Use of sphingomonas sp. microorganism for promoting hair growth

Abstract

The present invention relates to a use of a Sphingomonas sp. microorganisms, particularly Sphingomonas olei, for promoting hair growth or preventing hair loss. A composition comprising a Sphingomonas sp. microorganism (particularly Sphingomonas olei) or a lysate, culture medium, or extract thereof enhances the growth rate of hair length and increases the expression of growth promotion-related factors of hair follicle cells, and thus is useful for promoting hair growth or preventing hair loss.

Description

Use of Sphingomonas spp. for hair growth promotion

[0001] The present invention relates to the use of microorganisms of the genus Sphingomonas, particularly Sphingomonas olei, for promoting hair growth or preventing hair loss, and more particularly, to a composition for promoting hair growth or preventing hair loss, comprising a microorganism of the genus Sphingomonas (particularly Sphingomonas olei), or a lysate, culture solution or extract thereof.

[0002]

[0003] Hair production in hair follicles undergoes a repetitive cycle of growth, regression, and resting phases. A shortened growth phase or prolonged regression and resting phases can lead to alopecia. Hair loss is caused not only by genetic factors and disease, but also by aging, stress, hormonal changes, irregular lifestyle habits, and excessive use of chemical products. The prevalence of hair loss is increasing not only among middle-aged men but also among young people in their 20s and 30s and among women. In today's world, where appearance is paramount, the psychological stress caused by hair loss can lower quality of life and significantly disrupt interpersonal relationships and social life. Therefore, it is recognized as a condition requiring active prevention and treatment. The growing number of people with hair loss has led to rapid expansion of the hair loss market. However, currently, there are no hair loss treatments that are both highly effective and have minimal side effects with long-term use. Therefore, the discovery of substances that promote hair follicle growth is crucial.

[0004] Hair growth is driven by a complex mechanism involving multiple genes, growth factors, and their receptors. In particular, the outer root sheath cells of the hair follicle, composed of epithelial cells, and the papilla cells, composed of dermal cells, play a pivotal role in hair formation and growth. The interaction between these two cells leads to a cycle of growth, shedding, and telogen phases. The dermal papilla (DP) of the hair follicle is central to hair growth. It releases growth factors and inhibitory factors into the DP, thereby repeating the cycle of growth, shedding, and telogen phases. Representative genes that promote dermal papilla cell growth include insulin-like growth factor-1 (IGF-1) and vascular endothelial growth factor (VEGF). These growth factors are most strongly expressed during the anagen phase of the hair follicle, inducing the proliferation of dermal papilla cells and maintaining the anagen phase, thereby helping to maintain hair growth. Therefore, it can be said that the attempt to find a substance that increases the expression of hair follicle growth factors in dermal papilla cells is a basic prerequisite for the development of hair growth agents.

[0005] In the present invention, it was confirmed that microorganisms of the genus Sphingomonas, particularly Sphingomonas olei, not only promote the expression of hair follicle growth factors but also induce hair growth, thereby completing the present invention.

[0006]

[0007] Accordingly, the present invention aims to provide a composition for promoting hair growth or preventing hair loss, comprising a microorganism of the genus Sphingomonas (particularly Sphingomonas olei), or a lysate, culture solution or extract thereof.

[0008] Specifically, the present invention aims to provide a cosmetic composition for promoting hair growth or preventing hair loss, comprising a microorganism of the genus Sphingomonas (particularly Sphingomonas olei), or a lysate, culture solution or extract thereof.

[0009] The present invention provides a pharmaceutical composition for promoting hair growth or preventing hair loss, comprising a microorganism of the genus Sphingomonas (particularly Sphingomonas olei), or a lysate, culture solution or extract thereof.

[0010] The present invention provides a composition for external application to the skin for promoting hair growth or preventing hair loss, comprising a microorganism of the genus Sphingomonas (particularly Sphingomonas olei), or a lysate, culture solution or extract thereof.

[0011] The present invention provides a pharmaceutical composition for promoting hair growth or preventing hair loss, comprising a microorganism of the genus Sphingomonas (particularly Sphingomonas olei), or a lysate, culture solution or extract thereof.

[0012] The present invention provides a health functional food composition for promoting hair growth or preventing hair loss, comprising a microorganism of the genus Sphingomonas (particularly Sphingomonas olei), or a lysate, culture solution or extract thereof.

[0013] In addition, the present invention provides a Sphingomonas olei strain deposited under accession number KACC 81320BP or KACC 81321BP.

[0014] The present invention seeks to provide a lysate, culture solution, or extract of the above Sphingomonas olei strain.

[0015]

[0016] One aspect of the present invention provides a composition for promoting hair growth or preventing hair loss, comprising a microorganism of the genus Sphingomonas (particularly Sphingomonas olei), or a lysate, culture solution or extract thereof.

[0017] In the present invention, the microorganism of the genus Sphingomonas (particularly Sphingomonas olei) may be a viable bacterium (living bacterium) or a dead bacterium (dead bacterium). More specifically, the dead bacterium may be a bacterium killed by heat treatment.

