Genetic adjuvants for vaccines
Incorporating mRNA genetic adjuvants encoding chemokines like CXCL13 optimizes mRNA vaccines, enhancing antibody responses and inducing long-lived immune memory, addressing the waning immunity issue in current mRNA vaccines.
Patent Information
- Application Number
- PCT/US2025/034467
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-06-20
- Filing Date
- 2025-06-20
- Publication Date
- 2025-12-26
AI Technical Summary
Current mRNA vaccines face challenges with antibody and cellular responses waning over time, necessitating multiple booster doses to maintain protective immunity, and existing adjuvants do not efficiently exploit necessary immune pathways for durable protection.
Incorporation of mRNA genetic adjuvants encoding chemokines or cytokines, such as CXCL13, to enhance antibody and memory responses by optimizing variables like polyA tail length, modified nucleotides, protein length, and adjuvant dose, delivered via lipid nanoparticles.
Enhances antibody responses and induces long-lived plasma cells and cellular memory responses, improving the durability and efficacy of mRNA vaccines.
Smart Images

Figure IMGF000059_0001 
Figure IMGF000059_0002 
Figure IMGF000059_0003
Abstract
Description
Attorney Docket Number: WVU 3065-PCT GENETIC ADJUVANTS FOR VACCINES TECHNICAL FIELD
[0001] Various embodiments disclosed herein relate generally to genetic adjuvants to potentiate an immune response to a vaccine. The vaccine may be an mRNA, protein, peptide, protein fragment, protein sub-unit, or live-attenuated vaccine. BACKGROUND
[0002] The implementation of vaccination practices worldwide was invaluable to global efforts to control the spread of infectious diseases. Vaccines for some diseases, such as polio and smallpox, were able to nearly eradicate cases. Innovations within the field of vaccinology over the course of the last century have revolutionized the way vaccines are formulated, improving their effectivity. These included gaining an understanding of how purified antigens can be produced at a large scale without contamination, methods of attenuating live pathogens to avoid adverse reactions, and the engineering of conjugate particles to improve the immunogenicity of peptide antigens. Over time, scientists have revisited the vaccines being utilized by the general public, gradually improving them to use current technology and update the antigens to match clinically relevant strains of the target pathogen.
[0003] Although vaccines go through rigorous testing and clinical trials to ensure their efficacy prior to their approval and use, variations in individual hosts’ immune responses ultimately affect outcomes. Vaccines are largely formulated with a “one size fits most” application in mind—the only variations being made for infants or children. Host immunity can be affected by a range of factors from biological sex to age or preexisting metabolic conditions. Many groups have supported the suggestion that vaccines can be formulated with a degree of personalization to ensure their efficacy across patient demographics. Dose volume, antigen load, or adjuvants could all be manipulated to garner an inflammatory response that confers durable immune memory.
[0004] Before the process of improving a vaccine can even begin, the correlates of protection must be well understood. Vaccines differentially activate humoral and cellular components of the immune system and vary in the cell types required to ultimately mediate immunity. Accordingly, thisAttorney Docket Number: WVU 3065-PCT means that each vaccine upon administration employs its own unique immune signature of cytokine and chemokine signaling molecules to engage a complex milieu of local and systemic inflammatory events. Adjuvants have long been used to increase the activation of inflammatory pathways involved in the response to a vaccine. Many of these compounds, however, act in a nonspecific manner, and may not efficiently exploit the necessary pathways required for generating protection. With this in mind, the field of systems vaccinology has been growing, approaching vaccine innovation from an immune signatures-profiling approach to identify targets for novel adjuvants.
[0005] mRNA vaccines represent a major step forward in vaccinology and mRNA technology is poised to be applied to current and future challenges; however, there is room for significant improvement of the platform. The “adjuvanticity” of mRNA vaccines is attributed to both the innate sensing of the presence of mRNA, and the proinflammatory properties of the lipids forming the nanoparticle delivery vessel. Even though immunity induced by mRNA vaccination is remarkably robust, antibody and cellular responses wane over time, necessitating additional booster to maintain protective immunity. This phenomenon was observed in the case of COVID-19 mRNA vaccines, where antibody levels in the blood serum decrease over time. Currently, three doses of vaccine are needed to induce expansion of the B memory cell compartment specific to Spike antigen, and still, protection from these memory cells is short lived.
[0006] Novel mRNA vaccines against pertussis, have also been developed, including an mRNA combo vaccine for bacterial diseases (diphtheria, tetanus, and pertussis). The mRNA-DTP10 experimental vaccine is protective in toxin and bacterial challenge studies. However, all mRNA vaccines (COVID-19 and mRNA-DTP10) show decreasing antibody levels over time. These observations mirror what is observed in humans immunized with mRNA COVID-19 vaccines. To move the field of vaccinology forward and improve mRNA vaccine memory responses, mRNA genetic adjuvants may be used to enhance antibody levels, produce long-lived plasma cells, and increase cellular memory responses (memory T, B, and T follicular helper cells; Tfh) resulting from vaccines. Adjuvants represent perhaps the most logical component of any vaccine that can be easily manipulated to enhance efficacy, potency, or longevity.Attorney Docket Number: WVU 3065-PCT SUMMARY
[0007] In light of the present need for improved adjuvants for mRNA vaccines, a brief summary of various embodiments is presented. Some simplifications and omissions may be made in the following summary, which is intended to highlight and introduce some aspects of the disclosed subject matter, but not to limit the scope of the invention. Detailed descriptions of certain embodiments adequate to allow those of ordinary skill in the art to make and use the subject matter disclosed herein will follow in later sections.
[0008] Various embodiments disclosed herein relate to inclusion of a mRNA genetic adjuvant encoding chemokine or cytokine immune signal peptides in a vaccine formulation. The mRNA genetic adjuvant may improve antibody and memory responses to mRNA immunization. For example, mRNA encoding the chemokine CXCL13 may be used as a genetic adjuvant that enhances antibody responses when co-administered with mRNA vaccines. Inclusion of CXCL13 with 0.3 µg of mRNA-1273 results in antibody responses equal to 5 µg mRNA-1273 alone, effectively improving the antibody response by 10-fold. CXCL13, which is produced by germinal center B cells, Tfh cells, and follicular dendric cells during germinal center formation, is known to be a biomarker of broadly neutralizing humoral responses against pathogens such as HIV. CXCL13 is highly expressed in humans during times of high antibody production such as during SARS-CoV-2 infection. These CXCL13 levels correlate to longevity of antibody responses and induction of memory B cells following whole cell pertussis vaccine (DTP) immunization.
[0009] CXCL13 can be used as a genetic adjuvant to enhance mRNA vaccine efficacy and memory responses. An mRNA encoding CXCL13 enhances humoral responses to mRNA encoded antigen. The mechanisms of protection of CXCL13 -adjuvanted mRNA vaccines expressing viral or bacterial antigens are disclosed herein.
[0010] In various embodiments, a genetic adjuvant is combined with an mRNA vaccine. mRNA vaccines formulated with CXCL13 genetic adjuvant may be improved by optimizing a CXCL13 genetic adjuvant for expression and immunogenicity. Lipid nanoparticles (LNPs) encapsulating CXCL13 genetic adjuvant mRNA may be used to optimize their immunogenic potential in the context of coadministration with three model mRNA antigens. Key variables to optimize include: 1) polyA tail length,Attorney Docket Number: WVU 3065-PCT 2) percent substitution using modified nucleotides, 3) protein length of Cxcl13, and 4) adjuvant dose.
[0011] The protective capacity of CXCL13-mRNA adjuvanted viral and bacterial mRNA vaccines will be evaluated in experimental challenge models. Expression of Cxcl13-mRNA genetic adjuvant may enhance vaccine protection against viral or bacterial infection. Animals will be immunized with CXCL13-adjuvanted mRNA vaccines encoding viral antigens, e.g., SARS-CoV-2 RBD antigen, or bacterial antigens, e.g., pertussis antigens, or mRNA vaccines encoding viral or bacterial antigens alone. The animals then will be challenged with a pathogen or a toxin to evaluate the protective capacity and immune correlates from a combination of an mRNA genetic adjuvant and an mRNA vaccine, or from an mRNA vaccine alone.
[0012] In various embodiments, a genetic adjuvant may be combined with a vaccine containing a biopolymer or an attenuated or inactivated pathogen as an antigen. The vaccine may contain a bacterial polysaccharide; a bacterial or viral protein, peptide, protein fragment, or protein sub-unit; an attenuated or inactivated virus, or an attenuated or inactivated bacteria as an antigen. The genetic adjuvant may potentiate the effect of the biopolymer antigen or the attenuated or inactivated pathogen antigen.
[0013] Various embodiments disclosed herein relate to investigations of the correlates of protection of COVID-19 mRNA vaccines in laboratory mouse models. Neutralizing antibodies are an important correlate of protection for these vaccines, however, levels of these antibodies wane over time necessitating additional booster doses and antigen modifications to maintain protection against evolving strains of the SARS-CoV-2 virus. Groups of K18-hACE2 mice were vaccinated with a titration of mRNA-1273 and tracked changes in their antibody levels over time before performing viral challenge experiments to correlate antibody profiles with protection. The immune responses resulting early after vaccine administration in C57BL6 mice (backbone of K18-hACE2 transgenic strain) were examined to identify the potential predictive immune signatures of protective antibody responses. These results were used to inform preliminary studies using chemokine- encoding genetic adjuvants that boosted antibody responses to low doses of mRNA antigens.Attorney Docket Number: WVU 3065-PCT
[0014] Various embodiments relate to a method for inducing an immune response in a subject by administering to the subject an mRNA construct comprising an adjuvant coding sequence, wherein the first coding sequence encodes a chemokine, a cytokine, or a fragment thereof; and an antigen or a nucleotide sequence encoding an antigen. The antigen may be: an exogenous antigen from a virus, bacteria, pollen, a parasite, or fungi; an endogenous antigen; an autoantigen; or a tumor antigen. The chemokine may be selected from the group consisting of a CXC chemokine, a CC chemokine, a CX3C chemokine, and a C chemokine.
[0015] Various embodiments relate to a method for inducing an immune response in a subject by administering to the subject an mRNA construct comprising an adjuvant coding sequence, wherein the first coding sequence encodes a homeostatic chemokine or a fragment thereof; and a second antigen mRNA construct comprising second coding sequence, wherein the second coding sequence encodes an antigen. The homeostatic chemokine may be selected from the group consisting of a CXC chemokine, a CC chemokine, a CX3C chemokine, and a C chemokine.
[0016] In various embodiments, the homeostatic chemokine is a CXC chemokine selected from the group consisting of: a CXC chemokine which binds to a receptor selected from the group consisting of CXCR1 and CXCR2, and induces the migration of neutrophils to a target site; and a CXC chemokine which binds to a receptor selected from the group consisting of CXCR3, CXCR4, CXCR5, CXCR6, CXCR7, and CXCR8, and induces the migration of lymphocytes to a target site. The CXC chemokine may bind to the CXCR3 receptor, and induce the migration of T lymphocytes to a target site, wherein the chemokine binding to the CXCR3 receptor is CXCL9, CXCL10, CXCL11, and / or CXCL14. The CXC chemokine may bind to the CXCR5 receptor, and induces the migration of B lymphocytes to a lymph node, wherein the chemokine binding to the CXCR5 receptor is CXCL13.
[0017] Various embodiments relate to a method for inducing an immune response in a subject by administering to the subject a first mRNA construct comprising a first coding sequence, wherein theAttorney Docket Number: WVU 3065-PCT first coding sequence encodes a homeostatic chemokine or a fragment thereof; and a second antigen mRNA construct comprising a second coding sequence, wherein the second coding sequence encodes an antigen. The mRNA constructs may comprise the coding sequence which encodes the homeostatic chemokine; a 5’ untranslated region (5’ UTR) upstream of the coding sequence; a 3’ untranslated region (3’ UTR) downstream of the first coding sequence; a promoter upstream of the 5’ UTR; and a chain of adenosine monophosphate moieties [poly(A) tail] downstream of the 3’ UTR.
[0018] Various embodiments relate to a method for inducing an immune response in a subject by administering to the subject a first mRNA construct comprising a first coding sequence, wherein the first coding sequence encodes a homeostatic chemokine or a fragment thereof; and a second antigen mRNA construct comprising a second coding sequence, wherein the second coding sequence encodes an antigen. The immune response may be induced against infection by an infectious agent, e.g., a microbe or virus, by using an mRNA construct comprising a coding sequence which encodes a protein expressed by the infectious agent as the second antigen mRNA construct.
[0019] Various embodiments relate to a method for inducing an immune response in a subject by administering to the subject a first mRNA construct comprising a first coding sequence, wherein the first coding sequence encodes a homeostatic chemokine or a fragment thereof; and a second antigen mRNA construct comprising a second coding sequence, wherein the second coding sequence encodes an antigen. The immune response may be induced against a cancer cell by using an mRNA construct comprising a coding sequence which encodes a protein expressed by the cancer cell as the second antigen mRNA construct.
[0020] Various embodiments disclosed herein relate to a method for inducing an immune response in a subject, by administering to the subject a first mRNA construct comprising a first coding sequence, wherein the first coding sequence encodes a cytokine; and a second antigen mRNA construct comprising a second coding sequence, wherein the second coding sequence encodes an antigen. The cytokine may be a monomeric peptide, a peptide homodimer, or a fragment thereof. The cytokine may be: a cytokine of a TNF family; a cytokine of a type I cytokine family;Attorney Docket Number: WVU 3065-PCT a cytokine of a type II cytokine family; a cytokine of an interleukin-1 (IL-1) cytokine family; a cytokine of an interleukin-17 (IL-17) cytokine family; or a cytokine selected from the group consisting of interleukin-16 (IL-16), interleukin-34 (IL- 34), colony stimulating factor 1 (CSF-1), transforming growth factor beta (TGF-β), and macrophage migration inhibitory factor (MIF).
[0021] Various embodiments disclosed herein relate to a method for identifying a genetic adjuvant which potentiates an immune response to a target antigen, by exposing a first group of B lymphocytes or T lymphocytes to a first mRNA construct comprising a first coding sequence, wherein the first coding sequence encodes a homeostatic chemokine or chemokine fragment, and a second mRNA construct comprising a second coding sequence, wherein the second coding sequence encodes the target antigen. A second group of B lymphocytes or T lymphocytes is exposed to the second mRNA construct in the absence of the first mRNA construct. A first expression level of the target antigen, or an antibody to the target antigen, in the first group of B lymphocytes or T lymphocytes is compared to a second expression level of the target antigen, or an antibody to the target antigen, in the second group of B lymphocytes or T lymphocytes. The first mRNA construct potentiates the immune response to the target antigen, either by increasing or decreasing the immune response to the antigen. DESCRIPTION OF THE DRAWINGS
[0022] FIG. 1A shows that response to whole cell pertussis vaccine (DTP) immunization is characterized by increased CXCL13 expression in serum.
[0023] FIG. 1B shows that production of CXCL10 is induced by mRNA-1273 and Cxcl10 mRNA in B16F10 cells.
[0024] FIG.1C shows that CXCL13 was highly expressed following DTP vaccination, but not DTaP vaccination.
[0025] FIGS.1D-1F show a dose response between CXCL10, CXCL13, and interferon-gamma levels in serum following vaccination.
[0026] FIG.1G shows analysis of cell populations in mice immunized using mRNA-1273.Attorney Docket Number: WVU 3065-PCT
[0027] FIGS.2A and 2B show that Cxcl13 is produced in response to high doses of a mRNA- DTP10 vaccine.
[0028] FIG.2C shows that mRNA sequences encoding the mouse Cxcl10 and Cxcl13 genes were (1) cloned into plasmid vectors, then (2) DNA templates were amplified by PCR and (3) used in in vitro transcription reactions to produce mRNA for delivery by (4) lipid nanoparticle.
[0029] FIG.3 shows a prototype genetic adjuvant. mRNA encoded Cxcl10 was co-administered with an mRNA vaccine to act as a genetic adjuvant to improve responses.
[0030] FIG. 4A shows co-expression of prototype Cxcl10 as a genetic adjuvant for mRNA vaccine immunization responses.
[0031] FIG.4B shows standard genetic elements of a prototype genetic adjuvant, Cxcl10-mRNA. Primers for DNA amplification are shown (pT7-F2 and pT7-R2). A T7 promoter is used to perform IVT. The mouse Cxcl10 coding sequence is flanked by stabilizing 5’ and 3’ UTRs. The 3’ UTR is flanked by the poly A tail for stability and purification.
[0032] FIGS. 5A to 5C show expression of mRNA-VDC-0002 Cxcl13 during immunization enhances anti-RBD antibody production by 4-fold.
[0033] FIG.6 shows production of a prototype genetic adjuvant Cxcl10-mRNA. DNA plasmids are used to produce linear DNA templates for in vitro transcription of RNA then used for formulation and packaging into LNPs for delivery.
[0034] FIG. 7 shows a mRNA genetic adjunct pipeline from DNA to in vitro transcription to packaging to use. mRNA vaccines are produced by in vitro transcription (IVT) from DNA templates amplified in E.coli.
[0035] FIG. 8 shows co-administration of mRNA genetic adjuvants to enhance T and B cell responses to drive specific immune profiles to protect against infectious diseases or treat cancer.
[0036] FIGS. 9A to 9C show bioluminescent tracking of mRNA expressing cells post intramuscular immunization.
[0037] FIGS. 10A to 10D show candidate genetic adjuvants for evaluation in an adjuvant discovery program. * Denotes more than one mouse ortholog exists; # denotes previous evaluation as a DNA genetic adjuvant.Attorney Docket Number: WVU 3065-PCT
[0038] FIG.11 shows cytokine families of the candidate genetic adjuvants. Cytokine families are categorized based on three-dimensional structural similarity of the receptors and further grouped according to their receptor subunits.
[0039] FIG.12 shows chemokine families of the candidate genetic adjuvants. Chemokines are classified into four families: C, CC, CXC and CX3C based on the spacing and the number of cysteine residues in their N terminus. These chemokines are further grouped depending on the main corresponding GPCR receptor binding partners.
[0040] FIG.13 shows establishment of the optimal pertussis vaccine dose to study improvements of vaccine-mediated protection. Panel A shows B. pertussis load in the lung of non-vaccinated mice (PBS), or mice immunized with increasing amounts of DTaP (human dose) 3 days after challenge. Panel B shows the amount of anti-PT antibodies in yellow. Effect of an added antigen (RTX) can be observed in A. *: p<0.05; **: p<0.01; ***: p<0.001 when compared to PBS (ANOVA).
[0041] FIG.14 shows detection of antibody concentration and affinity in serum. Detection of antibody binding to the SARS-CoV2 receptor binding domain. Figure depicts how antibody affinity (y axis) but not concentration (x axis) change after infection (depicted with arrows).
[0042] FIGS.15A to 15D show intravital imaging for analysis of cellular responses. FIG.15A: Intravital bioluminescence image of melanoma tumor using the macro imaging (Macro) and microscopy systems (2X & 20X). FIG.15B and 15C: Real-time imaging and quantification of tumor growth (fluorescence: dendra2 and bioluminescence: Firefly luciferase, FLuc) and luminol and L- 012 to quantify changes in MPO (myeloperoxidase) and ROS (reactive oxygen species) changes over time within the tumor microenvironment. FIG.15D: Intravital confocal microscopy of CD8+ T cells (purple) and neutrophils (red) within the tumor (green) microenvironment.
[0043] FIG.16 shows adjuvant or antigen mRNA reporter constructs. Three reporter constructs will be used: a bioluminescence Click beetle red (CBR) luciferase, fluorescence E2Crimson, and a bioluminescence and fluorescence CBR-E2Crimson reporter.
[0044] FIGS.17A to 17F show an investigation of mRNA vaccine dose-dependent anti-RBD antibody responses and protection against SARS-CoV-2 challenge in K18-hACE2 mice.
[0045] FIGS. 18A to 18G show single-cell RNA sequencing of mouse lymph nodes after COVID-19 mRNA vaccination. K18-hACE2 mice were vaccinated with 10 µg mRNA-1273 or PBSAttorney Docket Number: WVU 3065-PCT and euthanized 24 hours later to collect the draining lymph node (inguinal) for scRNAseq (n=1 mouse per group). FIG. 18A: UMAP of cell populations identified using the Honeycomb HIVE sequencing system. FIG. 18B: UMAP of cell identities is unique to PBS vaccination vs mRNA vaccination. FIG.18C: Percent makeup of cell types in PBS-vaccinated or mRNA-vaccinated lymph nodes, derived from single-cell data, showing the relative distribution of immune cell populations. FIG.18D: Percent expression of inflammatory cytokines and chemokines by cell type, as determined from single-cell sequencing data, providing insights into the specific cellular drivers of inflammation. C57BL / 6 mice were vaccinated with 10 µg mRNA-1273 or PBS and euthanized 24 or 48 hours later to measure CXCL10 expression in the (FIG.18E) muscle, (FIG.18F) draining lymph node (popliteal), and (FIG.18G) serum. Data points represent mean ± SD of n=5 mice per group. Statistical comparisons displayed were calculated against PBS: ***P<0.001, ****P<0.0001, ns=not significant.
[0046] FIGS.19A to 19H show analysis of CXCL10 responses in vaccinated mouse lymph nodes post-boost.8-week-old female K18-hACE2 mice were vaccinated with a titration curve of mRNA- 1273 doses then boosted 4 weeks later with an identical dose. FIG. 19A: Cohorts of mice were euthanized 24 hours after priming and boosting to analyze CXCL10 expression in the muscle-site draining lymph node. FIG.19B: Correlogram showing the relationship between serum IgG levels one week post-boost and CXCL10 expression in the lymph node 24 hours after administration. FIGS.19C to 19H: Flow cytometry analysis of immune cell populations in the draining lymph nodes of vaccinated mice euthanized 24 hours post-boost. (n=5 mice per group).
[0047] FIGS.20A to 20F show levels of immune cells in the lymph nodes of mice vaccinated with a high dose of mRNA-1273 vaccine, compared to PBS controls.
[0048] FIGS.21A to 21E show analysis of CXCL10 expression and antibody responses after vaccination in aged mice.75-week-old K18-hACE2 mice were vaccinated with 1.25 or 10 µg of mRNA-1273 in two doses spread 4 weeks apart. FIG.21A: Serum CXCL10 levels quantified 24 hours post prime or post boost in vaccinated aged mice. Dotted lines indicate CXCL10 levels quantified in 8-week mice vaccinated with low (1.25 µg) or high (10 µg) doses of mRNA-1273 at the same time point post-boost. FIG.21B: RBD IgG antibody levels measured by AUC A450 from ELISAs performed using serum collected from vaccinated mice 3 weeks post-boost. Grey dataAttorney Docket Number: WVU 3065-PCT points show antibody levels in young mice comparisons. FIG.21C: In vitro plaque neutralization assays were performed using dilutions of serum from vaccinated mice cultured with SARS-CoV-2 Omicron virus and Vero cells. Serum antibodies from vaccinated aged mice did not reduce viral plaque formation. FIGS.21D and 21E: Lung homogenates were collected from vaccinated mice after SARS-CoV-2 Omicron challenge to measure viral burden by plaque forming units (PFU).
[0049] FIGS. 22A to 22D show antibody responses to mRNA vaccine occur independent of CXCL10. C57BL / 6 (WT) and B6.129S4-Cxcl10tm1Adl / J (KO) mice were vaccinated with two 10ug doses of mRNA-12734 weeks apart. FIG.22A: WT, but not KO mice show serum CXCL10 expression profiles after vaccination that are higher 24 hours post-boost than 24 hours post-prime. FIGS. 22B and 22D: AUC A450 values from ELISAs performed using serial dilutions of serum collected from mice quantitating changes in WA-1 RBD IgG antibody levels over time (out to 48 weeks post-prime). FIG.22C: Area under the curve analysis of the change in IgG antibody levels over time in WT and KO animals shows no significant difference in total antibody levels over time. (One Way ANOVA with Dunnett’s Multiple Comparisons test).
[0050] FIGS. 23A to 23D show CXCL13 expression occurs in a dose-dependent manner following vaccination in young as well as old mice. FIGS.23A and 23B: CXCL13 expression in the lymph nodes and serum of 8 week old mice that were primed or primed and boosted with a titration of mRNA-1273 doses and euthanized 24 hours after priming or boosting. Fig.23C: Correlogram showing relationship between CXCL13 expression 24 hours post boost and antibody levels one week after boosting in vaccinated mice. FIG.23D: Serum CXCL13 levels 24 hours after priming and boosting 75 week old mice with mRNA-1273. (n=5 mice per group).
[0051] FIGS. 24A to 24D show evaluation of CXCL13 expression and antibody responses following coadministration of COVID-19 mRNA vaccine with different adjuvants. Doses of vaccine were formulated to contain 0.32 ug of mRNA-1273 with Cxcl13-mRNA, empty lipid nanoparticles (eLNP), alum, CPG1018, or BECC470 then administered to mice on a four week prime and boost schedule. FIGS.24A and 24B: Serum CXCL13 was measured 24 hours after administration of prime and boost doses. FIGS. 24C and 24D: Anti-RBD IgG antibodies in serum were quantitated by ELISA 2 weeks after prime and boost. (n=5 mice per group).Attorney Docket Number: WVU 3065-PCT
[0052] FIG.25 shows representative domain mappings of the human proteins CXCL10, IFN-γ, and TNF as members of the five major families of cytokines.
[0053] FIGS.26A to 26D show window chambers for visualization of lymph nodes in mice. FIG. 26A shows a diagram with measurements of a window chamber. FIG.26B shows representative photograph of a lymph node window chamber. FIG.26C shows confocal imaging of Lymph node and lymphatic vessels using Texas Red dextran in real-time. FIG. 26D shows detection of metastasizing tumor CBG-GFP at the lymph node using a lymph node window chamber day 3 post primary tumor inoculation.
[0054] FIG.27 shows serum CXCL10 levels of C57BL / 6 mice euthanized 24 hours after priming and boosting with a titration of mRNA-1273. Data points represent mean ± SD of n=5 mice per group. Statistical comparisons displayed were calculated against PBS: ****P<0.0001.
[0055] FIG.28 shows an XY graph showing the relationship between serum IgG levels six weeks after boosting and CXCL10 expression in the lymph node 24 hours after administration. Points represent single mice, n=5 mice per group.
[0056] FIGS.29A to 29C show quantification of CXCL13 expression in muscle, draining lymph node, and serum collected from K18-hACE2 mice 24 and 48 hours after administration of 10 µg mRNA-1273 vaccine.
[0057] FIGS.30A and 30B show CXCL13 expression in the lymph nodes and serum of 8 week old mice that were primed or primed and boosted with a titration of mRNA-1273 doses, euthanized 24 hours after priming or boosting.
[0058] FIG. 30C shows a correlogram showing relationship between CXCL13 expression 24 hours post boost and antibody levels one week after boosting in vaccinated mice.
[0059] FIG.31 shows serum CXCL13 levels 24 hours after priming and boosting from 75-week- old K18-hACE2 mice vaccinated with low (1.25 µg) and high (10 µg) doses of mRNA-1273. Data points represent mean ± SD of n=5 mice per group.
[0060] FIGS.32 and 33 show CXCL13 expression in mouse serum 24 hours after prime and serum CXCL13 expression levels 24 hours post-boost, respectively, with low doses of mRNA-1273 (Spike) vaccine and Cxcl13-mRNA adjuvant.Attorney Docket Number: WVU 3065-PCT
[0061] FIGS. 34A and 34B show the influence of N1-methyl-pseudouridine substitution on CXCL10-mRNA genetic adjuvant expression.
[0062] FIGS. 35A and 35B show the influence of N1-methyl-pseudouridine substitution of mRNA therapeutic on cell levels in tissues.
[0063] FIGS. 36A to 36C show that different preparations of a DNA template for mRNA synthesis have little effect on expression profiles in vivo (FIG.36A) but longer polyA tails increase expression levels in vitro (FIGS.36B and 36C).
[0064] FIGS. 37A to 37E show that mRNA-LNPs produced from different preparations of a DNA template for mRNA synthesis elicit different inflammatory cytokine responses in vivo at 24 hours (detected in serum by MSD ELISA).
[0065] FIGS. 38A to 38C show that Cxcl13-mRNA LNP genetic adjuvant increases serum CXCL13 levels and anti-RBD IgG antibody production 24 hours after administration of a boost dose in aged mice (FIG.38A), and antibody production two weeks after administration of the boost dose (FIG.38C). Aged mice were administered 1 µg of mRNA-1273 vaccine with or without 5 µg of the Cxcl13-mRNA adjuvant.
[0066] FIGS.39A to 39C show that a N1-methyl-pseudouridine substituted IL-6-mRNA LNP genetic adjuvant increases IL-6 levels in serum and spleen of treated mice. C57BL / 6 mice were intramuscularly injected with 5ug of substituted IL-6-mRNA LNP genetic adjuvant. Serum (FIG. 39A), inguinal lymph node (FIG. 39B), and spleen (FIG. 39C) were harvested at 12, 24, and 24 hours after treatment. A naïve untreated group was also harvested to utilize as a negative control. All samples had IL-6 levels analyzed via MSD and Mann-Whitney tests were used to analyze the data. *P<0.05, **P<0.01.
[0067] FIGS.40A and 40B show that an IL-6-mRNA LNP genetic adjuvant increases IL-6 levels in serum of treated mice. C57BL / 6 mice were intramuscularly injected with two doses, 4 weeks apart, of a 1 / 160th human dose of DTaP, 1 / 160th DTaP+ 1µg of IL-6 mRNA LNP or 1 / 160th DTaP + 5µg of IL-6-mRNA LNP genetic adjuvant, or phosphate-buffered saline (PBS). Mice were bled at 2 and 10 weeks post second vaccine dose and anti-pertussis toxin (PT) IgG antibody levels were measured in serum via Enzyme linked immunosorbent assay (ELISA). FIG.40A shows results 2Attorney Docket Number: WVU 3065-PCT weeks post second dose of vaccine. FIG.40B shows results 10 weeks post second dose of vaccine. Mann-Whitney tests were used to analyze the data. *P<0.05.
[0068] FIGS.41A and 41B show that addition of IL-6-mRNA LNP and CXCL13-mRNA LNP to DTP-10 mRNA vaccine increases IL-6 levels after vaccination. FIG.41A shows serum IL-6 levels one day post prime. FIG.41B shows serum IL-6 levels one day post booster dose. DETAILED DESCRIPTION
[0069] mRNA sequences normally include the following nucleotides: adenosine (A), guanosine (G), cytidine (C), and uridine (T), with uracil replacing thymine found in DNA. During in vitro transcription, from 0% to 100% of uridine nucleotides may be replaced with modified nucleobases of N1-methyl-pseudouridine-5'-triphosphate (Pseudo-UTP; TriLink Biotechnologies). Thus, in the following discussion, as well as in the sequence listing, mRNA sequences are interpreted as containing the following nucleosides: a, corresponding to adenosine triphosphate; g, corresponding to guanosine triphosphate; c, corresponding to cytidine triphosphate; and t, corresponding to uridine triphosphate, Pseudo-UTP, or a mixture thereof.
[0070] The following discussion relates to mRNA sequences and protein sequences for mouse and / or human hosts. The disclosure is not limited to such hosts; the sequences discussed herein can be codon optimized for expression in any desired host, i.e. human, mouse, etc.
[0071] Cytokines and chemokines are classified on the basis of structure, and on the basis of the receptors to which they bind, as shown in FIGS.11-12. Cytokines
[0072] TNF family cytokines: TNF family cytokines include TNF-α, Lymphotoxin-alpha (LT- α), Lymphotoxin-beta (LT-β), Cluster of differentiation 40 (CD40), Fas ligand (FASL or CD95L), BAttorney Docket Number: WVU 3065-PCT cell activating factor (BAFF), a proliferation-inducing ligand (APRIL), CD27 ligand (CD27L), CD30 ligand (CD30L), 4-IBBL, TNF-related apoptosis-inducing ligand (TRAIL), tumor necrosis factor TNF-related activation-induced cytokine (TRANCE) and TNF-related weak inducer of apoptosis (TWEAK). TNF family cytokines bind to TNF receptors, which are type I transmembrane domains that includes ectodomain (ECD) composed of transmembrane helix, multiple cysteine rich- domains. TNF family cytokines form a trimeric ligand and bind to trimeric receptor complexes which activate downstream signaling.
