AAV vector, AAV vector combination, method for constructing aml pdx and mm pdx non-human animal, and method for constructing humanized immune system non-human animal
By injecting AAV vectors or combinations thereof that express cytokines into mice, and optimizing AAV serotypes and injection methods, the modeling problems of AML PDX and MM PDX models were solved, achieving long-term physiological cytokine expression and efficient human immune system reconstruction, thus improving the success rate and duration of the models.
Patent Information
- Application Number
- PCT/CN2025/103037
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-06-24
- Filing Date
- 2025-06-24
- Publication Date
- 2026-01-02
AI Technical Summary
Existing technologies have problems such as long production cycles, low modeling success rates, and short model duration when constructing AML PDX or MM PDX models. Furthermore, the immune system reconstruction efficiency of CD34+ humanized mouse models is low, making it difficult to reconstruct a complete human immune system.
By injecting AAV vectors or combinations thereof that express cytokines into mice, and optimizing AAV serotypes and vector injection methods, long-term expression of cytokines at physiological levels can be achieved, promoting the reconstitution of AML PDX and MM PDX, and improving the reconstitution efficiency of humanized mice of the immune system.
It successfully prolonged the expression time of cytokines in mice, improved the modeling success rate and duration of AML PDX and MM PDX models, enhanced the reconstruction efficiency of humanized mice of the immune system, and reduced time and labor costs.
Smart Images

Figure PCTCN2025103037-FTAPPB-I100001 
Figure PCTCN2025103037-FTAPPB-I100002 
Figure PCTCN2025103037-FTAPPB-I100003
Abstract
Description
AAV vectors, combinations of AAV vectors, methods of constructing AML PDX and MM PDX non-human animals, and methods of constructing immune system humanized non-human animals TECHNICAL FIELD
[0001] The present application belongs to the technical field of bioengineering, and specifically relates to an AAV vector, a combination of AAV vectors, and a method of constructing an AML PDX and MM PDX non-human animal, another AAV vector, a combination of AAV vectors, and a method of constructing an immune system humanized non-human animal, and a method of promoting human hematopoietic stem cells to differentiate into CD14 + monocytes and CD66b + a method of promoting human hematopoietic stem cells to differentiate into CD14 BACKGROUND
[0002] Acute myeloid leukemia (AML) is a clonal proliferative hematological malignancy of abnormal hematopoietic stem cells, with poor prognosis. Mice are an ideal animal model for studying acute leukemia. In recent years, there have been reports of constructing PDX mouse models by transplanting human leukemia cells into mice, but due to the low number of cells and low purity of cells, the success rate of modeling is very low. In addition, if the leukemia cells are cultured and expanded for a long time, it is easy to cause genetic and immunophenotypic variation of the cells.
[0003] Multiple myeloma (MM) is a malignant plasma cell tumor, which belongs to the category of B lymphocyte lymphoma. Normally, plasma cells are developed and mature from B cells through multi-organ, multi-stage, precise regulation, and antigen stimulation, and have antibody secretion function. During this process, various reasons can cause abnormal expression of genes, ultimately leading to MM. In recent years, there have been reports of constructing MM PDX mouse models by expressing MM PDX-dependent cytokines in mice through transgenic methods. This reconstruction method takes more than ten weeks, or even more than twenty weeks.
[0004] In addition, there have also been reports of using exogenous injection of cytokines to reconstruct AML PDX or MM PDX in mice, but the expression time of cytokines in these models is relatively short, which is not conducive to the study of the disease.
[0005] In summary, the existing technology has problems such as long production cycle, low modeling success rate, and short model duration in constructing AML PDX or MM PDX models.
[0006] Immune system humanized mice are a kind of experimental animal models, which are partially characterized by human immune system by transplanting human immune system cells (such as peripheral blood mononuclear cells (PBMCs) or hematopoietic stem cells (CD34+)) into severely immunodeficient mice. These humanized mice can simulate the response of human immune system to a certain extent, and thus become an important tool for studying human immune-related diseases, immunotherapy and drug development.
[0007] According to the type of transplanted human immune system cells, the transplantation method and the application field, immune system humanized mice can be divided into different categories: PBMCs transplantation model: in this model, peripheral blood mononuclear cells (PBMCs) isolated from human peripheral blood are transplanted into immunodeficient mice. Since this method reconstructs human immune cells into human T cells, it is often used for tests targeting T cells, such as PD1 antibodies, CD3-targeted bispecific antibodies and dendritic cell vaccines. However, this model has the disadvantage of being prone to GvhD, and the mice will die after 6 weeks, and the experimental window is short. Another method is CD34+ hematopoietic stem cell transplantation model: in this model, CD34+ hematopoietic stem cells isolated from human bone marrow or placental blood are transplanted into mice. Using this method, the GvhD disease of the reconstructed human immune system is low, the experimental window is long, and can reach 1 year. In addition to being able to reconstruct human T cells, human B cells and a small amount of human myeloid cells can also be reconstructed. This model is often used to study the development of human hematopoietic system, infectious diseases, tumor immune drugs, immune tolerance and evaluation of immunotherapy methods. Therefore, compared with human PBMC mice, CD34+ cell humanized animal models have a better application prospect in translational medicine.
[0008] Although the CD34+ humanized mouse model has been widely used, it still has the following disadvantages due to the lack of expression of human cytokines in mice and the lack of cross-reaction of some mouse-derived cytokines to human immune cells: (1) low immune system reconstruction efficiency. Due to the small amount of umbilical cord blood CD34 cells from the same donor, it is difficult to obtain a large number of single-donor-derived humanized mice for experiments. (2) Due to the lack of human cytokines, a complete human immune system cannot be reconstructed in mice, such as a small amount of myeloid cells and the lack of NK cells.
[0009] There are two main solutions at present. The first one is to make transgenic mice to overexpress human cytokines or to engineer mouse cytokine genes to be humanized in mice. In this regard, the mice are NSG SGM3 mice of Jackson Lab in the United States, NOG EXL mice of CIEA in Japan, and MITRG mice of Yale University. The above mice have the following disadvantages: (1) the transgenic mice involve multiple genes, and the production cycle is relatively long, which takes 3 to 5 years; (2) the expression level is uncontrollable, and often non-physiological expression; (3) the continuous expression of human cytokines leads to excessive activation of the reconstructed immune system, and thus the life cycle is relatively short. The second one is to inject cytokines and DNA to make mice express exogenous human cytokines instantaneously, but the duration of the expression of human cytokines by using this method is relatively short, and the time of the reconstruction of the immune system is relatively long, which takes 12 to 14 weeks, and the cytokines need to be continuously injected, otherwise the duration of the human immune cells obtained by the cytokines is relatively short, and the expression level of the exogenous cytokines by using this method is several tens of times or several thousand times of the physiological level. SUMMARY
[0010] In order to overcome the above problems, the present application injects an AAV vector expressing a cytokine or a combination of AAV vectors expressing different cytokines into mice, optimizes the AAV serotype and the injection method of the vector, prolongs the expression time of the exogenous gene in mice, realizes the physiological level expression of the cytokine, successfully promotes the reconstruction of the cytokine-dependent AML PDX and MM PDX, and improves the modeling success rate, the reconstruction efficiency and the duration of the cytokine-dependent AML PDX and MM PDX model, while reducing the time and labor cost.
[0011] In order to improve the reconstruction efficiency of the immune system, to reconstruct a complete human immune system in mice, to reduce the time and labor cost, to realize the physiological level expression of the cytokine, and to prolong the life of mice, the present application injects an AAV vector expressing a cytokine or a combination of AAV vectors expressing different cytokines into mice, so that the reconstruction proportion of certain human immune cell subtypes is greatly increased, and the optimized AAV vector is used to make the exogenous gene expressed in mice for about 1 year, and the reconstruction efficiency of the CD34 humanized mice is improved by 4 times.
[0012] Specifically, the present application relates to the following technical solutions:
[0013] 1. An adeno-associated virus (AAV) vector comprising a cytokine gene.
[0014] The cytokine is selected from any one or more of the following: human interleukin 3 (IL3), human granulocyte-macrophage colony-stimulating factor (GM-CSF), human interleukin 6 (IL6), human a proliferation-inducing ligand (APRIL), and human B-cell activating factor (BAFF).
[0015] 2. The AAV vector of item 1, comprising a fusion protein gene of human IL3 and human GM-CSF.
[0016] Preferably, the cDNA sequence of the fusion protein of human IL3 and human GM-CSF is shown in SEQ ID No: 6.
[0017] 3. The AAV vector of item 1, wherein the AAV vector has an AAV9 serotype or an equivalent tissue-tropic serotype thereof.
[0018] Preferably, the AAV vector has a serotype selected from any one of AAV2, AAV6, AAVDJ, AAVrh10, AAV-PHP.B, PHP.eB, AAV8, and AAV9, preferably an AAV9 serotype.
[0019] Preferably, the AAV vector is administered by intraperitoneal injection or tail vein injection, more preferably by intraperitoneal injection.
[0020] Preferably, the injection dose of the AAV vector is 1x10^8-1x10^11 GC per animal or 1x10^9-1x10^11 GC per animal.
[0021] Preferably, the AAV vector further comprises a promoter and a terminator, wherein the promoter is a CAG promoter, an EF1A promoter, a CMV promoter, a CBh promoter, or a variant thereof, further preferably a CAG promoter or an EF1A promoter.
[0022] Preferably, the sequence of the CAG promoter is shown in SEQ ID No: 9.
[0023] Preferably, the sequence of the EF1A promoter is shown in SEQ ID No: 15.
[0024] 4. A combination of adeno-associated virus (AAV) vectors, comprising:
[0025] AAV vectors comprising a cytokine gene selected from any two or more of the following: an AAV vector comprising a human IL3 gene, an AAV vector comprising a human GM-CSF gene, an AAV vector comprising a human IL6 gene, an AAV vector comprising a human APRIL gene, and an AAV vector comprising a human BAFF gene.
[0026] 5. The combination of AAV vectors according to item 4, wherein the combination of AAV vectors comprises:
[0027] an AAV vector comprising a human IL3 gene and an AAV vector comprising a human GM-CSF gene.
[0028] 6. The combination of AAV vectors according to item 4, wherein the combination of AAV vectors comprises:
[0029] an AAV vector comprising a human IL6 gene, an AAV vector comprising a human APRIL gene and an AAV vector comprising a human BAFF gene.
[0030] 7. The combination of AAV vectors according to any one of items 4 to 6, wherein each of the AAV vectors comprising a cytokine gene independently has an AAV9 serotype or an equivalent tissue-tropic serotype thereof;
[0031] Preferably, each of the AAV vectors comprising a cytokine gene independently has a serotype selected from any one of AAV2, AAV6, AAVDJ, AAVrh10, AAV-PHP.B, PHP.eB, AAV8 and AAV9, preferably an AAV9 serotype.
[0032] 8. The combination of AAV vectors according to any one of items 4 to 6, wherein the combination of AAV vectors is administered by intraperitoneal injection or by tail vein injection, more preferably by intraperitoneal injection;
[0033] Preferably, each of the injection doses of the AAV vectors comprising a cytokine gene independently is from 1 x 10Λ8 to 1 x 10Λ11 GC per animal or from 1 x 10Λ9 to 1 x 10Λ11 GC per animal.
[0034] 9. The combination of AAV vectors according to any one of items 4 to 6, wherein each of the AAV vectors comprising a cytokine gene further comprises a promoter and a terminator, the promoter being a CAG promoter, an EF1A promoter, a CMV promoter, a CBh promoter or a variant thereof, preferably a CAG promoter or an EF1A promoter;
[0035] Preferably, the sequence of the CAG promoter is as set forth in SEQ ID No: 9;
[0036] Preferably, the sequence of the EF1A promoter is as set forth in SEQ ID No: 15.
[0037] 10. A method for constructing an acute myeloid leukemia xenotransplanted non-human animal, comprising the steps of:
[0038] injecting into a non-human animal an AAV vector comprising a cytokine gene selected from any one or more of the following: an AAV vector comprising a human IL3 gene, an AAV vector comprising a human GM-CSF gene, and an AAV vector comprising a fusion protein gene of human IL3 and human GM-CSF; irradiating the non-human animal; and injecting into the non-human animal xenogeneic acute myeloid leukemia cells.
[0039] 11. The method of constructing a non-human animal of xenotransplantation of acute myeloid leukemia according to item 10, wherein the cDNA sequence of the fusion protein of human IL3 and human GM-CSF is shown in SEQ ID No: 6.
[0040] 12. A method of constructing a non-human animal of xenotransplantation of multiple myeloma, comprising the steps of:
[0041] injecting into a non-human animal an AAV vector comprising a cytokine gene selected from any one or more of the following: an AAV vector comprising a human IL6 gene, an AAV vector comprising a human APRIL gene, and an AAV vector comprising a human BAFF gene; irradiating the non-human animal; and injecting into the non-human animal xenogeneic multiple myeloma cells.
[0042] 13. The method according to any one of items 10 to 12, wherein the non-human animal is selected from any one of NOD-scid IL2Ry KO mice, NRG mice, B6RG mice, and BRG mice.
[0043] 14. The method according to any one of items 10 to 12, wherein the AAV vectors comprising a cytokine gene each independently have an AAV9 serotype or an equivalent tissue-tropic serotype thereof;
[0044] Preferably, the AAV vectors comprising a cytokine gene each independently have a serotype selected from any one of AAV2, AAV6, AAV DJ, AAVrh10, AAV-PHP.B, PHP.eB, AAV8, and AAV9, preferably an AAV9 serotype.
[0045] 15. The method according to any one of items 10 to 12, wherein the AAV vectors comprising a cytokine gene are injected into the non-human animal by intraperitoneal injection or tail vein injection, more preferably by intraperitoneal injection.
[0046] Preferably, the amount of each AAV vector injected into the non-human animal is independently 1 x 10Λ8 to 1 x 10Λ11 GC per animal or 1 x 10Λ9 to 1 x 10Λ11 GC per animal.
[0047] 16. The method of any one of items 10-12, wherein the AAV vector comprising the cytokine gene further comprises a promoter and a terminator, the promoter is a CAG promoter, an EF1A promoter, a CMV promoter, a CBh promoter or a variant thereof, preferably a CAG promoter or an EF1A promoter.
[0048] Preferably, the sequence of the CAG promoter is as shown in SEQ ID No: 9.
[0049] Preferably, the sequence of the EF1A promoter is as shown in SEQ ID No: 15.
[0050] 17. Use of the adeno-associated virus (AAV) vector of any one of items 1-3 or the combination of the AAV vectors of any one of items 4-9 in constructing an acute myeloid leukemia xenotransplanted non-human animal or a multiple myeloma xenotransplanted non-human animal.
[0051] 18. An adeno-associated virus (AAV) vector comprising a cytokine gene.
[0052] The cytokine is selected from any one or more than two of the following: human interleukin 2 (IL2), human interleukin 3 (IL3), human interleukin 6 (IL6), human interleukin 15 (IL15), human thrombopoietin (THPO), human stem cell factor (SCF) and human granulocyte-macrophage colony-stimulating factor (GM-CSF).
[0053] 19. The AAV vector of item 18, wherein the AAV vector has an AAV9 serotype or an equivalent tissue-tropic serotype thereof.
[0054] Preferably, the AAV vector has a serotype selected from any one of AAV2, AAV6, AAVDJ, AAVrh10, AAV-PHP.B, PHP.eB, AAV8 and AAV9, preferably an AAV9 serotype.
[0055] Preferably, the AAV vector is administered by intraperitoneal injection or tail vein injection, more preferably by intraperitoneal injection.
[0056] Preferably, the injection dose of the AAV vector is 1 x 10^8-1 x 10^11 GC per animal.
[0057] Preferably, the AAV vector further comprises a promoter and a terminator, the promoter is a CAG promoter, an EF1A promoter, a CMV promoter, a CBh promoter or a variant thereof, further preferably a CAG promoter or an EF1A promoter.
[0058] Preferably, the sequence of the CAG promoter is as set forth in SEQ ID No: 9;
[0059] Preferably, the sequence of the EF1A promoter is as set forth in SEQ ID No: 15;
[0060] Preferably, the cDNA sequence of human IL15 is as set forth in SEQ ID No: 18.
[0061] 20. A combination of adeno-associated virus (AAV) vectors comprising:
[0062] the AAV vectors comprising a cytokine gene selected from any two or more of: an AAV vector comprising a human IL2 gene, an AAV vector comprising a human IL3 gene, an AAV vector comprising a human IL6 gene, an AAV vector comprising a human IL15 gene, an AAV vector comprising a human THPO gene, an AAV vector comprising a human SCF gene, and an AAV vector comprising a human GM-CSF gene.