[0018] In the present invention, microorganisms of the genus Sphingomonas include, but are not limited to, the following species: Sphingomonas abaci, Sphingomonas adhaesiva, Sphingomonas aerolata, Sphingomonas aestuarii, Sphingomonas alaskensis, Sphingomonas alpine, Sphingomonas aquatilis, Sphingomonas aromaticivorans, Sphingomonas asaccharolytica, Sphingomonas astaxanthinifaciens astaxanthinifaciens), Sphingomonas aurantiaca, Sphingomonas azotifigens, Sphingomonas capsulate, Sphingomonas changbaiensis, Sphingomonas chlorophenolica, Sphingomonas chungbukensis, Sphingomonas cloacae, Sphingomonas cynarae, Sphingomonas desiccabilis, Sphingomonas dokdonensis, Sphingomonas echinoides echinoides), Sphingomonas endophytica, Sphingomonas faeni,Sphingomonas fennica, Sphingomonas formosensis, Sphingomonas ginsengisoli, Sphingomonas ginsenosidimutans, Sphingomonas glacialis, Sphingomonas haloaromaticamans, Sphingomonas hankookensis, Sphingomonas herbicidovorans, Sphingomonas histidinilytica, Sphingomonas indica, Sphingomonas Sphingomonas insulae, Sphingomonas japonica, Sphingomonas jaspsi, Sphingomonas jejuensis, Sphingomonas jinjuensis, Sphingomonas kaistensis, Sphingomonas koreensis, Sphingomonas laterariae, Sphingomonas leidyi, Sphingomonas macrogolitabida, Sphingomonas macrogoltabidus, Sphingomonas mali mali), Sphingomonas melonis, Sphingomonas molluscorum, Sphingomonas mucosissima,Sphingomonas natatoria, Sphingomonas olei, Sphingomonas oligophenolica, Sphingomonas oryziterrae, Sphingomonas panni, Sphingomonas parapaucimobilis, Sphingomonas paucimobilis, Sphingomonas phyllosphaerae, Sphingomonas pituitosa, Sphingomonas polyaromaticivorans, Sphingomonas pruni, Sphingomonas pseudosanguinis, Sphingomonas rosa, Sphingomonas roseiflava, Sphingomonas rubra, Sphingomonas sanguinis, Sphingomonas sanxanigenens, Sphingomonas sediminicola, Sphingomonas soli, Sphingomonas starnbergensis, Sphingomonas stygia, Sphingomonas subarctica, Sphingomonas Sphingomonas suberifaciens, Sphingomonas subterranean, Sphingomonas taejonensis,Sphingomonas terrae, Sphingomonas trueperi, Sphingomonas ursincola, Sphingomonas wittichii, Sphingomonas xenophaga, Sphingomonas xinjiangensis, Sphingomonas yabuuchiae, Sphingomonas yanoikuyae, and Sphingomonas yunnanensis.

[0019] In one specific example, the microorganism of the genus Sphingomonas may be Sphingomonas olei, and specifically may be a Sphingomonas olei strain deposited under accession number KACC 81169BP, KACC 81320BP or KACC 81321BP.

[0020] The above Sphingomonas genus microorganisms (particularly Sphingomonas olei) can be used singly or in combination of two or more species.

[0021] The term "lysate" as used herein refers to a solution or suspension in an aqueous medium of cells of a microorganism, such as a broken microorganism of the genus Sphingomonas. A cell lysate may contain macromolecules such as DNA, RNA, proteins, peptides, carbohydrates, lipids, etc., and / or micromolecules such as amino acids, sugars, fatty acids, etc., or fractions thereof. The lysate may also contain cell debris, which may be smooth or granular in structure.

[0022] Methods for achieving cell lysis of the above microorganisms can utilize various known methods, and any method capable of achieving cell lysis of the microorganisms can be used. For example, cell opening / disruption can be performed enzymatically, chemically, or physically. Non-limiting examples of enzymes and enzyme mixtures include proteases such as proteinase K, lipases, or glycosidases; non-limiting examples of chemicals include ionophores, detergents such as sodium dodecyl sulfate, acids, or bases; and non-limiting examples of physical means include high pressure, such as French pressing, osmotic pressure, and temperatures such as heat or cold. In addition, a method using an appropriate combination of enzymes, acids, bases, etc. other than proteolytic enzymes can also be used.

[0023] In this specification, the term "culture medium" may be used interchangeably with "culture supernatant", "conditioned culture medium" or "conditioned medium", and may mean the entire medium containing the microorganism, its metabolites, extra nutrients, etc., obtained by culturing Sphingomonas microorganisms for a certain period of time in a medium that can supply nutrients so that Sphingomonas microorganisms can grow and survive in vitro. In addition, the culture medium may mean a culture medium from which the microorganisms have been removed from a cell culture obtained by culturing the microorganisms. Meanwhile, the liquid from the culture medium from which the cell bodies have been removed is also called a "supernatant", and may be obtained by allowing the culture medium to stand still for a certain period of time and taking only the liquid in the upper layer excluding the portion that has settled to the lower layer, removing the cell bodies through filtration, or centrifuging the culture medium to remove the sediment at the bottom and taking only the liquid in the upper layer. The "cell bodies" above refers to the microorganisms themselves of the present invention, and includes the microorganisms themselves that have been separated and selected from a skin sample or the like, or the microorganisms that have been separated from the culture medium by culturing the microorganisms. The above-mentioned fungi can be obtained by centrifuging the culture solution and taking the portion that has settled to the lower layer, or by allowing the fungi to settle to the lower layer of the culture solution by gravity and then removing the upper liquid after leaving it still for a certain period of time.

[0024] According to one embodiment, the culture of the Sphingomonas microorganism of the present invention can use a medium easily selected by a person skilled in the art according to the purpose among the media used for microbial culture. Specifically, the culture of the Sphingomonas microorganism can use, for example, TSB (Tryptic soy broth) medium, R2A (Reasoner's 2A) medium, LB (Luria-Bertani) medium, or MH (Mueller Hinton) medium, but is not limited thereto. According to one specific example, the culture of the Sphingomonas microorganism of the present invention can be prepared by inoculating the Sphingomonas microorganism into the microbial culture medium and using a microbial culture method known in the art (for example, static culture, etc.).

[0025] The above culture solution may include the culture solution itself, a concentrate thereof, or a lyophilized product obtained by culturing a microorganism, or a culture supernatant obtained by removing a microorganism from the culture solution, a concentrate thereof, or a lyophilized product thereof.

[0026] The above culture solution may be obtained by culturing a Sphingomonas genus microorganism in an appropriate medium (e.g., TSB medium) at a temperature of 10°C to 40°C for a certain period of time, for example, 4 to 50 hours. A person of ordinary skill in the art may appropriately select or modify the culture medium and culture conditions for culturing the Sphingomonas genus microorganism.

