of the nonclinical toxicology program in rats and dogs. The GLP studies in rats and dogs demonstrated that, following IV administration^) by slow infusion (30 minutes in rats, 2 hours in dogs), plasma concentrations decreased slowly, with a significant concentration of Compound 1 remaining in plasma at 24 hours. The half-life was approximately 8 to 15 hours in both rats and dogs after IV administration. Clearance values of about 3 mL / min / kg were observed in previous non-GLP studies in both mice and rats, suggesting that Compound 1 is a low clearance drug.

[0219] In terms of dose relationship, systemic exposure to Compound 1 in rats and dogs increased in a generally close to a dose-proportional manner in the tested dose ranges. Exposure to Compound 1 also increased overtime upon repeated dosing, and slight accumulation was observed after dosing for 28 consecutive days in both species.

[0220] Clinical Safety

[0221] In total, 38 healthy subjects (randomized to 4 on active treatment and 2 on placebo per cohort) were treated with a single IV infusion of Compound 1 at dose levels of 0.015, 0.035, and 0.1 mg / kg per each cohort in the single ascending dose (SAD) part of the study. Sixteen healthy subjects in 2 cohorts (randomized to 4 on active treatment and 2 on placebo per cohort) were administered Compound 1 for 7 days at dose levels of 0.035 and 0.05 mg / kg per cohort in the multiple ascending dose (MAD) part of the study.

[0222] In summary, Compound 1 was found to be safe in healthy subjects during the SAD and MAD parts of the study. There were no notable changes in postbaseline clinical laboratory parameters (including kidney and liver) and vital signs, and no clinically meaningful abnormalities were noted in ECG assessment. Some infusion-related TEAEs such as fever, rigors, chills, and headaches were reported in the SAD cohorts. These TEAEs disappeared or minimized after repeated infusion.

[0223] In the MAD part of the study, injection site reactions such as pain, swelling, erythema, and phlebitis were present in all subjects to various degrees on active treatment. All TEAEs reported were mild to moderate in severity. For three subjects, the dosing was interrupted for 24 to 52 hours. One subject withdrew consent due to injection site reactions.

[0224] No subject died, experienced any serious TEAE, TEAE leading to study treatment interruption or study withdrawal.

[0225] Clinical Pharmacokinetics

[0226] Maximum plasma concentrations (Cmax) were observed at the end of infusion. The plasma concentration profiles exhibited a multi-exponential decline over time and the shape of the curves was similar on Day 1 and Day 7. Following single IV infusion the exposure, both in terms of Cmax and AUC, increased approximately proportional to dose in the dose interval 0.015 to 0.1 mg / kg, thus linear PK was observed. The terminal half-life (ti / 2) ranged from approximately 7 to 9 hours, when taking blood samples up to 24 hours postdose.

[0227] In both SAD and MAD, the observed systemic clearance (CL) was low ranging from approximately 34-74 ml / h / kg and the distribution volume associated with the terminal elimination phase (Vz) was ranging from 465 to 852 ml / kg, which corresponds approximately to the volume of total body water.

[0228] After repeated once daily dosing, based on Ctrough values the steady state was achieved from Day 5 and onwards. Based on AUCtau (AUCo-24h) only slight accumulation (approximately 1 .4-fold) was observed after 7 days of repeated once daily dosing.

[0229] Interindividual variation was relatively low, with CV% <20 for most of the PK parameters. Renal clearance was low and less than 2% of the dose was excreted in the urine as unchanged Compound 1 on Day 1 and less than 3% on Day 7.

[0230] Summary of Benefit and Risk

[0231] Compound 1 belongs to the polyene macrolide class of drugs. Compound 1 will be administered as intravenous (IV) infusion in this study. As with any IV infusion there is a risk of chills, fever, headache, redness of face, hypotension, increased heart rate, bronchospasm, nausea, and vomiting. From what is known from the closest comparable drug (amphotericin B liposomal injection, i.e., AmB), a few of these infusion reaction symptoms were seen at >1 / 10; however, most are <1 / 10 but >1 / 100. Hypokalaemia was a common side effect with AmB (>1 / 10) and should be followed with a laboratory control test and ECG. This class of drugs has two main risks with its use: a possible increase in some of (not all) the liver function tests and an adverse effect on kidney function; hence, the exclusion of patients with renal and liver function tests outside of the normal range. More importantly, the study of Compound 1 in human subjects did not reveal any safety issues related to renal and liver function. All TEAEs were considered to be moderate in severity and no safety issues other than infusion-related and infusion site reactions were reported.

[0232] Considering the preclinical data, Compound 1 is believed to show potential clinical benefits to patients with IFI who cannot tolerate the standard of care antifungal treatment.

[0233] The potential risks have been taken into consideration in the design and safety monitoring of the study to mitigate any risk. The study safety measures comprise specific eligibility criteria for participation in this study. All patients will be monitored closely during the study treatment infusion, and equipment and emergency drugs will be available to treat any medical emergencies during the study. The study will be discontinued in the event of any new findings that indicate a relevant deterioration of the benefit-risk ratio and would render the continuation of the study unjustifiable.

[0234] Taking into account the measures taken to minimize risk to patients participating in this study, the potential risks identified in association with Compound 1 are justified by the anticipated benefits that may be afforded to patients with IFI.

[0235] Treatment of Patients with IFI

[0236] In this study, Compound 1 is indicated as a therapy in patients with IFI that would benefit from being treated with amphotericin B or any of its lipid formulations (defined as AmB) but have shown intolerance to AmB. In addition, Compound 1 will be infused to patients who have failed other first-line therapy of Investigator’s choice or to patients who have not previously been treated with an antifungal treatment and have mild to moderate kidney impairment. Thus, this study is being conducted to evaluate the preliminary safety and efficacy of Compound 1 following ascending dose administrations in patients with IFI who are unable to tolerate AmB, (e.g., due to kidney toxicity), have failed previous first-line therapy, or in need for antifungal treatment and have concomitant mild to moderate kidney impairment. The primary and secondary objectives and endpoints of the study is summarized in Table 3.

[0237] Table 3. Primary and Secondary Objectives and Endpoints

[0238] Abbreviations: AESI = adverse event of special interest, AUCo-iast = area under the concentration-time curve from time 0 to last measurable concentration, AUCo-iast / Dose = area under the concentrationtime curve from time 0 to last measurable concentration per dose, AUCtau = area under the concentration-time curve at steady state, CLss = total plasma clearance at steady state, Cmaxss = maximum plasma concentration at steady state, Cmaxss / Dose = maximum plasma concentration per dose at steady state, Ctrough = concentration of drug reached immediately before the next dose is administered, IFI = invasive fungal infection, TEAEs = treatment-emergent adverse events, tmax = time to maximum plasma concentration, ti / 2 = terminal elimination phase half-life, Vzss= volume of distribution at steady state. 3Clinical response based on clinical signs, physical findings, and symptoms relevant to each patient and depending on the IFI. bRadiological response based on baseline radiological assessment during the Screening period and course of the study depending on the IFI. cMycological response based on assessments including applicable either culture sensitivity with (1 , 3) beta D-glucan (serum), or histology / cytology, or serologic markers (such as galactomannan antigen) depending on the IFI (identification should be to species level). Overview of Study Design

[0239] This study is undertaken to assess the safety and efficacy of intravenous administration of Compound 1 in patients with uncomplicated invasive fungal infections (I Fl) .

[0240] The study will be conducted in 3 cohorts consisting of 3 periods, namely: Screening, Treatment, and Follow-up periods. In each cohort, 5 patients are planned to be enrolled. Following 7 days of Screening period, patients will be enrolled in the study. In Cohort 1 , patients will be administered with a dose of 0.1 mg / kg of Compound 1 , which was tested in the single ascending dose (SAD) group of the healthy subject study and will follow an intra-patient dose-escalation step. Based on the overall health status of the patient (safety and efficacy of study intervention), the dose can be adjusted at any point of time according to the Investigator's judgment, which would be based on clinical or mycological or radiological assessments dependent on the information available. This can be dose escalation or dose de-escalation as appropriate. During the Treatment period, there may be a pause of one day or more if deemed necessary by the Investigator. Each patient will be evaluated individually for efficacy and safety to decide if escalation is possible. The dose will be escalated by 0.1 mg / kg of Compound 1 every 3 days or 1 day earlier (i.e., 2 days) at the Investigator’s discretion.

[0241] The starting dose in Cohort 1 will be 0.1 mg / kg of Compound 1 for the first 3 days of treatment; if no safety concerns are experienced, the patients will be escalated up to 0.2 mg / kg. This process will be followed up to a maximum of 1 .0 mg / kg of Compound 1 or till a maximum of 28 days of treatment duration in Cohort 1 , with the possibility to stop any time after 14 days depending on the status of the patient. The starting dose of Cohort 2 will be decided by the Data Safety Review Committee (DSRC) after review of all available relevant data up to Day 14 of treatment for all patients in Cohort 1 . Subsequently, a similar dose-escalation will be followed for Cohort 2 as defined above for Cohort 1 . The dose can be escalated up to a maximum of 2.0 kg / mg. A similar process will be followed for the first dose in Cohort 3 and the dose can be escalated up to a maximum of 3.0 mg / kg. Compound 1 will be administered daily via IV infusion for 120 minutes (may be prolonged for up to 240 minutes). As Compound 1 has a propensity for phlebitis, central catheters or long peripheral catheters are preferred for infusion.

[0242] The following guideline applies for initiating a new cohort:

[0243] Cohort 1 :

[0244] • If fewer than or equal to 40% of Cohort 1 patients (i.e., <2 patients) elicit any Compound 1 related serious adverse events (SAEs) for any of the key toxicity parameters (hypomagnesemia, hypokalemia, and renal failure), then dosing will proceed into Cohort 2 after the DSRC has reviewed all available relevant data up to Day 14 of treatment for all patients in Cohort 1 (i.e., safety and efficacy data collected up to Day 14 for the last subject of Cohort 1) and will determine the starting dose for Cohort 2 based on the dose that has the best risk / benefit profile.

[0245] • If more than 40% patients (>2 patients) in Cohort 1 do manifest SAEs that are related to Compound 1 , further dose-escalation will be stopped and an additional 5 patients will be enrolled in Cohort 1 to garner more data on Compound 1 tolerability and its relationship to dose and exposure. The dose will be within the dosing interval of Cohort 1 (0.1 to 1.0 mg / kg) and the Investigator will decide the most appropriate dose to initiate treatment. If, after this second group of Cohort 1 patients have been enrolled, the frequency of SAEs exceeds 40%, no patients will be enrolled in Cohort 2, but the last group of patients will be assigned to Cohort 1 as mentioned above, with the dose that is evaluated as safe and effective by the Investigator.

[0246] Cohorts 2 and 3:

[0247] A similar dosing strategy will be followed as detailed for Cohort 1 .

[0248] Number of Study Arms and Duration:

[0249] This study is a single arm study. The treatment (Compound 1) in each dose level will be administered once daily for 3 days via IV infusion. If the safety and tolerability profiles are acceptable at each dose level, the patients will be treated for a maximum of 28 days. Each patient will be in the study for up to 50 days, which consists of a 7-day Screening period, 1 day for baseline assessments, up to 28 days (maximum) of treatment with Compound 1 , and 14 days of follow-up.

[0250] Number of Investigators and Study Sites:

[0251] The study is planned to be conducted by 2 to 4 Investigators at 2 to 4 study sites in India.

[0252] Number of Patients:

[0253] Considering the exploratory nature of this study, the sample size is not based on formal statistical consideration. The sample size will depend on the number of dose levels evaluated in the study. Approximately 15 patients are planned to be enrolled in 3 cohorts.

[0254] Inclusion and Exclusion Criteria:

[0255] Inclusion Criteria

[0256] To be included in this study, each individual must satisfy all the following criteria:

[0257] 1. Age >18 years.

[0258] 2. Able to provide written informed consent or have a legally authorized representative that can provide informed consent in case of incapacitation.

[0259] 3. Diagnosed by Investigator to have an IFI .

[0260] Proven IFIs as defined in the 2020 consensus definitions by the European Organization for Research and Treatment of Cancer / Mycoses Study Group Education and Research Consortium (EORTC / MSGERC). Probable or possible IFIs can be included using the EORTC / MSGERC criteria or other established criteria. The inclusion of patients with IFI caused by, e.g., Aspergillus spp. and Candida spp., is preferred as these species are generally known to be responsive to a lower dose than other species, e.g., Mucor mycosis spp. 4. IFI patients with mild to moderate renal impairment or IFI patients requiring an alternative treatment as current treatment cannot be continued due to any of the following: a) Failure with one first-line agent, defined as either:

[0261] - Radiologic progression or

[0262] - Increase in serologic markers such as galactomannan antigen or beta-D-glucan or

[0263] - Failure of clearance of cultures or

[0264] - Progression or lack of improvement in a clinically appropriate timeframe of clinical symptoms attributed to IFI. b) Inability to tolerate AmB, as defined by at least one of the following: i. Nephrotoxicity with either:

[0265] 1 .5 mg / dL increase in creatinine from baseline or 50% increase in creatinine from baseline ii. Contraindication to use AmB with either:

[0266] Persistent hypokalemia or hypomagnesemia while on AmB despite appropriate electrolyte replacement c) Documented in vitro resistance to first-line antifungal therapy (i.e. fluconazole resistance in Candida auris) d) Treatment-limiting drug-drug interactions prohibiting the use of antifungals (azoles and echinocandins) such as concurrent rifampcin, rifabutin, phenytoin, carbamazepine, bedaqualine, quetiapine and others according to the antifungal interactions database (https: / / www.antifungalinteractions.org) or the patient is on any treatment prohibiting the use of standard antifungal agent such as azoles, echinocandins, amphotericin B, etc.

[0267] 5. Patient requiring not more than 28 days of antifungal therapy as per Investigator opinion as per the institutional guidance.

[0268] Exclusion Criteria

[0269] If an individual meets any of the following criteria, he or she is ineligible for this study:

[0270] 1 . Patient has a known hypersensitivity or severe infusion-related reaction to any polyene drug.

[0271] 2. Infection caused by a known or suspected organism with intrinsic resistance to AmB.

[0272] 3. Concurrent use of another investigational agent within 30 days of enrollment.

[0273] 4. Chronic kidney disease with estimated glomerular filtration rate (eGFR) <30 mL / min or dialysis. Patients with acute kidney injury with eGFR <30 mL / min and improving creatinine level can be included as judged by the Investigator.

[0274] Note: Patients may be rescreened within 48 hours if laboratory values are found to be abnormal.

[0275] 5. Has liver enzyme results (aspartate aminotransferase [AST] / alanine aminotransferase [ALT]) greater than 5 times the upper limit of normal. Note: Patients may be rescreened within 48 hours if laboratory values are found to be abnormal.

[0276] 6. Has a bilirubin level greater than 5 times the upper limit of normal.

[0277] Note: Patients may be rescreened within 48 hours if laboratory values are found to be abnormal.

[0278] 7. Patients who have an ejection fraction <25% of predicted.

[0279] 8. Currently pregnant or planning on getting pregnant while on study (details of contraception guidance are provided in Section 13).

[0280] 9. Breastfeeding.

[0281] 10. Patients not likely to survive a minimum of 28 days from start of screening.

[0282] 11. Patient receiving prohibited medications.

[0283] 12. Patient is an abuser of alcohol or medication.

[0284] 13. Patient is unlikely to comply with protocol requirements.

[0285] 14. Patients testing positive for HIV.

[0286] 15. Patients with malignancy.

[0287] 16. The Investigator is of the opinion the patient should not participate in the study.

[0288] 17. If participating in sexual activity that could lead to pregnancy, individuals of reproductive potential who can become pregnant must agree to use contraception throughout the study.

[0289] Prohibited Medications:

[0290] • High dose loop diuretics.

[0291] • Muscle relaxing drugs may increase the risk of low plasma levels of potassium if co administered with Compound 1 . These types of drugs might be allowed on a case-to-case basis dependent on the patient condition, to be agreed with the Sponsor's Medical Monitor.

[0292] • Any drug impacting the efficacy of polyene macrolide class of drugs.

[0293] • All other antifungals.

[0294] • Digoxin.

[0295] • Nephrotoxic medications, e.g., cyclosporine, aminoglycosides, foscarnet, etc.

[0296] Rescue Therapy:

[0297] Standard of care as applicable e.g., liposomal amphotericin B, azoles, echinocandins, or any other treatment in the opinion of Investigator.

[0298] Withdrawal from Study:

[0299] A patient may be withdrawn from the study at any time if the patient, the Investigator, or the Sponsor assess that it is not in the patient’s best interest to continue.

[0300] All patients are free to withdraw from participation at any time, for any reason, specified or unspecified, and without prejudice. At the time of discontinuation from the study, an ED visit should be conducted, as shown in the Schedule of Assessments (SoA). The patient will be permanently discontinued from the study intervention at that time. If the patient has withdrawn consent for the disclosure of future information, the Sponsor may retain and continue to use any data collected before such a consent withdrawal.

[0301] The Investigator should provide and document a reason for patient withdrawal from the study. The reason for the patient’s withdrawal from the study will be specified in the patient’s source documents.

[0302] Statistical Methods:

[0303] Safety Analyses: All safety and tolerability analyses will be based on the Safety Analysis Set. Safety evaluations will include the summary of incidence, severity, and type of treatment-emergent adverse events (TEAEs). Infusion site reactions will also be summarized. The incidence of hypomagnesemia, hypokalemia, and renal failure will be summarized. Time to recovery of baseline renal function for patients with elevated creatinine due to acute kidney injury will be analyzed by survival analysis method if there are sufficient data to allow such analyses. For mortality assessment, the number and percentage of patients who died up to the End-of-study (EoS) will be presented by cohort group and cause of death. Change from baseline in vital signs, 12-lead electrocardiograms (ECGs), and laboratory results will be summarized descriptively, as part of the safety analyses. The number of patients with clinically significant laboratory abnormalities will also be summarized. The physical examination findings will be summarized by frequency count and percentage.

[0304] Preliminary Efficacy Analyses:

[0305] All efficacy analyses will be based on the Efficacy Analysis Set. The overall response rates (including clinical, radiological, and mycological responses) will be summarized by frequency count and percentage. The 95% confidence interval (Cl) of response rates will be estimated by Clopper- Pearson exact method.

[0306] Pharmacokinetic Analysis:

[0307] Pharmacokinetic parameters will be summarized descriptively using Pharmacokinetic Analysis Set.

