Method for producing recombinant tumor necrosis factor

By using the kanamycin gene as a resistance gene and improving fermentation and purification methods, the problem of plasmid instability in the production of recombinant tumor necrosis factor was solved, the yield and activity were improved, and the safety and purity of the product were ensured.

WO2025260448A1PCT designated stage Publication Date: 2025-12-26SHANGHAI WEIKE BIOPHARML
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/107753
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-20
Filing Date
2024-07-26
Publication Date
2025-12-26

AI Technical Summary

Technical Problem

In existing methods for producing recombinant tumor necrosis factor, plasmid expression is unstable, plasmid loss rate is high, and TNF production and activity are insufficient after fermentation, posing safety risks.

Method used

Using the kanamycin gene as the resistance gene, a recombinant expression vector was constructed. Fermentation conditions and purification methods were improved. Ultrafiltration with fed-buffered buffer was used instead of dialysis, and the DEAE and S-100 chromatography processes were optimized.

Benefits of technology

The plasmid expression is stable, TNF production is significantly increased, activity is enhanced, penicillin allergic reactions are avoided, and product safety and purity are improved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024107753_26122025_PF_FP_ABST
    Figure CN2024107753_26122025_PF_FP_ABST
Patent Text Reader

Abstract

A method for producing a recombinant tumor necrosis factor. The method comprises: (1) constructing a recombinant expression vector containing a kanamycin-resistant tumor necrosis factor; (2) constructing an engineered bacterium containing the recombinant expression vector; (3) performing primary seed culture, secondary seed culture, and fermentation culture on the engineered bacterium to obtain a fermentation broth bacterial mass; and (4) crushing the fermentation broth bacterial mass, followed by fractional protein precipitation, and purification to obtain the recombinant tumor necrosis factor. A kanamycin gene is used as a resistance gene in the tumor necrosis factor expression vector. The stability of a plasmid is improved, and the loss rate of the plasmid is 0. In addition, the fermentation method and the purification method are improved, the plasmid is stably expressed during fermentation, the yield of the tumor necrosis factor is significantly improved, the activity of the purified tumor necrosis factor is improved, and the safety of a product is improved.
Need to check novelty before this filing date? Find Prior Art

Description

A method for producing a recombinant tumor necrosis factor TECHNICAL FIELD

[0001] The present invention belongs to the field of tumor necrosis factor production, and particularly relates to a method for producing a recombinant tumor necrosis factor. BACKGROUND

[0002] Tumor Necrosis Factor (TNF) is a cytokine produced by immune cells such as macrophages and T cells. It has multiple biological functions. There are mainly two types of TNF, TNF-α and TNF-β. TNF plays an important role in immune response and inflammatory processes, and can induce apoptosis, inflammation, and regulate the activity of immune cells. In addition, TNF is also involved in regulating cell proliferation, differentiation and apoptosis, and has some influence on the growth and spread of tumor cells. In certain disease states, overexpression of TNF can lead to excessive inflammation, triggering diseases. TNF has been widely studied and has become a target for the treatment of certain autoimmune diseases (such as rheumatoid arthritis, Crohn's disease, etc.) and tumors.

[0003] Recombinant Mutant Human Tumor Necrosis Factor for Injection (rmh-TNF) is referred to as TNF in this paper. The mechanism of action is: destroying the blood supply of tumor tissue, causing tumor tissue to bleed and necrotize; injecting into the tumor can directly kill cancer cells and inhibit the growth of cancer cells; and enhancing the anti-tumor effect of the immune system in the patient's body. The mature TNF molecule of human is composed of 157 amino acids. The spatial structure of TNF is a tight trimer structure composed of three identical TNF monomers. Each monomer TNF is wedge-shaped, 50A long and 30A wide, and is composed of two anti-parallel β-sandwich structures, which is very similar to the jelly-roll motif of viral envelope protein.

[0004] At present, the microbial fermentation method is the production means of TNF. For example, the patent with publication number CN1055200A adopts genetic engineering technology to obtain tumor necrosis factor gene TNF-α from PHT1 plasmid and clone it to neomycin pIJ486 carrier, and obtains recombinant plasmid PIJT7 with neomycin neo resistance. The patent application with publication number CN97125202.5 discloses a recombinant human tumor necrosis factor and a preparation method, and constructs an engineering bacterium containing a penicillin-resistant recombinant human tumor necrosis factor expression vector for fermentation. However, it is found in production that in the existing recombinant method of tumor necrosis factor, the plasmid is usually unstable in expression and is easy to be lost, and the yield of TNF after fermentation needs to be improved, and the activity of tumor necrosis factor needs to be improved.

[0005] In view of this, the present application is proposed.

[0006] SUMMARY

[0007] The technical problem solved by the present application is to overcome the shortcomings of the prior art, and to provide a production method of recombinant tumor necrosis factor. In the tumor necrosis factor expression vector of the present application, kanamycin gene is used as the resistance gene, the stability of the plasmid is improved, the plasmid loss rate is 0, and at the same time, the fermentation method and the purification method are improved. The plasmid is stably expressed during fermentation, the yield of tumor necrosis factor is significantly improved, the activity of tumor necrosis factor after purification is improved, and the safety of the product is improved.

[0008] To solve the above technical problems, the basic idea of the technical solution of the present application is:

[0009] The present application provides a production method of recombinant tumor necrosis factor, comprising:

[0010] (1) constructing a recombinant expression vector containing kanamycin-resistant tumor necrosis factor;

[0011] (2) constructing an engineering bacterium containing the recombinant expression vector;

[0012] (3) carrying out primary seed culture, secondary seed culture and fermentation culture on the engineering bacterium to obtain fermentation broth bacteria;

[0013] (4) crushing the fermentation broth bacteria, fractionally precipitating protein, purifying to obtain recombinant tumor necrosis factor.

[0014] In the tumor necrosis factor expression vector of the present application, kanamycin gene is used as the resistance gene, and the prepared recombinant engineering bacterium stably expresses the plasmid during fermentation, the yield of tumor necrosis factor is significantly improved, and at the same time, the penicillin-resistant engineering bacterium is avoided to add penicillin in the production process, which may cause penicillin allergic reaction damage to human body, and the safety of the product is improved.

[0015] The fermentation method of the application is aimed at kanamycin-resistant engineering bacteria, growth conditions are explored, and fermentation conditions such as fermentation temperature, inoculation amount, rotation speed, OD value and culture time are improved, so that the yield of bacterial protein is increased, the expression amount of fermentation protein is improved, and the efficiency is improved.

[0016] In the application, the method for removing ammonium sulfate by flow buffer ultrafiltration replaces the traditional dialysis method for removing ammonium sulfate, greatly shortens the time, improves the efficiency, and improves the activity of tumor necrosis factor.

[0017] In a further aspect, in step (1), the recombinant expression vector is an E. coli temperature-sensitive expression vector lacking a resistance gene, and a human tumor necrosis factor gene or a recombinant human tumor necrosis factor and a kanamycin gene with a promoter are inserted.

[0018] In a further aspect, in step (1), the recombinant expression vector is based on a pJLA-hTNFNC expression vector, and an ampicillin gene fragment is replaced by a kanamycin gene fragment with a promoter.

[0019] In the kanamycin gene with a promoter, the promoter is the promoter of the kanamycin gene itself.

