Method for constructing FLT3-gene-knockout mouse and method for constructing mouse having humanized immune system

By knocking out the FLT3 gene in mice and injecting the cytokine AAV vector, combined with human hematopoietic stem cells and PBMCs, the problems of low reconstruction efficiency and long time consumption in existing humanized mouse models have been solved, and the efficient construction of humanized mice with CD34-derived immune systems from adults or patients has been achieved.

WO2026002274A1PCT designated stage Publication Date: 2026-01-02HUANG JING
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/105663
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-28
Filing Date
2025-06-30
Publication Date
2026-01-02

AI Technical Summary

Technical Problem

Existing humanized mouse models have problems such as low reconstruction efficiency, long time consumption, and inability to reconstruct a complete human immune system when building the immune system. In particular, the HSC immune transplantation efficiency in the HSC humanized mouse model is low, and the reconstruction efficiency of the PBMC model has limitations such as donor dependence and allogeneic GvHD response.

Method used

By injecting AAV vectors containing cytokine genes into FLT3 gene knockout mice, the FLT3 gene in mice was knocked out using CRISPR/Cas9 gene editing technology. Combined with the injection of human hematopoietic stem cells and PBMCs, the proportion of myeloid cells and T cells was increased, thus establishing humanized mice with CD34-derived immune systems from adults or patients.

Benefits of technology

It significantly improved the reconstruction efficiency of umbilical cord blood HSCs and PBMCs, increased the proportion of myeloid cells and T cells, solved the problem of low immune system reconstruction efficiency, shortened the experimental cycle and reduced costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2025105663-FTAPPB-I100001
    Figure PCTCN2025105663-FTAPPB-I100001
  • Figure PCTCN2025105663-FTAPPB-I100002
    Figure PCTCN2025105663-FTAPPB-I100002
  • Figure PCTCN2025105663-FTAPPB-I100003
    Figure PCTCN2025105663-FTAPPB-I100003
Patent Text Reader

Abstract

Provided in the present invention is an sgRNA targeting the mouse FLT3 gene. Further provided in the present invention is a method for constructing a mouse having a humanized immune system, the method comprising: injecting an AAV vector comprising a cytokine gene into a severely immunodeficient FLT3-gene-knockout mouse; optionally irradiating the FLT3-gene-knockout mouse; and injecting human hematopoietic stem cells into the FLT3-gene-knockout mouse.
Need to check novelty before this filing date? Find Prior Art

Description

Method for constructing FLT3 gene knockout mice and method for constructing immune system humanized mice TECHNICAL FIELD

[0001] The present application belongs to the field of bioengineering technology, and specifically relates to a sgRNA targeting mouse FLT3 gene, a method for knocking out genes in mice, a method for constructing FLT3 gene knockout mice, application of the aforementioned method produced or constructed mice or their offspring, and a method for constructing immune system humanized mice. BACKGROUND

[0002] Humanized mice are genetically modified experimental animal models designed to make their immune systems more similar to the human immune system, thereby providing a more accurate simulation of human immune responses. The purpose of humanized mice is to address the differences between traditional mouse models and the human immune system, in order to better study the efficacy of human immune-related diseases, vaccines and drugs.

[0003] HSC (Hematopoietic Stem Cell, Hematopoietic Stem Cell) transplantation humanized mice are a type of model in which human hematopoietic stem cells are transplanted into mice, making the mice's hematopoietic system derived from humans. This model has important significance for the study of various blood-related diseases, hematopoietic stem cell transplantation and immunology.

[0004] The typical preparation steps of HSC transplantation humanized mice include: (1) Mouse pretreatment: First, the mouse is treated by radiation or chemical drugs to destroy its own immune system, preparing for subsequent transplantation. (2) Hematopoietic stem cell transplantation: Hematopoietic stem cells are obtained from human donors (usually bone marrow, peripheral blood or placental blood, etc.), and then these cells are transplanted into the pretreated mouse through intravenous or other routes. (3) Wait for transplantation: After transplantation, wait for the donor hematopoietic stem cells to colonize and differentiate into various immune cells in the mouse, and reconstitute the human immune system. Using these HSC transplantation humanized mouse models, immunological disease models, drug development, vaccine testing and other research can be conducted. The advantage of this model is that it can more accurately simulate the response of the human immune system in the body, improving the credibility and predictability of the research. Therefore, HSC transplantation humanized mice have become one of the important research tools in the fields of immunology and hematology.

[0005] Although HSC engrafted humanized mice have been widely used, there are several limitations: (1) Not enough single donor HSC humanized mice can be provided. The efficiency of HSC immune transplantation is relatively low, and 100,000 CD34+ cells need to be injected into each mouse. The source of HSC is umbilical cord blood, and the CD34+ cells from one umbilical cord blood are only about 1-2 million cells. Therefore, one umbilical cord blood can only reconstruct about 10 to 20 HSC humanized mice. An experiment often needs 50 to 60 mice. (2) Not a complete immune system can be reconstructed, mostly T cells, B cells and a small amount of myeloid cells, which are less than 5%. In the human body, the proportion of myeloid cells in white blood cells is more than 50%. Some transgenic immunodeficient mice, such as NSG SGM3, MITRG, and NOG EXL, mainly promote the reconstruction of hCD45 by expressing different human cytokines, but the proportion of myeloid cells only increases by about 2 times, which is still lower than the physiological standard. In addition, overexpression of human cytokines can also overactivate the reconstructed human immune system in mice, and the overactivated human immune system can reduce the lifespan of mice. (3) Adult HSC cell-derived human immune system cannot be effectively established in mice, so that PDX research can only be carried out in a heterologous human immune system.

[0006] The human peripheral blood mononuclear cell (PBMC) engrafted humanized mouse model is a modeling method for forming a short-term human immune system by injecting human PBMC into immunodeficient mice to expand human immune cells in mice. PBMC can be directly isolated from donor peripheral blood and contains mature T cells, B cells, NK cells and other immune cell components, without the need for in vitro induction or differentiation process, and the model is simple to construct and is commonly used for drug screening or short-term immune function evaluation. The advantage of this model is that it can be constructed quickly, and human T cells can be detected in peripheral blood within a few days to two weeks after transplantation. It is simple to operate and has low cost. However, it has obvious limitations:

[0007] First, the reconstruction efficiency of the PBMC model has significant donor dependence. The expansion ability of PBMC from different donors in the NOD-scid IL2Rγ knockout background (such as NSG mice) varies greatly. Some donor PBMCs show very low colonization efficiency and expansion ability in mice. This may be related to the residual innate immune system components in mice, especially mouse macrophages, which can affect the survival of human immune cells through phagocytosis.

[0008] Second, this model mainly expands T cells, and the expansion of other types of immune cells such as B cells and NK cells is limited in the traditional background, which can easily lead to an imbalance in immune components. In addition, T cells rapidly expand and can induce heterologous GvHD reactions within 4 to 6 weeks, leading to mouse consumption and death, which severely limits the experimental window.

[0009] Therefore, although the PBMC model is widely used for T cell related function and immune response research, its repeatability, stability and experimental period are still affected by many factors, and it is urgent to improve the model background or optimize the cell input strategy. SUMMARY

[0010] To solve the above problems, the present application greatly improves the reconstruction efficiency of cord blood HSC and PBMC by injecting an AAV vector including a cytokine gene into the FLT3 knockout mouse in vivo, increases the proportion of human myeloid cells after HSC and PBMC reconstruction, and can also establish an effective adult or patient CD34 derived immune system humanized mouse.

[0011] Specifically, the present application relates to the following technical solutions:

[0012] 1. sgRNA targeting any one of the first to the 24th exon of the mouse FLT3 gene.

[0013] 2. The sgRNA according to item 1, which targets the second exon of the mouse FLT3 gene, wherein the sgRNA comprises two of sgRNA1, sgRNA2, sgRNA3 and sgRNA4.

[0014] The sgRNA1 and sgRNA2 are both nucleotide sequences complementary to at least part of the first intron region of the mouse FLT3 gene, and the sgRNA3 and sgRNA4 are both nucleotide sequences complementary to at least part of the second intron region of the mouse FLT3 gene.

[0015] 3. The sgRNA according to item 2, wherein the sequence of the first intron region of the mouse FLT3 gene is as shown in SEQ ID NO: 6, and the sequence of the second intron region of the mouse FLT3 gene is as shown in SEQ ID NO: 7.

[0016] Preferably, the nucleotide sequence of the sgRNA1 is as shown in SEQ ID NO: 8; the nucleotide sequence of the sgRNA2 is as shown in SEQ ID NO: 9; the nucleotide sequence of the sgRNA3 is as shown in SEQ ID NO: 10; and the nucleotide sequence of the sgRNA4 is as shown in SEQ ID NO: 11.

[0017] 4. The sgRNA according to any one of items 1-3, wherein,

[0018] The sgRNA is composed of sgRNA1 and sgRNA3; or

[0019] The sgRNA is composed of sgRNA1 and sgRNA4; or

[0020] The sgRNA is composed of sgRNA2 and sgRNA3; or

[0021] The sgRNA is composed of sgRNA2 and sgRNA4.

[0022] 5. A method for knocking out a gene in a mouse, wherein the method comprises:

[0023] knocking out the FLT3 gene in a mouse using the sgRNA targeting the FLT3 gene in a mouse according to any one of items 1-4.

[0024] 6. The method according to item 5, wherein the technique for knocking out the FLT3 gene in a mouse is a zinc finger nuclease technique, a TALEN gene editing technique or a CRISPR / Cas9 gene editing technique.

[0025] 7. The method according to item 5 or 6, wherein the method comprises the steps of:

[0026] preparing a gene editing solution comprising a Cas9 nuclease and the sgRNA targeting the FLT3 gene in a mouse according to any one of items 1-4;

[0027] delivering the gene editing solution into a mouse zygote to obtain a F0 generation mouse.

[0028] 8. The method according to item 7, wherein the method for delivering the gene editing solution into a mouse zygote is microinjection or electroporation.

[0029] 9. The method according to item 7, wherein the method further comprises:

[0030] breeding the F0 generation mouse with a wild type mouse to obtain a F1 generation mouse.

[0031] 10. A method for constructing a FLT3 gene knockout mouse, wherein the method comprises:

[0032] knocking out the FLT3 gene in a mouse using the sgRNA targeting the FLT3 gene in a mouse according to any one of items 1-4.

[0033] 11. The method according to item 10, wherein the technique for knocking out the FLT3 gene in a mouse is a zinc finger nuclease technique, a TALEN gene editing technique or a CRISPR / Cas9 gene editing technique.

[0034] 12. The method according to item 10 or 11, wherein the method comprises the steps of:

[0035] a gene editing solution comprising a Cas9 nuclease and a sgRNA targeting a mouse FLT3 gene according to any one of items 1 to 4;

[0036] delivering the gene editing solution into a mouse zygote to obtain a F0 generation mouse.

[0037] 13. The method according to item 12, wherein the delivering the gene editing solution into a mouse zygote is microinjection or electroporation.

[0038] 14. The method according to item 12, wherein the method further comprises:

[0039] breeding the F0 generation mouse with a wild type mouse to obtain a F1 generation mouse.

