5-ketomilbemycin-producing bacterium and use thereof

Abstract

Disclosed in the present invention are a new Streptomyces strain and use thereof. The strain is named Streptomyces bingchenggensis HS-5-OXO-MIL-116, with a deposit number of CGMCC No. 29877. Also disclosed are a method for culturing 5-ketomilbemycin spore growth by using the strain HS-5-OXO-MIL-116 and a method for preparing 5-ketomilbemycin.

Description

A 5-ketomilbemycin producing strain and application thereof TECHNICAL FIELD

[0001] The present application relates to the field of microbial engineering, in particular to a Streptomyces bingchenggensis with high yield of 5-ketomilbemycin and application thereof in preparation of 5-ketomilbemycin. BACKGROUND

[0002] Milbemycin is a macrocyclic lactone anthelmintic drug, also known as milbemycin in the world, which was discovered by Sankyo Co. in 1967. After years of improvement, it was officially put on the market in 1986 under the trade name milbemycin oxime. Milbemycin has good control effect on various mites, agricultural pests and horticultural pests, kills target mites and forms long-term control. In addition, the mite-killing activity of milbemycin is not easily affected by temperature and the mechanism of action is different from that of traditional mite-killing agents, so it is still highly effective on some resistant pests, and is therefore considered to be the best mite-killing agent in the world today. Milbemycin oxime is an oxime derivative of milbemycin A3 and milbemycin A4. Milbemycin oxime has good effect on controlling and preventing most common parasitic diseases, has broad-spectrum control activity, high activity, small dosage, safety to humans and animals, no environmental pollution, harmless to natural enemies and not easy to produce resistance. It is usually used to prevent dirofilariasis, control diseases caused by nematodes and hookworms in dogs and cats, and whipworm disease in dogs, and has less toxicity to dogs sensitive to avermectin drugs, so it has good market prospects.

[0003] Milbemycin oxime is mainly produced by semi-synthetic method. First, milbemycin-producing Streptomyces is fermented to obtain milbemycin A3 and A4; then the C-5 hydroxyl groups of milbemycin A3 and A4 are oxidized to ketone to obtain 5-ketomilbemycin A3 and A4 (structural formula as shown in formula I and formula II); and then hydroxylamine hydrochloride is reacted in dioxane-methanol-water to obtain milbemycin oxime.

[0004] In the known milbemycin biosynthesis pathway, 5-ketomilbemycin is first produced, and under the catalysis of C5-ketoreductase encoded by milF gene, C-5 ketone group is reduced to hydroxyl group to obtain the final fermentation product milbemycin A3 and A4. Our company knocked out the milF gene by genetic engineering technology, blocked the C-5 ketone group reduction reaction in the organism, successfully obtained the genetically engineered bacteria YZ1-10 capable of directly fermenting 5-ketomilbemycin, saved the oxidation reaction step, simplified the synthesis process of milbemycin oxime, and filed a related patent ZL201310541829.8.

[0005] When the company further verified the titer of the genetically engineered bacteria YZ1-10 in the tank, it was found that a large amount of bubbles were generated during the fermentation process, and the foam increased the risk of contamination, so antifoam had to be added for inhibition. However, it was found that the antifoam had a great influence on the production of the bacteria YZ1-10, and after the addition of the antifoam, the growth rate of the high-yield period slowed down, and the total yield was significantly reduced, which could not meet the needs of industrial production. Therefore, an effective method is urgently needed to solve the influence of the antifoam on the production of the genetically engineered bacteria YZ1-10 during the fermentation process. SUMMARY

[0006] One of the purposes of the present application is to provide a new Streptomyces bingchenggensis HS-5-OXO-MIL-116 capable of producing 5-ketomilbemycins, which has a preservation number of CGMCC No.29877.

[0007] The microbial strain of the Streptomyces bingchenggensis HS-5-OXO-MIL-116 described in the present application was preserved in the China General Microbiological Culture Collection Center (CGMCC) (address: No. 1, Beichen West Road, Yard 3, Beijing Chaoyang District, Institute of Microbiology, Chinese Academy of Sciences) on February 22, 2024, has a preservation number of CGMCC No.29877, is classified as Streptomyces bingchenggensis, and is registered and proven to be alive.

[0008] The present application also provides the application of the Streptomyces bingchenggensis HS-5-OXO-MIL-116 in the production of 5-ketomilbemycins or pharmaceutical compositions containing 5-ketomilbemycins.

[0009] The present application also provides a method for culturing 5-ketomilbemycin spores to grow, which utilizes the above-mentioned Streptomyces bingchenggensis HS-5-OXO-MIL-116 to resist aerobic growth in a solid culture medium containing assimilable carbon sources and / or nitrogen sources, antifoam, and agar.