[0020] In a further aspect, the recombinant human tumor necrosis factor has an amino acid sequence of 151 amino acids, and compared with the prototype human tumor necrosis factor, the amino-terminal 1-7 amino acid residues are deleted, the 8th, 9th and 10th amino-terminal are replaced by Arg, Lys and Arg, and at least one of the carboxy-terminal Ala and Leu is replaced by one of Gln, Ser, Gly, Thr, Tyr and Asn. Preferably, the carboxy-terminal Ala or Leu is replaced by Gln.

[0021] In a further aspect, in step (3), when primary seed culture and secondary seed culture are carried out, the culture temperature is 31-35℃, and preferably 33℃.

[0022] The kanamycin-resistant engineering bacteria grow relatively slowly due to the absence of plasmid loss, and increasing the temperature and rotation speed can promote the growth of the bacterial cells.

[0023] In a further aspect, in step (3), when primary seed culture and secondary seed culture are carried out, the OD 600 When the OD 600 reaches 1.1-1.8, the culture is ended.

[0024] It is found that the kanamycin-resistant bacteria carrying plasmids are stable, the loss rate is 0%, the expression amount is >40%, and the stability is very high when the OD increases, so that more products can be obtained by increasing the OD, and the quality is stable.

[0025] Further, in step (3), the fermentation is carried out at a temperature of 31-35°C, preferably 33°C, and the pH is controlled at 6.0-7.2, and the fermentation is carried out for 3.5-5.0 hours under the condition that the dissolved oxygen is not less than 40%.

[0026] Preferably, during the fermentation, when the OD 600 reaches 0.8-1.8, the temperature is raised to 42°C for induction, and meanwhile the feeding is continued for 3.0-5.0 hours, and then the temperature is lowered to below 35°C for tank discharge, and at the time of tank discharge, the OD 600 >1.4.

[0027] It is found that when the OD is increased, the culture time is appropriately prolonged, the plasmid carried by the kanamycin-resistant bacteria is stable, the loss rate is 0%, and the expression amount is >40%, which is very stable. Therefore, increasing the OD and prolonging the time do not affect the product quality, and more product can be obtained, and the quality is stable.

[0028] Further, in step (4), the purification comprises:

[0029] (1) The fractionated precipitated protein is dissolved, and is subjected to desalting by using the flow addition method;

[0030] (2) DEAE chromatography is carried out;

[0031] (3) Ultrafiltration concentration is carried out;

[0032] (4) S-100 chromatography is carried out to obtain the tumor necrosis factor protein.

[0033] Further, in step (4), the precipitated protein is dissolved by using a buffer, and then is subjected to desalting by using the flow addition method through the ultrafiltration membrane package, so that the conductivity is reduced to 800-1100 ps / cm;

[0034] Preferably, the total time length for desalting by using the ultrafiltration membrane package is 3.5-7.0 hours;

[0035] Preferably, the buffer is Tris-HCL, and the pH of the buffer is controlled at 7.6±0.1;

[0036] Preferably, the pressure of the backflow port of the ultrafiltration clamp is controlled at below 220 psi, and the molecular weight range of the ultrafiltration membrane package is 5K-10K.

[0037] Further, in step (4), the step of carrying out DEAE chromatography comprises:

[0038] (1) DEAE column pretreatment: 0.5 mol / L NaOH is used to flush 1 times the column volume, and then sterile water for injection is used to flush to neutralize the effluent;

[0039] (2) Equilibration before loading: equilibrate the column with Buffer A, the equilibration volume is more than 7 column volumes, the pH of the effluent is 7.6±0.1, and the conductivity is the same as the original solution;

[0040] (3) Loading and equilibration: dilute the protein after desalting with Buffer A by 10 times for loading;

[0041] (4) Elution: elute with Buffer B, collect the effluent peaks at 280 nm according to the peak situation, and obtain the DEAE elution sample;

[0042] Preferably, the Buffer A buffer is a Tris-HCl buffer, and the Buffer B buffer is a Tris-HCl buffer containing NaCl.

[0043] In a further scheme, in step (4), the S-100 chromatography includes:

[0044] (1) S-100 column treatment: treat with Buffer B buffer for ≥1 column volume;

[0045] (2) Equilibration: equilibrate with Buffer A buffer for 2-4 column volumes until the conductivity and pH of the inflow and outflow buffers are consistent;

[0046] (3) Loading and elution: load the ultrafiltration concentrated liquid on the equilibrated S-100 column, elute with Buffer B buffer, and collect the 280 nm effluent to obtain the tumor necrosis factor protein;

[0047] Preferably, the Buffer A buffer is a Tris-HCl buffer, and the Buffer B buffer is a Tris-HCl buffer containing NaCl.

[0048] After adopting the above technical scheme, the present application has the following beneficial effects compared with the prior art.

[0049] (1) The kanamycin gene is used as the resistance gene in the tumor necrosis factor expression vector of the present application, the recombinant engineering bacteria prepared by the present application stably express the plasmid during fermentation, the yield of tumor necrosis factor is significantly improved, and the harm of penicillin allergy reaction to the human body caused by the addition of penicillin in the production process of the penicillin-resistant engineering bacteria is avoided, and the safety of the product is improved.

[0050] (2) In the fermentation process, it is found that the engineering bacteria containing the kanamycin-resistant tumor necrosis factor expression vector have very good plasmid stability, the plasmid loss rate and expression amount are better than those of the penicillin-resistant bacteria under the original temperature. The plasmid loss rate of the present application is 0%, that is, there is no plasmid loss, and the fermentation expression amount is higher than before, and is greater than 40%.

[0051] (3) The fermentation method of the present application, aiming at kanamycin-resistant engineering bacteria, explores the growth conditions, and improves the fermentation conditions such as fermentation temperature, inoculation amount, rotation speed, OD value, and culture time, so that the yield of bacterial protein is increased, the expression amount of fermentation protein is improved, and the efficiency is improved.

[0052] (4) In the purification of protein, the method of adding buffer ultrafiltration desalination is used to remove ammonium sulfate, instead of the traditional dialysis method to remove ammonium sulfate, so that the time is greatly shortened, the efficiency is improved, and it is found that the activity of tumor necrosis factor is improved.

[0053] (5) In the method of the present application, the DEAE filler and S-100 filler are improved, and the original GE imported glue is replaced by domestic navi glue. Due to the change of the filler, the properties of the filler also change accordingly; through multiple batches of research, the pH is increased from 7.2 to pH 7.6, which is easy to adsorb and improves the yield, and the elution flow rate is also adjusted according to the properties of the filler. Using the changed purification parameters for purification, the process is stable, the product quality is good, and the final product has an HPLC purity of 99.5% and an electrophoretic purity of 99%. Therefore, by using the changed domestic filler and process parameters, the purification process is stable, the yield is improved, and the quality of the purified product of the penicillin-resistant engineering bacteria meets the standard.

[0054] The specific embodiments of the present application will be described in further detail below in conjunction with the accompanying drawings. BRIEF DESCRIPTION OF DRAWINGS

[0055] The accompanying drawings are part of the present application and serve to provide a further understanding of the present application. The schematic embodiments of the present application and their descriptions serve to explain the present application but do not constitute an improper limitation on the present application. Obviously, the drawings described below are only some embodiments, and other drawings can be obtained by those skilled in the art without creative labor. In the drawings:

[0056] Fig. 1 is a structural map of the recombinant expression vector of the present application;

[0057] Fig. 2 is the sequencing result of the corresponding clone E56612A of C7189424G0-2 (promoter+kan_h-TNF-NC) constructed. The determined sequence includes the promoter+kanamycin gene+TNF gene sequence.