[0040] 15. Use of a mouse produced according to the method of any one of items 5 to 9 or a mouse constructed according to the method of any one of items 10 to 14 or a progeny thereof in preparing an animal model.

[0041] 16. Use of a mouse produced according to the method of any one of items 5 to 9 or a mouse constructed according to the method of any one of items 10 to 14 in a model system for pharmacological, immunological research.

[0042] 17. A method of constructing an immune system humanized mouse, wherein the method comprises:

[0043] injecting an AAV vector comprising a cytokine gene into a FLT3 knockout mouse; optionally irradiating the FLT3 knockout mouse; injecting human hematopoietic stem cells into the FLT3 knockout mouse.

[0044] 18. The method according to item 17, wherein the FLT3 knockout mouse is a mouse produced according to the method of any one of items 5 to 9 or a mouse constructed according to the method of any one of items 10 to 14.

[0045] 19. The method according to item 17 or 18, wherein the AAV vector comprising a cytokine gene is selected from any one or more of the following: an AAV vector comprising a human FLT3LG gene, an AAV vector comprising a human IL15 gene, an AAV vector comprising a human SCF gene, an AAV vector comprising a human IL3 gene, an AAV vector comprising a human GM-CSF gene, and an AAV vector comprising a human IL6 gene.

[0046] 20. The method according to item 19, wherein the AAV vector comprising a cytokine gene is:

[0047] an AAV vector comprising a human IL15 gene; and / or

[0048] an AAV vector comprising a human FLT3LG gene; and / or

[0049] an AAV vector comprising a human SCF gene, an AAV vector comprising a human IL3 gene, an AAV vector comprising a human GM-CSF gene, and an AAV vector comprising a human IL6 gene.

[0050] 21. The method of item 19 or 20, wherein the AAV vectors comprising a cytokine gene are each independently of serotype selected from any one of AAV2, AAV8 and AAV9, preferably of serotype AAV9.

[0051] 22. The method of item 19 or 20, wherein the AAV vectors comprising a cytokine gene are injected into the FLT3 gene knockout mouse by intraperitoneal injection or tail vein injection, more preferably by intraperitoneal injection.

[0052] Preferably, the AAV vector comprising a human IL15 gene is injected into the FLT3 gene knockout mouse in an amount of 1 x 10Λ8 to 1 x 10Λ11 GC per mouse.

[0053] Preferably, the AAV vector comprising a human FLT3LG gene is injected into the FLT3 gene knockout mouse in an amount of 1 x 10Λ8 to 1 x 10Λ10 GC per mouse, preferably 1 x 10Λ8 to 1 x 10Λ9 GC per mouse.

[0054] The AAV vector comprising a human SCF gene, the AAV vector comprising a human IL3 gene, the AAV vector comprising a human GM-CSF gene, and the AAV vector comprising a human IL6 gene are injected into the FLT3 gene knockout mouse in an amount of 1 x 10Λ9 to 1 x 10Λ10 GC per mouse, 5 x 10Λ9 to 5 x 10Λ10 GC per mouse, 1 x 10Λ9 to 1 x 10Λ10 GC per mouse, and 5 x 10Λ9 to 5 x 10Λ10 GC per mouse, respectively.

[0055] 23. The method of item 17 or 18, wherein the AAV vector comprising a cytokine gene further comprises a promoter and a terminator, the promoter being a CAG promoter, an EF1A promoter or a CMV promoter, preferably a CAG promoter or an EF1A promoter.

[0056] Preferably, the sequence of the CAG promoter is as shown in SEQ ID No: 14.

[0057] 24. The method of any one of claims 17 or 18, wherein the FLT3 gene knockout mouse is constructed using a mouse selected from the group consisting of NOD-scid IL2Ry KO mouse, NRG mouse, B6RG mouse and BRG mouse.

[0058] 25. The method of any one of claims 17 or 18, wherein the human hematopoietic stem cells are cord blood CD34 cells, adult CD34 cells; preferably, the adult CD34 cells are bone marrow-derived CD34 cells, G-CSF-mobilized peripheral blood-derived CD34 cells or iPS-derived CD34 cells.

[0059] 26. A method of constructing an immune system humanized mouse, wherein the method comprises:

[0060] injecting human peripheral blood mononuclear cells into the FLT3 gene knockout mouse.

[0061] 27. The method of claim 26, wherein the FLT3 gene knockout mouse is a mouse produced by the method of any one of claims 5-9 or a mouse constructed by the method of any one of claims 10-14.

[0062] 28. The method of claim 26 or 27, wherein the FLT3 gene knockout mouse is constructed using a mouse selected from the group consisting of NOD-scid IL2Ry KO mouse, NRG mouse, B6RG mouse and BRG mouse.

[0063] Effects of the invention

[0064] (1) The present application greatly reduces the level of endogenous immune cells, especially dendritic cells, in mice by injecting FLT3 gene knockout immunodeficient mice with an AAV vector expressing human FLT3LG.

[0065] (2) The knockout of the FLT3 gene partially attenuates the cross-reaction of human FLT3LG on the mouse immune system. Under the treatment of low concentration of AAV vector expressing human FLT3LG, both the expansion of myeloid cells and the proportion of hCD45 cells are effectively promoted.

[0066] (3) Injecting FLT3 gene knockout immunodeficient mice with AAV expressing human FLT3LG, while injecting AAV expressing hSCF, AAV expressing hGM-CSF, AAV expressing hIL6, AAV expressing hIL3, makes the reconstitution efficiency of human immune system reconstituted with cord blood-derived CD34 and adult PBMC-derived CD34 higher, and can greatly improve the proportion of myeloid cells and T cells in human leukocytes (hCD45 cells).

[0067] (4) In the case of the same injection of AAV or combination of AAV, compared with the method of injecting AAV or combination of AAV into ordinary immunodeficient mice (immunodeficient mice without knocking out FLT3 gene), the efficiency of immune system reconstruction can be increased by 2 times, the proportion of myeloid cells in human leukocytes (hCD45 cells) can be increased by about 9 times, and the proportions of NK cells and T cells are significantly increased.

[0068] (5) FLT3 knockout significantly improves the reconstruction efficiency of human immune cells in the peripheral blood of mice.

[0069] (6) Compared with ordinary immunodeficient mice (immunodeficient mice without knocking out FLT3 gene), the efficacy of PD1 antibody is enhanced in FLT3 knockout immunodeficient mice.

[0070] (7) The present application solves the problems of low efficiency, long time consumption and inability to reconstruct a complete human immune system in the current humanized mouse model, and the method of the present application has obvious efficiency advantages, while reducing time and labor costs. BRIEF DESCRIPTION OF DRAWINGS

[0071] Figure 1 is a schematic diagram of FLT3 gene knockout strategy.

[0072] Figures 2A and 2B are PCR and RT-PCR identification results of FLT3 knockout mice, respectively; Figure 2C shows the body weight of 4-week-old FLT3 knockout mice.

[0073] Figures 3A to 3D are flow cytometry analysis results of CD45 cells, CD3 T cells, CD19 B cells and CD56 NK cells, and CD33 cells of mice after injection of AAV hFLT3LG to reconstruct humanized immune system in NV-NSG FLT3KO mice.

[0074] Figure 4A shows the effect of FLT3KO on the expression level of mouse FLT3LG in serum; Figures 4B to 4E show the total number of thigh bone marrow cells, the absolute number of dendritic cells, the proportion of dendritic cells in bone marrow cells, and the proportion of dendritic cells in spleen leukocytes of NOG mice, NKG mice, NV-NSG mice and NV-NSG FLT3KO mice, respectively; Figures 4F to 4I show the effect of FLT3KO on four kinds of natural immune cells (neutrophils, monocytes, macrophages, dendritic cells) in the spleen of four-week-old mice of different genotypes (NV-NSG wild type, NV-NSG FLT3KO heterozygote, NV-NSG FLT3KO pure and mice).

[0075] Figure 5 is a construction map of the AAV vector of the present application.

[0076] Figure 6 shows the hFLT3LG concentration in serum of NV-NSG mice injected with different doses of AAV hFLT3LG after 4 weeks.

[0077] Figure 7A shows the effect of different doses of AAV9 hFLT3LG on the efficiency of human immune system reconstruction in vivo in NV-NSG mice and NV-NSG FLT3KO mice; Figure 7B shows the effect of different doses of AAV9 hFLT3LG on the efficiency of human CD33 myeloid cell reconstruction in vivo in NV-NSG mice and NV-NSG FLT3KO mice.

[0078] Figure 8 shows the effect of injection of AAV9 expressing different cytokines on the efficiency of immune system reconstruction in NV-NSG mice and NV-NSG FLT3KO mice.

[0079] Figures 9A-9E show the development of T cells, B cells, NK cells and myeloid cells in NV-NSG FLT3KO mice injected with AAV9FLT3LG, AAV9Plus4, AAV9FLT3LG+Plus4, respectively.

[0080] Figure 10 shows the effect of injection of AAV9Plus4 on the efficiency of immune system reconstruction in vivo in NV-NSG mice and NV-NSG FLT3KO mice when human immune system reconstruction is performed using cord blood CD34 cells.

[0081] Figure 11 shows the effect of injection of AAV9Plus4 on the efficiency of immune system reconstruction in vivo in NV-NSG mice and NV-NSG FLT3KO mice when human immune system reconstruction is performed using adult CD34 cells.

[0082] Figure 12 shows the effect of injection of AAV9Plus4 on the efficiency of immune system reconstruction in vivo in NV-NSG mice and NV-NSG FLT3KO mice when human immune system reconstruction is performed using iPS-derived CD34 cells.

[0083] Figure 13A shows the efficiency of human immune cell reconstruction in peripheral blood of NV-NSG FLT3KO mice at two and four weeks after PBMC transplantation; Figure 13B shows the weight change curve of NV-NSG FLT3KO mice after PBMC transplantation; Figure 13C shows the survival curve of NV-NSG FLT3KO mice after PBMC transplantation.

[0084] Figure 14A shows the comparison of PBMC reconstruction efficiency in NV-NSG group and NV-NSG FLT3KO group mice at different time points after BPMC transplantation; Figure 14B shows the weight change trend of mice after BPMC transplantation; Figure 14C shows the change of tumor volume of mice after BPMC transplantation.

[0085] Figure 15 is the expression profile of FLT3 in mouse bone marrow progenitor cells.

[0086] Figure 16 shows the reconstitution efficiency of NK cells in peripheral blood at day 7, day 14, day 21 after NK cell transplantation. DETAILED DESCRIPTION

[0087] The present application is further illustrated by the following examples, which are not intended to limit the present application. Unless otherwise defined, all technical and scientific terms used in this description are intended to have the same meaning as commonly understood by one of ordinary skill in the art. Although methods and materials similar or equivalent to those described herein can be used in the practice of the application, the methods and materials are described herein as being most useful in the practice of the application. In case of conflict, the present description, including definitions, will control. In addition, the materials, methods and examples are illustrative only and not intended to be limiting.