[0010] In a preferred embodiment, the assimilable carbon source in the solid culture medium is selected from one of glucose, sucrose, mannitol, D-galactose, dextrin, soluble starch, maltose, or a combination of the above-mentioned substances, preferably mannitol.

[0011] In a preferred embodiment, the assimilable nitrogen source in the solid culture medium is selected from one of yeast extract powder, malt extract powder, soybean meal powder, enzymatic hydrolysis casein, acid hydrolysis casein, skimmed milk powder, or a combination of the above-mentioned substances, preferably soybean meal powder.

[0012] In a preferred embodiment, the solid culture medium contains mannitol 10-50 g / L, soybean cake powder 10-50 g / L, agar 10-30 g / L, bupleurum 1-10 g / L, pH 7.0-7.2 before sterilization, preferably, the solid culture medium contains mannitol 20 g / L, soybean cake powder 20 g / L, agar 20 g / L, bupleurum 5 g / L, pH 7.2 before sterilization.

[0013] In a preferred embodiment, the temperature of the aerobic growth is 26-30°C, preferably 28°C; the time of the aerobic growth is 7-10 days, preferably 8 days.

[0014] The present application further provides a method for preparing 5-ketomilbemycin, which utilizes the above-mentioned Streptomyces lividans HS-5-OXO-MIL-116 to perform aerobic fermentation in a nutrient medium containing assimilable carbon source and / or nitrogen source, and bupleurum.

[0015] In a preferred embodiment, the assimilable carbon source in the nutrient medium is selected from one of soluble starch, malt dextrin, sucrose, glucose, glycerol, fructose, sorbitol, mannitol, maltose, lactose, galactose, xylan, industrial molasses, or a combination of the above-mentioned substances, preferably sucrose.

[0016] In a preferred embodiment, the assimilable nitrogen source in the nutrient medium is selected from one of soybean cake powder, yeast extract, malt extract, skim milk powder, yeast extract powder, yeast protein peptone, peanut cake powder, yeast powder, corn steep dry powder, gluten meal, wheat germ, soybean peptone, corn powder, soybean meal, or a combination of the above-mentioned substances, preferably one of soybean cake powder, peanut cake powder, gluten meal, or corn powder in combination with yeast extract, malt extract, further preferably a combination of soybean cake powder, yeast extract, and malt extract.

[0017] In a preferred embodiment, the nutrient medium further comprises inorganic salts, which are selected from one of zinc sulfate, magnesium sulfate, ferrous sulfate, copper sulfate, manganese sulfate, dipotassium hydrogen phosphate, potassium chloride, sodium chloride, magnesium chloride, cobalt chloride, sodium molybdate, trisodium citrate, calcium carbonate, calcium chloride, or a combination of the above-mentioned substances, preferably a combination of ferrous sulfate, dipotassium hydrogen phosphate, calcium carbonate, and magnesium sulfate.

[0018] In a preferred embodiment, the nutrient medium contains sucrose, soybean cake meal, malt extract, yeast extract, dipotassium hydrogen phosphate, magnesium sulfate, ferrous sulfate, calcium carbonate, and Superphosphate; preferably, the nutrient medium contains sucrose 100-500 g / L, soybean cake meal 10-50 g / L, malt extract 1-10 g / L, yeast extract 1-10 g / L, ferrous sulfate 0.01-0.1 g / L, dipotassium hydrogen phosphate 0.1-1 g / L, magnesium sulfate 0.1-1 g / L, calcium carbonate 1-10 g / L, and Superphosphate 1-10 g / L; further preferably, the nutrient medium contains sucrose 160 g / L, soybean cake meal 20 g / L, malt extract 5 g / L, yeast extract 5 g / L, ferrous sulfate 0.05 g / L, dipotassium hydrogen phosphate 0.5 g / L, magnesium sulfate 0.5 g / L, calcium carbonate 3.0 g / L, and Superphosphate 2 g / L.

[0019] In a preferred embodiment, the temperature of the aerobic fermentation is 26-30°C, preferably 28°C; the pH of the nutrient medium is 6.0-8.0, preferably 6.8-7.2; and the time of the aerobic fermentation is 240-400 hours, preferably 264-312 hours.

[0020] The 5-ketomilbemycin as described in the present application refers to the total of 5-ketomilbemycin A3 and A4, in other words, the titer of the 5-ketomilbemycin measured in the present application is the total of the titers of 5-ketomilbemycin A3 and A4.