[0063] 21. The combination of AAV vectors according to item 20, wherein the combination of AAV vectors comprises:
[0064] an AAV vector comprising a human IL3 gene, an AAV vector comprising a human SCF gene, and an AAV vector comprising a human GM-CSF gene; or
[0065] an AAV vector comprising a human IL3 gene, an AAV vector comprising a human IL6 gene, an AAV vector comprising a human SCF gene, and an AAV vector comprising a human GM-CSF gene; or
[0066] an AAV vector comprising a human IL3 gene, an AAV vector comprising a human IL6 gene, an AAV vector comprising a human THPO gene, an AAV vector comprising a human SCF gene, and an AAV vector comprising a human GM-CSF gene;
[0067] Preferably, the combination of AAV vectors further comprises:
[0068] an AAV vector comprising a human IL15 gene and / or an AAV vector comprising a human IL2 gene.
[0069] 22. The combination of AAV vectors according to item 20 or 21, wherein each of the AAV vectors comprising a cytokine gene independently has an AAV9 serotype or an equivalent tissue-tropic serotype thereof;
[0070] Preferably, the AAV vectors comprising the cytokine gene each independently have a serotype selected from any one of AAV2, AAV6, AAVDJ, AAVrh10, AAV-PHP.B, PHP.eB, AAV8 and AAV9, preferably AAV9 serotype.
[0071] 23. The combination of AAV vectors according to any one of items 20-22, wherein the combination of AAV vectors is administered by intraperitoneal injection or tail vein injection, more preferably by intraperitoneal injection.
[0072] Preferably, the injection dose of the AAV vectors comprising the cytokine gene each independently is 1 x 10Λ8-1 x 10Λ11 GC per animal.
[0073] 24. The combination of AAV vectors according to any one of items 20-23, wherein the AAV vectors comprising the cytokine gene further comprise a promoter and a terminator, the promoter being CAG promoter, EF1A promoter, CMV promoter, CBh promoter or a variant thereof, preferably CAG promoter or EF1A promoter.
[0074] Preferably, the sequence of the CAG promoter is shown in SEQ ID No: 9.
[0075] Preferably, the sequence of the EF1A promoter is shown in SEQ ID No: 15.
[0076] 25. The combination of AAV vectors according to any one of items 20-24, wherein the cDNA sequence of human IL15 is shown in SEQ ID No: 18.
[0077] 26. A method of constructing an immune system humanized non-human animal, comprising the steps of:
[0078] injecting into a non-human animal an AAV vector comprising a cytokine gene selected from any one or more of the following: an AAV vector comprising a human IL2 gene, an AAV vector comprising a human IL3 gene, an AAV vector comprising a human IL6 gene, an AAV vector comprising a human IL15 gene, an AAV vector comprising a human THPO gene, an AAV vector comprising a human SCF gene and an AAV vector comprising a human GM-CSF gene; irradiating the non-human animal; and injecting into the non-human animal human hematopoietic stem cells.
[0079] 27. The method according to item 26, wherein the non-human animal is a NOD-scid IL2Ry KO mouse, a NRG mouse, a B6RG mouse or a BRG mouse.
[0080] 28. The method of any one of items 26 or 27, wherein the AAV vector comprising a human IL3 gene, the AAV vector comprising a human IL6 gene, the AAV vector comprising a human THPO gene, the AAV vector comprising a human SCF gene and the AAV vector comprising a human GM-CSF gene are injected into the non-human animal, preferably further the AAV vector comprising a human IL15 gene and / or the AAV vector comprising a human IL2 gene are injected into the non-human animal.
[0081] 29. The method of any one of items 26 or 27, comprising the step of irradiating the non-human animal first, followed by injecting the non-human animal with human hematopoietic stem cells, and 3-5 weeks later injecting the non-human animal with the AAV vector comprising a human IL15 gene.
[0082] 30. The method of any one of items 26-29, wherein each of the AAV vectors comprising a cytokine gene independently has an AAV9 serotype or an equivalent tissue-tropic serotype thereof;
[0083] Preferably, each of the AAV vectors comprising a cytokine gene independently has a serotype selected from any one of AAV2, AAV6, AAVDJ, AAVrh10, AAV-PHP.B, PHP.eB, AAV8 and AAV9, preferably an AAV9 serotype.
[0084] 31. The method of any one of items 26-30, wherein each of the AAV vectors comprising a cytokine gene is injected into the non-human animal via intraperitoneal injection or tail vein injection, more preferably via intraperitoneal injection.
[0085] Preferably, each of the AAV vectors injected into the non-human animal independently has an amount of 1 x 10Λ8-1 x 10Λ11 GC per animal.
[0086] 32. The method of any one of items 26-31, wherein each of the AAV vectors comprising a cytokine gene further comprises a promoter and a terminator, the promoter being a CAG promoter, an EF1A promoter, a CMV promoter, a CBh promoter or a variant thereof, preferably a CAG promoter or an EF1A promoter.
[0087] Preferably, the CAG promoter has a sequence as set forth in SEQ ID No: 9.
[0088] Preferably, the EF1A promoter has a sequence as set forth in SEQ ID No: 15.
[0089] 33. The method of any one of items 26-32, wherein the cDNA sequence of human IL15 is set forth in SEQ ID No: 18.
[0090] 34. A method of promoting differentiation of human hematopoietic stem cells into CD14 + monocytes and CD66b + granulocytes, comprising the steps of: injecting a combination of AAV vectors comprising cytokine genes into a non-human animal; irradiating the non-human animal; injecting human hematopoietic stem cells into the non-human animal;
[0091] wherein the combination of AAV vectors comprising cytokine genes comprises:
[0092] an AAV vector comprising a human IL-3 gene, an AAV vector comprising a human GM-CSF gene, and an AAV vector comprising a human SCF gene; or,
[0093] an AAV vector comprising a human IL-3 gene, an AAV vector comprising a human GM-CSF gene, an AAV vector comprising a human SCF gene, and an AAV vector comprising a human IL-6 gene.
[0094] 35. The method of item 34, wherein each of the AAV vectors comprising cytokine genes independently has an AAV9 serotype or an equivalent tissue-tropic serotype thereof.
[0095] Preferably, each of the AAV vectors comprising cytokine genes independently has a serotype selected from any one of AAV2, AAV6, AAV DJ, AAVrh10, AAV-PHP.B, PHP.eB, AAV8, and AAV9, preferably an AAV9 serotype.
[0096] 36. The method of item 34 or 35, wherein the non-human animal is a NOD-scid IL2Ry KO mouse, a NRG mouse, a B6RG mouse, or a BRG mouse.
[0097] 37. The method of any one of items 34-36, wherein the combination of AAV vectors comprising cytokine genes is administered by intraperitoneal injection or tail vein injection, preferably by intraperitoneal injection.
[0098] Preferably, the injection dose of each of the AAV vectors comprising cytokine genes is independently 1 x 10Λ8- 1 x 10Λ11 GC per animal.
[0099] 38. The method of any one of items 34-37, wherein the AAV vector comprising the cytokine gene further comprises a promoter and a terminator, the promoter is CAG promoter, EF1A promoter, CMV promoter, CBh promoter or a variant thereof, preferably CAG promoter or EF1A promoter.
[0100] Preferably, the sequence of the CAG promoter is as shown in SEQ ID No: 9.
[0101] Preferably, the sequence of the EF1A promoter is as shown in SEQ ID No: 15.
[0102] 39. Use of the adeno-associated virus (AAV) vector of item 18 or 19 or the combination of the AAV vector of any one of items 20-25 in constructing an immune system humanized non-human animal.
[0103] Effects of the application
[0104] (1) The present application prolongs the expression time of cytokine genes dependent on PDX reconstruction in mice by injecting AAV vectors expressing cytokines or combinations of AAV vectors expressing different cytokines into mice, while optimizing AAV serotypes and vector injection methods, achieves physiological level expression of cytokines, successfully promotes the reconstruction of cytokine-dependent AML PDX and MM PDX, and improves the modeling success rate, model reconstruction efficiency and duration of cytokine-dependent AML PDX and MM PDX models. In addition, using AAV technology to continuously express cytokines saves time and economic costs compared to making transgenic mice. Because exogenous injection of cytokines has a short time in the body, it needs to be continuously injected, so the cost is more expensive. The method of the present application is particularly suitable for immunodeficient mice, and AAV-expressed exogenous proteins do not produce immunogenicity in mice, so the expression time is longer compared to using immunocompetent mice.
[0105] (2) The present application greatly increases the reconstruction ratio of certain human immune cell subtypes by injecting AAV vectors expressing cytokines or combinations of AAV vectors expressing different cytokines into mice, solving the problems of low immune system reconstruction efficiency, long time consumption, and inability to reconstruct a complete human immune system in current humanized mouse models. The present application optimizes the promoters of AAV vectors, enabling the longest expression of exogenous genes in mice for more than 48 weeks, and the expression level is stable. The present application further improves the expression level of cytokines expressed by AAV vectors in peripheral blood by optimizing the serotypes of AAV vectors and the injection route. The present application also optimizes the combination of AAV vectors expressing different cytokines, which increases the reconstruction efficiency of CD34 humanized mice by 4 times, and the same donor-derived umbilical cord blood CD34 cells can reconstruct more than 5 times the number of humanized mice.
[0106] In addition, the present application can also adjust the ratio of different AAV vectors to make the ratio of different immune cells more balanced and close to the physiological level. In immunodeficient mice, the physiologically expressed cytokines cannot lead to the physiological level of human immune system ratio, but by adjusting the expression amount of AAV, the reconstruction ratio of the immune system can be appropriately close to the physiological level.
[0107] The method of the present application for constructing an immune system humanized non-human animal has obvious efficiency advantages over making multi-gene transgenic non-human animals, and can reduce the production and breeding time. BRIEF DESCRIPTION OF DRAWINGS
[0108] Figure 1 is a schematic diagram of the AAV vector of the present application.
[0109] Figure 2 shows the expression level of cytokines expressed by different serotypes of AAV in peripheral blood.
[0110] Figure 3 shows the concentration of different cytokines expressed by AAV9 after injection through different injection routes in serum.
[0111] Figure 4 shows the expression level of cytokines driven by different promoters of AAV9 vectors in mouse serum.
[0112] Figure 5 shows the effect of different cytokines expressed by AAV9 vectors on the reconstruction efficiency of AML PDX of different donor sources (AML-1, AML-2, AML-3).
[0113] Figure 6 shows the concentration of hIgG antibodies in mouse serum after injecting AAV9 vectors expressing different cytokines to reconstruct AML PDX of different donor sources (MM-1, MM-2, MM-3).
[0114] Figure 7 shows the effect of different cytokines on the in vitro proliferation fold of HSC cells.
[0115] Figure 8 shows the effect of different cytokines expressed by AAV vectors on the efficiency of human immune system reconstitution in vivo.
[0116] Figure 9 shows the efficiency of human immune system reconstitution in NV-NSG mice injected with different numbers of CD34 cells by AAV9 Plus5.
[0117] Figure 10 shows the expression levels of hIL15 with different signal peptides expressed by AAV vectors in mouse serum.
[0118] Figure 11 shows the effect of injection of different doses of AAV9 hIL2SP-hIL15 on the efficiency of humanized mouse NK cell subpopulation reconstitution.
[0119] Figure 12 shows the effect of different injection doses of AAV9 hIL2SP-hIL15 on the health status of CD34 humanized mice.
[0120] Figure 13 shows the expression levels of each cytokine in mouse serum at the fourth week after injection of 10^10 GC of AAV9 hIL2 vector, AAV9 hIL7 vector, AAV9 IL2SP-hIL15 vector, AAV9 hGM-CSF vector.
[0121] Figure 14 shows the percentage of Treg cells in human CD4+ T cells detected at the 14th week after injection of 10^10 GC of AAV9 hIL2 vector, AAV9 hIL7 vector, AAV9 IL2SP-hIL15 vector, AAV9 hGM-CSF vector.
[0122] Figure 15 shows the effect of CD34 input amount on the proportion of NK cell reconstitution.
[0123] Figure 16 shows the effect of AAV9 hIL15 injection time on the proportion of NK cell reconstitution.
[0124] Figure 17 shows the proportion of CD33+ cells in human CD45 cells detected at the 12th week after injection of AAV9 hIL3 vector, AAV9 hIL6 vector, AAV9 hGM-CSF vector, AAV9 hSCF vector and immune system reconstitution.
[0125] Figure 18 shows the proportion of CD14 + subpopulation and CD66b + subpopulation in CD33+ cells, respectively.
[0126] Figure 19 shows CD33 expression ratio in cells at week 12 after injection of AAV9 hIL3 vector, AAV9 hIL6 vector, AAV9 hGM-CSF vector, AAV9 hSCF vector and immune system reconstitution. + HLA-DR expression in cells + expression ratio. Embodiments
[0127] Definitions
[0128] The term "AAV (Adeno-Associated Virus)" as used herein is a non-pathogenic virus that is often used as a gene delivery vector and is widely used in the fields of gene therapy and gene editing. Its structural feature is that AAV is a single-stranded DNA virus, and its genome contains about 4.7 kb of DNA sequence. The genome of AAV is divided into two oppositely oriented open reading frames (ORF): rep and cap. Rep encodes replication-related proteins, and cap encodes the capsid protein that packages the virus. There are two oppositely oriented short sequences in the genome of AAV, called ITR (Inverted Terminal Repeats), which play an important role in virus replication and packaging. Compared with other commonly used viral vectors such as lentivirus (Lentivirus), adenovirus (Adenovirus) and retrovirus (Retrovirus), AAV virus has low immunogenicity and long duration in vivo, and is used as a gene therapy drug in clinical practice. There are several articles using AAV-expressed cytokines to assist immune system reconstruction. However, there is no detailed comparison of different AAV serotypes, injection methods and expression elements of AAV gene vectors on expression level and persistence in severe immunodeficient mice.
[0129] The term "promoter" as used herein includes a DNA sequence operably linked to a nucleic acid sequence to be transcribed, such as a nucleic acid sequence encoding a desired molecule. The promoter is generally located upstream of the nucleic acid sequence to be transcribed and provides a site for specific binding of RNA polymerase and other transcription factors. In particular embodiments, the promoter is generally located upstream of the transcribed nucleic acid sequence to generate the desired molecule and provides a site for specific binding of RNA polymerase and other transcription factors.
[0130] As used herein, the term "terminator" is a DNA sequence that confers a signal for termination of RNA polymerase transcription, a structure of a few hundred bases in length located downstream of the poly(A) site. Terminators can be divided into two classes: one class is able to effect termination independent of protein cofactors, and the other class is dependent on protein cofactors to effect termination. Such protein cofactors are called termination factors, often referred to as rho factors. The basic structural unit of a terminator is a stretch of bases, with a stretch of palindromic sequence of 7-20 bp on each side of the palindrome separated by a few non-repeating bases. The axis of symmetry of the palindromic sequence is usually 16-24 bp from the termination point. Different terminators vary in their strength, with some being able to stop transcription almost completely, and others being able to only partially terminate transcription, with a portion of the RNA polymerase being able to continue along the DNA and transcribe.
[0131] As used herein, the term "immunodeficient" means that the non-human animal is deficient in one or more aspects of its native immune system, e.g., the animal is deficient in one or more types of functional host immune cells, e.g., deficient in non-human B cell number and / or function, non-human T cell number and / or function, non-human NK cell number and / or function, etc.
[0132] As used herein, the term NOD mouse refers to no obesity diabetes mouse, i.e., non- obese diabetic mouse. There are many derivative lines of NOD mice, including NOD / Scid, NOD / Lt mice, etc.
[0133] As used herein, the term "immunodeficient mouse" refers to a mouse that has one or more components of the immune system deficient due to a congenital genetic mutation or artificially caused by human intervention. Common mutant genotypes are SCID mutation, Ragl knock-out, Rag2 knock-out, and the major phenotype is lack of T cells and B cells.
[0134] As used herein, the term "severe combined immunodeficient mouse" generally refers to an immunodeficient mouse that has further knock-out of IL2Ry gene function. IL2Ry is a common receptor for many cytokines. Knock-out of IL2Ry further reduces the function of the immune system of the mouse. The major phenotype of the severe combined immunodeficient mouse is lack of T cell, B cell, NK cell function, and also a large reduction in the number of macrophages and dendritic cells. The major use of the severe combined immunodeficient mouse is to reconstitute the immune system of a human in the mouse.
[0135] As used herein, the term "humanized immune system mouse" generally refers to a mouse that has one or more types of human immune cells reconstituted in the mouse after implantation of human peripheral blood mononuclear cells (hPBMC) or human hematopoietic stem cells (CD34+ HSC) into a severe combined immunodeficient mouse.
[0136] The term "interleukin" as used herein is a class of cytokines produced by a variety of cells and acting on a variety of cells. It refers to a class of cytokines with basically clear molecular structure and biological function, which are uniformly named because of their important regulatory role. It belongs to the same category of cytokines as blood cell growth factors. The two work together and interact with each other to complete the functions of hematopoiesis and immune regulation. Interleukins play an important role in transmitting information, activating and regulating immune cells, mediating T and B cell activation, proliferation and differentiation, and in inflammatory reactions. Interleukin is abbreviated as IL, which is related to the expression and regulation of immune response, and this regulation involves many factors derived from lymphocytes or macrophages. Those derived from lymphocytes are called lymphocyte activins, and those derived from macrophages are called monokines, each of which has different biological activities (such as macrophage activation, promotion of T cell proliferation, etc.), and the physical and chemical properties of the factors themselves are not clear.