[0088] DEFINITIONS

[0089] The terms "polynucleotide," "nucleotide," "nucleotide sequence," "nucleic acid," and "oligonucleotide" are used interchangeably herein. They refer to polymeric forms of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or their analogs. Examples of polynucleotides include, but are not limited to, coding or non-coding regions of a gene or gene fragment, exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, vectors, isolated DNA, isolated RNA, nucleic acid probes, and primers. One or more nucleotides of a polynucleotide can be modified. The sequence of nucleotides can be interrupted by non-nucleotide components. A polynucleotide can be further modified, e.g., by conjugation to a labeling agent.

[0090] The term "CRISPR / Cas9" as used herein refers to an adaptive immune defense that bacteria and archaea have developed over long periods of evolution to combat invading viruses and foreign DNA. CRISPR / Cas9 gene editing technology is a technology that can be used to make specific DNA modifications to targeted genes. CRISPR / Cas9-based gene editing technology has shown great application prospects in a series of gene therapy application fields, such as blood diseases, tumors and other genetic diseases. The technology has been applied to precise modification of genomes of human cells, zebrafish, mice and bacteria.

[0091] The term "sgRNA" as used herein generally refers to a single-molecule guide RNA or single-chain guide RNA in the artificial CRISPR / Cas9 system, which is an RNA that guides the Cas9 protein to specifically bind to a target DNA sequence, and is an important component in the CRISPR gene knockout / knockin system. The sgRNA of the present application comprises a guide sequence targeting a target sequence.

[0092] The term "gene knockout" or "knockout" as used herein refers to editing (e.g., modifying such as inserting, replacing, and / or deleting, etc.) a gene in a cell so that the gene loses its original function (e.g., cannot express a functional protein). Various known molecular biology techniques (e.g., using zinc finger nuclease-based gene editing technology, TALEN gene editing technology, and CRISPR / Cas (e.g., CRISPR / Cas9) gene editing technology) can be used to edit a gene in the genome of a cell. Gene knockout is not limited to complete deletion or removal of an entire gene, but only needs to make the gene lose its original function. For example, knockout of a gene can be achieved by inserting an exogenous DNA fragment into the gene so that the gene cannot express a functional protein, or by inserting or deleting one or several bases in the gene so that the gene is subjected to a frameshift mutation. For example, the gene knockout herein can use CRISPR / Cas9 gene editing technology.

[0093] The term "CRISPR / Cas9" as used herein is an adaptive immune defense formed by bacteria and archaea during long-term evolution, which can be used to combat invading viruses and foreign DNA. CRISPR / Cas9 gene editing technology is a technology for specific DNA modification of a targeted gene. CRISPR / Cas9-based gene editing technology has shown great application prospects in a series of gene therapy application fields, such as blood diseases, tumors, and other genetic diseases. The technology has been applied to precise modification of the genomes of human cells, zebrafish, mice, and bacteria.

[0094] The term "zinc finger nuclease technology" (zinc Finger uclease, ZFNs) as used herein is a genetic engineering technology for site-specific editing and modification of the genome. It uses a special protein, zinc finger protein (zFP), and combines with a nuclease to form a complex to achieve cutting or modification of a specific DNA sequence. Zinc finger protein is a class of proteins with DNA binding ability, which contains a domain that binds zinc ions in its structure, called zinc finger. Each zinc finger can recognize and bind to 3 to 4 adjacent nucleotide base sequences. By combining different zinc fingers, zinc finger proteins that can specifically bind to target DNA sequences can be designed as needed.

[0095] The term "TALEN gene editing technology" as used herein is an advanced genome editing technology, the full name of which is TranSCriPtion Activator Like Efector Nucleases. TALEN gene editing technology uses a natural protein secreted by plant bacteria, TAL effector, to recognize and bind to specific DNA base pairs. By combining TAL effector with nucleases, this technology can achieve targeted cleavage of specific DNA sequences, thereby achieving the purpose of genome editing.

[0096] The term "vector" as used herein refers to a nucleic acid vehicle into which a polynucleotide can be inserted. When a vector is capable of effecting expression of an inserted polynucleotide encoded protein, the vector is referred to as an expression vector. A vector can be introduced into a host cell by transformation, transduction or transfection, so that the genetic material elements carried by the vector can be expressed in the host cell. Vectors are well known to those skilled in the art and include, but are not limited to, plasmids; phagemids; artificial chromosomes, such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC) or P1-derived artificial chromosomes (PAC); bacteriophages such as lambda phage or M13 phage, and animal viruses, etc. Animal viruses that can be used as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpes viruses (such as herpes simplex viruses), pox viruses, baculoviruses, papillomaviruses, papovaviruses (such as SV40). A vector can contain multiple elements for controlling expression, including but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements and reporter genes. In addition, a vector can also contain a replication initiation site.

[0097] The term "microinjection" as used herein refers to the injection of a substance into an organ, tissue, cell or intracellular organelle of an organism. The above-mentioned substance can include chemicals, polynucleotides or polypeptides.

[0098] The term "electroporation" as used herein, also known as electroporation or electroporation, refers to the transient increase in cell membrane permeability by the action of a high-intensity electric field, thereby absorbing exogenous molecules in the surrounding medium. This technology can introduce nucleotides, DNA and RNA, proteins, sugars, dyes and viral particles into prokaryotic and eukaryotic cells.

[0099] The term "AAV (Adeno-Associated Virus)" as used herein is a non-pathogenic virus, often used as a gene delivery vector, widely used in the field of gene therapy and gene editing. Its structural characteristics is that AAV is a single-stranded DNA virus, its genome contains about 4.7 kb of DNA sequence. The genome of AAV is divided into two oppositely oriented open reading frames (ORF): rep and cap. rep encodes replication-related proteins, and cap encodes the capsid protein that packages the virus. There are two oppositely oriented short sequences in the genome of AAV, called ITR (Inverted Terminal Repeats), which play an important role in virus replication and packaging. Compared with other commonly used viral vectors such as lentivirus (Lentivirus), adenovirus (Adenovirus) and retrovirus (Retrovirus), AAV virus has low immunogenicity and long duration in vivo, and is used as a gene therapy drug in clinic. There are several articles using AAV-expressed cytokines to assist immune system reconstruction. However, there is no detailed comparison of different AAV serotypes, injection methods and expression elements of AAV gene vectors on expression level and persistence in severe immunodeficient mice.

[0100] FMS-like tyrosine kinase 3 (FLT3) is a receptor tyrosine kinase that plays a key role in cell growth, differentiation and proliferation. FLT3 is usually expressed on precursor cells of hematopoietic cell series, including stem cells and early progenitor cells in bone marrow. Activation of FLT3 triggers a series of signaling pathways, promoting cell proliferation and survival, thus playing an important regulatory role in normal hematopoiesis. In studies, it was found that FLT3 is also associated with leukemia. FLT3 gene mutation or overexpression is closely related to the occurrence and progression of acute myeloid leukemia (AML). Since FLT3 activation can lead to abnormal cell proliferation, FLT3 has become an important therapeutic target in leukemia treatment.

[0101] FLT3LG (FMS-Like Tyrosine Kinase 3 Ligand) is a ligand for FLT3 receptor. It is a cytokine that activates the FLT3 receptor by binding to it. FLT3LG can promote the proliferation and differentiation of hematopoietic cells by binding to FLT3. In addition, FLT3LG can also affect the development of other hematopoietic cells, such as lymphocytes. In studies, FLT3LG has also been found to enhance immune response. By promoting the proliferation and differentiation of hematopoietic stem cells, FLT3LG is considered to be essential for the normal function of the immune system. Therefore, it has also been studied as a potential immunotherapy drug for enhancing immune response, such as in tumor treatment. In general, FLT3 and FLT3LG play an important role in cell signaling and immune regulation, and are essential for normal hematopoiesis and immune function, and are also important therapeutic targets in the study of diseases such as leukemia. The sequence of the human FLT3LG cDNA encoding human FLT3LG involved in this application is shown in SEQ ID No: 1.

[0102] SEQ ID No: 1

[0103] Stem cell factor (SCF) is also known as mast cell growth factor (IGF), Kit ligand (KL) and Steel factor (SLF). It is an acidic glycoprotein produced by stromal cells in the bone marrow microenvironment. Its sugar group is connected to the N and O groups of the peptide bond, with a relative molecular mass of 31000-36000, composed of two identical subunits combined by non-covalent bonds. SCF is a factor that acts through the tyrosine receptor c-Kit anchored and expressed on the surface of all HSCs, and c-Kit expression defects will lead to a decrease in the number of HSC expansion. Currently, almost all cytokine combinations used in HSC culture experiments contain SCF. In addition, SCF belongs to the tyrosine kinase receptor TKR family as FLT3, has a synergistic effect on expanding primitive hematopoietic cells, transmits signals to the cell interior by binding to specific TKRs, initiates the division and proliferation of early progenitor cells, makes cells out of G0 phase to start expansion, and inhibits apoptosis. The sequence of the human SCF cDNA encoding human SCF involved in this application is shown in SEQ ID No: 2.

[0104] SEQ ID No: 2

[0105] Interleukin 3 (IL3), also known as Multi-CSF, is mainly produced by activated CD4+ T cells. Its main function is to promote the directional differentiation and proliferation of pluripotent hematopoietic stem cells in bone marrow, producing various types of blood cells. It is produced by T lymphocytes and can stimulate the proliferation, differentiation and improve the function of cells involved in immune response. IL3 has a molecular weight of about 15 kD, and its chemical nature is glycoprotein. The sequence of human IL3 cDNA encoding human interleukin-3 (human IL3) involved in the present application is shown in SEQ ID No: 3.

[0106] SEQ ID No: 3

[0107] Granulocyte-macrophage colony-stimulating factor (GM-CSF), also known as colony-stimulating factor 2 (CSF2), is a monomeric glycoprotein mainly produced by T cells and macrophages, which can induce colony growth of granulocyte precursors and macrophage precursor cells, so it is simply called granulocyte-macrophage colony-stimulating factor. GM-CSF has strict species specificity, and its main biological function in vivo is to maintain the survival, promote the growth, induce the differentiation and enhance the phagocytic function and bactericidal effect of granulocyte and monocyte lineage cells; induce dendritic cell maturation and functional distribution. The sequence of human GM-CSF cDNA encoding human thrombopoietin (human GM-CSF) involved in the present application is shown in SEQ ID No: 4.

[0108] SEQ ID No: 4

[0109] The target cells of interleukin 6 (IL6) are many, including macrophages, hepatocytes, resting T cells, activated B cells and plasma cells, etc.; its biological effects are also very complex, and it was once called B cell stimulating factor 2 (bsf-2), 26kD protein, B cell differentiation factor (bCDf), hepatocyte stimulating factor (hsf), etc. IL6 cannot stimulate the secretion of other cytokines by the corresponding cells, and its autocrine effect on immune cells is also relatively weak at physiological concentrations, suggesting that its main immunological function is to enhance the effects of other cytokines. IL6 can be synthesized by a variety of cells, including activated T cells and B cells, monocyte-macrophages, endothelial cells, epithelial cells, and fibroblasts, etc. The human IL6 gene is located on chromosome 7; the molecular weight of IL6 is between 21-30KD, which is due to the difference in glycosylation and phosphorylation of the peptide chain. IL6 is composed of 2 glycoprotein chains; one is the α chain with a molecular weight of 80KD; the other is the β chain with a molecular weight of 130KD. The α chain lacks the intracellular region and can only bind to IL6 with low affinity, and the complex formed is immediately combined with the high-affinity β chain to transmit information to the cell through the β chain. The sequence of the human IL6 cDNA encoding human interleukin-6 (human IL6) involved in the present application is shown in SEQ ID No: 5.