[0308] Committees: A DSRC will review the safety data generated at each dose level. Following review, a discussion will be held whether to continue dose-escalation to the next dose level or not. At a minimum, the DSRC will consist of a Principal Investigator, an independent external antifungal expert and the Medical Monitor. The DSRC decision will be documented in the DSRC meeting minutes. A detailed description of roles, responsibility, and timelines will be described in the safety monitoring plan. The DSRC may also be called on as a per needed basis. Table 4 summarizes the schedule of assessments for the study and Table 5 summarizes the pharmacokinetic sampling time for Cohort 1 doses. chedule of Assessments able 4 Schedule of Assessments for Study

[0309] bbreviations: AE = adverse event, BP = blood pressure, CRP = C-reactive protein, DNA = deoxyribonucleic acid, ED = early discontinuation, ECG = electrocardiogram, EoS =nd-of-study, EoT = End-of-treatment, FSH = follicle stimulating hormone, HbA1 c = glycated hemoglobin, hCG = human chorionic gonadotropin, ICF = informed consent form,CR = polymerase chain reaction, PK = pharmacokinetics, SAE = serious adverse event, Scr = screening. a. During the treatment period, there may be a pause of one or more days if deemed necessary by the Investigator. b. Study Day 1 is the first day of study intervention administration; subsequent study days are consecutive calendar days. Day 0 is admission day. c. End-of-treatment can vary from 15 to 28 days. d. If patient treatment continued beyond 15 days, all the procedures and assessments applicable for dose-escalation will be followed. If the patient is on a stable dose, assessment will be done as per Investigator’s discretion on the day of study intervention. e. EoS will be after 14 days from EoT (Section 4.1 .2). f. A complete physical examination will be performed at screening, admission, EoT, and EoS / ED. A symptom-directed examination when clinically indicated. Preadmission (and post admission if relevant), patients will be assessed using APACHE scoring. g. Height is recorded at screening. Weight is recorded at Screening visit, EoS, and ED visit. An estimate is accepted if impossible to weigh. h. Vital signs include blood pressure, pulse rate, respiratory rate, and body temperature. Vital signs shall be monitored with the patient to be seated or semi-supine (both positions are preferred) wherever possible. Vital signs measurements must be taken using the same body position at subsequent visits, after resting for at least 3 minutes. On Day 1 , patients will be monitored predose up to 60 minutes prior to start of infusion, every 30 ± 5 minutes for 2 hours during the infusion, and then every hour ± 15 minutes every hour up to 8 hours since start of the dosing. At the Follow-up visit, BP, pulse rate, respiratory rate, and body temperature shall be monitored only once. i. A baseline ECG is required and will be taken after the patient has been seated or semi-supine (both positions are preferred) wherever possible, ECG must be taken using the same body position at subsequent visits for 3 minutes. Thereafter, ECG will be recorded on days of dosing: Predose (60 minutes ± 15 minutes

[0310] prior to dosing), start of infusion (+15 minutes), and after 90 minutes (± 15 minutes) of each infusion. An ECG will also be taken at the last Follow-up visit. Screening ECG will be performed in triplicate, and all other visits a single ECG will be performed. j. Hematology and blood chemistry samples are taken predose up to 16 hours before dosing, results have to be present before dose-escalation can occur. Hematology and blood chemistry parameters are listed in Section 15. k. beta-hCG test should be performed for all women of childbearing potential and FSH test will be performed for postmenopausal woman only. l. Urinalysis can be performed on the day of dose-escalation or a day prior. Results of urinalysis need to be presented before dosing. m. Inflammatory biomarkers include CRP and procalcitonin. If moderate to severe symptoms of hypersensitivity reaction such as rigor, chills, fever during the infusion or 30 minutes after end-of-infusion samples for cytokines (interleukin-6 and -8, tumor necrosis factor alpha) should also be taken. n. Blood sampling for predose plasma Compound 1 levels will be performed every day prior to dosing. o. Additional blood sampling for plasma Compound 1 PK profile will be performed for Cohort 1 on Days 3, 14, and 28 as outlined in the PK sampling schedule in Table 4. p. Sampling for mycological assessments will be performed before the dose-escalation. Mycological response based on assessments including applicable either culture sensitivity with (1 , 3) beta D-glucan (serum), or histology / cytology, or serologic markers (such as galactomannan antigen) depending on the IFI (identification should be to species level)Further details in Section 8.4.3.wq. Standard of care diagnostic imaging for fungal disease will be performed of the affected area prior to the start, during treatment (before dose escalation) and at Ul the EoT. If report is available within 6 days, no need to repeat the imaging on day 0. r. Dose-escalation to occur on Days 4, 7, 10, and 13 if no safety concerns are raised. Treatment duration can be a minimum of 14 days. Patients with partial improvement or stable disease at 2 weeks should be offered an additional 14 days of treatment (i.e. , maximum treatment period of 28 days). Follow-up will always be 14 days after the EoT. s. Adverse events will be collected following ICF. Patients will be followed up for TEAE up to 2 days after the last infusion was administered. All AEs and SAEs will be collected 15 days after the last dose of study intervention. Any other study procedures may be performed post ED visit if Investigator deemed necessary after Sponsor approval.

[0311] Table 5 Pharmacokinetic Sampling Time for Cohort 1 Doses Time Points Day 3 Day 14aDay 28

[0312] 30 minutes after start of infusion X X X

[0313] End of infusion X X X

[0314] 1 hour after end of infusion (±5 minutes) X X X

[0315] 3 hours after end of infusion (±15 X X X minutes) 9 hours after end of infusion (±30 X X X minutes) 22 hours after end of infusion (±30 X X X minutes)

[0316] Abbreviation: PK = pharmacokinetics Notes:aDay 14 full PK profile will not be taken if the patient continues to receive study intervention until Day 28. Then only trough levels, Day 3 and Day 28 profile will be sampled.

[0317] OBJECTIVES AND ENDPOINTS

[0318] This study will have the following objectives and endpoints (Table 6).

[0319] Table 6 Primary and Secondary Objectives and Endpoints

[0320] Abbreviations: AESI = adverse event of special interest, AUCo-iast = area under the concentration-time curve from time 0 to last measurable concentration, AUCo-iast / Dose = area under the concentrationtime curve from time 0 to last measurable concentration per dose, AUCtau = area under the concentration-time curve at steady sate, CLss = total plasma clearance at steady state, Cmax,ss = maximum plasma concentration at steady state, Cmax,ss / Dose = maximum plasma concentration per dose at steady state, Ctrough = concentration of drug reached immediately before the next dose is administered, IFI = invasive fungal infection, TEAEs = treatment-emergent adverse events, tmax = time to maximum plasma concentration, ti / 2 = terminal elimination phase half-life, Vzss= volume of distribution at steady state. Notes: a. Clinical response based on clinical signs, physical findings, and symptoms relevant to each patient and depending on the IFI. b. Radiological response based on baseline radiological assessment during the Screening period and course of the study depending on the IFI. a. Mycological response based on assessments including applicable culture and sensitivity with (1 ,3) beta D-glucan (serum) or histology / cytology, or serologic markers (such as galactomannan antigen) depending on the IFI (identification should be to species level). Further details in Section 8.4.3.

[0321] STUDY INVESTIGATIONAL PLAN Study Design

[0322] Study Overview The study is an open-label, single arm, multi-center, dose-escalation study to assess the safety and efficacy of intravenous Compound 1 in patients with uncomplicated IFI. The study consists of 3 specific periods: Screening period, Treatment Period, and Follow-up period. Up to 15 adult patients will be recruited for treatment with Compound 1 in potentially 3 cohorts of 5 patients each.

[0323] The nature of the dose-escalation suggests that in Cohort 1 (the lowest dose) the inclusion of patients with IFI caused by, e.g., Aspergillus spp. and Candida spp. is preferred as these species is generally known to be responsive to a lower dose than other species as, e.g., Mucor mycosis spp. All patients or their legally authorized representative will sign a written informed consent before the start of any study procedures. Pre-admission, the patients will be monitored using APACHE scoring if admitted to ICU as a part of standard of care.

[0324] Screening will be completed within a 7-day period and only eligible patients will receive the study intervention infusion. Following the screening procedure, the patient will be admitted to the study site on Day 0 to collect all baseline information. Eligible patients will receive study intervention from Day 1 .

[0325] In each cohort, 5 patients are planned to be enrolled. In Cohort 1 , patients will be administered with a dose of 0.1 mg / kg, which was tested in the SAD part of the healthy subject study and will follow an intra-patient dose-escalation step. Based on the overall health status of the patient (safety and efficacy of study intervention), the dose can be adjusted at any point of time according to the Investigator's judgment, which would be based on clinical or mycological or radiological assessments dependent on the information available. This can be dose-escalation or dose de- escalation as appropriate. During the Treatment period, there may be a pause of one day if deemed necessary by the Investigator. Each patient will be evaluated individually for efficacy and safety to decide if escalation is possible. The dose will be escalated by 0.1 mg / kg every 3 days or 1 day earlier (i.e., 2 days) at the Investigator’s discretion.

[0326] The starting dose in Cohort 1 will be 0.1 mg / kg for the first 3 days of treatment; if no safety concerns are experienced, the patients will be escalated up to 0.2 mg / kg. This process will be followed up to a maximum 1 .0 mg / kg or till a maximum of 28 days of duration in Cohort 1 , with the possibility to stop at 14 or 21 days depending on the status of the patient. The starting dose of Cohort 2 will be decided by the Data Safety Review Committee (DSRC) after review of all available relevant data up to Day 14 of treatment for all patients in Cohort 1 . Subsequently, a similar dose-escalation will be followed for Cohort 2 as defined above for Cohort 1 . The dose can be escalated up to a maximum of 2.0 kg / mg. A similar process will be followed for the first dose in Cohort 3 and the dose can be escalated up to a maximum of 3.0 mg / kg. Compound 1 will be administered daily via IV infusion for 120 minutes (may be prolonged for up to 240 minutes). As Compound 1 has a propensity for phlebitis, central catheters or long peripheral catheters are preferred for infusion.

[0327] The following guideline applies for initiating a new cohort: Cohort 1 :

[0328] • If fewer than or equal to 40% of Cohort 1 (i.e., <2 patients) elicit any Compound 1 related serious adverse events (SAEs) for any of the key toxicity parameters (hypomagnesemia, hypokalemia, and renal failure), then dosing will proceed into Cohort 2 after the DSRC has reviewed all available relevant data up to Day 14 of treatment for all patients in Cohort 1 (i.e., safety and efficacy data collected up to Day 14 for the last subject of Cohort 1) and will determine the starting dose for Cohort 2 based on the dose that has the best risk / benefit profile (Section 1.2).

[0329] • If more than 40% (> 2 patients) of Cohort 1 do manifest SAEs that are related to Compound 1 , further dose-escalation will be stopped and an additional 5 patients will be enrolled in Cohort 1 to garner more data on Compound 1 tolerability and its relationship to dose and exposure. The dose will be within the dosing interval of Cohort 1 (0.1 to 1 .0 mg / kg) and the Investigator will decide the most appropriate dose to initiate treatment. If, after this second group of Cohort 1 patients have been enrolled, the frequency of SAEs that are related to Compound 1 exceeds 40%, no patients will be enrolled in Cohort 2, but the last group of patients will be assigned to Cohort 1 as mentioned above, with the dose that is evaluated as safe and effective by the Investigator.

[0330] Cohort 2 and 3:

[0331] • A similar dosing strategy will be followed as detailed for Cohort 1 . Patients in each cohort will be dosed sequentially and monitored closely.

[0332] After ascertaining the safety of the administered dose and that the patient is responding to Compound 1 , subsequent dose-escalation will be carried out in that patient.

[0333] In the case of stable disease at least 6 days after treatment with Compound 1 at the patient’s highest administered dose, the decision of dose-escalation will be based on the Investigator’s discretion.

[0334] However, if a patient fails to respond any time (at least 6 days after treatment with Compound 1 at their highest administered dose) during the treatment period, the patient will be put on rescue therapy (Section 6.4.2).

[0335] If a patient is responding to Compound 1 but is not able to tolerate Compound 1 , further doseescalation will be stopped. The Investigator may continue administering the same dose or a lower dose, considering the risk to benefit ratio, for the remaining treatment duration in that patient.

[0336] In case a patient is not responding to Compound 1 administration, as well as not tolerating Compound 1 , then that patient will be withdrawn from the study and offered rescue treatment at the discretion of the Investigator (Section 6.4.2).

[0337] If a patient tests positive for fungal culture at Screening, the treatment will be continued for up to 28 days. Once the fungal culture turns negative, the patient should be further treated for a period of at least 14 days. The total treatment duration shall not exceed 28 days. The total treatment duration will be based on clinical, mycological, and / or radiological outcomes.

[0338] If a patient tests negative for fungal culture at Screening, the treatment duration will be based on clinical, mycological, and / or radiological outcomes; however, the minimum treatment duration is 14 days while the maximum treatment duration shall not exceed 28 days.

[0339] Study Duration

[0340] The study will potentially commence following institutional review board (IRB) / independent ethics committee (IEC) and competent authorities’ approval. Each patient will be in the study for up to 50 days, which consists of a 7-day Screening period, 1 day for baseline assessments, up to 28 days (maximum) of treatment with Compound 1 , and 14 days of follow-up.

[0341] End-of-study

[0342] A patient is considered to have completed the study if they have completed all required phases of the study including the last scheduled procedure shown in the Schedule of Assessments (SoA). Any additional long-term follow-up that is required for monitoring of the resolution of an adverse event (AE) or finding may be appended to the clinical study report. The EoS will be the last visit of the last patient for purposes of closing out sites and informing the IRB / IEC and competent authority as required per national guidelines.

[0343] Design Rationale

[0344] The trial is being conducted as an open-label, single arm study. An open-label study design with no comparator group has been chosen for this study, primarily based on the fact that the primary objective of the study is to assess overall response and establish a dose. A dose-response assessment is included to allow safer dose-escalation and to find initial indication of the most effective dose regimen with efficacy of Compound 1 in patients with IFI. Any dose dependent effects demonstrated are likely to be independent of a placebo effect.

[0345] Expansion of dose levels, based on DSRC assessment and advice, will allow for further analysis of the efficacy endpoint of this study. Results from this study will guide subsequent phases of development for this indication.

[0346] Endpoint Rationale

[0347] The primary aim of this study is to determine the safety and tolerability of Compound 1 in a dose-escalation fashion to establish an effective dose for additional studies. The primary endpoint will examine the incidence of TEAEs, with a particular focus on infusion-related reactions, signs of toxicity (as evidenced by the development of hypomagnesemia, hypokalaemia, and renal failure), and evidence of any abnormal laboratory parameters or changes to vital signs. These safety and tolerability assessment parameters are generally considered standard parameters. The efficacy endpoints are established based on current international and national guidelines considering the best practices at the hospitals. Standard efficacy endpoints for IFI are considered in this study.

[0348] Dosing Rationale

[0349] The recommended starting dose in Cohort 1 of this study is 0.1 mg / kg. This is the standard starting dose of AmB deoxycholate used in patients with IFI. The same dose level (0.1 mg / kg) of Compound 1 was evaluated in the SAD cohort of the healthy subject study. The results of the study showed that the Compound 1 at the 0.1 mg / kg dose level was safe with no SAE and only mild to moderate events such as headache, fever, and similar infusion reactions. The dose in the SAD could not be escalated further because the exposure was at the NOAEL level in these healthy subjects. However, this dose was not evaluated in the MAD cohort due to injection site reactions experienced by the healthy subjects. Similar AEs with mild to moderate severity were experienced by the subjects in the SAD part of the study. There were no SAEs noted, and the drug as such was safe. The infusion site reactions (redness, thickening, and pain at the infusion site, and up the veins used) did not allow further escalation of the dose in the healthy subjects and the exposure approached NOAEL levels.

[0350] In this proposed study, the injection site reactions will be mitigated by other ways of administering Compound 1. These patients are sick, have IFI, and will be in either ICU or in special infection units where other means of drug administration are a routine practice. Compound 1 will be administered via a central venous catheter or via a long peripheral catheter reaching to larger veins in the more central part of the body. This will allow reduction of irritation of the vein, as also seen with many other infusion products, and allow further dose-escalation based on safety and tolerability of Compound 1 in individual patients and any effect observed by the Investigator.

[0351] Furthermore, in an immunocompromised murine model with candidiasis, it has been shown that with an exposure 1890 ng h / mL, 70% of the mice survived after 7 days of treatment. In the completed study in healthy subjects, a single dose of 0.1 mg / kg reached an exposure level of 1575 ng h / mL, indicating that an effect of Compound 1 might be seen at 0.1 mg / kg, Therefore, in line with the ICH-E4 Guidance document, administration of higher dose levels might be beneficial dependent on the risk / benefit profile of the individual patient.

[0352] A number of in vivo studies were executed to determine the PK / pharmacodynamics (PD) activity and target linked to treatment efficacy of Compound 1 against Candida species and A. fumigatus. This information is useful to guide design or validation of clinically relevant dosing regimens for I FIs.

[0353] The studies characterized the in vivo PD activity of Compound 1 against C. albicans, C. glabrata, C. auris and A. fumigatus in neutropenic murine infection models. Pharmacokinetics for Compound 1 in neutropenic mice were relatively linear. Increasing doses produced concentrationdependent killing, both plasma AUC / MIC and plasma Cmax / MIC were predictive of efficacy for Compound 1 (R20.73 to 0.83). A stasis endpoint in these models has correlated with patient outcome in clinical studies. The mean AUC / MIC values associated with the stasis endpoints was a value near 5 for C. albicans and C. auris. The stasis AUC / MIC values for C. glabrata were lower (near 1) and higher for A. fumigatus (near 15). Since MIC values were uniformly a value of 1 mg / L, design of human doses achieving an AUC value near 5 mg«h / L for Candida and approximately 15 mg h / L for Aspergillus should be considered.

[0354] In the context of human exposure as tested in healthy subjects this would translate into an effective dose for Candida of 0.3-0.5 mg / kg and for Aspergillus of 0.6 to1 .0 mg / kg. At any given time, based on the Investigator’s judgment, the dose may be decreased or increased in a patient. This decision is based on efficacy and safety of the individual patient. After each cohort there will be a DSRC meeting to recommend the starting dose of the next cohort. Access to Study Intervention after the End-of-study

[0355] Access to study intervention or benefits to the study patients beyond the EoS is not permitted.

[0356] POPULATION

[0357] Inclusion Criteria

[0358] To be included in this study, each individual must satisfy all the following criteria:

[0359] 1. Age >18 years.

[0360] 2. Able to provide written informed consent or have a legally authorized representative that can provide informed consent in case of incapacitation.

[0361] 3. Diagnosed by Investigator to have an IFI .

[0362] Proven IFIs as defined in the 2020 consensus definitions by the European Organization for Research and Treatment of Cancer / Mycoses Study Group Education and Research Consortium (EORTC / MSGERC). Probable or possible IFIs can be included using the EORTC / MSGERC criteria or other established criteria. The inclusion of patients with IFI caused by, e.g., Aspergillus spp. and Candida spp., is preferred as these species are generally known to be responsive to a lower dose than other species, e.g., Mucor mycosis spp.

