Preparation method for recombinant photosynthetic bacteria and use thereof
By introducing conductive proteins into photosynthetic bacteria and optimizing the electron transfer process, the problem of low electron output efficiency in photosynthetic bacteria has been solved, enabling the application of highly efficient bio-photovoltaic cells with higher energy conversion efficiency and lower environmental impact.
Patent Information
- Application Number
- PCT/CN2024/099804
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-06-18
- Publication Date
- 2025-12-26
AI Technical Summary
Existing photosynthetic bacteria have low electron output efficiency, and traditional photovoltaic systems face problems such as low energy density, large land requirements, production capacity fluctuations due to changes in sunlight conditions, high initial investment, and significant environmental impact.
By introducing conductive proteins into photosynthetic bacteria using synthetic biology techniques, their conductivity is modified. Combined with physical methods such as adding salts and quinones, the electron transfer process is optimized, and recombinant photosynthetic bacteria are prepared for use in biophotovoltaic cells.
This improved the electron generation and output efficiency of photosynthetic bacteria, enhanced the power conversion efficiency of bio-photovoltaic cells, reduced costs and environmental impact, and achieved higher energy conversion efficiency and system stability.
Smart Images

Figure CN2024099804_26122025_PF_FP_ABST
Abstract
Description
Preparation method of recombinant photosynthetic bacteria and application thereof TECHNICAL FIELD
[0001] The present application belongs to the field of photovoltaic technology, and specifically relates to a preparation method of recombinant photosynthetic bacteria, and also relates to the application of the recombinant photosynthetic bacteria in preparing photovoltaic cells. BACKGROUND
[0002] The core of photovoltaic power generation technology lies in converting sunlight into electrical energy, which involves multiple scientific and technological fields such as semiconductor physics, solar cell technology, and photovoltaic system engineering. Among these fields, semiconductor physics provides the theoretical basis for understanding and utilizing the photoelectric effect, and is the foundation for designing efficient solar cells. Solar cell technology focuses on how to efficiently convert light energy into electrical energy, using various semiconductor materials such as silicon and cadmium selenide, and optimizing the structure and performance of these materials to improve spectral absorption and energy conversion efficiency.
[0003] Traditional photovoltaic power generation mainly relies on silicon-based solar cells, which can provide high-efficiency electrical energy output in sunny environments. Although traditional photovoltaic systems can continuously convert solar energy into electricity, they face many challenges, including significant environmental pollution, high material costs, and limited scalability due to the occupation of large land resources. A large amount of energy is used in the production process of traditional photovoltaics, especially in the refining and manufacturing process of silicon. In addition, harmful chemicals and greenhouse gases may be emitted during the production process. Although silicon-based photovoltaic panels have a long lifespan, their recycling and reuse processes are complex and costly because they contain multiple materials that are difficult to separate. These challenges highlight the shortcomings of traditional photovoltaic technology in terms of sustainable development and environmental protection.
[0004] To overcome these limitations, biological photovoltaic technology has emerged, which uses the photosynthesis and respiration of microorganisms (such as bacteria) to generate electricity, thereby achieving energy conversion. Biological photovoltaic systems have many advantages, such as low cost, strong scalability, and green and pollution-free characteristics, which can effectively utilize the self-repairing and regenerative capabilities of microorganisms to enhance the service life and stability of photovoltaic systems. Biological photovoltaic systems generally use renewable resources, and their production process has less impact on the environment. Certain biological photovoltaic systems can work effectively under low light conditions, such as on cloudy days or in indoor environments. Biological photovoltaic systems have the potential to use completely biodegradable materials, which helps to reduce waste and recycling problems. However, the commonly used bacterial photovoltaic has the defects of small power and low voltage, and the main challenge it faces is how to improve the efficiency of energy conversion and ensure the long-term stable operation of the system, which requires some improvement methods to improve the operating power of bacterial photovoltaic.
[0005] SUMMARY
[0006] The first object of the present application is to provide a preparation method of recombinant photosynthetic bacteria, which solves the problem of low electron output efficiency of photosynthetic bacteria in the prior art.
[0007] The second object of the present application is to provide a recombinant photosynthetic bacteria prepared by the above method.
[0008] The third object of the present application is to provide a photovoltaic cell.