[0058] Fig. 3 is a gel electrophoresis map of the enzyme digestion product of the recombinant expression vector. M: KBLadder; Lane 1: C7189424G0-2 plasmid; Lane 2: C7189424G0-2 plasmid digested by Pvul and Xhol enzymes;

[0059] Figure 4 is a flow chart of the protein purification process;

[0060] Figure 5 is a SDS-PAGE electrophoresis chart of the DEAE column sample detection;

[0061] Figure 6 is an electrophoresis chart of the S-100 chromatography protein electrophoresis detection;

[0062] Figure 7 is a SDS-PAGE electrophoresis chart of the protein amount comparison before and after the ultrafiltration desalination in the second test example.

[0063] It should be noted that the drawings and the written description are not intended to limit the scope of the inventive concept in any way, but to illustrate the inventive concept to those skilled in the art by referring to specific embodiments. DETAILED DESCRIPTION

[0064] In order to make the purpose, technical scheme and advantages of the embodiments of the present application more clear, the technical scheme in the embodiments will be described clearly and completely below by referring to the drawings in the embodiments of the present application. The following embodiments are used to illustrate the present application, but not to limit the scope of the present application.

[0065] I. Construction of the recombinant expression vector

[0066] 1. According to the sequence, the "promoter+kan" synthetic primer is designed, the "promoter+kan" fragment is amplified, and the recombinant method is used to clone it into the BspHI site of h-TNF-NC (C4582HL070-3) to obtain the product C7189424G0-2 (promoter+kan_h-TNF-NC), and the vector map is shown in Figure 1.

[0067] It should be noted that the h-TNF-NC (C4582HL070-3) vector is pJLA-hTNFNC described in CN1220997A. The ampicillin promoter+ampicillin resistance gene in the pJLA-hTNFNC vector is replaced by the kanamycin promoter+kanamycin gene to construct the C7189424G0-2 (promoter+kan_h-TNF-NC) of the present application. The other elements of the vector of the present application are the same as the pJLA-hTNFNC vector described in CN1220997A.

[0068] 1.1 Primer synthesis and PCR amplification

[0069] The primer sequence was designed and synthesized by an automatic synthesizer. After obtaining the target primer, PCR amplification was performed. The PCR product was detected by electrophoresis, and the PCR product with the expected size of the target sequence was obtained. The gene sequence of promoter+kan is: TGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGTTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTTCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTAC

[0070] 1.2 Connection transformation and colony screening

[0071] The amplified PCR product was connected with the linearized h-TNF-NC (C4582HL070-3) by GenBuilder, and the connection product was named C7189424G0-2 (promoter+kan_h-TNF-NC). The connection product was transformed into competent cells by heat shock method, and the transformed product was uniformly coated on LB plate medium containing kanamycin. The plate was inverted in an incubator at 37°C and cultured overnight.

[0072] A sterile gun head was used to pick single colonies as PCR templates for colony screening, and was transferred to LB liquid medium containing kanamycin. The colony screening primers were as follows:

[0073] C7189424G0-2_3 (5'-TGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTC-3') / C7189424G0-2_12 (5'-ATATTCAACGGGAAACGTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGC-3').

[0074] 1.3 Shake bacteria to extract plasmid

[0075] The C7189424G0-2 (promoter+kan_h-TNF-NC) colony screened clones were numbered as E56608, E56609, E56610, E56611, and E56612. After inoculating the selected clones, they were cultured overnight, and the bacterial cells were collected by centrifugation. The plasmid was extracted, and E56611 and E56612 were sequenced for verification, and E56608, E56609, and E56610 were reserved.

[0076] 1.4 Sequencing identification

[0077] The C7189424G0-2 (promoter+kan_h-TNF-NC) was sequenced for verification, and the corresponding clones E56611 and E56612 had correct sequencing results.

[0078] The primers and sequences are as follows:

[0079] C8950 EZSG 0-3-seql (5'-CGGATAAAATGCTTGATGGT-3')

[0080] C964BQLHG 0-5-seql (5'-ATATGGGTATAAATGGGCTC-3')

[0081] C4061 QAVG 0-2-seq3 (5'-AGGATTAGCAGAGCGAGGTA-3')

[0082] C7189 424G 0-2 (promoter+kan_h-TNF-NC) corresponding clone E56612A sequencing results are correct. The sequencing results are shown in Figure 2. The sequencing results are shown in Figure 2. The sequence determined includes the promoter + kanamycin gene + TNF gene sequence.

[0083] 1.5 Enzyme digestion identification

[0084] The plasmid E56612A (C7189 424G 0-2 (promoter+kan_h-TNF-NC)) was digested with Pvul / Xhol, and the enzyme digestion product was subjected to gel electrophoresis. The electropherogram is shown in Figure 3.

[0085] Conclusion: The Pvul / XhoI enzyme digestion of clone E56612A (C7189 424G 0-2 (promoter+kan_h-TNF-NC)) has a theoretical size of 2077bp, 3139bp, Lane 2 from top to bottom, the first band is about 3.1kb, the second band is about 2.1kb, which is consistent with the expected result.

[0086] II. Preparation of recombinant engineering bacteria

[0087] 1. Preparation and detection of glycerol bacteria of recombinant bacteria

[0088] Arrange clone E56612A to be transformed into competent cells HMS174 (DE3) by heat shock method, evenly coat the transformed product on LB plate medium containing kanamycin resistance, and invert the plate in a 37°C incubator for overnight culture.

[0089] Pick single colonies numbered E57209, E57210, shake bacteria to prepare plasmid, then perform sequencing verification and glycerol bacteria detection at the same time. The primers and sequences are as follows:

[0090] C4061 QAVG 0-2-seq3 (5'-AGGATTAGCAGAGCGAGGTA-3')

[0091] C7189424G0-2-seq2(5'-GTTATTCATTCGTGATTGCG-3')

[0092] The sequencing results for clones E57209 and E57210 corresponding to C7189424G0-3(promoter+kan_h-TNF-NC) are correct.

[0093] 260 μL of the original E57210 (C7189424G0-3(promoter+kan_h-TNF-NC)) bacterial culture and 260 μL of 50% glycerol were respectively mixed in sterile storage tubes to prepare glycerol-containing bacteria. 100 μL of the original bacterial culture was then transferred to a 96-well cell culture plate and cultured using a microplate reader at an OD wavelength of [wavelength missing]. 600 Under the specified conditions, the OD reading of the bacterial culture was 0.3954. 600 The actual value ((ELISA reader reading - blank reading) * 5.4) was 1.8889. 1 μL of the glycerol bacteria was then plated for verification and incubated overnight. The next day, the plates were examined and found to have normal colony morphology, no blemishes, and a colony count greater than 100.

[0094] 2. Identification of recombinant engineered bacteria

[0095] Three batches (engineered bacteria samples 1-3) of engineered bacteria were tested and identified.

[0096] 2.1 The plasmid copy number was detected by PCR, and the results are shown below:

[0097] Table 1

[0098] 2.2 TNF expression was detected by real-time quantitative PCR, and the results are shown below:

[0099] Table 2

[0100] III. Cultivation and Fermentation of Recombinant Engineered Microorganisms

[0101] 1. Reagents, culture media, and preparation methods:

[0102] 1.1 Primary seed culture LB medium ①: (preparation volume 1200ml)

[0103] Table 3

[0104] Pour LB medium ① for primary seed culture into a beaker, add purified water and stir until fully dissolved, then bring the volume to a final volume of 1200 ml. Dispense the solution into six 1000 ml Erlenmeyer flasks (200 ml per flask). Sterilize at 121°C for 30 minutes.