[0363] 4. IFI patients with mild to moderate renal impairment or IFI patients requiring an alternative treatment as current treatment cannot be continued due to any of the following: a) Failure with one first-line agent, defined as either:

[0364] - Radiologic progression or

[0365] - Increase in serologic markers such as galactomannan antigen or beta-D-glucan or

[0366] - Failure of clearance of cultures or

[0367] - Progression or lack of improvement in a clinically appropriate timeframe of clinical symptoms attributed to IFI. b) Inability to tolerate AmB, as defined by at least one of the following: i. Nephrotoxicity with either:

[0368] 1 .5 mg / dL increase in creatinine from baseline or 50% increase in creatinine from baseline ii. Contraindication to use AmB with either:

[0369] Persistent hypokalemia or hypomagnesemia while on AmB despite appropriate electrolyte replacement c) Documented in vitro resistance to first-line antifungal therapy (i.e. fluconazole resistance in Candida auris) d) Treatment-limiting drug-drug interactions prohibiting the use of antifungals (azoles and echinocandins) such as concurrent rifampcin, rifabutin, phenytoin, carbamazepine, bedaqualine, quetiapine and others according to the antifungal interactions database (https: / / www.antifungalinteractions.org) or the patient is on any treatment prohibiting the use of standard antifungal agent such as azoles, echinocandins, amphotericin B, etc. 5. Patient requiring not more than 28 days of antifungal therapy as per Investigator opinion as per the institutional guidance.

[0370] Exclusion Criteria

[0371] If an individual meets any of the following criteria, he or she is ineligible for this study:

[0372] 1 . Patient has a known hypersensitivity or severe infusion-related reaction to any polyene drug.

[0373] 2. Infection caused by a known or suspected organism with intrinsic resistance to AmB.

[0374] 3. Concurrent use of another investigational agent within 30 days of enrollment.

[0375] 4. Chronic kidney disease (Appendix 16) with estimated glomerular filtration rate (eGFR) <30 mL / min or dialysis. Patients with acute kidney injury with eGFR <30 mL / min and improving creatinine level can be included as judged by the Investigator.

[0376] Note: Patients may be rescreened within 48 hours if laboratory values are found to be abnormal.

[0377] 5. Has liver enzyme results (aspartate aminotransferase [AST] / alanine aminotransferase [ALT]) greater than 5 times the upper limit of normal.

[0378] Note: Patients may be rescreened within 48 hours if laboratory values are found to be abnormal.

[0379] 6. Has a bilirubin level greater than 5 times the upper limit of normal.

[0380] Note: Patients may be rescreened within 48 hours if laboratory values are found to be abnormal.

[0381] 7. Patients who have an ejection fraction <25% of predicted.

[0382] 8. Currently pregnant or planning on getting pregnant while on study (details of contraception guidance are provided in Section 13).

[0383] 9. Breastfeeding.

[0384] 10. Patients not likely to survive a minimum of 28 days from start of screening.

[0385] 11. Patient receiving prohibited medications, as mentioned in Section 6.4.1.

[0386] 12. Patient is an abuser of alcohol or medication.

[0387] 13. Patient is unlikely to comply with protocol requirements.

[0388] 14. Patients testing positive for HIV.

[0389] 15. Patients with malignancy.

[0390] 16. The Investigator is of the opinion the patient should not participate in the study.

[0391] 17. If participating in sexual activity that could lead to pregnancy, individuals of reproductive potential who can become pregnant must agree to use contraception throughout the study. Details of contraception guidance are provided in Section 13.

[0392] Exceptions to Eligibility Criteria

[0393] Prospective approval of protocol deviations to recruitment and enrollment criteria, also known as protocol waivers or exemptions, are not permitted. Lifestyle Restrictions

[0394] Dietary Restriction

[0395] There is no dietary restriction with IV administration of Compound 1 . However, the Investigator should ensure that the mealtime (if patient is in a condition to consume food) does not coincide with IV infusion.

[0396] STUDY INTERVENTIONS

[0397] Description of Study Intervention

[0398] The intervention for this study is Compound 1 - a polyene macrolide with antifungal activity.

[0399] Formulation, Preparation, Handling, Storage, and Accountability

[0400] The Investigator or designee must confirm appropriate temperature conditions have been maintained during the shipping duration for all study interventions received, and any discrepancies are reported and resolved before the use of the intervention in the study.

[0401] Only authorized site staff may supply and administer the study intervention to the patients enrolled in the study. All study interventions must be securely stored in an area that is access and environmentally controlled.

[0402] The Investigator is responsible for study intervention accountability, reconciliation, and record maintenance (i.e., receipt, reconciliation, and final disposition records).

[0403] The Investigator or designee must maintain an adequate record of receipt and distribution of all study interventions using the drug accountability form, which must be made available for inspections.

[0404] The Sponsor will provide adequate supplies of Compound 1 . The detailed instructions related to handling and storage of Compound 1 will be included in the study Pharmacy Manual. A description of the study intervention is provided in Table 7.

[0405] Table 7 Description of Study Intervention Dosing and Administration

[0406] The reconstituted Compound 1 is added to a 5% (w / v) glucose solution for infusion. The study intervention will be administered as a daily IV infusion with the patient in a supine position and administered over 120 minutes (may be prolonged for up to 240 minutes). The Compound 1 infusion product must not be administered via an infusion line used for saline or which has been flushed with saline due to a precipitation risk for Compound 1 . Any saline infusion must be in a separate infusion line or alternatively the line has to be flushed thoroughly with 5% (w / v) glucose solution before starting the Compound 1 infusion. As Compound 1 has a propensity for phlebitis, the use of a central venous catheter or a long peripheral catheter are preferred for infusion. The potential dosing regimens of study intervention is provided in Table 8. Each patient will be evaluated individually for efficacy and safety to decide if escalation is possible.

[0407] Table 8 Planned Dosing Regimens of Study Intervention

[0408] Study Intervention Dose Modification

[0409] The decision to proceed to the next cohort will be based on the recommendation of the DSRC considering the available safety, tolerability, and efficacy data (preliminary data). The dose can be adjusted according to the Investigator's judgment considering the overall health status of the patient.

[0410] Treatment Overdose

[0411] The Sponsor does not recommend any specific treatment in the event of overdose.

[0412] In the event of overdose, the Investigator should contact the Medical Monitor immediately. The Investigator must evaluate the patient to determine, in consultation with the Medical Monitor, whether the study intervention should be interrupted or whether the dose should be reduced. Further, the Investigator must closely monitor the patient for any AEs / SAEs or laboratory abnormalities and withdraw cytokine blood samples, if necessary. If an adverse event is associated with (“results from”) the overdose of study intervention, the adverse event is reported as a serious adverse event, even if no other criteria for seriousness are met.

[0413] All reports of overdose with and without an AE must be reported by the Investigator within 24 hours to the Sponsor either by electronic media or paper. Electronic reporting procedures can be found in the electronic data capture (EDC) data entry guidelines. Paper reporting procedures can be found in the Investigator Trial File Binder (or equivalent).

[0414] Treatment Assignment and Bias Minimization

[0415] Patient Assignment

[0416] After the informed consent form (ICF) is completed and signed by the patient, patients in the study will be assigned a unique sequential identification number according to their chronological order of inclusion in the study. This number will be used to identify the patient throughout the study and on study-related documents. Treatment Allocation

[0417] Eligible patients will be administered Compound 1.

[0418] Randomization Strategy and Procedure

[0419] This is an open-label study and randomization will not be implemented.

[0420] Assessment and Verification of Compliance

[0421] The Investigator or designee will administer Compound 1 to each patient on-site. The date, start time, and end time of the infusion will be recorded in the source documents. The dose of study intervention and patient identification will be confirmed by designated site staff other than the site staff administering the dose, except for the instances where the patient cannot tolerate the dose as per the Investigator's opinion.

[0422] Study Intervention Strategy

[0423] The qualified clinical staff will be responsible for the ongoing safety and wellbeing of the patients. There will be a provision of an electronic system to alert the site staff to any area at the study site where a patient may require medical attention. There will be a physician at the study site for 24 hours a day. Furthermore, if required, study site staff may contact on-call physicians or public emergency services in case of a serious event. Equipment and emergency drugs will be available to treat common medical emergencies.

[0424] Prior and Concomitant Therapies

[0425] Any medication or vaccine (including over-the-counter or prescription medicines, recreational drugs, vitamins, and / or herbal supplements) that the patient is receiving at the time of enrollment or receives during the study must be recorded along with:

[0426] • Reason for use

[0427] • Dates of administration, including start and end dates

[0428] • Dosage information, including dose and frequency.

[0429] The Medical Monitor should be contacted if there are any questions regarding concomitant or prior therapy.

[0430] All medications, procedures, and significant non-drug therapies (including physical therapy and blood transfusions) administered after the patient was enrolled into the study must be recorded in the electronic Case Report Form (eCRF). Protocol specific medications used by a patient during the study are not considered concomitant medications.

[0431] Correction of Electrolyte Imbalance and Prohibited Therapies

[0432] As a polyene, the class effect of causing hypokalemia and hypomagnesemia is a possible AE of Compound 1 (Section 8.2.4). Correction of these abnormalities is advised, as is avoidance of other drugs that may exacerbate hypokalemia and hypomagnesemia. If in the opinion of the Investigator and Sponsor, prescription or nonprescription drugs may interfere with the study, then patients must abstain from taking those drugs.

[0433] The following are prohibited concomitant medications:

[0434] • High dose loop diuretics.

[0435] • Muscle relaxing drugs may increase the risk of low plasma levels of potassium if co-administered with Compound 1 . These types of drugs might be allowed on a case-to-case basis dependent on the patient condition, to be agreed with the Sponsor's Medical Monitor.

[0436] • Any drug impacting the efficacy of polyene macrolide class of drugs.

[0437] • All other antifungals.

[0438] • Digoxin.

[0439] • Nephrotoxic medications, e.g., cyclosporine, aminoglycosides, foscarnet, etc.

[0440] Permitted Therapies

[0441] Anti-nausea and pain relief drugs may be administered. Paracetamol, ondansetron, diphenhydramine, meperidine, ibuprofen, and hydrocortisone may be prescribed at the discretion of the Investigator. Insulin may be administered at the discretion of Investigator to control diabetes. Any IV options of these medications must not include saline.

[0442] Although the available toxicological data from the rat and dog revealed the total lack of kidney toxicity with the use of Compound 1 , should any signs of kidney toxicity arise, then pre-hydration with normal saline prior to dosing can be considered but must be administered in a separate line to the drug administration cannula.

[0443] Rescue Therapy:

[0444] Standard of care as applicable e.g., liposomal amphotericin B, azoles, echinocandins, or any other treatment in the opinion of Investigator

[0445] DISCONTINUATION OF STUDY INTERVENTION AND PATIENT WITHDRAWAL FROM STUDY Temporary Treatment Discontinuation

[0446] A patient may be discontinued from study intervention at any time if the patient, the Investigator, or the Sponsor feels that it is not in the patient’s best interest to continue. The following is a list of possible reasons for study intervention discontinuation:

[0447] • Patient withdrawal of consent

[0448] • Patient is not compliant with study procedures

[0449] • AE that in the opinion of the Investigator would be in the best interest of the patient to discontinue study intervention

[0450] • Protocol violation requiring discontinuation of study intervention

[0451] • Lost to follow-up

[0452] • Significant change in potassium levels - as judged by the Investigator

[0453] • Any significant ECG changes - in particular, e.g., prolonged QT / QTc values • Uncontrollable symptoms during the drug infusions that cannot be managed by slowing of drug infusion rate or administration of appropriate permitted therapy (Section 6.4.2) - as judged by the Investigator

[0454] • Any other serious health hazard for the patient - as judged by the Investigator.

[0455] If a patient is withdrawn from treatment due to an AE, the patient will be followed and treated by the Investigator until the abnormal parameter or symptom has resolved or stabilized.

[0456] All patients who discontinue study intervention should come in for an early discontinuation visit as soon as possible. Assessments at the early discontinuation visit (ED) will be done in accordance with the SoA (Table 3).

[0457] Rechallenge

[0458] Rechallenge or restarting of study intervention can occur at the discretion of the Investigator following the resolution of uncontrollable symptoms during the IV infusion and AEs.

[0459] Withdrawal from Study

[0460] A patient may be withdrawn from the study at any time if the patient, the Investigator, or the Sponsor assess that it is not in the patient’s best interest to continue.

[0461] All patients are free to withdraw from participation at any time, for any reason, specified or unspecified, and without prejudice. At the time of discontinuation from the study, an ED visit should be conducted, as shown in the SoA. The patient will be permanently discontinued from the study intervention at that time. If the patient has withdrawn consent for the disclosure of future information, the Sponsor may retain and continue to use any data collected before such a consent withdrawal.

[0462] The Investigator should provide and document a reason for patient withdrawal from the study. The reason for the patient’s withdrawal from the study will be specified in the patient’s source documents.

[0463] Replacement of Patients

[0464] Patients who withdraw from the study intervention prior to initial dosing will be automatically replaced. Patients who withdraw after the initial dosing may be replaced at the discretion of the Sponsor and Investigator.

[0465] Patients Lost to Follow-up

[0466] As this study involves patients confined to ICU, the patient lost to follow-up may not be applicable; however, in the scenario when a patient recovers from the IFI and is discharged, the lost to follow-up rule applies.

[0467] A patient will be considered lost to follow-up if the patient repeatedly fails to return for scheduled visits and is unable to be contacted by the study site.

[0468] The following actions must be taken if a patient fails to return to the clinic for a required study visit:

[0469] • The site must attempt to contact the patient and reschedule the missed visit as soon as possible, counsel the patient on the importance of maintaining the assigned visit schedule, and ascertain whether the patient wishes to and / or should continue in the study. • Before a patient is deemed lost to follow-up, the Investigator or designee must make every effort to regain contact with the patient (where possible, 3 telephone calls, 1 e-mail, and if necessary, a certified letter to the patient’s last known mailing address or local equivalent methods). These contact attempts should be documented in the patient’s medical record.

[0470] • Should the patient continue to be unreachable, the patient will be considered to have withdrawn from the study.

[0471] Site personnel, or an independent third party, will attempt to collect the vital status of the patient within legal and ethical boundaries for all patients enrolled. Public sources may be searched for vital status information. If vital status is determined as deceased, this will be documented and the patient will not be considered lost to follow-up. Sponsor personnel will not be involved in any attempts to collect vital status information.

[0472] Discontinuation of a Treatment Cohort

[0473] Should serious safety concerns arise from the review of the DSRC, a treatment cohort can be temporarily discontinued, infusion rate can be increased, or the committee can recommend testing of different dose levels. Such decisions will be made in a joint decision between the DSRC and the Sponsor.

[0474] STUDY ASSESSMENT AND PROCEDURES

[0475] The following applies to study assessment and procedures:

[0476] • Study procedures and their timings are summarized in the SoA (Table 3)

[0477] • Adherence to the study design requirements, including those specified in the SoA, is essential and required for study conduct.

[0478] • Immediate safety issues should be discussed with Sponsor immediately on occurrence or awareness of the event to determine if the patient should be discontinued from the intervention.

[0479] • The maximum amount of blood collected from each patient throughout the study, including any extra assessments that may be required, depends on how long the patient remains on the treatment but may not exceed 385 mL in a 30-day period. Repeat or unscheduled samples may be withdrawn for safety or technical issues with the samples.

[0480] Screening / Baseline Assessment / Procedures

[0481] Patients will be screened up to 7 days prior to commencement of the treatment period to determine eligibility for study participation. Refer to the SoA (Table 3) for further granular information on various assessments to be performed during Screening and Baseline visits.

[0482] Demographics and Other Baseline Characteristics

[0483] During screening, the following demographic information will be collected and reported in the eCRF: age at the time of informed consent, year of birth (full date of birth will be documented in source document), sex, race, ethnicity. Females with reproductive status such as woman of nonchildbearing potential, postmenopausal, sterilization will be documented.

[0484] Medical, Surgical, and Medication History

[0485] Medical history will be documented during screening. The following medical / surgical history will be documented:

[0486] • History of known allergies

[0487] • History of previous IFI

[0488] • Surgical procedures and results

[0489] • Any other current or past medical conditions, signs, symptoms

[0490] A review of prior medications will be completed as specified in Section 6.4.

[0491] Safety Assessments and Procedures

[0492] The safety and tolerability assessments include evaluation of nature, frequency, and severity of AEs / SAEs, including relationship to study intervention, AEs leading to study intervention / study discontinuations, and changes in the laboratory parameters, laboratory toxicity assessments, vital signs, ECG, and physical examinations.

[0493] The planned timepoints for all safety assessments are provided in the SoA (Table 3).

[0494] Physical Examinations

[0495] A complete physical examination will be performed at Screening and admission (Table 3). At a minimum, the complete physical examination will include assessments of general appearance, skin, neck, head, eyes, ears, throat, chest, abdomen, limbs, musculoskeletal system, nervous system. A brief symptom-directed physical examination, including areas where previously noted abnormalities and / or that are associated with any new complaints from the patient, will be performed at all other visits, unless otherwise clinically indicated.

[0496] Vital Signs

[0497] Vital signs include systolic and diastolic pressure, pulse rate, respiratory rate and body temperature. Blood pressure and pulse rate will be assessed using an automated device according to the time points mention in the SoA (Table 3). Manual techniques will be used in case an automated device malfunctions or is not available. Blood pressure and pulse rate measurement should be preceded by at least 3 minutes rest in a sitting or semi-supine position (both positions are preferred) in a quiet setting without distractions (e.g., mobile device). Wherever possible, vital signs measurements must be taken using the same body position at subsequent visits and consistent method between patients. Vital sign data will be documented in both the source document and eCRF.

[0498] 12-lead Electrocardiogram

[0499] Single 12-lead ECGs will be obtained using an ECG machine to calculate the heart rate and measure PR intervals, RR intervals, QRS duration, and QT intervals. The corrected QT interval will be derived using Fridericia’s correction formula. The 12-lead ECGs will be performed after the patient has rested in a sitting or semi-supine position (both positions are preferred) wherever possible, ECG must be taken using the same body position at subsequent visits for at least 3 minutes. Whenever possible, ECG measurements must be taken using the same body position at subsequent visits and constant methods between patients. The ECG may be repeated at the discretion of the Investigator to confirm any errant readings.

[0500] All ECG data will be documented in the source documents and also reported in the eCRF. The Investigator or qualified designee will interpret the ECG using 1 of the following categories and record their evaluation accordingly:

[0501] • Normal

[0502] • Abnormal not clinically significant

[0503] • Abnormal clinically significant

[0504] In case of clinically significant ECG abnormalities, the Investigator will document those as AEs, and the findings will represent a change from baseline.

[0505] Clinical Safety Laboratory Assessments

[0506] Safety clinical laboratories will be analyzed at the site’s local laboratory (refer to Section 15 for the list clinical laboratory parameters). Venous blood sample will be collected for clinical laboratory evaluation including hematology, blood chemistry, HbA1c, pregnancy, and FSH testing according to the SoA (Table 3). Blood samples will be collected via direct venipuncture or via an indwelling cannula inserted in a vein (depending on the timepoints). Urine will be collected for urinalysis (and urine microscopy, if required).