[0073] Type I family cytokines: Type I family cytokines bind to Type 1 cytokine receptors, also known as hemopoietin receptors, which are transmembrane receptors that have four conserved cysteine residues. Type 1 cytokine receptors share a common amino acid motif (WSXWS) in the extracellular domain, a proline-rich Box1 / 2 regions in a cytoplasmic domain, and respond to cytokines with a four-α helical bundle. These receptors share similar domains, including fibronectin type III (Fn3) and immunoglobulin-like (Ig-like) domains. Type 1 cytokines are further classified based on their usage of receptor subunits. Type 1 cytokines are classified into three main sub-groups. Cytokines that do not fit into the main sub-groups were grouped as “other”. IL-6 family: IL-6 family cytokines are a group of cytokines that includes IL-6, IL-11, leukemia inhibitory factor (LIF), oncostatin M (OSM), IL-31 and cardiotrophin 1 (CT-1)36,37. These cytokines share a signal through receptor complexes that include glycoprotein 130 (gp130). IL-3 family: The IL-3 family cytokines contain cytokines IL-3, IL-5 and Granulocyte- macrophage colony-stimulating factor (GM-CSF). IL-3 family cytokines signal through IL-3 receptors, which are heterodimer receptor complexes that have cytokine specific α subunits and a common βc subunit. IL-2 family: IL-2 family cytokines include IL-2, IL-4, IL-9, IL-7, IL-21 and IL-1542,43. These cytokines bind to heterodimer receptor complexes that share a common γc subunit.
[0074] Type II family cytokines: Type II cytokines include interferons (IFNs) and IL-10 family cytokines, and bind to type II cytokine receptors. The Type II cytokines that bind to type II cytokine receptors have common six α-helix structures. These type II cytokine receptors contain Fn3 domains on the extracellular portion however, they do not contain the WSXWS motif, and the conservedAttorney Docket Number: WVU 3065-PCT cysteine sequences are in a different position than type I cytokine receptors. While similarities are observed in the extracellular portion, cytoplasmic portions are distinct between the members. Interferons: Based on the type of receptor they signal through, interferons are classified into three major groups: Type 1, Type 2, and Type 3 interferons. Type 1 interferons signal through Interferon-alpha / beta receptors 1 and 2 (IFNAR1, IFNAR2) and consist of IFN-α and IFN-β47. Type 2 interferon signals through Interferon gamma receptor 1 and 2 (IFNGR1, IFNGR2), and IFN-γ is the only cytokine in this group48. Type 3 interferons, also known as lambda interferons, consist of IFN-λ-1, IFN-λ-2, and IFN-λ-3. These interferons bind to the heterodimeric receptors interferon lambda receptor 1 (IFNLR1) and interleukin (IL)10Rβ49. IL-10 family: The IL-10 family consists of IL-10, IL-19, IL-20, IL-22 and IL-24. These cytokines share similarities in their secondary and intron-exon gene structures; however, they do not share high similarities at the amino acid chain level. The downstream signaling cascade of this family is highly conserved.
[0075] IL-1 family cytokines: The IL-1 family contains IL-1α, IL-1β, IL-1RA, IL-18, IL-33, IL36α, IL-36β, IL-36γ, and IL-36RA cytokines. IL-1 family signaling uses closely related receptors and shares similar structural architecture. IL-1 receptors have extracellular Ig-like domains and intracellular Toll / IL-1 receptor (TIR) domains.
[0076] IL-17 family cytokines: IL-17 family of cytokines consists of IL-17A, IL-17F, IL-17C, and IL-25. These cytokines and their receptors share sequence homology. Receptors for the IL-17 family cytokines share a SEFIR domain and a key adaptor protein Act1. The SEFIR domain is crucial for downstream IL-17 signaling. Chemokines
[0077] Chemokines are classified into four main families based on the variation in the configuration of the two cysteines close to the N terminus, as shown in FIG.12.
[0078] CC chemokine family: These chemokines have two adjacent cysteines in their N terminus. These chemokines bind to receptors CCR1-10.Attorney Docket Number: WVU 3065-PCT
[0079] CXC chemokine family: These chemokine’s two N-terminal cysteine residues are separated by a single amino acid X4. CXC chemokines bind to receptors CXCR1-7.
[0080] C chemokine family: These chemokines have only one N-terminal cysteine and another downstream cysteine residue.
[0081] CX3C chemokine family: There has been only one discovered chemokine, CX3CL1, in this group which has three amino acids between the two cysteine residues. mRNA Vaccines
[0082] mRNA vaccines represent a major step forward for vaccinology and public health. The implementation of mRNA vaccines in 2020 to combat widespread SARS-CoV-2 infections introduced a new era for molecular medicine. Immune responses to mRNA-encoded vaccine antigens were remarkably robust across hosts. With time, however, the durability of these immune responses has been unclear, as waning antibody and cellular responses have necessitated ‘booster’ doses to maintain long-term protection.
[0083] Development of new mRNA-based vaccines for bacterial diseases including pertussis, diphtheria, tetanus, and anthrax. When compared to more traditional platforms for vaccines, mRNA- based vaccines have unique advantages as well as disadvantages. mRNA vaccines do not induce the same magnitude of responses when used as a booster compared to protein or particle-based vaccines. This feature may contribute to antibody responses waning dramatically over time. These observations have been affirmed in the human population as well, necessitating the incorporation of multiple boost doses to maintain protective immunity. Despite this issue of longevity, the strong innate responses to mRNA vaccines can be translated into durable adaptive responses with the incorporation of novel “mRNA genetic adjuvants.”
[0084] An adjuvant is a substance that enhances the immune responses to an antigen. Traditional adjuvants used in vaccine formulations include chemical compounds like alum, AS04, or MF59, which non-specifically activate pro-inflammatory pathways to induce cellular responses that naked antigen alone cannot. The same advances in molecular engineering that has allowed for the development of nucleic acid vaccines offers a potentially powerful, targeted and complementary alternative to chemical adjuvants—namely: “genetic adjuvants,” illustrated in FIG.3. For example,Attorney Docket Number: WVU 3065-PCT mRNA encoded with Cxcl10 may be co-administered with an mRNA vaccine to act as a genetic adjuvant to improve vaccine responses. To the best of our knowledge, the term genetic adjuvant has been largely used for DNA-based formulations. Little work has been done on mRNA-based genetic adjuvants.
[0085] Genetic adjuvants encoding immune-stimulating proteins were first proposed and studied as a means of generating tailored immune responses through activation of specific cellular pathways in the context of DNA-based vaccines. Encoding both the vaccine antigen and its adjuvant into DNA vectors before co-administration, in principle, can ensure that cells in the immune microenvironment are exposed to both molecules in tandem when early immune activation take place. Numerous genetically encoded candidates have been observed to enhance the immune responses to DNA vaccines in the preclinical space, but the overall drawbacks of the delivery of DNA vaccine antigens imprecisely to their cellular targets have impeded their progression in the clinic and beyond.
[0086] In contrast, mRNA vaccines have largely displaced DNA vaccine candidates due to their intrinsic immunogenicity. Foreign mRNAs inherently cause greater pattern recognition receptor activation than DNA, leading to inflammation and the infiltration of cells that then uptake the mRNA, leading to its eventual expression. For this reason, COVID-19 mRNA vaccines are considered “self-adjuvanted” and were not thought to require an additional adjuvant in their formulation to induce sufficient protective immunity. With the growing knowledge that protective immunity still decreases with time, it has been proposed that adjuvants could be implemented to improve mRNA vaccines. No studies so far have identified adjuvants that both are compatible with mRNA vaccines, and enhance mRNA vaccine durability. Additional adjuvant mRNAs could be employed to favorably boost responses to mRNA antigens. This idea could help augment and strengthen the emerging platform of mRNA vaccines that have revolutionized the field of vaccinology. by addressing the lack of the longevity of the protection. mRNA-based genetic adjuvants encoding naturally occurring cytokines and chemokines may enhance mRNA-based vaccines for both viral and bacterial infectious diseases.
[0087] During an evaluation of innate and adaptive immune responses to the SARS-CoV-2 variants of concern in 2021, unique innate responses to the Delta variant (B.1.617.2) were observed that differed from those raised against the ancestral and Alpha variants. Delta induced a strongerAttorney Docket Number: WVU 3065-PCT cytokine storm and hyper-infiltration of inflammatory cells to the lungs causing lethal pneumonia. Among the mediators of this antiviral response, CXCL10 and CXCL13 were the most abundant chemokines in the lungs of Delta challenged K18-hACE2 mice. A serological study performed on humans infected with SARS-CoV-2 in the pre-vaccine COVID-19 era showed that patients with severe disease during the ancestral era also had high CXCL10 levels in serum. CXCL10 is a potent pro-inflammatory chemokine that is responsible for directing the migration of immune cells to sites of infection. The chemokine signals through its receptor CXCR3 to minimize disease pathologies by limiting viral replication, upregulating of interferon responses, and recruiting of both natural killer cells and virus-specific T cells. Despite the concern that CXCL10 could be driving damaging disease pathology in the lungs, it was known that people infected with the Delta variant produced strong antibody responses and strong convalescent immunity. Strong innate inflammatory responses mounted in response to mRNA vaccination may be driven by early production of chemoattractants (chemokines and cytokines) at the site of immunization. Early innate responses induced by the mRNA may be critical to shaping the subsequent adaptive responses.
[0088] Experiments were designed to characterize the early immune signals to mRNA vaccination; it was found that the production of proinflammatory chemokines and cytokines within the first 24-48 hours following immunization correlated with cellular infiltration of the immunization site with dendritic cells, B cells, and T cells. Dendric cells uptake mRNA vaccine antigen during this early phase and are directly responsible for the induction of mRNA vaccine immunity through lymph node trafficking and germinal center responses1. In mice, CXCL10 was one of the most highly expressed chemokines in the injection-site muscle, draining lymph node and serum after priming or boost with the mRNA-1273 COVID-19 vaccine. In humans, immunocompetent groups have higher CXCL10 levels during priming and boosting compared to immunocompromised groups, and this predicts the development of humoral responses. Analysis of the transcriptional atlas of the human immune response to 13 different human vaccines has also revealed CXCL10 as a common predictor of vaccine-induced antibody responses.
[0089] In summary, CXCL10 is a biomarker of immunity, where: 1) CXCL10 levels are high in humans with severe COVID-19, 2) CXCL10 is highly expressed in the lungs and blood of SARS-CoV-2 infected miceAttorney Docket Number: WVU 3065-PCT experiencing high inflammation and viral replication, 3) CXCL10 production in muscle, lymph nodes, and serum peaks at one day post immunization with mRNA-1273 in mice, and 4) mRNA vaccination in humans, causes increased CXCL10 levels in serum that correlate with protective humoral immunity.
[0090] Based on these learnings, a Cxcl10-encoding mRNA was constructed to function as a prototype genetic adjuvant for the recruitment of additional T cells, NK cells, macrophages, and antigen presenting cells to the immunization site to enhance vaccine responses, as shown in FIG.4A. Additionally, CXCL10 may facilitate B cell differentiation into plasma cells.
[0091] Thus, naturally occurring chemokines and cytokines may be utilized as genetic adjuvants. Many known cytokines and chemokines may be screened using both in vitro and in vivo analyses as novel adjuvants. All vaccine platforms can benefit from the inclusion of a genetic adjuvant.
[0092] Successful implementation of mRNA vaccines for the COVID-19 pandemic brought attention to the biomedical potential of mRNA technology. mRNA vaccine technology builds on a series of innovations, including: 1) an understanding of untranslated regions of mRNA as regulators of protein synthesis, 2) use of modified nucleobases to attenuate host immune responses, 3) the development of ionizable lipid nanoparticles as delivery systems, 4) structural mutations to increase protein payload stability, among others. mRNA-based therapeutics could be applied broadly to target infectious diseases, metabolic disorders, cancers, and other conditions through modifications to the host’s protein expression profile. mRNA technology has evolved since pioneering experiments in the 20thcentury and is now broadly available for use by the scientific community as more than a basic research tool. Currently, the use of COVID-19 vaccines has created opportunities to apply the platform in other areas of human disease. The Moderna and Pfizer / BioNTech mRNA vaccines against SARS-CoV-2 contain one or two mRNA antigen transcripts. Together, these demonstrate that mRNA vaccines can be multivalent as well as target multiple pathogens or toxins. The implementation of therapeutic mRNAs as vaccine adjuvants may overcome a critical barrier in mRNA vaccines: the need for improved immunological memory.Attorney Docket Number: WVU 3065-PCT
[0093] Co-administration of multiple immunostimulatory signals may be used to ‘adjuvant’ mRNA vaccines. IL-2 and IL-7 cytokines have been used in cancer vaccines to enhance the tumor microenvironment by driving lymphocyte infiltration. Currently approved mRNA vaccines rely on Toll-Like Receptor 7 (TLR7) and TLR8 and / or RIG-1 (Retinoic Acid Inducible Gene I) / MDA-5 (melanoma differentiation-associated protein 5) engagement, and inflammation resulting from nanoparticle delivery to drive overall inflammation. To enhance responses, co-administration of genetic adjuvant mRNA with mRNA antigen will recruit adaptive responses to the site of antigen expression (injection or delivery site).
[0094] Various embodiments disclosed herein relate to providing mRNA vaccines with improved durability and longevity of protection. mRNA vaccines offer unparalleled flexibility, scalability, and versatility, when compared to conventional vaccines. However, their longevity of protection remains a challenge. Despite robust immune responses, sustained immunity requires frequent boosting due to the relatively short-lived nature of the response. Since 2017, over 50 mRNA vaccine formulations encompassing various antigens including diphtheria, tetanus, pertussis, and COVID-19 have been investigated. While antibody responses surge promptly after boosting, they diminish significantly over time as illustrated by data obtained with mRNA-1273, a bivalent mRNA COVID-19 vaccine. When mice were immunized with doses of mRNA-1273 vaccine, ranging from 1 / 10th of a human dose (10 µg) to 1 / 640th of a human dose (0.16 µg). Serum RBD-specific IgG was measured monthly from 1-week post-prime out to 33 weeks, with boosting at week 5. Antibody titers decayed over time regardless of the dose, and were close to or below the limit of detection after 33 weeks. There is a need to improve the mRNA platform to deliver enhanced antibody responses and antigen-specific memory, thus improving the breadth and durability of vaccine immunity. Waning antibody responses have been extensively documented, highlighting a significant need to fully understand induction of immunogenicity of the mRNA platform in order to identify opportunities for improving the duration of protection.
[0095] mRNA COVID-19 vaccines such as mRNA-1273 (Moderna) and BNT162b2 (Pfizer- BioNTech) have been widely utilized since their release and Emergency Use Authorization (EUA) in December 2020. Despite numerous reformulations aimed at adapting to evolving antigens and epitopes, these vaccines offer only transient protection. Furthermore, these adjustments overlookedAttorney Docket Number: WVU 3065-PCT other factors potentially impacting their immunogenicity, such as lipid nanoparticle (LNP) formulation. In general, mRNA vaccines induce Th1 immune responses through antigen specific CD4+ IFN-γ+ T helper cells that facilitate B cell activation and differentiation into IgG producing plasma cells. Antibodies produced by these cells are major effectors that bind and neutralize pathogen or target antigen. In addition, CD4+ IFN- γ T helper cells further enhance cell mediated killing by macrophages, and CD8+ cells recognize various spike antigen T cell epitopes. Yet, waning immunity remains a significant concern.
[0096] Very few studies have shown positive impact from coformulation of mRNA vaccine with classical adjuvants. In one, CpG1018 inclusion boosted humoral and cellular responses to a mRNA rabies vaccine, showing that adjuvant incorporation warrants further consideration.6 The work proposed here aims at improving mRNA vaccine efficacy through novel adjuvants.
[0097] Tapioca, lecithin, agar, starch oil, saponin, and breadcrumbs applied to a vaccination site act as adjuvants, and increase antitoxin production in response to diphtheria toxin. Numerous additional adjuvants have been studied, but only seven have been formulated into FDA-approved vaccines: alum, an oil-in-water emulsion of squalene (MF59); AS01, a liposome-based adjuvant which contains 3-O-desacyl-4’-monophosphoryl lipid A (MPL) and the saponin QS-21, AS04, a liposome-based adjuvant which contains 3-O-desacyl-4’-monophosphoryl lipid A (MPL) and aluminum salt, AS03, an adjuvant system containing α-tocopherol and squalene in an oil-in-water emulsion; CpG 1018, a toll-like receptor 9 (TLR9) agonist, and Matrix M, composed of nanoparticles containing saponins extracted from Quillaja saponaria (soapbark) trees, cholesterol, and phospholipids. These adjuvants increase inflammation and activate the immune system in response to vaccination, but little evidence suggests they may be used in combination with mRNA.
[0098] Long-term studies in mice were performed, where antibody levels and protection after DTaP and DTP vaccination were measured. Surprisingly, antibody levels persisted at maximal levelsAttorney Docket Number: WVU 3065-PCT in mice for the full duration of the study. Mice were also protected against bacterial challenge, even 532 days post-prime. Interestingly, DTP was the only vaccine that induced detectable amounts of antigen-specific B memory cells in the bone marrow. Response to DTP was also characterized by increased CXCL13 expression in serum, and a higher number of CD4+ T cells in the lymph nodes, as compared to DTaP vaccinated mice, as shown in FIGS. 1A to 1H. These data suggested that CXCL13 expression is a correlate of immune memory.
[0099] FIG. 1A demonstrates that CXCL13 is a chemokine that is highly produced after immunization with DTP-10 combination vaccine in mice (1 / 80thto 1 / 20thhuman dose). However, immunization with either the acellular DTaP combination vaccine or the mRNA-1273 COVID-19 vaccine does not significantly enhance CXCL13 production.
[0100] This finding was further validated through broader scale phenotypic characterization of the unique chemokine expression profiles that occur after prime and boost with DTaP, DTP, and mRNA-1273. CXCL13 was highly expressed following DTP vaccination (20,000 pg / ml) but not DTaP, as shown in FIG.1C. CXCL13 levels in mRNA-1273 vaccinated mice were also extremely low compared to DTP-vaccinated mice. CXCL13 levels were measured one day post prime and post boost in mice immunized with a range of doses (1 / 10th to 1 / 320th human dose) with mRNA-1273. There was a dose response between CXCL13 levels in serum (FIG.1D) and the inguinal draining lymph node (FIG.1E), with the administered vaccine dose. This suggests that it is possible to elicit and enhance CXCL13 in response to mRNA vaccination.
[0101] Enhancing CXCL13 levels at the time of vaccination may boost antibody production and the institution of memory responses. Overall, CXCL13 may be a significant biomarker of humoral immune memory that can be targeted with adjuvants to tune and optimize vaccine responses.
[0102] A strong effort was put towards the development of DNA-based genetic adjuvants in the 1990s. These programs failed to produce licensed adjuvants, due to the difficulties associated with administering DNA-based vaccines and therapeutics. mRNA technology may be a suitable alternative to encode genetic adjuvants. An encoded chemokine may be used to directly coordinate an enhanced mRNA vaccine response. DNA sequences for proteins of interest were assembled and flanked by 5’ and 3’ untranslated regions to stabilize expression. These were cloned into plasmids following a T7 promoter for in vitro transcription. The plasmid additionally added a polyA tail withAttorney Docket Number: WVU 3065-PCT 20 to 150, 23 to 100, 25 to 75, 28 to 50, or 30 to 40 adenosine nucleotides for enhanced stability. Addition of polyA tails (20 to 150 adenosine bases) can enhance stability and expression of the coding sequence into its corresponding protein. The chemokine coding sequence retains a 5’ native secretion signal so that the resulting protein will be accurately processed and released from cells.
[0103] To show that chemokines can be encoded as mRNA and used as vaccine adjuvants, Cxcl10 and Cxcl13 were encoded. Cxcl10- and Cxcl13-mRNA were produced, purified, quality checked, sequenced (RT-PCR), and packaged into lipid nanoparticles, as shown in FIG.2C. mRNA constructs encoding each chemokine were combined with mRNA-1273 and administered to mice using the standard mRNA vaccination schedule (prime and boost 4 weeks later).
[0104] The Cxcl13 genetic adjuvant was able to enhance RBD-specific immune responses, as shown in FIGS.5A to 5C. Injection of Cxcl13-mRNA led to an increase in the detection of CXCL13 post-prime and boost, leading to levels similar to those observed in response to DTP vaccination. In addition, Cxcl13-mRNA was able to enhance antibody production in mice receiving the 1 / 320th human dose of mRNA to levels observed in mice administered 1 / 20th of the human dose of the vaccine. This remarkable increase took antibody levels from a non-protective dose of vaccine (1 / 320th) and increased antibody levels to those observed in response to a fully protective dose (1 / 20th). Other more classical adjuvants (alum, CPG1018, and an MPLA-like TLR4 agonist BECC 470) were tested to see if similar responses were observed when they were combined with mRNA- 1273. Addition of alum (1 / 20th human dose per DTaP formulation) did not result in any significant increase in CXCL13, as shown in FIG.24C and 24D. However, modest CXCL13 levels in serum were observed in response to inclusion of CpG 1018, as shown in FIG.24C, and very high CXCL13 levels in response to a BECC 470 MPLA-like TLR4 agonist. However, only Cxcl13-mRNA was able to increase Spike specific antibody levels and CXCL13 levels, as shown in FIGS.24C and 24D. Cxcl13 mRNA may be used as an mRNA genetic adjuvant to enhance humoral immune responses of mRNA vaccines.
[0105] These findings are significant because they reveal mRNA genetic adjuvants as a potentially powerful tool for developing precision vaccines. These vaccines could possess enhanced durability and memory characteristics, including specific B and Tfh memory for swift recall.Attorney Docket Number: WVU 3065-PCT
[0106] The pathways of antigen presentation of classical vaccines do not exactly apply to mRNA vaccines. mRNA vaccines expressing SARS-CoV-2 spike protein result in surface expressed antigens on target cells. In addition, the antigen is also released from the target cell surfaces by endogenous proteases, leading to detection in serum. During this process, dendritic cells (DCs) are thought to be the main cell type to pick up mRNA vaccine, express its antigen, and traffic to the lymph node. It is also known that LNP and mRNA exposure induces differentiation of antigen- presenting cells (APCs) and cellular activation. Co-expression of CXCL13 and an antigen by APCs may alter the mechanism of induction of vaccine-mediated protection.
[0107] Luciferase expression has been used to study translation of mRNA vaccines in vitro and in vivo. A luciferase reporter has been used to track cells that are expressing mRNA constructs by in vivo imaging systems using lymph node window chambers, whole animal imaging, or confocal intravital imaging of cell-to-cell interactions. Tracking of antigen or adjuvant expression can be used to understand the interplay between these two factors and how they generate immunity.
[0108] As shown in FIG.17A, a six-month waning immunity model using decreasing doses of mRNA-1273 has been established. This allows precise definition of protective and sub-protective vaccine doses, which allows evaluation of the effects of novel mRNA genetic adjuvants. In long- term studies, antigen specific B memory cell analyses were developed that will be used to examine under-characterized effects of mRNA vaccines on the memory response, and the impact of the Cxcl13-mRNA genetic adjuvant on vaccine durability.
[0109] There are additional elements of innovation disclosed herein, including: A focus on a first-of-its-kind Cxcl13 mRNA genetic adjuvant; Technological advantages of mRNA vaccine technology; and Evaluation of a novel mRNA antigens: RBD (COVID), FHA (pertussis) and PTXA (pertussis).
[0110] The Cxcl13 genetic adjuvant will be optimized for expression and immunogenicity. Lipid nanoparticles (LNPs) encapsulating Cxcl13 genetic adjuvant mRNA will be formulated, and their immunogenic potential in the context of coadministration with mRNA antigens will be optimized. This involves producing DNA template constructs, fully developing an mRNA IVT pipeline to produce mg amounts of research material, validating Cxcl13-mRNA expression in vitro (cells) andAttorney Docket Number: WVU 3065-PCT in vivo (in mice), and showing that Cxcl13 genetic adjuvant improves antibody responses to mRNA vaccines. The Cxcl13-mRNA construct was designed using the mouse CXCL13 amino acid sequence (uniport: O55038) containing the native secretion signal (aa 1-21). The codon sequence was optimized in silico for high expression in mice (Genscript Gensmart™ Codon Optimization tool). The natural mouse Cxcl13 sequence has a 47% GC content which was increased to 53% after codon optimization. The optimized coding sequence was then fused with 5’ and 3’ UTRs (β-globin; same as mRNA-1273 and other mRNAs). The coding sequence was then cloned into a DNA plasmid vector for expression under a T7 promoter, as shown in FIG.2C. The vector also fuses a polyA tail (20 to 150 nucleotides, or about 30 nucleotides) to the 3’ end of the sequence to increase construct stability and facilitate purification. Prior to in vitro transcription, high fidelity PCR was used to amplify a linear template of each construct. A linearized plasmid using restriction enzymes was also used as a means of template preparation.
[0111] The linear template was then purified before in vitro transcription (IVT) (Promega T7 RiboMAX™ Express Large-Scale RNA Production System). During IVT, 5’ end capping was also applied to the constructs to improve stability and enhance translation in cells. The resulting RNA was purified. With this pipeline, 3 mg of mRNA per lot can be produced.
[0112] mRNA is stored at -80°C and is packaged within a week of use to maintain stability. The Cxcl13-mRNA was formulated into LNPs using a Precision Nanosystems Ignite instrument. The LNPs were analyzed on a Malvern NanoSight NS300 and the LNPs were measured to be + / - 120nm. CXCL13 expression from the Cxcl13 genetic adjuvant delivery was similar to that of DTP immunization (FIG.5A).
[0113] mRNA technology is still in its early days and optimization for specific applications is necessary. The Cxcl13-mRNA construct disclosed herein is expressed in vitro and in vivo, and leads to improved antibody production when combined with mRNA-1273. Four main variables may be optimized for improved expression and efficacy: 1) percent substitution using modified nucleotides, 2) polyA tail length , 3) protein coding length of Cxcl13, and 4) adjuvant dose .Attorney Docket Number: WVU 3065-PCT
[0114] The presence of unmodified uridine-5’-triphosphate (UTP) in mRNA constructs triggers an interferon response, associated with decreases in transcription rates, potentially hindering expression of the product of interest. As a result, Moderna and Pfizer / BioNtech COVID-19 vaccines use up to 100% substitution of UTP with modified forms to dampen innate immune responses. In addition, reporter mRNAs such as fluorescent proteins and luciferase produced by Trilink and Genscript show highest reporter signal with 100% substitution. However, the innate immune engagement resulting from the use of unmodified UTP, is thought to be potentially be beneficial for some vaccine responses. It is now commonly accepted that 50% substitution results in some innate immune engagement that facilitates immunogenicity. and companies such as Curvac propose to not use uridine substitution. UTP substitution decreases in vitro transcription (IVT) and total RNA production, and more optimization is required to produce sufficient mass of mRNA for pre-clinical studies. mRNA vaccine with 0%, 50%, and 100% UTP substitution with N1-methylpseudouridine- 5'-triphosphate. To do this, the ratio of UTP to N1-methylpseudouridine- 5'-triphosphate is adjusted in the IVT mixture. These lots of CXCL13 will be produced and packaged into GenVoy-ILM™ based LNP formulations using the Cytiva Precision Ignite instrument. The % UTP substitution that results in the highest production of CXCL13 in cells in vitro will be selected.
[0115] The VDC-mRNA- 0002 Cxcl13 mRNA genetic adjuvant currently has 30 A nucleotides (a 30 bp poly(A) moiety) encoded on the plasmid prior to the end of the mRNA to increase stability of the trnscript. However, longer poly(A) tails improve the expression of the mRNA constructs. It is difficult to encode large polyA tails into plasmids, because they impact plasmid integrity and cause major deletions and recombination. While our Cxcl13 construct has resulted in high CXCL13 chemokine production in mice (FIG.5A), increasing the length of the poly(A) tail beyond 150 bp may increase CXCL13 expression. A larger polyA tail will be added after IVT. E. coli Poly(A) Polymerase will be used to add an additional 150 bp polyA tail to the Cxcl13 mRNA. PolyA polymerase is very efficient, and greater than 95% efficiency is expected. RT-PCT and Sanger sequencing will be used to verify the sequence of the construct. A Cxcl13-polyA construct with a 180 bp poly(A) segment will be packaged into LNPs, incubated with HEK293T cells and then tested in vitro for CXCL13 expression. Increasing the polyA length should also increase overall CXCL13 expression.Attorney Docket Number: WVU 3065-PCT
[0116] Chemokines typically encode a signal sequence of around 20 amino acids that is cleaved off in the endoplasmic reticulum (ER) prior to secretion. The CXCL13 signal sequence is 21 amino acids (MRLSTATLLLLLASCLSPGHG; residues 1-21 of SEQ ID No: 5). After cleavage, the mature CXCL13 is 88 amino acids in length (residues 22-109 of SEQ ID No: 5). Our Cxcl13- mRNA construct encodes both the signal sequence for proper trafficking and the full length of CXCL13. CXCL13 which lacks the final 16 amino acids, i.e., CXCL13 fragments with aa residues 22-93 of SEQ ID No: 5, result in greater CXCR5+ cell chemotaxis due to enhanced release from cells. It appears that the final 16 amino acids facilitate interaction of heparin which anchors the CXCL13 to the extracellular matrix of cells, keeping the CXCL13 closely associated with cells such as follicular dendritic or Tfh cells. Cathepsin B (Cath-B) is responsible for cleavage of CXCL13 and release from the cell. Other studies have implicated Cath-B and its cleavage sites and they correlate with the cleavage at position 93 / 94 of SEQ ID No: 5 of CXCL13. The potency of a genetic adjuvant construct can be correlated to its ability to be released from a cell, thus removal of these heparin interaction C-term tails, can improve the potency of the adjuvant.
[0117] The final 16 amino acids will be removed from our CXCL13 construct, and the resulting peptide [residues 22-93 of SEQ ID No: 5] will be compared to a peptide derived from a full length Cxcl13-mRNA construct, in terms of release into supernatant over time in both mouse DC2.4 immortalized cells and HEK293T (human) cells. The loss of the 16 aa C-terminal tail is expected to result in more release of CXCL13 from the cells in vitro. Next, the truncated Cxcl13-mRNA and the full length Cxcl13-mRNA adjuvant constructs will be co-formulated with mRNA-1273 to evaluate immunogenicity in mice. Mice will be primed and boosted with the mRNA antigen and mRNA adjuvant combo, testing the dose used in early studies (3 µg), as well as a lower dose (0.3 µg). Male (5) and female (5) outbred CD1 mice will be immunized with 0.1, 0.5, or 1 µg of mRNA-1273 vaccines as control groups (30 mice). The same groups will be supplemented with empty LNP (control) or 0.1, 0.5, 1 µg of either: full length Cxcl13-mRNA having a coding sequence of SEQ ID NO: 4 (encoding CXCL10 of SEQ ID NO: 5); or truncated Cxcl13-mRNA having a coding sequence of SEQ ID NO: 33 (encoding residues 1- 93 of SEQ ID NO: 5).Attorney Docket Number: WVU 3065-PCT As discussed above, residues 1-21 of the full length and truncated CXCL13 proteins will be cleaved off, leaving peptides with 88 and 72 amino acids, respectively. Mice will be bled to determine antibody levels and boosted at 4 weeks post prime. Mice will be bled monthly out to 6 months to observe antibody levels and durability. Unless otherwise specified, consider work described herein to have been performed with full-length Cxcl13-mRNA and full-length CXCL10 proteins.