[0137] Interleukin 3 (IL3), also known as Multi-CSF, is mainly produced by activated CD4+ T cells. Its main function is to promote the directional differentiation and proliferation of pluripotent hematopoietic stem cells in bone marrow to produce various types of blood cells. It is produced by T lymphocytes and can stimulate the proliferation, differentiation and function improvement of cells involved in immune response. IL3 has a molecular weight of about 15 kD and is a glycoprotein in chemical nature. The cDNA sequence of human IL3 encoding human interleukin-3 (human IL3) involved in this application is shown in SEQ ID No: 1.
[0138] Granulocyte-macrophage colony-stimulating factor (GM-CSF), also known as colony-stimulating factor 2 (CSF2), is a monomeric glycoprotein mainly produced by T cells and macrophages, which can induce colony growth of granulocyte precursor and macrophage precursor cells, hence the name granulocyte-macrophage colony-stimulating factor. GM-CSF has strict species specificity, and its main biological function in vivo is to maintain the survival, promote the growth, induce the differentiation and enhance the phagocytic function and bactericidal effect of granulocyte and monocyte lineage cells; induce dendritic cell maturation and functional distribution. The cDNA sequence of human GM-CSF encoding human thrombopoietin (human GM-CSF) involved in this application is shown in SEQ ID No: 2.
[0139] The term "fusion protein" as used herein is the expression product of two genes recombined by DNA recombination technology.
[0140] The target cells of interleukin 6 (IL6) are many, including macrophages, hepatocytes, resting T cells, activated B cells and plasma cells, etc.; its biological effects are also very complex, once known as B cell stimulating factor 2 (bsf-2), 26kD protein, B cell differentiation factor (bCDf), hepatocyte stimulating factor (hsf), etc. IL6 cannot stimulate the corresponding cells to secrete other cytokines, and its autocrine effect on immune cells is also relatively weak at physiological concentrations, suggesting that its main immunological function is to enhance the effect of other cytokines. IL6 can be synthesized by a variety of cells, including activated T cells and B cells, monocyte-macrophages, endothelial cells, epithelial cells, and fibroblasts, etc. The human IL6 gene is located on chromosome 7; the molecular weight of IL6 is between 21-30KD, which is due to the glycosylation and phosphorylation of the peptide chain. IL6 is composed of 2 glycoprotein chains; one is the alpha chain with a molecular weight of 80KD; the other is the beta chain with a molecular weight of 130KD. The alpha chain lacks the intracellular region and can only bind to IL6 with low affinity, and the complex formed is immediately combined with the high-affinity beta chain to transmit information to the cell through the beta chain. The cDNA sequence of human IL6 encoding human interleukin-6 (human IL6) involved in the present application is shown in SEQ ID No: 3.
[0141] A proliferation-inducing ligand (APRIL) is a cytokine belonging to the TNF family, an independent secreted ligand targeting TNFRSF13B / TACI and TNFRSF17 / BCMA. APRIL plays a role in regulating tumor cell growth and can be involved in monocyte / macrophage-mediated immune processes. APRIL is produced by myeloid cells and their precursors in the bone marrow. It accumulates in the peripheral tissues and is not accumulated under the action of HSPG (heparan sulfate proteoglycan). Its massive production in the bone marrow leads to more rapid maturation of cells and peripheral rupture. During the process of bacterial infection, the main source of APRIL is the neutrophils of the infected tonsil mucosa, and the keratinocytes are the main source of APRIL in the non-infected tissue. APRIL acts by binding to BCMA (B cell maturation antigen) and TACI (transmembrane activator and CAML-interactor), and competes with TALL-I (also known as BLyS or BAFF) for receptor binding. Soluble BCMA and TACI can specifically prevent the binding of APRIL, block the proliferation of primary B cells stimulated by APRIL, and soluble BCMA is a dominant negative molecule that can inhibit the production of antibodies in vivo. Therefore, in addition to lymphoma cell lines, APRIL stimulates the proliferation of primary lymphocytes in vitro and promotes the accumulation of B cells in the spleen in vivo. Therefore, APRIL-TALL-I and BCMA-TACI form a double ligand-double receptor pathway involved in the stimulation of B cell and T cell functions. The cDNA sequence of human APRIL encoding human cell activation factor (human APRIL) involved in the present application is shown in SEQ ID No: 4.
[0142] Cell activation factor (BAFF) belongs to the tumor necrosis factor superfamily member (TNFSF13B), mainly produced by monocytes, dendritic cells and T cells, which can promote B cell maturation and differentiation, play an important role in immune response, and is closely related to autoimmune diseases. Membrane-type BAFF is mainly expressed in antigen-presenting cells, and proteases can hydrolyze it to convert it into soluble BAFF. The cDNA sequence of human BAFF encoding human cell activation factor (human BAFF) involved in the present application is shown in SEQ ID No: 5.
[0143] Interleukin-2 (IL2) is a cytokine of the chemokine family. It is a cytokine produced by many cell types (mainly by activated T cells), and has multiple effects (mainly promoting lymphocyte growth, proliferation, and differentiation); it plays an important role in the body's immune response and anti-viral infection, etc., can stimulate T cell proliferation initiated by specific antigens or mitogens; can activate T cells, promote cytokine production; stimulate NK cell proliferation, enhance NK killing activity and cytokine production, induce LAK cell production; promote B cell proliferation and antibody secretion; activate macrophages. It can be used for clinical research and tumor treatment. The sequence of the human IL2 cDNA encoding human interleukin-2 (human IL2) involved in the present application is shown in SEQ ID No: 16.
[0144] Interleukin 15 (IL15) can be produced by activated monocyte-macrophage cells, epidermal cells, fibroblasts and other cells. IL15 has many similarities with IL2 in molecular structure, so it can use the beta chain and gamma chain of IL2 receptor to bind to target cells and exert similar biological activity to IL2. IL15 can induce B cell proliferation and differentiation, and is the only cytokine that can partially replace IL2 to induce early antibody production; IL15 can stimulate T cell and NK cell proliferation, induce LAK cell activity, and also can stimulate NK cells to produce IFN-γ in cooperation with IL12. The sequence of the human IL15 cDNA encoding human interleukin-15 (human IL15) involved in the present application is shown in SEQ ID No: 17 or SEQ ID No: 18.
[0145] Thrombopoietin (THPO), also known as megakaryocyte growth and development factor (MGDF), is a glycoprotein hormone produced by liver parenchymal cells, liver sinus endothelial cells and renal tubular cells. A small amount of expression is also found in striated muscle and bone marrow stromal cells. It can stimulate megakaryocytes to secrete and differentiate into a large number of platelets. Circulating THPO can be detected in normal and pathological conditions, including idiopathic thrombocytopenic purpura (ITP), essential thrombocythemia (ET), cirrhosis, amegakaryocytic thrombocytopenia (AMT) and anemia (AA). Parenchymal cells and liver sinus endothelial cells in the liver, proximal tubular cells in the kidney can synthesize thrombopoietin. In addition, a small amount of thrombopoietin can also be synthesized by striated muscle cells and bone marrow stromal cells. The sequence of the human THPO cDNA encoding human thrombopoietin (human THPO) involved in the present application is shown in SEQ ID No: 19.
[0146] Stem cell factor (SCF) is also known as mast cell growth factor (IGF), Kit ligand (KL) and Steel factor (SLF). It is an acid glycoprotein produced by stromal cells in the bone marrow microenvironment. Its sugar group is connected to the N and O groups of the peptide bond, with a relative molecular mass of 31000-36000, and is composed of two identical subunits combined by non-covalent bonds. SCF is a factor that acts through the tyrosine receptor c-Kit anchored and expressed on the surface of all HSCs, and the defect of c-Kit expression will lead to a decrease in the number of HSC expansion. At present, almost all cytokine combinations used in HSC culture experiments contain SCF. In addition, SCF and FL3 belong to the tyrosine kinase receptor TKR family, have a synergistic effect on expanding primitive hematopoietic cells, transmit signals to the cell by binding with specific TKR, start the division and proliferation of early progenitor cells, make the cells out of G0 phase and start expansion, and inhibit apoptosis. The sequence of the human SCF cDNA encoding human thrombopoietin (human SCF) involved in the present application is shown in SEQ ID No: 20.
[0147] The term "serotype" as used herein refers to a specific different subspecies in a virus. These microorganisms are generally classified and named by the antibodies of the cell surface layer. However, there are branches and differences in the same type of microorganism. In microbiology, different types of the same type of microorganism can be identified, which can usually be detected by serological methods, and is called serotype. The serotype of the virus can be combined with the corresponding antibody as an antigen to obtain an immune complex that can resist a specific virus in the outside world, and can also be used as serum to identify whether the human body has the related diseases caused by the corresponding virus.
[0148] The term "promoter" as used herein includes a DNA sequence operably linked to a nucleic acid sequence to be transcribed, such as a nucleic acid sequence encoding a desired molecule. The promoter is generally located upstream of the nucleic acid sequence to be transcribed, and provides a site for specific binding of RNA polymerase and other transcription factors. In a particular embodiment, the promoter is generally located upstream of the transcribed nucleic acid sequence to generate the desired molecule, and provides a site for specific binding of RNA polymerase and other transcription factors.
[0149] In order to improve the modeling success rate of cytokine-dependent PDX model, improve the model reconstruction efficiency and duration, and reduce the time and labor cost, in a first aspect, the present application provides an adeno-associated virus (AAV) vector comprising a cytokine gene; the cytokine is selected from any one or two or more of the following: human interleukin 3 (IL3), human granulocyte-macrophage colony-stimulating factor (GM-CSF), human interleukin 6 (IL6), human proliferation-inducing ligand (APRIL) and human cell activation factor (BAFF).
[0150] In some embodiments, the AAV vector comprises a fusion protein gene of hIL3 and hGM-CSF. In one specific embodiment, the AAV vector comprises a fusion protein gene of hIL6 and hAPRIL. In some embodiments, the AAV vector comprises a fusion protein gene of hIL6 and hBAFF. In some embodiments, the AAV vector comprises a fusion protein gene of hAPRIL and hBAFF. In some embodiments, the AAV vector comprises a fusion protein gene of hIL6, hAPRIL and hBAFF.
[0151] In some embodiments, the AAV vector has a size of no more than 4.5 kb, for example, no more than 4 kb, 3.5 kb, 3 kb, 2.5 kb, etc.
[0152] In some embodiments, the sequence of the fusion protein gene of human IL3 and human GM-CSF of the present application is as shown in SEQ ID No: 6.
[0153] In some embodiments, the AAV vector of the present application can have or be derived from any natural or recombinant AAV serotype. In some embodiments, the AAV vector of the present application has the AAV9 serotype or an equivalent tissue-tropic serotype thereof. In some embodiments, the AAV vector of the present application can have any one of the following serotypes: AAVDJ, AAVrh10, AAV-PHP.B, PHP.eB, AAV1, AAV2, AAV2.5, AAV2G9, AAV3, AAV4, AAV4-4, AAV5, AAV6, AAV6.1, AAV6.2, AAV6.1.2, AAV7, AAV7.2, AAV8, AAV9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.61, AAV9.68, AAV9.84, AAV9.9, AAV10, AAV11, AAV12 and AAV13.
[0154] In some embodiments, the AAV vector has a serotype selected from any one of AAV2, AAV8 and AAV9, more preferably has an AAV9 serotype. In some embodiments, the 5' UTR sequence of AAV9 is as shown in SEQ ID No: 7 (ctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcct), and the 3' utr sequence is as shown in SEQ ID No: 8 (ctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcct).
[0155] In some embodiments, the AAV vector is administered by intraperitoneal injection or tail vein injection, more preferably by intraperitoneal injection. In some embodiments, the injection dose of the AAV vector is 1x10^8-1x10^11 GC / each or 1x10^9-1x10^11 GC / each.
[0156] In some embodiments, the AAV vector further comprises a promoter and a terminator, the promoter being a CAG promoter, an EF1A promoter, a CMV promoter, a CBh promoter or a variant thereof, preferably a CAG promoter or an EF1A promoter. In a severe immunodeficient mouse, the above-mentioned promoters can drive the expression of the above-mentioned cytokines, and the CAG promoter and the EF1A promoter drive the expression of the above-mentioned cytokines for a longer time.
[0157]
[0158] In some embodiments, the sequence of the CMV promoter is set forth in SEQ ID No: 10 (tagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctggtttagtgaaccgtcagatc).
[0159]
[0160] In some embodiments, the AAV vector comprises a terminator that is a BGH pA terminator. In some embodiments, the sequence of the BGH pA is set forth in SEQ ID No: 11 (ctgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagagaatagcaggcatgctgggga).
[0161] In a second aspect, the present application also provides a combination of adeno-associated virus (AAV) vectors, comprising: any two or more of the following AAV vectors comprising a cytokine gene: an AAV vector comprising a human IL3 gene, an AAV vector comprising a human GM-CSF gene, an AAV vector comprising a human IL6 gene, an AAV vector comprising a human APRIL gene, and an AAV vector comprising a human BAFF gene.
[0162] In some embodiments, the combination of AAV vectors comprises: an AAV vector comprising a human IL3 gene and an AAV vector comprising a human GM-CSF gene.
[0163] In some embodiments, the combination of AAV vectors consists of: an AAV vector comprising a human IL3 gene and an AAV vector comprising a human GM-CSF gene.
[0164] In some embodiments, the combination of AAV vectors comprises: an AAV vector comprising a human IL6 gene and an AAV vector comprising a human APRIL gene. In some embodiments, the combination of AAV vectors consists of: an AAV vector comprising a human IL6 gene and an AAV vector comprising a human APRIL gene.
[0165] In some embodiments, the combination of AAV vectors comprises: an AAV vector comprising a human BAFF gene and an AAV vector comprising a human APRIL gene. In some embodiments, the combination of AAV vectors consists of: an AAV vector comprising a human BAFF gene and an AAV vector comprising a human APRIL gene.
[0166] In some embodiments, the combination of AAV vectors comprises: an AAV vector comprising a human IL6 gene and an AAV vector comprising a human BAFF gene. In some embodiments, the combination of AAV vectors consists of an AAV vector comprising a human IL6 gene and an AAV vector comprising a human BAFF gene.
[0167] In some embodiments, the combination of AAV vectors comprises: an AAV vector comprising a human IL6 gene, an AAV vector comprising a human APRIL gene, and an AAV vector comprising a human BAFF gene. In some embodiments, the combination of AAV vectors consists of an AAV vector comprising a human IL6 gene, an AAV vector comprising a human APRIL gene, and an AAV vector comprising a human BAFF gene.
[0168] In the present application, the injection amount of each AAV vector depends on the expression level of each cytokine, which is generally between 1 and 1000 pg / ml, preferably between 100 and 300 pg / ml, and more preferably around 100 pg / ml. Only when the expression level is within the above range, the immune system cannot be excessively activated. Below this expression level, sometimes the expression cannot be detected or the detection result is not accurate.
[0169] In some embodiments, each AAV vector has a size of no more than 4.5 kb, such as no more than 4 kb, 3.5 kb, 3 kb, 2.5 kb, etc.
[0170] In some embodiments, each AAV vector of the present application can have or be derived from any native or recombinant AAV serotype. In some embodiments, the AAV vectors of the present application have the AAV9 serotype or an equivalent tissue-tropic serotype thereof. In some embodiments, each AAV vector of the present application can independently have any one of the following serotypes: AAVDJ, AAVrh10, AAV-PHP.B, PHP.eB, AAV1, AAV2, AAV2.5, AAV2G9, AAV3, AAV4, AAV4-4, AAV5, AAV6, AAV6.1, AAV6.2, AAV6.1.2, AAV7, AAV7.2, AAV8, AAV9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.61, AAV9.68, AAV9.84, AAV9.9, AAV10, AAV11, AAV12, and AAV13.
[0171] AAV has different serotypes, and different serotypes of AAV have different expression levels in peripheral blood. In some embodiments, each AAV vector independently has a serotype selected from any one of AAV2, AAV8, and AAV9, and more preferably has the AAV9 serotype.
[0172] In some embodiments, the combination of AAV vectors is administered by intraperitoneal injection or tail vein injection, more preferably by intraperitoneal injection. In some embodiments, the injection dose of each AAV vector comprising a cytokine gene is independently 1x10^8-1x10^11 GC / each or 1x10^9-1x10^11 GC / each.
[0173] In some embodiments, the AAV vector further comprises a promoter and a terminator, wherein the promoter is a CAG promoter, an EF1A promoter, a CMV promoter, a CBh promoter or a variant thereof. Different promoters result in different expression times of the exogenous cytokines in vivo, and different promoters have different effects on the immune system reconstruction efficiency and the health status of the humanized mice. In the severely immunodeficient mice, the above-mentioned promoters can drive the expression of the above-mentioned cytokines, and the CAG promoter and the EF1A promoter drive the expression of the above-mentioned cytokines for a longer time. In some embodiments, the sequence of the CAG promoter is shown in SEQ ID No: 9. In some embodiments, the sequence of the EF1A promoter is shown in SEQ ID No: 15. In some embodiments, the sequence of the CMV promoter is shown in SEQ ID No: 10. In some embodiments, the AAV vector comprises a BGH pA terminator. In some embodiments, the sequence of the BGH pA is shown in SEQ ID No: 11. In some embodiments, the AAV vector comprises a CAG promoter and a BGH pA terminator, wherein the sequence of the CAG promoter is shown in SEQ ID No: 9 and the sequence of the BGH pA is shown in SEQ ID No: 11.