[0507] The processing, shipping, and analysis of samples for protocol required laboratory tests will be carried out as per the standard operating procedures of the site. Repeat or unscheduled samples may be withdrawn for safety reasons or technical issues.

[0508] The laboratory reports must be filed with the source documents. The Investigators must review the laboratory reports, document this review and, for protocol specified laboratory parameters, evaluate all out-of-range (abnormal) laboratory values for clinical significance using one of the following categories:

[0509] • Normal

[0510] • Abnormal, not clinically significant

[0511] • Abnormal, clinically significant

[0512] The evaluation must be documented in the source documents and eCRFs. Any clinically significant abnormality will be reported as an AE.

[0513] All laboratory tests with values that are clinically significant abnormalities during the study intervention and Follow-up period should be repeated until the values return to normal or baseline or are no longer considered clinically significant by the Investigator or Medical Monitor. If such values do not return to the normal / baseline within a period of time judged reasonable by the Investigator, the etiology should be identified where possible and the Sponsor to be notified promptly. The development of hypomagnesemia, hypokalemia, and renal failure are the primary endpoints among others. These parameters are defined according to Common Terminology Criteria for Adverse Events (CTCASE) guidelines. Note: For patients with mild to moderate renal failure at inclusion, it is expected that creatinine levels will be elevated during the course of the study. The final analysis of the data for these patients will be compared with their baseline values.

[0514] Adverse Events and Serious Adverse Events

[0515] An AE is defined as any untoward medical occurrence in a clinical investigation of a patient administered a pharmaceutical product and that does not necessarily have a causal relationship with the treatment. An AE is therefore any unfavorable and unintended sign (including an abnormal laboratory finding), symptom, or disease temporally associated with the administration of a study intervention, whether or not related to that study intervention. An unexpected AE is one of a type not identified in nature, severity, or frequency in the current IB or of greater severity or frequency than expected based on the information in the IB.

[0516] An SAE is defined as any untoward medical occurrence that, at any dose, meets one or more of the criteria listed in Section 14. Further details of AEs and SAEs can be found in Section 14.

[0517] The Investigator and designee are responsible for detecting, documenting, and recording of events that meet the definition of an AE or SAE and remain responsible for following up AEs that are serious, considered related to study intervention or study procedure, or that caused the patient to discontinue the study intervention.

[0518] Timeframe for Collection

[0519] All AEs and SAEs will be collected following completion of ICF until the ED / End-of-study (EoS) Follow-up visit, i.e., approximately 15 days after the last dose of study intervention. All AEs and SAEs will be recorded in source documents and also in the eCRF. An AE that begins before the start of the treatment but after signing the ICF will be recorded on the appropriate Section of the AE page of the eCRF.

[0520] All SAEs must be reported via the EDC system to the Sponsor or designated contact within 24 hours of the first awareness of the event. Please refer to Section 14 for further details for the method of communicating the SAE information.

[0521] In applicable cases, the Sponsor may request a report from the Investigator summarizing events related to the case. Investigators should follow patients as far as possible until an outcome to the events is known.

[0522] Investigators are not obliged to actively seek AE / SAE after the conclusion of the study. However, if the Investigator learns of any SAE, including death at any time after the patient has been discharged from the study, the Investigator must promptly notify the Sponsor. The method of recording, evaluating, and assessing causality of AE and SAE and the procedure for completing and transmitting the SAE report are provided in Section 14. Method of Detecting Adverse Events and Serious Adverse Events

[0523] Care will be taken not to introduce bias when detecting AEs and SAEs. Open-ended and nonleading verbal questions will be preferred to inquire about the AEs. Adverse events will be recorded in the source documents and eCRF. Adverse events will be described by duration (start and stop dates and times), severity, outcome, treatment, and relation to the study intervention.

[0524] Follow-up of AEs and SAEs

[0525] After the initial AE / SAE report, the Investigator is required to proactively follow each patient at subsequent visit / contact. For all AEs, the activity will continue 15 days following the last administered dose. All SAEs will be followed up until resolution, stabilization, the event is otherwise explained, or the patient is lost to follow-up. Any severe / moderate AEs that are classified as related to Compound 1 by the Investigator will be followed up until resolved or stable by the Investigator.

[0526] Regulatory Reporting of Adverse Events

[0527] An SAE may qualify for reporting to regulatory authorities if the SAE is considered to have a possible causal relationship to the study product, and is unexpected (suspected unexpected serious adverse reaction [SUSAR]) based upon the reference safety information in the current IB.

[0528] Where this is required by local regulatory authorities, and in accordance with the local institutional policy, the Investigator should notify (in writing) the IRB / IEC that approved the study of the SAEs, according to the IRB / IEC requirements. All deaths and harmful events should be reported by the Investigator to the local IRB / IEC and by the Sponsor or delegate to any other relevant regulatory authorities, according to the applicable regulation.

[0529] Details regarding the responsibilities for expedited reporting, including the cross reporting of SUSARs or other significant safety information originating from other ongoing studies conducted by the Sponsor can be found in the Safety Management Plan.

[0530] All SAEs and SUSARs occurring will be reported as per the local guidelines, as indicated in the Safety Management Plan.

[0531] In the event of significant safety issues that are considered to adversely affect the safety of patients or materially impact the continued ethical acceptability or conduct of the study, the Regulatory Agency, IRB / IEC and other Investigators will be notified.

[0532] Adverse Events of Special Interest

[0533] Infusion-related reactions were considered as the adverse events of special interest (AESI) and will be based upon the common terminology criteria for adverse events (CTCAE) Version 5.0.

[0534] Pregnancy

[0535] Patient Who Becomes Pregnant During the Study

[0536] A female patient must be instructed to stop taking the study intervention and immediately inform the Investigator if she becomes pregnant during the study. Pregnancies occurring up to 90 days after the completion of the study intervention must also be reported to the Investigator. The Investigator will make arrangements for the patient to be counseled by a specialist to discuss the risks of continuing with the pregnancy and the possible effects on the fetus. Monitoring of the patient should continue until the outcome of the pregnancy is known.

[0537] If a pregnancy is reported, the Investigator will record pregnancy information on the appropriate form and submit it to the Sponsor within 24 hours of learning of the female patient or female partner of male patient (after obtaining the necessary signed informed consent from the female partner) pregnancy.

[0538] While pregnancy itself is not considered to be an AE or SAE, any pregnancy complication or elective termination of a pregnancy for medical reasons will be reported as an AE or SAE. Abnormal pregnancy outcomes (e.g., spontaneous abortion, fetal death, stillbirth, congenital anomalies, ectopic pregnancy) are considered SAEs and will be reported as such.

[0539] Any poststudy pregnancy-related SAE considered reasonably related to the study intervention by the Investigator will be reported to the Sponsor. While the Investigator is not obligated to actively seek this information in former study patients / pregnant female partner, he or she may learn of an SAE through spontaneous reporting.

[0540] Any female patient who becomes pregnant while participating in the study will discontinue study intervention.

[0541] Patient Whose Partner Becomes Pregnant During the Study

[0542] If the female partner of the patient becomes pregnant, the study personnel at the site must be informed immediately and the pregnancy must be reported within 24 hours to the Sponsor.

[0543] Pharmacokinetics Assessment

[0544] Blood samples for PK samples will be drawn (Table 4) from the OPPOSITE arm of the infusion for pharmacokinetics assessments. Approximately 4 mL blood will be collected. Instructions for the collection and handling of biological samples will be detailed in a manual and provided by the Sponsor. The actual date and time (24-hour clock time) of each sample will be recorded. Plasma samples will be analyzed by liquid chromatography-tandem mass spectrometry (LC-MS / MS) for the concentration of Compound 1.

[0545] Efficacy Assessments and Procedures

[0546] One of the secondary objectives of the study is the Investigator’s assessed overall response integrating clinical, radiological, and mycological responses at Day 15 and Day 29 (Table 5). The overall response will be assessed using the following definition:

[0547] • Mortality

[0548] - EoT at Day 15

[0549] - Follow-up at Day 29

[0550] • Treatment “success” is defined as complete, or partial improvement, or stable disease

[0551] • Treatment “failure” is defined as progression of IFI. The criteria for assessed success, stable disease, and failure are provided in the table below (Table 9).

[0552] Table 9 Criteria for Assessing Response

[0553] Clinical Response The clinical response will be based on clinical signs, physical findings, and symptoms relevant to each patient and depending on IFI using criteria summarized below:

[0554] 1 . Resolution-Complete: resolution of all attributable clinical symptoms and physical findings of IFI present at baseline or that appeared at a subsequent visit AND no new clinical symptoms and physical findings of IFI noted at current visit32. Resolution-Partial: some persistence of the attributable clinical symptoms and physical findings of IFI noted either at baseline or at a subsequent prior postbaseline visit but there is improvement in at least some of these same symptoms and findings and no worsening of any of these same symptoms and findings and no new clinical symptoms and findings of I Fl at current visit*

[0555] 3. Stable: neither worsening nor improvement in any attributable clinical symptoms and physical findings present at baseline or that appeared at a subsequent prior visit and no new clinical symptoms and physical findings of IFI at current visit

[0556] 4. Failure-progression: either worsening in one or more attributable clinical symptom and physical findings present either at baseline or that appeared at a subsequent prior visit or appearance of new clinical symptoms and physical findings of IFI at the current visit

[0557] 5. Results not available / patient unevaluable.

[0558] Note:aFor patients lacking attributable clinical symptoms and physical findings of IFI present at baseline, can use same criteria as above plus patient meets mycological criteria for eradication or presumed eradication.

[0559] Radiological Response

[0560] Radiological imaging will be performed locally. Standard of care diagnostic imaging for fungal disease will be performed for the affected area and will be used for radiological assessment. Baseline radiological assessment will be performed during the Screening period and course of the study depending on IFI. Radiological assessments should be undertaken as clinically indicated.

[0561] 1 . > 90% improvement in aggregate (across all lesions if more than one lesion)

[0562] 2. > 50 to <90% improvement in aggregate (across all lesions if more than one lesion)

[0563] 3. > 25% to <50% improvement in aggregate (across all lesions if more than one lesion)

[0564] 4. No change (0%) to <25 % improvement in aggregate (across all lesions if more than one lesion)

[0565] 5. Worsening in aggregate (across all lesions if more than one lesion), including development of new (likely attributable) lesions

[0566] 6. No signs on radiological images at Screening

[0567] 7. Results not available.

[0568] Mycological Response

[0569] Mycological testing will be performed in a local laboratory.

[0570] 1 . Mycological assessments include culture, histology / cytology, and serologic markers (galactomannan antigen, beta-D-glucan, etc.) depending on the IFI (Table 9).

[0571] 2. Eradication of the original causative organism cultured or identified by histology / cytology at baseline and no emergence of new causative organisms at that visit.

[0572] 3. Presumed eradication - missing documentation of the eradication of the original causative organism cultured or identified by histology / cytology at baseline and no documentation of emergence of new causative organisms at that visit plus resolution of all or some attributable clinical symptoms and physical findings of IFI.

[0573] 4. Persistence of the original causative organism cultured or identified by histology / cytology at baseline or emergence of a new causative fungal organism at that visit. 5. Presumed persistence - missing documentation of the persistence of the original causative organism cultured or identified by histology / cytology at baseline and no documentation of emergence of new causative organisms at that visit plus either no resolution or worsening of any attributable clinical symptoms and physical findings of IFI.

[0574] 6. No mycological follow-up results available (no diagnostic test done at the scheduled timepoint AND other data are insufficient to support assigning Presumed Eradication or Presumed Persistence).

[0575] 7. No mycological evidence at baseline (negative diagnostic test results at baseline, or not done at baseline).

[0576] Evidence of fungal infection may be appropriate supportive evidence of response to or failure of therapy, although most take weeks to change enough to be useful for assessing therapeutic response. Detection of the following fungal species (Table 10) will be done according to the SoA (Table 4) for the relevant disease entities.

[0577] Table 10 Assessment of Serological and Urine Markers of Fungal Infection

[0578] Notes:aif available;bCSF antigen titer and quantitative culture, if possible;cTo be repeated only if positive at baseline

[0579] Mortality or Survival Assessment

[0580] Survival assessment i.e., if the patient is alive or dead will be performed on an ongoing basis from Day 2 until the EoS as per SoA. Patient’s death will be assessed by the Investigator to be attributable to the IFI, or an ‘associated death’, where the IFI may have contributed to death, but other conditions were more prominent in leading to death.

[0581] Relapse Assessment

[0582] Relapse assessment will be performed from Day 1 until EoT. The assessment includes all collected evidence e.g., clinical response, mycological and radiologic. The assessment will be performed according to (Table 8).

[0583] Pharmacodynamics

[0584] Pharmacodynamics are not evaluated in this study. Genetics

[0585] Genetics are not evaluated in this study.

[0586] Biomarker

[0587] Blood samples will be collected for C-reactive protein and procalcitonin in accordance with the SoA, and in the event of an AE, a blood sample will be collected (at the discretion of the Investigator) for cytokines (interleukin-6 and -8, tumor necrosis factor alpha). Biomarker test will be performed at site’s local laboratory. Blood sample collection and handling will be detailed in the laboratory manual.

[0588] Immunogenicity Assessments

[0589] Immunogenicity is not assessed in this study.

[0590] Health Economics or Medical Resource Utilization and Health Economics

[0591] Health economics or medical resource utilization and health economics parameters are not evaluated in this study.

[0592] STATISTICAL CONSIDERATION

[0593] Prior to the analysis of the final study data, a detailed Statistical Analysis Plan (SAP) will be written describing all analyses that will be performed. Any changes to the planned analysis in the protocol will be reported in the final SAP.

[0594] All statistical analyses will be performed using SAS statistical software, unless otherwise noted. The general analytical approach for the statistical analyses of this study will be descriptive in nature. For categorical variables, the number and percent of each category within a parameter will be presented. For continuous variables, the sample size (n), mean, median, standard deviation, minimum, and maximum values will be presented. Missing data will not be imputed unless otherwise stated.

[0595] Analysis Sets

[0596] The following analysis populations are planned:

[0597] Safety Analysis Set: includes all enrolled patients who receive at least one dose of Compound 1 . The Safety population will be used to summarize baseline demographics, safety, and tolerability data. Patients will be analyzed according to the initial cohort received.

[0598] Pharmacokinetic (PK) analysis set: includes all enrolled patients who receive at least one dose of Compound 1 and have at least one observation of a measurable level of Compound 1 . Patients will be analyzed according to the initial cohort received.

[0599] Efficacy Analysis Set: includes all enrolled patients who receive Compound 1 for at least 6 days and have efficacy assessment data of Day 6. Patients will be analyzed according to the initial cohort dosing received. Patient Demography and Baseline Data

[0600] Patient demography and baseline data will be summarized by cohorts and dose level and listed.

[0601] Analyses Supporting Primary Objective

[0602] The primary objective of this study is to establish the safety and tolerability of Compound 1 . The primary safety endpoint for evaluating safety and tolerability are provided in Table 5. Statistical methods for the safety analyses will be primarily descriptive in nature. Listings and summaries for all safety data will be presented using the Safety Analysis Set.

[0603] Analyses of AE will include AEs before administration of treatment and TEAEs. The TEAE is defined as an AE starting any time immediately after the start of the infusion or an event that was present prior to the infusion but worsened during or after the infusion. If any AE occurs post final dose, it will be considered a TEAE up to 2 days after the last infusion was administered. TEAEs will be coded using the Medical Dictionary for Regulatory Activities (MedDRA), and data will be summarized by System Organ Class and Preferred Term for each cohort, dose level and overall. The number and percentage of patients experiencing any TEAE, any severe, any serious, or any TEAE possibly, probably, or definitely related to study medication will be presented. A listing will be provided for the AEs that occurred before treatment administration. Infusion site reactions will also be summarized. The incidence of hypomagnesemia, hypokalemia, and renal failure will be summarized. For mortality assessment, the number and percentage of patients who died up to the EoS will be presented by cohort group and cause of death.

[0604] Time to recovery as evaluated by the Investigator of baseline renal function for patients with elevated creatinine due to acute kidney injury will be analyzed by survival analysis method if there are sufficient data to allow such analyses. Otherwise, only a descriptive summary will be provided. Change from baseline in vital signs, 12-lead ECGs, and laboratory results will be summarized descriptively by cohort, as part of the safety analyses. The number of patients with clinically significant laboratory and ECG abnormalities will also be summarized descriptively. The physical examination findings will be summarized by frequency count and percentage.

[0605] Analysis Secondary Objectives

[0606] Preliminary Efficacy

[0607] All preliminary efficacy analyses will be also based on the Efficacy Analysis Set. The overall response rates (integrating clinical, radiological, and mycological responses) will be summarized by frequency count and percentage, by cohort, dose level and study visit (Days 15 and 29). Each response category of complete success, partial success, overall success (complete + partial + stable disease), progression, overall failure (progression), and death from fungal infection will also be summarized. The selection of patients is based on the fact that there are almost no viable medical treatment options to offer as they have failed previous treatment thereby the treatment failure (progression) will happen in the majority of patients if not all. The study where Compound 1 is offered is declared a success if more than or equal to 25% of the overall population will have treatment success (complete + partial + stable) at day 15 / 29. The 95% Cl of response rates will be estimated by Clopper-Pearson exact method.

[0608] The number and percentage of patients who died up to the Follow-up visit will be presented by cohort group and cause of death. Overall survival (OS) is defined as the time from the date of first dosing to death due to any cause. For a patient who is not known to have died by the EoS, OS is censored at the date the patient is last known to be alive. If data permit, OS will be summarized by Kaplan-Meier method. The same analysis will be utilized to analyze the time to the first negative blood culture. If survival analysis is not permitted due to small sample size, only descriptive analysis will be conducted.

[0609] Pharmacokinetic Analysis

[0610] The pharmacokinetic analysis of Compound 1 after multiple dosing in patients is one of the secondary endpoints of this study, which include plasma levels and other parameters such as steady state development and accumulation in plasma.

[0611] Individual concentrations of Compound 1 will be listed for each individual and summarized by nominal sampling timepoint and dose group via descriptive statistics. Individual and mean concentration-time profiles for each dose group will be presented graphically.

[0612] Data collected at the specified timepoints will be used to calculate pharmacokinetic parameters via a non-compartmental approach. All concentrations below the limit of quantification (BLQ) or missing will be labeled as such in the listings. Patients or samples excluded from the PK analysis will be documented. For the purpose of calculating the non-compartmental PK parameters, concentrations that are BLQ prior to the first quantifiable value will be set equal to zero. BLQ values embedded between measurable concentrations will be set to missing. Concentrations that are BLQ in the terminal phase after the last measurable concentration will be set to missing.