[0027] In one specific example, the culture supernatant of a microorganism can be obtained by a step of removing microorganisms by centrifuging or filtering the microbial culture solution.

[0028] In another specific example, the concentrate can be obtained by concentrating the microbial culture itself, or the supernatant obtained after filtering the culture using centrifugation or a filter.

[0029] The term "extract" in this specification means an extract from the above-mentioned lysate, culture medium or concentrate thereof, and may include an extract, a diluted or concentrated extract, a dried product obtained by drying the extract, or a controlled or purified product thereof, or a fraction obtained by fractionating the same.

[0030] The composition is present in an amount of 0.00001 wt% to 80 wt%, for example, 0.00001 wt% to 60 wt%, 0.00001 wt% to 40 wt%, 0.00001 wt% to 30 wt%, 0.00001 wt% to 20 wt%, 0.00001 wt% to 10 wt%, 0.00001 wt% to 5 wt%, 0.05 wt% to 60 wt%, 0.05 wt% to 40 wt%, 0.05 wt% to 30 wt%, 0.05 wt% to 20 wt%, 0.05 wt% to 10 wt%, 0.05 wt% to 5 wt%, 0.1 wt% to 60 wt%, 0.1 wt% to 40 wt%, 0.1 It may include a microorganism, or a lysate, culture medium, or extract thereof, or a mixture of lysates, culture mediums, or extracts of two or more microorganisms, in an amount of from 0.1 wt% to 30 wt%, from 0.1 wt% to 20 wt%, from 0.1 wt% to 10 wt%, or from 0.1 wt% to 5 wt%.

[0031] In this specification, the term "including as an active ingredient" means that the microorganism, or its lysate, culture medium or extract is added to an extent that it can exhibit the above-mentioned effect, and includes formulating in various forms by adding various components as auxiliary components for drug delivery and stabilization, etc.

[0032] As used herein, the term "hair" includes hair of the scalp, skin, eyelashes, eyebrows, mustache area and / or beard area of ​​a subject.

[0033] As used herein, the term "stimulation of hair growth" means stimulating the production and growth of hair to increase the proportion of hair in the anagen phase in the total hair. This includes not only stimulating the production of new hair, but also making existing hair grow healthily. Stimulation of hair growth means increasing the length of hair fibers growing in a specific area of ​​the human body, i.e., increasing the length of hair in a given area over a period of time compared to the length of hair without the use of Sphingomonas spp. (particularly Sphingomonas olei) over the same period of time, and / or increasing the density of hair (i.e., skin cm 2 This includes increasing the number of hairs per scalp.

[0034] As used herein, the term "alopecia" refers to the phenomenon of hair falling out from the scalp or a condition in which hair becomes thicker or thinner. Hair loss can be caused by a decrease in the proportion of hair in the growth phase. Hair loss can be caused by exogenous or endogenous factors. Exogenous factors include various external factors, such as ultraviolet rays, while endogenous factors occur over time, including cell death of hair papilla cells due to telomeres and oxidative stress resulting from a decline in cell function. The above hair loss may be one or more selected from, but is not limited to, alopecia areata, androgenetic alopecia, telogen effluvium, traumatic alopecia, hair loss due to trichotillomania, pressure alopecia, anagen alopecia, pityriasis alopecia, alopecia syphlltiac, alopecia seborrhecia, symptomatic alopecia, cicatricial alopecia, and congenital alopecia.

[0035] As used herein, the term "hair loss prevention" refers to preventing, delaying, or preventing hair loss. The term "prevention" may be interchangeable with the term "reduction," which refers to reducing the amount of hair lost. Therefore, "hair loss prevention" may encompass hair loss improvement, hair loss prevention, hair loss treatment, and the like.

[0036] In the present invention, a microorganism of the genus Sphingomonas (particularly Sphingomonas olei), or a lysate, culture medium or extract thereof, may exhibit hair growth promoting or hair loss preventing activity. Specifically, a microorganism of the genus Sphingomonas (particularly Sphingomonas olei), or a lysate, culture medium or extract thereof, may promote hair length growth, or increase the expression of one or more of factors related to the promotion of hair follicle cell growth, such as insulin-like growth factor 1 (IGF-1), vascular endothelial growth factor (VEGF), hepatocyte growth factor (HGF), platelet-derived growth factor subunit A (PDGFA) and fibroblast growth factor 7 (FGF7).

[0037] In one specific example, the Sphingomonas genus microorganism (particularly Sphingomonas olei), or a lysate, culture or extract thereof, may be used together with other microorganisms effective in promoting hair growth or preventing hair loss.

[0038] The composition for promoting hair growth or preventing hair loss of the present invention can be used for various purposes and uses requiring promotion of hair growth or prevention of hair loss, and specifically, can be used as a cosmetic, a pharmaceutical (e.g., a topical skin preparation), an over-the-counter drug, a food, a health functional food, a detergent, a cleaning agent, a preservative, an antiseptic, a food additive, or a feed additive, but is not limited thereto.

[0039] In one specific embodiment, the present invention may be a cosmetic composition for promoting hair growth or preventing hair loss, comprising a microorganism of the genus Sphingomonas (particularly Sphingomonas olei), or a lysate, culture solution or extract thereof.

[0040] In the present invention, the cosmetic composition can be manufactured in a formulation including a toner (skin lotion), skin, skin softener, skin toner, astringent, lotion, milk lotion, moisture lotion, nourishing lotion, massage cream, nourishing cream, moisture cream, hand cream, hand sanitizer, foundation, essence, nourishing essence, pack, soap, cleansing foam, cleansing lotion, cleansing cream, body lotion, body cleanser, suspension, gel, powder, paste, mask pack, and sheet. The composition in such a formulation can be manufactured according to a method conventional in the art. The blending amount of additional ingredients such as the moisturizer can be easily selected by a person skilled in the art within a range that does not impair the purpose and effect of the present invention.