[0009] The fourth object of the present application is to provide an application of the recombinant photosynthetic bacteria in the preparation of a photovoltaic cell.
[0010] To achieve the above objects of the present application, the following technical solutions are adopted:
[0011] A preparation method of recombinant photosynthetic bacteria, comprising the following steps:
[0012] S1, culturing liquid photosynthetic bacteria;
[0013] S2, selecting a conductive protein, synthesizing a gene sequence for expressing the conductive protein, and constructing a conductive protein plasmid;
[0014] S3, modifying the liquid photosynthetic bacteria in S1 with the conductive protein plasmid in S2 to obtain an engineered photosynthetic bacteria with conductive ability.
[0015] In the present application, the photosynthetic bacteria are one of Synechococcus elongatus UTEX 2973, Synechocystis sp. strain PCC 6803, and Synechococcus elongatus PCC 7942.
[0016] In the present application, the conductive protein source is a bacterium with conductive ability or potential conductive ability.
[0017] Further, the conductive protein is derived from Shewanella or Sulfolobus.
[0018] In the present application, the conductive protein in S2 includes one of pilA, OmoS, and OmcZ.
[0019] In the present application, the amino acid sequence of the conductive protein in S2 is as shown in SEQ ID NO: 1 or SEQ ID NO: 3 or SEQ ID NO: 5.
[0020] Further, the gene sequence for synthesizing and expressing the conductive protein is as shown in SEQ ID NO: 2 or SEQ ID NO: 4 or SEQ ID NO: 6.
[0021] In the present application, the modification of the liquid photosynthetic bacteria in S1 with the conductive protein plasmid in S2 is co-culturing the conductive protein plasmid in S2 with the liquid photosynthetic bacteria in S1, and the specific process is as follows: centrifuging the collected photosynthetic bacteria liquid, resuspending after removing the supernatant, adding the conductive protein plasmid and mixing, shaking overnight under light-proof conditions, then coating the liquid on the BG11 plate and culturing to obtain the engineered photosynthetic bacteria with conductive ability.
[0022] Further, the resuspension adopts a sodium chloride solution.
[0023] Further, the culturing on the plate is culturing under the condition of 25-35 DEG C and light intensity of 1-3 mW for 3-10 days.
[0024] A recombinant photosynthetic bacterium is obtained by the above preparation method.
[0025] A photovoltaic cell comprises the above recombinant photosynthetic bacterium.
[0026] Further, the recombinant photosynthetic bacterium is an anode material of the photovoltaic cell.
[0027] A use of the above recombinant photosynthetic bacterium in preparing a photovoltaic cell.
[0028] In the present application, the recombinant photosynthetic bacterium is used as an anode material in the photovoltaic cell.
[0029] Further, the preparation method of the recombinant photosynthetic bacterium as an anode material in the photovoltaic cell comprises one of the following: placing the recombinant photosynthetic bacterium in a BG11 culture medium and growing on the surface of the anode material; or loading the recombinant photosynthetic bacterium in the culture medium into the cell, drying to make the recombinant photosynthetic bacterium dry on the surface of the anode material to form a film; or culturing the recombinant photosynthetic bacterium on the surface of the anode material to form a biofilm; or mixing the recombinant photosynthetic bacterium with a hydrogel and adsorbing on the surface of the anode material; or mixing the recombinant photosynthetic bacterium with a conductive material such as dopamine and adsorbing on the surface of the anode material.
[0030] In the present application, the anode material is further modified.
[0031] Further, the modification comprises one of polyethylene glycol modification or polylactic acid modification of the anode material.
[0032] In the present application, the recombinant photosynthetic bacterium is further added with a substance promoting the electronic transfer of the recombinant photosynthetic bacterium out of the cell.
[0033] Further, the substance promoting the electronic transfer of the recombinant photosynthetic bacterium out of the cell is one of high salt or quinone.
[0034] The present application has the following beneficial effects:
[0035] (1) The preparation method of the recombinant photosynthetic bacteria of the present application improves the electron production and output efficiency of the photosynthetic bacteria under light conditions by modifying the photosynthetic bacteria through synthetic biology technology. This modification enables the photosynthetic bacteria to serve as an efficient biological anode for use in a biological photovoltaic system, greatly improving the electricity generation performance of the organisms in the biological photovoltaic cell.