[0174] In a third aspect, the present application also provides a method for constructing an acute myeloid leukemia xenotransplantation non-human animal, comprising the following steps: injecting into a non-human animal an AAV vector comprising a cytokine gene selected from any one or two or more of the following: an AAV vector comprising a human IL3 gene, an AAV vector comprising a human GM-CSF gene, and an AAV vector comprising a fusion protein gene of human IL3 and human GM-CSF; irradiating the non-human animal; and injecting into the non-human animal xenogeneic acute myeloid leukemia cells.
[0175] In some embodiments, the cDNA sequence of the fusion protein of human IL3 and human GM-CSF is shown in SEQ ID No: 6.
[0176] In some embodiments, the method includes injecting any of the AAV vectors in the first aspect or a combination of any of the AAV vectors in the second aspect into a non-human animal, then irradiating the non-human animal, and finally injecting xenogeneic acute myeloid leukemia cells into the non-human animal.
[0177] Fourthly, this application also provides a method for constructing a non-human animal for xenotransplantation of multiple myeloma, comprising the following steps: injecting an AAV vector containing cytokine genes selected from any one or more of the following into the non-human animal: an AAV vector containing the human IL6 gene, an AAV vector containing the human APRIL gene, and an AAV vector containing the human BAFF gene; irradiating the non-human animal; and injecting xenogeneic multiple myeloma cells into the non-human animal.
[0178] The irradiation dose in this application is determined based on the size of the non-human animal. In some embodiments, the non-human animal is a mouse, and the irradiation dose is 80–200 cGy, for example, 80 cGy, 90 cGy, 100 cGy, 110 cGy, 120 cGy, 130 cGy, 140 cGy, 150 cGy, 160 cGy, 170 cGy, 180 cGy, 190 cGy, 200 cGy, etc.
[0179] In some embodiments, the method includes injecting any of the AAV vectors in the first aspect or a combination of any of the AAV vectors in the second aspect into a non-human animal, then irradiating the non-human animal, and finally injecting xenogeneic multiple myeloma cells into the non-human animal.
[0180] In some embodiments of the third and fourth aspects, non-human animals are, for example, laboratory animals, livestock, and animals such as rats, rodents, dogs, cats, pigs, horses, cattle, sheep, and non-human primates; such as mice, rats, rabbits, hamsters, guinea pigs, cattle, pigs, sheep, goats, and other transgenic animal species, particularly mammal species, as known in the art. In some embodiments, the genetically modified animal is a mouse, rat, or rabbit.
[0181] In some embodiments of the third and fourth aspects, the non-human animal is a mammal. In some embodiments, the non-human animal is a small mammal, e.g., of the order Dipodoidea or Muroidea. In some embodiments, the genetically modified animal is a rodent. In some embodiments, the rodent is selected from the group consisting of a mouse, a rat, and a hamster. In some embodiments, the rodent is selected from the order Muroidea. In some embodiments, the genetically modified animal is from a family selected from the group consisting of Calomyscidae (e.g., a mouse-like hamster), Cricetidae (e.g., hamsters, New World rats and mice, voles), Muridae (true mice and rats, gerbils, spiny mice, crested rats), Nesomyidae (climbing mice, rock mice, with-tailed rat, Malagasy rats and mice), Platacanthomyidae (e.g., spiny dormice), and Spalacidae (e.g., mole rates, bamboo rat, and zokors). In some embodiments, the genetically modified rodent is selected from the group consisting of a true mouse or rat (Muridae), a gerbil, a spiny mouse, and a crested rat. In some embodiments, the genetically modified mouse is from a member of the family Muridae.
[0182] In some embodiments of the third and fourth aspects, the non-human animal is a mouse, and the amount of each AAV vector injected into the mouse is independently 1 x 10^8 to 1 x 10^11 GC per mouse or 1 x 10^9 to 1 x 10^11 GC per mouse.
[0183] In some embodiments, the AAV vector comprising a human IL3 gene is injected into a mouse to construct an AML PDX mouse at an amount of 1 x 10^10 to 5 x 10^10 GC per mouse, e.g., 1 x 10^10 GC per mouse, 1.5 x 10^10 GC per mouse, 2 x 10^10 GC per mouse, 2.5 x 10^10 GC per mouse, 3 x 10^10 GC per mouse, 3.5 x 10^10 GC per mouse, 4 x 10^10 GC per mouse, 4.5 x 10^10 GC per mouse, 5 x 10^10 GC per mouse, etc.
[0184] In some embodiments, the AAV vector comprising the human GM-CSF gene is injected into the mouse to construct the AML PDX mouse at an injection amount of 5x10^9-5x10^10 GC per mouse, which can be, for example, 5x10^9 GC per mouse, 6x10^9 GC per mouse, 7x10^9 GC per mouse, 8x10^9 GC per mouse, 9x10^9 GC per mouse, 1x10^10 GC per mouse, 2x10^10 GC per mouse, 3x10^10 GC per mouse, 4x10^10 GC per mouse, 5x10^10 GC per mouse, etc.
[0185] In some embodiments, the AAV vector comprising the fusion protein gene of human IL3 and human GM-CSF is injected into the mouse to construct the AML PDX mouse at an injection amount of 1x10^10-5x10^10 GC per mouse, which can be, for example, 1x10^10 GC per mouse, 2x10^10 GC per mouse, 3x10^10 GC per mouse, 4x10^10 GC per mouse, 5x10^10 GC per mouse, etc.
[0186] In some embodiments, the AAV vector comprising the human IL6 gene is injected into the mouse to construct the MM PDX mouse at an injection amount of 1x10^9-1x10^10 GC per mouse, which can be, for example, 1x10^9 GC per mouse, 2x10^9 GC per mouse, 3x10^9 GC per mouse, 4x10^9 GC per mouse, 5x10^9 GC per mouse, 6x10^9 GC per mouse, 7x10^9 GC per mouse, 8x10^9 GC per mouse, 9x10^9 GC per mouse, 1x10^10 GC per mouse, etc.
[0187] In some embodiments, the AAV vector comprising the human APRIL gene is injected into the mouse to construct the MM PDX mouse at an injection amount of 5x10^9-5x10^10 GC per mouse, which can be, for example, 5x10^9 GC per mouse, 6x10^9 GC per mouse, 7x10^9 GC per mouse, 8x10^9 GC per mouse, 9x10^9 GC per mouse, 1x10^10 GC per mouse, 2x10^10 GC per mouse, 3x10^10 GC per mouse, 4x10^10 GC per mouse, 5x10^10 GC per mouse, etc.
[0188] In some embodiments, the AAV vector comprising the human BAFF gene is injected into the mouse to construct the MM PDX mouse at an injection amount of 5x10^9-5x10^10 GC per mouse, which can be, for example, 5x10^9 GC per mouse, 6x10^9 GC per mouse, 7x10^9 GC per mouse, 8x10^9 GC per mouse, 9x10^9 GC per mouse, 1x10^10 GC per mouse, 2x10^10 GC per mouse, 3x10^10 GC per mouse, 4x10^10 GC per mouse, 5x10^10 GC per mouse, etc.
[0189] In some embodiments, the non-human animal of the present application is a severe immunodeficient mouse lacking T cells, B cells, NK cells, further based on knockout of recombination activating gene 1 (Ragl) or knockout of recombination activating gene 2 (Rag2) or SCID mutation, deletion of IL2 receptor gamma chain.
[0190] In some embodiments, the non-human animal is selected from any one of NOD-scid IL2Ry KO mouse, NRG mouse, B6RG mouse and BRG mouse.
[0191] In some embodiments, the NOD-scid IL2Ry KO mouse is NOG mouse or NSG mouse; preferably, the NOG mouse is NOG-A2 mouse, NOG-DR4 mouse, NOG-B2M null IA null mouse, NOG-IL2 mouse, NOG-IL4 mouse, NOG-IL6 mouse, NOG-IL15 mouse, NOG-EXL NSG mouse or NOG-GCSF NSG mouse; the NSG mouse is NSG-A2 / B2M mouse, NSG-KitW41 mouse, NSG-DR1 mouse, NSG-DR4 mouse, NSG-DQ8 mouse, NSG-B2M null IA / IE null mouse, NSG-W41 mouse, NBSWG mouse, NSG-W41-IL7 mouse, NSG-IL15 mouse, NSG-IL7-IL15 mouse, NSG-SGM3 mouse or NSG-Quad mouse;
[0192] In some embodiments, the NRG mouse is NRG-A2 / DR4 mouse, NRG-W41 mouse, NRG-F mouse or NRG-SGM3 mouse;
[0193] In some embodiments, the B6RG mouse is B6RG-CD47 mouse, B6RG-KitW41 mouse, B6RG-SGM3 mouse or B6RG-Quad mouse; NOD mouse, B6RG-CD47 mouse, B6RG-KitW41 mouse, B6RG-SGM3 mouse or B6RG-Quad mouse; NOD mouse, B6RG-CD47 mouse, B6RG-KitW41 mouse, B6RG-SGM3 mouse or B6RG-Quad mouse;
[0194] In some embodiments, the BRG mouse is BRGS mouse or SRG mouse; preferably, the BRGS mouse is BRGS-A2 / DR2 mouse, BRGS-F mouse, BRGS-F-A2 mouse or BRGS-T mouse; the SRG mouse is SRG-6 mouse, SRG-15 mouse, MISTRG mouse, MISTRG-GR mouse, MISTRG-6 mouse or MISTRG-6-15 mouse.
[0195] In a fifth aspect, the present application also provides use of the aforementioned adeno-associated virus (AAV) vector or combination of AAV vectors in constructing an acute myeloid leukemia xenograft non-human animal or a multiple myeloma xenograft non-human animal.
[0196] In some embodiments, the use is use of an AAV vector comprising a human IL3 gene, or an AAV vector comprising a human GM-CSF gene, or an AAV vector comprising a fusion protein gene of human IL3 and human GM-CSF, or a combination of an AAV vector comprising a human IL3 gene and an AAV vector comprising a human GM-CSF gene in constructing an acute myeloid leukemia xenograft non-human animal.
[0197] In some embodiments, the use is use of any one or more than two selected from an AAV vector comprising a human IL6 gene, an AAV vector comprising a human APRIL gene and an AAV vector comprising a human BAFF gene in constructing a multiple myeloma xenograft non-human animal.
[0198] AML PDX and MM PDX need support of multiple cytokines to reconstitute successfully. Because in pathological conditions, some cytokines are highly expressed, these highly expressed cytokines promote the growth of certain liquid tumors. In the prior art, because immunodeficient mice lack the expression of these cytokines, the construction of these cytokine-dependent PDXs requires exogenous injection of these cytokines into immunodeficient mice or the use of transgenic technology to express these cytokines.
[0199] However, the method of exogenous injection of multiple cytokines has a short in vivo time of cytokine presence, and requires repeated injection. The PDX reconstitution period is long, the cytokines are expensive, and the reconstitution efficiency is low.
[0200] Using the transgenic method to exogenously express cytokines, it takes two years to make a transgenic mouse to obtain a pure line mouse. If multiple transgenic mice are involved, the hybridization between different transgenic mice and the mating of multiple gene pure lines also takes 2 years. The existing transgenic mouse PDX reconstitution efficiency is only about 60%, and the types and expression levels of cytokines need to be optimized. Limitations of transgenic technology in terms of efficiency.
[0201] The method of injecting AAV vector of the present application to express cytokines to assist PDX reconstruction has the following advantages: (1) The expression time of cytokines is close to one year, which is much longer than the time required for cytokine expression in PDX reconstruction. (2) Multiple cytokines can be expressed simultaneously, and some cytokines that are not included in transgenic mice can be expressed simultaneously. (3) The expression level can be optimized according to the injection amount. The existing transgenic mice have the possibility of overexpression or underexpression, and cannot be optimized later. (4) Cytokines can be expressed in different genetic background of severe immunodeficiency mice. Different severe immunodeficiency mice, such as NSG (NOD SCID IL2RγKO), NRG, and BRG, have different resistance to chemotherapy drugs and irradiation, and different immune system reconstruction efficiency. Each model has different experimental scenarios. AAV technology can be applied in different genetic background of severe immunodeficiency mice. It takes 2 to 3 years to crossbreed the genetic background of transgenic mice. (5) AAV virus construction and packaging only takes one month, and can be used in different genetic backgrounds, and the number and expression level of expressed genes can be optimized, which is incomparable to transgenic technology.
[0202] In order to improve the efficiency of immune system reconstruction, reconstruct a complete human immune system in mice, reduce the time and labor cost, realize the physiological level expression of cytokines, and prolong the life span of mice, in the sixth aspect, the present application provides an adeno-associated virus (AAV) vector, which comprises a cytokine gene; the cytokine is selected from any one or two or more of the following: human interleukin 2 (IL2), human interleukin 3 (IL3), human interleukin 6 (IL6), human interleukin 15 (IL15), human thrombopoietin (THPO), human stem cell factor (SCF), and human granulocyte-macrophage colony stimulating factor (GM-CSF).
[0203] In some embodiments, the AAV vector comprises a hIL2 gene and a hIL3 gene. In some embodiments, the AAV vector comprises a hIL2 gene and a hIL6 gene. In some embodiments, the AAV vector comprises a hIL2 gene and a hIL15 gene. In some embodiments, the AAV vector comprises a hIL2 gene and a hTHPO gene. In some embodiments, the AAV vector comprises a hIL2 gene and a hSCF gene. In some embodiments, the AAV vector comprises a hIL2 gene and a hGM-CSF gene. In some embodiments, the AAV vector comprises a hIL3 gene and a hIL6 gene. In some embodiments, the AAV vector comprises a hIL3 gene and a hIL15 gene. In some embodiments, the AAV vector comprises a hIL3 gene and a hTHPO gene. In some embodiments, the AAV vector comprises a hIL3 gene and a hSCF gene. In some embodiments, the AAV vector comprises a hIL3 gene and a hGM-CSF gene. In some embodiments, the AAV vector comprises a hIL6 gene and a hIL15 gene. In some embodiments, the AAV vector comprises a hIL6 gene and a hTHPO gene. In some embodiments, the AAV vector comprises a hIL6 gene and a hSCF gene. In some embodiments, the AAV vector comprises a hIL6 gene and a hGM-CSF gene. In some embodiments, the AAV vector comprises a hIL15 gene and a hTHPO gene. In some embodiments, the AAV vector comprises a hIL15 gene and a hSCF gene. In some embodiments, the AAV vector comprises a hIL15 gene and a hGM-CSF gene. In some embodiments, the AAV vector comprises a hTHPO gene and a hSCF gene. In some embodiments, the AAV vector comprises a hTHPO gene and a hGM-CSF gene. In some embodiments, the AAV vector comprises a hSCF gene and a hGM-CSF gene. In some embodiments, the AAV vector comprises a hIL3 gene, a hIL6 gene, a hTHPO gene, a hSCF gene, and a hGM-CSF gene. In some embodiments, the AAV vector comprises a hIL3 gene, a hIL6 gene, a hTHPO gene, a hSCF gene, a hGM-CSF gene, and a hIL15 gene. In some embodiments, the AAV vector comprises a hIL3 gene, a hIL6 gene, a hTHPO gene, a hSCF gene, a hGM-CSF gene, a hIL2 gene, and a hIL15 gene. In some embodiments, the AAV vector comprises IL2, IL3, and IL6. In some embodiments, the AAV vector comprises IL2, IL3, and THPO. In some embodiments, the AAV vector comprises IL2, IL6, and IL15.In some embodiments, the AAV vector comprises IL2, IL6, and THPO. In some embodiments, the AAV vector comprises IL2, IL6, and SCF. In some embodiments, the AAV vector comprises IL2, IL6, and GM-CSF. In some embodiments, the AAV vector comprises IL2, IL15, and THPO. In some embodiments, the AAV vector comprises IL2, THPO, and SCF. In some embodiments, the AAV vector comprises IL2, THPO, and GM-CSF. In some embodiments, the AAV vector comprises IL3, IL6, and IL15. In some embodiments, the AAV vector comprises IL3, IL6, and THPO. In some embodiments, the AAV vector comprises IL3, IL6, and SCF. In some embodiments, the AAV vector comprises IL3, IL6, and GM-CSF. In some embodiments, the AAV vector comprises IL3, IL15, and THPO. In some embodiments, the AAV vector comprises IL3, THPO, and SCF. In some embodiments, the AAV vector comprises IL3, THPO, and GM-CSF. In some embodiments, the AAV vector comprises IL6, IL15, and THPO. In some embodiments, the AAV vector comprises IL6, IL15, and SCF. In some embodiments, the AAV vector comprises IL6, IL15, and GM-CSF. In some embodiments, the AAV vector comprises IL15, THPO, and SCF. In some embodiments, the AAV vector comprises IL15, THPO, and GM-CSF. In some embodiments, the AAV vector comprises THPO, SCF, and GM-CSF. In some embodiments, the AAV vector comprises IL2, IL3, IL6, and IL15. In some embodiments, the AAV vector comprises IL2, IL3, IL6, and THPO. In some embodiments, the AAV vector comprises IL2, IL3, IL6, and SCF. In some embodiments, the AAV vector comprises IL2, IL3, IL6, and GM-CSF. In some embodiments, the AAV vector comprises IL2, IL3, IL15, and THPO. In some embodiments, the AAV vector comprises IL2, IL3, THPO, and SCF. In some embodiments, the AAV vector comprises IL2, IL3, THPO, and GM-CSF. In some embodiments, the AAV vector comprises IL2, IL6, IL15, and THPO. In some embodiments, the AAV vector comprises IL2, IL6, IL15, and SCF. In some embodiments, the AAV vector comprises IL2, IL6, IL15, and GM-CSF. In some embodiments, the AAV vector comprises IL2, IL6, THPO, and GM-CSF. In some embodiments, the AAV vector comprises IL2, IL6, THPO, and SCF.In some embodiments, the AAV vector comprises IL2, IL6, SCF, and GM-CSF. In some embodiments, the AAV vector comprises IL2, IL15, THPO, and GM-CSF. In some embodiments, the AAV vector comprises IL2, IL15, THPO, and SCF. In some embodiments, the AAV vector comprises IL2, THPO, SCF, and GM-CSF. In some embodiments, the AAV vector comprises IL3, IL6, IL15, and THPO. In some embodiments, the AAV vector comprises IL3, IL6, IL15, and SCF. In some embodiments, the AAV vector comprises IL3, IL6, IL15, and GM-CSF. In some embodiments, the AAV vector comprises IL3, IL6, THPO, and GM-CSF. In some embodiments, the AAV vector comprises IL3, IL6, THPO, and SCF. In some embodiments, the AAV vector comprises IL3, IL6, SCF, and GM-CSF. In some embodiments, the AAV vector comprises IL3, IL15, THPO, and GM-CSF. In some embodiments, the AAV vector comprises IL3, IL15, THPO, and SCF. In some embodiments, the AAV vector comprises IL3, THPO, SCF, and GM-CSF. In some embodiments, the AAV vector comprises IL6, IL15, SCF, and GM-CSF. In some embodiments, the AAV vector comprises IL6, IL15, THPO, and GM-CSF. In some embodiments, the AAV vector comprises IL6, IL15, THPO, and SCF.