[0110] SEQ ID No: 5

[0111] Interleukin 15 (IL15) can be produced by a variety of cells such as activated monocyte-macrophages, epidermal cells and fibroblasts, etc. IL15 has many similarities in molecular structure with IL2, so it can use the β chain and γ chain of the IL2 receptor to bind to target cells and exert similar biological activities to IL2. IL15 can induce B cell proliferation and differentiation, and is the only cytokine that can partially replace IL2 to induce early antibody production; IL15 can stimulate T cell and NK cell proliferation, induce LAK cell activity, and also can synergistically stimulate NK cells to produce IFN-γ with IL12. The sequence of the human IL15 cDNA encoding human interleukin-15 (human IL15) involved in the present application is shown in SEQ ID No: 18 or SEQ ID No: 19.

[0112] SEQ ID No: 18

[0113] SEQ ID No: 19

[0114] The term "promoter" as used herein includes a DNA sequence that is operably linked to a nucleic acid sequence to be transcribed, such as a nucleic acid sequence encoding a desired molecule. The promoter is generally located upstream from the nucleic acid sequence to be transcribed and provides a site for specific binding of RNA polymerase and other transcription factors. In particular embodiments, the promoter is generally located upstream from the nucleic acid sequence to be transcribed to generate a desired molecule and provides a site for specific binding of RNA polymerase and other transcription factors.

[0115] The term "terminator" as used herein is a DNA sequence that confers a signal for termination of RNA polymerase transcription, a structure of a few hundred bases in length located downstream from a poly(A) site. Terminators can be divided into two classes: one class is able to effect termination independent of protein cofactors, and the other class is dependent on protein cofactors to effect termination. Such protein cofactors are referred to as termination factors, often also referred to as rho factors. The basic structural unit of a terminator is a stretch of bases with a stretch of non-repeating bases separating two repeats of a palindromic sequence of 7-20 bp each, located just before the point of transcription termination. The axis of symmetry of the palindromic sequence is generally 16-24 bp from the point of transcription termination. Different terminators vary in their ability to stop transcription, with some terminators almost completely stopping transcription and some only partially stopping transcription, with a portion of RNA polymerase able to continue along the DNA and transcribe.

[0116] The term "immunodeficient" as used herein means that the non-human animal is deficient in one or more aspects of its native immune system, e.g., the animal is deficient in one or more types of functional host immune cells, e.g., deficient in non-human B cell number and / or function, non-human T cell number and / or function, non-human NK cell number and / or function, etc.

[0117] The term "immunodeficient mouse" as used herein refers to a mouse that is deficient in one or more components of the immune system due to a congenital genetic mutation or artificially caused, and common mutant genotypes are SCID mutation, Ragl knock-out, Rag2 knock-out, etc., and the main phenotype is the lack of T cells and B cells. The main phenotype of severe immunodeficient mice is the lack of T cells, B cells, NK cell function, and the number of macrophages and dendritic cells is also greatly reduced.

[0118] The term "immunodeficient mouse" as used herein refers to a mouse that is deficient in one or more components of the immune system due to a congenital genetic mutation or artificially caused, and common mutant genotypes are SCID mutation, Ragl knock-out, Rag2 knock-out, etc., and the main phenotype is the lack of T cells and B cells. The main phenotype of severe immunodeficient mice is the lack of T cells, B cells, NK cell function, and the number of macrophages and dendritic cells is also greatly reduced.

[0119] As used herein, the term "serotype" refers to a specific, different subspecies within a virus. These microorganisms are generally classified by the presence of antibodies in the cell surface layer. However, there can be branches and differences within the same class of microorganisms. In microbiology, different types of the same class of microorganism can be identified and are often detected serologically, and are referred to as serotypes. Serotypes of viruses can be used as antigens to bind to corresponding antibodies to form an immune complex that can resist a particular virus from the outside world, and can also be used as serum to identify whether a person has the corresponding virus-related diseases, etc.

[0120] As used herein, the term "promoter" includes a DNA sequence operably linked to a nucleic acid sequence to be transcribed, such as a nucleic acid sequence encoding a desired molecule. The promoter is generally located upstream of the nucleic acid sequence to be transcribed and provides a site for specific binding of RNA polymerase and other transcription factors. In particular embodiments, the promoter is generally located upstream of the transcribed nucleic acid sequence to generate a desired molecule and provides a site for specific binding of RNA polymerase and other transcription factors.

[0121] In order to improve the efficiency of immune system reconstruction and the proportion of human myeloid cells after reconstruction, in the first aspect, the present application provides a sgRNA targeting any one of the 1st to 24th exon of mouse FLT3 gene. In some embodiments, the sgRNA is a sgRNA targeting the 1st exon of mouse FLT3 gene. In some embodiments, the sgRNA is a sgRNA targeting the 2nd exon of mouse FLT3 gene. In some embodiments, the sgRNA is a sgRNA targeting the 3rd exon of mouse FLT3 gene. In some embodiments, the sgRNA is a sgRNA targeting the 4th exon of mouse FLT3 gene. In some embodiments, the sgRNA is a sgRNA targeting the 5th exon of mouse FLT3 gene. In some embodiments, the sgRNA is a sgRNA targeting the 6th exon of mouse FLT3 gene. In some embodiments, the sgRNA is a sgRNA targeting the 7th exon of mouse FLT3 gene. In some embodiments, the sgRNA is a sgRNA targeting the 8th exon of mouse FLT3 gene. In some embodiments, the sgRNA is a sgRNA targeting the 9th exon of mouse FLT3 gene. In some embodiments, the sgRNA is a sgRNA targeting the 10th exon of mouse FLT3 gene. In some embodiments, the sgRNA is a sgRNA targeting the 11th exon of mouse FLT3 gene. In some embodiments, the sgRNA is a sgRNA targeting the 12th exon of mouse FLT3 gene. In some embodiments, the sgRNA is a sgRNA targeting the 13th exon of mouse FLT3 gene. In some embodiments, the sgRNA is a sgRNA targeting the 14th exon of mouse FLT3 gene. In some embodiments, the sgRNA is a sgRNA targeting the 15th exon of mouse FLT3 gene. In some embodiments, the sgRNA is a sgRNA targeting the 16th exon of mouse FLT3 gene. In some embodiments, the sgRNA is a sgRNA targeting the 17th exon of mouse FLT3 gene. In some embodiments, the sgRNA is a sgRNA targeting the 18th exon of mouse FLT3 gene. In some embodiments, the sgRNA is a sgRNA targeting the 19th exon of mouse FLT3 gene. In some embodiments, the sgRNA is a sgRNA targeting the 20th exon of mouse FLT3 gene. In some embodiments, the sgRNA is a sgRNA targeting the 21st exon of mouse FLT3 gene. In some embodiments, the sgRNA is a sgRNA targeting the 22nd exon of mouse FLT3 gene.In some embodiments, the sgRNA is a sgRNA targeting the 23rd exon of the mouse FLT3 gene. In some embodiments, the sgRNA is a sgRNA targeting the 24th exon of the mouse FLT3 gene.

[0122] In some embodiments, the sgRNA is a sgRNA targeting the 2nd exon of the mouse FLT3 gene, wherein the sgRNA comprises two of sgRNA1, sgRNA2, sgRNA3 and sgRNA4; the sgRNA1 and sgRNA2 are both nucleotide sequences complementary to at least a part of the first intron region of the mouse FLT3 gene, and the sgRNA3 and sgRNA4 are both nucleotide sequences complementary to at least a part of the second intron region of the mouse FLT3 gene.

[0123] In some embodiments, the sequence of the first intron region of the mouse FLT3 gene is as set forth in SEQ ID NO: 6 (cttgcttctcatggctacagctagctccatgggatgccctgctgtcattcagagctacaacagctttcatgaaactttccttcctgtactcgcttctgactattcgtcccgtgtgccccccccccccccccccccccttttctttcgttctcttgttctgtggtaagacatatgctgatt), and the sequence of the second intron region of the mouse FLT3 gene is as set forth in SEQ ID NO: 7 (cctgccatggctaagtgggcacttctatcccttttctgttccaaacactatactgccagcttccttgctaccatgacatcaaccacttcccggagggtgagaggccatggattgaactccagcactgagggttagtctgagccatcatgtcagtgctgggaattgaacctgggtcctctg).

[0124] In some embodiments, the nucleotide sequence of the sgRNA1 is as set forth in SEQ ID NO: 8 (gaatagtcagaagcgagtacagg); the nucleotide sequence of the sgRNA2 is as set forth in SEQ ID NO: 9 (atggctacagctagctccatggg); the nucleotide sequence of the sgRNA3 is as set forth in SEQ ID NO: 10 (gacatcaaccacttcccggaggg); and the nucleotide sequence of the sgRNA4 is as set forth in SEQ ID NO: 11 (tgacatcaaccacttcccggagg).

[0125] In some embodiments, the sgRNA consists of the sgRNA1 and the sgRNA3; or the sgRNA consists of the sgRNA1 and the sgRNA4; or the sgRNA consists of the sgRNA2 and the sgRNA3; or the sgRNA consists of the sgRNA2 and the sgRNA4.

[0126] Since the FLT3LG and FLT3 pathway are cross-reactive between human and mouse, in a second aspect, the present application provides a method for knocking out a mouse gene, wherein the method comprises: using the sgRNA targeting the mouse FLT3 gene as described above to knock out the FLT3 gene of the mouse.

[0127] Those skilled in the art can understand that, after the efficient gene editing region is known, those skilled in the art can use any gene editing method, such as zinc finger nuclease-based gene editing technology, TALEN gene editing technology and CRISPR / Cas (such as CRISPR / Cas9) gene editing technology, and other gene editing methods discovered in the future, to edit the known efficient gene editing region, optimize the gene editing conditions, and achieve the purpose of efficient editing. Therefore, the present application covers the technical solutions of the FLT3 gene of the mouse identified in the present application by any available gene editing method.

[0128] In some embodiments, the FLT3 gene of the mouse is knocked out by CRISPR / Cas9 technology, wherein the sgRNA used in the CRISPR / Cas9 technology is the sgRNA targeting the FLT3 gene of the mouse as described in the first aspect. Knocking out the second exon region of the FLT3 gene causes a reading frame shift mutation, which causes the translation to terminate prematurely, thereby causing protein mutation, so the FLT3 gene is knocked out by selecting the second exon region of the FLT3 gene.

[0129] In some embodiments, the step of genetically knocking out the mouse comprises the steps of: preparing a gene editing solution comprising a Cas9 nuclease and sgRNAs for targeting the FLT3 gene of the mouse; delivering the gene editing solution into the fertilized egg of the mouse to obtain F0 generation mice.