[0036] (2) The present application provides an efficient, economical and environmentally friendly biological photovoltaic technology solution, which has many advantages that traditional photovoltaic technologies do not have, and shows great application potential in the field of future energy technology. The photosynthetic bacteria modified by synthetic biology can achieve more efficient conversion of light energy to electrical energy. This biological photovoltaic system optimizes the process of electron production and transmission, and thus can achieve higher energy conversion efficiency than traditional photovoltaic technology.
[0037] (3) The photosynthetic bacteria used in the present application as a biological catalyst for energy generation has a much lower cost than the expensive semiconductor materials used in traditional photovoltaic systems. The self-reproduction ability of photosynthetic bacteria further reduces the production and maintenance costs. Since photosynthetic bacteria can grow in various environments (including the ocean), they can be used in a variety of environments such as the ocean, without relying on specific land resources and being limited by region. They can effectively utilize solar energy in a variety of environments. The photosynthetic bacteria photovoltaic system utilizes light energy, a renewable biological resource, reducing dependence on fossil fuels and carbon emissions, while avoiding the problem of disposal of traditional photovoltaic cell waste, in line with the requirements of sustainable development.
[0038] (4) The photosynthetic bacteria of the present application have self-repairing and regenerative abilities, and the biological photovoltaic system of the present application has a longer service life and better stability, reducing the need for maintenance and replacement. The unlimited reproduction characteristics of photosynthetic bacteria eliminate the service life limitations of traditional photovoltaic systems.
[0039] (5) The engineered photosynthetic bacteria photovoltaic system of the present application can be customized according to demand, easy to expand and upgrade, and can adapt to different scales of energy demand, from small devices to large-scale power generation facilities. BRIEF DESCRIPTION OF DRAWINGS
[0040] The technical solutions of the present application will be further described below in conjunction with the drawings and specific embodiments of the present application.
[0041] Figure 1 is a photovoltaic cell device prepared from three kinds of photosynthetic bacteria of the present application;
[0042] Figure 2 is a series connection device of photosynthetic bacteria photovoltaic cells of different sizes of the present application;
[0043] Figure 3 is a parallel connection device of photosynthetic bacteria photovoltaic cells of different sizes of the present application;
[0044] Figure 4 is the current density, open-circuit voltage and power density of the recombinant photosynthetic bacteria tested in the present application;
[0045] Figure 5 is the photocurrent of the recombinant photosynthetic bacteria of the present application after adding salt and quinone;
[0046] Figure 6 is the operation of a watch driven by the photovoltaic cell of the recombinant photosynthetic bacteria of the present application;
[0047] Figure 7 is the operation of an LCD screen driven by the photovoltaic cell of the recombinant photosynthetic bacteria of the present application. DETAILED DESCRIPTION
[0048] The main disadvantages of existing photovoltaic technology are mainly reflected in the low energy density, the large demand for land or roof area, the fluctuation of production capacity caused by changes in light conditions, the high initial investment, the large environmental impact of material production and waste, the risk of supply of rare materials, the energy consumption and carbon emissions in the production process, and the performance degradation and rising maintenance costs caused by long-term use. These challenges highlight the shortcomings of traditional photovoltaic technology in terms of sustainable development and environmental protection. In contrast, biological photovoltaic power generation uses organisms such as photosynthetic bacteria and algae, which convert energy through photosynthesis and respiration. The advantage of biological photovoltaic technology is that it is low-cost and environmentally friendly, but the main challenges it faces are how to improve the efficiency of energy conversion and ensure the long-term stable operation of the system.