[0613] Pharmacokinetic parameters to be determined may include but are not limited to those outlined in Table 11 . Pharmacokinetic parameters will be summarized by dose group and by cohort. Table 11 Pharmacokinetic Parameters and Description Planned Interim Analysis

[0614] There is no formal interim analysis planned for this study.

[0615] Specified Analyses for the Safety Review Committee

[0616] Safety labs, AEs, infusion time, and any efficacy data prior to dose-escalation.

[0617] Sample Size Rationale

[0618] No formal sample size calculation has been performed. The study included an empirical number of patients sufficient to adequately characterize the safety, efficacy, and trough concentration of a new drug.

[0619] Projected Enrollment per Clinical Site

[0620] A maximum of up to 15 patients will participate in the study. The study is planned to be conducted by 2 to 4 Investigators at 2 to 4 clinical sites.

[0621] Protocol Deviation

[0622] Protocol deviations are defined as any change, divergence, or departure from the study design or procedures defined in the clinical study protocol. Major protocol deviations are a subset of protocol deviations and may significantly impact the correctness, accuracy, and / or reliability of the study data or that may significantly affect a patient’s rights, safety, or wellbeing. Major protocol deviations will be summarized descriptively by study cohort.

[0623] GENERAL CONSIDERATIONS: REGULATORY, ETHICAL, AND STUDY OVERSIGHT

[0624] Regulatory, Ethical, and Other Considerations

[0625] This study will be conducted in accordance with the ethical principles that have their origin in the World Medical Association (WMA) Declaration of Helsinki, adopted by the 18thWMA General Assembly, Helsinki, Finland, Jun 1964, and subsequent amendments (WMA, 2013). The conduct of the study will be in accordance with the Integrated Addendum to ICH E6 (R1), Guideline for GCP E6 (R2), and as per the standard operating procedures (SOPs) of the Sponsor and contract research organizations participating in the conduct of the study. Guidelines adopted by the ICH and other relevant international guidelines, recommendations, and requirements will be taken into account as comprehensively as possible, as long as they do not violate local law.

[0626] Ethics Review

[0627] This study will be conducted under a protocol reviewed and approved by an ethics committee (IRB / IEC) and investigations will be undertaken by scientifically and medically qualified persons, where the benefits of the study are in proportion to the risks. The study will be overseen by an Investigator who, prior to study start, will have read and agreed to an understanding of the protocol requirements and will agree to conduct the study in accordance with the above guidelines. Any documents that the IRB / IEC may need to fulfill its responsibilities (such as protocol, protocol amendments, IB, consent forms, information concerning patient recruitment, payment or compensation procedures, or other pertinent information) will be submitted to the IRB / IEC. The IRB / IEC’s written unconditional approval of the study protocol and the ICF will be in the possession of the Investigator before the study is initiated. The IRB / IEC’s unconditional approval statement will be transmitted by the Investigator to the Sponsor or designee prior to the shipment of study supplies to the site. This approval must refer to the study by exact protocol title and number and should identify the documents reviewed and the date of review.

[0628] Protocol and / or informed consent modifications or changes may not be initiated without prior written IRB / IEC approval except when necessary to eliminate immediate hazards to the patients or when the change(s) involves only logistical or administrative aspects of the study. Such modifications will be submitted to the IRB / IEC and written verification that the modification was submitted and subsequently approved should be obtained.

[0629] The IRB / IEC must be informed of revisions to other documents originally submitted for review; serious and / or unexpected adverse events occurring during the study in accordance with the standard operating procedures and policies of the IRB; new information that may affect adversely the safety of the patients of the conduct of the study; an annual update and / or request for re-approval; and when the study has been completed.

[0630] Investigator’s Responsibilities

[0631] Whenever the term “Investigator” is noted in the clinical study protocol text, it may refer to either the Investigator at the site or an appropriately qualified, trained, and delegated individual of the investigational site.

[0632] The Investigator will be responsible for the care of the patients throughout the study. If the Investigator is not present in the clinical site, they will leave instructions for the staff and a telephone number where they can be reached.

[0633] The Investigator is expected to:

[0634] 1 . Conduct the study in accordance with the protocol and only make changes after notifying the Sponsor (or designee), except when to protect the safety, rights, or welfare of patients.

[0635] 2. Personally conduct or supervise the study (or investigation).

[0636] 3. Ensure that the requirements relating to obtaining informed consent and IRB / IEC review and approval meet federal guidelines, as stated in the Integrated Addendum to ICH E6 (R1), Guideline for GCP E6 (R2).

[0637] 4. Report to the Sponsor or designee any AEs that occur during the study, in accordance with the Integrated Addendum to ICH E6 (R1), Guideline for GCP E6 (R2).

[0638] 5. Ensure that all associates, colleagues, and employees assisting in the conduct of the study are informed about their obligations in meeting the above commitments. 6. Maintain adequate and accurate records in accordance with the Integrated Addendum to ICH E6 (R1), Guideline for GCP E6 (R2), and to make those records available for inspection with the Sponsor (or designee).

[0639] 7. Ensure that an IRB / IEC that complies with the requirements of the Integrated Addendum to ICH E6 (R1), Guideline for GCP E6 (R2) and will be responsible for initial and continuing review and approval of the clinical study.

[0640] 8. Promptly report to the IRB / IEC and the Sponsor (or designee) all changes in the research activity and all unanticipated problems involving risks to patients or others (to include amendments and investigational new drug safety reports).

[0641] 9. Seek IRB / IEC approval before any changes are made in the research study, except when necessary to eliminate hazards to the patients.

[0642] 10. Comply with all other requirements regarding the Obligations of Clinical Investigators and all other pertinent requirements listed in the Integrated Addendum to ICH E6 (R1), Guideline for GCP E6 (R2).

[0643] Informed Consent

[0644] The Investigator will ensure that the patient is given full and adequate oral and written information about the nature, purpose, possible risk, and benefit of the study. Patients must also be notified that they are free to discontinue from the study at any time without prejudice. The patient should be given the opportunity to ask questions and allowed time to consider the information provided before voluntarily signing the written ICF.

[0645] The patient’s signed and dated informed consent must be obtained before conducting any study procedures. The patients will be informed of their rights to privacy but will be made aware that the study data will be submitted to the Sponsor and possibly to drug regulatory authorities for review and evaluation. They will also be informed that the study monitor may inspect their medical records to verify the accuracy and completeness of the study records and results.

[0646] The acquisition of informed consent should be documented in the patient’s medical records, as required by the Integrated Addendum to ICH E6 (R1), GCP E6 (R2). The ICF will be signed and personally dated by the patient and by the person who conducted the informed consent discussion (not necessarily an Investigator).

[0647] The Investigator must maintain the original, signed ICF. A copy of the signed ICF must be given to the patient or legal representative. The date that informed consent was signed will be recorded on the eCRF.

[0648] Rescreen

[0649] Screen failures are defined as patients who consent to participate in the clinical study but are not subsequently enrolled. A minimal set of screen failure information is required to ensure transparent reporting of screen failure patients to meet the Consolidated Standards of Reporting Trials publishing requirements and in order to respond to queries from Regulatory Agencies. Minimal information includes demography, screen failure details, eligibility criteria, and any SAE.

[0650] Patients can be rescreened at the discretion of the Investigator after consultation with the Sponsor. The Investigator must provide appropriate rationale prior to repeating any screening procedures or tests during the screening period. A new consent must be signed unless it has been <9 days since the last consent was signed. Rescreened patients will be assigned a new patient number.

[0651] Committees

[0652] An DSRC meeting is planned for every cohort prior to dose escalating to the next dose level. The DSRC will consist of the Principal Investigator and the Medical Monitor; it may also include a Sponsor representative and potentially an external antifungal treatment expert as deemed appropriate. However, only the Principal Investigator and Medical Monitor (independent to the Sponsor), with input from the external antifungal expert (if required), will decide and have a final say if the escalation to the next dose level is safe.

[0653] The DSRC will jointly review safety data (safety lab and AE listings) and efficacy data (if available) after each dose level and determine if the escalation to the next dose level is safe. The DSRC decision will be documented in the DSRC meeting minutes. A detailed description of roles and responsibility will be described in the safety monitoring plan. The DSRC may also be called on as per needed basis.

[0654] Data Privacy and Protection

[0655] All personal details will be treated as confidential by the Investigators and involved sites, and handling of personal data will comply with applicable acts specific to India.

[0656] The Investigator will particularly pay attention that source documents or additional documents handed over to the Sponsor obscure patient names and other confidential personal details, as per local regulations.

[0657] To maintain confidentiality, all laboratory specimens, evaluation forms, reports, and other records will be identified by a coded number and initials only. All study records will be kept in a locked file cabinet and code sheets linking a patient’s name to a patient identification number will be stored separately in another locked file cabinet. Clinical information will not be released without written permission of the patient, except as necessary for monitoring by the Drug Controller General of India (DCGI), or other regulatory body (when required). The Investigator must also comply with all applicable privacy regulations.

[0658] The Sponsor and the clinical site affirm and uphold the principle of the patient’s right to protection against invasion of privacy. Throughout the study, all data will be identified only by a patient identification number and, where applicable, patient initials and birth date.

[0659] Any information the study Sponsor shares with you regarding this study, including this protocol, is considered proprietary information and should be kept confidential. Once the study has begun, the Investigator will comply with the protocol as written except in instances that are of medical urgency. The Sponsor and the IRB / IEC should be notified of these cases as soon as possible. Any other changes on the protocol must be approved by both the Sponsor and the IRB / IEC prior to commencement.

[0660] The Investigator will keep all information provided by the Sponsor in strict confidence and to request similar confidentiality from their staff and the local IRB / IEC. Study documents provided by the Sponsor (protocols, IBs, eCRFs, etc.) will be stored appropriately to ensure their confidentiality. The information provided by the Sponsor to the Investigator(s) may not be disclosed to others without direct written authorization from the Sponsor, except to the extent necessary to obtain informed consent from subjects who wish to participate in the study.

[0661] Record Retention

[0662] All source data, clinical records, and laboratory data relating to the study will be archived for 15 years after the completion of the study. All data will be available for retrospective review or audit. Source documents are original documents, data, and records from which the patient’s eCRF data are obtained. These include but are not limited to (as applicable): hospital records, clinical and office charts, laboratory and pharmacy records, diaries, microfiches, radiographs, angiograms, study intervention’s accountability logs, and correspondence.

[0663] The Investigator(s) and study staff are responsible for maintaining a comprehensive filing system of all study-related (essential) documentation. These include but are not limited to: IRB / IEC correspondence, study intervention accountability logs, and curriculum vitae of all personnel participating in the study. These files must be suitable for inspection at any time by the Sponsor, monitor, and / or applicable regulatory authorities. All essential documentation should be retained by the institution for 15 years.

[0664] No study document should be destroyed without prior written agreement between the Sponsor and the Investigator. If the Investigator wishes to assign the study records to another party or move them to another location, he / she must notify the Sponsor in writing of the new responsible person and / or the new location.

[0665] Study Termination or Study Site Closure

[0666] Although the Sponsor has every intention of completing the study, they reserve the right to discontinue it at any time for clinical or administrative reasons. The study site will be closed upon study completion. A study site will be considered closed when all required documents and study supplies have been collected and the site closure visit has been completed.

[0667] The Investigator and the IRB / IEC also reserve the right to terminate or suspend the study at any time; however, this should be discussed between the relevant parties beforehand and the reason for such decision recorded. Should this occur, all data available will also be recorded in the eCRF. The Investigator(s) should notify the relevant IRB / IEC in writing of the study’s completion or ED. Reasons for the early closure of a study site by the Sponsor or Investigators may include but are not limited to:

[0668] Termination: discontinuation of further study intervention development Study site termination: • Failure of Investigator to comply with the protocol and requirements of IRB / IEC or local health regulations, the Sponsor’s procedure, or GCP guidelines.

[0669] • Inadequate or no recruitment of patients by the Investigators.

[0670] • Lack of evaluable and / or complete data.

[0671] In case of termination of the study, the Investigator must inform their patients of the decision as well as perform all applicable study assessments.

[0672] Financing and Insurance

[0673] The Sponsor will ensure sufficient insurance is available to enable them to indemnify and hold the Investigator(s) and relevant staff as well as any hospital, institution, ethics committee or the like, harmless from any claims for damages for unexpected injuries, including death, that may be caused by the study intervention but only to the extent that the claim is not caused by the fault or negligence of the patients or Investigator(s).

[0674] Publication Policy

[0675] The information provided by the study Sponsor in this protocol and the associated IB and the data generated by this clinical study are to be considered as confidential property of the study Sponsor. The data and information associated with this study may be used by the study Sponsor now and in the future for the purposes of presentation, publication at discretion of the study Sponsor or for submission to Regulatory Agencies. In addition, relative to the release of any proprietary information, the study Sponsor reserves the right of prior review of any publication or presentation of data from this study.

[0676] In signing this protocol, the Investigator agrees to the release of the data from this study and acknowledges the above publication policy.

[0677] The preparation and submittal for publication of manuscripts containing the study results shall be in accordance with a process determined by mutual written agreement among the study Sponsor and participating institutions. In addition, upon study completion and finalization of the study report, the results of this study may be either submitted for publication and / or posted in a publicly accessible database of clinical study results.

[0678] RISK MANAGEMENT AND QUALITY ASSURANCE

[0679] Quality Tolerance Limit

[0680] A study specific risk management plan including the predefined quality tolerance limit (if necessary) will be prepared outside of this protocol.

[0681] Data Quality Assurance

[0682] Monitoring

[0683] Monitoring visits will be conducted by representatives of the Sponsor according to the ICH Guidelines for GCP (E6). By signing this protocol, the Investigator grants permission to the Sponsor (or designee) and appropriate regulatory authorities to conduct on-site monitoring and / or auditing of all appropriate study documentation.

[0684] The study monitor will conduct data audits through on-site visits. As part of these data audits, the study monitor will review the CRFs for completeness, and review the source documents and regulatory documents. The study monitor will also perform regular drug accountability checks. Upon completion of the study, the study monitor will conduct a final study close-out review of all the study files. The Investigator or a designee will work with the study monitor during the on-site visits and also provide the documents for review and respond to queries. The Investigator will permit inspection of study files by authorized representatives of Regulatory Agencies.

[0685] Audits

[0686] All study-related documents and records are to be retained for a minimum of 15 years after study completion. Written agreement from the Sponsor must precede destruction of the same. In accordance with ICH GCP, this study may be selected for audit. Inspection of site facilities (e.g., pharmacy, medication storage areas, laboratories) and review of study-related records may occur by the Sponsor, Sponsor’s representative, or regulatory authority to evaluate the study conduct and compliance with the protocol, ICH GCP, and applicable regulatory requirements.

[0687] Source Data, Data Capture, and Management

[0688] The Investigator will prepare and maintain adequate and accurate source documents designed to record all observations and other pertinent data for each patient treated with the study intervention.

[0689] Study personnel at the site will enter data from source documents corresponding to a patient’s visit into the protocol specific eCRF when the information corresponding to that visit is available. Patients will not be identified by name in the study database or on any study documents to be collected by the Sponsor (or designee), but will be identified by a site number, patient number, and initials.

[0690] If a correction is required for an eCRF, the time and date stamps track the person entering or updating eCRF data and creates an electronic audit trail. The Investigator is responsible for all information collected on patients enrolled in this study. All data collected during the course of this study must be reviewed and verified for completeness and accuracy by the Investigator. A copy of the eCRF will remain at the Investigator’s site at the completion of the study.

[0691] After data have been entered into the study database, a system of computerized data validation checks will be implemented and applied to the database on a regular basis. Queries are entered, tracked, and resolved through the EDC system directly. The study database will be updated in accordance with the resolved queries. All changes to the study database will be documented.

[0692] The database is safeguarded against unauthorized access by established security procedures; appropriate backup copies of the database and related software files will be maintained. Databases are backed up by the database administrator in conjunction with any updates or changes to the database. At critical junctures of the protocol (e.g., production of interim reports and final reports), data for analysis are locked and cleaned per established procedures.

[0693] Investigator Expectation for Source Documentation

[0694] The Investigator must make study data accessible to the monitor, other authorized representatives of the Sponsor (or designee), IRB / IEC, and Regulatory Agency inspectors upon request. A file for each patient must be maintained that includes the signed informed consent, and copies of all source documentation related to that patient. The Investigator must ensure the reliability and availability of source documents from which the information on the eCRF was derived.

[0695] Monitor Expectations for Source Data

[0696] To ensure the rights, safety, and welfare of study subjects are being maintained, the study monitor will maintain assurance that all study staff are trained on the study protocol. If the study monitor discovers that an Investigator is not complying with the signed Investigator Agreement, the investigational plan, applicable laws, or any conditions of approval imposed by the reviewing IRB / IEC, the study monitor will report to the Sponsor and take such steps necessary to promptly secure compliance. If compliance cannot be secured, study intervention to the Investigator may be discontinued and the Investigator’s participation in the investigation terminated. The study monitor shall also require such an Investigator to dispose of or return the study intervention, unless this action would jeopardize the rights, safety, or welfare of a patient.

[0697] IFI Consensus Definitions to be Used in this Study

[0698] In all categories only proven or probable IFI (not possible) to be enrolled in this study. EORTC / MSG definitions to be used for all proven IFI and all neutropenic or recently neutropenic patients, transplant patients (except lung transplants). Patients with pneumocystis infection should not be enrolled. Criteria for proven fungal disease is shown in Table 12.