[0118] The expression of Cxcl13-mRNA will be optimized in vitro and in vivo and the adjuvanticity of the optimized construct will be tested in vivo in combination with mRNA-1273. The proposed modifications will be performed sequentially using go-no go criteria based on both in vitro and in vivo expression: the optimal UTP substitution ratio and the polyA tail allowing for highest expression will be used for subsequent experiments.
[0119] 50% UTP substitution and extension of the polyA tail by 150 bases will lead to the maximal expression levels of CXCL13 both in vitro and in vivo. If time allows, in addition to the variables described above (substitution, polyA, length), 10% sucrose will be added to our LNP formulations to improve the overall stability of LNP based vaccines.
[0120] The protective capacity of Cxcl13-mRNA adjuvanted viral and bacterial mRNA vaccines in experimental challenge models will be evaluated. Expression of a Cxcl13-mRNA genetic adjuvant may enhance vaccine protection against viral and bacterial challenge. Animals will be immunized with Cxcl13- adjuvanted mRNA vaccines encoding viral (SARS-CoV-2 RBD antigen) or bacterial antigens (pertussis antigens), and subsequently challenged with pathogen or toxins to evaluate the protective capacity and immune correlates.
[0121] Cxcl13-mRNA can adjuvant mRNA vaccines such as mRNA-1273 and improve the humoral response to the spike antigen, as shown in FIGS.6A and 6B. Currently, mRNA vaccines are used for protection against viral infection, and various additional mRNA vaccines are currently under development against bacterial pathogens. To broaden the impact of this work and translation to the future of the mRNA vaccine landscape, the effect of Cxcl13-mRNA on protection will be tested using two challenge models, SARS-CoV2 and B. pertussis. mRNA vaccines are available for both pathogens.
[0122] The antigens included in experimental and approved COVID-19 vaccines have evolved over time. Our first studies with COVID-19 vaccine formulations contained the SARS-CoV2 WA1Attorney Docket Number: WVU 3065-PCT (Washington 1 or Wuhan like ancestral virus) Receptor Binding Domain (RBD) of the Spike protein to cross reacting material of Diphtheria toxoid (CRM)24, and were protective against WA1 and Delta variants. To provide protection against Omicron variants, the formulation was improved by antigen linkage via a Spytag over to Hepatitis B virus like particle, pairing with BECC 470 (TLR4 agonist) adjuvant and intranasal delivery. The RBD is sufficient for protection, and that the full S1 and S2 domains are not necessary.
[0123] In previous work, an attenuated flu strain expressing RBD in place of its neuraminidase (ΔNA(RBD)-Flu) was developed. To facilitate the surface expression of the RBD, the murine immunoglobulin H chain V-region leader sequence was added to the N-terminus. The transmembrane region and cytoplasmic domain of murine B7.1 (CD80) was added to the C-terminus to tether this protein to the cell membrane. This attenuated flu vaccine was then used to intranasally immunize mice which were able to induce anti-RBD IgA and IgG responses and were protected against SARS-CoV-2 viral challenge.
[0124] This strategy will be used to design an mRNA-encoded RBD antigen that is expressed on the surface of eukaryotic cells via the B7.1 transmembrane domain. This RBD-B7.1 antigen construct has been synthesized with both wild type ancestral and Omicron BA.5 mutations. This novel RBD-B7.1 antigen will be used in the SARS-CoV-2 challenge studies and will be compared with commercial mRNA COVID-19 vaccines (mRNA-1273, mRNA-1273.222, or mRNA-1283.
[0125] Regarding diphtheria, tetanus and pertussis antigens, the impact of Cxcl13-mRNA on responses to vaccines against bacterial pathogens will be evaluated. As model, a multivalent DTP mRNA pertussis vaccine will be used, containing the same antigens as DTaP alum adjuvanted sub- unit vaccine. The mRNA DTP vaccine that will be used in these studies contains 5 mRNA antigens: diphtheria toxoid, tetanus toxoid, pertussis toxoid (PTXA), truncated filamentous haemagglutinin (MCD), and pertactin (PRN). This simplified formulation is highly protective and best mimics the DTaP licensed formulations. A proposed mRNA genetic adjuvant Cxcl13 sequence is shown in FIG. 4B.
[0126] Mice will be primed and boosted with COVID-19 or DTP antigens. The first goal will be to measure the effect of inclusion of Cxcl13-mRNA on the humoral response. Based onAttorney Docket Number: WVU 3065-PCT optimizations performed in SA1, 0.5 to 1µg of Cxcl13-mRNA will be paired with 1µg (or less) of total mRNA antigen load. These studies will be performed in C57BL / 6 mice.
[0127] For studies with the pertussis vaccine, mice will be immunized intramuscularly with: licensed COVID (mRNA-1273 / mRNA-1283 at 1 / 40th human dose, positive control for SARS- CoV2), RBD-B7.1 mRNA, or RBD-B7.1 mRNA + Cxcl13- mRNA. Adjuvant and antigen mRNA will be packaged into separate LNPs as this is the field standard for bi-valent COVD-19 vaccines.
[0128] For studies with the pertussis vaccine, responses to DTaP (1 / 40th human dose; positive control for pertussis studies), mRNA-DTP, and mRNA-DTP + Cxcl13- mRNA will be compared.
[0129] The doses of vaccines were selected through in-depth characterization of the dose- response to vaccination in mice with both SARS-CoV2 and pertussis vaccines. Partially protective doses that will allow the detection of improvements of the vaccine response in response to formulation with Cxcl13- mRNA have been selected. Mice will be primed at 8 weeks of age and boosted 4 weeks later. One set of mice will be euthanized at 16 weeks post prime, and the second set will be followed out to six months post prime.
[0130] Antigen-specific IgG responses will be measured using ELISA at 5 weeks, 16 weeks, and 6 months post-prime using methodologies well-established in our laboratories. For SARS-CoV2 studies, antibody function will also be tested using plaque assay formation and live WA-1 and XBB1.5 omicron variants. In addition, at 16 weeks and 6 months post-prime, the cells in the spleen, inguinal lymph nodes, and bone marrow will be extracted, prepared as single cell suspensions, and used for B cell ELISPOT assays 5. To detect humoral responses against SARS-CoV2, ancestral WA- 1 and Omicron XBB1.5 full length recombinant RBD will be used. For B. pertussis, we have produced diphtheria, tetanus, PTXA, FHA, and PRN which will be used as antigens.
[0131] The number of antigen-specific memory B cells will be measured using fluorophore- labelled antigen-oligo conjugates. This strategy was used to identify OprF antigen-specific cells from mice immunized with Pseudomonas aeruginosa OprF and have adapted it to identify antigen- specific B memory cells relevant to this work (PTXA and FHA for pertussis or RBD for COVID- 19). The proteins will be recombinantly expressed with Avi-tag. Each recombinant Avi-tag biotinylated proteins will be mixed with fluorophore conjugated streptavidin, and a different color of fluorophore will be used for each antigen for multiplexing. The memory B cells will be isolatedAttorney Docket Number: WVU 3065-PCT using a Miltenyi murine memory B cell isolation kit. The memory B cells will be incubated with fluorophore-labelled antigen conjugates and analyzed using BD LSR Fortessa. The effect of adding Cxcl13-mRNA to COVID-19 and pertussis mRNA vaccines on the humoral response triggered by these vaccines will be determined. This will be measured by: 1) total antigen specific IgG antibodies (ELISA), 2) amount of antibody producing B cells in bone marrow, lymph nodes and spleen, and 3) amount of antigen specific memory B cells. Formulations containing Cxcl13-mRNA + mRNA antigen will be compared to formulations with mRNA antigens alone. Cxcl13 can enhance antibody responses to mRNA COVID-19 vaccines and an RBD COVID-19 antigen will be used as well as the 5-antigen DTP vaccine.
[0132] Since early in the pandemic the hACE2-mouse has been used to evaluate numerous candidate vaccines including: RBD-CRM conjugates, VLP-RBD, mRNA vaccines, and intranasal vaccines. All major variants of SARS-CoV-2 have been studied in mice and hamsters including: ancestral, alpha, beta, delta, BA1 omicron, BA5 Omicron, and we have obtained XBB1.5 for these studies as it best represents the circulating strains and it has a robust morbidity and mortality phenotype in hACE2-mice. Virus stocks are cultured in BSL-3 conditions and sequenced for quality control to avoid potential passage mutations. We will challenge mice with 104PFU which is a lethal dose and overall protection will be measured using a survival curve. We will then perform a timepoint study to determine the plaque forming units (PFU) of virus at 2 days post challenge. We will then perform correlation analyses between survival, viral burden, and the correlates of protection measured in SA2.1. We will use the vaccine groups, schedule, and route described in SA.2.1. For this sub-aim we will use male and female C57BL6 / J hACE2 mice and we expect to utilize 220 mice total.
[0133] hACE2-mice are an excellent model for evaluation of protection against SARS-CoV-2; however, this model has several caveats, such as discrepancies between hACE2 transgenic expression and ACE2 expression in humans. Hamsters express an ACE2 receptor very similar toAttorney Docket Number: WVU 3065-PCT humans. We will evaluate the vaccines studied in the hamster model as well. Hamsters will be euthanized 2- and 6-days post challenge and serum and tissues will be collected. Nasal tissues will be processed for histopathology and IHC analysis to determine viral antigen localization. In addition to the timepoint study we will also perform a survival curve comparing the protection afforded by the Cxcl13 mRNA genetic adjuvant. In these studies, we expect to use a total of 120 total hamsters.
[0134] While evaluating the novel mRNA DTP-10 vaccine, we were able to identify a partially protective dose (1 / 160th human dose). We will use this partially protective dose to test the hypothesis that Cxcl13-mRNA can improve protection against challenge with B. pertussis. C57BL6 / J mice will be vaccinated using DTaP, mRNA DTP5, or mRNA DTP5 + Cxcl13-mRNA. As additional control, mice will be immunized with either a high (1 / 40th) or low dose (1 / 160th) DTaP or DTP vaccine. We will evaluate bacterial burden at 1, 3, and 7 days post challenge.
[0135] Pertussis toxin causes numerous issues inside the host including leukocytosis and neutrophilia. Pertussis toxin is an AB5 toxin that binds and causes toxic effects on many mammalian cells. In vitro analysis of PT can be done with CHO cells and various other assays. However, we have realized that antibodies that neutralize PT in vitro don’t always function in vivo. To test neutralization in the relevant setting, we developed a simple intoxication model in mice. Delivery of active pertussis toxin into mice by intraperitoneal injection results in systemic increases in total white blood cells, specifically the lymphocyte and leukocyte populations which are the hallmark effects of pertussis toxin and occur during B. pertussis infection (paper accepted at npj Vaccines). Injection of 1µg of pertussis toxin into 20 g mice results in ~15,000 white blood cells per µl of blood (baseline levels = 1000 cells µl). Immunization with 10 µg of mRNA-DTP10 lead to a very strong neutralization of PT activity. Based on these data, we propose that a lower dose of mRNA (1µg) will not fully suppress PT-mediated leukocytosis and will allow to observe the effects of Cxcl13-mRNA. C57BL6 / J mice will be vaccinated with Cxcl13-mRNA. One set of mice will receive 1 µg PT injection while the control group will receive vehicle control. We expect these experiments will demonstrate the superior PT neutralization capacity of antibodies of a vaccine group adjuvanted with Cxcl13-mRNA.
[0136] We anticipate that inclusion of CXCL13 will enhance the humoral response, leading to greater antibody titers, higher neutralization, and increased B memory compartment. We expect thatAttorney Docket Number: WVU 3065-PCT this will correlate with increased protection against challenge. If time and resources permit, we will evaluate long-term (6 month-1year) responses for both RBD and DTP mRNA antigens. We have performed numerous experiments with lowered vaccine does in order to find levels of immunity with which we can model enhanced responses due to inclusion of the Cxcl13 genetic adjuvant. However, this exact level of immunity may need to be further dissected to test the Cxcl13 mediated enhancement of humoral immunity. We do not anticipate challenges with expression and activity of the mouse CXCL13 in hamster, as sequence comparison between mouse and hamster show high level of conservation. If needed, we will re-clone and produce a hamster specific CXCL13 to enable these studies.
[0137] We have proposed four distinct challenge models in these studies, but if time permits we could use a coughing rat model of pertussis to evaluate enhanced protection in the coughing model. The rat CXCL13 is highly similar to that of mouse CXCL13.
[0138] Tracking cells that are expressing mRNA antigens and adjuvant will reveal the underpinning events that lead to enhanced immunogenicity and memory responses. LNPs co- formulated with fluorescent tracers will facilitate the study of early immune events that lead to B memory responses and longer mRNA vaccine immunity. Cxcl13 improves antibody responses to mRNA COVID-19 vaccine. The primary producers of CXCL13 in the lymph node are follicular dendritic cells (FDC) and Tfh cells. There are two main paths that antigens can use to generate germinal center responses that results in antibody producing cells (long-lived plasma cells) and memory cells including B memory and Tfh memory cells.
[0139] An antigen recognized as non-self can be opsonized by circulating antibodies or complement. The macrophages in the lymph node subcapsular sinus (SCS) express CR1 and CR2 complement receptors. SCS macrophages present and transfer antigen over to follicular B cells that then can deliver the antigen to the FDC. B cells are attracted to the FDC because of CXCL13. CXCR5+ cells are drawn to the FDCs loaded with antigen. If B cells have a B cell receptor (BCR) that can bind the antigen, they are rewarded with survival signals that allow them to proliferate and cycle through somatic hypermutation to improve the antibody affinity and the germinal center reaction grows to build antibody producing cells.Attorney Docket Number: WVU 3065-PCT
[0140] Not much is known about CXCL13 and how it is regulated by FDC. The second pathway that gets antigen into the lymph node is the direct delivery by dendritic cells (DCs). mRNA vaccines are expressed and presented by DCs. mRNA vaccine can be detected in the lymph nodes (LNs) due to transfer of DCs from the injection site to the LN. DC expression of the mRNA construct is the main pathway that drives follicular responses to mRNA vaccines. It is likely that the DCs produce antigens, and also present antigens on Major Histocompatibility Complex (MHC) Class I and MHC Class II Proteins. DCs are not a natural producer of CXCL13. When Cxcl13 mRNA is taken up by the DC, this enhances B cell migration and follicle formation leading to stronger germinal center reactions. In this aim, the timing of mRNA adjuvant and antigen uptake may be determined using a combination of fluorescent tracer dyes and cellular phenotyping.
[0141] Cells that have taken up mRNA antigen and adjuvant LNPs will be tracked. Cells that have received LNP will be tracked using a far-red fluorescent, lipophilic carbocyanine referred to as DiD (1,1'-Dioctadecyl-3,3,3',3'- Tetramethylindodicarbocyanine, 4-Chlorobenzenesulfonate Salt, λ- excitation = 644 nm, λ-emission = 665 nm). The DiD tracer dye is formulated into LNPs and delivered by intramuscular injection into mice. B cells, in both the lymph node and spleen, that have been delivered mRNA take up DiD-labeled LNP. Along with DiD, a DiO fluorescent tracer that will emit in the green channel (λ-excitation =484 nm, λ-emission = 501 nm) will also be used to distinguish between antigen and adjuvant. LNPs will contain mRNA antigen (RBD or DTP antigens) or Cxcl13 mRNA. The adjuvant LNP will be packaged with DiD tracer and the antigen LNPs will be packaged with DiO tracer. Mice will be immunized with the tracer labeled LNPs, and intravital imaging will be used to characterize the relative spatiotemporal kinetics of the cells that have taken up the tracer labeled LNPs. Surgically implanted lymph node window chambers allow mice to be profiled in real-time to monitor fluorescent LNP uptake and capture early immune responses to immunization. Intravital imaging studies will establish timepoints of highest fluorescent LNP uptake where mice will be euthanized post injection, e.g., between 6 – 12 hours post injection. Flow cytometry will be used to quantify and phenotype DiO+ and DiD+ cells.
[0142] We will then build a comprehensive interaction network of the early events post immunization and before the germinal center reaction. DCs that are expressing both antigen and adjuvant will migrate into the lymph nodes and spleen. Histopathology will be performed usingAttorney Docket Number: WVU 3065-PCT peanut agglutinin (PNA) to label germinal centers. More total germinal centers per lymph node (inguinal and popliteal) and spleen section will be found, as compared to both non-immunized animals as well as animals immunized with DTP / COVID-19 control vaccines.
[0143] The strategy for the tracer labeling of the early responding cells provides an opportunity to characterize the effects of mRNA vaccine expression on single cells. As mentioned, CXCL13 is not naturally produced by DCs. CXCL13 expression may impact the phenotype of the APC. MHC-I and MHC-II expression may be increased. The DCs may have enhanced expression of migration factors. DCs express antigen and migrate to the lymph node, and the genetic adjuvant may facilitate this process. Fluorescence-activated cell sorting, or FACS, will be used to sort out the DiO, DiD, and DiO / DID double positive cells. The cells will then be used for single-cell RNA-sequencing (scRNA- seq) analysis. DiO, DiD, and DiO / DID double positive will be analyzed and compared in relation to naïve mice or mice administered DTP / COVID-19 commercial vaccine controls.
[0144] This discovery analyses may reveal new cell types not considered with our cell surface marker staining approach. For these studies we will evaluate the injection site (muscle), draining lymph nodes, and spleen. Furthermore, we will analyze the bone marrow so that we may pair antibody sequences from the germinal centers and correlate with the B memory analysis. We have recently performed these scRNAseq analysis such as this on lymph node, spleen, PBMCs (mouse and human), and other tissues. We will also focus on the antigen and adjuvant expressing DC cells as we propose these cells are critical to protective vaccine responses to mRNA vaccines. Overall, these studies will shed light on the early events and immunology of mRNA vaccines that are not well understood despite the success of the platform.
[0145] CXCL13 has encoded into the genome of a rabies virus and used as a vaccine. The CXCL13 producing strain was able to cause increased Tfh, GC B cells, and production of antibody producing plasma cells. mRNA Cxcl13 delivery may accomplish the same effects. The next phase of humoral immunity will be evaluated by measuring the number of Tfh and GC Bcells at various timepoints using flow cytometry and intravital imaging. CXCL13 production in both the serum and lymph nodes, the number of Tfh cells, and the number of GC B cells to the total number of GCs will be measured. The number of antigen specific plasma cells in the bone marrow will be evaluated using B cell ELISPOTs.Attorney Docket Number: WVU 3065-PCT
[0146] Tracer-based tracking experiments will be used to determine what cells have received mRNA vaccine antigen as an adjuvant. Intravital imaging will establish these kinetics and cell phenotyping will allow us to characterize the vaccine induced populations. The scRNAseq approach will allow consideration of the impact of mRNA adjuvant on specific cells. We have clear data on the levels of CXCL13 in serum and lymph nodes, we will also study the cell populations impacted by the mRNA adjuvant. We expect to be able to follow these cells for several days post prime or boost immunization. While the single cell approach will be interesting, we can alternatively use FACs sorting and bulk RNAseq to increase the depth of information.
[0147] In humans, CXCL10 expression is high in patients with severe disease in the early months of the pandemic before COVID-19 vaccines were implemented. In hACE2-mice, Delta variant induced the highest levels of CXCL10 observed in any bacterial or viral challenge studies. These observations prompted for the need to consider the role of CXCL10 in the induction of the adaptive immune response. CXCL10 expression occurs in mice at both the injection site and draining lymph node in response to mRNA immunization. Similar results are observed in humans where mRNA immunization with COVID-19 vaccine induces CXCL10 production in the lymph nodes. CXCL10 production in cells in response to mRNA-1273 vaccine was measured. The vaccine induces production of ~2000 pg / ml CXCL10 at 1 day post incubation. In mice, after intramuscular immunization with mRNA-1273, high CXCL10 production one day post injection is associated with increasing numbers of CD4+ / CD8+ and cDC1 cells, as seen in FIG. 1C to 1F. Expression of CXCL10 at the site of immunization can drive adaptive immune responses to vaccines. Cxcl10 mRNA-based expression may enhance immune responses through: 1) recruitment of APCs to site of immunization, and 2) enhancement of T and B cell responses in the draining lymph node. The main role of CXCL10 in COVID-19 has been described as pathogenic in relation to a cytokine storm; however, controlled CXCL10 expression as a genetic adjuvant may be used to improve vaccine induced immunity.
[0148] Cxcl10-genetic adjuvant constructs as the genetic payloads of LNPs were prepared. The sequence of the genetic adjuvant is mouse Cxcl10 for preclinical evaluations in mice. The mouse CXCL10 coding sequence was codon optimized for efficient translation. The optimized geneAttorney Docket Number: WVU 3065-PCT sequence is constructed to encode the gene flanked by 5’ and 3’ UTRs (β-globin; same as mRNA- 1273 and other mRNAs, as shown in FIG.6). The coding sequence was cloned into a DNA plasmid vector for expression under a T7 promoter. The vector backbone fuses a polyA tail (30 nucleotides) to the 3’ end of the sequence to increase construct stability and facilitates purification. Prior to in vitro transcription, high fidelity PCR was used to amplify a linear template of each construct. In FIG. 6, the 653 bp linear T7-UTR-Cxcl10-UTR DNA template is shown. Then, in vitro transcription (IVT) was performed on the T7-UTR-Cxcl10-UTR DNA template. In this step, Anti-Reverse Cap Analog (ARCA) capping was also applied to the constructs to improve stability and enhance translation in cells. Also during in vitro transcription, 50% of uridine nucleotides can be replaced with the modified nucleobases Pseudouridine-5'-triphosphate (Pseudo-UTP). Pseudo-UTP incorporation dampens innate sensing and interferon responses and is currently used in licensed COVID-19 vaccines. The resulting mRNA constructs are purified, quantified, and analyzed by RT- PCR-sequencing to ensure transcripts contain the desired sequence without mutations. mRNAs were produced in 1-2 mg lots to ensure quality control across experimental batches. mRNAs are stored at - 80°C until LNP packaging.
[0149] To validate our basic prototype construct design, as shown in FIG.6, Cxcl10 mRNA was formulated for liposome-based delivery using in vivo-jetPEI (Polyplus). We compared mRNA-1273 (Moderna) to prototype VDC-mRNA-0001-mCxcl10. In this experiment, the B16F10 mouse melanoma cell line was utilized. The B16F10 cells produce SARS-CoV-2 spike antigen due to incubation with mRNA-1273 vaccine. As shown in FIG.1B, pg / ml of CXCL10 at days 1 and 2 post incubation with vaccine. At 1 µg, mCxcl10 was able to induce superior amounts of CXCL10 compared to mRNA-1273 by B16F10 cells. The Cxcl10 mRNA construct is active and can drive both expression and secretion of the genetic adjuvant protein product. Based on these data, production of mRNA genetic adjuvants and evaluation of their potential in cells is possible. In vitro transcription of the mCxcl10 construct to substitute in the Pseudo-UTP modified nucleobase is underway. Furthermore, HA epitope tags may be used in construct sequences to confirm the cytokine being detected is due to the mRNA construct and not just natural innate sensing of mRNA in liposomes. Nonsense scrambled mRNAs may be used as experimental controls for mRNA sensing.Attorney Docket Number: WVU 3065-PCT
[0150] FIG.7 shows a mRNA genetic adjunct pipeline from DNA to in vitro transcription to packaging to use. mRNA vaccines are produced by in vitro transcription (IVT) from DNA templates. The coding sequences are optimized for their host (mouse or human). The sequences are flanked with standard untranslated region sequences used in other mRNA vaccines. IVT is performed with mRNA polymerase. During transcription, pseudouridine is substituted at a 50% ratio to native uridine to dampen immune recognition of mRNA. mRNA is assayed for purity and concentration to be packaged into standard lipid nanoparticles (100 nm) for delivery into cells in vitro or to be experimentally administered to mice or humans.
[0151] FIG. 8 shows co-administration of mRNA genetic adjuvants to enhance T and B cell responses to drive specific immune profiles to protect against infectios diseases or treat cancer. Proof of principal data with Cxvl10 and Cxcl13 suggests that there are sets of cytokines and chemokines that when expressed by dendritic cells (antigen presenting cells) from mRNA can drive specific immune responses. Table 1 details current adjuvant cocktail sets that have known functions together to drive specific responses. mRNA based genetic adjuvants can enhance antibody production, and a) drive cancer-fighting T cells, or b) push cellular responses to seek and kill pathogens and provide longer vaccine immunity.
[0152] Referring to Table 1, the chemokine CXCL10 T cell and B cell responses, increasing antibody production. Interleukin12 and Interleukin 27 drive immune memory and macrophage recruitment. Transforming growth factor-beta (TGF-beta) and interleukins 6, 23A, 12B, and 1B direct neutrophils to clear pathogens. Interleukins 2, 12, and 15; CCL chemokines 3, 4, and 5; and tumor necrosis factor alpha (TNF-α) prime CD8+ T cells to recognize tumor antigens and attack tumors.
[0153] Each of the above chemokines and cytokines can be produced in vivo using an mRNA vaccine including an mRNA including a coding sequence flanked by a 5’ untranslated region (5’ UTR; SEQ ID NO: 1) and a 3’ UTR (SEQ ID NO: 2). The 3’ end of the 3’UTR may be followed by a polyadenosine sequence (polyA; SEQ ID NO: 3). The coding sequences encoding the chemokines and cytokines is presented in Table 2. Table 2 also presents the identity of the protein encoded by each mRNA sequence, along with the SEQ ID NO, of each protein, where available. Thus, for example, CXCL13 (SEQ ID NO: 5) may be obtained from an mRNA having the structure:Attorney Docket Number: WVU 3065-PCT SEQ ID NO: 1—SEQ ID NO: 4—SEQ ID NO: 2—SEQ ID NO: 3 while interleukin-6 (IL-6; SEQ ID NO: 11) may be obtained from an mRNA having the structure: SEQ ID NO: 1—SEQ ID NO: 10—SEQ ID NO: 2—SEQ ID NO: 3.Attorney Docket Number: WVU 3065-PCT Table 1. Table 2. mRNA Sequence 5’UTR 3’ UTR Coding Encodes protein (SEQ ID NO.) SEQ ID NO. SEQ ID NO. Sequence SEQ ID No. VDC-mRNA-0002 1 2 4 CXCL13 (SEQ ID NO.: 5) VDC-mRNA-0036 / 37 1 2 6 Il-12A; Il-12B VDC-mRNA-0038 / 39 1 2 7 Il-27A; Il-27B VDC-mRNA-0040 1 2 8 TGF-beta (SEQ ID NO.9) VDC-mRNA-0041 1 2 10 Il-6 (SEQ ID NO.: 11) VDC-mRNA-0042 / 37 1 2 12 Il-23A; Il-12B VDC-mRNA-0044 1 2 13 Il-1B (SEQ ID NO.: 14) VDC-mRNA-0045 1 2 15 Il-15 (SEQ ID NO.: 16) VDC-mRNA-0046 1 2 17 Il-2 (SEQ ID NO.: 18) VDC-mRNA-0047 1 2 19 CCL3 (SEQ ID NO.: 20) VDC-mRNA-0048 1 2 21 CCL4 (SEQ ID NO.: 22) VDC-mRNA-0049 1 2 23 CCL5 (SEQ ID NO.: 24) VDC-mRNA-0050 1 2 25 TNF-alpha (SEQ ID NO.: 26)Attorney Docket Number: WVU 3065-PCT
[0154] Another chemokine of interest is CXCL10 (C-X-C motif chemokine ligand 10). As an example, mouse CXCL10 has the protein sequence SEQ ID NO.30. CXCL10 may be obtained from an mRNA having the structure: SEQ ID NO: 1—SEQ ID NO: 31—SEQ ID NO: 2—SEQ ID NO: 3. Alternatively, CXCL10 may be obtained using SEQ ID NO: 32, which includes SEQ ID NO: 31 flanked by 5’ UTR and 3’UTR sequences. While SEQ ID NOS: 1 and 2 are provided as exemplary UTR sequences in mRNA molecules for obtaining CXCL10 and the peptides of Table 2, other UTR sequences known in the art may be used instead. For example, the 3’ poliovirus UTR may be used.
[0155] Analysis of cytokine expression and lymphocytes at one day post priming of mice with mRNA-1273 was performed. High CXCL10 was observed at one and two days post prime with 10 µg mRNA-1273, but 10 µg (1 / 10thof a human dose) is a high dose of mRNA vaccine for mice. Therefore, a vaccine titration experiment was performed to identify appropriate mouse doses of mRNA vaccines and to establish an mRNA vaccine waning immunity model. Mice were immunized with 10 to 0.16 µg (1 / 10th to 1 / 640th human dose) of COVID-19 vaccine (mRNA-1272) and serum cytokines were analyzed 24 h after. Not surprisingly, as the dose of vaccine was lowered, CXCL10, CXCL13, and interferon gamma levels decreased in correlation to lowering of dose (FIGS.1D to 1F).
[0156] Levels of immune cells were studied in various tissues following intramuscular vaccination with mRNA-1273. FIG.19H shows levels of CD4+ T cells in the muscle and lymph nodes following vaccination. FIG.19G shows levels of CD8+ T cells in the muscle and lymph nodes following vaccination. FIG. 19E shows levels of macrophages in the muscle and lymph nodes following vaccination. Each of these immunologically active cell types is as high or higher in the lymph nodes as in the muscles following vaccination. Cell populations in FIGS. 19C to 9H are indicated as number of cells per tissue.
[0157] T cells, macrophages and dendritic cells follow the same trend, decreasing in correlation with less antigen. Lower vaccine dosages caused lower detectable amounts of each cell population (FIG.1G). The amount of RBD specific antibodies in each immunized group (10 to 0.16µg) was tracked from 2 weeks post prime to 26 weeks post prime (FIG.17A). The 10µg dose induced the highest amount of RBD specific antibody detectable in blood; however, over the 26 weeks, theAttorney Docket Number: WVU 3065-PCT antibody level decreased to 40 percent of its original level (FIG. 17A). Lower doses of mRNA vaccine, e.g., 2.5 to 0.63 µg, resulted in rising antibody levels between priming and boosting before they began to decline 7 weeks later. However, these lower doses of vaccine resulted in lower rates of waning antibody levels. These results demonstrate that it is critical to use the correct mouse doses of vaccine to evaluate waning immunity as well as to measure the effect of the inclusion of novel enhancers such as new adjuvants. Referring to FIG. 28, high titers of COVID-19 antibodies exceeding 100,00010 weeks after boost correlated with high CXCL10 levels after vaccination.
[0158] FIGS. 9A to 9C shows bioluminescent tracking of mRNA expressing cells post intramuscular immunization. Mice with lymph node window chambers are immunized with lipid nanoparticles containing mRNA with luciferase (FIG.9A). The luciferase allows those cells to glow and be imaged by in vivo imaging systems. mRNA containing cells migrate from the injection site to the lymph nodes (FIG.9B). As seen in FIG.9C, inguinal lymph nodes show greater radiance, and hence a higher concentration of luciferase mRNA, than popliteal lymph nodes. Dendritic cells can deliver cytokine and chemokine payloads to the lymph nodes to promote responses. Analysis of vaccine responding cells at one day post boost with mRNA-1273.
[0159] Almost all vaccines administered to the human population are delivered in multiple dose programs because the immune system is built to drive responses based on repeated exposures. Prime immunization, or initial exposure, typically results in the production of IgM antibodies and some T cell differentiation. However, as antigen is re-introduced by booster doses of vaccine or re-exposure to an immunogen, germinal center responses will coordinate stronger T cell differentiation leading to the more efficient production of antibodies due to engagement of T follicular helper cells. Secondary immune responses lead to generation of recall immunity through the production of clonal B memory cells. mRNA vaccines were also implemented using a two-dose prime / boost schedule. The recall responses result in an increase in plasma cells being produced that can then seed the bone marrow to produce more antibody over time. Eventually, these antibody production rates decrease due to the natural turnover of the body’s cells. Plasma cells can produce antibody for what is accepted as “long term,” however, even these cells will eventually die. Hypothetically, measures could be taken to target these cells directly, enhancing the populations of plasma cells while simultaneously feedingAttorney Docket Number: WVU 3065-PCT them the signals necessary for their activity.