[0021] The 5-ketomilbemycin as described in the present application is detected by HPLC under the following conditions:

[0022] Column: Elite ODS2 (4.6 x 150 mm, 5 μm)

[0023] Column temperature: 25°C;

[0024] Injection volume: 5 μL;

[0025] Flow rate: 1 mL / min;

[0026] Detection wavelength: 240 nm;

[0027] Analysis time: 15 min;

[0028] Mobile phase: acetonitrile: water = 85:15 (v / v);

[0029] In which, the retention time of the 5-ketomilbemycin A3 peak is about 6.0 min; and the retention time of the 5-ketomilbemycin A4 peak is about 7.4 min.

[0030] The main biological characteristics of the bubble enemy resistant mutant strain HS-5-OXO-MIL-116 (CGMCC No. 29877) of the present application are: colony morphology is round, surface is convex, colony diameter is about 8-12 mm, colony surface has wrinkles, has grooves, is convex in the middle, substrate hyphae are developed, are not tightly combined with the culture medium, are easy to pick up, substrate hyphae are ochreous brown, aerial hyphae are onyx gray, spores are produced abundantly, early signal is white, later signal is milky white, and no soluble pigment is produced.

[0031] Compared with the prior art, the present application has the following beneficial effects:

[0032] The HS-5-OXO-MIL-116 (CGMCC No. 29877) of the present application is a brand-new 5-ketomilbemycin producing strain, and the ability of the strain to produce 5-ketomilbemycin is greatly improved compared with other strains in the prior art, and the titer can be as high as 6964 mg / L, while the titer of 5-ketomilbemycin produced by the genetically engineered strain YZ1-10 disclosed in ZL201310541829.8 is only 3562 mg / L, which is more conducive to industrial production. BRIEF DESCRIPTION OF DRAWINGS

[0033] Fig. 1 is a culture characteristic of the strain HS-5-OXO-MIL-116 (CGMCC No. 29877) of Example 2.

[0034] Fig. 2 is a comparison of culture characteristics of the strain HS-5-OXO-MIL-116 (CGMCC No. 29877) and the strain YZ1-10 on eight kinds of culture media of ISP1, ISP2, ISP3, ISP4, ISP5, Gause No. 1, calcium malate and nutrient agar. DETAILED DESCRIPTION

[0035] In the following examples, the experimental methods used are conventional methods unless otherwise specified.

[0036] In the following examples, the materials, reagents, etc. used are commercially available unless otherwise specified. Refer to the relevant contents in the book "Molecular Cloning Experiment Guide" and the total DNA template of the Streptomyces is extracted by the improved lysozyme method Pitcher method (Pitcher et al., 1989), and the 16S rRNA gene amplification is carried out by using the universal primers 27F (SEQ ID NO: 1) and 1495R (SEQ ID NO: 2), the PCR product is detected and purified, and then directly subjected to sequence determination, and the sequencing is performed by Shanghai Sunway Biotech Co., Ltd.

[0037] The present application will be further described in conjunction with specific examples. It should be understood that the following examples are only used to illustrate the present application but not to limit the scope of the present application.

[0038] Example 1: Strain source

[0039] Streptomyces HS-5-OXO-MIL-116 is a white-spore-producing strain obtained from the strain YZ1-10 (disclosed in ZL201310541829.8) with the milF gene knocked out by the method of NTG combined with bubble enemy tolerance complex mutagenesis.

[0040] The strain YZ1-10 is used as the starting strain, and after being cultured at 28°C for 8 days in a solid slant medium, the mycelium is scraped off under sterile conditions to obtain a bacterial suspension for NTG (nitrosoguanidine) mutagenesis treatment.

[0041] 2 mg of NTG crystals are dissolved in 2 mL of sterile Tris buffer (pH 6.0). 1 mL of the NTG solution is added to 1 mL of the bacterial suspension using a pipette, and the mixture is shaken on a rotary or reciprocating shaker at 28°C for 1 hour. The specific steps are as follows:

[0042] (1) Preparation and culture of mycelium

[0043] The solid medium (also referred to as the slant medium of the present application) has the following formulation: mannitol 20 g / L, soybean cake powder 20 g / L, agar 20 g / L, bubble enemy 5 g / L, and pH 7.2 before sterilization. After being sterilized at 121°C for 20 minutes, the medium is cooled to 50-60°C and poured into plates. The mutagenized bacterial suspension is appropriately diluted, and 0.2 mL of the bacterial solution is spread on the plates of the above-mentioned solid medium. The bacterial suspension that has not been mutagenized is also appropriately diluted and spread on the plates of the above-mentioned solid medium as a control. The plates are placed in a constant temperature incubator at 28°C and cultured in the dark for 8 days. The single colonies are expanded on slants, and the expanded slants are further cultured in the dark for 8 days according to the above-mentioned method until the mycelium is mature.