[0130] The Cas9 nuclease can be a commercially available Cas9 nuclease, and a person skilled in the art can select a suitable Cas9 nuclease according to the actual operation needs. The gene editing injection solution can be prepared by various known methods in the art.

[0131] In some embodiments, the sgRNA editing solution is composed of sgRNA1 editing solution and sgRNA3 editing solution. In some embodiments, the preparation of the sgRNA editing solution comprises the steps of: synthesizing sgRNA1 and sgRNA3 respectively to obtain sgRNA1 editing solution and sgRNA3 editing solution; mixing the sgRNA1 editing solution and the sgRNA3 editing solution to obtain the sgRNA editing solution.

[0132] In some embodiments, the sgRNA editing solution is composed of sgRNA1 editing solution and sgRNA4 editing solution. In some embodiments, the preparation of the sgRNA editing solution comprises the steps of: synthesizing sgRNA1 and sgRNA4 respectively to obtain sgRNA1 editing solution and sgRNA4 editing solution; mixing the sgRNA1 editing solution and the sgRNA4 editing solution to obtain the sgRNA editing solution.

[0133] In some embodiments, the sgRNA editing solution is composed of sgRNA2 editing solution and sgRNA3 editing solution. In some embodiments, the preparation of the sgRNA editing solution comprises the steps of: synthesizing sgRNA2 and sgRNA3 respectively to obtain sgRNA2 editing solution and sgRNA3 editing solution; mixing the sgRNA2 editing solution and the sgRNA3 editing solution to obtain the sgRNA editing solution.

[0134] In some embodiments, the sgRNA editing solution is composed of sgRNA2 editing solution and sgRNA4 editing solution. In some embodiments, the preparation of the sgRNA editing solution comprises the steps of: synthesizing sgRNA2 and sgRNA4 respectively to obtain sgRNA2 editing solution and sgRNA4 editing solution; mixing the sgRNA2 editing solution and the sgRNA4 editing solution to obtain the sgRNA editing solution.

[0135] In some embodiments, the method of delivering the gene editing editing fluid to the zygote is microinjection and electroporation. The specific operation of microinjection and electroporation is the operation method known in the art. For the obtained F0 generation mice, since the early cleavage speed of the zygote is very fast, the obtained F0 generation mice are chimeras, and do not necessarily have the ability to stably inherit, and need to be passaged to obtain F1 generation mice that can stably inherit, so the method of the present application can further comprise: breeding the F0 generation mice with wild type mice to obtain F1 generation mice, thereby obtaining FLT3 gene knockout mice.

[0136] In some embodiments, the method of knocking out the gene of the mouse comprises the following steps: synthesizing sgRNA; preparing sgRNA editing fluid; delivering the gene editing fluid into the zygote of the mouse by microinjection to obtain F0 generation mice, and identifying the genotype of the obtained F0 generation mice by PCR and sequencing; breeding the F0 generation mice with wild type mice to obtain F1 generation mice; identifying the genotype of the obtained F1 generation mice by PCR and sequencing to obtain FLT3 gene knockout mice.

[0137] In a third aspect, the present application also provides a method for constructing FLT3 gene knockout mice, wherein the method comprises: knocking out the FLT3 gene of the mouse by using the sgRNA targeting the FLT3 gene of the mouse described above.

[0138] In some embodiments, the FLT3 gene of the mouse is knocked out by CRISPR / Cas9 technology, wherein the sgRNA used in the CRISPR / Cas9 technology is the sgRNA targeting the FLT3 gene of the mouse described in the first aspect above.

[0139] In some embodiments, the method for constructing FLT3 gene knockout mice comprises the following steps: preparing a gene editing fluid comprising a Cas9 nuclease and sgRNA for targeting the FLT3 gene of the mouse; delivering the gene editing fluid into the zygote of the mouse to obtain F0 generation mice.

[0140] In some embodiments, the sgRNA editing fluid is composed of sgRNA1 editing fluid and sgRNA3 editing fluid. In some embodiments, the preparation of the sgRNA editing fluid comprises the following steps: synthesizing sgRNA1 and sgRNA3 respectively to obtain sgRNA1 editing fluid and sgRNA3 editing fluid; mixing the sgRNA1 editing fluid and the sgRNA3 editing fluid to obtain the sgRNA editing fluid.

[0141] In some embodiments, the sgRNA editing solution is composed of sgRNA1 editing solution and sgRNA4 editing solution. In some embodiments, the preparation of the sgRNA editing solution comprises the following steps: synthesizing sgRNA1 and sgRNA4 respectively, obtaining sgRNA1 editing solution and sgRNA4 editing solution; mixing sgRNA1 editing solution and sgRNA4 editing solution to obtain sgRNA editing solution.

[0142] In some embodiments, the sgRNA editing solution is composed of sgRNA2 editing solution and sgRNA3 editing solution. In some embodiments, the preparation of the sgRNA editing solution comprises the following steps: synthesizing sgRNA2 and sgRNA3 respectively, obtaining sgRNA2 editing solution and sgRNA3 editing solution; mixing sgRNA2 editing solution and sgRNA3 editing solution to obtain sgRNA editing solution.

[0143] In some embodiments, the sgRNA editing solution is composed of sgRNA2 editing solution and sgRNA4 editing solution. In some embodiments, the preparation of the sgRNA editing solution comprises the following steps: synthesizing sgRNA2 and sgRNA4 respectively, obtaining sgRNA2 editing solution and sgRNA4 editing solution; mixing sgRNA2 editing solution and sgRNA4 editing solution to obtain sgRNA editing solution.

[0144] In some embodiments, the method for delivering the fertilized egg by the gene editing editing solution is microinjection and electroporation. The specific operation of microinjection and electroporation is the operation method known in the art. For the obtained F0 generation mice, since the early cleavage speed of the fertilized egg is very fast, the obtained F0 generation mice are chimeras and do not necessarily have the ability of stable inheritance, and need to be passaged to obtain F1 generation mice which can be stably inherited, therefore the method of the present application can further comprise: breeding the F0 generation mice with wild type mice to obtain F1 generation mice, mating the F1 generation mice with severe immunodeficiency mice for two generations to F3 generation, and then mating the F3 generation hybrid mice to obtain F4 generation mice, that is, FLT3 gene knockout mice are obtained.

[0145] In some embodiments, the method of constructing FLT3 gene knockout mice comprises the following steps: synthesizing sgRNA; preparing sgRNA editing solution; delivering the gene editing solution into the mouse zygote by microinjection to obtain F0 generation mice, and identifying the genotype of the obtained F0 generation mice by PCR and sequencing; breeding the F0 generation mice with wild type mice to obtain F1 generation mice; identifying the genotype of the obtained F1 generation mice by PCR and sequencing, mating the F1 generation FLT3 KO heterozygous mice with severe immunodeficient mice for two generations to F3 generation, diluting non-specific mutations, and then mating the F3 generation FLT3 KO heterozygous mice to obtain F4 generation FLT3 KO pure mice, and identifying the pure NV-NSG FLT3 KO mice by PCR to obtain FLT3 gene knockout mice.

[0146] The immune system of the FLT3 gene knockout (FLT3KO) mice constructed in the present application lacks macrophages and dendritic cells (DCs) compared to NSG mice and NSG W41 mice, and these cells play an important role in immune response. The reduction of immune cells enables the reconstruction of exogenous cells (such as PBMC) with higher efficiency and less background interference of immune response. Unlike NSG W41 mice, FLT3KO mice have higher reconstruction efficiency when performing immune cell reconstruction, especially for human myeloid cells (such as monocytes and T cells). Although NSG W41 mice also remove part of the activity of bone marrow cells, their immune deficiency characteristics have different effects on the reconstruction of human cells. The FLT3KO mice constructed in the present application have a more suitable immune environment, which is suitable for more efficient reconstruction, especially in the reconstruction of adult-derived CD34+ cells or iPS-CD34 cells.

[0147] In a fourth aspect, the present application provides a use of the mouse produced by the method of the second aspect or the mouse constructed by the method of the third aspect or its offspring in preparing an animal model.

[0148] In a fifth aspect, the present application provides a use of the mouse produced by the method of the second aspect or the mouse constructed by the method of the third aspect in a model system for pharmacological and immunological research.

[0149] In a sixth aspect, the present application provides a method of constructing an immune system humanized mouse, wherein the method comprises:

[0150] injecting an AAV vector comprising a cytokine gene into the FLT3 gene knockout mouse; optionally irradiating the FLT3 gene knockout mouse; and injecting human hematopoietic stem cells into the FLT3 gene knockout mouse.

[0151] In some embodiments, the irradiation dose is 80-200 cGy, for example, can be 80 cGy, 90 cGy, 100 cGy, 110 cGy, 120 cGy, 130 cGy, 140 cGy, 150 cGy, 160 cGy, 170 cGy, 180 cGy, 190 cGy, 200 cGy, etc.

[0152] In some embodiments, the AAV vector comprising a cytokine gene is selected from any one or more of the following: an AAV vector comprising a human FLT3LG gene, an AAV vector comprising a human IL15 gene, an AAV vector comprising a human SCF gene, an AAV vector comprising a human IL3 gene, an AAV vector comprising a human GM-CSF gene, and an AAV vector comprising a human IL6 gene.

[0153] In some embodiments, the AAV vector comprising a cytokine gene is an AAV vector comprising a human FLT3LG gene, and the method comprises the step of irradiating the FLT3 gene knockout mouse. When the human immune system is reconstituted in the FLT3 gene knockout mouse, injection of the AAV vector comprising a human FLT3LG gene can greatly increase the proportion of hCD33 in hCD45 cells in the myeloid cells.

[0154] In some embodiments, the method comprises: injecting an AAV vector comprising a human IL15 gene into a FLT3 gene knockout mouse; optionally irradiating the FLT3 gene knockout mouse; and injecting human hematopoietic stem cells into the FLT3 gene knockout mouse.

[0155] The AAV vector comprising a cytokine gene is an AAV vector comprising a human SCF gene, an AAV vector comprising a human IL3 gene, an AAV vector comprising a human GM-CSF gene, and an AAV vector comprising a human IL6 gene; and the method comprises the step of irradiating the FLT3 gene knockout mouse. When the human immune system is reconstituted in the FLT3 gene knockout mouse, injection of a combination of the above four AAV vectors can effectively increase the proportion of hCD45 in total CD45 cells.

[0156] In some embodiments, the AAV vector comprising a cytokine gene is: an AAV vector comprising a human FLT3LG gene, an AAV vector comprising a human SCF gene, an AAV vector comprising a human IL3 gene, an AAV vector comprising a human GM-CSF gene, and an AAV vector comprising a human IL6 gene; the method comprises a step of irradiating the FLT3 gene knockout mouse. When the human immune system is reconstructed in the FLT3 gene knockout mouse, the injection of the AAV vector comprising the human FLT3LG gene at the same time as the injection of the other four AAV vectors can simultaneously increase the proportion of hCD33 myeloid cells to hCD45 cells, and the proportion of hCD45 cells to total CD45 cells.