[0105] 1.2 Kanamycin sulfate solution prescription (5ml preparation volume)

[0106] Table 4

[0107] In the primary seed inoculation process, 1g of kanamycin sulfate was added to 5ml of sterilized purified water in a clean bench, and 100μl of kanamycin sulfate was added to the LB medium during inoculation.

[0108] 1.3 Secondary seed liquid LB medium (40L preparation volume)

[0109] Table 5

[0110] After sterilizing the 75L fermenter with purified water, the purified water in the tank was drained. The secondary seed liquid LB medium was poured into a container, purified water was added and stirred to fully dissolve it, then it was added to the 75L fermenter, and the final volume was set to 40L. After setting the wet heat sterilization conditions at 121°C for 30min, the medium was cooled to 33°C. 26L of the secondary seed liquid LB medium was disposed of, and the remaining 14L of the secondary seed liquid LB medium was reserved for use.

[0111] 1.4 Fermentation LB medium ② (200L preparation volume)

[0112] Table 6

[0113] 1.5 Fermentation trace element formula:

[0114] 1.5.1 Trace element solution A (100ml volume)

[0115] Table 7

[0116] 1.5.2 Trace element solution B (100ml volume)

[0117] Table 8

[0118] After sterilizing the 300L fermenter with purified water, the purified water in the tank was drained. The fermentation LB medium was poured into a container and purified water was added, stirred to fully dissolve it, then added to the fermenter. 2ml of trace element solution A and 2ml of trace element solution B were added to the tank, and purified water was added to make up to 200L. The automatic sterilization program of the fermenter was run (set sterilization conditions: 121°C, 30min), and after completion, the medium was cooled to 33°C.

[0119] 1.6 48L feeding medium ③: (8000ml preparation)

[0120] Table 9

[0121] The feed medium is poured into a feed bottle, and the above ingredients are dissolved in purified water, and then purified water is added to 8000 ml. After wet heat sterilization at 121°C for 30 min, it is ready for use as a feed during fermentation.

[0122] 1.7 55L feed medium ③: (prepare 5000 ml)

[0123] Table 10

[0124] The feed medium is poured into a feed bottle, and the above ingredients are dissolved in purified water, and then purified water is added to 8000 ml. After wet heat sterilization at 121°C for 30 min, it is ready for use as a feed during fermentation.

[0125] 1.8 TES buffer formula (prepare 20L volume):

[0126] Table 11

[0127] The above ingredients are poured into a beaker, dissolved in purified water (80% of the preparation volume), and then adjusted to pH 7.2±0.1 with HCL. Add purified water to 20L, and adjust the pH to 7.2±0.1.

[0128] 2. Cultivation and fermentation

[0129] 2.1 Primary seed inoculation: Take 5 bottles of 200 ml LB medium, and in the clean bench in the inoculation room, add 100 μl of kanamycin sulfate solution to the LB medium, and then add 1000 μl of recombinant engineering bacteria strain (glycerol bacteria) to the LB medium, and prepare for cultivation.

[0130] 2.2 Primary seed culture: After inoculation, the flask is placed in a constant temperature incubator shaker, set to 33°C and 200 rpm, and cultured for 10-12 hours. Then take a sample and measure the OD value of the primary seed liquid. When the OD reaches 1.5, the culture is complete, and under a microscope, it should be a typical gram-negative E. coli with no mixed bacteria.

[0131] 2.3 75L fermentation tank emptying:

[0132] Put 40L of purified water into the fermentation tank and sterilize at 121.0°C for 30 min to perform emptying of the fermentation tank.

[0133] 2.4 75L fermentation tank real consumption:

[0134] Add 40L of secondary seed medium to the fermentation tank and sterilize at 121.0°C for 30 min.

[0135] 2.5 Primary seed liquid combined bottle

[0136] Primary seed liquid combined bottle: 5 bottles of primary seed culture liquid were combined and poured into the inoculation bottle, and the total volume was controlled at 1000±50ml.

[0137] 2.6 75L fermenter inoculation

[0138] Before inoculation, 26L of the secondary seed liquid LB medium in the fermenter was treated, and the remaining 14L was used. The well-cultured primary seed liquid 1000ml was inoculated by flame method, and the secondary culture was started.

[0139] 2.7 75L fermenter fermentation culture

[0140] The secondary culture was carried out at 33℃ and 100-700rpm, and the culture was carried out for 2-4 hours, OD 600 When the OD value reached 0.9-1.8, gram staining microscopic examination should be typical gram-negative E. coli without mixed bacteria.

[0141] The process parameters of the secondary seed liquid 75L fermenter culture: temperature: (33±2)℃, rotation speed: 500rpm, OD value: 1.5, culture time: 3.5h, tank pressure: 0.2bar, air flow (AIRFL): 50L / min.

[0142] 2.8 75L fermenter seed transfer

[0143] When the OD value and microscopic examination were qualified, the 75L fermenter outlet line and the 300L fermenter inlet line were connected, and the transfer operation was carried out. Or transfer to the inoculation bottle, store at 2-6℃, inoculate within 24 hours.

[0144] 2.9 300L fermenter emptying

[0145] Put 160L of purified water into the fermenter, sterilize at 121.0℃ for 30min, and perform emptying of the fermenter.

[0146] 2.10 300L fermenter real consumption

[0147] Add 200L of fermentation medium to the fermenter, add trace element liquid A: 2ml, trace element liquid B: 2ml, sterilize at 121.0℃ for 30min, and perform real consumption.

[0148] 2.11 300L fermenter inoculation

[0149] The well-cultured secondary seed liquid 15L was inoculated into the 200L fermentation medium which had been sterilized and cooled to 33℃ for fermentation culture.

[0150] 2.12 300L fermenter fermentation culture

[0151] Fermentation is carried out at 33°C, tank pressure: 0.2 bar, aeration amount (AIRFL): (50±5) L / min, pH is controlled between 6.0-7.2, pH can be adjusted with water, dissolved oxygen is not less than 40% (in order to ensure that the dissolved oxygen is ≥40% during the fermentation process, the speed control range can be adjusted in stages according to the need (200-900) rpm), about 3.5-5.0 hours of fermentation, OD 600 When it reaches 0.8-1.8, the temperature is raised to 42°C for induction, and at the same time, the feeding is supplemented, and the culture is continued for about 3.0-5.0 hours. When the OD starts to drop during the culture, an appropriate amount of prepared 5L medium is added.

[0152] Gram staining microscopy should be typical gram-negative E. coli, no mixed bacteria, and the temperature is lowered to 35°C or below for centrifugation. When the tank is discharged, OD 600 >1.4.

[0153] 2.13 300L Fermentation Tank Fermentation Tank Discharge

[0154] The discharge port of the fermentation tank is connected with the inlet of the tubular separator, or connected with the inlet of the pre-cooled storage tank. The inlet of the tubular separator is connected with the discharge port of the storage tank. The water supply valve of the tubular separator is opened. The tubular separator is opened. The pressure in the tank is maintained at 0.2-0.6 bar. Slowly open the discharge valve. Control the flow rate of the fermentation broth at about 1.0-2.0 L / min per centrifuge. When the liquid level in the fermentation tank is below the lowest stirring paddle, stop stirring. The supernatant is discharged to the inactivation tank after inactivation and then discarded. After centrifugation, use a stainless steel scraper to scrape the wet bacteria. Detect the expression amount.