[0160] Studies performed prior to COVID-19 showed that antigen presenting cells were a major cell population that translate mRNA antigens. In those studies, labeled mRNA was used to show that those APCs that harbor mRNA from the vaccine traffic it to the draining lymph node for germinal center reactions. Furthermore, it was shown that interferon inducible genes were expressed along with genetic adjuvant CXCL10. To evaluate lymph node responses to immunization with mRNA, we vaccinated mice with mRNA-1273 and at one day post administration, we harvested the injection site muscle and drained lymph nodes. The tissues were prepared as single cell suspensions and loaded into Honeycomb HIVE single cell analysis devices. These devices allow for capture of cells, stabilization, cell lysis, transcript capture, and preparation of scRNAseq libraries to dive deeply into the gene expression of individual cells. We compared cells from mice that received an injection of buffer to mice that received a 10µg dose of mRNA-1273. This dose was selected as it had previously used to show protection against SARS-CoV-2 challenge in hACE2-transgenic mice.
[0161] Upon mRNA-1273 immunization, signaling by interleukins, NF-κB signaling and overall cellular stress responses were increased in both B and T cells. This overall population is comprised of the central responders to mRNA vaccination. CXCL10 in the muscle and lymph nodes correlates with cell recruitment at these timepoints. This experiment provided an in-depth look at those early responding cells. Additionally, this experiment showed us the value of single cell RNAseq to discover novel genetic adjuvants. Genetic adjuvants that enhance early germinal center responses will result in more durable and protective immunity.
[0162] The human genome encodes around 200 cytokines and chemokines. Many of these have been evaluated as immune stimulators in combination with DNA vaccines. Due to the flexibility of the mRNA platform and relative ease of manufacturing, we can use the specific version per each model and activity. Human genetic adjuvants will be screened for activity in vitro in human cells. If these genetic adjuvants induce favorable responses in the high throughput screens, we will clone, express, and produce mouse variants for in vivo animal studies. The selection of cytokines was restricted to those that have orthologs in both humans and mice. Finally, we selected proteins that are functional as monomers or homodimers only to simplify their assembly and function in vivo. In FIGS.12 A-12C, the candidate cytokines have been grouped by families with their correspondingAttorney Docket Number: WVU 3065-PCT protein names, known primary receptors, and their known producer cells, with a legend in FIG.10D. This list of candidates can be classified based on literature into five main families: colony stimulating factors (CSFs), interferons, interleukins, tumor necrosis factors (TNFs), and chemokines. Multivariate analysis for grouping candidate mRNA genetic adjuvants to maximize biological diversity for screening and candidate selection.
[0163] Within the candidate genetic adjuvants, pleiotropy exists with overlap of some cytokines or chemokines acting on similar receptors, as shown in FIGS. 10 and 11. Therefore, there is an expected redundancy among the candidates, albeit with an acknowledgement that there may be subtle but distinct differences among responses induced. There is, therefore, a need to prioritize these candidates for screening in a manner that maximizes the biological diversity covered. The selected cytokines and chemokines are classified according to their sequence or structural similarity and corresponding receptors. While these cytokines or chemokines may have sequence similarity and structural relatedness, most have distinct functional roles. Some candidates have similar effects, but not all cytokines or chemokines will have the same potency or effects. Using this strategy, data is systematically collected for cytokines / chemokines that range across the biological design space of target receptors, protein sequences, and cellular producers; these data will inform an iterative experimental approach to optimize lead adjuvant candidates using an Active Learning-based model. The cytokines to be evaluated in this study are grouped by their corresponding families, as discussed above and shown in FIGS.11-12.
[0164] Existing adjuvants like CpG-1018, LPS, MPLA, and MF59 have established benefits for enhancing the immunogenicity of vaccines with acceptable safety profiles. These adjuvants modulate the innate and adaptive immune systems to respond through one or more mechanisms that induce a pluralistic response of cytokines, chemokines, and other signals—that is, the biological response they induce is multi-faceted. Formulation of mRNA vaccines with these existing adjuvants can be complicated and may impact the stability or performance of this new class of vaccine. If an adjuvant added to an mRNA vaccine induces strong interferon responses with high similarity to viral infection, the interferon could drive decreased protein translation in cells, thus abrogating the mRNA vaccine’s effectiveness.Attorney Docket Number: WVU 3065-PCT
[0165] Use of genetically-encoded versions of one or more critical signal peptides downstream of the pathways activated by existing adjuvants can induce similar or improved immunogenicity of a vaccine. This requires determining both the composition and concentration of these signals to be included with an mRNA-encoded antigen. Given the plurality and pleotropic nature of these signals, and the potential safety considerations of these cytokines / chemokines, it is critical to use an approach to advance and optimize lead candidates that considers and evaluates a multiplicity of benefits and costs of including one or more factors in a candidate formulation.
[0166] Traditional methods to optimize the selection of lead candidates in drug screening or vaccine formulation rely on statistical methodologies like Design of Experiments (DoE) to evaluate a multiplicity of factors to optimize each one in a given design space (for example, the identity of an adjuvant and its concentration in a formulated candidate). The number of experiments required in these methods depends strongly on the number of factors evaluated, and often can exceed 1000’s of experiments for multi-factor optimizations (e.g., vaccine formulations), making it too costly or labor- intensive to adequately evaluate all potential combinations of cytokines. Another intrinsic limitation to these methods (based on their designs for testing a limited set of conditions) is that the mathematical fitting of the data depends on linear or quadratic regressions and may not capture non- linear behaviors in the system evaluated. For the work disclosed herein, evaluating 96 different cytokines / chemokines for potential benefits as genetic adjuvants, the scope of experiments required for the optimization of the selection of lead candidates is beyond feasibility using these standard approaches.
[0167] Advances in Machine Learning (ML) and mathematical optimization now allow new algorithmic approaches to improve the efficiency of evaluating a design space experimentally. One pragmatic and beneficial type of ML for optimizations—like that required to identify beneficial genetic adjuvants—is called Active Learning. This approach uses both the experimental conditions tested and corresponding response data to develop mathematical models that serve as a surrogate or digital replica of the real experimental system. Subsequently, evaluation of different experimental conditions can be performed to select only a few relevant experiments for further evaluation in the real system based on a defined objective function. This process may be performed recursively for multiple cycles (typically a small number) until convergence is achieved, as determined byAttorney Docket Number: WVU 3065-PCT agreement between model predictions and experimentally observed outcomes. This computer- assisted approach to experimental optimization will be used to guide the selection of lead candidates (comprising either individual cytokines or combinations) for each pool of factors tested for follow- up evaluation in animal models for in vivo responses.
[0168] An Active Learning algorithm comprises two main components: (i) a Surrogate model, and (ii) Optimization. The Surrogate model mimics the experimental system in silico based on the data collected up to that point. The Optimization component interacts with the Surrogate model to provide a set of additional experiments needed. Subsequently, new data are collected for the suggested set of experiments and the Surrogate model is updated with the new data. This process of model building and experimental suggestion proceeds iteratively.
[0169] In the Optimization component, the goal is to use the developed surrogate model to guide the design of an optimal set of experiments for further evaluation, based on a predefined objective or goal. One of the objectives might be a complete characterization of the system, that is, to establish a model and data to quantify a target property across an entire design space (e.g., all responses for all genetic adjuvants). Most often, however, experiments are associated with a more targeted goal, e.g., maximizing the immunogenicity of the adjuvant combination and minimizing dose concentration. In such cases, combinations predicted to have unfavorable outcomes, e.g., combinations of a genetic adjuvant and an antigen predicted to require excessive doses or to have low immunogenicity, are selectively ignored iteratively, thus reducing the overall number of experiments.
[0170] For candidate genetic vaccines, e.g., mRNA strands encoding cytokines or chemokines, genetic vaccines that show favorable activity and responses in the cell lines and primary cells, mouse-specific ortholog sequences will be encoded and produced for evaluation in animals. Lead candidate genetic adjuvants comprising one or more mRNA-encoded genes will be co-formulated with vaccines for in vivo immunogenicity studies including antibody and T cell response analyses. Genetic adjuvants that significantly potentiate these responses will be further evaluated in pathogen challenge studies to determine the added protective capacity of each novel vaccine formulation. From here, lead candidate vaccines will then be evaluated to demonstrate their pathway activationAttorney Docket Number: WVU 3065-PCT and determine the structural domains necessary for adjuvanticity.
[0171] This systematic approach to assess the candidate cytokines / chemokines will further allow improved predictions of combinations. In the final stage of the program, we will perform combinational studies in vitro and in mice and compare the data to the single adjuvant studies. This strategy is a first-of-its-kind approach that intercalates immunology and AI / ML in a synergistic program to discover novel mRNA adjuvants. Computational analysis for prioritization of the candidate pool to maximize diversity evaluated.
[0172] An aspect disclosed herein is the evaluation and selection of genetic adjuvants for in vivo testing from the candidate sets. Prior knowledge from the literature provides a general framework for the biological effects of different cytokines and chemokines, as shown in FIGS.10A-10C and 11-12. There is known pleiotropy among the candidate sets selected for this proposal. Furthermore, to maximize the translational potential for one or more genetic adjuvants tested here for mRNA vaccines with respect to safety, efficacy, and costs, the candidate set may be evaluated in vitro to identify complementary and potentially synergistic candidates out of each set. Using a combination of prior knowledge and multivariate analysis of the data collected in the high throughput screens here, we will classify the genetic adjuvants based on similar and differential biological effects.
[0173] To determine a diverse set of cytokines and chemokines for our initial evaluations, each of the 96 cytokines and chemokines was annotated with the corresponding primary receptors that it binds to and the cells that express these cytokines / chemokines, as shown in FIGS.10A-10C and 11- 12. Additionally, the amino acid sequences of all the selected cytokines and chemokines were collected. Subsequently, a vector representation of these sequences was obtained by processing them through an encoder-decoder language model developed in-house, trained on the entire human proteome. Classification of genetic adjuvants based on in vitro responses.
[0174] The data acquired in the high throughput screens will comprise transcriptomic expression data (bulk and single-cell RNA-seq) as well as direct measurement of cytokines / chemokines andAttorney Docket Number: WVU 3065-PCT phenotypic data on cell types for the candidate adjuvants as a function of dose level for each one. Combinations of multivariate analyses from similar data may be used to distinguish biological responses in disease and therapeutic interventions in cancer and food allergies. For example, in lung cancer, disease-specific T cell transcriptional phenotypes were identified, including Th1-effector regulatory T cells and lung cancer-specific dysfunctional CD8+ T cells that are associated with resistance to immune checkpoint blockade inhibition. Clonally distinct transcriptional phenotypes of T cells, including Tfh-like, Th2A-like, and Th1-like phenotypes, among peanut-reactive CD4+ memory T cells were found in the peripheral blood of patients undergoing peanut oral immunotherapy for the treatment of food allergy, and features of pathogenic effector TH2 cells were found in the esophageal biopsies and peripheral blood of patients with the allergic disease eosinophilic esophagitis.
[0175] An approach for developing model-based selection of adjuvants to maximize immunogenic responses with the test vaccines (COVID-19, TB, pertussis) will benefit from the data- driven classification of the candidate genetic adjuvants in the screening phase to prioritize lead candidates (or combinations) for evaluation in vivo in animals as well as pathway analyses to assess the functional responses elicited by the candidates in vivo. High throughput genetic adjuvant screening
[0176] High throughput screening is an automated testing method that allows for the association of compounds to desired effects or activities. Biological pathways can have known effectors, however, by using unbiased approaches, it is possible to “discover” new ways to drive intended outcomes. Human evolution has used high throughput modeling to develop several hundred biological signals that can be applied as therapeutic adjuvants. We will harness natural adjuvants through genetic expression of immunostimulatory protein signals.
[0177] Genetic adjuvants will be screened for their biological activity. In screens relying on cells, we will use human or mouse-specific sequences respectively depending on the cell species being used and in mice we will use mouse-specific sequences. The pipeline for producing the mRNAs begins with basic construct design. Before the screen, we must produce the candidate DNA templates (1), perform in vitro transcription incorporating modifications to enhance function (2),Attorney Docket Number: WVU 3065-PCT purify RNAs (3-4), and formulate the mRNA into lipid nanoparticles (5). As described above, we select the mouse or human coding sequences per each activity or sub-task. For example, we will use human coding sequences for the initial screen of each candidate in HEK293 human kidney cells. The leading objective will be to confirm that the mRNA genetic adjuvant can be expressed by cells (6). Next, we will need to determine that each candidate has an activity after expression (7). We will use human PBMCs containing cells that express all of the target receptors for our cytokines and chemokines (8). Single-cell RNA-seq analysis will be used to determine what cells express the mRNA adjuvant product (cytokine / chemokine) and what cells respond to the presence of the expressed adjuvant (9). As described above, we have used single cell analysis to identify the interferon gene-expressing cells that respond to the production of the prototype Cxcl10 genetic adjuvant. We will also perform scRNA-seq analysis on cells co-incubated with control adjuvants and vaccines. These baseline data will be used to perform statistical comparisons and facilitate model design. Lead candidate mRNA genetic adjuvants will be constructed with mouse ortholog sequences for animal studies. We will perform toxicology studies on the candidates. We will aim to identify candidate adjuvants that show improved features compared to known control adjuvants based on enhanced levels of cytokine expression, activation of relevant cell types (e.g., CD8+ T cells), or activated pathways of effector genes (e.g., interferon pathways). Using a ML-based Active Learning approach, we will also constrain this optimization to minimize the number of mRNA components required, and concentrations of each. In this way, we will select candidate formulations of genetic adjuvants for further in vivo assessments.
[0178] We have established a pipeline for mRNA production. We appreciated the need for proper UTRs to stabilize mRNAs. The first step of the pipeline is to select the coding sequence of the gene corresponding to the cytokine or chemokine. We next evaluate its coding sequence and perform codon optimization which incorporates codon swaps that will improve protein translation in the host of choice. We next add 5’ and 3’ β-globin UTR sequences that are commonly used in both COVID- 19 vaccines. Since we want the translated proteins to be secreted in the same manner as they are natively, we will keep their natural secretion signals that occur within the coding sequences. In the case of CXCL10, this has allowed for secretion of the protein from cells that were incubated with liposome-mRNA formulations. Once a candidate genetic adjuvant sequence is established, we willAttorney Docket Number: WVU 3065-PCT fuse the sequence to a T7 in vitro transcription vector. Each candidate is provided with a simple VDC-mRNA-000X number to indicate its unique coding sequence. The DNA is then synthesized, fused into the DNA plasmid vector. DNA sequencing analysis is used to confirm the authentic and intended DNA coding sequence is achieved downstream. Each DNA vector encoding the candidate genetic adjuvant, will contain six constant design features. First, a T7 promoter (SEQ ID NO: 27) is located upstream of a β-globin 5’ UTR (FIG.4B) followed by a Kozak sequence (for eukaryotic ribosomal binding) immediately in front of the start codon reading frame of the genetic adjuvant. The codon optimized coding sequence is next followed by a standard “triple stop” codon sequence to end translation (FIG.4B). After the coding sequencing, a 3’ UTR for stabilization is encoded in the DNA followed by a string of 30 adenine nucleotides to form a poly A tail (FIG.4B). Some mRNA vaccines have longer poly A tails, and this feature could be investigated if we need to achieve higher stability and expression. In our studies with Cxcl10, the standard 30 amino acid long poly A tail has appeared sufficient for expression. The last feature of the DNA template is a set of flanking primers (SEQ ID NOS: 28 and 29) that bind the plasmid sequence before the T7 promoter sequence (SEQ ID NO: 28) and after the poly A tail sequence (SEQ ID NO: 29). There is a T7 terminator incorporated between the polyA and the flanking reverse primer which signals the end of T7 transcription. These primers will be common for all genetic adjuvants as they match to the backbone of the base plasmid (FIG.4B). Working with these primers, we have established optimal PCR conditions to produce linear DNA templates for the next methods sub-section. Using a common set of flanking primers for PCR generation of transcription templates streamlines our production pipeline by avoiding case-by- case primer pair optimization. In vitro transcription of mRNA genetic adjuvants.
[0179] Linear DNA templates that have been Sanger sequencing confirmed, will be produced to sufficient mass for in vitro transcription (IVT). Standard T7 RNA polymerase will be used to produce mRNAs from the linear DNA templates. IVT will be performed in RNAse free environments and sterility will be maintained using biosafety cabinets. NEB T7 RNA polymerase will be used in combination with the modified nucleobase Pseudouridine-5'-triphosphate (Pseudo- UTP; TriLink Biotechnologies). We will aim for 50% incorporation of Pseudo-UTP, matching theAttorney Docket Number: WVU 3065-PCT substitution level found in COVID-19 vaccines. CleanCap® Reagent AG, which is a co- transcriptional capping reagent for IVT, will be used to add a 5’ cap to the mRNAs. CleanCap has been shown to provide up to 98% capping efficiency. mRNA constructs will be produced in milligram lots to control between batches. We have previously used the NEB ARCA cap, but TriLink CleanCap is a superior modification and will be used in this project. CleanCap technology is co-transcriptional capping reaction that does not require extra purification or phosphatase. CleanCap is also currently directly available in GMP grade. In the next section we will describe the HPLC methods for mRNA construct purification.
[0180] For most genetic adjuvants we will clone the native coding sequence. However, we do appreciate that we may need to add additional epitope tags to our constructs for detection or other experimental advantages. The DNA plasmids that encode each genetic adjuvant construct can be used to generate N term or C term HA epitope tagged (YPYDVPDYA; SEQ ID NO: 34) or 3X Flag- tagged (DYKDHDGDYKDHDIDYKDDDDK; SEQ ID NO: 35) constructs. To generate HA or Flag tagged versions, we will design two sets of primers the amplify two new versions of the construct in two parts. At the overlap point of these fragments, we will add an epitope tag using a third set of amplification primers. After epitope tag sequences are added the two fragments can be used to fuse, fill in, and amplify the non-overlapping sections. This PCR-based method will be used to add epitope tags as needed for confirmation of expression studies. HPLC Purification of mRNA constructs and quality control.
[0181] RNA purification can be performed by many different protocols with distinct outcomes. The use of LNP-encapsulated mRNA vaccine vectors requires that any innate immune response elicited to the vaccine be specific to the antigen-adjuvant payload, not to the foreign mRNA. Kariko and Weissman document that the activation of RNA sensors such as; retinoic acid inducible gene I (RIG-1), and Toll-like receptors (TLR) 3,7 and 8 can sense dsRNA leading to activation of an innate immune response and clearance of the mRNA, reducing translation efficiency of a protein of interest. Kariko and Weissman recognized that HPLC purification results in mRNA that does notAttorney Docket Number: WVU 3065-PCT induce interferons and is translated at 10-1000-fold higher levels in primary cells. Purification of long coding sequences needed for mRNA vaccines is typically performed by HPLC because of all its advantages and overall throughput. HPLC purification also removes unincorporated nucleoside triphosphates and any small, aborted transcripts or double stranded RNAs. Therefore, we will use the nucleotide modifications discussed in A.1.3.3 and HPLC purification to reduce contaminants capable of inducing these non-specific RNA responses.
[0182] RNA for genetic adjuvants will be purified by HPLC using a POROSTMOligo (dT)25 Affinity Resin (Thermo Fisher) column composted of 50 µm polymeric resin designed for the isolation of mRNA A polyhydroxyl surface coating provides low non-specific binding. The surface is functionalized with poly(dT) and allows capture of mRNA though base pairing with the mRNA polyA tail, described in A.1.3.1. The POROS™ Oligo (dT)25 Affinity Resin provides efficient capture and release under standard mRNA purification conditions. The selective nature of this resin allows reduction in plasmid DNA and other transcription mix components. A Vanquish Flex UHPLC System with Diode Array Detector and Fraction Collector (Thermo Fisher) is included within the proposed contract budget as dedicated equipment for mRNA purification to mitigate the risk of RNase contamination and mRNA product degradation. mRNA purification will utilize the following protocol: Equilibrate the column using 3–4 CVs of 10 mM Tris-HCl, 0.5 M NaCl, 1 mM EDTA, pH 7.4; Adjust the mRNA sample mix to approximately 10mM Tris-HCl, 0.5M NaCl, 1mM EDTA, pH 7.4; Load the sample onto the column at 50–150 cm / h; Wash the column with an additional 2–3 CVs of 10 mM Tris-HCl, 0.5 M NaCl, 1 mM EDTA, pH 7.4; Wash the column with 3–5 CVs of 10 mM Tris-HCl, 100–300 mM NaCl, 1 mM EDTA, pH 7.4, or until the conductivity stabilizes; Elute the bound mRNA using 3–5 CVs of 10 mM Tris-HCl,1 mM EDTA, pH 7.4, or 3–5 CVs water. The resulting mRNA will be analyzed for integrity and concentration on an Agilent 4200 Tapestation (FIG.6). Formulation of mRNA genetic adjuvants into LNPs.
[0183] To formulate our mRNA adjuvants into lipid nanoparticles, we will use the Precision Nanosystems Ignite instrument. The Ignite uses the GenVoy Ionizable lipid mix. ALC-0315 and SM102 are the ionizable lipids used in Pfizer and Moderna COVID-19 vaccines, respectively. TheAttorney Docket Number: WVU 3065-PCT Precision Nanosystems GenVoy-ILM is similar to standardly used LNP formulations. LNPs were first designed for liver delivery and their use in muscle is relatively recent. It is now well accepted that these LNPs have high nucleic acid encapsulation, high transfection efficiency, and low toxicity to cells. Both ALC-0315 and SM102 LNPs mimic low-density lipoproteins and are taken up by receptor-mediated endocytosis and phagocytosis. Once in the cell, ionizable lipids sense the pH change and trigger the disruption of the endosome to release the nucleic acid into the cytoplasm. To enter the endocytic pathway, LNPs interact with apolipoproteins which are the substrate for the LDL-receptor. Apolipoproteins are naturally available in systemic circulation. The LDL receptor- mediated pathway is present in many cell types. To make LNPs, an ethanolic solution of lipids is mixed with an aqueous solution of RNA at low pH. Upon mixing, the change in polarity of the environment triggers the self-assembly of LNPs. The low pH causes the ionizable lipids to become cationic and due to interaction with the anionic RNA electrostatic forces hold the particle core together. Precision Nanosystems use this rapid mixing strategy to promote core formation to develop homogenous LNPs. The Ignite system produces reproducible LNPs on par with GMP commercial licensed COVID-19 vaccines.
[0184] To formulate genetic adjuvant LNPs GenVoy-ILM working solution will be prepared by 1:1 dilution with anhydrous ethanol. The RNA is diluted to a working range of 0.179-0.180 mg / ml in PNI formulation buffer. Lipid mixes are then pre-set for the expected volumes and flow rates. The cartridge is then installed for mixing the two components and the LNPs are collected. The particles are then diluted in Ca2+and Mg2+free PBS and then the LNPs can be centrifuged in a filtration tube to dilute particle solution and resuspend in desired buffer up to 1.8 ml of volume. In 50 µl this will be a 10µg dose. Lower doses can be made simply by dilution of the particle solutions in PBS. The Ignite instrument is small and will be housed in a biosafety cabinet during formulation. All materials will be handled in sterile conditions. The methods described in this section will be used wherever RNA LNPs are required. Confirmation of expression and secretion of mRNA genetic adjuvants in HEK293 cells.
[0185] To confirm that each mRNA construct and LNP formulation are functional and can instruct cells to produce the intended genetic adjuvants, we will evaluate the formulations inAttorney Docket Number: WVU 3065-PCT HEK293 cells for expression. HEK293T cells (ATCC CRL-3216) will be cultured in DMEM culture media supplemented with 2mM L-glutamine in 5% CO2 incubators. To access a dose-dependent response we will administer 10, 1, and 0.1 µg of mRNA genetic adjuvant, which will be co- incubated with 1X106cells and allowed to contact through gentle mixing of the cultures. We have observed high production of CXCL10 in low RNA doses of 1µg per 1 million cells at 24 hrs incubation. At 6 and 24 post incubation cells and supernatant will be collected and Luminex Assays will be used to quantify the amount of intracellular or secreted cytokine or chemokine, as shown in FIG.1B. Production of mRNA-expressed candidate cytokines / chemokines will be confirmed and quantitated using R&D Luminex Simplex assays capable of detecting target candidates on a logarithmic scale. If reagents to detect a certain target candidate do not exist and custom reagents are not producible, we have developed an alternative strategy using the HA modification described above in A.1.3.3. Briefly, we will utilize PCR modification of the DNA template to add a HA tag to either the C or N terminus to use this epitope for detection of expression. Candidate specific- biological activity of a particular candidate identified using the HA tag approach will then be confirmed in A.1.3.8 by confirmation of primary receptor activity in human PBMC scRNAseq analysis. Confirmation of cellular activation of mRNA genetic adjuvants and controls in THP-1 cells with high throughput reporter assays and flow cytometry analysis.
[0186] HEK293 cells are commonly used to demonstrate expression of mRNA constructs; however, they lack many immune pathway receptors and would not respond or activate in a manner like immune cells. Therefore, we will screen for immune activation in THP-1 cells (ATCC TIB-202) which are a human monocyte cell line. Upon treatment with a stimulant, THP-1 cells will upregulate surface expression of activation markers and they differentiate into THP-1 macrophages. Additionally, we will use this opportunity to determine an optimal concentration of mRNA constructs for PBMC screening82. We will stimulate 1x106THP-1 cells with 10, 1, and 0.1 µg of mRNA genetic adjuvant and collect cells at 24 & 48 hrs post incubation. We will compare fluorescence intensity of surface activation markers from THP-1 cells treated with candidate adjuvants to negative control treated cells. By establishing a baseline activation due to inert mRNAAttorney Docket Number: WVU 3065-PCT and LNP formulations, we can determine a threshold for activation induced by functional mRNA- encoded candidate cytokines / chemokines. THP-1 cells will be lifted from 12-well plates using TrypLE (Gibco) dissociation buffer. Prior to antibody staining non-specific binding with blocked using Fc-Block (BD). We will determine an optimal concentration for PBMC screening by identifying the maximum tolerated dose of mRNA constructs using a Live / Dead Viability stain (Near-IR, Invitrogen). The cells will then be stained with α-CD80-BV421 (BioLegend), α- CD11b- BB515 (BD), and α-CD14-PE-Cy5 (Biolegend) to determine activation by THP-1 macrophage differentiation. Stained cells will be fixed using 4% paraformaldehyde. Cells will be analyzed in a 96-well plate using a BD Aurora spectral flow cytometer. The use of the spectral flow cytometer will increase the rigor and reproducibility of the activation screen by allowing the direct comparison of data collected across the numerous rounds of treatments required for the high-throughput nature of the experiment. Activation of THP-1 differentiated macrophages will be analyzed using FlowJo software (TreeStar). Candidates of interest will be identified by 1.) candidates demonstrating increased THP-1 activation / differentiation compared to negative controls, and 2.) those candidates that demonstrate activation, while not increasing cellular toxicity. Screening of mRNA genetic adjuvants with human PBMCs using high throughput single cell RNAseq.
[0187] The ambitious goal of identifying the specific activity of many candidate adjuvants requires the establishment of a refined HTS mechanism capable of isolating a response to an identified pathway. The uniqueness of our approach intensifies that difficulty by introducing different receptors for many of the candidate cytokines / chemokines. Therefore, a traditional HTS screening mechanism isolating the activity of thousands of candidate adjuvants to a single pathway would not be possible in this scope. To accomplish this task, we propose the use of high-throughput single-cell RNA (scRNAseq) sequencing on human PBMCs to identify an immune profile of a specific candidate adjuvant, and to confirm the activity of a particular candidate’s primary receptor(s). While the use of human cell lines will be beneficial in demonstrating that our adjuvants are stimulating cells, our candidate cytokines / chemokines require a specific receptor(s) to elicit a response. Unfortunately, a single cell line, or even a combination of multiple cell lines may notAttorney Docket Number: WVU 3065-PCT express the receptor necessary to a particular candidate. For this reason, we chose to use human PBMCs for our RNAseq screening. The use of PBMCs will allow us to screen multiple cell populations increasing the likelihood that a certain receptor is expressed in our assay. Furthermore, rather than bulk sequencing we will utilize scRNAseq to directly identify which cell populations we measure this response in. Additionally, we can confirm gene expression of the primary receptor for a particular cytokine from this analysis. Thus, demonstrating the biological activity of mRNA-encoded cytokines / chemokines.
[0188] Leukopak leukapheresis products will be procured from STEMCELL Technologies83. PBMCs will be isolated using ACK lysis RBC depletion, and platelets removed. PBMCs will be counted using an automated cell counter, and cells will be seeded overnight at 5 x 105cells / well in a 24-well plate. Cells will be cultured in RPMI-1640 with 2% patient serum isolated from the corresponding Leukopak. The following morning cells will be treated with a candidate adjuvant mRNA construct determined in sub-activity A1.3.7. After a 24 h incubation suspension and adherent cells will be harvested and counted. We will utilize a Honeycomb Hive CLX cell capture chamber to separate single cells. This technology enables a high yield recovery of cells, and a direct platform for RNA library preparation that we have used in the past. RNA sequencing will be performed using an Illumina NovaSeq X, pooling 10 samples per flow cell, resulting in an estimated 36,000 reads / cell. Classification of mRNA genetic adjuvants based on in vitro data from human cells (THP-1 and PBMCs).
[0189] Based on prior literature, we anticipate that the candidate pools of genetic adjuvants evaluated (Table 3) might lead to overlapping responses in target cell populations that may synergistically amplify effects or balance inflammatory responses (e.g., IFNg vs. IL-10). In this Activity, data will be combined to determine the orthogonality of candidates based on the cytokines elicited (Luminex), phenotypes of cells present post-exposure (flow cytometry), and transcriptional states (scRNA-seq) collected for the genetic adjuvants and the reference adjuvants tested. We will categorize the responses elicited from individual adjuvants based on the biological effects induced and cellular states manifested post-exposure. In this way, we will be able to eliminate candidates with no modulation compared to negative controls (e.g., incorrect protein expression or signaling)Attorney Docket Number: WVU 3065-PCT and identify groups of factors.Cloning, IVT production, purification, and formulation of mouse-specific mRNA genetic adjuvant candidates.
[0190] We will produce mouse-specific mRNA genetic adjuvants. In FIGS.10A-10D, we have confirmed that each human cytokine and chemokine candidate have at least on mouse ortholog, to allow for us to study their activity in mouse models. As described herein, we have a straightforward pathway for DNA cloning, linear template preparation, in vitro transcription, modified nucleobase addition, purification (HPLC\), and formulation into lipid nanoparticles. To produce mouse specificAttorney Docket Number: WVU 3065-PCT coding sequences of mRNA adjuvants, we will codon optimize the mouse coding sequence, and follow the same basic pipeline as described for human mRNAs. Confirmation of expression of mouse specific genetic adjuvants in mouse cells.
[0191] Genetic adjuvant candidates evaluated in this program require a mouse ortholog with a high percentage of similarity to be selected for the initial screening. We will generate mRNA constructs of mouse orthologs from the down-selected candidates that were identified in the human PBMC scRNA-seq. We will confirm the production of these genetic adjuvant candidates using the murine dendritic cell, DC2.4 cell line (EMD Millipore). This cohort of candidates will be smaller than the PBMC screening. Therefore, we will combine adjuvant candidate protein production and cellular activation into a single assay. DC2.4 cells will be seeded into 6-well plates at 5x105cells per well 18 h before stimulation. Cells will then be transfected with 0.1, 1 or 10 µg LNP-encapsulated mRNA, and supernatant collected after 6 and 24 h incubation. Adherent DC2.4 cells will be collected, and activation determined by the upregulation of surface activation markers by flow cytometry. Luminex simplex plates will be used to quantify production and secretion of murine genetic adjuvants from collected cellular supernatant. Activation of DC2.4 cells will be assessed using CD80-BV421, CD86-APC, CD40-PE-CF594, and the viability of cells determined with Live / Dead Viability stain (Near-IR, Invitrogen. Genetic adjuvants for which secretion is confirmed and activated DC2.4 cells will proceed to in vivo adjuvanticity studies. Immunization of mice with candidate genetic adjuvants and analysis of early immune response biomarkers to confirm activity in mice.