[0204] In some embodiments, the AAV vector is no more than 4.5 kb in size, e.g., no more than 4 kb, 3.5 kb, 3 kb, 2.5 kb, etc.
[0205] In some embodiments, the AAV vectors of the present application can have or be derived from any natural or recombinant AAV serotype. In some embodiments, the AAV vectors of the present application have the AAV9 serotype or an equivalent tissue-tropic serotype thereof. In some embodiments, the AAV vectors of the present application can have any one of the following serotypes: AAV DJ, AAVrhIO, AAV-PHP.B, PHP.eB, AAV1, AAV2, AAV2.5, AAV2G9, AAV3, AAV4, AAV4-4, AAV5, AAV6, AAV6.1, AAV6.2, AAV6.1.2, AAV7, AAV7.2, AAV8, AAV9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.61, AAV9.68, AAV9.84, AAV9.9, AAV10, AAV11, AAV12, and AAV13.
[0206] In some embodiments, the AAV vector has a serotype selected from any one of AAV2, AAV8 and AAV9, more preferably has an AAV9 serotype. In some embodiments, the 5' UTR sequence of AAV9 is shown in SEQ ID No: 7, and the 3' UTR sequence is shown in SEQ ID No: 8.
[0207] In some embodiments, the AAV vector is administered by intraperitoneal injection or tail vein injection, more preferably by intraperitoneal injection. In some embodiments, the injection dose of the AAV vector is 1 x 10^8-1 x 10^11 GC / each.
[0208] In some embodiments, the AAV vector further comprises a promoter and a terminator, wherein the promoter is a CAG promoter, an EF1A promoter, a CMV promoter, a CBh promoter or a variant thereof, preferably a CAG promoter or an EF1A promoter. In a severe immunodeficient mouse, the above-mentioned promoters can drive the expression of the above-mentioned cytokines, and the CAG promoter and the EF1A promoter drive the expression of the above-mentioned cytokines for a longer time.
[0209] In some embodiments, the sequence of the CAG promoter is shown in SEQ ID No: 9.
[0210] In some embodiments, the sequence of the CMV promoter is shown in SEQ ID No: 10.
[0211] In some embodiments, the sequence of the EF1A promoter is shown in SEQ ID No: 15.
[0212] In some embodiments, the terminator comprised in the AAV vector is a BGH pA terminator. In some embodiments, the sequence of the BGH pA is shown in SEQ ID No: 11.
[0213] In some embodiments, the cDNA sequence of human IL15 is shown in SEQ ID No: 18.
[0214] In a seventh aspect, the present application also provides a combination of adeno-associated virus (AAV) vectors, comprising: any two or more of the AAV vectors comprising a cytokine gene selected from the group consisting of an AAV vector comprising a human IL2 gene, an AAV vector comprising a human IL3 gene, an AAV vector comprising a human IL6 gene, an AAV vector comprising a human IL15 gene, an AAV vector comprising a human THPO gene, an AAV vector comprising a human SCF gene and an AAV vector comprising a human GM-CSF gene.
[0215] In some embodiments, the combination of AAV vectors comprises: an AAV vector comprising a human IL3 gene, an AAV vector comprising a human SCF gene, and an AAV vector comprising a human GM-CSF gene.
[0216] In some embodiments, the combination of AAV vectors consists of: an AAV vector comprising a human IL3 gene, an AAV vector comprising a human SCF gene, and an AAV vector comprising a human GM-CSF gene.
[0217] In some embodiments, the combination of AAV vectors comprises: an AAV vector comprising a human IL3 gene, an AAV vector comprising a human IL6 gene, an AAV vector comprising a human SCF gene, and an AAV vector comprising a human GM-CSF gene.
[0218] In some embodiments, the combination of AAV vectors consists of: an AAV vector comprising a human IL3 gene, an AAV vector comprising a human IL6 gene, an AAV vector comprising a human SCF gene, and an AAV vector comprising a human GM-CSF gene.
[0219] In some embodiments, the combination of AAV vectors comprises: an AAV vector comprising a human IL3 gene, an AAV vector comprising a human IL6 gene, an AAV vector comprising a human THPO gene, an AAV vector comprising a human SCF gene, and an AAV vector comprising a human GM-CSF gene. The composition comprising these 5 AAV vectors can greatly increase the reconstitution rate of hCD45 in severe immunodeficient mice, can reconstitute more qualified humanized mice, and can be applied to provide a large number of single-donor CD34 humanized mice.
[0220] In some embodiments, the combination of AAV vectors consists of: an AAV vector comprising a human IL3 gene, an AAV vector comprising a human IL6 gene, an AAV vector comprising a human THPO gene, an AAV vector comprising a human SCF gene, and an AAV vector comprising a human GM-CSF gene.
[0221] In some embodiments, the combination of AAV vectors comprises: an AAV vector comprising a human IL3 gene, an AAV vector comprising a human IL6 gene, an AAV vector comprising a human THPO gene, an AAV vector comprising a human SCF gene, an AAV vector comprising a human GM-CSF gene, and an AAV vector comprising a human IL15 gene. The composition comprising these 6 AAV vectors can greatly increase the reconstitution rate of hCD45 in severe immunodeficient mice, can make the CD3-CD56+NK cells in the mice comparable to the physiological level of normal humans in the proportion of hCD45 cells, and can reconstitute more qualified humanized mice.
[0222] In some embodiments, the combination of AAV vectors consists of an AAV vector comprising a human IL3 gene, an AAV vector comprising a human IL6 gene, an AAV vector comprising a human THPO gene, an AAV vector comprising a human SCF gene, an AAV vector comprising a human GM-CSF gene, and an AAV vector comprising a human IL2 gene.
[0223] In some embodiments, the combination of AAV vectors consists of an AAV vector comprising a human IL2 gene and an AAV vector comprising a human GM-CSF gene.
[0224] In some embodiments, the combination of AAV vectors consists of an AAV vector comprising a human IL3 gene, an AAV vector comprising a human IL6 gene, an AAV vector comprising a human THPO gene, an AAV vector comprising a human SCF gene, an AAV vector comprising a human GM-CSF gene, and an AAV vector comprising a human IL2 gene. The composition comprising these 6 AAV vectors can greatly increase the proportion of hCD45 reconstitution of severe immunodeficient mice, while promoting the development of Treg cells in mice.
[0225] In some embodiments, the combination of AAV vectors consists of an AAV vector comprising a human IL3 gene, an AAV vector comprising a human IL6 gene, an AAV vector comprising a human THPO gene, an AAV vector comprising a human SCF gene, an AAV vector comprising a human GM-CSF gene, an AAV vector comprising a human IL15 gene, and an AAV vector comprising a human IL2 gene. The composition comprising these 7 AAV vectors can greatly increase the proportion of hCD45 reconstitution of severe immunodeficient mice, while promoting the development of Treg cells in mice, and also enabling the proportion of CD3-CD56+ NK cells in mice to be comparable to the physiological level of normal humans, and the mice are relatively healthy, and can reconstitute very qualified humanized mice.
[0226] In some embodiments, the combination of AAV vectors consists of an AAV vector comprising a human IL3 gene, an AAV vector comprising a human IL6 gene, an AAV vector comprising a human THPO gene, an AAV vector comprising a human SCF gene, an AAV vector comprising a human GM-CSF gene, an AAV vector comprising a human IL15 gene, and an AAV vector comprising a human IL2 gene.
[0227] In the present application, the injection amount of each AAV vector depends on the expression level of each cytokine, which is generally between 1 and 1000 pg / ml, and preferably around 100 pg / ml. Only when the expression level is within the above range, the immune system cannot be excessively activated. Below this expression level, sometimes the expression cannot be detected or the detection result is not accurate.
[0228] In some embodiments, the viral quantity of each AAV vector included in the combination of AAV vectors is independently 1 x 10^8~1 x 10^11 GC. In some embodiments, the injection quantity of each AAV vector is 1 x 10^8~1 x 10^11 GC / mouse when the combination of AAV vectors described above is injected into a severe immunodeficient mouse.
[0229] In some embodiments, each AAV vector has a size of no more than 4.5 kb, such as no more than 4 kb, 3.5 kb, 3 kb, 2.5 kb, etc.
[0230] In some embodiments, each AAV vector of the present application can have or be derived from any natural or recombinant AAV serotype. In some embodiments, the AAV vector of the present application has an AAV9 serotype or an equivalent tissue-tropic serotype thereof. In some embodiments, each AAV vector of the present application can independently have any one of the following serotypes: AAV DJ, AAVrh10, AAV-PHP.B, PHP.eB, AAV1, AAV2, AAV2.5, AAV2G9, AAV3, AAV4, AAV4-4, AAV5, AAV6, AAV6.1, AAV6.2, AAV6.1.2, AAV7, AAV7.2, AAV8, AAV9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.61, AAV9.68, AAV9.84, AAV9.9, AAV10, AAV11, AAV12, and AAV13.
[0231] AAV has different serotypes, and different serotypes of AAV have different peripheral blood expression levels. In some embodiments, each AAV vector independently has a serotype selected from any one of AAV2, AAV8, and AAV9, and more preferably has an AAV9 serotype.
[0232] In some embodiments, the combination of AAV vectors is administered by intraperitoneal injection or tail vein injection, and more preferably by intraperitoneal injection. In some embodiments, the injection dose of each AAV vector including a cytokine gene is independently 1 x 10^8~1 x 10^11 GC / each.
[0233] In some embodiments, the AAV vector further comprises a promoter and a terminator, wherein the promoter is a CAG promoter, an EF1A promoter, a CMV promoter, a CBh promoter, or a variant thereof. Different promoters result in different expression times of the exogenous cytokines in vivo, and different promoters have different effects on the immune system reconstruction efficiency and the health status of the humanized mice. In the severely immunodeficient mice, the above-mentioned promoters can drive the expression of the above-mentioned cytokines, and the CAG promoter and the EF1A promoter drive the expression of the above-mentioned cytokines for a longer time. In some embodiments, the sequence of the CAG promoter is shown in SEQ ID No: 9. In some embodiments, the sequence of the CMV promoter is shown in SEQ ID No: 10. In some embodiments, the sequence of the EF1A promoter is shown in SEQ ID No: 15. In some embodiments, the terminator comprised by the AAV vector is a BGH pA terminator. In some embodiments, the sequence of the BGH pA is shown in SEQ ID No: 11. In some embodiments, the AAV vector comprises a CAG promoter and a BGH pA terminator, wherein the sequence of the CAG promoter is shown in SEQ ID No: 9, and the sequence of the BGH pA is shown in SEQ ID No: 11.
[0234] In some embodiments, the sequence of the cDNA of human IL15 is shown in SEQ ID No: 18.
[0235] In a eighth aspect, the present application further provides a method for constructing an immune system humanized non-human animal, comprising the following steps: injecting an AAV vector comprising a cytokine gene selected from any one or two or more of the following into a non-human animal: an AAV vector comprising a human IL2 gene, an AAV vector comprising a human IL3 gene, an AAV vector comprising a human IL6 gene, an AAV vector comprising a human IL15 gene, an AAV vector comprising a human THPO gene, an AAV vector comprising a human SCF gene, and an AAV vector comprising a human GM-CSF gene; irradiating the non-human animal; and injecting human hematopoietic stem cells into the non-human animal.
[0236] The irradiation dose of the present application is determined according to the size of the non-human animal. In some embodiments, the non-human animal is a mouse, and the irradiation dose is 80-200 cGy, for example, 80 cGy, 90 cGy, 100 cGy, 110 cGy, 120 cGy, 130 cGy, 140 cGy, 150 cGy, 160 cGy, 170 cGy, 180 cGy, 190 cGy, 200 cGy, etc.
[0237] In some embodiments, the non-human animal is, for example, a laboratory animal, a domestic animal, a farm animal, and the like, such as a species such as a mouse, a rodent, a dog, a cat, a pig, a horse, a cow, a sheep, a non-human primate, and the like; for example, a mouse, a rat, a rabbit, a hamster, a guinea pig, a cow, a pig, a sheep, a goat, and other transgenic animal species, particularly mammalian species, as known in the art. In some embodiments, the subject genetically modified animal is a mouse, a rat, or a rabbit.
[0238] In one embodiment, the non-human animal is a mammal. In some embodiments, the non-human animal is a small mammal, for example, of the family Dipodoidea or Muroidea. In one embodiment, the genetically modified animal is a rodent. In some embodiments, the rodent is selected from the group consisting of a mouse, a rat, and a hamster. In some embodiments, the rodent is selected from the family Muroidea. In some embodiments, the genetically modified animal is from a family selected from the group consisting of Calomyscidae (e.g., mouse-like hamsters), Cricetidae (e.g., hamsters, New World rats and mice, voles), Muridae (true mice and rats, gerbils, spiny mice, crested rats), Nesomyidae (climbing mice, rock mice, with-tailed rat, Malagasy rats and mice), Platacanthomyidae (e.g., spiny dormice), and Spalacidae (e.g., mole rates, bamboo rat, and zokors). In some embodiments, the genetically modified rodent is selected from the group consisting of a true mouse or rat (Muridae), a gerbil, a spiny mouse, and a crested rat. In some embodiments, the genetically modified mouse is from a member of the family Muridae.
[0239] In some embodiments, the non-human animal of the present application is a severe combined immunodeficiency mouse that is further knocked out of T cells, B cells, NK cells based on knockout of recombination activating gene 1 (Ragl) or knockout of recombination activating gene 2 (Rag2) or SCID mutation, deletion of IL2 receptor gamma chain.
[0240] In some embodiments, the non-human animal can be any one of severe combined immunodeficiency mice, for example, can be NOD-scid IL2Ry KO mice, NRG mice, B6RG mice or BRG mice.
[0241] In some embodiments, the NOD-scid IL2RγKO mouse is a NOG mouse or an NSG mouse; more preferably, the NOG mouse is a NOG-A2 mouse, a NOG-DR4 mouse, or a NOG-B2M mouse. null IA null Mice, NOG-IL2 mice, NOG-IL4 mice, NOG-IL6 mice, NOG-IL15 mice, NOG-EXLNSG mice, or NOG-GCSFNSG mice; wherein the NSG mice are NSG-A2 / B2M mice, NSG-Kit^W41 mice, NSG-DR1 mice, NSG-DR4 mice, NSG-DQ8 mice, or NSG-B2M mice. null IA / IE null Mice, NSG-W41 mice, NBSWG mice, NSG-W41-IL7 mice, NSG-IL15 mice, NSG-IL7-IL15 mice, NSG-SGM3 mice, or NSG-Quad mice.