[0041] In addition to the effective ingredients disclosed herein, the above cosmetic composition may further include functional additives and components included in general cosmetic compositions, and may further include purified water, thickeners, preservatives, stabilizers, solubilizers, surfactants, carriers, fragrances, or combinations thereof that are commonly used. The functional additives may include components selected from the group consisting of water-soluble vitamins, oil-soluble vitamins, high molecular peptides, high molecular polysaccharides, sphingolipids, and seaweed extracts. The carriers may include, for example, alcohols, oils, surfactants, fatty acids, silicone oils, humectants, moisturizers, viscosity modifiers, emulsifiers, stabilizers, ultraviolet scatterers, ultraviolet absorbers, colorants, fragrances, and the like. Compounds / compositions that can be used as the above alcohols, oils, surfactants, fatty acids, silicone oils, humectants, moisturizers, viscosity modifiers, emulsifiers, stabilizers, ultraviolet scatterers, ultraviolet absorbers, colorants, fragrances, etc. are already known in the art, so a person skilled in the art can select and use the appropriate corresponding substances / compositions. In addition, the cosmetic composition may further contain, as necessary, ingredients such as sunscreens, antioxidants (butylated hydroxyanisole, propyl gallate, ellisorbic acid, tocopheryl acetate, butylated hydroxytoluene, etc.), preservatives (methylparaben, butylparaben, propylparaben, phenoxyethanol, imidazolidinyl urea, chlorphenesin, etc.), colorants, pH adjusters (triethanolamine, citric acid, citric acid, sodium citrate, malic acid, sodium malate, formaldehyde, sodium formaldehyde, succinic acid, sodium succinate, sodium hydroxide, sodium hydrogen phosphate, etc.), moisturizers (glycerin, sorbitol, propylene glycol, butylene glycol, hexylene glycol, diglycerin, betaine, glycereth-26, methylgluceth-20, etc.), and lubricants.

[0042] Additionally, for each type of cosmetic composition, appropriate ingredients can be selected and blended according to the cosmetic formulation or intended use. Since the blending ingredients and method can be achieved using conventional techniques, a detailed description thereof is omitted herein.

[0043] In another specific embodiment of the present invention, there may be provided a pharmaceutical composition for promoting hair growth or preventing hair loss, comprising a microorganism of the genus Sphingomonas (particularly Sphingomonas olei), or a lysate, culture solution or extract thereof.

[0044] The term "pharmaceutical composition" as used herein may refer to a molecule or compound that, when administered to a subject, imparts several beneficial effects. Beneficial effects may include enabling diagnostic determination; improving a disease, symptom, disorder, or condition; reducing or preventing the onset of a disease, symptom, disorder, or condition; and generally combating a disease, symptom, disorder, or condition.

[0045] As used herein, the term "prevention" refers to a method of partially or completely delaying or preventing the onset or recurrence of a disease, disorder, or its associated symptoms, preventing the acquisition or reacquisition of a disease or disorder, or reducing the risk of acquiring a disease or disorder. For example, the term "prevention" refers to any action that inhibits or delays the onset of skin damage or symptoms by administering a composition according to the present invention.

[0046] The term “treatment” as used herein includes inhibition, alleviation or elimination of the development of a disease.

[0047] The term "improvement" herein may mean any action that at least reduces the severity of a symptom, for example, a parameter related to alleviation or treatment of a condition.

[0048] In the pharmaceutical composition according to the present invention, a microorganism of the genus Sphingomonas (particularly Sphingomonas olei), or a lysate, culture medium, or extract thereof, may be included in a pharmaceutical composition having hair growth promotion or hair loss prevention activity, or may be used as an adjuvant for an active ingredient having a medicinal use. The pharmaceutical composition may be prepared according to a method well known to those skilled in the art.

[0049] The pharmaceutical composition described above can be administered orally or parenterally, depending on the intended method, and can be used in the form of a general pharmaceutical formulation. Parenteral administration can refer to administration via routes other than oral administration, such as rectal, intravenous, peritoneal, intramuscular, arterial, transdermal, nasal, inhalational, ocular, and subcutaneous. In one specific example, the pharmaceutical composition can be applied to the scalp.

[0050] When the pharmaceutical composition of the present invention is used as a medicine, it may additionally contain one or more active ingredients exhibiting the same or similar function.

[0051] The above pharmaceutical composition may be further manufactured by including at least one pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers include saline solution, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, and mixtures of at least one of these components. If necessary, other conventional additives such as antioxidants, buffers, and bacteriostatic agents may be added. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate the composition into injectable formulations such as aqueous solutions, suspensions, and emulsions, pills, capsules, granules, or tablets. Furthermore, the composition may be preferably formulated according to each disease or component using an appropriate method in the art.

[0052] When formulating the above pharmaceutical composition, it is prepared using diluents or excipients such as fillers, bulking agents, binders, wetting agents, disintegrating agents, and surfactants that are commonly used. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspensions may include vegetable oils such as propylene glycol, polyethylene glycol, olive oil, and injectable esters such as ethyl oleate. Suppository bases may include Witepsol, macrogol, Tween 61, cacao butter, liurin butter, and glycerogelatin.

[0053] The pharmaceutical composition may contain carbohydrates such as glucose, sucrose or dextran, antioxidants such as ascorbic acid or glutathione, chelating agents, low-molecular-weight proteins or other stabilizers to increase stability or absorbability.

[0054] In another specific embodiment of the present invention, the pharmaceutical composition may be a skin external application composition for promoting hair growth or preventing hair loss.

[0055] The above-mentioned skin external preparation may be a cream, gel, ointment, skin emulsifier, skin suspension, transdermal patch, lotion, or a combination thereof. The above-mentioned skin external preparation may be appropriately mixed with ingredients commonly used in skin external preparations such as cosmetics or medicines, such as aqueous ingredients, oily ingredients, powder ingredients, alcohols, moisturizers, thickeners, UV absorbers, whitening agents, preservatives, antioxidants, surfactants, fragrances, colorants, various skin nutrients, or a combination thereof, as needed. The above skin external preparation may also appropriately contain metal sequestrants such as sodium edetate, trisodium edetate, sodium citrate, sodium polyphosphate, sodium metaphosphate, and gluconic acid; caffeine, tannin, bellapamil, licorice extract, glabridin, various herbal medicines, tocopherol acetate, glycyrrhizic acid, tranexamic acid and derivatives or salts thereof; and sugars such as vitamin C, magnesium ascorbic acid phosphate, ascorbic acid glucoside, arbutin, kojic acid, glucose, fructose, and trehalose.