[0157] In some embodiments, the FLT3 gene knockout mouse is a mouse produced by the method of the aforementioned second aspect or a mouse constructed by the method of the aforementioned third aspect, and the FLT3 gene knockout mouse is a severe immunodeficient mouse lacking T cells, B cells, and NK cells constructed by further knocking out the IL2 receptor gamma chain on the basis of knocking out the recombination activating gene 1 (Ragl) or knocking out the recombination activating gene 2 (Rag2) or SCID mutation. Preferably, the FLT3 gene knockout mouse is constructed by using a mouse selected from one of NOD-scid IL2RyKO mice, NRG mice, B6RG mice, and BRG mice.

[0158] In some embodiments, the NOD-scid IL2RyKO mouse is a NOG mouse or a NSG mouse; further preferably, the NOG mouse is a NOG-A2 mouse, a NOG-DR4 mouse, a NOG-B2M null IA null mouse, a NOG-IL2 mouse, a NOG-IL4 mouse, a NOG-IL6 mouse, a NOG-IL15 mouse, a NOG-EXL NSG mouse, or a NOG-GCSF NSG mouse; the NSG mouse is a NSG-A2 / B2M mouse, a NSG-KitW41 mouse, a NSG-DR1 mouse, a NSG-DR4 mouse, a NSG-DQ8 mouse, a NSG-B2M null IA / IE null mouse, a NSG-W41 mouse, a NBSWG mouse, a NSG-W41-IL7 mouse, a NSG-IL15 mouse, a NSG-IL7-IL15 mouse, a NSG-SGM3 mouse, or a NSG-Quad mouse.

[0159] In some embodiments, the NRG mouse is a NRG-A2 / DR4 mouse, a NRG-W41 mouse, a NRG-F mouse, or a NRG-SGM3 mouse;

[0160] In some embodiments, the B6RG mouse is a B6RG-CD47 mouse, a B6RGS NOD mouse, a B6RGS NOD mouse, a B6RGS mouse, or a HUMAMICE mouse.

[0161] In some embodiments, the BRG mouse is a BRGS mouse or a SRG mouse; further preferably, the BRGS mouse is a BRGS-A2 / DR2 mouse, a BRGS-F mouse, a BRGS-F-A2 mouse, or a BRGS-T mouse; and the SRG mouse is a SRG-6 mouse, a SRG-15 mouse, a MISTRG mouse, a MISTRG-GR mouse, a MISTRG-6 mouse, or a MISTRG-6-15 mouse.

[0162] In some embodiments, the injection amount of each AAV vector depends on the expression level of each cytokine, which is generally between 1-1000 pg / ml, preferably around 100 pg / ml. Only when the expression level is within the above range, the immune system cannot be excessively activated. Below this expression level, sometimes the expression cannot be detected or the detection result is not accurate.

[0163] In some embodiments, the injection amount of the AAV vector comprising the human IL15 gene into the FLT3 gene knockout mouse is 1x10^8-1x10^11 GC per mouse, preferably 1x10^9-1x10^10.

[0164] In some embodiments, the injection amount of the AAV vector comprising the human FLT3LG gene into the FLT3 gene knockout mouse is 1x10^8-1x10^10 GC per mouse, preferably 1x10^8-1x10^9. A low dose of AAV FLT3LG can increase the proportion of hCD33 myeloid cells without inhibiting the proportion of hCD45 cells.

[0165] In some embodiments, the injection amount of the AAV vector comprising the human SCF gene, the AAV vector comprising the human IL3 gene, the AAV vector comprising the human GM-CSF gene, and the AAV vector comprising the human IL6 gene into the FLT3 gene knockout mouse is 1x10^9-1x10^10 GC per mouse, 5x10^9-5x10^10 GC per mouse, 1x10^9-1x10^10 GC per mouse, and 5x10^9-5x10^10 GC per mouse, respectively.

[0166] In some embodiments, the size of each AAV vector is no more than 4.5 kb, such as no more than 4 kb, 3.5 kb, 3 kb, 2.5 kb, etc.

[0167] In some embodiments, each AAV vector of the present application can have or be derived from any natural or recombinant AAV serotype. In some embodiments, each AAV vector of the present application can each independently have any one of the following serotypes: AAV1, AAV2, AAV2.5, AAV2G9, AAV3, AAV4, AAV4-4, AAV5, AAV6, AAV6.1, AAV6.2, AAV6.1.2, AAV7, AAV7.2, AAV8, AAV9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.61, AAV9.68, AAV9.84, AAV9.9, AAV10, AAV11, AAV12, and AAV13.

[0168] AAV has different serotypes, and different serotypes of AAV can have different expression levels in peripheral blood. In some embodiments, each AAV vector independently has a serotype selected from any one of AAV2, AAV8, and AAV9, and more preferably has an AAV9 serotype. In some embodiments, the 5' UTR sequence of AAV9 is as shown in SEQ ID No: 12 (ctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcct), and the 3' UTR sequence is as shown in SEQ ID No: 13 (ctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcct).

[0169] In some embodiments, the AAV vector comprising the cytokine gene is injected into the FLT3 knockout mouse by intraperitoneal injection or tail vein injection, and more preferably by intraperitoneal injection.

[0170] In some embodiments, the AAV vector comprising the cytokine gene has an AAV9 serotype, and is injected into the FLT3 knockout mouse by intraperitoneal injection.

[0171] In some embodiments, the AAV vector comprising the cytokine gene further comprises a promoter and a terminator, the promoter is a CAG promoter, an EF1A promoter or a CMV promoter, preferably a CAG promoter or an EF1A promoter. Different promoters result in different expression times of exogenous cytokines in vivo, and different promoters have different effects on the immune system reconstruction efficiency and the health status of humanized mice. In the severely immunodeficient mice, the above-mentioned promoters can drive the expression of the above-mentioned cytokines, and the CAG promoter and the EF1A promoter drive the expression of the above-mentioned cytokines for a longer time.

[0172]

[0173]

[0174] In some embodiments, the AAV vector comprises a BGH pA terminator. In some embodiments, the sequence of BGH pA is set forth in SEQ ID No: 17 (ctgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagagaatagcaggcatgctgggga). In some embodiments, the AAV vector comprises a CAG promoter and a BGH pA terminator.

[0175] In some embodiments, the human hematopoietic stem cells are cord blood CD34 cells, adult CD34 cells, iPS-derived CD34 cells, or G-CSF-mobilized PBMC-derived CD34 cells.

[0176] In the present application, adult CD34 cells refer to bone marrow-derived CD34 cells or G-CSF-mobilized PBMC-derived CD34 cells from a patient with a tumor or an autoimmune disease. iPS-derived CD34 cells refer to CD34 cells differentiated from pluripotent immortalized cells formed by introducing multiple transcription factors into human CD34 cells or fibroblasts.

[0177] The method for reconstructing the highly efficient immune system humanized animal model of the present application has the following advantages: 1. More single-donor-derived immune system humanized mice can be reconstructed using fewer cord blood-derived CD34 cells; 2. The human immune system can be efficiently reconstructed using adult hematopoietic stem cells (bone marrow-derived CD34 cells, G-CSF-mobilized peripheral blood-derived CD34 cells); 3. The humanized immune system can be reconstructed using iPS-derived CD34 cells. The main technical feature of the method is to express different human cytokines on FLT3 KO NOD-scid IL2Rγ KO mice, NRG mice, B6RG mice, or BRG mice using AAV technology to enhance the efficiency of various hematopoietic stem cells in reconstructing the immune system.

[0178] In a seventh aspect, the present application also provides a method for constructing an immune system humanized mouse, comprising: injecting human peripheral blood mononuclear cells into the FLT3 gene knockout mouse in vivo.

[0179] FLT3 knockout significantly improves the reconstitution efficiency of human immune cells in peripheral blood of mice. Compared with common immunodeficient mice (immunodeficient mice without FLT3 gene knockout), the efficacy of PD1 antibody is enhanced in FLT3 knockout immunodeficient mice.

[0180] In some embodiments, the FLT3 knockout mouse is a mouse produced by the method of the aforementioned second aspect or a mouse constructed by the method of the aforementioned third aspect, and the FLT3 knockout mouse is a severe immunodeficient mouse lacking T cells, B cells, and NK cells, which is constructed based on knockout of recombination activating gene 1 (Ragl) or knockout of recombination activating gene 2 (Rag2) or SCID mutation, further knockout of IL2 receptor gamma chain. Preferably, the FLT3 knockout mouse is constructed using one mouse selected from NOD-scid IL2RyKO mouse, NRG mouse, B6RG mouse, and BRG mouse. Among them, the NOD-scid IL2RyKO mouse, NRG mouse, B6RG mouse, and BRG mouse are as described in the aforementioned sixth aspect.

[0181] Examples

[0182] The NV-NSG mice used in the following examples are all 4-week-old NV-NSG mice purchased from Futuregene (Suzhou) Biotechnology Co., Ltd. Unless otherwise specified, the NV-NSG FLT3KO mice in the following examples refer to NV-NSG FLT3KO homozygous mice. In each of the following examples, each AAV vector is dissolved in 100 μL of PBS before injection.

[0183] In the following examples, the expression level of cytokines is detected by Elisa method, wherein the detection instrument is Multiskan FC enzyme label instrument of Invitrogen, and the kit is EHFLT3LG FLT-3L Human ELISA kit purchased from Invitrogen.

[0184] Example 1 Preparation of FLT3 knockout NV-NSG mice

[0185] FLT3 has a specific expression pattern in mouse hematopoietic system. It is highly expressed in multipotent progenitor cells (MPP), lymphoid-myeloid progenitor cells (LMPP) and common lymphoid progenitor cells (CLP), while it is very low or almost absent in long-term hematopoietic stem cells (LT-HSC) and megakaryocyte-erythroid progenitor cells (MEP). Figure 15 is the expression profile of FLT3 in mouse bone marrow progenitor cells, which indicates that FLT3 has a regulatory role in the development of immune precursor cells, while it has little effect on the maintenance of stem cell proliferation in vivo and / or the development of erythroid lineage. Therefore, based on this expression feature, the FLT3 gene knockout model is designed to achieve selective regulation of immune cell lineage, which is suitable for the establishment and intervention of immune reconstruction window period after human PBMC transplantation. Since FLT3LG and FLT3 pathway are very important for immune system reconstruction, especially for myeloid cell reconstruction, we use AAV vector to express human FLT3LG to study the effect of FLT3LG / FLT3 signaling pathway on immune system reconstruction. Since FLT3LG and FLT3 pathway have cross-reactivity between humans and mice, we use CRISPR / Cas9 technology to knock out the second exon region of FLT3 gene according to the FLT3 gene knockout strategy diagram of Figure 1, thereby obtaining FLT3 gene knockout NV-NSG (NOD SCID IL3Rg- / -) mice.

[0186] 1. CRISPR sgRNA design

[0187] Crispr.mit.edu was used to design guide sgRNA. sgRNA1 (SEQ ID NO: 8) and sgRNA2 (SEQ ID NO: 9) were designed for the first intron sequence of FLT3 gene (SEQ ID NO: 6), and sgRNA3 (SEQ ID NO: 10) and sgRNA4 (SEQ ID NO: 11) were designed for the second intron sequence of FLT3 gene (SEQ ID NO: 7).