[0699] Table 12 Criteria for Proven Fungal Disease Probable Invasive Pulmonary Mold Diseases

[0700] Host factors

[0701] • Recent history of neutropenia (<0.5 x 109neutrophils / L [<500 neutrophils / mm3] for >10 days) temporally related to the onset of invasive fungal disease

[0702] • Hematologic malignancy3

[0703] • Receipt of an allogeneic stem cell transplant

[0704] • Receipt of a solid organ transplant

[0705] Clinical features

[0706] Pulmonary aspergillosis

[0707] The presence of 1 of the following 4 patterns on CT:

[0708] • Dense, well-circumscribed lesions(s) with or without a halo sign

[0709] • Air crescent sign

[0710] • Cavity

[0711] • Wedge-shaped and segmental or lobar consolidation

[0712] Other pulmonary mold diseases

[0713] As for pulmonary aspergillosis but also including a reverse halo sign

[0714] Tracheobronchitis

[0715] • Tracheobronchial ulceration, nodule, pseudomembrane, plaque, or eschar seen on bronchoscopic analysis

[0716] Sino-nasal diseases

[0717] • Acute localized pain (including pain radiating to the eye)

[0718] • Nasal ulcer with black eschar

[0719] • Extension from the paranasal sinus across bony barriers, including into the orbit

[0720] Central nervous system infection

[0721] 1 of the following 2 signs:

[0722] • Focal lesions on imaging

[0723] • Meningeal enhancement on magnetic resonance imaging or CT

[0724] Mycological evidence

[0725] • Any mold, for example, Aspergillus, Fusarium, Scedosporiu species or Mucorales recovered by culture from sputum, BAL, bronchial brush, or aspirate

[0726] • Microscopical detection of fungal elements in sputum, BAL, bronchial brush, or aspirate indicating a mold

[0727] Tracheobronchitis

[0728] • Aspergillus recovered by culture of BAL or bronchial brush

[0729] • Microscopic detection of fungal elements in BAL or bronchial brush indicating a mold Sino-nasal diseases

[0730] • Mold recovered by culture of sinus aspirate samples

[0731] • Microscopic detection of fungal elements in sinus aspirate samples indicating a mold Aspergillosis only Galactomannan antigen

[0732] Antigen detected in plasma, serum, BAL, or CSF

[0733] Any 1 of the following:

[0734] • Single serum or plasma: >1 .0

[0735] • BAL fluid: >1.0

[0736] • Single serum or plasma: >0.7 and BAL fluid >0.8

[0737] • CSF: >1.0

[0738] Aspergillus PCR

[0739] Any 1 of the following:

[0740] • Plasma, serum, or whole blood 2 or more consecutive PCR tests positive

[0741] • BAL fluid 2 or more duplicate PCR tests positive

[0742] • At least 1 PCR test positive in plasma, serum, or whole blood and 1 PCR test positive in BAL fluid

[0743] • Aspergillus species recovered by culture from sputum, BAL, bronchial brush, or aspirate Abbreviations: BAL, bronchoalveolar lavage; CSF, cerebrospinal fluid; CT, computed tomography; PCR, polymerase chain reaction.

[0744] Probable invasive fungal diseases (IFD) require the presence of at least 1 host factor, a clinical feature and mycologic evidence and is proposed for immunocompromised patients only, whereas proven IFD can apply to any patient, regardless of whether the patient is immunocompromised. Probable IFD requires the presence of a host factor, a clinical feature, and mycologic evidence. Cases that meet the criteria for a host factor and a clinical feature but for which mycological evidence has not been found are considered possible IFD. (1 ,3)-beta-D glucan was not considered to provide mycological evidence of any invasive mold disease.aHematologic malignancy refers to active malignancy, in receipt of treatment for this malignancy, and those in remission in the recent past. These patients would comprise largely acute leukemias and lymphomas, as well as multiple myeloma, whereas patients with aplastic anemia represent a more heterogeneous group of individuals and are not included.

[0745] Table 13 Consensus criteria for invasive aspergillosis in intensive care (including influenza or Covid-19):

[0746] Abbreviations: BAL = bronchoalveolar lavage fluid, IAPA = influenza-associated pulmonary aspergillosis, ICU = intensive care unit, GM = granulocyte macrophage, PCR = polymerase chain reaction,

[0747] Note: These patients will be sub-classified into influenza-associated or Covid-19-associated pulmonary aspergillosis dependent on the predisposing factor, and if neither of these preceding viral infections then simply ICU-associated IA.

[0748] Consensus Criteria for Pulmonary Mucormycosis

[0749] Definitions of COVID-19 associated pulmonary mucormycosis

[0750] COVID-19-associated pulmonary mucormycosis (CAPM) is diagnosed either simultaneously with or within 3 months of virologically confirmed COVID-19.

[0751] Proven CAPM

[0752] Histopathology or cytology showing aseptate hyphae or culture obtained by a sterile procedure from a usually sterile site (pleural fluid or lung) showing growth of Mucorales.

[0753] Probable CAPM

[0754] Presence of all the following: compatible clinical features, risk factors, and suggestive imaging (thick-walled cavity, large consolidation, reversed halo sign, or multiple large nodules) and demonstration of aseptate hyphae (with or without growth of Mucorales) in a sample representative of the lower respiratory tract (including bronchoalveolar lavage, non- bronchoscopic bronchial lavage, bronchial washings, bronchial brushing, endotracheal aspirates, and sputum).

[0755] Possible CAPM

[0756] Presence of all the following: compatible clinical features; uncontrolled diabetes, prolonged or inappropriate glucocorticoid therapy (dose, duration, or indication deviating from the current evidencebased practice for glucocorticoids in COVID-19); and highly suggestive radiology (reversed halo sign, mycotic aneurysm, or thick-walled cavity), in the absence of a definite alternative diagnosis. Contraceptive and Barrier Guidance

[0757] Investigators will counsel patient with childbearing potential and male patients who are sexually active with patient with childbearing potential on the importance of pregnancy prevention and the implications of an unexpected pregnancy.

[0758] Patients of childbearing potential

[0759] A woman is considered fertile following menarche and until becoming postmenopausal unless sterile permanently: Premenarcheal, premenopausal (with documented hysterectomy and bilateral oophorectomy) and postmenopausal females are not considered to be patient with childbearing potential.

[0760] Note:

[0761] 1 . A postmenopausal state is defined as no menses for 12 months without an alternative medical case. A high FSH level in the postmenopausal range (greater than 30 mIU / mL) may be used to confirm a postmenopausal state in women not using hormonal contraception or hormonal replacement therapy (HRT). However, in the absence of 12 months of amenorrhea, a single FSH measurement is sufficient.

[0762] 2. Female on HRT and whose menopausal status is in doubt will be required to use 1 of the nonestrogen hormonal highly effective contraception methods if they wish to continue their HRT during the study. Otherwise, they must discontinue HRT to allow confirmation of postmenopausal status before study enrollment.

[0763] Contraception guidance:

[0764] The following methods have been determined to be highly effective (<1% failure rate per year when used consistently and correctly12) and are permitted under this protocol for use by the patient and his / her partner:

[0765] • Complete abstinence from heterosexual intercourse during the entire potential period of risk associated with the study interventions, when this is in line with the preferred and usual lifestyle of the patient;

[0766] • Oral, intravaginal, or transdermal combined (containing estrogen and progestogen) hormonal contraception associated with inhibition of ovulation;

[0767] • Oral, injectable, or implanted progestogen-only hormonal contraception associated with inhibition of ovulation;

[0768] Oral and injectable progestogen-only hormonal contraception may be used if they associated with inhibition of ovulation are not considered highly effective methods of contraception for this protocol because inhibition of ovulation is not their primary mechanism of action.

[0769] • Intrauterine device (IUD);

[0770] • Intrauterine hormone-releasing system (IUS);

[0771] • Vasectomy or vasectomized partner, provided that the partner is the sole sexual partner of the female patient and that the vasectomized partner has received medical assessment of the surgical success; • Bilateral oophorectomy with or without hysterectomy or tubal ligation at least 6 weeks prior to taking study intervention. In the case of oophorectomy alone, only when the reproductive status of the woman has been confirmed by follow-up levels of luteinizing hormone, FSH;

[0772] • Female patients who have undergone surgical sterilization by oophorectomy alone will have FSH levels assessed at Screening.

[0773] Notes:

[0774] 1 . Male patients with female partners with childbearing potential are eligible to participate if they follow one of the these: o Abstinence from penile-vaginal intercourse as their usual and preferred lifestyle and agree to remain abstinent for study duration and for 140 days after the last treatment. o Agree to use male condom and have their partner (who is not currently pregnant) use a contraception method described above while having penile-vaginal intercourse.

[0775] 2. Male patient must refrain from sperm duration during the study and 140 days after receiving the last study intervention.

[0776] 3. Male patient with pregnant partner or breastfeeding partner must agree to use male condom during penile-vaginal intercourse or must abstain from penile-vaginal intercourse.

[0777] Adverse Events and Serious Adverse Events - Definitions, Severity, And Causality Adverse Event Definition

[0778] • An AE is any untoward medical occurrence in a clinical study patient, temporally associated with the use of study intervention, which is not necessarily have causal relationship to the study intervention.

[0779] • NOTE: An AE can therefore be any unfavorable and unintended sign (including an abnormal laboratory finding), symptom, or disease (new or exacerbated) temporally associated with the use of study intervention.

[0780] Events Meeting the AE Definition

[0781] • Any abnormal laboratory test results (hematology, clinical chemistry, or urinalysis) or other safety assessments (e.g., ECG, radiological scans, vital signs measurements), including those that worsen from baseline, considered clinically significant in the medical and scientific judgment of the Investigator (i.e., not related to progression of underlying disease, or more severe than expected for the patient’s condition).

[0782] • Exacerbation of a chronic or intermittent pre-existing condition including either an increase in frequency and / or intensity of the condition.

[0783] • New condition detected or diagnosed after study intervention administration even though it may have been present before the start of the study.

[0784] • Signs, symptoms, or the clinical sequelae of a suspected drug-drug interaction.

[0785] • Signs, symptoms, or the clinical sequelae of a suspected overdose of either study intervention or a concomitant medication. Overdose per se will not be reported as an AE / SAE unless it is an intentional overdose taken with possible suicidal / self-harming intent. Such overdoses should be reported regardless of sequelae.

[0786] • Lack of efficacy or failure of expected pharmacological action per se will not be reported as an AE or SAE. Such instances will be captured in the efficacy assessments. However, the signs, symptoms, and / or clinical sequelae resulting from lack of efficacy will be reported as AE or SAE if they fulfill the definition of an AE or SAE.

[0787] • The signs, symptoms, and / or clinical sequelae resulting from lack of efficacy will be reported as an AE or SAE if they fulfill the definition of an AE or SAE. Lack of efficacy or failure of expected pharmacological action also constitutes an AE or SAE.

[0788] Events NOT Meeting the AE Definition

[0789] • Any abnormal laboratory findings or other abnormal safety assessments that are associated with the underlying disease, unless judged by the Investigator to be more severe than expected for the patient’s condition.

[0790] • The disease / disorder being studied or expected progression, signs, or symptoms of the disease / disorder being studied, unless more severe than expected for the patient’s condition.

[0791] • Medical or surgical procedure (e.g., endoscopy, appendectomy): the condition that leads to the procedure is the AE.

[0792] • Situations in which an untoward medical occurrence did not occur (social and / or convenience admission to a hospital, e.g., elective surgery).

[0793] • Anticipated day-to-day fluctuations of pre-existing disease(s) or condition(s) present or detected at the start of the study that do not worsen.

[0794] Definition of SAE: An SAE is defined as any untoward medical occurrence that, at any dose, meets one or more of the criteria listed:

[0795] • Results in death.

[0796] • Is life-threatening.

[0797] • The term life-threatening in the definition of serious refers to an event in which the patient was at risk of death at the time of the event. It does not refer to an event, which hypothetically might have caused death, if it were more severe.

[0798] • Requires inpatient hospitalization or prolongation of existing hospitalization. o In general, hospitalization signifies that the patient has been admitted (usually involving at least an overnight stay) at the hospital or emergency ward for observation and / or treatment that would not have been appropriate in the physician’s office or outpatient setting. Complications that occur during hospitalization are AEs. If a complication prolongs hospitalization or fulfills any other serious criteria, the event is serious. When in doubt as to whether hospitalization occurred or was necessary, the AE should be considered serious. o Hospitalization for elective treatment of a pre-existing condition that did not worsen from baseline is not considered an AE. • Results in persistent or significant disability / incapacity o The term disability means a substantial disruption of a person’s ability to conduct normal life functions. o This definition is not intended to include experiences of relatively minor medical significance such as uncomplicated headache, nausea, vomiting, diarrhea, influenza, and accidental trauma (e.g., sprained ankle) that may interfere with or prevent everyday life functions but do not constitute a substantial disruption.

[0799] • Is a congenital anomaly / birth defect.

[0800] • Is a suspected transmission of any infectious agent via an authorized medicinal product.

[0801] • Other situations: o Medical or scientific judgment should be exercised by the Investigator in deciding whether SAE reporting is appropriate in other situations such as important medical events that that may not be immediately life-threatening or result in death or hospitalization but may jeopardize the patient or may require medical or surgical intervention to prevent one of the other outcomes listed in the above definition. These events should usually be considered serious. o Examples of such events include invasive or malignant cancers, intensive treatment in an emergency room or at home for allergic bronchospasm, blood dyscrasias, convulsions not resulting in hospitalization, or development of intervention dependency or intervention abuse.

[0802] AE and SAE Recording

[0803] • When an AE / SAE occurs, it is the responsibility of the Investigator to review all documentation (e.g., hospital progress notes, laboratory reports, and diagnostics reports) related to the event.

[0804] • The Investigator will then record all relevant AE / SAE information.

[0805] • It is not acceptable for the Investigator to send photocopies of the patient’s medical records to the \Sponsor or designee in lieu of completion of the applicable / required form.

[0806] • There may be instances when copies of medical records for certain cases are requested by the Sponsor or designee. In this case, all patient identifiers, with the exception of the patient number, will be redacted on the copies of the medical records before submission to the Sponsor or designee.

[0807] • The Investigator will attempt to establish a diagnosis of the event based on signs, symptoms, and / or other clinical information. Whenever possible, the diagnosis (not the individual signs / symptoms) will be documented as the AE / SAE.

[0808] Assessment of Intensity

[0809] National Cancer Institute Common Terminology Criteria for Adverse Events (NCI CTCAE) The severity (or intensity) of an AE will be evaluated by the Investigator in accordance with the NCI CTCAE v 5.0. • Grade 1 : Mild: asymptomatic or mild symptoms; clinical or diagnostic observations only; intervention not indicated.

[0810] • Grade 2: Moderate; minimal, local or noninvasive intervention indicated; limiting age-appropriate instrumental activities of daily living (refer to preparing meals, shopping for groceries or clothes, using the telephone, managing money, etc.).

[0811] • Grade 3: Severe or medically significant but not immediately life-threatening; hospitalization or prolongation of hospitalization indicated; disabling; limiting self-care activities of daily living (refer to bathing, dressing and undressing, feeding self, using the toilet, taking medications, and not bedridden).

[0812] • Grade 4: Life-threatening consequences; urgent intervention indicated.

[0813] • Grade 5: Death related to AE.

[0814] Grades above refer to the severity / intensity of an AE and should not be confused with the seriousness.

[0815] Assessment of Causality

[0816] • The Investigator is obligated to assess the relationship between study intervention and each occurrence of each AE / SAE. The Investigator will use clinical judgment to determine the relationship.

[0817] • A reasonable possibility of a relationship conveys that there are facts, evidence, and / or arguments to suggest a causal relationship, rather than a relationship cannot be ruled out.

[0818] • Alternative causes, such as underlying disease(s), concomitant therapy, and other risk factors, as well as the temporal relationship of the event to study intervention administration, will be considered and investigated.

[0819] • For causality assessment, the Investigator will also consult the IB and / or product information, for marketed products.

[0820] • The Investigator must review and provide an assessment of causality for each AE / SAE and document this in the medical notes There may be situations in which an SAE has occurred and the Investigator has minimal information to include in the initial report to the Sponsor or designee. However, it is very important that the Investigator always make an assessment of causality for every event before the initial transmission of the SAE data to the Sponsor or designee.

[0821] • The Investigator may change their opinion of causality in light of follow-up information and send an SAE follow-up report with the updated causality assessment.

[0822] • The causality assessment is one of the criteria used when determining regulatory reporting requirements.

[0823] Follow-up of AEs and SAEs

[0824] • The Investigator is obligated to perform or arrange for the conduct of supplemental measurements and / or evaluations as medically indicated or as requested by the Sponsor or designee to elucidate the nature and / or causality of the AE or SAE as fully as possible. This may include additional laboratory tests or investigations, histopathological examinations, or consultation with other health care professionals.

[0825] • If a patient dies during participation in the study or during a recognized follow-up period, the Investigator will provide the Sponsor or designee with a copy of any postmortem findings including histopathology.

[0826] • New or updated information will be recorded in the originally submitted documents.

[0827] • The Investigator will submit any updated SAE data to the Sponsor or designee within 24 hours of receipt of the information.

[0828] Reporting of SAEs

[0829] SAE Reporting to the Sponsor or designee via Paper Data Collection Tool

[0830] • The primary mechanism for reporting an SAE to the Sponsor or designee will be the paper SAE form.

[0831] • E-mail is the preferred method rather than facsimile transmission of the SAE paper data collection tool to transmit this information to the Sponsor / Medical Monitor or the SAE coordinator.

[0832] • Initial notification via telephone does not replace the need for the Investigator to complete and sign the SAE data collection tool within the designated reporting timeframes.

[0833] • Contacts for SAE reporting can be found in Investigator’s site file.

[0834] Clinical Laboratory Tests

[0835] The tests detailed in Table 14 below will be performed by the local laboratory.

[0836] Table 14. Summary of blood tests performed in the study. Definition and Classification of Chronic Kidney Disease

[0837] Definition of Chronic Kidney Disease (CKD)

[0838] Chronic kidney disease is defined as abnormalities of kidney structure or function, present for >3 months, with implications for health (not graded).

[0839] Criteria for CKD (either of the following present for >3 months)

[0840] Markers of kidney damage (one or • Albuminuria (AER >30 mg / 24 hours; ACR >30 more) mg / g [>3mg / mmol])

[0841] • Urine sediment abnormalities

[0842] • Electrolyte and other abnormalities due to tubular disorders Abnormalities detected by histology

[0843] • Structural abnormalities detected by imaging History of kidney transplantation

[0844] Decreased GFR • GFR <60 ml / min / 1 .73 m2(GFR categories G3a-

[0845] G5)

[0846] Abbreviations: CKD = chronic kidney disease, GFR = glomerular filtration rate.

[0847] Staging of Chronic Kidney Disease

[0848] It is recommended that CKD is classified based on cause, GFR category, and albuminuria category (CGA). Assign the cause of CKD based on presence or absence of systemic disease and the location within the kidney of observed or presumed pathologic-anatomic findings (not graded). Assign GFR categories as shown in Table 15 (not graded):

[0849] Table 15. GFR categories.

[0850] Abbreviations: GFR = glomerular filtration rate.

[0851] *Relative to young adult level

[0852] In the absence of evidence of kidney damage, neither GFR category G1 nor G2 fulfill the criteria for CKD. Assign albuminuria categories as shown in Table 16 (not graded): note that where albuminuria measurement is not available, urine reagent strip results can be substituted. Table 16. albuminuria categories.

[0853] Abbreviations: ACR = albumin-to-creatinine ratio, AER = albumin excretion rate, CKD = chronic kidney disease.

[0854] Notes:aRelative to young adult level.blncluding nephrotic syndrome (albumin excretion usually 42200 mg / 24 hours [ACR 42220 mg / g; 4220 mg / mmol]).

[0855] Example 3: Treatment of invasive fungal infection in a subject

[0856] The pharmaceutical composition of Compound 1 , or a pharmaceutically acceptable salt thereof, is reconstituted in an aqueous solution and administered by intravenous infusion to a subject for the treatment of an invasive fungal infection. Each administration delivers 1 mg / kg of Compound 1 , or a pharmaceutically acceptable salt thereof. The subject is treated once daily with the pharmaceutical composition for a period of at least two weeks. After two weeks, the invasive fungal infection in the subject has been eradicated.