[0155] 2.14 Bacterial cell washing:

[0156] Mix the bacterial cells in 3000ml TES solution, slowly stir to wash evenly and smoothly, and put it into a high-speed refrigerated centrifuge. Centrifuge at 6700 rpm for 20 min at 4°C. The supernatant is clear and transparent. The supernatant is poured out and discarded after inactivation. The above washing operation is repeated once. The weight of the wet bacterial cells is measured, and the expression amount is detected.

[0157] 2.15 High-pressure homogenization:

[0158] Mix the bacterial cells in 10 times the volume of TES solution, adjust the air inlet valve of the high-pressure homogenizer pump motor and the air inlet valve of the discharge pipe to make the pressure in the outlet pipe in the range of 340-1400 bar, and homogenize the bacterial cells to obtain cell broken liquid. Check the complete breakage of the bacterial cells by microscopy.

[0159] 2.16 Broken liquid separation:

[0160] The cell crushing solution was centrifuged at 4°C and 11000 rpm for 30 min, and the supernatant was collected. The generated precipitate was inactivated at 121°C for 30 min and then discarded.

[0161] 2.17 Fractionation of proteins by ammonium sulfate:

[0162] Ammonium sulfate (100 ml / 29.6 g, 50% by mass) was added to the supernatant after centrifugation, and the mixture was thoroughly dissolved and then placed in a refrigerator for stirring for 1 hour at a temperature of 4°C. After stirring for 1 hour, the mixture was centrifuged at a temperature of 4°C and a rotation speed of 11000 rpm for 30 min. The supernatant was discarded, and the precipitate was collected. Ammonium sulfate (100 ml / 7.9 g, 10% by mass) was added to the supernatant after the harvest, and the mixture was thoroughly dissolved and then placed in a refrigerator for stirring for 1 hour at a temperature of 4°C. After stirring for 1 hour, the mixture was centrifuged at a temperature of 4°C and a rotation speed of 11000 rpm for 30 min. The supernatant was discarded, and the precipitate was collected. The weight of the precipitate was measured, and the purity of the protein was detected. The protein was stored at -20°C for no more than 6 months.

[0163] The results of the fermentation detection of the three batches are shown below:

[0164] Table 12

[0165] IV. Protein purification:

[0166] 10×Buffer A mother liquor (1000 ml)

[0167] Table 13

[0168] Tris was dissolved in an appropriate amount of water for injection (70%-80% of the preparation volume), and the pH value was adjusted to 7.6±0.1 using HCl. Water for injection was added to make up to 1000 ml, and the pH value was fine-tuned to 7.6±0.1. After ultrafiltration with an 8K membrane, wet heat sterilization was performed (121°C, 30 min).

[0169] 5×Buffer B mother liquor (1000 ml)

[0170] Table 14

[0171] Tris and NaCl were dissolved in an appropriate amount of water for injection (70%-80% of the preparation volume), and the pH value was adjusted to 7.6±0.1 using HCl. Water for injection was added to make up to 1000 ml, and the pH value was fine-tuned to 7.6±0.1. After ultrafiltration with an 8K membrane, wet heat sterilization was performed (121°C, 30 min).

[0172] The protein purification process is shown in Figure 4.

[0173] 1. Ultrafiltration desalination of protein solution:

[0174] 1.1 Before ultrafiltration, the number of silica gel tubes used by the peristaltic pump should be noted, and the contact position of the peristaltic pump head with the silica gel tube should be changed to avoid fatigue burst of the silica gel tube. The operator should observe the pressure during the ultrafiltration process.

[0175] 1.2 The protein solution ultrafiltration device should be built with at least two peristaltic pumps and one membrane package clamp. The membrane package should be cleaned in advance before ultrafiltration, and the membrane package should be sealed with 1x Buffer A solution. The molecular weight range of the membrane package is 5K-10K.

[0176] 1.3 The flow rate of the protein solution addition pump should be controlled at more than 30ml / min, and the rotation speed of the ultrafiltration peristaltic pump should be set at more than 30rpm. After the membrane package cleaning is completed, the 1x Buffer A solution conductance and pH value of the clamp inlet, outlet and backflow port should be consistent.

[0177] 1.4 Simulate the protein ultrafiltration process with 1x Buffer A solution, adjust the clamp backflow port pressure to about 1.0bar, the clamp inlet flow rate is more than 30ml / min, the protein solution containing serum bottle is placed on the magnetic stirrer, the rotor rotation speed is set to more than 30rpm, the inlet pressure and backflow pressure difference is not more than 10%.

[0178] 1.5 After the simulation is completed, the clamp inlet, backflow port and addition pump inlet are placed together in the serum bottle containing protein solution, the clamp inlet, backflow port and outlet septum valves are screwed to the maximum, the peristaltic pump connected to the clamp is turned on, the protein solution backflow is allowed for a while, the clamp backflow port septum valve is slowly tightened to about 1.0bar, then the addition pump is turned on to add pre-cooled 1x buffer A solution to the serum bottle containing protein solution at a flow rate of more than 30ml / min, the ultrafiltration membrane package clamp outlet is connected to the serum bottle to record the waste liquid volume.

[0179] 1.6 Detect the conductivity of the diluted 10 times protein solution to be below 1100μs / cm, and perform DEAE chromatography operation.

[0180] 2. DEAE chromatography:

[0181] 2.1 DEAE chromatography uses a 300*750 Hanbang manual chromatography column, which is filled with 20.0L of Nanwei UniGel8-8 DEAE filler. Due to the compressibility of the filler, the column height should be 29cm±3cm. The column efficiency and symmetry should be measured before DEAE chromatography, and the operation should be started after meeting the requirements.

[0182] 2.2 DEAE column pretreatment: 0.5 mol / L NaOH, at a flow rate of 40 L / h, flush 1 column volume (about 20 L), and then flush with sterile water for injection at 40 L / h until the effluent is neutral.

[0183] 2.3 Equilibrium before loading: equilibrate the column with Buffer A at a flow rate of 40 L / h, the equilibrium volume is greater than 7 column volumes, the effluent pH is 7.6±0.1, and the conductivity is consistent with the original solution.

[0184] 2.4 Loading and equilibration: dilute the qualified ultrafiltrate with Buffer A at a ratio of 1:10 to control the conductivity at 550-800 us / cm, pause the instrument, replace the Buffer A solution with the diluted sample, and start loading at a flow rate of 20 L / h. A loading peak with a platform should appear.

[0185] After loading, equilibrate with Buffer A at a flow rate of 40 L / h for 2-3 column volumes until the baseline is flat.

[0186] 2.5 Elution: elute with Buffer B at a flow rate of 20 L / h. According to the computer display of the peak, collect the effluent peak at 280 nm in sections. Specifically, collect the first peak, temporarily store it. The second peak is the target protein peak, and the third peak is collected and temporarily stored; collect the collected sample in sections with a beaker, and the volume is ≤2 / 3 of the capacity. The DEAE sample is obtained. Take samples to determine the protein content and perform electrophoresis detection.

[0187] 2.6 DEAE column sample detection: SDS-PAGE electrophoresis: check the purity of the rmhTNF target protein peak collection liquid, Coomassie brilliant blue or silver staining, non-reducing electrophoresis scanning, purity >80%.

[0188] The SDS-PAGE electrophoresis results are shown in Figure 5. From the detection results, peak 1, 2 have a large amount of target protein (protein containing ammonium sulfate before ultrafiltration), peak 3 has a small amount of target protein, and peak 4 has a very small amount of target protein. The collected peaks of 1, 2, and 3 are combined and ultrafiltrated and concentrated.