[0188] 2. Gene editing solution preparation

[0189] The sgRNA in the examples was chemically synthesized, and the purified Cas9 mRNA was purchased from Origene with product number GE100054. The ratio of sgRNA to Cas9 mRNA was 1:1.

[0190] 3. Zygote injection

[0191] 3.1 Fertilization

[0192] Preparation of zygote by nature mating: Female mice were injected with pregnant mare serum gonadotropin (PMSG) (Sigma Chemical Inc., cat. no. G4877-2000 IU) and 46-48 hours later, human chorionic gonadotropin (HCG) (Sigma Chemical Inc., cat. no. CG10-1 VL) was injected. The female mice were immediately put in a cage with a normal male mouse at a ratio of 1:1. On the second day, the female mice were sacrificed by cervical dislocation and the entire oviducts were surgically removed and placed in a hyaluronidase-0.3 mg / M2solution. Under a microscope, the zygotes in the hyaluronidase M2solution (sigma chemical, cat. no. M7167) were observed and when the granulosa cells around the zygote were detached, the zygote was sucked out and washed in M2solution and finally placed in M16 solution (Sigma Chemical, cat. no. M7292) in a 5% CO2, 37°C incubator. The zygotes with full cells, clear zona pellucida and clear nucleus were selected under a microscope and used.

[0193] Preparation of zygote by in vitro fertilization (IVF): The female mice were injected with PMSG and 46-48 hours later, HCG was injected. The next day, the vaginal plugs were checked. Sperm was collected by cervical dislocation of the sexually mature male mice and the epididymal upper body was removed. After removing the fat and blood, the epididymal tail was placed in HTF solution (Millipore, cat. no. MR-070-D). The epididymal tail was cut with an ophthalmic scissors in a droplet and when the sperm was sufficiently separated from the epididymal tail, the tissue was removed from the droplet and the culture dish was placed in an incubator. The female mice were sacrificed after superovulation and the oviducts were removed. The oocyte clusters were pushed into the fertilization droplet with a microforceps. The sperm was sucked from the sperm droplet with a 10 μl pipette and added to the oocyte droplet. About 8 μl of sperm was added to each droplet according to the size of the oocyte cluster and the activity of the sperm. The sperm and oocyte mixture was finally placed in M16 solution in a 5% CO2, 37°C incubator.

[0194] 3.2 Zygote activity assay

[0195] Preparation of pseudopregnant mice: Normal female mice were put in a cage with a castrated male mouse at a ratio of 3:1. On the second day, the female mice with plugs were considered pseudopregnant. About 20 zygotes were implanted in the oviducts of each pseudopregnant mouse. After 3 weeks, the mice were born. The number of born mice and the ratio of implanted zygotes were used to measure the activity of the zygotes.

[0196] 3.3 Microinjection

[0197] Microinjection was started after the zygotes were cultured in M16 for a while. A drop of M2 medium was dropped in the center of a tissue culture slide, and the drop was covered with mineral oil. The zygote was sucked with a holding pipette, and each time the pipette was inserted into the nucleus or cytosol of the zygote with the injection of linearized homologous recombination plasmid DNA (100 ng), sgRNA (100 ng each), and Cas9 mRNA (100 ng). The injection caused the cell to swell, and the pipette was withdrawn. The next zygote was sucked and injected.

[0198] 4. Embryo transfer

[0199] On the same day of the injection, about 20 zygotes were sucked with an oocyte transfer pipette and implanted into the ampullary portion of the oviduct of a pseudopregnant female mouse. Then the ovary and oviduct were returned to the pseudopregnant mouse, and the wound was sutured.

[0200] 5. Genotype identification of the obtained F0 generation mice by PCR and sequencing

[0201] 6. Breeding of the F0 generation mice with wild type mice to obtain F1 generation mice

[0202] 7. Genotype identification of the obtained F1 generation mice by PCR and sequencing

[0203] 8. The F1 generation FLT3 KO heterozygous mice and NV-NSG mice were mated for two generations to F3 generation, and the non-specific mutation was diluted, and then the F3 generation heterozygous mice were interbred to obtain F4 generation FLT3 KO pure mice. The pure NV-NSG FLT3 KO mice were identified by PCR and RT-PCR methods.

[0204] The genotype identification method by PCR is as follows:

[0205] The mouse genomic DNA was extracted according to the following steps: ① The mouse tail and the required solution for the reaction were stored on ice; ② 100 μl of DDH2O was added to each of the primers (P1-P3, P1 / P2 / P3-FLTKO) (3000-4000 rpm, 1 min, centrifugation) and mixed well; ③ 1.5 ml EP tubes were prepared, labeled, and 10 μl of the diluted primers was added to each tube, followed by 90 μl of DDH2O and mixed well; ④ A 1.5 ml EP tube was prepared, and DNA Extraction (reaction solution) and Enzyme Mix (proteinase k) were added according to the amount calculated in Table 1, mixed well, and 100 μl was added to the mouse tail; ⑤ The sample was placed on a floating pad and put into a 55°C water bath for 20 / 40 min, and then put into a 95°C water bath for 5 min (to inactivate the enzyme), followed by the addition of 100 μl of termination solution and storage in a 4°C refrigerator or on ice for standby; ⑥ Two 1.5 ml EP tubes were prepared, labeled, and the appropriate amount was added according to the requirement, and then put into the PCR tube, centrifuged, and put into the PCR; ⑦ 2 g of agarose was added to 1X TAE 100 ml, and heated at 100°C for 15 min, and after cooling (not hot to the touch), 50 μl of NA-red (1:2000) was added, mixed well, and poured into the gel plate base, and the comb was inserted; ⑧ After waiting for the agarose gel to cool and solidify, the comb was removed, 1X TAE was poured into the electrophoresis instrument, and the DNA sample 10 μl was added along the comb teeth (DNA dye was added in the first hole, and DNA sample was added in the second hole to detect different genotypes, and DNA dye was used to separate them); ⑨ The positive and negative electrodes were connected (positive---negative), 150V was applied, and electrophoresis was performed until the gel was two-thirds full, and then the power was turned off, the gel was removed, and transferred to the gel imaging instrument for observation and photography. The results of PCR identification of Flt3 gene knockout are shown in Figure 2A, and the results of Figure 2A show that the Flt3 gene was successfully knocked out.

[0206] Table 1

[0207] The primers for genotype identification by PCR, the PCR reaction system, and the cycle program are shown in Table 2.

[0208] Table 2

[0209] The genotype identification method by RT-PCR is as follows:

[0210] (1) Extraction of total RNA from the spleen and brain of F4 generation mice, the specific steps are as follows: ①Centrifuge the PLG tube at 12000 rpm for 30 s for standby; ②Centrifuge the hard-walled tube containing Trizol, cerebellum, spleen tissue and ceramic beads at 12000 rpm for 10 min at 4℃, pour the supernatant into the above-mentioned PLG tube, then add 200 μl of chloroform, shake vigorously for 15 s, stand for 2 min, and then centrifuge at 12000 rpm for 15 min at 4℃ after the solution is layered; ③Transfer the supernatant water phase after centrifugation in the above step to a clean 1.5 ml EP tube, add an equal volume of isopropanol for precipitation for 30 min, then centrifuge at 12000 rpm for 10 min at 4℃, and the white precipitate at the bottom of the tube is the RNA; ④Discard the supernatant of the centrifuged sample in the above step, and use 75% alcohol prepared with DEPC water and anhydrous ethanol to wash the RNA sample, 1 ml per tube, and then centrifuge at 7500 rpm for 10 min at 4℃; ⑤Discard the supernatant after centrifugation, open the tube mouth and air dry for 1-2 min, and then add an appropriate amount of DEPC water to dissolve. After dissolution, the sample is stored at -80℃.

[0211] (2) Reverse transcription of the first strand cDNA synthesis, using the full type gold reverse transcription kit, gDNA Removal and cDNA Synthesis SuperMix (AT311-03), the specific steps are as follows:

[0212] The above RNA sample is quantified by spectrophotometer, and the first step reaction solution is configured as follows:

[0213] (3) Perform PCR amplification, and perform 1% agarose gel electrophoresis detection, the primers used for PCR amplification are shown in Table 3, and the PCR program is shown in Table 4.

[0214] Table 3

[0215] Table 4

[0216] The RT-PCR identification results of the FLT3 gene knockout are shown in Figure 2B, and the P1 primer is designed to cross the knockout region. The results of Figure 2B show that the HO mouse gene has been knocked out.

[0217] When the FLT3 gene knockout NV-NSG mouse (NV-NSGF mouse or NV-NSG FLT3KO mouse) identified above is four weeks old, its body weight is measured with NOG, NKG and NV-NSG mice of the same age, and the results are shown in Figure 2C. The results show that compared with NV-NSG, the body weight of NV-NSGF mouse decreases significantly, with an average decrease of about 20%, indicating that FLT3 knockout has an impact on the overall development or hematopoietic function of the mouse.

[0218] Example 2 FLT3KO effect on immune cells of NV-NSG mice

[0219] (1) Take the femur bone marrow of 4 NV-NSG mice and 4 NV-NSG FLT3KO mice, wherein the preparation method of NV-NSG FLT3KO mice refers to Example 1; use ELISA to determine the expression level of mouse FLT3LG in the serum of mice, and the results are shown in Figure 4A. The expression level of mouse FLT3LG in the serum of NV-NSG mice is only about 300 pg / ml, and the expression level of mouse FLT3LG in the serum of NV-NSG FLT3KO mice is greatly improved, about 10 ng / ml.

[0220] (2) Select 3 NV-NSG mice, 3 NKG mice, 3 NV-NSG mice and 3 NV-NSG FLT3KO mice of 4 weeks old, take the femur bone marrow of mice, wherein the preparation method of NV-NSG FLT3KO mice refers to Example 1; use cell flow cytometry to determine the total number of femur bone marrow cells, the absolute number of dendritic cells, the proportion of dendritic cells in bone marrow cells, and the proportion of dendritic cells in spleen white blood cells of each mouse, and the results are shown in Figures 4B-4E. The results show that, compared with other mice, the total number of femur bone marrow cells, the absolute number of dendritic cells, the proportion of dendritic cells in bone marrow cells, and the proportion of dendritic cells in spleen white blood cells of NV-NSG FLT3KO mice are significantly reduced.

[0221] (3) Refer to Example 1 to prepare 3 NV-NSG FLT3KO hybrid mice and NV-NSG FLT3KO pure mice, take 3 NV-NSG wild type mice, 3 NV-NSG FLT3KO hybrid mice and NV-NSG FLT3KO pure mice of 4 weeks old, and use cell flow cytometry to determine the proportion of neutrophils, monocytes, macrophages and dendritic cells in the spleen of each mouse, and the results are shown in Figures 4F-4I. The results show that there is no significant difference in the proportion of neutrophils in the spleen among the three genotypes of mice; compared with NV-NSG wild type mice and NV-NSG FLT3KO hybrid mice, the proportion of monocytes and macrophages in the spleen of NV-NSG FLT3KO pure mice decreases; compared with NV-NSG wild type mice and NV-NSG FLT3KO hybrid mice, the proportion of dendritic cells in the spleen of NV-NSG FLT3KO pure mice significantly decreases.