[0242] In some embodiments, the NRG mouse is an NRG-A2 / DR4 mouse, an NRG-W41 mouse, an NRG-F mouse, or an NRG-SGM3 mouse.
[0243] In some embodiments, the B6RG mouse is a B6RG-CD47 mouse or a B6RGS mouse. NOD Mice, B6RGS NOD -K mice, B6RGS mice, or HUMAMICE mice.
[0244] In some embodiments, the BRG mouse is a BRGS mouse or an SRG mouse; more preferably, the BRGS mouse is a BRGS-A2 / DR2 mouse, a BRGS-F mouse, a BRGS-F-A2 mouse, or a BRGS-T mouse; and the SRG mouse is an SRG-6 mouse, an SRG-15 mouse, a MISTRG mouse, a MISTRG-GR mouse, a MISTRG-6 mouse, or a MISTRG-6-15 mouse.
[0245] In some embodiments, the method includes injecting a combination of any of the AAV vectors described in the seventh aspect above into a non-human animal, then irradiating the non-human animal, and finally injecting artificial hematopoietic stem cells into the non-human animal.
[0246] In some embodiments, the method includes the following steps: irradiating a non-human animal, then injecting artificial hematopoietic stem cells into the non-human animal, and injecting an AAV vector containing the human IL15 gene into the non-human animal 3–5 weeks later. Delayed injection of the AAV vector containing the human IL15 gene can significantly reduce the proportion of NK cells in peripheral blood, improve the multilineage differentiation balance of the immune system, and significantly reduce the inflammatory response induced by human NK cell expansion, thus lowering the risk of GvHD-like pathology.
[0247] In some embodiments, the amount of each AAV vector injected into the non-human animal is independently 1x10^8 to 1x10^11 GC / animal.
[0248] In some embodiments, the amount of each AAV vector injected into the mice is independently 1x10^8 to 1x10^11 GC / mouse, for example, 1x10^8 GC / mouse, 2x10^8 GC / mouse, 3x10^8 GC / mouse, 4x10^8 GC / mouse, 5x10^8 GC / mouse, 6x10^8 GC / mouse, 7x10^8 GC / mouse, 8x10^8 GC / mouse, 9x10^8 GC / mouse, 1x10^9 GC / mouse, 2x10^9 GC / mouse, 3x10^9 GC / mouse, 4x10^9 GC / mouse, etc. GC / each, 5x10^9GC / each, 6x10^9GC / each, 7x10^9GC / each, 8x10^9GC / each, 9x10^9GC / each, 1x10^10GC / each, 1.5x10^10GC / each, 2x10^10GC / each, 3x10^10GC / each, 4x10^10GC / each, 5x10^10GC / each, 6x10^10GC / each, 7x10^10GC / each, 8x10^10GC / each, 9x10^10GC / each, 1x10^11GC / each, etc.
[0249] Ninthly, this application also provides a method for promoting the conversion of human hematopoietic stem cells to CD14. + Monocytes and CD66b + A method for granulocyte differentiation includes the following steps: injecting a combination of AAV vectors including cytokine genes into a non-human animal; irradiating the non-human animal; and injecting artificial hematopoietic stem cells into the non-human animal.
[0250] The combination of AAV vectors including cytokine genes is: a combination of an AAV vector including the human IL-3 gene, an AAV vector including the human GM-CSF gene, and an AAV vector including the human SCF gene.
[0251] In some preferred embodiments, the present application promotes the conversion of human hematopoietic stem cells to CD14. +Monocytes and CD66b + In the method of granulocyte differentiation, the combination of AAV vectors including the cytokine genes is: a combination of an AAV vector including a human IL-3 gene, an AAV vector including a human GM-CSF gene, an AAV vector including a human SCF gene, and an AAV vector including a human IL-6 gene.
[0252] In some embodiments, each AAV vector can have or be derived from any natural or recombinant AAV serotype. In some embodiments, the AAV vectors of the present application have the AAV9 serotype or an equivalent tissue-tropic serotype thereof. In some embodiments, each AAV vector of the present application can each independently have any one of the following serotypes: AAVDJ, AAVrh10, AAV-PHP.B, PHP.eB, AAV1, AAV2, AAV2.5, AAV2G9, AAV3, AAV4, AAV4-4, AAV5, AAV6, AAV6.1, AAV6.2, AAV6.1.2, AAV7, AAV7.2, AAV8, AAV9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.61, AAV9.68, AAV9.84, AAV9.9, AAV10, AAV11, AAV12, and AAV13.
[0253] There are different serotypes of AAVs, and different serotypes of AAVs can have different expression levels in peripheral blood. In some embodiments, each AAV vector independently has a serotype selected from any one of AAV2, AAV8, and AAV9, and more preferably has the AAV9 serotype.
[0254] In some embodiments, the combination of AAV vectors including the cytokine genes is administered by intraperitoneal injection or tail vein injection, and more preferably by intraperitoneal injection. In some embodiments, the injection dose of each AAV vector including the cytokine genes is independently 1 x 10^8-1 x 10^11 GC per mouse.
[0255] In some embodiments, each AAV vector further comprises a promoter and a terminator, the promoter is a CAG promoter, an EF1A promoter, a CMV promoter, a CBh promoter or a variant thereof. Different promoters result in different expression times of exogenous cytokines in vivo, and different promoters have different effects on immune system reconstruction efficiency and the health status of humanized mice. In severely immunodeficient mice, the above-mentioned promoters can drive the expression of the above-mentioned cytokines, and the CAG promoter and the EF1A promoter drive the expression of the above-mentioned cytokines for a longer time. In some embodiments, the sequence of the CAG promoter is shown in SEQ ID No: 9. In some embodiments, the sequence of the CMV promoter is shown in SEQ ID No: 10. In some embodiments, the sequence of the EF1A promoter is shown in SEQ ID No: 15. In some embodiments, the terminator included in the AAV vector is a BGH pA terminator. In some embodiments, the sequence of the BGH pA is shown in SEQ ID No: 11. In some embodiments, the AAV vector comprises a CAG promoter and a BGH pA terminator, the sequence of the CAG promoter is shown in SEQ ID No: 9, and the sequence of the BGH pA is shown in SEQ ID No: 11.
[0256] In a tenth aspect, the present application also provides a use of the adeno-associated virus (AAV) vector of the sixth aspect or the combination of the AAV vectors of the seventh aspect in constructing an immune system humanized non-human animal.
[0257] In the prior art, a complete human immune system is usually reconstructed in mice by two methods: exogenous injection of multiple cytokines and transgenic expression of cytokines. Among them, the method of exogenous injection of multiple cytokines has a short time of existence in vivo, and needs to be injected repeatedly. Using the transgenic method to exogenously express cytokines, it takes two years to make transgenic mice to obtain a pure line of mice, and if multiple transgenic mice are involved, the hybridization between different transgenic mice and the mating of multiple gene pure lines also takes 2 years, which is a limitation of the efficiency of transgenic technology.
[0258] The method of injecting AAV vector of the present application has the following advantages: (1) long expression time of cytokines, close to one year. (2) multiple cytokines can be expressed simultaneously, and some cytokines not included in transgenic mice can be expressed simultaneously. (3) The expression level can be optimized according to the injection amount. The existing transgenic mice have the possibility of overexpression or underexpression, and cannot be optimized later. (4) Cytokines can be expressed in different genetic background of severe immunodeficiency mice. Different severe immunodeficiency mice, such as NSG (NOD SCID IL2RγKO), NRG, BRG, etc., have different resistance to chemotherapy drugs and irradiation, and different immune system reconstruction efficiency. Each model has different experimental scenarios. AAV technology can be applied in different genetic background of severe immunodeficiency mice. Even the test cross of the genetic background of transgenic mice needs 2 to 3 years of time, which is much longer than the reconstruction time of the present application. (5) AAV virus construction and packaging only need one month of time, and can be used in different genetic backgrounds, the number of expressed genes and the expression level can be optimized, which is incomparable to transgenic technology.
[0259] Examples
[0260] The mice used in the following examples are all 4-week-old NV-NSG mice purchased from Future Model (Suzhou) Biotechnology Co., Ltd.
[0261] In the following examples, the expression level of each cytokine was detected by Elisa method, wherein the detection instrument was Multiskan FC enzyme label instrument of Invitrogen; the kit was 430504 ELISA MAX Deluxe Set Human IL-6 Kit, 431804 ELISA MAX Deluxe Set Human IL-2 Kit, 432004 ELISA MAX Deluxe Set Human GM-CSF Kit, 435104 ELISA MAX Deluxe Set Human IL-15 Kit, KHC0031 IL-3 Human ELISA Kit, EHCSF1 M-CSF (CSF-1) Human ELISA Kit, BMS2001 INST G-CSF Human Instant ELISA purchased from Biolegend. TM Deluxe Set Human IL-6 Kit, 431804 ELISA MAX Deluxe Set Human IL-2 Kit, 432004 ELISA MAX Deluxe Set Human GM-CSF Kit, 435104 ELISA MAX Deluxe Set Human IL-15 Kit, KHC0031 IL-3 Human ELISA Kit, EHCSF1 M-CSF (CSF-1) Human ELISA Kit, BMS2001 INST G-CSF Human Instant ELISA purchased from Biolegend. TM Deluxe Set Human IL-2 Kit, 432004 ELISA MAX Deluxe Set Human GM-CSF Kit, 435104 ELISA MAX Deluxe Set Human IL-15 Kit, KHC0031 IL-3 Human ELISA Kit, EHCSF1 M-CSF (CSF-1) Human ELISA Kit, BMS2001 INST G-CSF Human Instant ELISA purchased from Biolegend. TM Deluxe Set Human GM-CSF Kit, 435104 ELISA MAX Deluxe Set Human IL-15 Kit, KHC0031 IL-3 Human ELISA Kit, EHCSF1 M-CSF (CSF-1) Human ELISA Kit, BMS2001 INST G-CSF Human Instant ELISA purchased from Biolegend. TM Deluxe Set Human IL-15 Kit; KHC0031 IL-3 Human ELISA Kit, EHCSF1 M-CSF (CSF-1) Human ELISA Kit, BMS2001 INST G-CSF Human Instant ELISA purchased from Invitrogen. TMKit, EHFLT3LG FLT-3L Human ELISA Kit, EHIL7 IL-7 Human ELISA Kit; human APRIL ELISA Kit (ab119505) purchased from abcam; human BAFF ELISA Kit (DBLYS0B) purchased from R&D system. In each of the following examples, each AAV vector was dissolved in 100 μL of PBS before injection.
[0262] Example 1 Optimization of AAV vector
[0263] (1) Expression of human IL3 and human GM-CSF using AAV vectors of different serotypes
[0264] According to FIG. 1, the part represented by cytokine in FIG. 1 is hIL3, and an AAV vector expressing the cDNA of human IL3 (SEQ ID No: 1) is constructed; according to FIG. 1, the part represented by cytokine in FIG. 1 is hGM-CSF, and an AAV vector expressing the cDNA of human GM-CSF (SEQ ID No: 2) is constructed; each AAV vector contains a CAG promoter and a BGH pA terminator, and the expression frame is flanked by AAV9 5'UTR and AAV9 3'UTR.
[0265] AAV vectors have different serotypes, and the expression levels of different serotypes of AAV in peripheral blood can be different. Common serotypes are AAV2, AAV8 and AAV9. Different cytokines are expressed using different capsid proteins, and 12 4-week-old NV-NSG mice are randomly divided into six groups, 2 in each group, and 1x10^10 GC of AAV2 expressing human IL3, 1x10^10 GC of AAV2 expressing human GM-CSF, 1x10^10 GC of AAV8 expressing human IL3, 1x10^10 GC of AAV8 expressing human GM-CSF, 1x10^10 GC of AAV9 expressing human IL3 and 1x10^10 GC of AAV9 expressing human GM-CSF are respectively injected into the six groups of mice through the tail vein, and the expression level of cytokine is detected by Elisa after 3 weeks, and the results are shown in FIG. 2. It can be seen that by injecting the same dose of AAV of different serotypes through the tail vein, the cytokine expressed by serotype AAV9 has the highest concentration in peripheral blood in vivo.
[0266] (2) Comparison of different injection routes of AAV9
[0267] For AAVs with different serotypes, different injection routes also affect the expression levels of cytokines in peripheral blood. The injection routes of AAVs are divided into intravenous injection, subcutaneous injection, intramuscular injection and intraperitoneal injection. In order to make the peripheral blood express enough cytokines, the effects of intraperitoneal injection and tail vein injection are compared here. Eight 4-week-old NV-NSG mice were randomly divided into four groups, two in each group. The first group of mice was injected with 1x10^10 GC / mouse of AAV9 hIL3 by intraperitoneal injection, the second group of mice was injected with 1x10^10 GC / mouse of AAV9 hGM-CSF by intraperitoneal injection, the third group of mice was injected with 1x10^10 GC / mouse of AAV9 hIL3 by tail vein injection, and the fourth group of mice was injected with 1x10^10 GC / mouse of AAV9 hGM-CSF by tail vein injection. After 3 weeks of injection, the expression levels of hIL3 and hGM-CSF were detected by Elisa, and the results are shown in Figure 3. It can be seen that the expression level of cytokines can be higher by using intraperitoneal injection.
[0268] (3) Effect of different promoters on cytokine expression
[0269] The expression level of cytokines driven by AAV vectors is also affected by the promoter sequence. Therefore, this study compares the expression level and expression duration of cytokines driven by different promoters (CAG promoter and CMV promoter) of AAV vectors in the peripheral blood of mice.
[0270] According to Figure 1, the part represented by cytokine in Figure 1 is hIL3, the promoter is CMV promoter, and the AAV9 vector expressing the cDNA of human IL3 (AAV9 CMV hIL3) is constructed; according to Figure 1, the part represented by cytokine in Figure 1 is hGM-CSF, the promoter is CMV promoter, and the AAV9 vector expressing the cDNA of human hGM-CSF (AAV9 CMV hGM-CSF) is constructed; according to Figure 1, the part represented by cytokine in Figure 1 is hIL3, the promoter is CAG promoter, and the AAV9 vector expressing the cDNA of human IL3 (AAV9 CAG hIL3) is constructed; according to Figure 1, the part represented by cytokine in Figure 1 is hGM-CSF, the promoter is CAG promoter, and the AAV9 vector expressing the cDNA of human hGM-CSF (AAV9 CAG hGM-CSF) is constructed. The four kinds of AAV9 vectors all contain BGH pA terminator, and the expression frame is flanked by AAV9 5'UTR and AAV9 3'UTR.
[0271] Thirty-two 4-week-old NV-NSG mice were randomly divided into four groups of eight each. The four groups were intraperitoneally injected with AAV9 CMV hIL3 (1x10^10 GC / mouse), AAV9 CMV hGM-CSF (1x10^10 GC / mouse), AAV9 CAG hIL3 (1x10^10 GC / mouse), and AAV9 CAG hGM-CSF (1x10^10 GC / mouse), respectively. At 3, 6, 9, 12, 24, and 48 weeks after injection, the expression levels of hIL3 and hGM-CSF were detected using ELISA. The results are shown in Figure 4. The results indicate that in severely immunodeficient mice, the CAG promoter can drive the sustained expression of hIL3 and hGM-CSF for more than 48 weeks, while the longest in vivo expression time of cytokines driven by the CMV promoter is only 12 weeks.
[0272] The above experiments found that when using the CAG promoter, the exogenous gene in the AAV9 vector can be expressed in immunodeficient mice for more than six months at a stable expression level, thus it can be used as an alternative to transgenic mice. The method described in this application has a significant efficiency advantage over methods for producing multi-transgenic transgenic animals, reducing production and breeding time.
[0273] Example 2
[0274] (1) AAV-assisted reconstruction of acute myeloid leukemia (AML) PDX NV-NSG mouse model
[0275]
[0276] (2) AAV assisted reconstitution of multiple myeloma (MM) PDX mouse model
[0277] According to FIG. 1, the parts represented by cytokines in FIG. 1 are IL6, APRIL and BAFF respectively, the promoter is CAG promoter, and the terminator is BGH pA terminator. The AAV9 vector expressing the cDNA of hIL6, the AAV9 vector expressing the cDNA of hAPRIL, and the AAV9 vector expressing the cDNA of hBAFF are constructed. The AAV9 expressing different cytokines is dose optimized so that after intraperitoneal injection of AAV9 for 3 weeks, the detection level of each cytokine in serum is between 100 pg / ml and 300 pg / ml, which is similar to the concentration range of cytokines in pathological state, thereby determining the dose of each AAV9 expressing different cytokines, wherein the injection amount of AAV IL6 is 5x10^9 GC / mouse, the injection amount of AAV APRIL is 1x10^10 GC / mouse, and the injection amount of AAV BAFF is 1x10^10 GC / mouse. Subsequently, 60 4-week-old NV-NSG mice are randomly divided into 4 groups, 15 mice in each group, wherein the first group is not injected with AAV9, and the second to fourth groups are intraperitoneally injected with AAV9 expressing different cytokines at the above-mentioned determined doses; one week later, the mice are irradiated with a dose of 100 cGy; the next day, 15 mice in each group are randomly divided into A, B and C groups, 5 mice in each group, and the mice in A, B and C groups are intravenously injected with different donor-derived MM-1, MM-2 and MML-3 cells (provided by Tianjin General Hospital) at 1x10^6 cells per mouse. After 4 months, the serum level of human antibody IgG is detected by bone marrow, and the results are shown in FIG. 6. FIG. 6 shows that in addition to IL6, APRIL and BAFF can also promote the reconstitution of MM PDX NV-NSG mice.