[0049] The present invention aims to overcome a series of problems existing in traditional photovoltaic systems, particularly the low energy density, the large demand for land or roof area, the fluctuation of production capacity caused by changes in lighting conditions, the high initial investment, and the environmental impact during production and disposal. The bacterial photovoltaic system uses photosynthetic bacteria to convert light energy into electrical energy, which not only has low cost, but also effectively reduces the dependence on rare materials and reduces the initial investment cost. In addition, the bacterial photovoltaic system has less impact on the environment during production and disposal compared to traditional photovoltaic systems. The biological materials used in this system are generally renewable, and the treatment after the end of the system's life is relatively simple, thereby reducing the environmental burden. This limits its practicality in a wider range of life and industrial applications. The root of these problems lies in the limited conductivity of bacteria itself, and the current system design and material use have failed to effectively optimize the generation and transmission of electrical energy. First, the insufficient conductivity of bacteria is due to the low efficiency of electron transfer in its natural state. The electrons generated by bacteria during photosynthesis will significantly reduce the output efficiency of electrical power if they cannot be effectively transferred from the bacteria to the external circuit. Therefore, improving the conductivity of bacteria is crucial to improving the power and voltage of bacterial photovoltaic. Using synthetic biology techniques to modify bacteria to express conductive nanowires or other conductive proteins is a way to improve the conductivity of bacteria. These biologically synthesized conductive structures can form internal and external electron transfer networks, enhancing the efficiency of electron exchange between bacteria and electrodes. In addition, some physical means, such as the addition of salts and quinones, can improve the electron output capacity of photosynthetic bacteria and improve the electrical output capacity of bacterial photovoltaic.
[0050] The present invention significantly improves the environmental sustainability and economic benefits of photovoltaic systems by modifying photosynthetic bacteria and biological photovoltaic devices, providing a new and effective approach to solving global energy and environmental challenges.
[0051] Specifically, the present invention combines synthetic biology and photovoltaic technology to propose a biological photovoltaic system that modifies photosynthetic bacteria to improve their efficiency in converting light energy into electrical energy.
[0052] First, the present invention provides a recombinant photosynthetic bacterium that uses synthetic biology methods to introduce conductive proteins (conductive nanowires) into photosynthetic bacteria. This modification not only enhances the conductivity of bacteria, but also improves their ability to convert light energy into electrical energy. Through this method, the modified photosynthetic bacteria can effectively produce and transport electrons under light conditions on the anode, forming an electric current for power use.
[0053] Photovoltaic cells were then manufactured using these recombinant photosynthetic bacteria, and this bio-photovoltaic system offers significant advantages. First, it can operate in diverse environments, including areas difficult for traditional photovoltaic systems to reach, such as the ocean. This provides new possibilities for utilizing underutilized natural resources on Earth, such as the ocean, and helps expand the application of renewable energy. Second, because photosynthetic bacteria have the ability to self-replicate, the maintenance and expansion costs of this system are extremely low. Compared to traditional silicon-based or other material-based photovoltaic panels, bio-photovoltaic systems are more cost-effective and sustainable.
[0054] Example 1
[0055] A method for preparing recombinant photosynthetic bacteria includes the following steps:
[0056] S1. Cultivate liquid photosynthetic bacteria;
[0057] The specific process is as follows: Photosynthetic bacteria are cultured in liquid culture medium. The photosynthetic bacteria can be one of Synechococcus elongatus UTEX 2973, Synechocystis sp.strain PCC 6803, or Synechococcus elongatus PCC 7942. In this embodiment, Synechococcus elongatus PCC 7942 is selected for culture.
[0058] S2. Select a conductive protein, synthesize and express the conductive protein gene sequence, and construct conductive protein particles;
[0059] The specific process is as follows:
[0060] Conductive proteins originate from bacteria such as Shewanella or Thiodiobacterium, which possess electrical conductivity or have the potential to do so. Conductive proteins include one of pilA, OmcS, and OmcZ.
[0061] Selecting pilA as the conductive protein:
[0062] The amino acid sequence of the conductive protein is as follows:
[0063] The gene sequence for designing and synthesizing the conductive protein is as follows:
[0064] Selecting OmcS as the conductive protein:
[0065] The amino acid sequence of the conductive protein is as follows:
[0066] The gene sequence for designing and synthesizing the conductive protein is as follows:
[0067] Conducting protein selection OmcZ:
[0068] The amino acid sequence of the conducting protein is as follows:
[0069] The gene sequence for designing and synthesizing the conducting protein is as follows:
[0070] The following primers are used to construct the plasmid:
[0071] pilA-F: gaaacagCATAtggccaattac;
[0072] pilA-R: gcgtggatccttaactttcggg.
[0073] OmcS-F: gaaacagCATAtgaaaaaggggatg;
[0074] OmcS-R: cgtggatccttagtccttggc.
[0075] OmcZ-F: catatggaattcatgaagaaaaaggtac;
[0076] OmcZ-R: cgcgtggatccttaccgtttgac.