[0044] (2) Preparation and culture of seed liquid

[0045] The seed medium has the following formulation (g / L): sucrose 10 g / L, skim milk powder 1 g / L, proteose peptone 3.5 g / L, yeast extract 5 g / L, potassium phosphate dibasic 5×10 -1 g / L, and pH 7.2 before sterilization. The volume of liquid in a triangular flask is 30 mL / 250 mL, and the liquid is sterilized at 121°C for 20 min. Each seed flask is inoculated with about 1 cm 2 of the bacterial thallus, and the flask is cultured at 28°C with shaking at 250 rpm for 30 hours.

[0046] (3) Preparation and culture of fermentation medium (also referred to as the nutrient medium of the present application)

[0047] Fermentation medium formula (g / L): sucrose 160 g / L, soybean cake powder 20 g / L, yeast extract 5 g / L, malt extract 5 g / L, potassium phosphate dibasic 0.5 g / L, magnesium sulfate 0.5 g / L, ferrous sulfate 0.05 g / L, calcium carbonate 3 g / L, diquat 2 g / L, pH 7.2 before sterilization; the volume of the seed solution was 25 mL / 250 mL, and sterilization was performed at 121°C for 20 min. The seed solution was inoculated into the fermentation medium at a volume ratio of 6%, and the culture temperature was 28°C, the rotation speed was 250 rpm, and the culture time was 264 hours.

[0048] After NTG mutagenesis, 300 single colonies were selected, and 300 test tube slopes were successively expanded and cultured. The 5-ketomilbemycin content in the fermentation broth was detected by HPLC method, and the selected high-yield strain was the mutagenized strain HS-5-OXO-MIL-116 (CGMCC No. 29877).

[0049] Example 2: Morphological, cultural, physiological and biochemical characteristics of Streptomyces HS-5-OXO-MIL-116 (CGMCC No. 29877).

[0050] The experiment was performed according to the relevant contents in the books such as "Streptomyces Identification Manual", "Classification and Identification of Actinomycetes", and "Common Bacterial System Identification Manual": the color judgment was compared with the colors in RAL K7 color card.

[0051] 1. Strain number: HS-5-OXO-MIL-116 (CGMCC No. 29877).

[0052] 2. Cultural characteristics of the strain: After the strain HS-5-OXO-MIL-116 (CGMCC No. 29877) was cultured on solid medium (mannitol 20 g / L, soybean cake powder 20 g / L, agar 20 g / L, diquat 5 g / L, pH 7.2 before sterilization) at 28°C for 8 days, the colony morphology was round, the surface was convex, the colony diameter was about 8-12 mm, the colony surface had wrinkles, grooves, and a convex middle, the substrate mycelium was developed, was not tightly combined with the medium, was easy to pick up, the substrate mycelium was ochre brown, the aerial mycelium was amethyst gray, spore production was rich, the early signal was white, the late signal was milky white, and no soluble pigment was produced. The results are shown in FIG. 1.

[0053] Other cultural characteristics were observed after the strain was cultured on 8 kinds of media, i.e., ISP1, ISP2, ISP3, ISP4, ISP5, nutrient agar, calcium malate, and Gause No. 1, at 28°C for 8 days, and the colony, mycelium, spores, and pigment production were observed. The results are shown in Table 1.

[0054] Table 1 Culture characteristics of strain HS-5-OXO-MIL-116 (CGMCC No. 29877) on 8 kinds of media

[0055] 3. Physiological and biochemical characteristics test: results are shown in Tables 2-7.

[0056] a) Utilization of carbon sources: ISP9 was used as the basic medium, and the final concentration of each carbon source was 1.0%, as shown in Table 2.

[0057] b) Utilization of inorganic nitrogen sources: ISP9 was used as the basic medium, and the concentration of potassium nitrate and ammonium sulfate was 0.1%, as shown in Table 2.

[0058] c) Degradation test and NaCl tolerance experiment: the basic medium was GYEA (pH 6.8), and the concentration of each degrading substance and the results of the degradation test are shown in Table 3; the results of the NaCl tolerance experiment are shown in Table 7.

[0059] d) Catalase test, pH test, and temperature test all used ISP2 medium. The results of the catalase test are shown in Table 4, the results of the pH test are shown in Table 5, and the results of the temperature test are shown in Table 6.

[0060] e) M.R, V-P, and other experiments used the methods in the "Common Bacterial System Identification Manual", and the results are shown in Table 4.