[0189] Table 15

[0190] 2.7 DEAE column sample combination: according to the detection results of SDS-PAGE electrophoresis, the TNF effluent peak collection liquid with a purity of >80% is combined for the next process production (combine the collected peaks of 1, 2, and 3, and ultrafiltrate and concentrate).

[0191] 3 Ultrafiltration and concentration:

[0192] 3.1 Ultrafiltration preparation: The ultrafiltration membrane is cleaned with sterile water for injection or water for injection within the effective period until neutral, disinfected with 0.1 mol / L sodium hydroxide solution, and then washed with sterile water for injection or water for injection within the effective period until neutral. Then, 1 L of Buffer A is used to wash for about 30 min.

[0193] 3.2 Ultrafiltration: The qualified DEAE column combined liquid is concentrated by ultrafiltration membrane to obtain an ultrafiltration concentrated liquid.

[0194] 3.3 Cleaning of the ultrafiltration membrane: After the ultrafiltration is completed, the ultrafiltration membrane is cleaned with 0.1 mol / L NaOH solution, and then washed with sterile water for injection or water for injection within the effective period until neutral. After cleaning, the ultrafiltration membrane is stored with 0.05 mol / L NaOH solution.

[0195] 4. S-100 chromatography:

[0196] The S-100 chromatography uses a Hanbang manual chromatography column with a size of 140*950, and the Nanwei NW Super 100 filler is loaded into the column at a volume of 10.0 L. Due to the compressibility of the filler, the column height should be 54 cm ± 3 cm. Before S-100 chromatography, the column efficiency and symmetry are measured, and the operation is started after the requirements are met.

[0197] 4.1 S-100 column treatment: When the S-100 chromatography column is used for the first time, it is disinfected by washing with 0.2 mol / L NaOH solution at a flow rate of 3 L / h for more than 1 / 3 of the column volume. Then, it is washed with Buffer B buffer at a flow rate of 3 L / h for more than 1 column volume. When it is used again, Buffer B buffer can be directly used to treat 1 column volume.

[0198] 4.2 Equilibrate 2-4 column volumes with Buffer A buffer at a flow rate of 1.1-3 L / h until the conductivity and pH of the incoming and outgoing buffers are consistent. Then, the sample can be separated.

[0199] 4.3 Load the ultrafiltration concentrated liquid onto the S-100 column equilibrated as described above at a flow rate of 3 L / h. Elute with Buffer B buffer at a flow rate of 3 L / h. According to the peak display on the computer, collect the 280 nm effluent. After the peak collection is completed, take a sample for detection. The qualified effluent is combined, and the sample is detected to obtain the recombinant modified human tumor necrosis factor stock solution (i.e., rmhTNF stock solution).

[0200] The protein electrophoresis detection result of S-100 chromatography is shown in Figure 6. The analysis result is as follows: The separation effect of S-100 chromatography is good, and the target band is obvious. The purity HPLC detection result is as follows: stock solution purity: 98.1%; electrophoresis result: 98.9%, which meets the requirements.

[0201] The rmhTNF stock solutions obtained from the three batches were detected by the above method, and the detection results are shown in the following table:

[0202] Table 16

[0203] 4.4 rmhTNF stock solution structure confirmation

[0204] 4.4.1 C-terminal sequence: The C-terminal sequence of the rmhTNF stock solution protein was analyzed by mass spectrometry, and the results showed that the C-terminal amino acid sequence of the rmh-TNF stock solution of the three batches was: Ser Gly Gin Val Tyr Phe Gly Ile Ile Ala Gin.

[0205] 4.4.2 N-terminal sequence: The results showed that the N-terminal amino acid sequence of the rmh-TNF stock solution of the three batches was: NH2-Met-Arg-Lys-Arg-Lys-Pro-Val-Ala-His-Val-Val-Ala-Asn-Pro-Gln Ala-Glu-Gly-Gln-Leu, which was consistent with the theoretical sequence.

[0206] 4.4.3 Disulfide bond: After non-reducing enzymatic digestion and liquid chromatography-mass spectrometry analysis of the three batches of rmh-TNF stock solution, one kind of disulfide bond was identified which was consistent with the theoretical disulfide bond pairing mode.

[0207] Theoretical sequence:

[0208] 4.5 Addition of stabilizer

[0209] Under laminar flow protection, first measure the volume VO with a measuring cylinder, add 20% human blood albumin qualified TNF stock solution at VO / 19, mix and filter through a one-time 0.22 μm filter to obtain the recombinant modified human tumor necrosis factor stock solution with albumin (i.e. TNF stock solution with albumin).

[0210] 4.6 Stock solution dispensing

[0211] The stock solution with human blood albumin was dispensed in a saline bottle, and the amount of each bottle was not more than 2 / 3 of the total capacity. After sealing, it was stored in a refrigerator below -30°C.

[0212] Experimental Example 1 Determination of plasmid stability and protein expression during recombinant E. coli fermentation

[0213] 1. Measurement of recombinant plasmid loss rate experiment

[0214] Experimental process

[0215] (1) Preparation of kanamycin-free plates

[0216] The prepared and sterilized LB solid medium was directly poured into the sterilized Petri dishes. About 15 ml of medium was poured into each plate on average, and was labeled (KA+) and kept ready after solidification.

[0217] (2) Preparation of kanamycin-containing plates

[0218] 20 mg of kanamycin was weighed and dissolved in 2 ml of phosphate buffer to obtain a kanamycin solution having a concentration of 10 mg / ml. 100 ml of LB solid medium was melted in a water bath and cooled to about 50-60°C, 10 ml of the kanamycin solution was added to 0.5 ml to obtain a concentration of 50 ug / ml, and then mixed and poured into the sterilized Petri dishes. About 15 ml of medium was poured into each plate on average, and was labeled (KA+) and kept ready after solidification.

[0219] (3) 0.5 ml of the seed solution was taken, a loop was picked up with an inoculation loop, and streaked on the plate without kanamycin, and cultured at 37°C for 24 h.

[0220] (4) After the culture was completed, two LB medium plates without kanamycin and two LB medium plates with kanamycin were taken.

[0221] (5) Single colonies were picked up from the plates with a sterilized toothpick, inoculated on the LB medium plate without kanamycin, and then inoculated on the LB medium plate with kanamycin. The inoculated plates were placed in a 37°C incubator and cultured for 24 h.

[0222] Experimental results: The number of colonies in the plates with and without kanamycin was counted, and the results are shown in the following table.

[0223] Table 17 Statistics of the number of colonies of the recombinant plasmid engineering bacteria overnight culture plates Note: Plasmid loss rate = (1 - number of colonies in kanamycin-containing plates / number of colonies in kanamycin-free plates) * 100%

[0224] According to the formula, the plasmid loss rates of plates No. 1 and No. 2 were both (1-100 / 100)*100% = 0%, and the average was 0%.

[0225] 2. Determination of the expression amount of the target protein (SDS-PAGE)

[0226] The bacterial cells of each batch of fermentation broth obtained after the 2.13 fermenter of the aforementioned recombinant engineering bacteria culture and fermentation project was discharged were used for protein expression amount determination experiments, and the purity of the protein after ammonium sulfate secondary precipitation was detected by SDS-PAGE.

[0227] 1. Experimental process

[0228] (1) Preparation of double-layer glass plate

[0229] Take the double-layer glass plate for protein preparation and fix it on the glue making mold. Pour purified water into the double-layer glass and check if there is any water leakage. If there is no water leakage, it means that the double-layer glass is sealed well. Pour out the purified water and dry the remaining water inside with filter paper for standby use.

[0230] (2) Preparation of separation glue and concentration glue: prepare the separation glue and concentration glue according to the following table.