[0077] By changing the positions of the amino acids and the types of the amino acids in the conducting protein, the natural conducting protein is mutated, the conducting protein with different conducting capacities is synthesized, the mechanism of electron transfer in the conducting protein is explored according to the rules between the mutated amino acids, and thus the engineering photosynthetic bacteria with different conducting capacities, i.e., the biological photovoltaic cells with different powers, can be obtained.
[0078] S3, the liquid photosynthetic bacteria in S1 are modified by using the conducting protein plasmid in S2, and the engineering photosynthetic bacteria with conducting capacity are obtained.
[0079] The conducting protein plasmid in S2 is co-cultured with the liquid photosynthetic bacteria in S1, and the specific process is as follows: the collected photosynthetic bacteria liquid is centrifuged, resuspended after removing the supernatant, and then the conducting protein plasmid is added and mixed, and then the liquid is coated on the BG11 plate containing antibiotics and cultured to obtain the engineering photosynthetic bacteria with conducting capacity.
[0080] In this embodiment, 1.5 mL of photosynthetic bacteria is collected into a centrifuge tube, the supernatant is removed by centrifugation, resuspended with 10 mM sodium chloride solution, mixed with the plasmid in S2, the centrifuge tube is wrapped with tin paper to avoid light, and shaken overnight in a 30°C incubator. The liquid is spread on a BG11 plate and cultured at 30°C and a light intensity of 1.5 mW for 5 days to allow the growth of the transformants. The correct insertion of the target fragment into the transformant gene is verified by PCR, and the transformant with the correct insertion of the target gene is subcultured on a plate with added antibiotic. After about 4 generations, a recombinant strain with a pure genotype completely inserted with the target gene is obtained, and its phenotype is verified by PCR.
[0081] After successfully introducing the conductive protein into the photosynthetic bacteria, the conductive ability of the engineered photosynthetic bacteria is tested by photoelectric current and potassium ferricyanide reduction, and a battery with different conductive ability is prepared. The potassium ferricyanide test is performed by adding a certain amount of potassium ferricyanide to the bacterial solution with a biomass of OD=1, and determining the absorption of the supernatant of the bacterial solution at 420 nm at different times to determine the ability of the engineered photosynthetic bacteria to reduce potassium ferricyanide.
[0082] Example 2
[0083] A recombinant photosynthetic bacterium for use in the preparation of a photovoltaic cell.
[0084] The engineered photosynthetic bacteria are prepared into a photovoltaic cell, which includes an anode and a cathode. The anode is an ITO flexible electrode, and the cathode is carbon cloth, as shown in FIG. 1. The recombinant photosynthetic bacteria serve as an anode material in the photovoltaic cell. The method for preparing the recombinant photosynthetic bacteria as an anode material in the photovoltaic cell includes one of the following: placing the recombinant photosynthetic bacteria in a BG11 culture medium and growing on the surface of the anode material; or loading the recombinant photosynthetic bacteria in the culture medium into the battery, drying the recombinant photosynthetic bacteria to form a film on the surface of the anode material; or culturing the recombinant photosynthetic bacteria on the surface of the anode material to form a biofilm; or mixing the recombinant photosynthetic bacteria with a hydrogel and adsorbing them on the surface of the anode material; or mixing the recombinant photosynthetic bacteria with a dopamine conductive material and adsorbing them on the surface of the anode material.
[0085] Since the distance between the photosynthetic bacteria and the anode material is relatively long compared to the distance of electron transfer, the anode material is modified to improve the adsorption between the photosynthetic bacteria and the anode material, thereby shortening the distance between them. The modification of the anode material includes one of polyethylene glycol modification or polylactic acid modification. In this application, an ITO flexible electrode is used, and the specific process is as follows:
[0086] Modification of polyethylene glycol
[0087] 1) Clean the ITO electrode
[0088] Clean ITO glass pieces in deionized water for 15 minutes using ultrasonic cleaner. Clean in ethanol for 15 minutes using ultrasonic cleaner. Finally clean in dichloromethane for 15 minutes using ultrasonic cleaner. Dry or air dry ITO glass pieces using nitrogen or clean lint-free cloth.
[0089] 2) Surface activation
[0090] Place cleaned ITO glass pieces in UV-ozone cleaner for 15-30 minutes or in a plasma cleaner to increase the surface hydroxyl functionality.