[0061] f) Except for the temperature experiment, all were cultured at 28°C for 8 days.

[0062] Table 2 Utilization of carbon and nitrogen sources by strain HS-5-OXO-MIL-116 (CGMCC No. 29877)

[0063] Table 3 Degradation test results of strain HS-5-OXO-MIL-116 (CGMCC No. 29877)

[0064] Table 4 Main physiological and biochemical characteristics of strain HS-5-OXO-MIL-116 (CGMCC No. 29877)

[0065] Table 5 pH test for growth of strain HS-5-OXO-MIL-116 (CGMCC No. 29877)

[0066] Table 6 Temperature test for growth of strain HS-5-OXO-MIL-116 (CGMCC No. 29877)

[0067] Table 7 Tolerance of strain HS-5-OXO-MIL-116 (CGMCC No. 29877) to NaCl

[0068] *Note: In Tables 2-7: 0, no growth; 1, very weak growth; 2, growth with a small amount of spores; 3, good growth with a large amount of spores; 4, best growth with abundant spores; +, positive; -, negative.

[0069] Example 3: Strain identification

[0070] 1. 16S rDNA sequence analysis of ice city Streptomyces HS-5-OXO-MIL-116 (CGMCC No. 29877)

[0071] The experiment was performed according to the relevant content in the book Molecular Cloning Experiment Guide. Mycelium was collected, and then total DNA was extracted using an actinomycete DNA extraction kit (purchased from Beijing Naibo Yuanzhi Biotechnology Co., Ltd.). Universal primers 27F (SEQ ID NO: 1) / 1495R (SEQ ID NO: 2) were used for 16S rDNA sequence amplification, and the amplification system and PCR reaction program are shown in Table 8. The PCR product was detected by 0.8% agarose gel electrophoresis, and the purified PCR product was recovered using a SanPrep column type PCR product purification kit purchased from Shengong Bioengineering (Shanghai) Co., Ltd. The purified PCR product was directly sent to Shanghai Shengong Bioengineering Co., Ltd. for sequence determination.

[0072] Table 8 PCR amplification system and reaction program

[0073] The sequence of 16S rDNA measured by strain HS-5-OXO-MIL-116 (CGMCC No. 29877) was corrected, and homologous sequence BLAST comparison was performed with the sequences of related species and genera in the GenBank database to determine the classification status of the strain.

[0074] The 16S rDNA sequence (SEQ ID NO: 3) measured by strain HS-5-OXO-MIL-116 (CGMCC No. 29877) was submitted to NCBI for BLAST comparison with related sequences in GenBank, and the results are shown in Table 9 (only the higher homologous model strains are listed in the table).

[0075] Table 9 Homology of strain HS-5-OXO-MIL-116 (CGMCC No. 29877) and typical model strains

[0076] The 16S rDNA region of the strain HS-5-OXO-MIL-116 (CGMCC No. 29877) is sequenced, the homologous sequence BLAST comparison is carried out with the sequences of related species and genera in the GenBank database, the morphological and cultural characteristics experimental results of the strain HS-5-OXO-MIL-116 (CGMCC No. 29877) are combined, it is found that the strain is very similar to the classification characteristics of Streptomyces bingchenggensis strain 226541, and the homology is as high as 99.93%, so the strain HS-5-OXO-MIL-116 (CGMCC No. 29877) is identified as Streptomyces bingchenggensis strain.

[0077] Example 4: The physiological and biochemical comparison of the Streptomyces bingchenggensis HS-5-OXO-MIL-116 (CGMCC No. 29877) of the application and the strain YZ1-10 is as follows:

[0078] The Streptomyces bingchenggensis HS-5-OXO-MIL-116 (CGMCC No. 29877) of the application and the strain YZ1-10 have great differences in morphological characteristics, cultural characteristics and physiological and biochemical characteristics, the comparison of the cultural characteristics of the strain HS-5-OXO-MIL-116 (CGMCC No. 29877) of the application and the strain YZ1-10 is shown in Table 10 and Figure 2, and the comparison of the physiological and biochemical characteristics is shown in Table 11.

[0079] Table 10 Comparison of the cultural characteristics of the strain HS-5-OXO-MIL-116 (CGMCC No. 29877) and the strain YZ1-10 on 8 kinds of culture media

[0080] Table 11 Comparison of the physiological and biochemical characteristics of the strain HS-5-OXO-MIL-116 (CGMCC No. 29877) and the strain YZ1-10

[0081] Note: In Table 11, 0, no growth; 1, very weak growth; 2, can grow, with a small amount of spores; 3, good growth, with a large amount of spores; 4, best growth, with abundant spores; +, positive; -, negative.