[0231] Table 18 Reagent formula for preparing separation glue and concentration glue

[0232] Use a pipette to suck the separation glue and immediately pour it into the double-layer glass plate (note to avoid air bubbles). Pour until about 3 cm from the top of the double-layer glass, then carefully add purified water to cover the separation glue, which can keep the glue surface flat. Let it stand at room temperature for about 30 minutes until it solidifies. After the glue surface solidifies, discard the water layer and dry the remaining water with filter paper.

[0233] Use a pipette to suck the concentration glue and immediately pour it into the double-layer glass plate (on top of the separation glue), until the top, insert the washed sample comb, and let it stand at room temperature for 40 minutes until the glue solidifies.

[0234] (3) Sample loading: take 60ul of test sample and add 20ul of test buffer, mix well, and boil at 100℃ for 5 minutes. Load the treated sample and Marker into the gel hole.

[0235] (4) Electrophoresis: cover the electrophoresis tank cover, connect the electrophoresis instrument, connect the power supply, turn on the switch, start electrophoresis at 80V, when the blue indicator band electrophoresis to the connection between the separation glue and the concentration glue, control the voltage at 180V, until the indicator band migrates to the bottom of the glue, turn off the power and stop electrophoresis. The length of electrophoresis is about 80 minutes.

[0236] (5) Staining and decolorization

[0237] After electrophoresis, place the electrophoresis gel in a plastic box and put it in the fixing solution for 60 minutes. Discard the fixing solution, add the Coomassie brilliant blue staining solution, and shake the plastic box on the shaker for 60 minutes. Discard the staining solution, wash once with purified water, pour out the purified water, add the Coomassie brilliant blue decolorizing solution, and shake overnight until the gel color is almost colorless. Take out the gel and place it in the storage solution.

[0238] (6) Electrophoresis gel scanning: scan the electrophoresis gel to obtain the electrophoresis spectrum and calculate the protein expression amount. The experimental results are as follows:

[0239] Table 19

[0240] The fermentation results of each batch are shown in the above table. It can be seen that the plasmid loss rate is 0%, and the expression amount of the target protein is high.

[0241] Experimental Example Two

[0242] For the protein produced by the fermentation of TP20231203 batch, SDS-PAGE electrophoresis was performed on the samples before and after ultrafiltration desalination, DEAE column loading, ultrafiltration waste liquid, DEAE column after sample, peak 1, peak 2 and regeneration peak. The protein content results are shown in Table 20 below, and the SDS-PAGE electrophoresis chart is shown in Figure 7.

[0243] Table 20

[0244] Results: From the electrophoretogram, it can be seen that the electrophoretogram before and after ultrafiltration desalination is similar (lanes 1 and 3 from left), and the protein content determination shows that the total protein content is similar, indicating that ultrafiltration desalination has no effect on the protein content.

[0245] Comparative Example 1

[0246] A strain containing the original plasmid with ampicillin resistance was used for the comparative test of plasmid loss rate.

[0247] Experimental process:

[0248] (1) Preparation of plates without ampicillin

[0249] Pour the prepared and sterilized LB solid medium directly into the sterilized culture dishes. Pour about 15 ml of medium into each plate on average, and make a mark (AP-) before solidification for standby.

[0250] (2) Preparation of plates containing ampicillin

[0251] Weigh 91.7 mg of ampicillin sodium, add 9 ml of phosphate buffer to dissolve it to make a kanamycin solution with a concentration of 10 mg / ml. Take 100 ml of water bath to melt and cool to about 50-60°C LB solid medium, add 10 ml of kanamycin solution 1 ml to make the concentration 100 ug / ml, then mix and pour into the already sterilized culture dishes. Pour about 15 ml of medium into each plate on average, and make a mark (AP-) before solidification for standby.

[0252] (3) Take 1 ml of seed liquid bacteria (engineered bacteria containing ampicillin-resistant plasmid before improvement), use a loop to pick a loop and streak on the plate without ampicillin, and culture. Incubate at 37°C for 24 h.

[0253] (4) After the end of the culture, two plates of LB medium without ampicillin and two plates of LB medium with ampicillin were taken.

[0254] (5) Single colonies were picked from the plates with sterilized toothpicks, inoculated on plates of LB medium without ampicillin first, and then inoculated on plates of LB medium with ampicillin. The inoculated plates were placed in a 37°C incubator for 24 hours.

[0255] Experimental results: The number of colonies in plates with and without ampicillin was counted respectively, and the results are shown in the following table.

[0256] Table 21 Statistics of the number of colonies of ampicillin-resistant plasmid engineering bacteria in overnight culture plates Note: Plasmid loss rate = (1 - number of colonies in ampicillin-containing plates / number of colonies in ampicillin-free plates) * 100%

[0257] According to the formula, the plasmid loss rate of plate No. 1 is (1-82 / 100)*100%=18%, and the plasmid loss rate of plate No. 1 is (1-88 / 100)*100%=12%, with an average of 15%.

[0258] Therefore, the average plasmid loss rate of ampicillin-resistant engineering bacteria is 15%, which is relatively unstable. Compared with the kanamycin-resistant recombinant plasmid, the plasmid loss rate is much higher, which shows that the presence of kanamycin-resistant gene indeed helps to increase the stability of the recombinant plasmid.

[0259] Comparison of fermentation methods before and after improvement of Comparative Example 2

[0260] The engineering bacteria resistant to kanamycin were fermented, a total of 12 batches of fermentation, including 2 batches of 50 liters of fermentation volume and 10 batches of 200 liters of fermentation volume. The strain before improvement was ampicillin-resistant expression vector engineering bacteria (the strain after improvement was kanamycin-resistant expression vector engineering bacteria)

[0261] The steps of the fermentation process were followed by the original process, the difference was that: (1) the fermentation temperature was 30°C before improvement and 33°C after improvement; (2) the inoculum was 2000 ml before improvement and 15000 ml after improvement; (3) the rotation speed was 200 rpm / min before improvement and 500 rpm / min after improvement. The specific conditions and result comparison are shown in the following table.

[0262] Table 22 Comparison of conditions before and after improvement of fermentation process

[0263] Table 23 Comparison of fermentation conditions and results of multiple batches

[0264] Results: The fermentation temperature is improved, the growth rate is faster than that at the original temperature, and the density (OD value) is increased, but the product quality is not affected. The plasmid loss rate and expression level are better than those of the penicillin-resistant gene strain fermented at the original temperature. Therefore, when the kanamycin-resistant engineered strain is fermented, the growth is promoted by increasing the temperature. Therefore, 33°C and 15L inoculum are determined, the process is stable in multiple batches, the quality is stable, and the yield is greater than that of the original engineered strain fermentation product.

[0265] Compared with the improved fermentation process, the fermentation temperature is improved, the growth rate is faster than that at the original temperature, and the density (OD value) is increased, but the product quality is not affected. The plasmid loss rate and expression level are better than those of the penicillin-resistant gene strain fermented at the original temperature. Therefore, when the kanamycin-resistant engineered strain is fermented, the growth is promoted by increasing the temperature. Therefore, 33°C and 15L inoculum are determined, the process is stable in multiple batches, the quality is stable, and the yield is greater than that of the original engineered strain fermentation product.

[0266] Through multiple batch fermentation, it is found that the kanamycin-resistant engineered strain has very good plasmid stability, and there is no plasmid loss. The expression level is higher than before, and is greater than 40%. Since there is no plasmid loss, each engineered strain carries TNF, so the growth rate is slightly slower than that of the penicillin-resistant engineered strain. By adjusting the temperature, the growth rate is basically the same as before, and is slightly faster. After research, the process parameters for batches TF20231203 and TF20231204 are determined.