[0091] 3) Silanization
[0092] Place treated ITO glass pieces in a mixture solution of 3-aminopropyltriethoxysilane (APTES) and anhydrous ethanol (commonly used concentration is 2-5% APTES). React at room temperature for 1-2 hours. Remove and wash with ethanol to remove unreacted APTES, then wash with deionized water and dry.
[0093] 4) Polyethylene glycol modification
[0094] Use PEG solution containing terminal active groups (such as PEG-COOH or PEG-NH2) for modification. PEG can be dissolved in an appropriate solvent (such as water, ethanol, etc.) with a concentration of 1-10 mg / mL. Place silanized ITO glass pieces in PEG solution and react at room temperature or slightly higher temperature for several hours to overnight. After reaction, wash with deionized water or appropriate solvent to remove unreacted PEG, then dry with nitrogen or air dry.
[0095] Modification of polylactic acid (PLA)
[0096] 1) Pre-treatment of ITO electrode
[0097] Clean ITO glass electrode with ethanol and deionized water and treat in ultrasonic cleaner for 10 minutes to remove surface impurities. Perform plasma treatment to further clean the surface and increase surface energy, improving the adhesion of PLA on ITO surface.
[0098] 2) Preparation of PLA solution
[0099] Dissolve polylactic acid in an appropriate solvent (such as chloroform) to prepare PLA solution with desired concentration. Stir and heat the solution to complete dissolution.
[0100] 3) Coating of PLA film
[0101] The pre-processed ITO electrode is placed on a spin coater and the PLA solution is dropped on the electrode surface. The rotation speed and time of the spin coater are set as required (e.g. 2000 rpm, 60 seconds) to form a uniform PLA film. Alternatively, the ITO electrode can be immersed in the PLA solution by dip coating method, slowly taken out and dried at room temperature.
[0102] 4) Drying and solidification
[0103] The PLA-coated ITO electrode is placed in an oven or hot plate for drying at an appropriate temperature (e.g. 60°C) to remove the solvent and solidify the PLA film.
[0104] The photoelectric current, open circuit voltage and power density of the engineered photosynthetic bacteria are tested, and the current of the engineered photosynthetic bacteria under light is tested by electrochemical device. The light intensity is set to 10 mW, the photoelectric current is tested using a three-electrode system, 10 s light, 10 s dark, cross test, the biomass of the photosynthetic bacteria is OD = 1, and the test is carried out at room temperature. The results are shown in Figures 4a-4c.
[0105] The results show that the recombinant photosynthetic bacteria have higher current density than the wild photosynthetic bacteria. By modifying the wild-type photosynthetic bacteria, the photoelectric current of the photosynthetic bacteria is improved. The power density of the recombinant photosynthetic bacteria photovoltaic device can reach 0.8 mW / cm 2 , which is equivalent to 8000 mW / m 2 , greatly improving the power of the current bacterial photovoltaic cell.
[0106] By adding high salt and quinones and other substances that can physically promote the transfer of blue-green bacteria electrons out of the cell, the electron output capacity of the engineered photosynthetic bacteria is improved. The results are shown in Figure 5. As shown in Figure 5, adding salt (sodium chloride 250 mM) or quinone (benzoquinone, anthraquinone 100 uM) can improve the photoelectric current of the recombinant photosynthetic bacteria. When salt and quinone are added at the same time, the photoelectric current is improved more, indicating that salt and quinone have a synergistic effect in improving the electron output efficiency of the recombinant photosynthetic bacteria.
[0107] The biological photovoltaic cell can be prepared into a larger or smaller cell device, or operated in series and parallel, to further improve its current and voltage. By using different cathode materials, biological photovoltaic cells with different current and voltage can be obtained, as shown in Figures 2 and 3, where Figure 2 is in series and Figure 3 is in parallel. The electrical energy in the biological photovoltaic cell can be collected to light a bulb, drive an LCD screen, or serve as a battery for any electrical device in life, as shown in Figures 6 and 7.
[0108] The application improves the electron output efficiency of the bacteria by genetic modification and optimization of the bacterial carrier, then improves the electron output efficiency of the bacteria by some physical means (such as adding salts and quinones and other chemicals to open the electron transport channel of the bacteria), and further improves the power generation efficiency of the biological photovoltaic, which shows great potential to replace the traditional photovoltaic system. An innovative approach is provided to solve the limitations of existing photovoltaic power generation, and revolutionary progress is brought to the field of sustainable energy.