[0082] The comparison of the culture characteristics of the strain HS-5-OXO-MIL-116 (CGMCC No. 29877) and the strain YZ1-10 in ISP4 medium and the comparison of the physiological and biochemical characteristics are shown in Table 12. As can be seen from Table 12, the culture characteristics of the strain HS-5-OXO-MIL-116 (CGMCC No. 29877) and the strain YZ1-10 in ISP4 medium are different, and there are differences in the physiological and biochemical characteristics such as adenine degradation, hypoxanthine degradation, and milk peptonization.

[0083] Table 12 Comparison of the culture characteristics and the physiological and biochemical characteristics of the strain HS-5-OXO-MIL-116 (CGMCC No. 29877) and the strain YZ1-10

[0084] Note: In Table 12, 0, no growth; 1, very weak growth; 2, can grow, with a small amount of spores; 3, good growth, with a large amount of spores; 4, best growth, with abundant spores; +, positive; -, negative.

[0085] In combination with the morphology, the culture characteristics, and the DNA sequence identification results of the strain HS-5-OXO-MIL-116 (CGMCC No. 29877) of the present application, it can be known that the strain HS-5-OXO-MIL-116 (CGMCC No. 29877) of the present application belongs to Streptomyces bingchenggensis, and it is different from the original strain YZ1-10. Therefore, the Streptomyces bingchenggensis HS-5-OXO-MIL-116 (CGMCC No. 29877) of the present application is a new 5-ketomilbemycin producing strain obtained by the NTG combined with bubble enemy resistant complex mutagenesis method.

[0086] Example 5: Aerobic growth experiment of the strain HS-5-OXO-MIL-116 (CGMCC No. 29877) of the present application in solid culture medium containing soybean meal as nitrogen source

[0087] (1) Preparation and culture of slant colony

[0088] The carbon source of the slant medium is mannitol 20 g / L; the nitrogen source of the slant medium is soybean meal 10 g / L, or 20 g / L, or 50 g / L; agar 20 g / L; bubble enemy 5 g / L; and the pH before sterilization is 7.2.

[0089] High-pressure steam sterilization at 121°C for 20 min, and the medium is cooled to 50-60°C for placing the slant. A sterile inoculation loop is used to inoculate a ring of spores in a super-clean bench, and then the slant is cultured at 28°C in the dark for 8 days.

[0090] (2) Preparation and culture of seed culture medium

[0091] Seed medium formula (g / L): sucrose 10 g / L, skim milk powder 1 g / L, proteose peptone 3.5 g / L, yeast extract 5 g / L, K2HPO4 5 x 10 -1 g / L, pH 7.2 before sterilization.

[0092] The triangular flask was filled with 30 mL / 250 mL of liquid, sterilized at 121℃ for 20 min. About 1 cm 2 of the mycelium was inoculated into each seed flask, and the seed culture was cultivated at 28℃ with 250 rpm shaking for 30 hours.

[0093] (3) Preparation and cultivation of fermentation medium

[0094] Fermentation medium formula (g / L): sucrose 160 g / L, soybean meal 20 g / L, yeast extract 5 g / L, malt extract 5 g / L, K2HPO4 0.5 g / L, MgSO4 0.5 g / L, FeSO4 0.05 g / L, CaCO3 3.0 g / L, Tween 2 g / L, pH 7.2 before sterilization.

[0095] The triangular flask was filled with 25 mL / 250 mL of liquid, sterilized at 121℃ for 20 min. The seed liquid was inoculated into the fermentation medium at a 6% (volume ratio) inoculation amount, and the culture was carried out at 28℃ with 250 rpm shaking for 264 hours.

[0096] The aerobic growth experiment results of the strain HS-5-OXO-MIL-116 (CGMCC No. 29877) of the application are shown in Table 13. As can be seen from Table 13, the strain HS-5-OXO-MIL-116 (CGMCC No. 29877) of the application has a high titer of 5-ketomilbemycin when cultured in the three solid media in the following table, and the titer of formula 2 is the highest.

[0097] Table 13. Aerobic growth experiment of the strain HS-5-OXO-MIL-116 (CGMCC No. 29877) in solid medium

[0098] Example 6: Aerobic fermentation experiment of the strain HS-5-OXO-MIL-116 (CGMCC No. 29877) of the application in a nutrient medium containing soybean meal, peanut meal, corn meal, and gluten meal as nitrogen sources.

[0099] (1) Preparation and cultivation of slant colony

[0100] The slant medium adopts mannitol 20 g / L, soybean meal 20 g / L, agar 20 g / L, Tween 5 g / L, pH 7.2 before sterilization. The slant is sterilized by high-pressure steam, and the cultivation is the same as in Example 5.