[0056] The skin external application composition according to the present invention may contain 0.00001 wt% to 80 wt% of a microorganism, its lysate, culture solution or extract based on the total weight of the composition.

[0057] The above skin includes all skin areas of the body, including the face, hands, arms, legs, feet, chest, stomach, back, buttocks, and scalp.

[0058] Another aspect of the present invention provides a method for preventing, improving, or treating a condition of a subject, comprising administering or applying to the subject a microorganism of the genus Sphingomonas (particularly Sphingomonas olei), or a lysate, culture, or extract thereof.

[0059] The condition of the above object may be a condition requiring promotion of hair growth or prevention of hair loss.

[0060] The terms "administering," "applying," "introducing," and "implanting" are used interchangeably herein and may refer to placement of a composition according to one embodiment into a subject by a method or route that results in at least partial localization of the composition to a desired site according to one embodiment.

[0061] Administration can be administered by any method known in the art. Administration can be administered directly to the subject by any means, including intravenous, intramuscular, oral, transdermal, mucosal, nasal, intratracheal, or subcutaneous administration. Administration can be systemic or local.

[0062] The subject may be a mammal, such as a human, cow, horse, pig, dog, sheep, goat, or cat. The subject may be an individual in need of hair growth promotion or hair loss prevention.

[0063] The above administration is 0.00001 mg to 1,000 mg of the composition according to one specific example per subject per day, for example, 0.00001 mg to 500 mg, 0.00001 mg to 100 mg, 0.00001 mg to 50 mg, 0.00001 mg to 25 mg, 1 mg to 1,000 mg, 1 mg to 500 mg, 1 mg to 100 mg, 1 mg to 50 mg, 1 mg to 25 mg, 5 mg to 1,000 mg, 5 mg to 500 mg, 5 mg to 100 mg, 5 mg to 50 mg, 5 mg to 25 mg, 10 mg to 1,000 mg, 10 mg to 500 mg, 10 mg to 100 mg, 10 mg to 50 mg, Or it may be administered 10 mg to 25 mg. However, the dosage may be prescribed in various ways depending on factors such as the formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and response sensitivity, and a person of ordinary skill in the art can appropriately adjust the dosage by considering these factors. The frequency of administration may be once a day or twice or more within the range of clinically acceptable side effects, and the administration site may be administered in one or more sites, and the total number of administration days may be from 1 to 30 days per treatment, daily or at intervals of 2 to 5 days. If necessary, the same treatment may be repeated after an appropriate period. For animals other than humans, the same dosage as for humans per kg may be administered, or the above dosage may be converted into an amount based on the volume ratio (e.g., average value) of the organs (heart, etc.) of the target animal and humans.

[0064] In addition, the present invention provides a composition comprising a microorganism of the genus Sphingomonas (particularly Sphingomonas olei), or a lysate, culture solution or extract thereof, for use in promoting hair growth or preventing hair loss.

[0065] Another aspect of the present invention provides a method for promoting hair growth or preventing hair loss, comprising treating a subject with a microorganism of the genus Sphingomonas (particularly Sphingomonas olei), or a lysate, culture or extract thereof.

[0066] At this time, the description of the microorganisms of the genus Sphingomonas (particularly Sphingomonas olei), or their lysates, culture solutions and extracts, and their hair growth promoting or hair loss preventing activities are as described above.

[0067] Methods for treating an individual with microorganisms of the genus Sphingomonas (particularly Sphingomonas olei) or their lysates, culture solutions, or extracts can be appropriately used according to conventional methods well known to those skilled in the art in various fields requiring promotion of hair growth or prevention of hair loss. The amount of treatment with microorganisms of the genus Sphingomonas (particularly Sphingomonas olei) or their lysates, culture solutions, or extracts can be appropriately determined depending on the intended use.

[0068] In another specific embodiment of the present invention, a composition for promoting hair growth or preventing hair loss, comprising a microorganism of the genus Sphingomonas (particularly Sphingomonas olei), or a lysate, culture solution or extract thereof, may be a quasi-drug composition.

[0069] In this specification, the term "quasi-drug" means a product that is used for the purpose of diagnosing, treating, improving, alleviating, managing or preventing diseases of humans or animals, and has a milder effect than a drug. For example, according to the Pharmaceutical Affairs Act, a quasi-drug is a product excluding products used for the purpose of drugs, and includes fiber and rubber products used for the treatment or prevention of diseases of humans or animals, products that have a mild or no direct effect on the human body, are not instruments or machines or similar thereto, and sterilizers and insecticides for preventing infectious diseases.

[0070] The type or formulation of the pharmaceutical composition of the present invention is not particularly limited, but may be a bandage, gauze, cotton, adhesive bandage, disinfectant, shower foam, gargle, wet tissue, detergent soap, hand wash, humidifier filler, mask, or filter filler.

[0071] When the composition of the present invention is included in an over-the-counter drug for the purpose of promoting hair growth or preventing hair loss, the composition may be used as is or in combination with other over-the-counter drug ingredients, and may be used appropriately according to a conventional method. The mixing amount of the active ingredients may be appropriately determined depending on the intended use, and the over-the-counter drug composition according to the present invention may contain 0.01 wt% to 20 wt% of microorganisms, their lysates, cultures, or extracts based on the total weight of the composition.

[0072] In another specific embodiment of the present invention, a composition for promoting hair growth or preventing hair loss, comprising a microorganism of the genus Sphingomonas (particularly Sphingomonas olei), or a lysate, culture solution or extract thereof, may be a health functional food composition.