[0278] The above experiment shows that the long-acting cytokine-expressing AAV vector and its combination of the present application have high reconstitution efficiency and short cycle of human PDX mouse model, which is helpful for screening more cytokine-dependent PDX reconstitution.
[0279] Example 3 Optimization of AAV combination expressing different cytokines increases the reconstitution efficiency of the immune system
[0280] Because the number of CD34 from cord blood is limited, it is difficult to obtain a large number of single-donor-derived CD34 humanized mice using traditional methods. It is known that some transgenic immunodeficient mice can increase the efficiency of human immune system reconstruction by expressing cytokines such as IL3, SCF and GM-CSF. It is known that some cytokines can promote the proliferation of CD34 hematopoietic stem cells in vitro. And using AAV technology can express different human cytokines in vivo for a long time, so by using AAV vectors to express different cytokines, the differences in the efficiency of human immune system reconstruction in vivo by different cytokines are observed. It is reported that the cytokines that help CD34 proliferation in vitro are SCF, GM-CSF, G-CSF, M-CSF, THPO, IL3, IL6, FLT3LG, and the results are shown in Figure 7. According to Figure 1, the part represented by the cytokine in Figure 1 is hSCF, hGM-CSF, hG-CSF, hM-CSF, hTHPO, hIL3, hIL6, hFLT3LG, the promoter is CAG promoter, and the terminator is BGH pA terminator. The AAV9 vector expressing the cDNA of hSCF, the AAV9 vector expressing the cDNA of hGM-CSF, the AAV9 vector expressing the cDNA of hG-CSF, the AAV9 vector expressing the cDNA of hM-CSF, the AAV9 vector expressing the cDNA of hTHPO, the AAV9 vector expressing the cDNA of hIL3, the AAV9 vector expressing the cDNA of hIL6, and the AAV9 vector expressing the cDNA of hFLT3LG are constructed. The AAV9 expressing different cytokines is optimized for dose, so that after 3 weeks of intraperitoneal injection of AAV9, the detection level of each cytokine in serum is between 100 pg / ml and 300 pg / ml, thereby determining the dose of each AAV9 expressing different cytokines, wherein the injection amount of the AAV vector containing hIL3, the AAV vector containing hIL6, the AAV vector containing hTHPO, the AAV vector containing hSCF, the AAV vector containing hGM-CSF, the AAV vector containing hM-CSF, and the AAV vector containing hFLT3LG is 5x10^10 GC / mouse, 5x10^9 GC / mouse, 5x10^9 GC / mouse, 5x10^9 GC / mouse, 5x10^10 GC / mouse, 5x10^9 GC / mouse, and 5x10^9 GC / mouse, respectively. Subsequently, 45 4-week-old NV-NSG mice are randomly divided into 9 groups, 5 mice in each group, wherein 1 group is not injected with AAV9, and the other 8 groups are injected with AAV9 expressing different cytokines into the mouse peritoneal cavity at the dose determined above; one week later, the mice are irradiated with a dose of 100 cGy; the next day, 100,000 CD34 cells separated from cord blood are injected into the tail vein; at 12 weeks after cell injection, the efficiency of human immune system reconstruction is detected by taking blood from the orbit, and the health status of the mice is observed every three days.Because the time for mouse human immune system maturation is 12-14 weeks, the reconstitution efficiency of hCD45 was observed after 12 weeks with different AAV9, the formula for reconstitution efficiency is hCD45% = hCD45+ / (hCD45+mCD45). The NV-NSG mice without injection of AAV9 are control group. The results are shown in Figure 8, in vivo, SCF, GM-CSF, IL3, IL6 and THPO can promote the reconstitution efficiency of hCD45 cells. While overexpressed G-CSF, M-CSF, FLT3LG inhibit the reconstitution efficiency of hCD45 immune cells. This is probably due to the cross reaction of these hCD45 inhibitory human cytokines and mouse natural immune system, which promotes the growth of mCD45 cells.
[0281] The above experiment shows that IL3, IL6, THPO, SCF and GM-CSF can promote the growth of hCD45 cells and the proportion of total CD45 cells, so the AAV9 expressing these 5 cytokines (AAV Plus5) are mixed together and injected into NV-NSG mice as experimental group, wherein the injection amount of AAV9 hIL3, AAV9 hIL6, AAV9 hTHPO, AAV9 hSCF, AAV9 hGM-CSF is 5x10^10 GC / mouse, 5x10^9 GC / mouse, 5x10^9 GC / mouse, 5x10^9 GC / mouse, 5x10^10 GC / mouse respectively; NV-NSG mice without injection are control group. The experimental group mice are randomly divided into three groups after 100 cGy dose of whole body irradiation, each group of 5, each group is injected with different amounts (100,000, 30,000, 10,000) of the same source of human CD34 cells, and the proportion of hCD45 is detected after 12 weeks. Figure 9 shows that under the condition of injecting 100,000 human CD34 cells, the reconstitution proportion of hCD45 in the control group of mice can reach more than 25%, and with the decrease of CD34 injection amount, the reconstitution proportion of hCD45 decreases sharply, which is lower than 25%. While the NV-NSG mice injected with AAV Plus5 have a significant increase in the reconstitution proportion of hCD45, and with the decrease of CD34 cell injection amount, the reconstitution proportion of hCD45 decreases slightly, but is still higher than the industry default qualified line of 25%. Because the use of this technology to express cytokines greatly promotes the proliferation of CD34 cells in vivo, even if a small proportion of CD34 cells is injected into mice, a qualified humanized mouse can still be reconstituted. Therefore, this technology can be applied to provide a large number of single-donor CD34 humanized mice.
[0282] Example 4 Development of certain specific human immune cells assisted by AAV-expressed cytokines
[0283] 1. Development of human NK cells
[0284] Transgenic IL15 severe immunodeficient mice can support CD34 mouse developmental NK cells. But some IL15 immunodeficient mice have too high IL15 expression levels, leading to CD34 HSC mice dying from GvHD disease. Or IL15 levels are too low, leading to too low a proportion of CD34 humanized mouse NK cells. Using AAV technology, IL15 expression levels can be adjusted by adjusting the injection dose, so that the proportion of NK cells in peripheral blood can be similar to that of humans, at the 5% to 20% level.
[0285] (1) Optimization of human IL5 signal peptide sequence
[0286] The signal peptide of human IL15 is weak and it is not easy to obtain secreted IL15. Therefore, the signal peptide of IL15 needs to be modified. The optimized hIL15 sequence (SEQ ID No: 18) can also be referred to as IL2SP_hIL15 sequence, which replaces the signal peptide of unedited human IL15 (SEQ ID No: 17) with the high-activity human IL2 signal peptide.
[0287] According to FIG. 1, the part represented by the cytokine in FIG. 1 is hIL15, the promoter is CAG promoter, and the terminator is BGH pA sequence, to construct an AAV9 vector expressing the cDNA of unedited human IL15 (AAV9 hIL15); according to FIG. 1, the part represented by the cytokine in FIG. 1 is hIL2SP_hIL15, the promoter is CAG promoter, and the terminator is BGH pA sequence, to construct an AAV9 vector expressing the cDNA of human IL2SP_hIL15 (AAV9 hIL2SP_hIL15).
[0288] Eight NV-NSG mice were randomly divided into four groups, two in each group, and the four groups were injected intraperitoneally with AAV9 hIL15 (5x10^9 GC / mouse), AAV9 hIL15 (1.5x10^10 GC / mouse), AAV9 hIL2SP_hIL15 (5x10^9 GC / mouse), and AAV9 hIL2SP_hIL15 (1.5x10^10 GC / mouse), respectively. Four weeks later, the expression level of human IL15 in serum was detected by Elisa, and the results are shown in FIG. 10. After signal peptide modification, the expression level of peripheral blood hIL15 in vivo can be increased by 10 times.
[0289] (2) AAV dose optimization
[0290] AAV9 IL2SP_hIL15 were injected into 4-week-old NV-NSG mice at a dose of 5x10^9 GC / mouse and 1.5x10^10 GC / mouse respectively, irradiated at 100 cGy one week later, and injected with 100,000 CD34 cells the next day. Blood was collected at week 12 to detect the proportion of CD3-CD56+ NK cells in hCD45 cells. At the same time, the health status of the mice was observed. As shown in FIGS. 11 and 12, injection of a high dose of AAV resulted in a non-physiological level of NK cells with a proportion of more than 30%, and the lifespan of the mice was shortened, and the mice showed GcHD-like disease. After injection of a low dose of AAV, the proportion of NK cells was about 10%, which was comparable to the physiological level of normal humans, and the mice were relatively healthy.
[0291] 2. Development of Treg cells
[0292] CD4 Treg cells are important suppressive cells for immune regulation and are also an important component of tumor immunity. However, the proportion of these cells in humanized mice is relatively small. We constructed AAV9 vectors expressing human IL2 cDNA, AAV9 vectors expressing human IL7 cDNA, AAV9 vectors expressing human IL15 cDNA, and AAV9 vectors expressing human GM-CSF cDNA according to FIG. 1, in which the cytokines represented in FIG. 1 were replaced by hIL2, hIL7, hIL15, and hGM-CSF, the promoter was CAG promoter, and the terminator was BGH pA sequence.
[0293] Eight NV-NSG mice were randomly divided into four groups, two mice in each group, and the four groups of mice were injected with the above four AAV9 vectors, with an injection dose of 1x10^10 GC / mouse. Serum was collected after 4 weeks to detect the expression concentration of each cytokine, and the results are shown in FIG. 13.
[0294] Twenty-five NV-NSG mice were randomly divided into five groups, five mice in each group, one group of which was not injected with AAV, and the remaining four groups of mice were injected with the above four AAV9 vectors, with an injection dose of 1x10^10 GC / mouse. One week after injection, the mice were irradiated at a dose of 100 cGy, and the next day, 100,000 CD34 cells isolated from umbilical cord blood were injected through the tail vein to reconstruct the immune system of the umbilical cord blood CD34 cells. The percentage of Treg cells (CD25+.CD127-, CD4+, CD3+, hCD45+) in human CD4+ T cells was detected at week 14 after reconstruction, and the results are shown in FIG. 14. The results show that human IL2 and human GM-CSF can promote the development of Treg cells in mice, and human GM-CSF may promote the development of Treg cells indirectly by promoting the development of myeloid cells.
[0295] Example 5
[0296] NK cells in human peripheral blood usually account for 5% to 20% of the total number of white blood cells. However, traditional CD34 + In humanized mouse models, the proportion of NK cell reconstitution is generally less than 1%, which cannot effectively simulate the composition of human innate immunity. In order to improve the reconstitution efficiency of human NK cells, AAV-mediated IL-15 expression has been widely used to enhance NK expansion. This embodiment studies the effects of CD34 input amount and injection time of AAV vector expressing human IL2SP_hIL15 on NK cell reconstitution. The construction of AAV9 IL2SP_hIL15 in this embodiment is referred to Example 4.
[0297] (1) Effect of CD34 injection amount on NK cell reconstitution proportion
[0298] Six 4-week-old NV-NSG mice were randomly divided into 3 groups, 2 mice in each group. All mice were injected with 1x10^10 GC / mouse of AAV9 expressing human IL2SP_hIL15 (AAV9 IL2SP_hIL15) through intraperitoneal injection on the day of transplantation (week 0). The next day, all mice were irradiated at 1 Gy, and 4-6 hours later, 3 groups of mice were injected with different amounts of CD34 + cells (2x10 4 , 5x10 4 and 10x10 4 ) through tail vein. All mice were collected peripheral blood at 8 weeks after transplantation, and the proportion of human NK cells (hCD45 + CD3-CD56 + ) in hCD45 cells was analyzed by flow cytometry. The results are shown in Figure 15. Figure 15 shows that the lower the amount of CD34 + cell input, the higher the proportion of NK cells, suggesting that IL-15-induced NK cell differentiation is more intense under low hematopoietic support conditions, which may form immune bias.
[0299] The above experiment found that the reconstitution proportion of NK cells is not only related to the expression level of IL15, but also closely related to the number of injected CD34 + hematopoietic stem cells. When the amount of CD34 4 injection is low, NK cells are more likely to expand in large numbers, which may competitively inhibit the differentiation of other immune systems.
[0300] (2) Effect of AAV9 IL2SP_hIL15 injection time on NK cell reconstitution proportion
[0301] Six 4-week-old NV-NSG mice were randomly divided into 3 groups, and were myeloablative irradiated at a dose of 1 Gy. 4-6 hours later, all mice were injected with 5x10 4 CD344 Cells. Three groups of mice were injected with AAV9 IL2SP_hIL15 at the same dose (1x10^10 GC / mouse) at different time points (0thweek, 3rdweek and 5thweek after immune reconstitution). Peripheral blood was collected from all mice at 8thweek after transplantation. The proportion of human NK cells (hCD45 + CD3-CD56 4 ) in hCD45 cells was analyzed by flow cytometry. The results are shown in Figure 16. Figure 16 shows that delayed injection of IL-15 expression vector can significantly reduce the proportion of NK cells, indicating that early IL15 signal has a significant differentiation bias induction effect on hematopoietic system, especially when the amount of stem cell input is insufficient.
[0302] The above experimental results show that under the condition of low CD34 injection amount, early injection of AAV9 IL2SP_hIL15 will lead to excessive expansion of NK cells, and inhibit the development of other immune subpopulations such as T cells, B cells and myeloid cells. Delaying the injection time of AAV9 IL2SP_hIL15 (such as 3rdweek or 5thweek) can significantly reduce the proportion of NK cells, so that the reconstitution is closer to the normal proportion range of NK cells in human peripheral blood (5%~20%), which helps to achieve balanced reconstruction of multi-lineage immune system, and effectively avoids the inflammatory reaction and GvHD-like tissue damage caused by excessive expansion of NK cells, and improves the physiological relevance and safety of the model.
[0303] Example 6 AAV-mediated combined expression of IL-3, GM-CSF, SCF and IL-6 promotes differentiation of CD33 4 myeloid cells to CD14 4 and enhances their functional phenotype with CD66b+
[0304] Referring to Example 3, AAV9 vectors expressing hIL3 cDNA, hIL6 cDNA, hSCF cDNA, and hGM-CSF cDNA were constructed. Dosage optimization was performed on the AAV9 vectors expressing different cytokines, ensuring that, three weeks after intraperitoneal injection of AAV9, the serum levels of each cytokine were between 100 pg / ml and 300 pg / ml. This determined the optimal dosage for each AAV9 vector expressing different cytokines. The determined injection doses for the AAV9 vectors expressing hIL3, hIL6, hSCF, and hGM-CSF were 5 x 10^10 GC / mouse, 5 x 10^9 GC / mouse, 5 x 10^9 GC / mouse, and 5 x 10^10 GC / mouse, respectively. Subsequently, 15 four-week-old NV-NSG mice were randomly divided into three groups: a PBS control group, a GM3 group, and a GM36 group, with five mice in each group. The PBS control group received only intraperitoneal injection of PBS; the GM3 group received intraperitoneal injection of a combination of AAV vectors including hIL3, hSCF, and hGM-CSF at the determined doses; and the GM36 group received intraperitoneal injection of a combination of AAV vectors including hIL3, hIL6, hSCF, and hGM-CSF at the determined doses. One week later, the mice were irradiated whole-body with 100 cGy. The next day, umbilical cord blood CD34 cells isolated from 100,000 human umbilical cord blood cells were injected via the tail vein to reconstruct the CD34 cell immune system. At week 12 after cell injection, blood was collected from the orbital cavity to detect the proportion of CD33+ cells to human CD45 cells and the CD14+ cell count in each group. + Subgroups and CD66b + The proportion of subpopulations in CD33+ cells and the percentage of CD33+ cells in each group + HLA-DR in cells + The proportions are shown in the bar charts, and the results are shown in Figures 17-19.
[0305] The results showed that, compared with the PBS group, the peripheral blood CD33 levels in the three-factor group (GM3) mice were significantly lower. + The proportion of myeloid cells increased significantly, CD33 + CD14 in the population + and CD66b + Differentiation subsets were significantly increased. The four-factor group (GM36) further increased CD33 levels in mouse peripheral blood. + Myeloid cell ratio, and CD33 + CD14 in the population + With CD66b +The proportion further increased, and CD33 + HLA-DR + The proportion of cells significantly increased, indicating that IL-6 has an auxiliary effect on myeloid functional maturation. The present inventors further observed that IL-6 expression has a positive regulation trend on HLA-DR + expression in myeloid cells. At a moderate expression level, IL-6 can support the enhancement of antigen presentation ability, but in a high expression background, the phenomenon of reduced amplitude of HLA-DR expression level is also observed. The above trend suggests that the IL-6 expression level may affect the balance of myeloid immune maturation, which can be an important variable for regulating functional myeloid differentiation in this platform.