[0101] (2) Seed medium preparation and culture

[0102] (3) Preparation and culture of fermentation medium

[0103] The fermentation medium formula (g / L) is as follows: sucrose 160 g / L as carbon source, soybean meal 20 g / L, or peanut meal 20 g / L, or gluten meal 20 g / L, or corn meal 20 g / L, yeast extract 5 g / L, malt extract 5 g / L as nitrogen source, dipotassium hydrogen phosphate 0.5 g / L, magnesium sulfate 0.5 g / L, ferrous sulfate 0.05 g / L, calcium carbonate 3.0 g / L, and Tween 2 g / L, with pH 7.2 before sterilization.

[0104] The liquid volume in a triangular flask is 25 mL / 250 mL, and sterilization is performed at 121 ℃ for 20 min. The seed liquid is inoculated into the fermentation medium at a volume ratio of 6%, and the culture temperature is 28 ℃, the rotation speed is 250 rpm, and the culture time is 264 hours.

[0105] The aerobic fermentation experiment results of the strain HS-5-OXO-MIL-116 (CGMCC No. 29877) are shown in Table 14. As can be seen from Table 14, the strain HS-5-OXO-MIL-116 (CGMCC No. 29877) is fermented in the four kinds of nutrient media in the following table, and the titers of 5-ketomilbemycin prepared are all high, of which the titer of formula 1 is the highest.

[0106] Table 14 Aerobic fermentation experiment of the strain HS-5-OXO-MIL-116 (CGMCC No. 29877) in nutrient medium

[0107] Example 7: Preparation of 5-ketomilbemycin by shake flask fermentation of the strain HS-5-OXO-MIL-116 (CGMCC No. 29877) and the starting strain YZ1-10

[0108] (1) Preparation and culture of slant colony

[0109] The slant medium adopts mannitol 20 g / L, soybean meal 20 g / L, agar 20 g / L, and Tween 5 g / L, with pH 7.2 before sterilization.

[0110] High-pressure steam sterilization is performed at 121 ℃ for 20 min, and the slant is placed after the medium is cooled to 50-60 ℃. A spore ring is inoculated on the slant in a sterile workbench, and the slant is cultured at 28 ℃ in the dark for 8 days.

[0111] (2) Seed medium preparation and culture

[0112] Seed culture medium formula (g / L): sucrose 10g / L, skim milk powder 1g / L, peptone 3.5g / L, yeast extract 5g / L, dipotassium hydrogen phosphate 5×10⁻⁶ -1 g / L, pH 7.2 before disinfection.

[0113] Fill Erlenmeyer flasks with 30 mL / 250 mL liquid volume and sterilize at 121°C for 20 min. Inoculate each seed flask with approximately 1 cm of liquid. 2 Mycelial growth was cultured at 28℃ and 250 rpm for 30 hours with shaking.

[0114] (3) Preparation and cultivation of fermentation medium

[0115] Fermentation medium formula (g / L): sucrose 160g / L, soybean meal powder 20g / L, yeast extract 5g / L, malt extract 5g / L, dipotassium hydrogen phosphate 0.5g / L, magnesium sulfate 0.5g / L, ferrous sulfate 0.05g / L, calcium carbonate 3.0g / L, foaming agent 2g / L, pH 7.2 before sterilization.

[0116] The solution was filled into 25 mL / 250 mL Erlenmeyer flasks and sterilized at 121 °C for 20 min. The seed culture was inoculated into the fermentation medium at a rate of 6% (v / v), and cultured at 28 °C and 250 rpm for 264 hours. HPLC analysis showed that the fermentation units of strain HS-5-OXO-MIL-116 (CGMCC No. 29877) were 6964 mg / L, while those of YZ1-10 were 3562 mg / L. Therefore, strain HS-5-OXO-MIL-116 (CGMCC No. 29877) exhibited significantly better anti-foaming titer than strain YZ1-10.

[0117] sequence list

[0118] (SEQ ID NO:1)

[0119] Upstream primer 27F: ATTGGGCCACATGACATGATTA

[0120] (SEQ ID NO:2)

[0121] Downstream primer 1495R: GTGGCATAGGGCAGTGATTCGA

[0122] (SEQ ID NO:3)

[0123] Sequence of the 16S rDNA region:

Claims

1. A Streptomyces bingchenggensis HS-5-OXO-MIL-116, with accession number (CGMCC No.29877).

2. The use of *Streptomyces hygroscopicus* HS-5-OXO-MIL-116 according to claim 1 in the production of 5-ketomilbemycin or pharmaceutical compositions containing 5-ketomilbemycin.