[0073] The above health functional food composition may be used alone or in combination with other foods or food ingredients, and may be used by conventional methods, including using microorganisms of the genus Sphingomonas (particularly Sphingomonas olei) or their lysates, culture solutions, or extracts. The amount of the active ingredients may be appropriately determined depending on the intended use (prevention, health, or therapeutic treatment). Generally, when manufacturing a food or beverage, the composition of the present specification may be added in an amount of 15 parts by weight or less relative to the raw materials.

[0074] There are no specific restrictions on the types of the above health functional foods. Examples of foods to which the above substances can be added include formulations selected from the group consisting of powders, granules, tablets, capsules, pills, gels, jellies, suspensions, emulsions, syrups, tea bags, infused teas, and health drinks, and include all health foods in the conventional sense. Among the types of health functional foods, beverage compositions may contain various flavorings or natural carbohydrates as additional ingredients, just like conventional beverages.

[0075] The above natural carbohydrates include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As a sweetener, a natural sweetener such as thaumatin and stevia extract, or a synthetic sweetener such as saccharin or aspartame can be used. The above health food composition may also contain a nutrient, a vitamin, an electrolyte, a flavoring agent, a coloring agent, a pectic acid and its salts, an alginic acid and its salts, an organic acid, a protective colloid thickener, a pH adjusting agent, a stabilizer, a preservative, glycerin, alcohol, a carbonating agent used in carbonated beverages, or a combination thereof. The above health functional food composition may also contain fruit pulp for the production of natural fruit juice, fruit juice beverage, or vegetable beverage, or a combination thereof.

[0076] Another aspect of the present invention provides a Sphingomonas olei strain deposited under accession number KACC 81320BP or KACC 81321BP.

[0077] The Sphingomonas olei strain deposited with accession number KACC 81320BP may include 16S rRNA of sequence number 2, and the Sphingomonas olei strain deposited with accession number KACC 81321BP may include 16S rRNA of sequence number 3.

[0078] The above Sphingomonas olei strain can promote hair length growth or increase the expression of one or more growth-promoting factors of hair follicle cells, such as IGF-1, VEGF, HGF, PDGFA, and FGF7. Therefore, the above Sphingomonas olei strain can be used for hair growth promotion or hair loss prevention.

[0079] Another aspect of the present invention provides a lysate, culture solution, or extract of the Sphingomonas olei strain.

[0080] The description of the above Sphingomonas olei strain, its lysate and culture medium is as described above.

[0081] The lysate, culture medium, or extract of the above Sphingomonas olei strain can promote hair length growth or increase the expression of one or more growth-promoting factors of hair follicle cells, such as IGF-1, VEGF, HGF, PDGFA, and FGF7. Therefore, the lysate, culture medium, or extract of the above Sphingomonas olei strain can be used for promoting hair growth or preventing hair loss.

[0082]

[0083] A composition comprising a microorganism of the genus Sphingomonas (particularly Sphingomonas olei) or a lysate, culture solution or extract thereof according to one aspect of the present invention can be usefully used for promoting hair growth or preventing hair loss by increasing the growth rate of hair length and increasing the expression of growth-promoting factors of hair follicle cells.

[0084]

[0085] Figure 1 shows the hair growth effect of Sphingomonas olei culture using human hair follicle organ culture. It is a graph showing the results of measuring the length of hair grown on the 2nd and 4th days after treating human hair follicle tissue with 4% (v / v) of Sphingomonas olei culture.

[0086] Figure 2 is a photograph showing the hair growth effect of Sphingomonas olei culture using human hair follicle organ culture. It is a photograph of hair on the 6th day after treating human hair follicle tissue with 4% (v / v) of Sphingomonas olei culture.

[0087] Figure 3 shows the results of confirming cytotoxicity after treating human breast papilla cells with 0.2%, 0.4%, or 1% (v / v) of Sphingomonas olei culture solution.

[0088] Figure 4 is a graph showing the results of real-time PCR analysis of the expression levels of hair follicle growth factors IGF-1, VEGF, HGF, PDGFA, and FGF7 48 hours after treatment of 0.4% or 0.8% (v / v) of Sphingomonas olei culture solution in human hair papilla cells isolated from the human body.

[0089] Figure 5 is a graph showing the results of real-time PCR analysis of the relative expression level of hair follicle growth factor IGF-1 mRNA 24 hours after treatment with 1% culture of Sphingomonas olei strain in human hair papilla cells (CON, negative control (sterile distilled water); So-1, Sphingomonas olei KACC 81169BP; So-2, Sphingomonas olei KACC 81320BP; So-3, Sphingomonas olei KACC 81321BP).

[0090]

[0091] Hereinafter, the present invention will be described in more detail through examples. However, these examples are intended to exemplify the present invention, and the scope of the present invention is not limited by these examples.

[0092]

[0093] Example 1. Preparation of Sphingomonas olei culture solution

[0094] Sphingomonas olei KACC 81169BP strain was cultured in TSB medium at 34°C for 24 hours with stirring, and the strain culture was collected at the final point of the division phase (Log phase) of the growth curve. The culture was centrifuged at 6,000 rpm for 30 minutes and sterilized by filtration using a 0.2 μm filter. Evaluation and activity analysis were performed no longer than 1 day after preparation.

[0095]

[0096] Example 2. Evaluation of hair growth using Sphingomonas olei culture solution

[0097] To determine whether the Sphingomonas olei culture prepared in Example 1 promotes hair growth, human hair follicle organs were cultured and hair growth was evaluated.