[0306] This embodiment can significantly enhance the reconstitution efficiency of human CD33 + myeloid cells by expressing the above three or four factors before hematopoietic stem cell transplantation. + myeloid cells, and induce them to differentiate into CD14 + monocytes and CD66b + granulocytes. At the same time, the introduction of IL-6 factor helps to improve the expression of functional markers such as HLA-DR in the population, indicating that myeloid cells are in a more mature or activated state. Among them, IL-3 can promote the expansion of multi-lineage myeloid progenitor cells, GM-CSF drives them to differentiate into granulocyte and monocyte lineage, and SCF enhances the stability and differentiation potential of stem cells. In addition to supporting myeloid survival, IL-6 also activates molecules such as CIITA through the STAT3 signaling pathway, thereby promoting the expression of MHC class II molecules. The AAV expression system used in the present application does not need to construct a transgenic mouse model, and has the advantages of controllable expression, flexible combination, clear safety window, etc.
[0307] The above is only a preferred embodiment of the present application, and is not intended to limit the other forms of the present application. Any person skilled in the art can modify or change the above disclosed technical content to equivalent embodiments. However, any simple modification, equivalent change and modification made according to the technical essence of the present application to the above embodiments, without departing from the technical solution content of the present application, still belongs to the protection scope of the present application.
Claims
1. An adeno-associated virus (AAV) vector comprising cytokine genes; The cytokines are selected from any one or more of the following: human interleukin-3 (IL3), human granulocyte-macrophage colony-stimulating factor (GM-CSF), human interleukin-6 (IL6), human proliferation-inducing ligand (APRIL), and human cell activating factor (BAFF).
2. The AAV vector according to claim 1, comprising the fusion protein gene of human IL3 and human GM-CSF; Preferably, the cDNA sequence of the fusion protein of human IL3 and human GM-CSF is shown in SEQ ID No:
6.
3. The AAV carrier according to claim 1, wherein, The AAV vector has the AAV9 serotype or its equivalent tissue transduction serotype; Preferably, the AAV vector has a serotype selected from any one of AAV2, AAV6, AAVDJ, AAVrh10, AAV-PHP.B, PHP.eB, AAV8, and AAV9, and more preferably has the AAV9 serotype; Preferably, the AAV carrier is administered via intraperitoneal injection or tail vein injection, more preferably via intraperitoneal injection; Preferably, the injection dose of the AAV vector is 1x10^8 to 1x10^11 GC / animal or 1x10^9 to 1x10^11 GC / animal; Preferably, the AAV vector further includes a promoter and a terminator, wherein the promoter is a CAG promoter, an EF1A promoter, a CMV promoter, a CBh promoter or a variant thereof, and more preferably a CAG promoter or an EF1A promoter; Preferably, the sequence of the CAG promoter is shown in SEQ ID No:9; Preferably, the sequence of the EF1A promoter is shown in SEQ ID No:
15.
4. A combination of adeno-associated virus (AAV) vectors, comprising: AAV vectors containing cytokine genes are selected from any two or more of the following: AAV vectors containing the human IL3 gene, AAV vectors containing the human GM-CSF gene, AAV vectors containing the human IL6 gene, AAV vectors containing the human APRIL gene, and AAV vectors containing the human BAFF gene.
5. The combination of AAV carriers according to claim 4, wherein, The combination of AAV carriers includes: AAV vectors including the human IL3 gene and AAV vectors including the human GM-CSF gene.
6. The combination of AAV carriers according to claim 4, wherein, The combination of AAV carriers includes: AAV vectors including the human IL6 gene, AAV vectors including the human APRIL gene, and AAV vectors including the human BAFF gene.
7. The combination of AAV carriers according to any one of claims 4 to 6, wherein, Each of the AAV vectors containing cytokine genes independently has the AAV9 serotype or its equivalent tissue transduction serotype; Preferably, each of the AAV vectors containing cytokine genes independently has a serotype selected from any one of AAV2, AAV6, AAVDJ, AAVrh10, AAV-PHP.B, PHP.eB, AAV8, and AAV9, and preferably has the AAV9 serotype.
8. The combination of AAV carriers according to any one of claims 4 to 6, wherein, The combination of AAV carriers is administered via intraperitoneal injection or tail vein injection, more preferably via intraperitoneal injection. Preferably, the injection dose of the AAV vector containing cytokine genes is independently 1x10^8 to 1x10^11 GC / animal or 1x10^9 to 1x10^11 GC / animal.
9. The combination of AAV carriers according to any one of claims 4 to 6, wherein, The AAV vector containing cytokine genes also includes a promoter and a terminator, wherein the promoter is a CAG promoter, an EF1A promoter, a CMV promoter, a CBh promoter or a variant thereof, preferably a CAG promoter or an EF1A promoter; Preferably, the sequence of the CAG promoter is shown in SEQ ID No:9; Preferably, the sequence of the EF1A promoter is shown in SEQ ID No:
15.
10. A method for constructing a non-human animal for xenotransplantation of acute myeloid leukemia, comprising the following steps: AAV vectors containing cytokine genes selected from any one or more of the following are injected into non-human animals: AAV vectors containing the human IL3 gene, AAV vectors containing the human GM-CSF gene, and AAV vectors containing the fusion protein gene of human IL3 and human GM-CSF; the non-human animals are irradiated; xenogeneic acute myeloid leukemia cells are injected into the non-human animals.
11. The method for constructing a non-human animal for acute myeloid leukemia xenotransplantation according to claim 10, wherein, The cDNA sequence of the fusion protein of human IL3 and human GM-CSF is shown in SEQ ID No:
6.
12. A method for constructing a non-human animal for xenotransplantation of multiple myeloma, comprising the following steps: AAV vectors containing cytokine genes selected from any one or more of the following are injected into non-human animals: AAV vectors containing the human IL6 gene, AAV vectors containing the human APRIL gene, and AAV vectors containing the human BAFF gene; the non-human animals are irradiated; xenogeneic multiple myeloma cells are injected into the non-human animals.
13. The method according to any one of claims 10 to 12, wherein, The non-human animal is selected from any one of NOD-scid IL2RγKO mice, NRG mice, B6RG mice, and BRG mice.
14. The method according to any one of claims 10 to 12, wherein, Each of the AAV vectors containing cytokine genes independently has the AAV9 serotype or its equivalent tissue transduction serotype; Preferably, each of the AAV vectors containing cytokine genes independently has a serotype selected from any one of AAV2, AAV6, AAVDJ, AAVrh10, AAV-PHP.B, PHP.eB, AAV8, and AAV9, and preferably has the AAV9 serotype.
15. The method according to any one of claims 10 to 12, wherein, The AAV vector containing cytokine genes is injected into a non-human animal via intraperitoneal injection or tail vein injection, more preferably via intraperitoneal injection. Preferably, the amount of each AAV carrier injected into the non-human animal is independently 1x10^8 to 1x10^11 GC / animal or 1x10^9 to 1x10^11 GC / animal.
16. The method according to any one of claims 10 to 12, wherein, The AAV vector containing cytokine genes also includes a promoter and a terminator, wherein the promoter is a CAG promoter, an EF1A promoter, a CMV promoter, a CBh promoter or a variant thereof, preferably a CAG promoter or an EF1A promoter; Preferably, the sequence of the CAG promoter is shown in SEQ ID No:9; Preferably, the sequence of the EF1A promoter is shown in SEQ ID No:
15.
17. Use of the adeno-associated virus (AAV) vector of any one of claims 1 to 3 or a combination of the AAV vectors of any one of claims 4 to 9 in the construction of non-human animals for xenografting acute myeloid leukemia or multiple myeloma.
18. An adeno-associated virus (AAV) vector comprising cytokine genes; The cytokines are selected from any one or more of the following: human interleukin-2 (IL2), human interleukin-3 (IL3), human interleukin-6 (IL6), human interleukin-15 (IL15), human thrombopoietin (THPO), human stem cell factor (SCF), and human granulocyte-macrophage colony-stimulating factor (GM-CSF).
19. The AAV carrier according to claim 18, wherein, The AAV vector has the AAV9 serotype or its equivalent tissue transduction serotype; Preferably, the AAV vector has a serotype selected from any one of AAV2, AAV6, AAVDJ, AAVrh10, AAV-PHP.B, PHP.eB, AAV8, and AAV9, and more preferably has the AAV9 serotype; Preferably, the AAV carrier is administered via intraperitoneal injection or tail vein injection, more preferably via intraperitoneal injection; Preferably, the injection dose of the AAV vector is 1×10^8~1×10^11 GC / animal; Preferably, the AAV vector further includes a promoter and a terminator, wherein the promoter is a CAG promoter, an EF1A promoter, a CMV promoter, a CBh promoter or a variant thereof, and more preferably a CAG promoter or an EF1A promoter; Preferably, the sequence of the CAG promoter is shown in SEQ ID No:9; Preferably, the sequence of the EF1A promoter is shown in SEQ ID No:15; Preferably, the cDNA sequence of human IL15 is shown in SEQ ID No:
18.
20. A combination of adeno-associated virus (AAV) vectors, comprising: AAV vectors containing cytokine genes are selected from any two or more of the following: AAV vectors containing the human IL2 gene, AAV vectors containing the human IL3 gene, AAV vectors containing the human IL6 gene, AAV vectors containing the human IL15 gene, AAV vectors containing the human THPO gene, AAV vectors containing the human SCF gene, and AAV vectors containing the human GM-CSF gene.
21. The combination of AAV carriers according to claim 20, wherein, The combination of AAV carriers includes: AAV vectors including the human IL3 gene, AAV vectors including the human SCF gene, and AAV vectors including the human GM-CSF gene; or AAV vectors including the human IL3 gene, AAV vectors including the human IL6 gene, AAV vectors including the human SCF gene, and AAV vectors including the human GM-CSF gene; or AAV vectors including the human IL3 gene, AAV vectors including the human IL6 gene, AAV vectors including the human THPO gene, AAV vectors including the human SCF gene, and AAV vectors including the human GM-CSF gene. Preferably, the combination of the AAV carrier further includes: AAV vectors that include the human IL15 gene and / or AAV vectors that include the human IL2 gene.
22. The combination of AAV carriers according to claim 20 or 21, wherein, Each of the AAV vectors containing cytokine genes independently has the AAV9 serotype or its equivalent tissue transduction serotype; Preferably, each of the AAV vectors containing cytokine genes independently has a serotype selected from any one of AAV2, AAV6, AAVDJ, AAVrh10, AAV-PHP.B, PHP.eB, AAV8, and AAV9, and preferably has the AAV9 serotype.
23. The combination of AAV carriers according to any one of claims 20 to 22, wherein, The combination of AAV carriers is administered via intraperitoneal injection or tail vein injection, more preferably via intraperitoneal injection. Preferably, the injection dose of the AAV vector containing cytokine genes is independently 1×10^8 to 1×10^11 GC / animal.
24. The combination of AAV carriers according to any one of claims 20 to 23, wherein, The AAV vector containing cytokine genes also includes a promoter and a terminator, wherein the promoter is a CAG promoter, an EF1A promoter, a CMV promoter, a CBh promoter or a variant thereof, preferably a CAG promoter or an EF1A promoter; Preferably, the sequence of the CAG promoter is shown in SEQ ID No:9; Preferably, the sequence of the EF1A promoter is shown in SEQ ID No:
15.
25. The combination of AAV carriers according to any one of claims 20 to 24, wherein, The cDNA sequence of human IL15 is shown in SEQ ID No:
18.
26. A method for constructing a humanized non-human animal immune system, comprising the following steps: AAV vectors containing cytokine genes selected from any one or more of the following are injected into a non-human animal: AAV vector containing the human IL2 gene, AAV vector containing the human IL3 gene, AAV vector containing the human IL6 gene, AAV vector containing the human IL15 gene, AAV vector containing the human THPO gene, AAV vector containing the human SCF gene, and AAV vector containing the human GM-CSF gene; the non-human animal is irradiated; and artificial hematopoietic stem cells are injected into the non-human animal.
27. The method according to claim 26, wherein, The non-human animals are NOD-scid IL2RγKO mice, NRG mice, B6RG mice, or BRG mice.
28. The method according to claim 26 or 27, wherein, An AAV vector containing the human IL3 gene, an AAV vector containing the human IL6 gene, an AAV vector containing the human THPO gene, an AAV vector containing the human SCF gene, and an AAV vector containing the human GM-CSF gene are injected into a non-human animal. Preferably, an AAV vector containing the human IL15 gene and / or an AAV vector containing the human IL2 gene are further injected into the non-human animal.
29. The method according to claim 26 or 27, comprising the steps of: irradiating a non-human animal, then injecting artificial hematopoietic stem cells into the non-human animal, and injecting an AAV vector including the human IL15 gene into the non-human animal 3 to 5 weeks later.
30. The method according to any one of claims 26 to 29, wherein, Each of the AAV vectors containing cytokine genes independently has the AAV9 serotype or its equivalent tissue transduction serotype; Preferably, each of the AAV vectors containing cytokine genes independently has a serotype selected from any one of AAV2, AAV6, AAVDJ, AAVrh10, AAV-PHP.B, PHP.eB, AAV8, and AAV9, and preferably has the AAV9 serotype.
31. The method according to any one of claims 26 to 30, wherein, The AAV vector containing cytokine genes is injected into a non-human animal via intraperitoneal injection or tail vein injection, more preferably via intraperitoneal injection. Preferably, the amount of each AAV carrier injected into the non-human animal is independently 1x10^8 to 1x10^11 GC / animal.
32. The method according to any one of claims 26 to 31, wherein, The AAV vector containing cytokine genes also includes a promoter and a terminator, wherein the promoter is a CAG promoter, an EF1A promoter, a CMV promoter, a CBh promoter or a variant thereof, preferably a CAG promoter or an EF1A promoter; Preferably, the sequence of the CAG promoter is shown in SEQ ID No:9; Preferably, the sequence of the EF1A promoter is shown in SEQ ID No:
15.
33. The method according to any one of claims 26 to 32, wherein, The cDNA sequence of human IL15 is shown in SEQ ID No:
18.
34. A method for promoting the conversion of artificial hematopoietic stem cells to CD14 + Monocytes and CD66b + A method for granulocyte differentiation includes the following steps: injecting a combination of AAV vectors including cytokine genes into a non-human animal; irradiating the non-human animal; and injecting artificial hematopoietic stem cells into the non-human animal. in, The combination of AAV vectors including cytokine genes includes: AAV vectors including the human IL-3 gene, AAV vectors including the human GM-CSF gene, and AAV vectors including the human SCF gene; or, AAV vectors including the human IL-3 gene, AAV vectors including the human GM-CSF gene, AAV vectors including the human SCF gene, and AAV vectors including the human IL-6 gene.
35. The method according to claim 34, wherein, Each of the AAV vectors containing cytokine genes independently has the AAV9 serotype or its equivalent tissue transduction serotype; Preferably, each of the AAV vectors containing cytokine genes independently has a serotype selected from any one of AAV2, AAV6, AAVDJ, AAVrh10, AAV-PHP.B, PHP.eB, AAV8, and AAV9, and preferably has the AAV9 serotype.
36. The method according to claim 34 or 35, wherein, The non-human animals are NOD-scid IL2RγKO mice, NRG mice, B6RG mice, or BRG mice.
37. The method according to any one of claims 34 to 36, wherein, The combination of AAV vectors including cytokine genes is administered via intraperitoneal injection or tail vein injection, preferably via intraperitoneal injection. Preferably, the injection dose of the AAV vector containing cytokine genes is independently 1×10^8 to 1×10^11 GC / animal.
38. The method according to any one of claims 34 to 37, wherein, The AAV vector containing cytokine genes also includes a promoter and a terminator, wherein the promoter is a CAG promoter, an EF1A promoter, a CMV promoter, a CBh promoter or a variant thereof, preferably a CAG promoter or an EF1A promoter; Preferably, the sequence of the CAG promoter is shown in SEQ ID No:9; Preferably, the sequence of the EF1A promoter is shown in SEQ ID No:
15.
39. Use of the adeno-associated virus (AAV) vector of claim 18 or 19, or a combination of the AAV vectors of any one of claims 20 to 25, in constructing humanized non-human animals with immune systems.
Citation Information
Patent Citations
Humanized mouse model with improved human innate immune cell development
CN110740641A
Capsid-modified, RAAV3 vector compositions and use in gene therapy of human liver cancer
CN111411125A
Construction method of humanized immune system mouse with myeloid immune cells
CN111705082A
Method for carrying out gene modification on non-human animal and constructing immunodeficiency animal model
CN113930447A
Preparation method and application of cytokine humanized non-human animal
CN117070522A