[0192] We will confirm the immune activity of genetic adjuvant candidates in vivo using a murine adjuvanticity model. The down-selection approach will result in the identification of candidates with the greatest potential as adjuvants with minimal selection bias using a novel machine learning platform. We will characterize the innate immune properties when delivering exogenous mRNA-encoded cytokines / chemokines as vaccine adjuvants. We will characterize the innate immune response by 1) quantifying local and systemic cytokine response, 2) quantifying and profiling infiltrating white blood cell populations, and 3) identifying any potential markers ofAttorney Docket Number: WVU 3065-PCT toxicity, and 4) analyzing scRNA-seq transcriptomic response to candidate adjuvants. To reduce the effort and time commitment required to complete full immunogenicity experiments, we will compare the early immune response generated from our candidate genetic adjuvants to adjuvants that are currently licensed by the FDA as human vaccine adjuvants. These parameters will be characterized for the down selected formulations identified in PBMCs, subsequently providing equivalent data points of the lead candidate performance in mice This experimental design will provide machine learning algorithms with specific datapoints to compare against down-selected genetic adjuvants. The computation analysis will score the ability of a candidate to generate a response less than, equal to, or greater than known licensed adjuvants.
[0193] C57B6 mice aged 5 weeks will be administered LNP-encapsulated mRNA adjuvants by intramuscular injection with 50µl. We will administer candidate adjuvants at two doses to identify a dose-dependent response. Clinical adjuvants used as positive controls will include aluminum salts (1:1 ratio, concentration dependent on antigen 1 µg & 10 µg)(Alhydrogel, Invivogen), MPLA 2 & 20 µg (MPLA-SM Vaccigrade, Invivogen), MF59 (1:1 ratio, concentration dependent on antigen 1 µg & 10µg) (Addavax, Invivogen), and CpG 20 & 50 µg (Odn2395 Vaccigrade, Invivogen), referred to as reference adjuvants. Lastly, we will include LNP- encapsulated nonsense scrambled mRNA as a negative control. Animals will be euthanized at 24hrs after prime immunization. We will first analyze serum to determine if the mRNA-encoded cytokine of interest is indeed elevated compared to nonsensical mRNA. Additionally, we will use a multiplex proinflammatory Luminex kit to determine an innate immune response profile of a candidate genetic adjuvant (Mouse XL Cytokine, Luminex). We expect that based on the varying serum cytokines known to be elevated when primed with reference adjuvants, we will generate distinct profiles from our genetic adjuvants. We expect one day post prime is a sufficient timepoint to collect the data needed however, we may need to also perform additional timepoints to observe the cellular responses.
[0194] To evaluate the toxicity of adjuvant candidates we will use established cage-side and clinical observations, and clinical chemistry. Cage-side observations will be scored using established health scoring examining mortality, morbidity, posture, activity, eye closure, and respiratory rate. In addition, to behavioral observations we will measure weight loss, body temperature, and an injection-site clinical scoring evaluation will be performed to determine any clinical adverse vaccineAttorney Docket Number: WVU 3065-PCT effects. Finally, at euthanasia at 24 h, we will perform clinical chemistry evaluating liver function and acute kidney disease. Mouse urine will be analyzed by a Luminex multiplex assay to measure Clusterin, Cystatinn C, EGF, Lipoxalin-2, and Osteopontin for kidney injury84. Mouse liver function will be determined by quantifying Arginase 1 in sera by ELISA. We will measure the cellular response elicited from these cytokine profiles by analyzing the draining lymph nodes from the injection site. Inguinal lymph nodes and muscle tissue from injection site will be taken from the mice, and cell populations determined by staining of surface cell markers. Prior to cell marker staining ~30,000 cells will be isolated for scRNA-seq analysis and pooled per group. Cells will be processed using Honeycomb Hive CLX. Expected outcomes and alternative approaches.
[0195] We expect to produce and formulate candidate mRNA genetic adjuvants. The genetic adjuvants will be screened for production in HEK293 cells, confirmed for immune activation in THP-1 cells, and evaluated for biological activity in human PBMCs using single cell RNAseq analysis. THP-1 cells have been utilized in several high throughput adjuvant discovery programs; however, we reserve the option to substitute another cell line if needed as preliminary data are obtained. AI / ML-based modeling may be used to nominate lead candidate mRNA genetic adjuvants. Lead candidates will be constructed into mouse-specific forms and re-confirmed for expression and activation. Preclinical testing of adjuvant / antigen in vivo using animal model systems.
[0196] We will produce and evaluate human mRNA genetic adjuvants in a series of screens using human cells. Nomination of lead candidates, which may be done with the aid of artificial intelligence and / or machine learning, will result in production of mouse specific mRNA adjuvants to be produced for evaluation in animals. We will use three pre-clinical models of the infectious diseases of COVID-19, pertussis, and tuberculosis. Due to the scope of the project, we propose it is important to move candidates into mice as early as possible so that we may discover adjuvants that increase vaccine responses in vivo. We selected these three diseases as the vaccines currently implemented for protection provide sub-optimal protection characterized by waning immunity, inability to fullyAttorney Docket Number: WVU 3065-PCT protect against infection or transmission, and overall low or variable efficacy in different cohorts of patients.
[0197] COVID-19 mRNA vaccines are directly credited for control of the COVID-19 pandemic. A combination of frequent boosting and natural infections, however, were required to reach sufficient herd immunity. Furthermore, SARS-CoV-2 mutated into a less virulent class of variants, referred to as the Omicron sub-lineage in late 2021. Since that time, morbidity and mortality across the world have been low and overall transmission has decreased. COVID-19 has slipped into an endemic disease. While mRNA vaccines used their speed and flexibility to meet the demands of an evolving pandemic, it is known that antibody responses generated by mRNA immunization wane over time. We have performed longevity studies with mRNA-1273 in mice and observed decaying antibody levels over time (FIG.1G). We hypothesize that genetic adjuvants can improve mRNA immune responses and overcome the needs for boosters. These innovations may result in vaccine formulations that better protect the most vulnerable, and open doors for highly protective strategies for future needs such as other epidemics or pandemics.
[0198] Pertussis is a human-specific respiratory disease caused by the Gram-negative bacterial pathogen, Bordetella pertussis. Two generations of pertussis vaccines have been used to decrease the overall burden of pertussis worldwide. In the 1940s, whole cell pertussis DTP vaccines were developed. Prior to the 1940s, there were 250,000+ cases of pertussis reported and up to 6,000 infants dying in the United States per year. After DTP implementation, the number of reported cases dropped to 1,000 per year. In the early 1980s, concerns around the reactogenicity of the DTP whole cell vaccine lead Japan, Europe, and the US to develop acellular pertussis vaccines composed of purified protein antigens that were detoxified with formalin and adsorbed to alum adjuvant. While these acellular vaccines (DTaP and later Tdap booster) are very safe and effective at protection against severe disease, they do not protect against asymptomatic infection or transmission, which leaves infants, children, and adolescent populations without sufficient protection to break the cycle of transmission. Thus, pertussis remains endemic and an important yet difficult problem to solve.
[0199] Tuberculosis (TB) remains one of the leading causes of infectious disease due to a single pathogen responsible for approximately 1.6 million deaths each year and an enormous incidence of infected people that totals near 25% of the human population85. Bacille Calmette Guérin (BCG) is aAttorney Docket Number: WVU 3065-PCT live-attenuated vaccine for protection against Mycobacterium tuberculosis (Mtb)86. Despite a strong safety profile following more than 100 years of use and high disease protection in infancy and early childhood, it generates poor and highly variable long-term protection against pulmonary TB. Worldwide, BCG is given to children at or shortly after the time of birth in global regions with high incidence of TB disease. While protective against disseminated infection by Mtb in young children, BCG fails to confer reliable, long-term protection against pulmonary disease. To have a realistic chance of achieving milestones of an 80% decline in new TB cases and 90% decline in mortality by the year 2030 as prioritized by the WHO in the End TB Strategy, new vaccines and vaccination strategies are critical. While new vaccine candidates are in clinical trials, there is currently no single or combination antigen vaccine licensed for human use that provides superior protection to BCG. Since the world is already mobilized for BCG use, one approach is to find mechanisms to augment BCG efficacy and duration of protection; novel adjuvants offer this potential. We have developed a model of neonatal BCG vaccination and adult aerosol Mtb challenge that models the human timeline of vaccine delivery and disease transmission. Evaluating immunogenicity of COVID-19, pertussis, and tuberculosis vaccines supplemented with lead candidate mRNA genetic adjuvants in mice.
[0200] Preclinical evaluation of vaccines is complicated by one major factor: differences in responses between animals (e.g. mice) and humans. Animals are not always susceptible to every pathogen that infects humans, and therefore the terminology “model” is often used to describe animal observations and how they “might” correlate with humans. We hypothesize that one of the underlying reasons for which protection observed in mice does not always correlate with protection in humans is because the doses of vaccines tested in mice far exceed doses physiologically relevant for human administration.
[0201] To address this problem, the team assembled has asked a simple question in the context of pertussis, COVID, and tuberculosis vaccination: what protective but non-saturating dose of a human vaccine should be evaluated in mice? Furthermore, the team has also been equally interested inAttorney Docket Number: WVU 3065-PCT identifying the first dose of vaccines that provides sub-optimal protection in mice to be able to study new ways of improving upon protection. For example, with pertussis vaccines, the literature published in the 1990s supporting the use of DTaP or Tdap vaccines used doses in mice corresponding to 1 / 5ththe human dose. This arbitrary number came from empirical studies that attempted to correlate the acellular vaccine doses and whole cell DTP vaccines. To study the effect of new antigens and adjuvants on the efficacy of pertussis vaccines, our team first identified the vaccine dose physiologically relevant for mouse that can be improved upon.
[0202] This simple principle will be applied to the strategy of how we will evaluate adding new mRNA genetic adjuvants to: mRNA vaccines (COVID-19), acellular protein vaccines (Tdap – pertussis), or live-attenuated bacterial vaccines (BCG- tuberculosis). As stated previously, we selected these not only because of our expertise, but the need for improving each of these vaccines. We hypothesize that genetic adjuvants can improve mRNA vaccines, as well as traditional platforms. We hypothesize that mRNA adjuvants could be added to any type of infectious disease vaccine to drive initial immune activation and immunity. We will utilize base vaccine doses that are at the edge of the minimally protective limits to offer room for genetic adjuvants to enhance responses and improve protection. In general, we will prime, boost, and analyzed the immunogenicity of base vaccines and compare to base vaccines with genetic adjuvants (that have been evaluated extensively in vitro (HEK293, THP-1, and primary human PBMCs). Next, we will challenge mice with each pathogen and evaluate correlates of protection. Selection of optimal vaccine doses for COVID-19 vaccine evaluation.
[0203] Over the past two years, we have carefully developed models of SARS-CoV-2 challenge in hACE2-mice. Here our goal is to evaluate the enhanced protection due to adding the lead candidate genetic adjuvants to a standard COVID-19 vaccine: mRNA-1273 (Moderna). Very few mouse studies in hACE2-mice have been performed with licensed vaccines such as mRNA-1273. Doses of 1 to 10 µg have been used by our group and others in the field to protect mice against experimental challenge. We hypothesized that these doses are likely high (saturating dose) for mice. We performed a vaccine titration experiment with mRNA-1273 from 1 / 10thto 1 / 640th(10 to 0.16µg) of the human dose (FIG. 15; FIG. 1G). Even at the lowest human dose (1 / 640th), RBD-specificAttorney Docket Number: WVU 3065-PCT antibody is produced that would likely protect mice from challenge based on our data from numerous other COVID-19 vaccine formations. We observed that the 10µg dose leads to maximal antibody production within five weeks. By monitoring antibody levels in these mice over time, we observed a significant drop out to 26 weeks post prime, demonstrating that immunity wanes. This cohort of 45 mice are currently 30 weeks of age and will be experimentally challenged in June 2023 with the Omicron variant at a dose of 105PFU. We expect this challenge data will provide us with an IgG to protection correlation that will be informative in selection of the high (protective) and low (sub-optimal) doses of COVID-19 vaccine that will be used in this activity. Based on what we know currently, it is likely that we will use 1.25 µg as our high protective dose and 0.16 µg as our sub- optimal non-protective dose based on the waning titers we have seen in these groups. Selection of optimal vaccine doses for pertussis vaccine evaluation.
[0204] Acellular pertussis vaccines are classically studied in mice using high doses of vaccine. For example, the lots of vaccine produced for human use are validated by using 1 / 5thhuman dose per mouse, followed by intranasal challenge with B. pertussis. This dose leads to full protection and clearance of the pathogen in less than three days from 107CFU at day 0, to 4x106at day 1, and <1,000 at day 3 (detection limit) in the lung. This dose is saturating and not physiologically relevant in the murine model. To establish a more relevant dose to study pertussis immunity in response to immunization in mice, we conducted titration studies to determine the highest non-protective dose of vaccine. Thirty variables were collected per mouse to determine the correlates of protection associated with vaccination against pertussis in this model. From the lung bacterial burden (Fig.13), antibody production (Fig.13), IL-6, and other variables, we identified the highest non-protective dose (1 / 80th) and supplemented it with a novel antigen (RTX) to demonstrate antigen synergy (Fig. 20A). We observed that doses as low as 1 / 160thand 1 / 320thwere still protective (Fig.13). From these experiments, we selected 1 / 20thas a fully protective dose (positive control), and 1 / 160thas a partially protective dose to study the role of genetic adjuvants in this contract. By performing these studies, we established a unique model to test new adjuvants to be formulated with pertussis vaccines, which will be crucial for the completion of this project.
[0205] In this contract, we have selected to perform studies with the approved human vaccineAttorney Docket Number: WVU 3065-PCT Tdap Boostrix. Unlike DTaP which is used to vaccinate neonates and young children, Tdap is used to boost immunity later in life (adolescents and adults). DTaP fulfills its primary role as vaccine, which is protect highly susceptible infants against pertussis. Unfortunately, the protection they provide wanes over time, prompting for the use of booster shots later in life. We propose that the greatest opportunity for pertussis vaccine improvement is the enhancement of the immunity provided by Tdap boosters. Genetic adjuvants could improve Tdap-mediated immunity and prevent carriage and transmission of B. pertussis to vulnerable populations. Selection of optimal vaccine doses for tuberculosis vaccine evaluation.
[0206] Bacille Calmette-Guérin (BCG) is a live-attenuated strain of Mycobacterium bovis developed for use as an vaccine to prevent TB. Despite high protection in infancy and early childhood it generates poor long-term immunity. While BCG revaccination is well tolerated, efforts to boost with BCG did not increase the efficacy of protection against TB disease or long-term mortality. This was not surprising as persistence of vaccine antigen is one hypothesis to explain the inadequate central memory immune response generated by BCG vaccination. We aim to evaluate enhanced protection of BCG by adding lead candidate genetic adjuvants to a standard BCG vaccine. Similarly, to sub-activities A4.3.1.1, A.4.3.1., we will identify suboptimal protective dosages of BCG vaccination. The standard human infant dose ranges from 5x106-4x107CFU BCG, depending on the country or region of the world. An average normal birth weight human neonate is 3.5 kg (range= 2.5-4 kg). In our model, we vaccinate neonatal mice at 7 days of life when they are similar in immunological development to a human neonate and weigh approximately 3.5 g (range=3.2-4.3 g). Thus, a 1 / 1000th(~5x103CFU) human infant dose is appropriate for a C3HeB / FeJ murine neonatal vaccination model and our findings demonstrate this dose is immunostimulatory and provides a ten-fold reduction in Mtb in the lungs of mice challenged 5 weeks post-vaccination as adults (manuscript in review). In addition to this high (protective) dose, we will also evaluate a lower (sub-optimal) dose of 500 BCG CFUs in this activity. To summarize, based on preliminary data, we will use ~5 x103CFU (1 / 1000th) as our high protective dose and ~500 CFU (1 / 10,000th) as our sub- optimal non-protective dose.Attorney Docket Number: WVU 3065-PCT Experimental groups and vaccination schedules.
[0207] Immunization studies performed in this section will be done in mice of the same age and strains as those used in the challenge studies performed in A4.3.3 to A.4.3.5. The challenge models for SARS-CoV-2 and M. tuberculosis require different strains and ages of mice. SARS-CoV-2 challenge requires the use of adult (5 weeks old) hACE2 mice in the C57BL / 6 background. In contrast, M. tuberculosis requires the use of neonatal (7-8 days) C3HeB / FeJ mice to best mimic the human vaccination schedule and variability in vaccine-mediated responses. For ease of comparison, challenges with B. pertussis will be performed in adult C57BL / 6 mice. Control groups will be shared between vaccination and challenge studies whenever possible. Groups of mice will be composed of 10 mice / group, 5 males and 5 females. We cannot control the sex distribution in neonatal litters, but historical data suggest that over multiple experiments, the sex distribution will be nearly equivalent. Therefore, both age and sex will be considered as biological variables in these studies. Scrambled mRNA packaged in LNPs will be used as vehicle control. The high / low adjuvant only groups will serve as negative controls. The groups with vaccine protective doses will serve as positive controls. The groups with the vaccine sub-protective doses will be used to set the baseline for protection to improve upon. mRNA1273 and Tdap will be tested in adult mice, BCG in neonatal mice. In the experimental groups, we will determine the effect of genetic adjuvants on improving the protection mediated by the sub-protective dose of mRNA1273, Tdap, or BCG (Table 5). Vaccination schedule.
[0208] Due to the differences between human vaccination schedules and models, different schedules will be used for each vaccine: COVID-19 (mRNA1273): administered IM at day 0, followed by a boost 28 days later. Tdap (Boostrix): administered IM at day 0, followed by a boost 21 days later. Tuberculosis (BCG): administered subscapular at day 0, no boost. Analysis of antigen specific antibodies.
[0209] Antibody production often correlates with vaccine-mediated protection. We will firstAttorney Docket Number: WVU 3065-PCT monitor the production of antibodies over the course of prime and boost to determine the effect of the genetic adjuvants on vaccine immunogenicity. In addition to antibody levels produced in response to vaccination, we will also gain insights into the quality of the antibodies produced by performing affinity analysis (FIG.14). Serological samples will be obtained from adult mice weekly via sub-mandibular bleeding. For neonatal mice, serological studies will be performed at five weeks of age (4 weeks post-vaccination, 1-week pre-challenge). Evaluation of the serological response against SARS-CoV-2.
[0210] The production of anti-RBD antibodies in response to SARS-CoV-2 infection or vaccination is important for protection against COVID-19. However not all anti-RBD antibodies protect against infection. Therefore, it is also important to determine the levels of virus neutralizing antibodies. We will first measure the levels of antibodies specific to RBD in serum over time to determine if adding genetic adjuvants affects the production of these antibodies. Antibody levels in serum will be determined using standard enzyme-linked immunosorbent assays (ELISA) following protocols well established in our laboratory. Microtiter plates will be coated with RBD antigen then serum samples from vaccinated mice will be serially diluted across the plates. Total IgG, IgG1, IgG2a, and IgG2b will be quantitated per sample. Increased vaccine efficacy provided by addition of the genetic adjuvants will be determined as a significant increase in antibody titers in mice vaccinated with the sub-protective dose + genetic adjuvants compared to mice vaccinated with the sub-protective dose only. In addition to antibody levels produced in response to vaccination, we will also gain insights into the quality of the antibodies produced by performing affinity analysis (FIG. 14). In these assays, serum antibodies will be quantitated in the presence of chaotropic agents to identify high-affinity subpopulations. Increased vaccine efficacy provided by addition of the genetic adjuvants will be determined as a significant increase in Kd in mice vaccinated with sub-protective dose + genetic adjuvants compared to mice vaccinated with the sub-protective dose only. Finally, the functionality of the antibodies against RBD will be evaluated using a SARS-CoV-2 virus neutralization assay. Evaluation of the serological immune response against B. pertussis.Attorney Docket Number: WVU 3065-PCT
[0211] High antibody titers against pertussis toxin (PT) and filamentous hemagglutinin (FHA) are correlates of protection of acellular pertussis vaccines. We will measure the levels of antibodies specific for PT and FHA in sera to determine if adding genetic adjuvants affects the production of anti-PT and anti-FHA antibodies. Antibody levels in serum will be determined using ELISA as described in 4.3.2.1 with the following modification: microtiter plates will be coated with PT or FHA at 1 μg / ml, or with a suspension of B. pertussis (OD600in SSM = 0.3 corresponding to 109CFU per ml). ELISA will be performed with the type strain UT25. Antibody titers will be considered positive if the signal is detected above the threshold set for background signal (scrambled RNA LNPs vaccinated control mouse serum). Increased vaccine immunogenicity provided by addition of the genetic adjuvants will be determined as a significant increase in antibody titers in mice vaccinated with 1 / 160thBoostrix + genetic adjuvants compared to mice vaccinated with 1 / 160thBoostrix only. Antibody affinity analyses will be performed as described in 4.3.2.1 using labeled PT and FHA. Increased vaccine efficacy provided by addition of the genetic adjuvants will be determined as a significant increase in Kd in mice vaccinated with 1 / 160thBoostrix + genetic adjuvants compared to mice vaccinated with 1 / 160thBoostrix only. Evaluation of the serological immune response against M. tuberculosis.
[0212] The humoral immune response has conventionally been considered to have little role in the control of Mtb. Furthermore, while it is established that cell-mediated immunity is required, there are currently no correlates of protection known for TB. The traditional dogma surrounding contributions of antibody during TB have recently been challenged and a variety of studies suggest that antibodies may contribute to protection during a TB infection. B cells are recruited to granulomas and antibodies against the Mtb antigens CFP-10 and ESAT-6 are found in lung tissue and draining lymph nodes of infected rhesus macaques. Heavily exposed healthy individuals produce high levels of antibodies against purified protein derivative. Regardless of viewpoint on this controversy, antibody responses are generated in response to BCG vaccination and Mtb infection and can be used as markers of immune activity. We are also interested in the four murine isotypes of antibodies (IgM, IgG1, IgG3 and IgA) that have been observed to be protective against Mtb infection. We will measure serum levels of ESAT-6, PPD-specific and whole BCG antibodies at theAttorney Docket Number: WVU 3065-PCT time of challenge (5 weeks post-vaccination) and investigate the four isotypes listed above. Serum antibody levels will be determined using an ELISA as described here, in short, microtiter plates will be coated with either ESAT-6, PPD, or a suspension of BCG at room temperature overnight. Plates are then washed 3 times with wash buffer (1x PBS with 0.05% tween 20) and blocked with 0.5% casein for 1h at 37°C. Plates are again washed 3 times with wash buffer and sera samples are added to the first row in a 1:50 mixture with blocking buffer. A serial dilution is performed down the rows with the last row containing only blocking buffer to serve as a vehicle control. Plates will be incubated for 1h at 37°C and then washed 3 times with wash buffer. Either 100 µL of Alkaline phosphatase-conjugated goat anti-mouse IgG1, IgG3, or IgM are added to each well. For IgA analysis, 100 µL of Horseradish Peroxidase-conjugated goat anti-mouse IgA antibody will be added to each well. Plates will incubate 1h at 37°C and then washed 3 times with wash buffer. Plates are then developed at room temperature with 100 µL of either p-nitrophenyl phosphate (IgG1, IgG3, IgM) or 3,3’ ,5,5’-Tetramethylbenzidine (TMB) (IgA) substrate for 30 minutes. Color reactions in plate wells will be measured in absorbance at 405 nm for PNPP and 650 nm for TMB on a plate reader (Biotek Synergy H1 Plate Reader). Antibody titers will be considered positive if they are above the background threshold set by the vehicle control row. Increased vaccine efficacy provided by inclusion of genetic adjuvant will be determined by a significant increase in antibody titer in mice vaccinated with suboptimal dose BCG + genetic adjuvant compared to sub-optimal BCG vaccination alone.
[0213] Antibody affinity analyses will be performed using labelled ESAT-6, PPD and BCG. Increased vaccine efficacy provided by addition of the genetic adjuvant will be determined by a significant increase in Kd of antibodies from mice vaccinated with a suboptimal BCG dose + genetic adjuvant compared to suboptimal BCG dose vaccination only. Down-selection and prioritization strategy.
[0214] Data collected from these serological studies will be used to prioritize the vaccine formulations that will proceed to evaluation in the challenge models. The first criterion used for down-selection will be improvement of the overall antibody titer in response to vaccination. The second criterion used for down-selection will be improvement of antibody affinity. In formulationsAttorney Docket Number: WVU 3065-PCT tested in combination with mRNA1273, improvement of viral neutralization will be used as the third criterion. Genetic adjuvants that provide an improvement to more than one vaccine type will be prioritized compared to those that provide improvement to only one vaccine. Genetic adjuvants that do not provide improvement of the serological responses will be abandoned at this phase. The top 3 genetic adjuvants identified from these studies will be evaluated in challenge models. Analysis of protection in response to experimental challenge, analysis of efficacy, and correlates of protection: SARS-CoV2 challenge in K18-hACE2-mice.
[0215] Mice will be immunized as described herein. Twenty-eight days post-boost, mice will be moved to ABSL3 housing for intranasal viral challenge with 105PFU Omicron SARS-CoV-2 (XBB1.5 or currently circulating variant). Mice will be monitored daily after challenge through in- person health checks during which disease scores are awarded based on phenotypic changes in activity, body hunch, weight loss, and appearance. At day 2, when Omicron viral replication and tissue viral burden is at its peak, mice will be euthanized. Lung tissues will be used for histopathological analysis of inflammatory damage, PFU analysis of viral burden, and viral RNA quantification using qRT-PCR. Brain tissue will be homogenized for qRT-PCR. Nasal wash fluid will be used for qRT-PCR and serum will be collected for antibody analysis. Vaccine efficacy will be determined as a significant decrease in viral burden in the nares, lung, and brains, and in the decrease in lung inflammation of vaccinated and challenged mice compared to scrambled mRNA LNP vaccinated and challenged control mice. Increased vaccine efficacy provided by addition of the genetic adjuvants will be determined as a significant decrease in viral burden in the airways and brains, and in the decrease in lung inflammation of challenged mice vaccinated with the sub- protective dose + genetic adjuvants compared to mice vaccinated with the sub-protective dose only. B. pertussis challenge in mice.
[0216] Mice will be immunized as described herein. Fourteen days after boost, mice will be challenged with 107colony forming units (CFU) of B. pertussis UT25 grown to exponential culture in Stainer Scholte Medium (SSM). At day 3 post-infection, mice will be euthanized by intraperitoneal pentobarbital injection. Whole blood will be collected by cardiac puncture forAttorney Docket Number: WVU 3065-PCT serology analysis. Lung will be collected and homogenized, and the nares will be flushed with PBS. Inguinal lymph nodes and bone marrow will also be collected. To determine the effect of our experimental vaccine on the clearance of the pathogen from the airways, we will measure the bacterial burden in nasal washes and lung homogenate by plating serial dilutions of the tissues on Bordet Gengou (BG) agar plates and determine the number of CFUs at day 3 post-challenge. Vaccine efficacy will be determined as a significant decrease in bacterial burden in the nares and lung of vaccinated and challenged mice compared to scrambled mRNA LNP vaccinated and challenged control mice. Increased vaccine efficacy provided by addition of the genetic adjuvants will be determined as a significant decrease in bacterial burden in the airways of challenged mice vaccinated with 1 / 160thBoostrix + genetic adjuvants compared to mice vaccinated with 1 / 160thBoostrix only. M. tuberculosis challenge in mice.
[0217] Five weeks after vaccination, mice will be infected with M. tuberculosis by the aerosol route. Mice will be placed in mesh baskets at ten or fewer mice per sector within an inhalation chamber (Glas-Col Model A4212). A target concentration of 5x107CFUs / 5 ml of M. tuberculosis strain H37Rv will applied to the nebulizer for a target delivery of ~100 CFUs per mouse. The following exposure settings will be used: 15 min warm-up, 35 min nebulize, 30 min cloud decay, 15 min UV exposure (Vacuum Pressure Setting: 60 cubic feet per hour; Comp Air Pressure Setting: 10 cubic feet per hour). Following aerosol infection, the mice will be immediately removed from the chamber and housed for 8 weeks. Mice will be monitored daily for signs of distress and morbidity. At 8 weeks post-infection, mice will humanely euthanized, and blood and lungs collected for downstream analysis. Blood will be processed for serological analyses. Lungs from M. tuberculosis- infected mice will be used for qRT-PCR quantification of M. tuberculosis levels using ESAT6 gene expression. Since BCG are known to persist for prolonged periods following vaccination and do so for greater than 5 weeks in mice vaccinated as neonates (PMID: 36530844), it is necessary to differentiate persistent BCG from Mtb. Standard plate colony counts do not accomplish this, so we developed an approach that measures Mtb-specific ESAT-6 transcript levels correlated to known numbers of Mtb CFUs for enumeration of viable bacilli (manuscript in review). Enumeration ofAttorney Docket Number: WVU 3065-PCT bacterial burden will be done using a standard curve generated by qPCR of known amounts of Mtb spiked into age-matched lungs. Vaccine efficacy will be determined as a significant decrease in bacterial burden in the lung of vaccinated and challenged mice compared to scrambled mRNA LNP vaccinated and challenged control mice. Increased vaccine efficacy provided by addition of the genetic adjuvants will be determined as a significant decrease in bacterial burden in the lung of challenged mice vaccinated with the sub-protective dose + genetic adjuvants compared to mice vaccinated with the sub-protective dose only. Down-selection and prioritization strategy.
[0218] Data collected from the challenge studies will be used to prioritize which vaccines should be further evaluated for the determination of the effect of genetic adjuvants on vaccine memory responses. The primary criterion used for down-selection will be improvement of the clearance of viral or bacterial loads in the airways in response to challenge. Genetic adjuvants that provide an improvement to more than one vaccine type will be prioritized compared to those that provide improvement to only one vaccine. Genetic adjuvants that do not improve the serological responses will be abandoned at this phase. The top genetic adjuvant identified from these studies will be evaluated in the vaccine longevity studies described herein. Evaluation of the effects of genetic adjuvants on vaccine memory responses.
[0219] Most murine models to study vaccine-mediated immune responses focus on short term evaluation of serological correlates of protection and response to challenge. Unfortunately, these approaches were not able to detect the shortcomings of some vaccines, in particular as they relate to the longevity of the protection they provide. Our team has dedicated significant efforts to identifying early immunological markers of the longevity of the immunological response to B. pertussis. We have identified that whole cell pertussis vaccines that lead to long-term protection are associated with an increase in the presence of T follicular helper cells (TFH) and CXCL13 levels in the draining lymph nodes after boost compared to acellular pertussis vaccines that provide a short-lived memory. This is important as TFHand CXCL13 are both involved in germinal center formation and the generation of memory B cells (Bmem), long-lived plasma cells, and high-affinity antibodies. In thisAttorney Docket Number: WVU 3065-PCT contract, we will measure the effect of genetic adjuvants on CXCL13 levels and production of long- lived plasma cells, as early markers of vaccine-mediated memory response. These studies will be followed by monitoring antibody levels over 26 weeks to determine the effect genetic adjuvants have on waning immune responses over time. These experiments will allow us to gain insights into the potential of genetic adjuvants to not only improve the efficacy, but also the longevity of the protection mediated by COVID-19, pertussis, and BCG vaccines. In addition, we will monitor the effect of genetic adjuvants on T cell response by measuring the number of antigen-specific T cells in response to vaccinations by standard ELISPOT analysis.
[0220] Lead genetic adjuvants will be evaluated in the studies described below. This adjuvant will be combined with sub-protective doses of mRNA1273, Boostrix, and BCG and compared to sub-protective doses of these vaccines alone. One cohort of mice will be euthanized 8 weeks post- vaccination and one cohort will be euthanized 26 weeks post-vaccination. Evaluation of CXCL13 levels.