[0267] Comparison of purification methods before and after improvement of Comparative Example 3

[0268] (1) For ammonium sulfate precipitation after breaking the bacteria, remove ammonium sulfate, replace the original dialysis process with ultrafiltration desalination, greatly shorten the time, and improve the activity. (2) The purification DEAE filler and S00 filler are changed. The original GE imported glue is replaced with domestic Navi glue. Due to the change of the filler, the properties of the filler also change accordingly. (3) Through multiple batch research, the purification method is adjusted, the pH is increased to pH 7.6, the adsorption is easy, the yield is improved, and the elution flow rate is also adjusted according to the properties of the filler. The purification is carried out using the changed purification parameters, the process is stable, the product quality is good, and the final product purity HPLC is 99.5%, and the electrophoretic purity is 99%. Therefore, using the changed domestic filler and process parameters, the purification process is stable, the yield exceeds that of the penicillin-resistant engineered strain purification product, and the quality meets the standard. The difference between the improved purification process and the original process is shown in the table below.

[0269] Table 24 Comparison of purification process parameters before and after improvement

[0270] Table 25 Comparison of purification equipment and filler before and after improvement

[0271] 1. The results of different batch experiments using the purification scheme of the present application are compared and analyzed as follows:

[0272] Table 26

[0273] Result analysis: In the above table, TP20231003, TP20231004, TP20231101 are ampicillin engineering bacteria batches, and TP20231202 is a kanamycin engineering bacteria batch. From the results, high-purity protein can be obtained.

[0274] 2. Comparative analysis of results of adding rmh-TNF stock solution into human serum albumin, as shown in the following table:

[0275] Table 27

[0276] Result analysis: In the above table, TP20231003, TP20231004, TP20231101 are ampicillin engineering bacteria batches (dialysis), and TP20231202 is a kanamycin engineering bacteria batch (ultrafiltration). From the results, the product activity is improved after ultrafiltration replaces dialysis.

[0277] The titer of the stock solution produced by the penicillin-resistant genetically engineered bacteria is 1.7*10 8 The titer of the stock solution produced by the kanamycin-resistant genetically engineered bacteria in the present application is 2.0*10 8 The above can reach 3.73*10 8 The product activity is greatly improved.

[0278] The above is only a preferred embodiment of the present application, and does not limit the present application in any form. Although the present application has been disclosed as above, it is not intended to limit the present application. Any skilled person in the art can make some changes or modifications to the above-mentioned technical content without departing from the scope of the present application, and any simple modification, equivalent change and modification of the above-mentioned technical content within the scope of the present application are still within the scope of the present application.

Claims

1. A method for producing recombinant tumor necrosis factor, characterized in that, include: (1) Construct a recombinant expression vector containing kanamycin-resistant tumor necrosis factor; (2) Construct engineered bacteria containing recombinant expression vectors; (3) The engineered bacteria were subjected to primary seed culture, secondary seed culture and fermentation culture to obtain fermentation broth cells; (4) The fermentation broth cells were broken, the proteins were graded and precipitated, and purified to obtain recombinant tumor necrosis factor.

2. The production method according to claim 1, characterized in that, In step (1), the recombinant expression vector uses a temperature-sensitive E. coli expression vector lacking the resistance gene as a backbone, and inserts human tumor necrosis factor gene or recombinant human tumor necrosis factor, as well as kanamycin gene with promoter.

3. The production method according to claim 1 or 2, characterized in that, In step (1), the recombinant expression vector is based on the pJLA-hTNFNC expression vector, and the ampicillin gene fragment is replaced with a kanamycin gene fragment with a promoter.

4. The production method according to any one of claims 1-3, characterized in that, In step (3), the culture temperature is 31-35℃, preferably 33℃, when carrying out primary and secondary seed culture.

5. The production method according to any one of claims 1-4, characterized in that, In step (3), during primary and secondary seed culture, OD 600 The culture ends when the pH reaches 0.9-1.

8. Preferred, OD 600 The culture ends when the pH reaches 1.1-1.

8.

6. The production method according to any one of claims 1-5, characterized in that, In step (3), the fermentation temperature is 31-35℃, preferably 33℃; the pH is controlled between 6.0 and 7.2; and the fermentation time is 3.5-5.0h under dissolved oxygen conditions of not less than 40%. Preferably, during fermentation, when OD 600 When the OD reaches 0.8-1.8, raise the temperature to 42℃ for induction, while simultaneously feeding and continuing incubation for 3.0-5.0 hours. Then cool to below 35℃ and remove from the container. At the time of removal, the OD... 600 >1.

4.

7. The production method according to any one of claims 1-6, characterized in that, In step (4), the purification includes: (1) Dissolve the fractionated precipitated protein and desalt it by ultrafiltration using a fed-batch method; (2) Perform DEAE chromatography; (3) Perform ultrafiltration concentration; (4) Perform S-100 chromatography to obtain tumor necrosis factor protein.

8. The production method according to claim 7, characterized in that, In step (4), the precipitated protein is dissolved in buffer solution and then fed through an ultrafiltration membrane for desalting, reducing the conductivity to 800-1100 ps / cm; Preferably, the total desalination time of the ultrafiltration membrane pack is 3.5-7.0 hours; Preferably, the buffer solution is Tris-HCl, and the pH of the buffer solution is controlled at 7.6 ± 0.1; Preferably, the pressure at the reflux port of the ultrafiltration clamp is controlled to be below 220 psi, and the molecular weight range of the ultrafiltration membrane pack is 5K to 10K.

9. The production method according to claim 7, characterized in that, In step (4), the steps for performing DEAE chromatography include: (1) DEAE column pretreatment: Wash with 0.5 mol / L NaOH for 1 column volume, and then rinse with sterile water for injection until the effluent is neutral; (2) Equilibration before loading: Equilibrate the column with Buffer A, with an equilibration volume greater than 7 column volumes. The pH of the effluent is 7.6±0.1, and the conductivity is consistent with that of the original solution. (3) Loading and equilibration: After desalting, the protein is diluted 10 times with Buffer A and loaded. (4) Elution: Elute with Buffer B, and collect the elution peaks at 280 nm wavelength in segments according to the elution situation to obtain DEAE eluted samples; Preferably, Buffer A is a Tris-HCl buffer and Buffer B is a Tris-HCl buffer containing NaCl.

10. The production method according to claim 7, characterized in that, In step (4), S-100 chromatography includes: (1) S-100 column treatment: ≥1 column volume was treated with Buffer B buffer. (2) Equilibration: Equilibrate with Buffer A buffer for 2-4 column volumes until the conductivity and pH of the inflow and outflow buffer are consistent. (3) Loading and elution: Load the ultrafiltration concentrate onto a equilibrated S-100 column, elute with Buffer B, collect the 280nm eluent, and obtain tumor necrosis factor protein. Preferably, Buffer A is a Tris-HCl buffer and Buffer B is a Tris-HCl buffer containing NaCl.

Citation Information

Patent Citations

  • DNA plasmids having improved expression and stability

    CN102016045A

  • Reformed human tumor necrosin derivative and preparation method thereof

    CN1148624A

  • Recombination human tumour necrofactor and preparation method

    CN1220997A

  • Compositions and methods for fusion protein separation

    US20060276625A1

  • Vectors and transformed most cells for recombinant protein production with reduced expression of selectable markers

    US5256568A