3. A method for culturing 5-ketomilbemycin spores, characterized in that, The *Streptomyces hygroscopicus* HS-5-OXO-MIL-116 of claim 1 was subjected to aerobic growth in a solid culture medium containing an assimilated carbon source and / or nitrogen source, foam inhibitor, and agar.

4. The method according to claim 3, characterized in that, The assimilated carbon source in the solid culture medium is selected from one or a combination of glucose, sucrose, mannitol, D-galactose, dextrin, soluble starch, and maltose, with mannitol being preferred.

5. The method according to claim 3, characterized in that, The assimilated nitrogen source in the solid culture medium is selected from one or a combination of yeast extract powder, malt extract powder, soybean meal powder, enzymatically hydrolyzed casein, acidified hydrolyzed casein, and skim milk powder, with soybean meal powder being preferred.

6. The method according to any one of claims 3-5, characterized in that, The solid culture medium contains 10-50 g / L mannitol, 10-50 g / L soybean meal, 10-30 g / L agar, and 1-10 g / L bubbling agent, with a pH of 7.0-7.2 before sterilization. Preferably, the solid culture medium contains 20 g / L mannitol, 20 g / L soybean meal, 20 g / L agar, and 5 g / L bubbling agent, with a pH of 7.2 before sterilization.

7. The method according to any one of claims 3 to 6, characterized in that, The temperature for aerobic growth is 26–30°C, preferably 28°C; the time for aerobic growth is 7–10 days, preferably 8 days.

8. A method for preparing 5-ketomilbemycin, characterized in that, Aerobic fermentation was carried out using the *Streptomyces hygroscopicus* HS-5-OXO-MIL-116 as described in claim 1 on a nutrient medium containing an assimilated carbon source and / or nitrogen source and a foaming agent.

9. The method according to claim 8, characterized in that, The assimilated carbon source in the nutrient culture medium is selected from one or a combination of soluble starch, maltodextrin, sucrose, glucose, glycerol, fructose, sorbitol, mannitol, maltose, lactose, galactose, xylan, and industrial molasses, with sucrose being preferred.

10. The method according to claim 8, characterized in that, The assimilated nitrogen source in the nutrient culture medium is selected from one or a combination of the following: soybean meal, yeast extract, malt extract, skim milk powder, yeast extract powder, yeast peptone, peanut meal, yeast powder, corn steep liquor powder, gluten powder, wheat germ flakes, soybean peptone, corn flour, and soybean meal. Preferably, it is a combination of soybean meal, peanut meal, gluten powder, or corn flour with yeast extract or malt extract. More preferably, it is a combination of soybean meal, yeast extract, and malt extract.

11. The method according to any one of claims 8-10, characterized in that, The nutrient culture medium also includes inorganic salts, which are selected from one or a combination of zinc sulfate, magnesium sulfate, ferrous sulfate, copper sulfate, manganese sulfate, dipotassium hydrogen phosphate, potassium chloride, sodium chloride, magnesium chloride, cobalt chloride, sodium molybdate, trisodium citrate, calcium carbonate, and calcium chloride, preferably a combination of ferrous sulfate, dipotassium hydrogen phosphate, calcium carbonate, and magnesium sulfate.

12. The method according to any one of claims 8-11, characterized in that, The nutrient culture medium contains sucrose, soybean meal powder, malt extract, yeast extract, dipotassium hydrogen phosphate, magnesium sulfate, ferrous sulfate, calcium carbonate, and foaming agent; preferably, the nutrient culture medium contains 100-500 g / L sucrose, 10-50 g / L soybean meal powder, 1-10 g / L malt extract, 1-10 g / L yeast extract, 0.01-0.1 g / L ferrous sulfate, 0.1-1 g / L dipotassium hydrogen phosphate, 0.1-1 g / L magnesium sulfate, 1-10 g / L calcium carbonate, and 1-10 g / L foaming agent; more preferably, the nutrient culture medium contains 160 g / L sucrose, 20 g / L soybean meal powder, 5 g / L malt extract, 5 g / L yeast extract, 0.05 g / L ferrous sulfate, 0.5 g / L dipotassium hydrogen phosphate, 0.5 g / L magnesium sulfate, 3.0 g / L calcium carbonate, and 2 g / L foaming agent.

13. The method according to any one of claims 8 to 12, characterized in that, The temperature for aerobic fermentation is 26–30°C, preferably 28°C; the pH of the nutrient medium is 6.0–8.0, preferably 6.8–7.2; and the fermentation time is 240–400 hours, preferably 264–312 hours.

Images