[0221] Mice will be vaccinated as described herein. One day post-boost, we will quantify CXCL13 levels in serum by ELISA (R&D Systems). Using this procedure, we will determine if genetic adjuvants promote CXCL13 expression, which is associated with germinal center formation and immunological memory. Measurement of the serological response over time.
[0222] Blood will be collected via sub-mandibular bleeding every 1-2 weeks during the course of 26 week. The presence of antibodies against RBD, PT, FHA, B. pertussis, and M. tuberculosis will be determined in serum using the methodology described herein. Using this procedure, we will determine the kinetics of antibody production over time measure the effect of the genetic adjuvant on the decay of antibody titers. Measurement of antigen-specific antibody producing cells.
[0223] At 8-and 26-weeks post-vaccination, mice will be euthanized and the bone marrow will be extracted to prepare single cell suspensions. Antigen-specific antibody producing cells will be detected by ELISPOT (Mabtech) following the manufacturer’s procedure. Using this procedure, weAttorney Docket Number: WVU 3065-PCT will measure the number of cells that produce antibodies against RBD, PT, FHA, B. pertussis, and M. tuberculosis in the bone marrow, providing insights into the B cell memory compartment elicited by the vaccines. Antigen-specific T cell analysis.
[0224] T cells are essential orchestrators of the adaptive immune response. In the context of SARS-CoV-2 infections, they are also important effector cells. Measurements of T cell responses will be performed at 8- and 26-weeks post-vaccination. To measure the number of CD4+ and CD8+ T cells that are produced in response to immunization with or without genetic adjuvants, we will first perform standard T cell ELISPOT analysis using RBD, FHA, or EsxG protein antigens to determine the number of T cells that recognize the native antigens. We will also perform antigen specific T cell analysis using flow cytometry and tetramers. Tetramers will be obtained from the NIH tetramer facility using known peptide epitopes that have been validated in other studies and found on the Immune Epitope Database (IEDB) which is a freely available resource funded by NIAID. Briefly, single cell suspensions will be harvested at post prime and boost from immunized mice. The effect of genetic adjuvant on the number of antigen-specific T cells will provide insights into the role of these adjuvants in vaccine-mediated response. The improvement of the memory response provided by addition of the genetic adjuvants will be determined as a significant increase in the levels of CXCL13 in serum after boost, increase in the number of antigen-specific antibody-producing cells and T cells, and in an improvement on the decay of antibody titers over time in mice vaccinated with the sub-protective dose + genetic adjuvant compared to mice vaccinated with the sub-protective dose only. Proposed numbers of animals.
[0225] We will perform extensive mouse studies in three different disease models to evaluate lead genetic adjuvant candidates. We have a robust strategy to compare the novel genetic adjuvants to appropriate controls. We will aim to evaluate 230 mice per model for a maximum total of 690 mice. However, the Mtb model includes use of neonatal mice, which will need to be bred and raised on site. This presents a challenge in terms of guaranteed mouse numbers per cohort. We will aim toAttorney Docket Number: WVU 3065-PCT perform the best experiments in relation to animal subject availability. Expected outcomes and alternative approaches.
[0226] We expect to evaluate novel genetic adjuvants in three disease models. The data collected will inform future adjuvant selections and improve our knowledge. During the project, data will be used to nominate candidates that will then be constructed as the mouse-specific sequences. We have described immunogenicity endpoints of data that will be used to identify mRNA genetic adjuvants that improve antibody or T cell responses in comparison to the base vaccines. We expect that some candidates will not improve immunogenicity and we will abandon those candidates. We also anticipate that some adjuvants may require higher or lower effective doses to achieve an effect. Therefore, we may perform additional studies where we increase or decrease the genetic adjuvants to drive sufficient responses. C3HeB / FeJ are widely considered a TB susceptible mouse strain. As such, if too much variability in immune responses is observed, the more TB-resistant C57BL / 6 stain will be used for TB studies. We also realize that not all adjuvants will work in all three models. We could also consider using different dose schedules as we do not yet know what the best dose timing will be for the mRNA genetic adjuvants. Mechanism of Action (MOA) Studies
[0227] Comprehensive understanding of the underlying cellular pathways and molecular mechanisms activated by adjuvants is crucial to further design and develop effective adjuvants. We seek to elucidate the direct or indirect effects of mRNA genetic adjuvant-mediated stimulation of cellular pathways to understand the working mechanism and elicited responses by the lead genetic adjuvant candidates.
[0228] Our mRNA genetic adjuvants consist of cytokines and chemokines that are secreted by numerous cells playing an essential role in immune signaling, homeostasis and cellular responses. These molecules act as molecular messengers that can bind to specific receptors and initiate downstream signaling pathways. Cytokine binding to its corresponding receptor activates downstream pathways such as JAK / STAT, MAPK and NF-κB pathways, which control cell proliferation, survival, immune cell activation and differentiation and expression of other immuneAttorney Docket Number: WVU 3065-PCT molecules. Chemokines are involved in direct recruitment of immune cells during various processes including inflammation and immune surveillance. Upon chemokine binding, GPCRs triggers intracellular signaling pathways such as PI3K / Akt and MAPK pathways, which enhances chemotaxis, intracellular calcium signaling, proliferation, cell growth, superoxide production, and cell survival.
[0229] In this activity, we will analyze the effects of mRNA genetic adjuvant candidates on immune activation of human PBMCs and THP-1 cells in addition to the elicited immune responses including germinal center responses in a murine model when administered with base vaccines. These analyses will be performed using single-cell RNA sequencing and quantitative intravital molecular imaging techniques. Identifying the key receptors and signaling pathways associated with vaccination including mRNA genetic adjuvants as well as those associated with desired immune responses will help us to rationally design adjuvants with improved efficacy and reduced adverse effects. The outcomes of this activity will contribute to the fundamental understanding of mRNA genetic adjuvants and how they can be used safely and effectively. In silico analysis of the effects of genetic adjuvant candidate’s effects on immune activation of human PBMCs.
[0230] THP-1 and human PBMC analyses will occur in vitro with the human versions of each genetic adjuvant. As cells produce the genetic adjuvant, the corresponding chemokine or cytokine will be produced which will result in release of a signal that can then be sensed by neighboring cells. In the case of THP-1 cells, they will be limited in the number and diversity of receptors. However, human PBMCs have numerous receptors and can likely respond to all of the candidate genetic adjuvants. We will first evaluate the cellular effects of each genetic adjuvant using RNAseq analysis. Based on our knowledge of each cytokine and chemokine (FIGS. 11 and 12), we will perform logical in vitro experiments to confirm pathway activation using human genetic adjuvants. Next, we will perform mouse studies using three protective genetic adjuvants based on their performance in challenge studies. Lastly, we will use live animal germinal center imaging to visualize and confirm the early events and cell signatures responsible for adaptive immunity.
[0231] Only mRNA genetic adjuvants that improved the protection of the base vaccines—Attorney Docket Number: WVU 3065-PCT mRNA-1273 (COVID-19), Tdap (pertussis acellular vaccine) or BCG vaccine (live attenuated)— will be further investigated. Ideally, we will test the mRNA genetic adjuvants that most enhanced responses per base vaccine (one adjuvant per vaccine). However, in the event where there was improvement of protection from more than one mRNA genetic adjuvant in one vaccine and no significant improvement seen in other vaccines, we will consider testing more than one mRNA genetic adjuvant per vaccine. In silico analysis of pathway activation from in vitro
[0232] The effect of administering mRNA genetic adjuvants will be screened using single cell RNA sequencing analysis. The data will be evaluated using the Honeycomb HIVE analysis pipeline and will be further analyzed using Seurat R toolkit of single cell genomics. The cell type annotation will be performed using automated methods such as ScType. If the automated cell type annotations will not be able to annotate specific cell types, marker genes to identify these clusters will be defined based on the following criteria: 1) the average expression value in the cluster of interest will be at least 0.5 fold higher than the average expression in all of the other clusters combined; 2) the marker genes will be expressed in the top 10% of the associated cluster of interest compared to the rest of the clusters. We will also consider known canonical cell markers to annotate the single cell clusters. After annotation of cell clusters, we will confirm gene expression of primary receptor and downstream pathways in different cell subsets. We will perform GO Term analysis of cell clusters to understand the specific signaling pathways that are upregulated or downregulated in response to a mRNA genetic adjuvant. Functional gene enrichment of differentially regulated genes in each cell cluster will be performed using WebGestalt Gene set analysis toolkit. We will also perform upstream regulator analysis within each cell cluster using Ingenuity Pathway Analysis (IPA, QIAGEN Inc.). These analyses will help us further understand the effects of mRNA genetic adjuvants on functional / activity pathways within specific cell clusters in human PBMCs. Confirmation of pathway activation per each family of receptors.Attorney Docket Number: WVU 3065-PCT
[0233] In order to confirm downstream pathway activation per each family of receptors, we will use THP-1 cells. THP-1 cells will be treated with genetic mRNA cytokine / chemokine adjuvant or nonsense scrambled mRNA as an mRNA sensing control. We will use an optimal concentration of mRNA constructs. We will use known adjuvants as a comparison control. Production of mRNA- expressed candidate cytokines / chemokines will be confirmed and quantitated using R&D Luminex Simplex assays in THP-1 cells or alternative cell lines. To examine the effect of the downstream pathway activation of mRNA constructs or control adjuvants, we will extract proteins at 12- or 24- hours post-treatment from THP-1 cells and perform western-blotting using specific antibodies against target downstream proteins to measure their expression levels and phosphorylation status. To investigate the downstream protein-protein interactions and identify components of cytokine / chemokine signaling complexes we will perform immunoprecipitations using cell lysates collected 12 or 24 hours post-treatment from THP-1 cells. Immunoprecipitated complexes will be analyzed by western blot or mass spectrometry. We will also perform luciferase cell reporter assays in THP-1 cells for specific downstream signaling pathways. Luciferase reporter THP-1 cells will be treated with mRNA genetic adjuvant or nonsense scrambled mRNA as an mRNA sensing control. To assay luciferase activity, cells will be lysed at 16 hours post-treatment using lysis buffer and luciferase activity will be measured using SpectraMax i3 spectrophotometer (Molecular Devices LLC). The same experimental setup will be used for each family of genetic mRNA cytokine / chemokines described below unless otherwise specified.
[0234] IL-1 family: Upon IL-1 cytokine binding, TIR domains of primary receptor specific for cytokine binding and its accessory receptor form a dimer and lead to recruitment of MYD88, IRAK4, TRAF6 and other downstream signaling molecules. We will perform immunoprecipitation and western blot techniques to identify protein complexes and activation of the MyD88 / IRAK4 / TRAF6 pathway. IL-1 family cytokines lead to activation of NF-κB downstream signaling54,109. To quantify activation of NF-κB signaling pathway, we will use an NF-κB luciferase reporter assay in THP-1 cells. To identify the biological activity of IL-1 family inhibitor cytokines IL-1RA and IL-36RA, THP-1 cells will also be stimulated with IL-1 or IL-36 cytokines.
[0235] TNF family: The main downstream signaling pathway of TNF-family is activation of the NF-κB pathway. The TNF family also leads to activation of JUN, p38, ERK1 / ERK2 proteins. WeAttorney Docket Number: WVU 3065-PCT will perform western blot to quantify activation of JUN, p38 and ERK1 / ERK2 proteins. We will also perform NF-κB luciferase reporter assay to quantify NF-κB signaling activity.
[0236] Type 1 and Type 2 cytokines: Both Type 1 and Type 2 cytokines signal through the JAK / STAT signaling pathway. Upon cytokine activation, STATs are activated via phosphorylation by JAK family members and dimerize to translocate a signal to the nucleus. Using western blot and immunoprecipitation, JAK / STAT signaling activation can be quantified. For cytokines that activate STAT3, such as IL-6 and IL-10, we will use a STAT3 luciferase reporter assay in THP-1 cells. To monitor the activity of interferon-induced JAK / STAT signaling pathway that leads to activation of STAT1 and STAT2, we will use Interferon Stimulated Response Element (ISRE) luciferase reporter kit.
[0237] IL-17 family: IL-17 family cytokines activate MAPK pathway proteins. We will identify activation of MAPK pathways by quantifying protein expression and phosphorylation status using western blotting. We will use the NF-κB luciferase reporter assay to quantify downstream NF-κB signaling activation.
[0238] Chemokines: Upon binding, chemokines mediate GPCR signaling that leads to downstream activation of PI3K / Akt, MAPK pathways. We will quantify protein expression and phosphorylation of downstream pathways of GPCR signaling. To measure activation of GPCR upon stimulation, intracellular calcium flux assay using Fluo-8 dye will be used to monitor fluorescence intensity after cells received mRNA cytokine / chemokine adjuvant or mRNA sensing control. scRNAseq analysis of early immune responses to genetic adjuvants paired with base vaccines.
[0239] To test the hypothesis that mRNA genetic adjuvants can improve immune responses to the base vaccines, we will administer three select mRNA genetic adjuvants per year together with base vaccines in a murine model. mRNA genetic adjuvants that will be used in this study will be selected. We will use adult C57B / 6 mice (5 female and 5 male mice / group) and immunize mice with mRNA genetic adjuvants alone or together with base vaccines mRNA-1273 (COVID-19), Tdap (pertussis acellular vaccine) or BCG vaccine (live attenuated). The dose of vaccines used in this activity will be determined. We will use scrambled mRNA packaged LNPs as a vehicle control. The control and experimental groups that will be used are listed in Table 4. The controls of scrambled mRNA only,Attorney Docket Number: WVU 3065-PCT vaccine only and scrambled mRNA paired with a base vaccine will only be performed once throughout the program.
[0240] Mice will be euthanized 1-day post-vaccination to analyze the effect of mRNA genetic adjuvants on overall early immune responses when paired with base vaccines. The draining lymph nodes will be collected, homogenized and strained using a 70 µm filter. Cells will be counted using trypan blue in Countess II Automated Cell Counter. Five male or female mice per group will be pulled together and loaded into Honeycomb HIVE CLX single cell analysis picowells containing barcoded mRNA-capture beads. Approximately 30,000 live cells per HIVE will be loaded. RNA sequencing will be performed using an Illumina NovaSeq X. These studies will define early elicited immune responses occurring in vivo due to administration of mRNA genetic adjuvant. The Love lab at MIT will perform analyses on these data to determine the key populations of cells identified as a function of the adjuvant, changes in those populations, and pathways activated by the adjuvants. Analysis of germinal center responses to immunization with genetic adjuvants.
[0241] Clonal expansion of germinal centers within lymph nodes can be measured using live animal imaging by quantitative intravital molecular imaging to understand the spaciotemporal events preceding immunization and prior to induction of adaptive immunity. This imaging system (FIGS. 15A to 15D) will allow us to understand the temporal and spatial changes in immune cell populations within the lymph node in relation to immunization and mRNA vaccine antigen expression. This real-time imaging of immune cell recruitment and mRNA vaccine distribution andAttorney Docket Number: WVU 3065-PCT uptake at cellular resolution in vivo is not achievable with other imaging modalities. Using this technology, we can evaluate changes occurring in the lymph node following treatment that are easily overlooked with conventional biological, immunological, and imaging techniques (e.g., Western blot, immunohistochemical staining, positron emission tomography). This intravital molecular imaging platform utilizes window chamber murine models that uniquely combines bioluminescence and fluorescence imaging with genetically-encoded and exogenous reporters (FIGS.15A and 15D). This combination provides a powerful multi-plex strategy to study molecular and cellular processes spatially and temporally in a quantitative manner longitudinally in vivo. The same window chamber can be consecutively imaged at the macroscopic and microscopic scale, monitoring global changes and molecular and cellular changes at high resolution (FIGS.15A and 15C). We have the capability to image immune cells using fluorophore conjugated antibodies. T cells, and neutrophils were imaged within a tumor microenvironment (FIG. 15D). Tumor cells stably express a yellow fluorescent protein reporter while CD8+T cells and neutrophils were imaged 30 min following a retro-orbital injection of CD8a-conjugated APC / Fire750 and Ly6G-conjugated APC antibodies (FIG.15D).
[0242] In order to identify, localize, and analyze cells expressing mRNA adjuvant antigens, we will use mRNA reporter constructs using a Click beetle red luciferase (CBR, λem= 600 nm)117, a red fluorescent protein, E2Crimson (λex= 612 nm, λem= 645 nm), and a conjugated bioluminescence- fluorescence reporter, CBR-E2Crimson. These reporters are encoded on the same mRNA after the mRNA genetic adjuvant sequence (FIG. 16). We will also generate control mRNA reporter constructs using scrambled mRNA packaged LNPs. In vitro and in vivo expression of the bioluminescence and fluorescence proteins will occur parallel to the expression of adjuvant antigen within the cells that uptake mRNA genetic adjuvant construct. These constructs will allow us to track the spatiotemporal localization of mRNA delivered to cells and levels of adjuvant antigen produced by these cells. In this study, we will use C57B / 6 mice (5 female and 5 male mice / group) and immunize mice with mRNA genetic adjuvants alone or together with base vaccines mRNA-1273 (COVID-19), Tdap (pertussis acellular vaccine) or BCG vaccine (live attenuated). The mice groups that are proposed to be used in this study are shown in Table 5.Attorney Docket Number: WVU 3065-PCT
[0243] We will characterize mRNA reporter adjuvant uptake and expression profiles of cells at the injection site by injection E2Crimson mRNA adjuvant construct alone or with a base vaccine of interest. Vaccinated mice will be euthanized at day 1 post intramuscular injection, and lymph nodes will be processed as described herein. E2Crimson positive lymphocytes will be sorted by FACSAria III Sorter to identify cells that are expressing adjuvant antigen. These cells will be sequenced and analyzed Honeycomb HIVE single cell sequencing platform to fingerprint the cells affected by immunization of mRNA vaccines.
[0244] We have established an inguinal lymph node window chamber adapted from our abdominal window, as shown in FIG.26A. Accumulation of Texas Red dextran in the lymph nodes and lymphatic vessels was observed in real time following a retro-orbital injection by confocal imaging. In vivo tracking of mRNA genetic adjuvant CBR reporter expressing cells will occur using lymph node window chambers, as shown in FIG.26B and 26C. CBR bioluminescence will only be detected in the presence of luciferin. Due to the negligible background photons in bioluminescence, we anticipate that the CBR bioluminescent construct will provide the best strategy for quantification due to the large signal-to-noise ratio. Following immunization using the mRNA genetic adjuvant reporter alone or together with the base vaccine, the translation of adjuvant antigen at the inguinal lymph node will be quantified using bioluminescence imaging. The immune cells identified from the single cell RNA-sequencing studies described above will identify the target immune cells that uptake and express the mRNA adjuvant vaccine. These immune cells will be labeled using fluorophore- conjugated antibodies; B cells will be imaged using B220, CD8+and CD4+T cells will be imaged using CD8 and CD4, dendritic cells will be imaged using CD11c, neutrophils will be imaged usingAttorney Docket Number: WVU 3065-PCT Ly6G, macrophages will be imaged using F4 / 80. We will quantify in real-time the expression of adjuvant antigen CBR bioluminescence by immune cell types at days 1, 2, 4, and 7. We will further identify the recruitment of immune cells by immunization with the mRNA adjuvant reporter. These studies will quantify and describe the cell types that translate the adjuvant antigen as well as the corresponding recruitment of immune cells at the lymph node from immunization with mRNA genetic adjuvant. Structure-Activity Relationship (SAR) Studies
[0245] Cytokines and chemokines are the protein mediators of the immune response. The binding of these proteins to their corresponding receptors expressed on the surfaces of immune and peripheral cells triggers downstream responses including chemotaxis, activation, and other immunological functions to resolve threats. Cytokines exhibit a high level of pleiotropy among receptors—multiple proteins may signal through the same receptor—made possible by the high degree of structural homology showcased between families of proteins despite unique genetic sequences. In FIG. 25, a representative from three major families is shown to show the various domains these proteins can encode. Each domain serves as an opportunity to change cytokine structure and activity. For example, signal peptides, which often are found at the beginning of the gene sequence, ensure protein secretion after expression, pro-peptides at the end of the sequence are post-translationally modified to turn proteins into their active forms, glycosylation and lipidation sites throughout the sequence. The observation that cytokine sequences are largely variable and convey unique responses despite a fairly large order of homology between families demonstrates the important of these unique domains and sites for post-translational modifications that control function. This also contributes to the hypothesis that cytokine structure modifications, and perhaps even truncated forms of the proteins, may lend themselves to the development of therapeutic cytokine molecules.
[0246] Our mRNA-based genetic adjuvant technology offers a unique opportunity to simplify cytokine adjuvants into their most active domains. Cytokine tertiary structure varies by family but at a very generalized glance, most feature α-helical bundles and a series of anti-parallel β-sheets. After assembly, some cytokines exist as monomers but many of the proteins form multimers asAttorney Docket Number: WVU 3065-PCT homodimers or homotrimers. As just one example of our theory, it’s possible that administration of an encoded single protein subunit of the full multimer could elicit an equally functional response. We will explore this concept and other variations of encoded truncated cytokines, exploiting the ease with which gene sequences can be created to specifically encode active protein derivatives.
[0247] The spike protein encoded by mRNA in Pfizer and Moderna’s COVID-19 vaccines was a unique choice as it features a stabilization mutation that ensures the protein is always surface expressed and constitutively open. We hypothesize that the domains of each cytokine protein are integral to its function inside the host and its interactions with its cognate receptors. However, it is possible that intracellular expression and not secretion can provide adjuvanticity.
[0248] The adjuvant compounds used in modern day vaccines consist of a number of highly purified substances from a variety of sources. Two examples, the active molecule of Matrix-M is just one of many saponins purified from tree bark extracts, and CpG oligodeoxynucleotides are concise DNA motifs rich in unmethylated bases, and pathogen-associated molecular patterns. As are any proteins naturally expressed by eukaryotes, cytokines are subject to the process of proteolysis where whole proteins are cleaved as a means of maintaining homeostasis in biochemical pathways. Cleavage of cytokines into truncated derivatives has been described previously for chemokines that signal through the receptor CXCR3. Multiple variants of CXCL10 exist in stimulated human keratinocyte cultures which each differed from the expected mass of the protein based on previously published data on its amino acid sequence. It was determined that each of these variants was derived from proteolytic interactions at a number of predicted cleavage sites. Cleaved variants may not retain the functions of the complete protein, however it would be necessary to distinguish between variants where cleavage deletes function entirely versus merely reducing it, as has been shown previously. If a cytokine candidate that comes through our screening pipeline is known to exist naturally in both membrane-bound as well as secretory forms, such as some proteins belonging to the tumor necrosis factor family, it will become important to distinguish the unique properties of each variant. Additional candidate mRNAs can be encoded as truncated sequences of the form of interest. Selection of domains of genetic adjuvants for evaluation.
[0249] We will continue to focus our attentions on the genetic adjuvant candidates to determineAttorney Docket Number: WVU 3065-PCT the potential bioactivity of truncated variants of each protein. First, we will start by utilizing UniProt and other public databases to define the unique protein domains of each cytokine or chemokine. Second, we will preferentially select alpha-helices domains in these cytokines to increase stability and resistance to proteases, increase immunogenicity, and avoid the formation of aggregates such as amyloid fibrils. The selection will vary depending on the number of alpha-helices domains in each cytokine. For example, interferon-gamma contains only alpha-helices domains, CXCL10 contains only one alpha-helix in the c-terminal domain, but TNFs do not have alpha-helices domains. Additionally, we will predict possible cleavage sites, glycosylation sites, and lipidation sites as potential positions to make point mutations that will delete these features. Examples of the possible domains possessed by candidates from each cytokine family are mapped in FIG.25. The various features of each cytokine and cytokine family provide integral support for the protein’s biological function. The secretion signal, found on interleukins, interferons, and colony stimulating factors, enables export +of the proteins post-translation inside the cells, releasing them into circulation to bind peripheral receptors. Pro-peptides, found on the terminal end of the amino acid sequences for a number of chemokines, function as sites for post-translational cleavage by matrix metalloproteases which activate the protein to function at rates much higher than un-cleaved forms. It is unclear if exclusion of these domains in the encoded sequence for these proteins when used as genetic adjuvants will have a negative impact on function. Other cytokines, such as those in the tumor necrosis factor family, exhibit multiple variants of their intracellular domains in addition to unique sequences for membrane-bound and soluble forms. For this reason, we will investigate if truncating the pro-peptide region of the selected cytokines will confer intracellular adjuvant activity in comparison to their extracellular counterpart. In the selection of genetic sequences for the genetic adjuvants described in this program’s proposal, it will be important to select sequences for the desired protein domains, as well as determine the importance of these domains in downstream functions. Production of truncated genetic adjuvant DNA templates.
[0250] We will produce DNA plasmid templates of the specific domains of the lead genetic adjuvant candidates. We assume that the genetic adjuvant candidates will have numerous proteinAttorney Docket Number: WVU 3065-PCT domains including but not limited to: alpha-helices domains, signal peptides, pro-peptides, intracellular domains, cleavage sites, glycosylation sites, lipidation sites, and modified residues which regulate the cytokines’ homeostatic functions in vitro and in vivo. From the selected genetic adjuvant candidates, we will select up to 12 total truncated genetic adjuvant constructs based on the predicted domains of our candidates. As shown in FIG.25, it is possible that one selected candidate may consist of only a secretion signal and the cytokine’s amino acid chain (as demonstrated by IL- 17A), while another cytokine’s amino acid sequence may have multiple predicted variations of intracellular domains in addition to multiple active forms and numerous sites for post-translational modifications (for example, TNF). With this in mind, we may choose to produce for example, only one truncated version of IL-17A (a version lacking a signal peptide) and compare it to a complete version, while six truncated versions of TNF (comprised of one of two intracellular domain variants, lacking predicted modification sites, or encoding either the soluble or membrane form) are assessed in these studies compared to a sequence of its native form. Synthesis of truncated genetic adjuvant RNA constructs and formulation into LNPs.
[0251] We will select the coding sequences for the desired domain or domains of each truncated human cytokine candidate and perform codon optimization to ensure host expression in human cell lines. Like in A1.3.1, we will add 5’ and 3’ β-globin UTR sequences, a Kozak sequence, and a triple- stop codon to frame the coding sequence. The resulting sequence containing UTRs and the domain sequences will be cloned into DNA plasmid vectors to add a T7 promoter sequence as well as a PolyA tail. Primers specific to the vector will be used in PCR reactions to linearize and amplify DNA templates for the truncated genetic adjuvants. The resulting product will be purified and subjected to Sanger sequencing to confirm production of a correct template. After confirmation of the sequence, the DNA templates will be used in in vitro RNA synthesis reactions. If desired, epitope tags may be constructed for truncated genetic adjuvant candidates using a series of custom primers designed to generate N or C term HA epitopes on the constructs.
[0252] The products of these mRNA synthesis reactions will be purified by HPLC. Briefly, reaction products will be filtered using a POROSTMOligo (dT)25 Affinity Resin (Thermo Fisher) column composed of 50 µm polymeric resin to remove remaining plasmid DNA templates andAttorney Docket Number: WVU 3065-PCT additional transcription reaction reagents. After wash steps with Tris-HCl and EDTA, the mRNA product will be eluted using using 3–5 CVs of 10 mM Tris-HCl,1 mM EDTA, pH 7.4, or 3–5 CVs water. At this point, the mRNAs will be assessed for both quality and purity using the Agilent 4200 RNA TapeStation. Before administering our truncated candidate mRNAs to cells, they will be formulated into lipid nanoparticles using the GenVoy Ionizable lipid mix and the Precision Nanosystems Ignite instrument. Confirmation of expression of truncated mRNA genetic adjuvant candidates in HEK293T cells.
[0253] In order to compare the adjuvanticity of our truncated candidate genetic adjuvants, we will administer formulations of truncated construct LNPs as well as the base complete adjuvant candidates to HEK293T cells. Mirroring the validation studies described in A1.3.6, HEK293T cells (ATCC CRL-3216) will be cultured in DMEM+L-glutamine in 5% CO2. Truncated candidate formulations and their complete-protein controls will be added to cell culture supernatant at 10, 1, and 0.1 µg amounts, then briefly incubated with gentle swirling to increase LNP contact with cells, and left to incubate for up to 24 hours. Cells and cell media will be collected at 6 and 24 hrs post- administration. Expression of the truncated candidates both intracellularly and secreted will be confirmed. In the case that the target epitopes of anti-candidate antibodies available in commercial kits are not available in the truncated versions of the proteins, expression can be confirmed through the quantitation of HA-tagged proteins in the cell lysates and media. Assessment of cellular activation by truncated genetic adjuvants in THP-1 cells
[0254] It is assumed that the truncated versions of our mRNA genetic adjuvant candidates may induce differential effects when compared to the complete versions identified in our program thus far. However, the possibility remains that the truncated versions can induce similar degrees of adjuvant responses, thereby demonstrating the efficiency and utility of simplified mRNA constructs. After confirming that our truncated candidates are expressed in HEK293T cells, we will move on to measure their immune-activating capabilities in the human monocyte THP-1 cell line (ATCC TIB- 202). As in A1.3.7, 1x106THP-1 cells will be stimulated with 10, 1, and 0.1 ug of control candidateAttorney Docket Number: WVU 3065-PCT mRNAs or truncated candidate mRNAs to compare the degree of similarity between truncated and complete versions of the expressed proteins. Cells will be collected at 24 & 48 h post incubation at which point the fluorescent intensity of surface activation markers will be measured in comparison to empty LNP and untreated controls. THP-1 cells post-treatment will be dissociated from plate wells, Fc blocked and stained using a Live / Dead Viability stain (Near-IR, Invitrogen), α-CD80- BV421 (BioLegend), α- CD11b-BB515 (BD), and α-CD14-PE-Cy5 (Biolegend) to determine activation through the expression of macrophage markers. Stained cells will be fixed using 4% paraformaldehyde. Cells will be analyzed in a 96-well plate using a BD Aurora spectral flow cytometer. Truncated versions of genetic adjuvant candidates that are able to activate macrophage differentiation in the THP-1 cells at an increased rate compared to the negative controls will move on to additional immunological activity screenings in A3.3.6 using human PBMCs Evaluation of immune activation by truncated adjuvant candidates in human PBMCs.
[0255] To further understand the immunological response to truncated adjuvant candidates compared to their previously investigated complete form, we will repeat scRNAseq using PBMCs stimulated with the truncated candidates that induced high levels of activation in THP-1 cells in A3.3.5. As in A1.3.8, Leukopak leukapheresis products will be procured from STEMCELL Technologies. PBMCs will be isolated using ACK lysis RBC depletion, and platelets removed. PBMCs will be counted using an automated cell counter, and cells will be seeded overnight at 5 x 105cells / well in a 24-well plate. Cells will be cultured in RPMI-1640 with 2% patient serum isolated from the corresponding Leukopak. Cells will be treated the following morning with a candidate adjuvant mRNA construct. After a 24 h incubation suspension and adherent cells will be harvested and counted. We will utilize a Honeycomb Hive cell capture chamber to separate single cells. This technology enables for a high yield recovery of cells and a direct platform for RNA library preparation that we have used in the past. RNA sequencing will be performed using an Illumina NovaSeq X, pooling 10 samples per flowcell, resulting in an estimated 36,000 reads / cell. From the resulting data sets, we will seek to identify amplification of inflammatory responses and compare the transcriptional profiles of PBMCs treated with the truncated candidates to the responses.Attorney Docket Number: WVU 3065-PCT Investigation of co-administered genetic adjuvant candidates through in vitro and in vivo immunogenicity screening.
[0256] Individual cytokines function in combination with an assortment of additional cytokines in vivo to convey immune responses. We hypothesize that the use of multiple candidate genetic adjuvants described in this program in combination with each other will be efficacious in some cases of coformulation with vaccine antigens. We will select genetic adjuvant candidates that may prove to be efficacious in vaccine co-formulations when used in combination with each other. For this, we will generate complete or truncated genetic adjuvants, formulate them in LNPs and administer them to mice utilizing the immunization and disease models described. Results mRNA vaccine confers dose-dependent antibody responses and protection in mice.