[0857] Example 4: Pharmacokinetics / Pharmacodynamics (PK / PD) of Compound 1 in Neutropenic Murine Disseminated Candidiasis and Invasive Pulmonary Aspergillosis Models

[0858] The pharmacokinetics and pharmacodynamics of Compound 1 were evaluated in mice.

[0859] In vitro susceptibility testing of Compound 1 was first performed, followed by plasma pharmacokinetics in mice to determine exposure response relationships of Compound 1 in mice (i.e., AUC24 / MIC and Cmax / MIC). Lastly, the in vivo efficacy of Compound 1 was evaluated in mouse models of invasive Candidiasis (IC) and invasive pulmonary Aspergillosis (IPA).

[0860] Methods

[0861] Methods and protocols used in this study are summarized below (also see Zhao M et al AAC 2018; 62(4):e02542-17 and Lepak AJ et al. AAC 2013;57:579-85 for reference).

[0862] Drug Preparation

[0863] Compound 1 was reconstituted in deionized water prior to susceptibility testing and mouse administration.

[0864] Susceptibility Testing of Compound 1 and Fungal Species and Strains

[0865] Susceptibility testing of Compound 1 comprised of minimum inhibitory concentration (MIC) assays against various fungal pathogens. The MICs were determined by standard Clinical and Laboratory Standards Institute (CLSI) microdilution techniques, and were performed on three separate occasions in duplicate. The following fungal species and strains were used in the MIC assays: Candida albicans (K1 , 580, 2-76, 98-17), Candida glabrata (10956, 5592, 35315, 5376), Candida auris (B11104, B11221 , B11219, B11804), Aspergillus fumigatus (AF41 , AF293, F11628, AF72).

[0866] Plasma Pharmacokinetics

[0867] Single dose plasma pharmacokinetic studies of Compound 1 were performed. Dose levels of 0.5, 2, 8, and 32 mg / kg of Compound 1 were administered intraperitoneally to each mouse. Plasma was collected from groups of three mice for drug concentration determination at 0.5, 1 , 2, 4, 12, 18, 24, and 36 hours. Plasma was obtained from each animal by centrifugation of anticoagulated blood obtained by cardiac puncture. Plasma was collected in amber glass vials and frozen immediately at - 80 °C. Pharmacokinetic parameters, including the elimination half-life (ti / 2), area under the drug concentration-time curve (AUC), and maximum concentration of drug (Cmax), were calculated using a non-compartmental model. The half-life was determined by linear least-squares regression. The AUC was calculated from the mean concentrations using the trapezoidal rule.

[0868] Murine Invasive Pulmonary Aspergillosis Model

[0869] Six-week-old, specific-pathogen-free, female ICR / Swiss mice weighing 23 to 27 g were used for all studies (Harlan Sprague-Dawley, Indianapolis, IN). Mice were maintained in accordance with criteria of the Association for Assessment and Accreditation of Laboratory Animal Care. A neutropenic, corticosteroid immunosuppressed murine invasive pulmonary aspergillosis (IPA) model was utilized.

[0870] Briefly, mice were rendered neutropenic (polymorph nuclear cell counts, <100 / mm3) by the subcutaneous (s.c.) injection of 150 mg / kg cyclophosphamide on days -4 and -1 and +3 to ensure the maintenance of neutropenia until the end of study (96 h). Additionally, cortisone acetate was administered at 250 mg / kg s.c. on day -1 . Throughout the 4-day experiment, mice were also given ceftazidime at 50 mg / kg / day s.c. to prevent opportunistic bacterial infection.

[0871] Fungal pathogens were prepared by sub-culturing on potato dextrose agar (PDA) 5 days prior to infection and incubated at 37°C. On the day of infection, the inoculum was prepared by flooding the culture plate with 5 mL of normal saline containing 0.05% Tween 20. Gentle agitation was used to release the conidia. The conidial suspension was collected and quantified by hemocytometer (Bright- Line, Hausser Scientific, Horsham, PA). The suspension was diluted in saline to a final concentration of 1 xi o7conidia / ml. Viability was confirmed by plating the suspension and performing CFU counts.

[0872] Infection was produced in animals using an aspiration pneumonia model. Briefly, mice were anesthetized with a combination of ketamine and xylazine to ensure deep anesthesia and reproducible infectious burden in lungs. Fifty microliters of the conidia suspension was pipetted into the anterior nares with mice held upright to allow aspiration into the lungs. Drug treatment commenced 2 h after the initiation of infection. Antifungal therapy with Compound 1 via intraperitoneal dosing at 0.5, 2, 8, and 32 mg / kg administrated every 24 h for the duration of the experiment (4 days) was performed. Zero hour and no treatment controls were included for each isolate. Four mice were included in each treatment and control group. At the end of the study period, the animals were sacrificed by CO2 asphyxiation and the kidneys from each mouse were removed by aseptic technique and placed into saline. The kidneys were homogenized and serially diluted for CFU counts on SDA plates to determine organism burden. Pulmonary fungal burden was determined by real time quantitative PCR (qPCR). Briefly, animals were euthanized if showing signs of distress or at the end of the 96-h experiment. Both lungs were immediately removed by aseptic technique and placed into sterile Whirl-Pak bags (Nasco, Fort Atkinson, Wl) containing 2 mL of sterile 0.9% normal saline. Samples were then homogenized or frozen until homogenization could occur. Homogenization of lung tissue occurred in two steps. First, the lungs were manually homogenized using direct pressure to yield a primary homogenate. One mL of the primary homogenate was then transferred to a sterile 2 mL screw-cap microcentrifuge tube (Sarstedt, Newton, N.C.) with 700 pL of 425-600 pm acid-washed glass beads (Sigma-Aldrich, St. Louis, MO). The primary homogenate was mechanically disrupted by vigorous agitation in a Bio-spec mini bead beater (Bartlesville, OK) for 90 s at 4,200 rpm to yield a secondary homogenate. This secondary homogenate was stored at -20°C until DNA extraction.

[0873] DNA was extracted from secondary homogenates with the DNeasy Blood and Tissue kit (Qiagen, Valencia, CA) following the manufacturer’s protocol and stored at -20°C until the day of qPCR analysis. Extracted DNA was subjected to quantitative, real-time PCR. qPCR plates were prepared on the day of the assay. Standard amounts of conidia were prepared by hemocytometer counts and were spiked into blank uninfected lungs used for generating standard curves. Samples were assayed in duplicate using a Bio-Rad CFX96 real-time system (Bio-Rad, Hercules, CA). A single-copy gene, Fks1, was chosen for quantitation. Primer sequences included the following: forward primer (5’-GCCTGGTAGTGAAGCTGAGCGT-3’), reverse primer (5’- CGGTGAATGTAGGCATGTTGTCC-3’), and probe (5’- / 56-FAM- TCACTCTCTACCCCCATGCCCGAGCC / 3IABkFQ / -3’) (Integrated DNA Technologies, Coralville, IA). The Fks1 mutation in strain EMFR S678P was not located in the primer-probe area of the genome and has been previously shown to not affect the quantitation reaction for that isolate. The primerprobe set was validated for all isolates by determining the kinetics and quantitative results for known quantities of conidia over the dynamic range (102to 108). The cycling conditions were as follows: activation, 50°C, 2 min; heat inactivation, 95°C, 10 min for 1 cycle; denaturation, 95°C, 15 sec; annealing and extension, 65°C, 1 min for 40 cycles. Quantitation standards were run in conjunction with each set of samples. The threshold cycle (Ct) of each sample was interpolated from a five-point standard curve of Ct values prepared by spiking uninfected mouse lungs with known amounts of conidia (103-107) from each isolate being tested. qPCR data was fit to sigmoid Emax model (Hill equation), while AUC / MIC and Cmax / MIC were modeled given previous PK / PD index analysis of Compound 1 . Results were reported as conidial equivalent (CE) / mL of lung homogenate. Murine Invasive Candidiasis Model

[0874] Six-week-old, specific pathogen-free, female ICR / Swiss mice weighing 23 to 27 g were used for all studies (Harlan Sprague-Dawley, Indianapolis, IN). Mice were maintained in accordance with the American Association for Accreditation of Laboratory Animal Care (AAALAC) criteria. Mice were rendered neutropenic (neutrophils < 100 / mm3) by injection of cyclophosphamide (Mead Johnson Pharmaceuticals, Evansville, IN) subcutaneously 4 days (150 mg / kg) and 1 day (100 mg / kg) before infection. The study duration was 4 days, therefore additional doses of cyclophosphamide (150 mg / kg) were administered on day +3 to ensure neutropenia throughout the duration of the experiment. Fungal pathogens were sub-cultured onto Sabouraud's dextrose agar (SDA) plates 24 h prior to infection. The inoculum was prepared by placing 3-5 colonies from 24 h of growth and placing into sterile 0.15 M NaCI warmed to 35°C. The final inoculum was adjusted to a transmittance of 0.6 at 530 nm. Inoculum viability was verified by colony counts on SDA (range 5.7-6.4 logw CFU / mL). Disseminated infection was achieved by injection of 0.1 mL of the 106CFU inoculum via the lateral tail vein 2 h prior to the start of antifungal therapy.

[0875] Antifungal therapy with Compound 1 via intraperitoneal dosing at 0.125, 0.5, 2, 8, and 32 mg / kg was administrated every 24 h for the duration of the experiment (4 days). Zero hour and no treatment controls were included for each isolate. Four mice were included in each treatment and control group. At the end of the study period (4 days), the animals were sacrificed by CO2 asphyxiation and the kidneys from each mouse were removed by aseptic technique and placed into saline. The kidneys were homogenized and serially diluted for CFU counts on SDA plates to determine organism burden. The burden data was fit to sigmoid Emax model (Hill equation), while AUC / MIC and Cmax / MIC were modeled given previous PK / PD index analysis of Compound 1.

[0876] Pharmacokinetics / Pharmacodynamics (PK / PD), In Vivo Dose-Response Studies, and Relationship Between AUC / MIC, Cmax / MIC, and Efficacy

[0877] The sixteen fungal strains described above were used in the in vivo murine models. Compound 1 at 0.125, 0.5, 2, 8, and 32 mg / kg doses were administrated intraperitoneally every day for 4 days. Groups consisted of four mice per dose level. The organism burden based on quantitative kidney culture was evaluated for invasive candidiasis, whereas qPCR was used to measure lung burden in the pulmonary aspergillosis model at the start and end of therapy. Nonlinear regression (Emax model) was used to determine the PK / PD exposures linked to efficacy endpoints of net stasis and 1 log kill compared to the start of therapy.

[0878] Dose-response experiments using the disseminated candidiasis model were performed for four C. albicans, C. glabrata, C. auris, and A. fumigatus isolates as described in methods above. Compound 1 at 0.125, 0.5, 2, 8, and 32 mg / kg doses were administrated intraperitoneally every day for 4 days. The dose-response relationships were quantified for each organism and dosing group. The relationship between the PK / PD parameter AUC / MIC and Cmax / MIC and treatment efficacy using the sigmoid Emax (hill) model was performed using Sigma Plot. The coefficient of determination (R2) from this model was used to numerically quantify the strength of this relationship. This coefficient represents the percentage of the variance in fungi numbers that can be attributed to the PK / PD parameter.

[0879] Magnitude of the PK / PD Parameter Required for Efficacy The AUC / MIC and Cmax / MIC required for ED50 and static effect for multiple C. albicans, C. glabrata, C. auris, and A. fumigatus pathogens in the disseminated candidiasis and invasive pulmonary aspergillosis models were determined utilizing the dose-response relationships and plasma pharmacokinetics over the dose range studied. Results

[0880] Compound 1 murine plasma pharmacokinetics

[0881] Murine plasma pharmacokinetic analysis of Compound 1 is shown in FIG. 2. Peak levels ranged from 0.19 to 1 .62 mg / L. AUCo - values ranged from 1 .36 to 57.6 mg«h / L. The elimination halflife ranged from 6.6 to 16 hours. Raw plasma concentrations of Compound 1 in mice are presented in Table 17.

[0882] Table 17. Raw plasma concentrations of Compound 1 in mice.

[0883] Study Organisms, MICs to Compound 1

[0884] The study organisms, their MICs to Compound 1 , and fitness (growth in controls) are listed in Table 18. MICs were the same (1 .0 mg / L) for all isolates. All organisms demonstrated adequate fitness in the model with growth of over 1 .5 logw CFU / organ in untreated controls except for a single C. glabrata isolate 35315.

[0885] Table 18. Compound 1 MIC, Infecting Inoculum, Organism Control Growth, Static Dose, Associated AUC / MIC, and Cmax / MIC

[0886] Pharmacokinetics / Pharmacodynamics (PK / PD), In Vivo Dose-Response Studies, and Relationship Between AUC / MIC, Cmax / MIC, and Efficacy

[0887] The dose-response curves and relationship between PK / PD index AUC / MIC, Cmax / MIC (both plasma and kidney), and efficacy for each of the fungal species and strains in the murine infection models in shown in FIG. 3. Dose-dependent response was observed across the fungal isolate set with the exception of study against a single A. fumigates isolate. A stasis effect was achieved for all isolates, except for a single A. fumigates isolate 72. The PK / PD exposure response relationships are presented in FIGs. 4-7 for C. albicans, C. auris, C. glabrata, and A. fumigates, respectively. The relationship between 96 h plasma AUC / MIC and treatment effect was strong (R20.72 vs 0.85).

[0888] Similarly, the relationship between Cmax / MIC and outcome was also strong (R20.74 vs 0.83). The dose (mg / kg / 24h) and associated AUC / MIC and Cmax / MIC needed to achieve a static effect are presented in Table 12.

[0889] The Compound 1 exposure response relationships for AUC / MIC and Cmax / MIC and each organism species is shown in FIGs. 4, 5, 6, and 7. The static doses and associated AUC / MIC and Cmax / MIC values are shown in Table 12. Raw treatment results are shown in Table 19. Table 19. Raw Organism Burden Data in Compound 1 Treated Mice

[0890] The PK / PD exposures between the different groups of fungi were different (shown in Table 20 and FIG. 8). C. glabrata exhibited the lowest median AUCo-ge / MIC value with net stasis at 6.08. In comparison, higher exposures (AUCo-ge / MIC) were required for same outcome for C. auris at 18.7, C. albicans at 29.3, and A. fumigates at 102.4. The Cmax / MIC targets for the four fungi groups were 0.22 (C. glabrata), 0.48 (C. auris), 0.60 (C. albicans), and 1.41 (A. fumigatus). Table 20. Static dose, total drug AUC0-96 / MIC, and Cmax / MIC for A. fumigatus, C. albicans, C. glabrata, and C. auris from in vivo mouse models treated with Compound 1.

[0891] Conclusions

[0892] The above studies have characterized the in vivo pharmacodynamic activity of Compound 1 against C. albicans, C. glabrata, C. auris and A. fumigatus in neutropenic murine infection models. Pharmacokinetics for Compound 1 in neutropenic mice were relatively linear. The half-life of Compound 1 was long in mice, with a range of 6.6-16 h and was dose-dependent. Increasing doses produced concentration-dependent killing, both plasma AUC / MIC and plasma Cmax / MIC were predictive of efficacy for Compound 1 (R20.72-0.85). The dose-response curves within each fungal species were concordant given the similarity of the MICs. A stasis endpoint in these models has correlated with patient outcome in clinical trials. The mean AUC / MIC values associated with the stasis endpoints was a value near 5-7 for C. albicans and C. auris. The stasis AUC / MIC values for C. glabrata were lower (near 1) and higher for A. fumigatus (near 25). There were, however, differences in PK / PD exposures between the different groups of fungi (shown in Table 14 and FIG. 8). The median AUCo-ge / MIC associated with net stasis was lowest at 6.08 for C. glabrata. Increasing exposures (AUCo-ge / MIC) were needed for same outcome for C. auris at 18.7, C. albicans at 29.3, and A. fumigatus at 102.4. The Cmax / MIC targets for the four fungi groups were 0.22 (C. glabrata), 0.48 (C. auris), 0.60 (C. albicans), and 1 .41 (A. fumigatus). The Cmax / MIC PK / PD targets were numerically lower than other polyene studies using the same infection models. For example, traditional stasis Cmax / MIC targets for Candida were observed at Cmax / MIC of about 2 and for Aspergillus at Cmax / MIC of 2-4. Since MIC values were uniformly a value of 1 mg / L, design of human doses achieving an AUC value near 15 mg«h / L for Candida and approximately 25 mg«h / L for Aspergillus can be extrapolated.

[0893] Example 5: Dosing escalation clinical trial of Compound 1 in human subjects with invasive fungal infection (IFI)

[0894] Subjects were treated as described in the protocols of Examples 1 and 2. The study recruited patients with invasive fungal infection (IFI) who were unable to tolerate liposomal injection of Amphotericin B (e.g., due to kidney toxicity), had failed previous first-line therapy, or in need of antifungal treatment and had concomitant mild to moderate kidney impairment. A total of 10 patients diagnosed with IFI were enrolled in Cohorts 1 and 2. The mean age of patients was 58.4 years and the mean weight was 58.4 kg.

[0895] The starting dose in Cohort 1 was 0.1 mg / kg for the first 3 days of treatment: if no safety concerns were experienced, the patients’ doses were escalated up to 0.2 mg / kg. This process was followed up to a maximum of 1.0 mg / kg or till a maximum of 28 days of treatment duration in Cohort 1 , with the possibility to stop any time after 14 days depending on the status of the patient. The starting dose of Cohort 2 was decided by the Data Safety Review Committee (DSRC) after review of all available relevant data up to Day 14 of treatment for all patients in Cohort 1 . Subsequently, a similar dose-escalation was followed for Cohort 2 as defined above for Cohort 1 . The dose could be escalated up to a maximum of 2.0 kg / mg. A similar process was followed for the first dose in Cohort 3 and the dose could be escalated up to a maximum of 3.0 mg / kg. Compound 1 was administered daily via IV infusion for 120 minutes (could be prolonged for up to 240 minutes). Multiple infusions of escalating doses of Compound 1 were found safe without any impact on kidney function and adverse events were manageable with medical therapies and were reversible in patients with invasive fungal infection. Initial efficacy data was promising in patients with invasive fungal infection with 100% success rate in both Cohorts 1 and 2 on Day 15 following administration of escalating doses of Compound 1 . The efficacy and safety results are summarized below.

[0896] Safety Results

[0897] Overall, the observed safety and tolerability profile of Compound 1 from the Cohort 1 and 2 is consistent with prior studies in healthy subjects. The most frequently reported treatment emergent adverse events (TEAEs) were infusion-related reaction and hypokalemia, and the most frequently reported Compound 1 -related TEAE was infusion related reactions. The adverse event of special interest (AESI) of infusion related reactions were reported in 6 patients, of which 5 patients had treatment interruption. Infusion-related reactions were managed by systemic corticosteroid, analgesic, and systemic antihistamine. The most frequently reported infusion related reactions were chills and pyrexia. One patient died during the study due to a pulmonary hemorrhage. No patient discontinued Compound 1 infusion or study due to an adverse event. Overall vital signs, physical examinations, and ECG evaluations were largely unremarkable.