[0098] First, hair follicles were isolated one by one from human hair follicle tissue, and the subcutaneous fat layer was removed as much as possible to prevent contamination with fibroblasts, which are dermal cells of the skin. 350 μL of Williams's E Medium containing 2 mM L-glutamine, 10 μg / mL insulin, 10 ng / mL hydrocortisone, 100 μg / mL streptomycin, and 100 U / mL penicillin was added to each well of a 48-well plate, and one hair follicle was placed per well and cultured in a 37°C, 5% CO2 cell incubator. Eight hair follicles were used per experimental group, and the culture medium was replaced every two days with the Sphingomonas olei culture solution. The Sphingomonas olei culture solution was treated at a concentration of 4%, and sterile distilled water was used for the negative control group. Length measurements were taken from each hair follicle before adding the Sphingomonas olei culture medium, using this as a reference point. Hair length was measured every two days, and the reference point length was used as the hair growth length. The results are shown in Figures 1 and 2.

[0099] Figure 1 is a graph showing the results of measuring the length grown on the 2nd and 4th days after treating human hair follicle tissue with a 4% (v / v) Sphingomonas olei culture solution.

[0100] Figure 1 shows that, compared to the negative control group, the length of hair follicles in the Sphingomonas olei culture treatment group grew approximately 20% more on days 2 and 4. Therefore, it was confirmed that the Sphingomonas olei culture was effective in early hair follicle growth.

[0101] Figure 2 is a photograph of hair taken on the 6th day after treating human hair follicle tissue with a 4% (v / v) Sphingomonas olei culture solution.

[0102] From the above figures 1 and 2, it can be seen that when treated with Sphingomonas olei culture solution, hair growth was promoted and the hair grew longer compared to the control group.

[0103]

[0104] Example 3. Evaluation of cytotoxicity of Sphingomonas olei culture solution

[0105] A cytotoxicity test was performed to determine whether the Sphingomonas olei culture solution prepared in Example 1 could exhibit toxicity to cells.

[0106] Specifically, dermal papilla (DP) cells from human hair follicles were seeded at 2x10 in 96-well plates. 4After dispensing cells / well, they were cultured in DMEM medium (Dubelcco's modified eagle medium) containing 0.25% fetal bovine serum (FBS), 100 μg / mL streptomycin, and 100 U / mL penicillin in a 5% CO2 incubator at 37°C. After 24 hours of culture under the same conditions, Sphingomonas olei culture was treated at concentrations of 0.2%, 0.4%, and 1% (v / v) and cultured for an additional 48 hours. At this time, the group treated with sterile distilled water (DW) instead of the culture medium was used as a negative control, and the total volume per well was 100 μL. After that, 10 μL of WST-1 reagent was added to each cell culture well and cultured for an additional 4 hours under the same conditions, and the absorbance was measured at 450 nm, and the results are shown in Fig. 3.

[0107] Figure 3 is a graph showing the results of evaluating the viability of human breast papilla cells according to treatment with the Sphingomonas olei culture solution prepared in Example 1 using the WST-1 assay.

[0108] As shown in Fig. 3, treatment with 0.2%, 0.4%, and 1% (v / v) Sphingomonas olei culture solution had little effect on cell growth and toxicity compared to the negative control group. From this, it can be confirmed that the Sphingomonas olei culture solution prepared in Example 1 did not exhibit toxicity to cells.

[0109]

[0110] Example 4. Analysis of hair follicle growth factor expression using Sphingomonas olei culture solution.

[0111] In order to evaluate the effect of the Sphingomonas olei culture solution prepared in Example 1 on hair follicle growth factors, the expression of growth factors such as insulin-like growth factor 1 (IGF-1), vascular endothelial growth factor (VEGF), hepatocyte growth factor (HGF), platelet-derived growth factor subunit A (PDGFA), and fibroblast growth factor 7 (FGF7) in dermal papilla (DP) cells of hair follicles was analyzed.

[0112] Specifically, human dermal papilla cells were cultured in DMEM medium containing 0.25% bovine serum, 100 μg / mL streptomycin, and 100 U / mL penicillin in a 5% CO2 incubator at 37°C in 6-well plates. When the cells reached 80–90% of the plate area, the medium was replaced and cultured under the same conditions for 24 h. Then, Sphingomonas olei culture was treated at concentrations of 0.4% and 0.8% (v / v) and cultured for an additional 48 h. Sterile distilled water was used as a negative control. RNA was extracted using Trizol, and cDNA was synthesized using 2 μg of RNA each. Real-time PCR was performed for the target gene using the synthesized cDNA as a template. At this time, the hair follicle cell growth factors IGF-1, VEGF, HGF, PDGFA, and FGF7 genes were used as target genes, and the expression levels of the genes were finally analyzed through correction for the 36B4 gene, and the results are shown in Figure 4.

[0113] Figure 4 is a graph showing the results of real-time PCR analysis of the relative expression levels of mRNA of hair follicle growth factors IGF-1, VEGF, HGF, PDGFA, and FGF7 48 hours after treatment of 0.4% or 0.8% (v / v) of Sphingomonas olei culture solution in human hair papilla cells isolated from the human body.

[0114] As shown in Fig. 4, the expression of IGF-1, VEGF, HGF, PDGFA, and FGF7 increased compared to the negative control group when treated with 0.4% or 0.8% Sphingomonas olei culture solution, and in particular, the expression of IGF-1, VEGF, HGF, PDGFA, and FGF7 significantly increased compared to the control group when treated with 0.8% Sphingomonas olei culture solution. Therefore, it can be seen that Sphingomonas olei culture solution promotes the expression of hair follicle growth factors.

[0115]

[0116] Example 5. Analysis of hair follicle growth factor expression by various Sphingomonas olei strain cultures.

[0117] In order to determine whether other Sphingomonas olei strains besides the Sphingomonas olei KACC 81169BP strain have hair growth-promoting effects, the expression of IGF-1, a representative growth factor that is most strongly expressed in the growth phase of dermal papilla cells and induces cell proliferation, was analyzed for several types of Sphingomonas olei strains.

[0118] In this example, in addition to the Sphingomonas olei KACC 81169BP strain used in Examples 1 to 4, two strains (KACC 81320BP and KACC 81321BP) isolated from the skin of a healthy Korean person and identified as Sphingomonas olei through analysis of 16S rRNA sequences were used. The Sphingomonas olei KACC 81169BP, KACC 81320BP, and KACC 81321BP strains have the 16S rRNA sequences of SEQ ID NOs: 1 to 3, respectively.