[0257] Modelling human vaccines in animal models requires vaccines to be administered at much lower doses. A mouse-relevant protective dose of the COVID-19 vaccine mRNA-1273 is unknown. In prior studies performed by our lab, 1 / 10thhuman dose of mRNA-1273 (10 µg) was determined to be protective against challenge with SARS-CoV-2 variants of concern. This dose, however, is high and likely to confer sterilizing immunity, making it difficult to compare against novel vaccines or improve with novel formulations. An experiment was designed to accomplish the major goals of establishing a protective mouse dose of COVID-19 mRNA vaccine as well as establish the durability of this protection. A cohort of female K18-hACE2 mice were vaccinated using nine doses of mRNA vaccine, titrated from 10 µg (1 / 10thhuman dose) to 0.16 µg (1 / 640thhuman dose). Mice received a second dose of vaccine four weeks after the first.
[0258] FIGS.17A to 17F shows an investigation of vaccine dose-dependent antibody responses and protection against SARS-CoV-2 challenge in K18-hACE2 mice. 8-week-old female K18- hACE2 mice were vaccinated with a titration curve of mRNA-1273 doses then boosted 4 weeks later with an identical dose. (FIG.17A) Blood was collected from the submandibular vein two weeks after priming, one week after boosting, then monthly for six months to track changes in RBD-IgG antibody levels. ELISAs were performed to calculate AUC A450 values for each mouse. Dotted lineAttorney Docket Number: WVU 3065-PCT represents limit of protection determined using average group antibody level and viral challenge data. (FIG.17B) AUC values for the curve of changes in antibody level from two to 33 weeks post- prime. (FIG.17C) In vitro plaque neutralization assays were performed using dilutions of serum collected from vaccinated mice one week post boost cultured with SARS-CoV-2 Omicron virus and Vero cells. (FIG. 17D) In vitro plaque reduction assays using serum collected one week prior to SARS-CoV-2 challenge. (FIG.17E) Lung homogenates were collected from vaccinated mice two days after SARS-CoV-2 Omicron challenge to measure viral burden by plaque forming units (PFU). (FIG.17F) qRT-PCR was performed on total RNA collected from the lung tissue of challenged mice at euthanasia to quantitate copies of the SARS-CoV-2 nucleocapsid gene. Data points represent mean + SD of n=5 mice per group at each timepoint.
[0259] Serum analysis revealed anti-RBD IgG antibody production two weeks after priming that peaked one week after boost and waned over monthly serum collection points (Fig.17A). Vaccine dose directly correlated to antibody levels, with the highest dose of mRNA eliciting the highest amounts of serum IgG (Fig.17B). Only mice vaccinated with the lowest dose of vaccine, 0.16 µg, were determined to not have a significant increase in serum IgG compared to PBS vaccinated controls. Importantly, regardless of dose, all mice experienced antibody waning over time. To assess the function of these antibody levels, in vitro plaque neutralization assays were performed with serum collected at two timepoints. Using serum collected at five weeks post-priming (1-week post- boost), fewer plaques were observed in cultures where Vero E6 cells were incubated with the SARS- CoV-2 Omicron virus and serum collected from mice vaccinated with the highest doses of vaccine (Fig. 17C). This observation is indicative of virus neutralizing antibodies present in vaccinated serum. Repeating the assay withs serum collected 32 weeks post-boost, the correlation between high vaccine doses and low plaque formation was largely maintained, however, the standard deviation between individual mice in each group became greater (Fig. 17D). No statistically significant difference was measured between vaccine groups’ plaque neutralization at weeks 5 or 32. At week 33 of the experiment, approximately six weeks post-boost, mice were subjected to intranasal challenge with the SARS-CoV-2 Omicron BA.1 virus, then euthanized two days post-challenge to measure viral burden in the lungs. Again, a clear correlation was observed between high doses of vaccine and limited live virus detected in plaque assays performed with lung homogenateAttorney Docket Number: WVU 3065-PCT supernatants (Fig.17E). PFU levels were reduced to the assay’s limit of detection for 60% of the mice in the 10, 5, and 2.5 µg dose groups. Despite 0.16 µg being the only vaccine dose which did not significantly increase average IgG levels above those in the PBS group (Fig. 17A, 17B), neither mouse groups vaccinated with 0.16 µg or 0.31 µg were determined to have lower PFUs in the lung than the PBS group (Fig.17E). Viral RNA levels encoding the SARS-CoV-2 nucleocapsid gene were quantified in total lung RNA using qRT-PCR and recapitulated PFU data where viral copy numbers in some mice approached the limit of detection in higher vaccine dose groups (Fig.20F). Here, copy numbers in all vaccine doses through the eighth titration (0.31 µg) were significantly lower than those in the PBS group (Fig. 17F). These data together show that the generation of protection from mRNA vaccines occurs in a dose dependent manner, and suggests that in laboratory mice, the lowest dose of vaccine necessary for partial limitation of viral replication upon SARS- CoV-2 is approximately 0.6 µg.
[0260] Based on these data and the correlations made between vaccine dose, antibody levels, and PFU levels, the 2.5 µg dose of COVID-19 mRNA vaccine was determined to meet the minimum of protection necessary for mice. Although none of the dose groups limited lung PFUs to the assay’s limit of detection, this was the last dose in the titration which was able to partially confer this level of protection. Accordingly, the minimum level of IgG antibodies from a vaccine that are required to execute this protection was determined using an average AUC of 113740.8 for this group, 32 weeks after vaccination and 1 week prior to challenge. Single cell RNA sequencing of the lymph node from a mouse vaccinated with mRNA reveals a unique cellular immune profile activated by vaccination.
[0261] With an understanding of the relationship between vaccine dose and humoral immunity, the immunological response profile which supports the production of protective antibodies was studied. To transcriptionally identify the cellular response phenotype of the lymph nodes early after vaccination, we primed mice with a single high dose (10 µg) of mRNA vaccine or PBS, then collected the draining lymph node (dLN) 24 hours later and performed single cell RNA sequencing (scRNAseq).
[0262] FIG.18 shows cellular analysis of mouse tissues after COVID-19 mRNA vaccination.Attorney Docket Number: WVU 3065-PCT K18-hACE2 mice were vaccinated with 10 µg mRNA-1273 or PBS and euthanized 24 hours later to collect the draining lymph node (inguinal) for scRNAseq (n=1 mouse per group). (FIG.18A) UMAP of cell populations identified using the Honeycomb HIVE sequencing system. (FIG.18B) UMAP of cell identities unique to PBS vaccination vs mRNA vaccination. (FIG.18C) Percent makeup of cell types in PBS-vaccinated or mRNA-vaccinated lymph nodes. (FIG. 18D) Percent expression of inflammatory cytokines and chemokines by cell type. C57BL / 6 mice were vaccinated with 10 µg mRNA-1273 or PBS and euthanized 24 or 48 hours later to measure CXCL10 expression in the (FIG.18E) muscle, (FIG.18F) draining lymph node (popliteal) and (FIG.18G) serum. (n=5 mice per group).
[0263] We identified a diverse cellular profile within the lymph nodes that clustered into 10 distinct populations (Fig. 18A). Further analysis revealed clear separation between the clusters resulting from vaccination and those present in the control (Fig. 18B). Overlaps between the experimental groups included populations identified as macrophages, natural killer cells, and effector CD4+ T cells, which were present in similar frequencies (Fig.18C). The frequencies of naïve CD8+ and CD4+ T cells were greater in the PBS lymph node than in the vaccinated sample (Fig.18C). Most remarkably, scRNAseq revealed the expansion of a large cluster of cells identified by the expression of interferon-stimulated genes (ISG) (Fig. 18C). Interferon signaling is an essential coordinator of the inflammatory events that occur in response to vaccine antigen, making its pathways advantageous targets for novel vaccine strategies developed to improve immune responses. With this in mind, we looked at the relative expression of additional proinflammatory cytokines and chemokines among the cell clusters in our data set. From the list of genes selected for this analysis, CCL5 and TGFB1 showed similar levels of expression by greater than 25% of antigen presenting cells including macrophages, natural killer cells, and dendritic cells, however this trend existed in both PBS and mRNA vaccinated group (Fig.18D). The gene for CXCL10 was the only gene within our set expressed in the mRNA group which was not observed in the PBS group. CXCL10 was expressed by greater than 25% of macrophages after vaccination (Fig. 18D). CXCL10 is a chemokine expressed in response to IFNγ and TNF-α signaling to guide chemotaxis of T cells, macrophages, and natural killer cells following antigen recognition. Early investigation of the chemokine showed that administration of CXCL10 with antigens could generate immune memoryAttorney Docket Number: WVU 3065-PCT sufficient to protect against vaccinia challenge. Since then, clinical reports have identified CXCL10 profiles following vaccination which correlate to antibody development, suggesting its potential utility as a biomarker of protective immunity. We vaccinated an additional cohort of mice with mRNA or PBS to measure the duration and level of subsequent CXCL10 protein secretion. CXCL10 levels were highest in the muscle – the site of administration – at 24 hours (Fig. 18E). In the muscle’s draining lymph node (inguinal) and in serum, CXCL10 levels were also measurable at levels significantly higher than those of PBS vaccinated mice (dLN p=0.0005; serum p<0.0001) (Fig.18F). By 48 hours after vaccination, CXCL10 levels in all three tissues had dropped back to the levels of PBS controls (no significant difference). These data suggested to us that CXCL10 is a chemokine produced in the early, or innate, response to vaccination. With this in mind, we designed additional experiments to understand its role in the later development of protective immunity. The CXCL10 response to vaccination is elevated in response to boosting.
[0264] Our experiments showed that protective antibody responses directly correlate to dose of vaccine. We revisited the dose titration model and measured CXCL10 levels after priming and boosting in the lymph node where B cell responses develop. At 24 hours after administration of each dose, cohorts of mice were euthanized to collect the administration site draining lymph nodes.
[0265] FIG.19 shows analysis of CXCL10 responses in vaccinated mouse lymph nodes post- boost.8-week-old female K18-hACE2 mice were vaccinated with a titration curve of mRNA-1273 doses then boosted 4 weeks later with an identical dose. (FIG. 19A) Cohorts of mice were euthanized 24 hours after priming and boosting to analyze CXCL10 expression in the muscle-site draining lymph node. (FIG.19B) Correlogram showing the relationship between serum IgG levels one week post-boost and CXCL10 expression in the lymph node 24 hours after administration. (FIGS.19C-19H) Flow cytometry analysis of immune cell populations in the draining lymph nodes of vaccinated mice euthanized 24 hours post-boost. (n=5 mice per group).
[0266] FIGS.23A TO 23D shows a correlogram showing the relationship between serum IgG levels six weeks after boosting and CXCL10 expression in the lymph node 24 hours after administration. (n=5 mice per group).
[0267] FIGS.20A-20F show flow cytometry analysis of immune cell subtypes in the muscle siteAttorney Docket Number: WVU 3065-PCT draining lymph node of mRNA-1273 vaccinated mice 24 hour after vaccine priming. (n=5 mice per group).
[0268] In the supernatants of homogenized lymph nodes collected 24 hours after priming, slight increases in CXCL10 were observed in the higher doses of mRNA vaccine however these were not determined to be significant when compared to PBS (Fig.19A). After boosting, substantial increases in CXCL10 expression were measured at the highest doses, 2.5 µg to 10 µg, which were significant compared to PBS (Fig.19A). These levels of expression were also observed to correlate to both dose and peak antibody levels— mice vaccinated with the highest doses of mRNA vaccine expressed the most CXCL10 and showed the highest anti-RBD IgG serum titers one week post boost (Fig.19B). Flow cytometry analysis of the draining lymph node at the 24-hour timepoint post-vaccination was performed to evaluate changes in immune cell populations expected to be involved in vaccine- mediated immunity. After priming, CD11c+CD11b+ dendritic cells were the only antigen presenting cells found to be significantly increased in the lymph nodes of mice vaccinated with the highest dose of vaccine compared to PBS controls (FIG. 20). Trends in higher frequency of the other antigen presenting cells evaluated in vaccinated groups, CD11c+CD11b- dendritic cells and macrophages, were not determined to be significant (FIG.20B and 20C). B cells did significantly increase after priming, but this change was only significant in the 1.25 µg vaccination group (FIG. 20D). Interestingly, CD8+ and CD4+ T cell frequency were found to decrease after vaccination compared to controls (FIG. 20E and 20F). After boosting, macrophages increased in frequency along with CD11c+CD11b+ dendritic cells in vaccinated animals, however, CD11c+CD11b- cells still showed no changes (FIG.19C to 19E). B cell frequency continued to increase with vaccination (FIG.19F). And finally, CD4+ and CD8+ T cell frequencies still did not show any increases (FIGS.19G and 19H). CXCL10 expression by activated antigen presenting cells supports recruitment of previously antigen-experienced cells upon re-exposure. Our data here shows that 24 hours after both priming and boosting, innate responses involving antigen presenting cells such as dendritic cells and macrophages are active in the lymph node. After boosting, CXCL10 expression surpasses the levels occurring after initial antigen exposure correlating to increased recruitment of immune cells that coordinate immune memory responses inside the lymph node.Attorney Docket Number: WVU 3065-PCT Vaccinated aged mice show a correlation between low CXCL10 expression and reduced antibody responses.
[0269] Although some of today’s common vaccines are specifically formulated for children or for adults, this practice of one-size-fits-most vaccination fails to take into consideration the effect of additional factors such as biological sex, age, and preexisting conditions on the development of immunity. Immune responses are known to decline with age, leaving the elderly at risk for experiencing more severe infections, but also more vulnerable to poor efficacy of vaccines. We sought to evaluate CXCL10 expression profiles and COVID-19 mRNA vaccine efficacy in an aged mouse model. Groups of K18-hACE2 mice at 75 weeks of age were primed and boosted with PBS or either low (1.25 µg) or high (10 µg) doses of mRNA-1273. To our surprise, serum CXCL10 expression levels 24 hours after vaccination did not follow the trend in expression levels observed in the lymph nodes of younger animals.
[0270] FIGS. 21A-21E shows analysis of CXCL10 expression and antibody responses after vaccination in aged mice.75-week-old K18-hACE2 mice were vaccinated with 1.25 or 10 µg of mRNA-1273 in two doses spread 4 weeks apart. (FIG.21A) Serum CXCL10 levels quantified 24 hours post prime or post boost in vaccinated aged mice. Dotted lines indicate CXCL10 levels quantified in 8-week mice vaccinated with low (1.25 µg) or high (10 µg) doses of mRNA-1273 at the same time point post-boost. (FIG.21B) RBD IgG antibody levels measured by AUC A450 from ELISAs performed using serum collected from vaccinated mice 3 weeks post-boost. Grey data points show antibody levels in young mice comparisons. (FIG.21C) In vitro plaque neutralization assays were performed using dilutions of serum from vaccinated mice cultured with SARS-CoV-2 Omicron virus and Vero cells. Serum antibodies from vaccinated aged mice did not reduce viral plaque formation. FIGS.21D-21E) Lung homogenates were collected from vaccinated mice after SARS-CoV-2 Omicron challenge to measure viral burden by plaque forming units (PFU). Additionally, qRT-PCR was performed to quantitate copies of the SARS-CoV-2 nucleocapsid gene.
[0271] After priming, vaccinated animals did show significant increases in expression compared to PBS controls (Fig.25A). After boosting, CXCL10 levels remained at those reached following prime, nearly 1.5 times lower in the low dose group, and 3 times lower in the high dose group than levels in young mice at the same time point (Fig.25A). Anti-RBD IgG antibody levels were alsoAttorney Docket Number: WVU 3065-PCT significantly lower in aged mice, mirroring an event that occurs in aging humans (Fig.25B). These antibodies exhibited no virus-neutralizing activity in in vitro plaque reduction assays (Fig. 25C). During SARS-CoV-2 Omicron challenge, four weeks after boosting, it was also observed that neither dose of vaccine protected mice, with no significant differences in viral burden in the lung between vaccinated animals and PBS controls (Figs.25D and 25E). This correlation between a lack of CXCL10 expression after priming and low humoral responses that did not protect against SARS- CoV-2 challenge further demonstrated to us that CXCL10 responses after vaccination may be necessary for the production of protective antibodies. Antibody production after vaccination occurs independent of CXCL10
[0272] Our data thus far suggested that CXCL10 is a biomarker of efficacious vaccination and may be required for durable antibody responses. In order to define this relationship, we vaccinated B6.129S4-Cxcl10tm1Adl / J mice which are homozygous for a mutation in the Cxcl10 gene which replaces the coding region with a PGK-neo cassette thus impairing expression of the chemokine and downstream signaling axis. CXCL10-knockout (KO) and age matched C57BL / 6 (WT) mice were primed and boosted with the highest dose of vaccine (10 µg), then analyses were repeated to measure differences in antibody production and levels over time.
[0273] FIGS. 22A-22D show antibody responses to mRNA vaccine occur independent of CXCL10. C57BL / 6 (WT) and B6.129S4-Cxcl10tm1Adl / J (KO) mice were vaccinated with two 10ug doses of mRNA-12734 weeks apart. (FIG.22A) WT, but not KO mice show serum CXCL10 expression profiles after vaccination that are higher 24 hours post-boost than 24 hours post-prime. (FIG. 22B) AUC A450 values from ELISAs performed using serial dilutions of serum collected from mice quantitating changes in WA-1 RBD IgG antibody levels over time. (FIG. 22C) Area under the curve analysis of the change in IgG antibody levels over time in WT and KO animals shows no significant difference in total antibody levels over time. (One Way ANOVA with Dunnett’s Multiple Comparisons test).
[0274] As expected, 24 hours after priming and boosting, CXCL10 expression was undetectable in the serum of KO animals, while wild type animals showed the pattern of serum CXCL10 expression after prime increasing after boost (Fig.22A). KO animals still developed robust anti-Attorney Docket Number: WVU 3065-PCT RBD IgG antibody levels that waned at a similar rate as WT animals (Fig.22B). Only at 25 weeks after prime, or 21 weeks after boosting, was there a statistically significant difference between groups (Fig.22B). In total, there was determined to be no significant difference in antibody levels waning over the course of the experiment between the experimental groups (Fig.22C). These data countered the presumption that CXCL10, while still perhaps a biomarker of immune activation for effective vaccines, is not essential to the induction of durable antibody responses. CXCL13 is also expressed in a dose-dependent manner after prime and boost vaccination
[0275] With the finding that CXCL10 is not required for antibody production after vaccination, we turned our attention to another chemokine: CXCL13. While CXCL10 is involved in T cell trafficking and recruitment of antigen experienced CD8+ T cells after secondary antigen exposure, CXCL13 is an integral signaling protein for the development of germinal center responses and B cell recruitment. Previously, our lab has shown that CXCL13 expression following Bordetella pertussis whole cell vaccination (DTAP) is a biomarker for the development of long-lived memory B cell populations in the lymph nodes.
[0276] FIGS. 23A to 23D show CXCL13 expression occurs in a dose-dependent manner following vaccination in young as well as old mice. (FIGS.23A-23B) CXCL13 expression in the lymph nodes and serum of 8 week old mice that were primed or primed and boosted with a titration of mRNA-1273 doses and euthanized 24 hours after priming or boosting. (FIG.23C) Correlogram showing relationship between CXCL13 expression 24 hours post boost and antibody levels one week after boosting in vaccinated mice. (FIG.23D) Serum CXCL13 levels 24 hours after priming and boosting 75 week old mice with mRNA-1273. (n=5 mice per group).
[0277] In our COVID-19 mRNA dose-titration model, CXCL13 expression follows a similar pattern to that of CXCL10 where we observed slight increases in expression 24 hours after priming, with significantly higher expression after boosting in the lymph node (FIG. 23A) as well as the serum (FIG.23B). Although the expression level of CXCL13 post-boost was much lower than that of CXCL10, we still determined a correlation between expression level and serum antibody levels at peak (FIG. 23C). These data, keeping in mind our previous observations after DTP vaccination,Attorney Docket Number: WVU 3065-PCT further suggest to us that the expression profile of CXCL13 may be important to the production of antibodies. When we revisited the aging mouse model where antibody production levels are low and do not confer protection against viral challenge, the CXCL13 expression profile appears to remain intact in older mice (FIG.23D). Additionally, CXCL13 serum expression after priming and boosting in some aged mice was actually higher than the average expression level in younger mice. One observed difference in the aging model is that CXCL13 levels did not increase following the second dose of vaccine. These data confound the original observation in younger healthy adult animals of a positive relationship between CXCL13 and antibodies. However, this discrepancy between age groups may highlight the importance of customized vaccination strategies that support the immune response as it becomes complicated with age or other factors. Coadministration of Cxcl13-encoding mRNA with low doses of COVID-19 mRNA antigen increases antibody production
[0278] Adding adjuvants to vaccine antigen formulations is a common approach to improving the immunogenicity of vaccines. mRNA vaccines have yet to be formulated with today’s clinically approved adjuvants, such as aluminum hydroxide (alum) or MF59, and are considered self- adjuvanted due to the inflammatory nature of both the lipid nanoparticle and the synthetic RNA itself. COVID-19 mRNA vaccines are appreciated as successful inducers of antibody responses, despite the finding that these responses dramatically wane with time. We, and others, have hypothesized the potential utility of adjuvants that may improve the development of memory B cell populations but also antibody-producing plasma cells following mRNA vaccination. Based on our data showing that CXCL10 and CXCL13 expression after vaccination may be biomarkers for humoral immunity, we aimed to exploit expression of these chemokines during vaccination through mRNA genetic adjuvants.
[0279] FIG. 24 shows evaluation of CXCL13 expression and antibody responses following coadministration of COVID-19 mRNA vaccine with different adjuvants. Doses of vaccine were formulated to contain 0.32 ug of mRNA-1273 with Cxcl13-mRNA, empty lipid nanoparticles (eLNP), alum, CPG1018, or BECC470 then administered to mice on a four week prime and boost schedule. (FIGS.24A-24B) Serum CXCL13 was measured 24 hours after administration of primeAttorney Docket Number: WVU 3065-PCT and boost doses. (FIGS.24C-24D) Anti-RBD IgG antibodies in serum were quantitated by ELISA 2 weeks after prime and boost. (n=5 mice per group)
[0280] We produced genetic adjuvants encoding the mouse Cxcl10 and Cxcl13 genes and packaged them in lipid nanoparticles. Both constructs were determined to increase expression of the respective chemokine in serum following administration (FIGS.29A-29B). Notably, “empty” lipid nanoparticle controls formulated without mRNA cargo, also induced high expression of both chemokines. To measure if the genetic adjuvants could improve antibody production in response to antigen, mRNA-LNPs were admixed with the two lowest doses of mRNA-1273 that were determined previously to confer low levels of protection against SARS-CoV-2 challenge: 0.16 µg and 0.32 µg (FIGS.29A-29B). Two weeks after administration of the prime dose, serum anti-RBD IgG levels were not statistically different between mice receiving only mRNA antigen or mRNA antigen and the genetic adjuvant (FIGS. 29C-29D). After boost, mice vaccinated with Cxcl10- mRNA showed no change in antibody levels compared to antigen-only mice (FIG. 29E). The coadministration of Cxcl13-mRNA, however, robustly increased the antibody levels resulting from 0.32 µg of mRNA antigen, making them statistically comparable to antibody levels from 5 µg of antigen alone (FIG. 29F). These studies made a compelling case for further exploration of how control of CXCL13 expression at the time of antigen exposure could be used to improve responses to vaccines. To determine if a Cxcl13 encoding genetic adjuvant could outperform traditionally used adjuvants in CXCL13 exploitation, we admixed 0.32 µg of mRNA-1273 with either alum, CPG1018, or the LPS mimetic BECC470. Empty LNPs were also included as an adjuvant, as the lipid formulation of our mRNA-adjuvant differs from that of the mRNA-1273 vaccine. After priming, serum CXCL13 levels at 24 hours were increased in all groups of mice receiving adjuvants with the exception of groups receiving alum, which did not increase compared to mRNA antigen alone (Fig.24A). CXCL13 levels in the BECC470 group were remarkably higher than any of the other groups. None of the adjuvants, however, increased serum antibody levels compared to antigen alone two weeks later (Fig.24B). Four weeks after priming, mice were boosted with a second dose and bled at the 24 hour timepoint to assess Serum CXCL13 levels were increased compared to levels post-prime in the Cxcl13-mRNA, CPG1018, and BECC470 adjuvant groups (Fig. 24C). Interestingly, antibody levels two weeks later showed that only mice receiving antigen with Cxcl13-Attorney Docket Number: WVU 3065-PCT mRNA or eLNP adjuvants developed antibody levels that were significantly higher than the antigen only control (Fig.24D). Together, these data show that genetic adjuvants targeting the CXCL13 signaling axis may be strong potentiators of humoral responses to mRNA vaccines. Materials and Methods Mouse Vaccination and Serum Collection
[0281] The mRNA-1273 (Moderna) vaccine was diluted using sterile 1X PBS to formulate 50uL volume doses ranging from 10ug-0.156ug mRNA. Vaccines were administered into the hindleg of female 6–8-week-old mice. For boosting studies, a second identical dose of vaccine was administered four weeks after the first dose. Vaccination controls were made using 50uL sterile PBS administered at matched timepoints. Serum was collected from vaccinated animals via puncture of the submandibular vein at varying timepoints after vaccination. SARS-CoV-2 RBD IgG Antibody ELISA
[0282] Blood collected by submandibular bleed and cardiac puncture were assessed for anti- SARS-CoV-2 RBD IgG antibody content using ELISA. High-binding 96-well plates were coated overnight with 2ug / mL recombinant RBD protein in 1X PBS. Plates were then washed 3x with PBS- Tween20 and blocked with 3% nonfat milk in PBS-Tween20. After incubation at room temperature shaking for 1hr, plates were washed 3x again, then 5uL of serum was added into 95uL 1% nonfat milk-PBS-Tween20 in the first row of the plate. Samples were then diluted 1:2 into 1% nonfat milk- PBS-Tween20 from row A to G across two plates, leaving row H of the second plate as a blank containing only the diluent. Plates were incubated for 1 hour shaking at room temperature, then washed 4 times to remove unbound serum antibodies. Secondary antibody (goat anti-mouse IgG- HRP; Novus Biologicals NB7539) was added to all wells and incubated for 1 hour shaking at room temperature. Plates were washed 5x, then TMB substrate was added to all wells. After 15-minute incubation in the dark, 2N Sulfuric acid was added to stop substrate development. ELISA plates were analyzed by plate reader (Synergy H1) at an absorbance of 450 nm. Area under the curve analysis in GraphPad Prism V9.0.0 was used to quantify antibody levels using the dilution curves ofAttorney Docket Number: WVU 3065-PCT each sample and a baseline value calculated from the blank wells. Viral Challenge and Necropsy
[0283] Vaccinated K18-hACE2 mice for challenge studies were health checked by vet staff prior to being moved into the ABSL3 suite to ensure their fitness for further experiments. Mice acclimated for 3 days before challenge, at which point mice were anesthetized with an IP injection of ketamine (Patterson Veterinary 07-803-6637) + xylazine (Patterson Veterinary 07-808-1947) (70 mg / kg), then administered 25 µL of 105PFU Omicron virus stock by pipette into each nare (50 µL total dose). Daily checks post-challenge were performed in person to assess the development of disease phenotypes including weight loss, rectal temperature, and changes in behavior and appearance. Disease scores were assigned based on our lab’s previously described scoring system: mice are scored based on changes in weight, activity, appearance, conjunctivitis, and respiratory patterns. Any mice awarded a score of 5 or reaching 20% weight loss prior to the end of the experiment were humanely euthanized. All mice were euthanized 2 days post-challenge using an IP injection of pentobarbital (390mg / kg) and cardiac puncture was performed as a secondary method of euthanasia. Blood from cardiac puncture was collected in BD gold serum tubes and centrifuged at 12,000 x g for 5 minutes to separate the serum. Necropsy was performed to collect the lung tissue for further analysis. Viral PFU Quantitation
[0284] Right lobes of mouse lungs were collected at euthanasia, weighed, and homogenized in 1mL 1X PBS using the gentleMACS system from Miltenyi. Homogenates were portioned out, and those slated for PFU analysis were centrifuged at 15,000 x g for 5 minutes. At the time of the assay, Vero E6 ACE2 / TMPRSS2 cells were plated at 150,000 cells per well in 12-well plates and incubated at 37°C and 5% CO2 for 24 hours. Supernatants obtained from mouse lung homogenates were serially diluted in media, then 200uL was applied to each well in duplicate. Plates were incubated at 37°C and 5% CO2 for 1 hour, with gentle rocking every 15 minutes. After incubation, 2 mL of 0.6% carboxymethylcellulose overlay was added to each well. Plates were incubated at 37°C and 5% CO2Attorney Docket Number: WVU 3065-PCT for 4 days. On day 4, the overlay was aspirated. Wells were fixed with 10% neutral-buffered formalin and stained with 0.1% crystal violet. qRT-PCR Analysis of Viral Gene Copies
[0285] During necropsy, 300uL of mouse lung tissue homogenates were added to 900uL TRIzol reagent and frozen at -20°C until the end of the experiment. To measure SARS-CoV-2 nucleocapsid gene copies, samples were thawed, then RNA was isolated using the Direct-zol RNA miniprep kit (Zymo Research R2053) according to the manufacturer’s protocol. qPCR of the SARS-CoV-2 nucleocapsid gene was then performed for each mouse and sample using the Applied Biosystems TaqMan RNA to CT One Step Kit (ThermoFisher Scientific 4392938) with the primers F: ATGCTGCAATCGTGCTACAA; R: GACTGCCGCCTCTGCTC) and TaqMan probe (IDT: / 56- FAM / TCAAGGAAC / ZEN / AACATTGCCAA / 3IABkFQ / ) synthesized according to Winkler. et al, 2020 to measure viral copy number via transcript number. Each sample reaction was prepared in triplicate and analyzed in MicroAmp Fast optical 96 well reaction plates (Applied Biosystems 4306737) on the StepOnePlus Real-Time System machine using the following parameters: Reverse transcription for 15 minutes at 48°C, activation of AmpliTaq Gold DNA polymerase for 10 minutes at 95°C, and 50 cycles of denaturing for 15 seconds at 95°C and annealing at 60°C for 1 minute. Flow Cytometry
[0286] Flow cytometry was performed on inguinal lymph nodes 24 h after prime and boost immunizations. Single-cell suspensions of lymph nodes were prepared by mechanical disruption using Eppendorf pestle. The homogenized tissue was then centrifuged at 300 x g for 10 mins. Supernatant was stored for cytokine analysis, and cellular pellet was resuspended in RPMI, and filtered through 70 µm filter. Individual samples were quantified using an automated counter (Countess), and adjusted to 1 million cells for all samples, and samples pelleted by centrifugation. Fc receptors were blocked using murine Fc Block (BD, 553141, 1:200) in FACS Buffer (0.1% BSA, 0.2% sodium azide, 2 mM EDTA in phosphate buffer saline). Cells were then stained with CD3e- BV650 (Biolegend, 100229,1:100), CD19-PE (BD, 557399), CD4-PE-Cy5 (Biolegend, 1004110), CD11b-BB515 (BD, 564454), CD11c-APC-Cy7 (Biolegend, 117324), Ly-6G-PerCP-eFluor710Attorney Docket Number: WVU 3065-PCT (eBioscience, 46-9668-82), F4 / 80-BV421, CD8a-PE-Vio770 (Miltenyi Biotec, 130-118-946) on ice for 30 mins. All dilutions were 1:200, unless otherwise noted, and antibodies were diluted in Brilliant Stain Buffer Plus (BD,566385). Samples were pelleted and washed two times, then fixed with 4% paraformaldehyde for 10 mins on ice. Samples were pelleted and washed two times before storage overnight at 4 degrees. Stained cells were analyzed on a Cytek Aurora (Cytek) the following day. Data was analyzed using FlowJo Software 10.8.1 (BD). Events were quantified using percentage of live, single cells. Cytokine Analyses
[0287] Blood was collected from vaccinated mice by submandibular bleeds performed 24 hours after administration of vaccine. Lymph nodes were collected at euthanasia and homogenized in PBS before centrifugation and separation of the supernatants. Serum and supernatants were diluted in assay buffer before cytokine analysis. CXCL10 was quantified using Meso Scale Discovery’s V-Plex IP-10 Mouse Kit following the manufacturer’s instructions (MSD, K15NVD-1). CXCL13 was quantified using Meso Scale Discovery’s U- PLEX Mouse BCA-1 / BLC Assay following the manufacturer’s instructions (MSD, K152F0K-1) mRNA Adjuvant Production
[0288] CXCL10 and CXCL13 encoding mRNAs were produced for use as genetic adjuvants. First, the genes for mouse CXCL10 and CXCL13 (UniProt) were codon optimized (GenScript). Then, sequences were cloned with 3’ and 5’ UTRs into plasmid vectors under a T7 promoter (VectorBuilder). Plasmids were isolated from Escherichia coli by maxi prep then the desired coding sequences were amplified by polymerase chain reaction using custom primers (Thermo Fisher Scientific). DNA templates were column purified then checked for size and purity by gel electrophoresis before use in in vitro transcription reactions to produce mRNA (Promega, P1300). mRNA was purified by column (New England Biolabs, T2050L) then integrity was checked using the Agilent RNA TapeStation system. One week prior to administration, RNA was packaged into lipid nanoparticles using the NanoAssemblr Ignite formulation system (Cytiva) and the GenVoy ionizable lipid mix (Cytiva). Assembled nanoparticles were checked for size and particle number using the NanoSight from Malvern Panalytical. Formulated lipid nanoparticles were stored at 4C and administered to mice no more than 2 weeks after production.Attorney Docket Number: WVU 3065-PCT Vaccine Formulation with Adjuvants
[0289] mRNA-1273 was obtained from the pharmacy at WVU’s Ruby Memorial Hospital and used as antigen in experimental vaccine formulations. mRNA antigen was diluted in sterile 1X PBS. Diluted antigen was combined with adjuvants by admixing. Aluminum hydrogel (Invivogen) was combined at 10 ug per dose and rotated at room temperature for one hour to mix. CpG 1018 (Dynavax) was combined at 10 ug per dose. BECC470 was used at 25 ug per dose: BECC470 was added to water and sonicated for 15 minutes before rotation at room temperature to form micelles. 10X PBS was added to BECC470 formulations immediately prior to administration. Cxcl13-mRNA, Cxcl10-mRNA, and empty LNPs were combined with mRNA-1273 dilutions immediately prior to vaccination. Vaccines were delivered to mice in 50 uL volumes via the intramuscular route into the hind leg. Statistical Analyses
[0290] The statistical analysis of data sets in this study was performed using GraphPad Prism version 9. Mouse experiments were performed with an n=10 for all groups, with n=3 mice per group euthanized on day 2 and n=7 mice euthanized at day 10 post-challenge. Comparisons between two data sets were measured using unpaired t tests. Normally distributed data sets were compared using ordinary one-way ANOVA with Tukey’s multiple comparisons tests. Kaplan-Meier survival curves were created to compare the survival of vaccinated K18-hACE2 mice following viral challenge. Statistically significant comparisons were measured as having a P value ≤ 0.05. CXCL10 Levels following administration of mRNA-1273 COVID vaccine
[0291] FIG.27 shows serum CXCL10 levels of C57BL / 6 mice euthanized 24 hours after priming and boosting with a titration of the COVID-19 vaccine mRNA-1273. The data points represent the mean value, ± SD, of n=5 mice per group. As shown in FIG.27, vaccination with from 2.5 µg to 10 µg produced a statistically significant (P<0.0001) increase in CXCL10 levels 24 hours after a boost dose. Statistically significant increases in CXCL10 levels were not seen after a boost dose of fromAttorney Docket Number: WVU 3065-PCT 0.15 µg to 1.25 µg, or after an initial prime dose of mRNA-1273. Statistical comparisons were calculated against PBS.