[0109] The above disclosure is only the preferred embodiment of the application, and of course cannot limit the scope of the right of the application, so the equivalent changes made according to the claims of the application still belong to the scope covered by the application.
Claims
1. A method for preparing a recombinant photosynthetic bacterium, characterized by, The method comprises the following steps: S1, culturing liquid photosynthetic bacteria; S2, selecting conductive proteins, synthesizing and expressing gene sequences of conductive proteins, and constructing conductive protein plasmids; S3, transforming the liquid photosynthetic bacteria in S1 with the conductive protein plasmids in S2 to obtain engineered photosynthetic bacteria with conductive capacity.
2. The method for preparing recombinant photosynthetic bacteria according to claim 1, characterized in that, The photosynthetic bacteria are one of Synechococcus elongatus UTEX 2973, Synechocystis sp. strain PCC 6803, and Synechococcus elongatus PCC 7942.
3. The method for preparing recombinant photosynthetic bacteria according to claim 2, characterized in that, The conductive proteins in S2 include one of pilA, OmcS, and OmcZ.
4. The method for preparing recombinant photosynthetic bacteria according to claim 1, characterized in that, The gene sequence for synthesizing and expressing the conductive proteins is as shown in SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO:
6.
5. The method for preparing recombinant photosynthetic bacteria according to claim 1, characterized in that, In S3, the conductive protein plasmids in S2 are used to transform the liquid photosynthetic bacteria in S1, which is to co-culture the conductive protein plasmids in S2 with the liquid photosynthetic bacteria in S1, and the specific process is as follows: centrifuge the collected photosynthetic bacterial liquid, resuspend after removing the supernatant, add the conductive protein plasmids, mix, shake overnight in the dark, then coat the liquid on a BG11 plate, and culture to obtain engineered photosynthetic bacteria with conductive capacity.
6. A recombinant photosynthetic bacterium, characterized in that, The engineered photosynthetic bacteria are prepared by the method of any one of claims 1-5.
7. Use of the recombinant photosynthetic bacteria of claim 6 in the preparation of a photovoltaic cell.
8. Use of a recombinant photosynthetic bacterium according to claim 7 for the preparation of a photovoltaic cell, characterized in that, The method for preparing the recombinant photosynthetic bacteria as an anode material in a photovoltaic cell comprises one of the following: placing the recombinant photosynthetic bacteria in a BG11 culture medium and growing on the surface of the anode material; or loading the recombinant photosynthetic bacteria in the culture medium into the cell, drying to dry the recombinant photosynthetic bacteria on the surface of the anode material to form a film; or culturing the recombinant photosynthetic bacteria on the surface of the anode material to form a biofilm; or mixing the recombinant photosynthetic bacteria with a hydrogel and adsorbing on the surface of the anode material; or mixing the recombinant photosynthetic bacteria with a conductive material such as dopamine and adsorbing on the surface of the anode material.
9. Use of a recombinant photosynthetic bacterium according to claim 8 for the preparation of a photovoltaic cell, characterized in that, The method further comprises the following steps: The anode material is modified, and the modification comprises one of polyethylene glycol modification or polylactic acid modification of the anode material.
10. Use of a recombinant photosynthetic bacterium according to claim 8 for the preparation of a photovoltaic cell, characterized in that, The method further comprises the following steps: adding a substance that promotes electron transfer of the recombinant photosynthetic bacteria out of the cell to the recombinant photosynthetic bacteria; and the substance that promotes electron transfer of the recombinant photosynthetic bacteria out of the cell is one of a high salt or a quinone.
Citation Information
Patent Citations
Nucleic Acids, Cells, and Methods for Producing Secreted Proteins
US20150093495A1
Microbes with controlled adhesive properties
US20150140666A1
Engineered photosynthetic organisms, photosynthetic electrodes including the engineered photosynthetic organisms, photosynthetic bioelectrochemical cells and photosynthetic fuel cells
US20180138538A1
Biocatalyst comprising photoautotrophic organisms producing recombinant enzyme for degradation of harmful algal bloom toxins
US20190263871A1