[0119]

[0120] 설명서열서열번호KACC 81169BP16S rRNAGAGCGCAACCCTCGCCTTTAGTTACCATCATTTAGTTGGGTACTCTAAAGGAACCGCCGGTGATAAGCCGGAGGAAGGTGGGGATGACGTCAAGTCCTCATGGCCCTTACGCGCTGGGCTACACACGTGCTACAATGGCAACTACAGTGGGCAGCAATCCCGCGAGGGTGAGCTAATCTCCAAAAGTTGTCTCAGTTCGGATTGTTCTCTGCAACTCGAGAGCATGAAGGCGGAATCGCTAGTAATCGCGGATCAGCATGCCGCGGTGAATACGTTCCCAGGCCTTGTACACACCGCCCGTCACACCATGGGAGTTGGATTCACCCGAAGGCGTCGCGCTAACCGCAAGGAGGCAGGCGACCACGGTGGGTTTAGCGACTGGGGTGA1KACC 81320BP 16S rRNAAACGAGCGCAACCCTCGCCTTTAGTTACCATCATTTAGTTGGGTACTCTAAAGGAACCGCCGGTGATAAGCCGGAGGAAGGTGGGGGATGACGTCAAGTCCTCATGGCCCTTACGCGCTGGGCTACACACGTGCTACAATGGCAACTACAGTGGGCAGCAATCCCGCGAGGGTGAGCTAATCTCCAAAAGTTGTCTCAGTTCGGATTGTTCTCTGCAACTCGAGAGCATGAAGGCGGAATCGCTAGTAATCGCGGATCAGCATGCCGCGGTGAATACGTTCCCAGGCCTTGTACACACCGCCCGTCACACCATGGGGAGTTGGATTCACCCGAAGGCGTCGCGCTAACCGCAAGGAGGCAGGCGACCACGGTGGGTTTAGCGACTGGGGTGAA2KACC 81321BP 16SrRNAAACCGCCGGTGATAAGCCGGAGGAAGGTGGGGATGACGTCAAGTCCTCATGGCCCTTACGCGCTGGGCTACACACGTGCTACAATGGCAACTACAGTGGGCAGCAATCCCGCGAGGGTGAGCTAATCTCCAAAAGTTGTCTCAGTTTCGGATTGTTCTCTGCAACTCG AGAGCATGAAGGCGGAAATCGCTAGTAATCGCGGATCAGCATGCCGCGGTGAATACGTTCCCAGGCCTTGTACACACCGCCCGTCACACCATGGGAGTTGGATTCACCCGAAGGCGTCGCGCTAACCGCAAGGAGGCAGGCGACCACGGTGGGTTTAGCGACTGGGGTGAA3

[0121] Specifically, human dermal papilla cells were cultured in a 6-well plate in DMEM medium containing 10% FBS (Fatal calf serum), 100 μg / mL streptomycin, and 100 U / mL penicillin using the same method as in Example 1 in a 5% CO2 incubator at 37°C. When the cells reached 80-90% of the plate area, the medium was replaced with 0.25% FBS-DMEM and cultured under the same conditions for 24 hours, then treated with Sphingomonas olei culture medium at a concentration of 1% (v / v) and cultured for an additional 24 hours. Sterile distilled water was used as a negative control. After RNA was extracted using Trizol, cDNA was synthesized using 1 μg of total RNA each. Real-time PCR was performed on the IGF-1 gene using the synthesized cDNA as a template. At this time, the expression level of the gene was finally analyzed through correction for the 36B4 gene, and the results are shown in Figure 5.

[0122] Figure 5 is a graph showing the results of real-time PCR analysis of the relative expression level of hair follicle growth factor IGF-1 mRNA 24 hours after treatment with 1% culture of Sphingomonas olei strain in human hair papilla cells (CON, negative control (sterile distilled water); So-1, Sphingomonas olei KACC 81169BP; So-2, Sphingomonas olei KACC 81320BP; So-3, Sphingomonas olei KACC 81321BP).

[0123] As shown in Fig. 5, all three culture groups treated with Sphingomonas olei strains showed at least a 1.5-fold increase in IGF-1 expression compared to the negative control group, and the results were statistically significant (*p<0.05; **p<0.005 compared to the negative control group). These results indicate that Sphingomonas olei strains themselves promote the expression of hair follicle growth factors (e.g., IGF-1), and are therefore effective in promoting hair growth.

[0124]

[0125]

[0126]

Claims

1. A composition for promoting hair growth or preventing hair loss, comprising Sphingomonas olei, or a lysate, culture solution or extract thereof.

2. A composition according to claim 1, wherein Sphingomonas olei is a Sphingomonas olei strain deposited under accession number KACC 81169BP, KACC 81320BP, or KACC 81321BP.

3. A composition according to claim 1 or 2, wherein Sphingomonas olei, or a lysate, culture medium or extract thereof, promotes hair length growth or increases the expression of one or more of insulin-like growth factor 1 (IGF-1), vascular endothelial growth factor (VEGF), hepatocyte growth factor (HGF), platelet-derived growth factor subunit A (PDGFA) and fibroblast growth factor 7 (FGF7).

4. A composition according to any one of claims 1 to 3, wherein the composition is used as a cosmetic, a pharmaceutical, a skin external preparation, a quasi-drug, or a health functional food.

5. A method for promoting hair growth or preventing hair loss, comprising administering to a subject Sphingomonas olei, or a lysate, culture or extract thereof.

6. A composition comprising Sphingomonas olei, or a lysate, culture or extract thereof, for use in promoting hair growth or preventing hair loss.

7. Sphingomonas olei strain deposited under accession number KACC 81320BP or KACC 81321BP.

8. A lysate of the strain according to claim 7.

9. Culture medium of the strain according to claim 7.

10. An extract of the strain according to claim 7.

Images