[0292] FIG.28 shows an XY graph showing the relationship between serum IgG levels six weeks after boosting (10 weeks after prime) with mRNA-1273 and CXCL10 expression in the lymph node 24 hours after administration. Points represent single mice, n=5 mice per group. As shown in FIG. 28, little or no production of either antibodies or CXCL10 was observed following administration of phosphate-buffered saline (PBS). Administration of vaccination with from 2.5 µg to 10 µg mRNA- 1273 produced generally high levels of antibodies (>200,000 AUC) and high CXCL10 levels (>1000 pg / mL). Administration of 0.63 µg to 1.25 µg mRNA-1273 produced moderate to high levels of antibodies, but lower levels of CXCL10. CXCL13 Levels following administration of mRNA-1273 COVID vaccine
[0293] FIGS.29A to 29C show quantification of CXCL13 expression in muscle, draining lymph node, and serum collected from K18-hACE2 mice 24 and 48 hours after intramuscular administration of 10 µg mRNA-1273 vaccine in lipid nanoparticles. As seen in FIG.29A, slight increases in levels of CXCL13 (P<0.05) were observed in the muscle 24 hours after administration of 10 µg mRNA-1273 vaccine. Statistically significant increases in CXCL13 were also observed in the serum (P<0.06) 24 hours after administration of 10 µg mRNA-1273 vaccine (FIG. 29C). However, extremely high levels of CXCL13 (P<0.008) were observed in the lymph nodes 24 hours after administration of mRNA-1273 (FIG.29B). This supports the conclusion that lipid nanoparticles rapidly drain from muscles to the immunologically active tissues in the lymph nodes.
[0294] FIGS.30A and 30B show CXCL13 expression in the lymph nodes and serum of 8 week old mice that were primed or primed and boosted with a titration of mRNA-1273 doses, euthanized 24 hours after priming or boosting. As seen in FIG. 30A, administration of 10 µg mRNA-1273 showed a statistically significant increase in CXCL10 levels (P<0.0001) in the serum, following administration of both the first prime dose and the second boost dose, while administration of 5 µg mRNA-1273 showed a statistically significant increase in CXCL10 levels in the serum following administration of the boost dose, but not the prime dose. Administration of 2.5 µg to 10 µg mRNA- 1273 showed a statistically significant increase in CXCL10 levels (P<0.0001 for 5 to 10 µg; P <0.06Attorney Docket Number: WVU 3065-PCT for 2.5 µg) in the lymph nodes, following administration of the second boost dose. CXCL10 levels in the lymph nodes were substantially lower following the prime dose.
[0295] FIG. 30C shows a correlogram showing relationship between CXCL13 expression 24 hours post boost and antibody levels one week after boosting (five weeks after prime) in mRNA- 1273 vaccinated mice. Mice administered PBS showed no antibodies, and low levels of CXCL13. Mice administered 0.63 µg to 1.25 µg mRNA-1273 showed increased antibodies, but little or no increase in CXCL13, compared to PBS. Mice administered 2.5 µg to 10 µg mRNA-1273 showed increased antibodies and increased CXCL13 levels, compared to PBS. However, the higher doses of mRNA-1273, i.e., >2.5 µg, produced increased CXCL13 levels, but failed to produce a clear increase in antibody levels.
[0296] FIG.31 shows serum CXCL13 levels 24 hours after priming and boosting from 75-week- old K18-hACE2 mice vaccinated with low (1.25 µg) and high (10 µg) doses of mRNA-1273. Data points represent mean ± SD of n=5 mice per group. As seen from the error bars in FIG.31, a low dose of mRNA-1273 does not clearly increase CXCL10 levels. However, a high dose of mRNA- 1273 does appear to increase CXCL10 levels in serum. CXCL13 Levels following administration of mRNA-1273 COVID vaccine and Cxcl13-mRNA
[0297] FIGS.32 and 33 show CXCL13 expression in mouse serum 24 hours after prime with mRNA-1273 (Spike) and / or Cxcl13-mRNA and serum CXCL13 expression levels 24 hours post- boost with mRNA-1273, respectively. Referring to FIG.32, administration of 5 µg of the Cxcl13- mRNA adjuvant leads to an increase in CXCL13 protein levels, relative to PBS administration. Administration of a low dose of mRNA-1273 (0.15 to 0.31 µg) does not produce any increase in CXCL13 levels, relative to PBS administration. However, administration of a low dose of mRNA- 1273 leads to a large and significant increase in CXCL13 levels, compared to a low dose of mRNA- 1273 alone (P<0.0001). Similar results are seen 24 hours post-boost (FIG.33).
[0298] Referring back to FIGS. 30C and 30D, administration of 0.32 µg of mRNA-1273 with Cxcl13-mRNA produced statistically significant increases (P<0.0001) in levels of CXCL1324 hours after a boost dose, while administration of 0.32 µg of mRNA-1273 alone produced no increase in CXCL13 (FIG.30C). Further, antibody levels two weeks after the boost dose showed that miceAttorney Docket Number: WVU 3065-PCT receiving 0.32 µg of mRNA-1273 in combination with Cxcl13-mRNA developed antibody levels that were significantly higher (P<0.01) than those found in mice receiving only 0.32 µg of mRNA- 1273 (Fig.30D). Other combinations of low-dose mRNA-1273 with different adjuvants were tested; no other adjuvants offered both a statistically significant increases in CXCL13 levels and antibody production, as seen with Cxcl13-mRNA, as seen in FIGS.30C and 30D.
[0299] FIGS. 38A to 38C show that Cxcl13-mRNA LNP genetic adjuvant increases serum CXCL13 levels and anti-RBD IgG antibody production 24 hours after administration of a boost dose in aged mice (FIG.38A), and antibody production two weeks after administration of the boost dose (FIG.38C). Aged mice were administered 1 µg of mRNA-1273 vaccine with or without 5 µg of the Cxcl13-mRNA adjuvant. As seen in FIG.38A, after 24 hours, administration of 1 µg mRNA-1273 in lipid nanoparticles produces no significant increase in CXCL13 protein levels. However, after 24 hours, administration of 1 µg mRNA-1273 in lipid nanoparticles in combination with 5 µg Cxcl13- mRNA produces a significant increase in CXCL13 protein levels, relative to a PBS control.
[0300] As seen in FIG.38B, two weeks after administration of a prime vaccine dose containing 1 µg mRNA-1273 lipid nanoparticles in combination with 5 µg Cxcl13-mRNA lipid nanoparticles, mice administered the mRNA-1273 vaccine and the genetic adjuvant show a significant increase in levels of an antibody to the RBD protein, relative to a PBS control. However, two weeks after administration of a prime vaccine dose containing only 1 µg mRNA-1273 lipid nanoparticles, levels of the antibody to the RBD protein are higher than in either the PBS control or the mice administered mRNA-1273 in combination with Cxcl13-mRNA.
[0301] However, referring to FIG.38C, two weeks after administration of a boost vaccine dose containing 1 µg mRNA-1273 in combination with 5 µg Cxcl13-mRNA, mice administered the combination show a significant increase in levels of an antibody to the RBD protein, relative to a PBS control. Two weeks after administration of a prime vaccine dose containing only 1 µg mRNA- 1273 lipid nanoparticles, levels of the antibody to the RBD protein are comparable to levels of antibody in the mice administered the combination. While not clearly significant, it is worth noting that the mRNA-1273 / Cxcl13-mRNA combination appears to produce higher antibody levels after the boost dose than the mRNA-1273 alone.Attorney Docket Number: WVU 3065-PCT Effect of Uridine Substitution on Genetic Adjuvant Expression
[0302] FIGS. 34A and 34B show the influence of N1-methyl-pseudouridine (Pseudo-UTP) substitution on CXCL10-mRNA genetic adjuvant expression. 5 µg Cxcl10-mRNA and 5 µg modified Cxcl10-mRNA (sCxcl10-mRNA) including Pseudo-UTP in place of uridine. Serum and inguinal lymph node CXCL10 protein levels were quantitated using MSD ELISAs at euthanasia points after intramuscular administration of Cxcl10-mRNA LNPs or sCxcl10-mRNALNPs to mice.
[0303] As seen in FIG. 34A, CXCL10 levels in the serum 12 hours after administration of CXCL10-mRNA are about double the levels of CXCL1012 hours after administration of sCXCL10- mRNA. Also, 24 to 72 hours after administration of sCXCL10-mRNA, levels of CXCL10 in the inguinal lymph nodes are substantially lower than levels of CXCL10 in the lymph nodes following administration of CXCL10-mRNA.
[0304] FIGS.35A and 35B show the influence of N1-methyl-pseudouridine substitution on cell levels in tissues. Pseudo-UTP substitution for uridine in a CXCL10-mRNA genetic adjuvant may lead to reduced CXCL10 levels in the lymph nodes, as discussed above; however, Pseudo-UTP substitution does not affect cell levels in immunologically relevant tissues. Total cell numbers in the spleen (FIG.35A) and inguinal lymph node (FIG.35B) of mice administered Cxcl10-mRNA LNPs are not significantly different from cell numbers in mice administered Pseudo-UTP-substituted sCxcl10-mRNA LNPs. Cell numbers in both groups of mice were observed at varying euthanasia timepoints ranging from 12 hours following administration of the genetic adjuvant to 72 hours following administration. Effect of DNA Template Preparation on Cxcl13-mRNA Genetic Adjuvant Expression
[0305] FIGS. 36A to 36C show that different preparations of a DNA template for mRNA synthesis have little effect on expression profiles in vivo (FIG.36A) but longer polyA tails increase expression levels in vitro (FIGS.36B and 36C).
[0306] Referring to FIG. 7, the desired mRNA are cloned into in vitro transcription plasmid vectors and grown in E.coli. As seen in FIG. 7, step 1, DNA sequences encoding CXCL13 is prepared. The DNA sequences include sequences which may be transcribed into a 5’ UTR mRNAAttorney Docket Number: WVU 3065-PCT sequence, e.g., SEQ ID NO: 1, a CXCL10 coding sequence, e.g., SEQ ID NO: 4 (full) or SEQ ID NO: 33 (truncated), a 3’ UTR sequence, e.g., SEQ ID NO: 2, and a polyA sequence, e.g., SEQ ID NO: 3. The DNA sequences encoding CXCL13 are cloned into a plasmid and amplified using PCR by known methods, as seen in FIG.7, step 2. Purified plasmid DNA is linearized after amplification by cleavage with a restriction enzyme, as seen in FIG.7, step 3. FIG.7, step 3 also shows that a 719 base pair DNA sequence may be obtained following restriction, where this DNA encodes CXCL13. Purified linear DNA is used as template in in vitro transcription mRNA synthesis reactions with optional nucleotide substitutions (uridine may be substituted with 0-100% N1-methylpseudouridine) and capped with m7G (7-methylguanylate) by known methods, as shown in FIG. 7, step 4. The resulting Cxcl13-mRNA is enclosed within lipid nanoparticles (FIG.7, steps 5-6), and injected into a recipient, e.g., a mouse (FIG.7, step 7).
[0307] Purified plasmid DNA may be linearized by restriction digest using BsiWI or SapI. BsiWI is a restriction endonuclease that recognizes the sequence 5’-CGTACG. SapI is a Type IIS restriction enzyme that recognizes asymmetric DNA sequences and cleaves outside their recognition sequence. The resulting linearized plasmid sequences are used for transcription of the desired mRNA sequences, and then translation of the Cxcl13-mRNA into CXCL13 protein. As a control, preparation of the Cxcl13-mRNA by PCR amplification of the corresponding DNA coding sequence without preparation of an intervening plasmid, followed by translation into mRNA, was tested. As seen in FIG. 36A, CXCL13 levels were tested following administration of lipid nanoparticles containing 5 µg of: Cxcl13-mRNA prepared from plasmid DNA obtained by cleavage with BsiWI; Cxcl13-mRNA prepared from plasmid DNA obtained by cleavage with SapI and addition of a longer polyA tail using polyA polymerase PcnB; and Cxcl13-mRNA obtained using PCR amplification of the corresponding DNA coding sequence (no restriction enzyme). Over a period of 7 days following Cxcl13-mRNA administration, the method of preparing Cxcl13- mRNA has little effect on expression profiles in vivo.
[0308] As seen in FIGS.36B and 36C, transfection of Cxcl13-mRNA into lymph node cells in vitro to the various preparations of Cxcl13-mRNA produces different results when compared to aAttorney Docket Number: WVU 3065-PCT negative control sample exposed to lipid nanoparticles containing no Cxcl13-mRNA. Cxcl13-mRNA prepared using plasmid cleavage with BsiWI and Cxcl13-mRNA obtained using PCR amplification with no restriction enzyme were comparable to the negative control, as no CXCL13 was produced. However, Cxcl13-mRNA prepared using both cleavage with SapI and addition of a longer polyA tail produced substantial levels of CXCL13 protein following transfection of Cxcl13-mRNA into lymph node cells. Thus, when transfecting cells with a genetic adjuvant, modification of the adjuvant to include a long polyA tail may be beneficial. Effect of DNA Template Preparation on mRNA Genetic Adjuvant Expression for various cytokines
[0309] As noted above, the method of preparing Cxcl13-mRNA has little effect on CXCL13 expression profiles in vivo. However, the method of preparing mRNA genetic adjuvants may impact cytokine production for other genetic adjuvants.
[0310] mRNA genetic adjuvants containing coding sequences encoding IL-12p70 (SEQ ID NO: 6), IL-1B (SEQ ID NO: 13), IL-2 (SEQ ID NO: 17), , IL-6 (SEQ ID NO: 11), and TNF-α (SEQ ID NO: 25).
[0311] FIGS. 37A to 37E show production of various cytokines and chemokines, following administration of lipid nanoparticles containing 5 µg of a corresponding mRNA sequence in lipid nanoparticles. However, the mice were administered mRNA-LNPs produced from different preparations of a DNA template for mRNA synthesis. Mice were administered: Cxcl13-mRNA prepared from plasmid DNA obtained by cleavage with BsiWI; Cxcl13-mRNA prepared from plasmid DNA obtained by cleavage with SapI and addition of a longer polyA tail using polyA polymerase PcnB; and Cxcl13-mRNA obtained using PCR amplification of the corresponding DNA coding sequence (no restriction enzyme).
[0312] Cxcl13-mRNA prepared using different techniques elicits different inflammatory cytokine responses in vivo at 24 hours (detected in serum by MSD ELISA). In some cases, e.g., IL-1B (FIG. 37B), there is no significant difference in cytokine production between mRNA prepared by different methods. In other cases, e.g., IL-2 (FIG.37C), Cxcl13-mRNA obtained using PCR amplificationAttorney Docket Number: WVU 3065-PCT without any restriction enzyme produces superior results. However, in the case of IL-12 (IL12p70; FIG. 37A), Cxcl13-mRNA obtained using PCR amplification without any restriction enzyme produced no cytokine while Cxcl13-mRNA prepared from plasmid DNA obtained by cleavage with BsiWI does produce the desired IL-12 cytokine. IL-6 Levels following administration of vaccine
[0313] FIGS.39A to 39C show that a N1-methyl-pseudouridine substituted IL-6-mRNA LNP genetic adjuvant (IL-6-mRNA) increases IL-6 levels in serum and spleen of treated mice. C57BL / 6 mice were intramuscularly injected with 5µg of IL-6-mRNA LNP genetic adjuvant, where uridine moieties were replaced with Pseudo-UTP. Serum (FIG.39A), inguinal lymph node (FIG.39B), and spleen (FIG.39C) were harvested at 12, 24, and 24 hours after treatment. A naïve untreated group was also harvested to utilize as a negative control, while mice administered PBS only were also used as a control group. Administration of mRNA encoding the fluorescent protein mCherry (mCherry- mRNA) was used as a positive control. All samples had IL-6 levels analyzed via Meso Scale Discovery (MSD) tests and Mann-Whitney tests were used to analyze the data.
[0314] As seen in FIG.39A, levels of IL-6 in the serum were significantly increased, relative to naïve mice and mice administered PBS, 12 hours after administration of either mCherry-mRNA or IL-6-mRNA. However, administration of IL-6-mRNA produced significantly higher IL-6 levels than administration of mCherry-mRNA (P<0.05). While administration of either IL-6-mRNA or mCherry-mRNA produced significantly higher IL-6 levels than administration of PBS (P<0.01) after 24 hours, only administration of IL-6-mRNA produced a significant increase (P<0.01) 48 hours after administration. Administration of IL-6-mRNA also produced significantly higher IL-6 levels than administration of mCherry-mRNA in the spleen after 12 hours (FIG.39C; P<0.01). Administration of IL-6-mRNA also produced higher IL-6 levels than administration of mCherry-mRNA in the lymph nodes after 12 hours (FIG.39B); however, IL-6 levels in the lymph nodes were lower than in the serum or the spleen. Thus, while Cxcl13-mRNA administration appears to have comparable effects on CXCL13 levels in the lymph nodes and serum (FIGS.23A and 23B), IL-6-mRNA has greater effect on the spleen than the lymph nodes.Attorney Docket Number: WVU 3065-PCT
[0315] FIGS.40A and 40B show that an IL-6-mRNA LNP genetic adjuvant increases IL-6 levels in serum of treated mice. C57BL / 6 mice were intramuscularly injected with two doses, 4 weeks apart, of: a 1 / 160th human dose of DTaP, an acellular combination vaccine that protects against three bacterial infections: diphtheria, tetanus, and pertussis (whooping cough); a 1 / 160th human dose of DTaP in combination with 1µg of IL-6 mRNA LNP genetic adjuvant; a 1 / 160th human dose of DTaP in combination with 5µg of IL-6-mRNA LNP genetic adjuvant; or phosphate-buffered saline (PBS). Mice were bled at 2 and 10 weeks following the second vaccine dose (boost) and anti-pertussis toxin (PT) IgG antibody levels were measured in serum via enzyme linked immunosorbent assay (ELISA). FIG.40A shows results 2 weeks after the second dose of vaccine. FIG.40B shows results 10 weeks after the second dose of vaccine. Mann-Whitney tests were used to analyze the data. Addition of IL-6-mRNA to combination vaccines increases IL-6 levels after vaccination.
[0316] In the following discussion, multiple combination vaccines are considered, including: DTaP, an acellular combination vaccine against diphtheria, tetanus, and pertussis, containing antigens of the pertussis pathogen; DTwP, a combination vaccine against diphtheria, tetanus, and pertussis, containing diphtheria and tetanus toxoids, and inactivated whole cells of the pertussis pathogen; and DTP-10, a combination vaccine against diphtheria, tetanus, and pertussis, containing diphtheria and tetanus toxoids, and killed whole cells of the pertussis pathogen.
[0317] As seen in FIG.40A, administration of either a 1 / 160th human dose of DTaP alone or a 1 / 160th human dose of DTaP in combination with 1µg of IL-6 mRNA appears to increase levels of the PT IgG antibody two weeks after administration, relative to a PBS control. However, it is not clear that this increase is significant, or that the addition of 1µg of IL-6 mRNA to the vaccine increases antibody levels, compared to administration of a 1 / 160th human dose of DTaP alone. However, administration of a 1 / 160th human dose of DTaP in combination with 5 µg of IL-6 mRNAAttorney Docket Number: WVU 3065-PCT does significantly increase levels of the PT IgG antibody, relative to the PBS control or administration of a 1 / 160th human dose of DTaP alone (P<0.05).
[0318] As seen in FIG.40B, administration of: a 1 / 160th human dose of DTaP alone, a 1 / 160th human dose of DTaP in combination with 1µg of IL-6 mRNA, and a 1 / 160th human dose of DTaP in combination with 5 µg of IL-6 mRNA each increase levels of the PT IgG antibody ten weeks after administration, relative to a PBS control. However, it is not clear that there is a significant difference between PT IgG antibody achieved using these three vaccination protocols. Reviewing FIGS.40A and 40B, while addition of IL-6 mRNA to DTaP does not produce a long-term increase in antibody levels, addition of 5 µg of IL-6 mRNA to DTaP does appear to stimulate early production of increased antibody levels, possibly increasing short-term efficacy of the vaccine.
[0319] Referring to FIGS.41A and 41B, C57BL / 6 mice were intramuscularly injected with two 1 / 160th human doses, 4 weeks apart, of: mCherry-mRNA LNP, DTaP, DTwP, DTP-10, DTP-10 in combination with 5µg IL-6-mRNA LNP, DTP-10 in combination with 5µg CXCL13-mRNA LNP, DTP-10 + 5µg mCherry-mRNA LNP, or Phosphate buffer saline (PBS). Mice were bled at 1 day post prime and booster dose of vaccine. FIG.41A shows serum IL-6 levels one day after administration of the prime dose. FIG.41A shows serum IL-6 levels one day after administration of the booster dose.
[0320] FIG. 41A shows that administration of 1 / 160th of a human dose of DTwP causes formation of IL-6 in the serum 24 hours after administration of the prime dose. Administration of 1 / 160th of a human dose of DTaP or DTP-10 does not cause measurable formation of IL-6 in the serum. However, administration of DTP-10 in combination with 5µg IL-6-mRNA lipid nanoparticlesAttorney Docket Number: WVU 3065-PCT or 5µg CXCL13-mRNA lipid nanoparticles causes formation of IL-6 in the serum. Notably, administration of IL-6-mRNA or CXCL13-mRNA as a genetic adjuvant with DTP-10 causes greater levels of IL-6 in the serum than the live-cell vaccine DTwP. Administration of 5µg mCherry-mRNA in combination with DTP-10 causes formation of IL-6 in the serum; however, levels of IL-6 following DTP-10 / mCherry-mRNA administration are comparable to those obtained following DTwP administration and lower than those produced following DTP-10 / IL-6-mRNA or DTP- 10 / CXCL13-mRNA administration. FIG. 41B shows that similar effects are seen 24 hours after administration of the booster dose.
[0321] Based on the results shown in FIGS. 41A and 41B, administration of DTwP causes formation of IL-6 in the serum; however, administration of DTP-10 does not cause formation of IL-6 in the serum. Induced formation of the cytokine IL-6 is a possible advantage of the live-cell vaccine DTwP over DTP-10. However, the combination of DTP-10 with either IL-6-mRNA or CXCL13- mRNA does cause formation of IL-6 in the serum, so that the activity of the combination of DTP-10 with the genetic adjuvant is comparable to, or greater than, that of DTwP in terms of IL-6 production. Further, the combination of DTP-10 with CXCL13-mRNA would increase levels of both IL-6 and CXCL13.
[0322] Although the various exemplary embodiments have been described in detail with particular reference to certain exemplary aspects thereof, it should be understood that the invention is capable of other embodiments and its details are capable of modifications in various obvious respects. As is readily apparent to those skilled in the art, variations and modifications can be affected while remaining within the spirit and scope of the invention. Accordingly, the foregoing disclosure, description, and figures are for illustrative purposes only and do not in any way limit the invention, which is defined only by the claims.
Claims
Attorney Docket Number: WVU 3065-PCT CLAIMS What is claimed is:
1. A method for inducing an immune response in a subject, the method comprising: administering to the subject: a) a first mRNA construct comprising a first coding sequence, wherein the first coding sequence encodes a chemokine or cytokine or a fragment thereof; and b) an antigen or a second mRNA construct encoding the antigen; wherein the chemokine or cytokine is selected from the group consisting of an interleukin, an interferon, a tumor-associated antigen, a CXC chemokine, a CC chemokine, a CX3C chemokine, and a C chemokine.
2. The method of claim 1, wherein the chemokine or cytokine is a peptide with a disulfide bridge formed by bonding between two cysteine moieties in the chemokine.
3. The method of claim 1, wherein the method comprises administering to the subject the first mRNA construct and the antigen, wherein the antigen is a biopolymer or an attenuated or inactivated pathogen.
4. The method of claim 1, wherein the method comprises administering to the subject the first mRNA construct and the antigen, wherein the antigen is a protein, a peptide, a protein fragment, a protein subunit, or a mixture thereof.
5. The method of claim 1, wherein the method comprises administering to the subject the first mRNA construct and the second mRNA construct encoding the antigen, wherein the antigen is a protein, a peptide, a protein fragment, a protein subunit, or a mixture thereof.
6. The method of claim 1, wherein the first mRNA construct encodes a CXC chemokine selected from the group consisting of:Attorney Docket Number: WVU 3065-PCT a CXC chemokine which binds to a receptor selected from the group consisting of CXCR1 and CXCR2, and induces the migration of neutrophils to a target site; and a CXC chemokine which binds to a receptor selected from the group consisting of CXCR3, CXCR4, CXCR5, CXCR6, CXCR7, and CXCR8, and induces the migration of lymphocytes to a target site.
7. The method of claim 1, wherein the first mRNA construct encodes a CXC chemokine selected from the group consisting of: a CXC chemokine which binds to the CXCR3 receptor, and induces the migration of T lymphocytes to a target site, wherein the CXC chemokine which binds to the CXCR3 receptor is selected from the group consisting of CXCL9, CXCL10, CXCL11, and CXCL14; and a CXC chemokine which binds to the CXCR5 receptor, and induces the migration of B lymphocytes to a lymph node, wherein the CXC chemokine which binds to the CXCR5 receptor is CXCL13.
8. The method of claim 1, wherein the first mRNA construct encodes a cytokine or a chemokine selected from the group consisting of interferon-gamma, interleukin-10, IL-12p70, IL-1B, IL-2, IL-5, IL-6, TNF-α, CCL3 (KC / GRO), IL-4, CXCL10, and CXCL13.
9. The method of claim 8, wherein the first mRNA construct encodes a cytokine or a chemokine selected from the group consisting of IL-6, CXCL10, and CXCL13.
10. The method of claim 1, wherein the first mRNA construct comprises: the first coding sequence which encodes the chemokine; a 5’ untranslated region (5’ UTR) upstream of the first coding sequence; a 3’ untranslated region (3’ UTR) downstream of the first coding sequence; a promoter upstream of the 5’ UTR; and a poly(A) tail downstream of the 3’ UTR.Attorney Docket Number: WVU 3065-PCT 11. The method of claim 1, wherein the immune response is induced against infection by an infectious agent selected from the group consisting of a microbe or virus, the method comprising: administering to the subject: a) the first mRNA construct; and b) the second mRNA construct, wherein the antigen is a protein expressed by the infectious agent.
12. The method of claim 1, wherein the immune response is induced against a cancer cell, the method comprising: administering to the subject: a) the first mRNA construct; and b) the second mRNA construct, wherein the antigen is a protein expressed by the cancer cell.
13. A method for inducing an immune response in a subject, the method comprising: administering to the subject: a) a first mRNA construct comprising a first coding sequence, wherein the first coding sequence encodes a cytokine; and b) a second mRNA construct comprising a second coding sequence, wherein the second coding sequence encodes an antigen; wherein the cytokine is selected from the group consisting of: a cytokine of a TNF family; a cytokine of a type I cytokine family; a cytokine of a type II cytokine family; a cytokine of an interleukin-1 (IL-1) cytokine family; a cytokine of an interleukin-1 (IL-6) cytokine family; a cytokine of an interleukin-17 (IL-17) cytokine family; and a cytokine selected from the group consisting of interleukin-16 (IL-16), interleukin-34 (IL-34), colony stimulating factor 1 (CSF-1), transforming growthAttorney Docket Number: WVU 3065-PCT factor beta (TGF-β), and macrophage migration inhibitory factor (MIF).
14. A method for identifying a genetic adjuvant which potentiates an immune response to a target antigen, the method comprising: exposing a first group of B lymphocytes or T lymphocytes to: a first mRNA construct comprising a first coding sequence, wherein the first coding sequence encodes a homeostatic chemokine or chemokine fragment, and a second mRNA construct comprising a second coding sequence, wherein the second coding sequence encodes the target antigen; exposing a second group of B lymphocytes or T lymphocytes to the second mRNA construct in the absence of the first mRNA construct; and comparing: a first expression level of an antibody to the target antigen, in the first group of B lymphocytes or T lymphocytes, and a second expression level of the antibody to the target antigen, in the second group of B lymphocytes or T lymphocytes; wherein the first mRNA construct potentiates the immune response to the target antigen if the first expression level is different from the second expression level.
Citation Information
Patent Citations
Methods and compositions using recombinant dendritic cells for cancer therapy
US20200016250A1
Methods and compositions relating to immunization of immune distinct patients
WO2023133342A2