[0898] Efficacy Results

[0899] • In Cohort 1 , the treatment success rate was 100% for Day 15, while it was 80% for Day 29. One patient died on Day 16 due to a pulmonary hemorrhage.

[0900] • In Cohort 2, the treatment success rate was 100% for both Day 15 and Day 29.

[0901] • Overall, 8 patients achieved a treatment success or partial success on Day 29.

[0902] • For the Aspergillus strain, estimated clinical dose for treatment success was 0.9 mg / kg and 1.8 mg / kg for the Cohorts 1 and 2, respectively.

[0903] The overall response to treatment was based on clinical, radiological, and mycological responses observed at Day 15 and Day 29. The response was classified as either success-complete, success partial, stable, or failure-progression.

[0904] Overall, all patients received at least one Compound 1 infusion (Table 21) . In Cohort 1 , median treatment duration was 20 days and cumulative dose per patient was 8.6 mg / kg. In Cohort 2, median treatment duration was 28 days and cumulative dose per patient was 35.0 mg / kg. Table 21. Summary of Treatment Exposure (Safety Analysis Set) aTreatment duration was calculated as Date of last dose - Date of first dose + 1 .bAverage dose per patient was calculated by using below formula:

[0905] Average dose per patient = (Dose x Days at that Dose) / Total treatment dayscCumulative dose per patient was calculated by using below formula:

[0906] Cumulative dose per patient = (Dose x Days at that Dose)

[0907] In Cohort 1 , the treatment success rate was 100% for Day 15, while it was 80% for Day 29, with 4 out of 5 patients achieving partial success (Table 22). One patient died on Day 16 due to pulmonary hemorrhage. Overall Response Rate was defined as patients having Treatment success, failure, or mortality. Crude mortality was defined as overall mortality rate and associated mortality was defined as mortality rate related to IFI.

[0908] Table 22. Summary of Overall Response Rate at Days 15 and 29 (Efficacy Analysis Set) Abbreviations: Cl = confidence interval, EoS = end-of-study, EoT = end-of-treatment I Fl= invasive fungal infection, N= sample size, n= patient count. Notes: a Percentages were calculated using respective column header count as denominator. b 95% Cl for proportion was calculated by using Clopper-Pearson method. For the Aspergillosis, estimated clinical dose for treatment success was 0.9 mg / kg and 1 .8 mg / kg for the Cohorts 1 and 2, respectively, while for strains involving both Aspergillosis and Mucormycosis, the estimated clinical dose for treatment success was1 .9 mg / kg in Cohort 2 (see Table 23). Table 23. Dose Estimation for Treatment Success based on Fungal Infection (Efficacy Analysis

[0909] Set)

[0910] Overall, 9 patients experienced at least 1 TEAE. The most frequently (>5 patients or 50% of patients) reported TEAE was in the System Organ Class of Injury, Poisoning, and Procedural Complications (6 patients, 60%). Frequently reported (>2 patients or 20% of patients) TEAEs were infusion-related reaction (6 patients, 60%) and hypokalemia (3 patients, 30%). The infusion-related reaction was more common in Cohort 2 (5 patients) as compared with Cohort 1 (1 patient). Of note, three patients in Cohort 2 experienced hypokalemia and one patient in Cohort 1 experienced hypomagnesemia.

[0911] Conclusion Multiple infusions of escalating doses of Compound 1 were safe without any impact on kidney function and the AEs were manageable with medical therapies and were reversible in patients with invasive fungal infection. The initial efficacy data appeared promising in patients with invasive fungal infection with the partial treatment success in 8 patients on Day 29 following escalating doses of Compound 1 .

Claims

CLAIMS1 . A method of treating a fungal infection in a subject, the method comprising administering to the subject Compound 1 :Compound 1 or a pharmaceutically acceptable salt thereof, as an intravenous infusion in an amount of from 0.1 to about 3.0 mg / kg / day, thereby treating the subject.

2. A method of treating a fungal infection in a subject suffering from compromised kidney function, the method comprising administering to the subject Compound 1 :Compound 1 or a pharmaceutically acceptable salt thereof, as an intravenous infusion in an amount of from about 0.1 to about 3.0 mg / kg / day, thereby treating the subject.

3. A method of treating a fungal infection in a subject undergoing concomitant treatment with diuretics, the method comprising administering to the subject Compound 1 :Compound 1 or a pharmaceutically acceptable salt thereof, as an intravenous infusion in an amount of from about 0.1 to about 3.0 mg / kg / day, thereby treating the subject.

4. A method of treating a fungal infection in a subject undergoing concomitant treatment with muscle relaxants, the method comprising administering to the subject Compound 1 :Compound 1 or a pharmaceutically acceptable salt thereof, as an intravenous infusion in an amount of from about 0.1 to about 3.0 mg / kg / day, thereby treating the subject.

5. A method of treating a fungal infection in a subject undergoing concomitant treatment with digoxin, the method comprising administering to the subject Compound 1 :Compound 1 or a pharmaceutically acceptable salt thereof, as an intravenous infusion in an amount of from about 0.1 to about 3.0 mg / kg / day, thereby treating the subject.

6. A method of treating a fungal infection in a subject undergoing concomitant treatment with nephrotoxic medication, the method comprising administering to the subject Compound 1 :Compound 1 or a pharmaceutically acceptable salt thereof, as an intravenous infusion in an amount of from about 0.1 to about 3.0 mg / kg / day, thereby treating the subject.

7. The method of any one of claims 1-6, wherein the intravenous infusion is administered, consecutively or non-consecutively, on at least 3 days over the course of each week over a period of at least two weeks.

8. The method of claim 7, wherein the intravenous infusion is administered daily over a period of at least two weeks.

9. The method of claim 8, wherein Compound 1 , or a pharmaceutically acceptable salt thereof, is administered daily for 28 days.

10. The method of claim 7, wherein the intravenous infusion is administered every other day or every third day over a period of at least two weeks.11 . The method of any one of claims 1-10, wherein from 0.15 to 3.0 mg / kg / day of Compound 1 , or a pharmaceutically acceptable salt thereof, is administered.

12. The method of any one of claims 1-10, wherein 0.1 ± 0.01 , 0.2 ± 0.02, 0.3 ± 0.03, 0.4 ± 0.04, 0.5 ±0.05, 0.6 ± 0.06, 0.7 ± 0.07, 0.8 ± 0.08, 0.9 ± 0.09, 1.0 ± 0.1 , 1.1 ± 0.11 , 1.2 ± 0.12, 1.3 ± 0.13, 1.4 ±0.14, 1.5 ± 0.15, 1.6 ± 0.16, 1.7 ± 0.17, 1.8 ± 0.18, 1 .9 ± 0.19, 2.0 ± 0.2, 2.1 ± 0.21 , 2.2 ± 0.22, 2.3 ±0.23, 2.4 ± 0.24, 2.5 ± 0.25, 2.6 ± 0.26, 2.7 ± 0.27, 2.8 ± 0.28, 2.9 ± 0.29, or 3.0 ± 0.3 mg / kg ofCompound 1 , or a pharmaceutically acceptable salt thereof, is administered.

13. The method of any one of claims 1-10, wherein from 0.1 mg / kg / day to 1 .0 mg / kg / day of Compound 1 , or a pharmaceutically acceptable salt thereof, is administered to the subject, and wherein the fungal infection is caused by Aspergillus, Candida, or Cryptococcus.

14. The method of claim 13, wherein the Candida infection is invasive Candidiasis.

15. The method of claim 13, wherein the Aspergillus infection is Aspergillosis.

16. The method of claim 15, wherein the Aspergillosis is invasive pulmonary Aspergillosis.

17. The method of any one of claims 1-10, wherein from 1 .5 mg / kg / day to 3.0 mg / kg / day of Compound 1 , or a pharmaceutically acceptable salt thereof, is administered to the subject, and wherein the fungal infection is Fusarium or Mucorales.

18. The method of any of one of claims 1-17, wherein the subject receives a dosing level of Compound 1 , or a pharmaceutically acceptable salt thereof, for a dosing period, the method further comprising the following steps:(a) measuring a fungal burden in subject during or at the end of the dosing period; and(b) based on the fungal burden measurement of step (a), (i) stopping the treatment at the end of the dosing period if the subject exhibits no fungal burden; or (ii) administering Compound 1 , or a pharmaceutically acceptable salt thereof, for a second dosing period if the subject exhibits a fungal burden.

19. The method of claim 18, comprising administering Compound 1 , or a pharmaceutically acceptable salt thereof, for a second dosing period if the subject exhibits a higher fungal burden, wherein the dosing level of Compound 1 , or a pharmaceutically acceptable salt thereof, is increased during the second dosing period.

20. The method of claim 18, comprising administering Compound 1 , or a pharmaceutically acceptable salt thereof, for a second dosing period if the subject exhibits a lower fungal burden, wherein the dosing level of Compound 1 , or a pharmaceutically acceptable salt thereof, is the same during the second dosing period.21 . The method of any one of claims 18-20, wherein the fungal burden in a subject is measured by determining the amount of a fungal cell wall biomarker in a blood sample from the subject.

22. The method of claim 21 , wherein the fungal cell wall biomarker is a mannan.

23. The method of claim 22, wherein the mannan is galactomannan.

24. The method of claim 21 , wherein the fungal cell wall biomarker is 1 ,3-beta-D-glucan.

25. The method of any one of claims 1 -24, wherein Compound 1 , or a pharmaceutically acceptable salt thereof, is administered as an aqueous pharmaceutical composition.

26. The method of claim 25, wherein the pharmaceutical composition has a pH of from 4.0 to 8.0.

27. The method of claim 26, wherein the pharmaceutical composition has a pH of 5.0 ± 0.3.

28. The method of any one of claims 1-27, wherein the salt of Compound 1 is Compound 1 acetate.

29. The method of any one of claims 1 -28, wherein Compound 1 , or a pharmaceutically acceptable salt thereof, is administered as an isotonic solution that is isotonic with body fluids to the subject, further comprising a nonionic tonicity agent.

30. The method of claim 29, wherein the nonionic tonicity agent is 5% (w / v) glucose.31 . The method of claim 29 or 30, wherein the isotonic solution is substantially free of saline.

32. The method of any one of claims 1-31 , wherein Compound 1 , or a pharmaceutically acceptable salt thereof, is administered in an infusion line that is substantially free of saline.

33. The method of any one of claims 1 -32, wherein Compound 1 , or a pharmaceutically acceptable salt thereof, is administered in an IV bag that is substantially free of saline.

34. The method of any one of claims 1 -33, wherein Compound 1 , or a pharmaceutically acceptable salt thereof, is administered in water for injection (WFI) that is substantially free of saline.

35. The method of any one of claims 1-34, wherein the concentration of Compound 1 , or a pharmaceutically acceptable salt thereof, is 0.16 ± 0.016 mg / mL.

36. The method of any one of claims 1 -35, wherein Compound 1 , or a pharmaceutically acceptable salt thereof, is administered over a time period of 120 ± 30 minutes to 240 ± 30 min minutes.

37. The method of any one of claims 1 -36, wherein the method further comprises ECG monitoring of the subject to detect prolonged QT / QTc values after the administration of Compound 1 , wherein the administration of Compound 1 is discontinued if prolonged QT / QTc values are detected.

38. The method of any one of claims 1-37, wherein the infection is an invasive fungal infection.

39. The method of claim 38, wherein the infection is caused by a Candida, Aspergillus, Cryptococcus, Fusarium, or Mucorales genus.

40. The method of claim 39, wherein the Candida species is selected from C. albicans, C. auris, C. glabrata, C. krusei, C. parapsilosis, or C. tropicalis.41 . The method of claim 39, wherein the Aspergillus species is selected from A. niger, A. fumigatus, A. flavus, A. nidulans, or A. terreus.

42. The method of claim 39, wherein the Cryptococcus species is C. neoformans var. grubii.

43. The method of claim 39, wherein the Fusarium species is selected from F. solan! or F. annulatum.

44. The method of claim 39, wherein the Mucorales species is selected from M. circinelloides, M. ramosissimus, or Rhizopus spp.

45. The method of any one of claims 1-44, wherein the subject has failed treatment with an antifungal therapy.

46. The method of claim 45, wherein the subject has shown an intolerance to a polyene macrolide.

47. The method of claim 46, wherein the polyene macrolide is amphotericin B.

48. A method of treating a Candida infection in a subject comprising administering Compound 1 , or a pharmaceutically acceptable salt thereof, to the subject in an amount and for a duration sufficient to treat the Candida infection.

49. The method of claim 48, wherein the Candida species is selected from C. albicans, C. auris, C. glabrata, C. krusei, C. parapsilosis, or C. tropicalis.

50. The method of claim 49, wherein the C. auris infection is resistant to an azole and / or a polyene macrolide.51 . The method of claim 50, wherein the azole is fluconazole.

52. The method of claim 50, wherein the polyene macrolide is amphotericin B.

53. A method of treating an Aspergillus infection in a subject comprising administering Compound 1 , or a pharmaceutically acceptable salt thereof, to the subject in an amount and for a duration sufficient to treat the Aspergillus infection.

54. The method of claim 53, wherein the Aspergillus species is selected from A. niger, A. fumigatus, A. flavus, A. nidulans, or A. terreus.

55. A method of treating a Candida infection in a subject who has failed treatment with an antifungal therapy, the method comprising administering Compound 1 , or a pharmaceutically acceptable salt thereof, to the subject in an amount and for a duration sufficient to treat the Candida infection.

56. The method of claim 55, wherein the Candida species is selected from C. albicans, C. auris, C. glabrata, C. krusei, C. parapsilosis, or C. tropicalis.

57. The method of claim 55 or 56, wherein the subject has failed treatment with an azole or a polyene macrolide.

58. The method of claim 57, wherein the azole is fluconazole.

59. The method of claim 57, wherein the polyene macrolide is amphotericin B.

60. A method of treating an Aspergillus infection in a subject who has failed treatment with an antifungal therapy, the method comprising administering Compound 1 , or a pharmaceutically acceptable salt thereof, to the subject in an amount and for a duration sufficient to treat the Aspergillus infection.61 . The method of claim 56, wherein the Aspergillus species is selected from A. niger, A. fumigatus, A. flavus, A. nidulans, or A. terreus.

62. The method of claim 60 or 61 , wherein the subject has failed treatment with an azole or a polyene macrolide.

63. The method of claim 62, wherein the azole is fluconazole.

64. The method of claim 62, wherein the polyene macrolide is amphotericin B.

65. The method of any one of claims 1 -64, wherein the administration of Compound 1 , or a pharmaceutically acceptable salt thereof, produces: a) an average Cmax (maximum concentration) of 150 ± 15 to 170 ± 17 ng / mL; b) an average Tmax (time at maximum concentration) of 1 .97 ± 0.2 to 2.2 ± 0.2 h; c) an average AUCo - (extrapolated area under the plasma concentration time curve) of 1038 ± 104 mg«h / mL to 1197 ± 120 mg«h / mL; and / or d) an average T1 / 2 (half-life) of 9.5 ± 0.95 h to about 11.1 ± 1.1 h.

66. A method of treating a fungal infection caused by a Candida species in a subject, the method comprising administering to the subject Compound 1 :Compound 1 or a pharmaceutically acceptable salt thereof, as an intravenous infusion in an amount of from about 0.05 to about 0.6 mg / kg / day, thereby treating the subject.

67. The method of claim 66, wherein the Candida species is selected from C. albicans, C. auris, C. glabrata, C. krusei, C. parapsilosis, or C. tropicalis.

68. The method of claim 66 or 67, wherein the subject has candidiasis.

69. A method of treating a fungal infection caused by a Aspergillus species in a subject, the method comprising administering to the subject Compound 1 :Compound 1 or a pharmaceutically acceptable salt thereof, as an intravenous infusion in an amount of from about 0.6 to about 1 .8 mg / kg / day, thereby treating the subject.

70. The method of claim 69, wherein the Aspergillus species is selected from A. niger, A. fumigatus, A. flavus, A. nidulans, or A. terreus.71 . The method of claim 69 or 70, wherein the subject has aspergillosis.

72. A method of treating a fungal infection caused by a Aspergillus species in a subject, the method including administering to the subject Compound 1 :Compound 1 or a pharmaceutically acceptable salt thereof, as an intravenous infusion in an amount of from about 0.6 to about 1 .8 mg / kg / day, thereby treating the subject.

73. The method of claim 72, wherein the Aspergillus species is selected from A. niger, A. fumigatus, A. flavus, A. nidulans, or A. terreus.

74. The method of claim 72 or 73, wherein the subject has aspergillosis.

75. The method of any one of claims 72 to 74, wherein about 0.9 mg / kg / day of Compound 1 is administered to the subject.

76. The method of any one of claims 72 to 74, wherein about 1 .8 mg / kg of Compound 1 is administered to the subject.

77. A method of treating a fungal infection caused by a Aspergillus species in a subject, the method comprising administering to the subject Compound 1 :Compound 1 or a pharmaceutically acceptable salt thereof, as an intravenous infusion in an amount of from about 1 .5 to about 1 .8 mg / kg / day, thereby treating the subject.

78. The method of claim 77, wherein the Aspergillus species is selected from A. niger, A. fumigatus, A. flavus, A. nidulans, or A. terreus.

79. The method of claim 77 or 78, wherein the subject has aspergillosis.

80. A method of treating a fungal infection caused by a Mucor species in a subject, the method comprising administering to the subject Compound 1 :Compound 1 or a pharmaceutically acceptable salt thereof, as an intravenous infusion in an amount of from about 1 .5 to about 1 .9 mg / kg / day, thereby treating the subject.

81. The method of claim 80, wherein the subject has mucormycosis.

82. The method of claim 80 or 81 , wherein the subject has a mixed infection comprising a Mucor species and an Aspergillus species.

83. The method of any one of claims 1 to 82, wherein the subject is dosed at a level less than 1 mg / kg, and the subject experiences reduced risk of infusion-related reactions compared to subjects dosed at a level more than 1 mg / kg.

84. The method of claim 83, wherein the infusion-related reaction is fever, chills, stiffness, pain, swelling, erythema, or phlebitis.

85. The method of any one of claims 1 to 84, wherein the subject is treated without transient or permanent impact on their kidney function.

86. The method of claim 85, wherein the risk of hypomagnesemia or hyperkalemia in the subject is reduced compared to an equivalent dosage of amphotericin B liposomal injection.

87. The method of claim 85, wherein the creatinine from baseline level in the subject is reduced in comparison to an equivalent dosage of amphotericin B liposomal injection.

Citation Information

Patent Citations

  • Derivatives of nystatin and their use as antifungal agents

    WO2009004322A2

  • Pharmaceutical compositions of a therapeutic polyene macrolide and methods of their use

    WO2021170841A1