[0222] In summary, the experimental results shown in FIGS. 4A-4I show that FLT3 gene knockout has a significant impact on the constitution of the innate immune system in mice, especially in the generation and distribution of dendritic cells, and has less impact on granulocytes, and slightly interferes with monocytes and macrophages.

[0223] Example 3 Influence of FLT3 gene knockout on PBMC reconstitution efficiency

[0224] Four 4-week-old NOG mice, NV-NSG mice and NV-NSGF mice (i.e. NV-NSG FLT3KO mice) were selected, and 5x10 6 Human PBMC cells were selected, and 5x10 6 The results are shown in FIG. 13A. The results show that PBMCs can still expand T cells in the FLT3 knockout background, and the reconstitution efficiency of human immune cells in the peripheral blood of NV-NSG FLT3KO mice increases over time. In addition, the number of human CD45+ cells in FLT3KO mice is significantly higher than that in ordinary NV-NSG mice in the first two weeks after PBMC transplantation, and the early reconstitution efficiency is increased by more than 2 times. The reason may be that in FLT3KO mice, FLT3LG is excessive due to the loss of receptor consumption. Excessive FLT3LG can activate and expand human dendritic cells (DCs) in PBMCs. This advantage enables researchers to more quickly establish a humanized mouse model, shorten the experimental waiting period, and be used for vaccine research and PBMC in vivo reconstitution experiments related to autoimmune diseases. In addition, this platform can also reduce the frequency of using highly reactive PBMC donors, thereby saving valuable cell resources.

[0225] After PBMC transplantation, we monitored the weight change and survival curve of NV-NSG FLT3KO mice, and the results are shown in FIGS. 13B and 13C. Compared with ordinary NV-NSG mice, FLT3KO mice showed a more moderate weight loss trend, and the onset of graft-versus-host disease (GvHD) was significantly delayed. This phenomenon may be related to the decrease in the number and activity of natural immune cells (such as DCs) in FLT3 gene knockout mice, thereby weakening the immune response induced by PBMCs.

[0226] In summary, compared with ordinary NV-NSG mice, this model enhances the immune reconstitution ability without increasing the toxicity response, and is suitable for longer period and more complex design of immunopharmacological studies.

[0227] Example 4 Influence of FLT3 gene knockout on PBMC mouse PD1 antibody efficacy

[0228] Select 4-week-old NV-NSG mice and NV-NSGF mice (i.e. NV-NSG FLT3 knockout mice) each 12, and respectively divided into 3 groups according to the treatment method, 4 in each group, a total of 6 experimental groups. NV-NSG mice are divided into 3 groups: ① the basic control group without tumor inoculation and PBMC reconstruction (NV-NSG group); ② the solid tumor PBS control group inoculated with 10×10 6 A375 human melanoma cells and PBMC reconstruction, and then treated with PBS (NV-NSG A375 PBS group); ③ the solid tumor intervention group treated with PD-1 antibody after A375 tumor cell inoculation and PBMC reconstruction (NV-NSG A375 PD-1 group). NV-NSGF mice are also divided into corresponding 3 groups, namely NV-NSGF group, NV-NSGF A375 PBS group, and NV-NSGF A375 PD-1 group. The construction method of the tumor model is as follows: 10×10 6 A375 human melanoma cells are subcutaneously injected into the right armpit of the mice, and the tumor volume reaches about 80mm 3 on the 7th day after inoculation, 5×10 6 human PBMC cells are injected through the tail vein to establish a human immune system. From the 3rd day after PBMC injection, intervention is carried out twice a week for 4 times, among which the NV-NSG A375 PBS group and the NV-NSGF A375 PBS group are injected with PBS (dose 10mg / kg), and the intervention group (NV-NSG A375 PD-1 group and NV-NSGF A375 PD-1 group) is injected with programmed death receptor-1 (PD-1) antibody Nivolumab (trade name , provided by Bristol-Myers Squibb Company, dose 10mg / kg), for comparison of the effect of FLT3 knockout on the treatment effect of PD-1 antibody in PBMC human reconstruction tumor model.

[0229] During the treatment process, the peripheral blood of the mice was collected at multiple time points (including the 7th day, the 14th day, the 21st day, etc. after PBMC transplantation), and the reconstruction level of human T cells (CD45 + CD3 + ) was detected by flow cytometry, and the results are shown in FIG. 14A. At the same time, the body weight of the mice was recorded as an index of physical condition, and the results are shown in FIG. 14B. In addition, the tumor long diameter and short diameter were measured every 2-3 days using a vernier caliper, and the tumor volume was calculated to monitor the treatment effect, and the results are shown in FIG. 14C.

[0230] The present embodiment provides a model for evaluating the effect of immune checkpoint antibody (PD-1) in the FLT3 knockout background. The results show that the FLT3 gene knockout has a certain regulation effect on the proportion of human-derived T cells after PBMC reconstitution and their tumor immune response; in the A375 solid tumor model, the effect of PD-1 antibody on tumor inhibition differs in different mouse strains. FLT3KO mice show more stable tumor inhibition curves under PD-1 antibody treatment, accompanied by rapid recovery after initial mild weight loss. This indicates that the T cell activity in this model is high but not excessive, which can more truly reflect the clinical efficacy and toxicity window of PD-1 drugs, and is an ideal platform for combination immunotherapy (such as PD-1 + vaccine, PD-1 + ADC). The model can be used to optimize immunotherapy conditions, screen GvHD and immune response-related indicators, and is suitable for early in vivo validation studies of tumor immunotherapy drugs.

[0231] Example 5 FLT3LG function test

[0232] According to FIG. 5, the part represented by the cytokine in FIG. 5 is FLT3LG, the CMV promoter and BGH pA terminator are selected, and the AAV vector (AAV hFLT3LG) expressing the cDNA of hFLT3LG is constructed, and the expression frame is flanked by AAV 5'UTR (SEQ ID No: 12) and AAV 3'UTR (SEQ ID No: 13).

[0233] Take 6 NV-NSG mice, and randomly divide them into 3 groups. Different doses (2x10^8GC, 2x10^9GC and 1x10^10GC) of AAV hFLT3LG are injected into the 3 groups of NV-NSG mice through intraperitoneal injection. Four weeks later, the expression amount of hFLT3LG in the serum of the mice is detected, and the results are shown in FIG. 6. After injection of AAV hFLT3LG, the expression amount of hFLT3LG in the serum of the mice is very high. After injection of 1x10^10GC of AAV hFLT3LG, the expression amount of hFLT3LG in the serum can reach 4-5 ng / ml. Therefore, in the subsequent functional experiments, 2x10^8GC and 2x10^9GC of AAV9hFLT3LG are injected into NV-NSG mice and NV-NSG FLT3KO mice.

[0234] Take 15 NV-NSG mice, randomly divided into 3 groups, one group does not inject AAV vector, the other two groups are injected with 2x10^8GC and 2x10^9GC of AAV9hFLT3LG by intraperitoneal injection; take 15 NV-NSG FLT3KO mice (preparation method refers to example 1), randomly divided into 3 groups, 5 in each group, one group does not inject AAV vector, the other two groups are injected with 2x10^8GC and 2x10^9GC of AAV9hFLT3LG by intraperitoneal injection; 1 week after injection, the mice are irradiated with a dose of 100cGy, the next day, 100,000 CD34 cells isolated from umbilical cord blood are injected into the tail vein for umbilical cord blood CD34 cell immune system reconstruction, and 1 mouse is taken for cell flow analysis after 10 weeks of injection. The specific experimental operation is as follows:

[0235] 1. Experimental reagents

[0236] MACS Buffer: 2% calf serum (10 ml) + 2 mmol EDTA (2 ml) + 500 ml PBS (filtered)

[0237] Heparin: 30 ml of normal saline + 0.1 g of heparin sodium

[0238] Separation solution: STEMCELL Cat#07851 / 0786 Lot#00122

[0239] Red blood cell lysis solution: Beyotime C3702

[0240] PBS: Beyotime C0221A

[0241] 2. Experimental apparatus

[0242] 50ml and 15ml centrifuge tubes, 1.5ml EP tubes, sterile pipettes (size: 3-5ml), capillary glass tubes, pipette guns and tips (size: 0-1000ul), cell flow tubes

[0243] 3. Experimental steps

[0244] (1) Prepare 15ml centrifuge tubes for the number of mice that need to be bled, add 5ml PBS to each, prepare equal amount of 1.5ml EP tubes, add 50ul heparin to each, and go to the animal room.

[0245] (2) Bleeding: Dip the capillary glass tube with heparin, and take the blood from the eye socket, 10 drops of blood (about 100ul), drop the blood into the EP tube containing heparin, and dilute with 1ml PBS in the EP tube (blow a few times, without bubbles) and suck into the 15 centrifuge tubes (the mouse number is consistent with the centrifuge tube number), the sample is stored at 4℃ and taken back to the laboratory.

[0246] (3) Invert the 15 ml centrifuge tube containing the blood sample several times to mix the sample, and make sure that no red blood cells are deposited at the bottom of the tube. Take 2 ml of the separation solution with a pipette, and slowly inject it into the bottom of the tube to make the separation solution and the blood sample stratify. Centrifuge (400 x g, 20 min).

[0247] (4) Prepare an equal number of 15 ml centrifuge tubes, and add 5 ml of MACS Buffer to each tube. Take out the centrifuge tubes from the centrifuge, and take the white blood cells in the middle of the stratification with a pipette and add them to the centrifuge tubes containing the MACS Buffer. Discard the remaining liquid into a waste bottle. Centrifuge the centrifuge tubes containing the white blood cells and the MACS Buffer mixture (400 x g, 10 min), and remove the supernatant.

[0248] (5) Add 200 μl of red blood cell lysis solution, and let it stand for 5-10 min. Add 1 ml of MACS Buffer, and prepare an equal number of EP tubes. Transfer the mixture to the EP tubes, and centrifuge (400 x g, 10 min), and remove the supernatant.

[0249] (6) Prepare the antibody receptor blocking solution (Human TruStain FeX and TruStain FeX (anti-mouse) CD16 / 32), and prepare the MACS Buffer containing the blocking solution according to the number of samples. Add 30 μl of the blocking solution (0.5 μl of blocking antibodies for humans and mice, respectively) to each sample to suspend the cells, and block for 10 min.

[0250] (7) At the same time, prepare the antibodies (fluorescently dyed antibodies, as shown in Table 5), and add them in order in the dark. Prepare a staining mixture according to 0.5 μl of each antibody per sample, and add 20 μl of the staining antibody mixture to each sample after blocking for 10 min. After 20 min in the dark, add 1 ml of MACS Buffer, centrifuge (400 x g, 10 min), remove the supernatant, and add 250 μl of MACS Buffer to each tube, and mix well by blowing.

[0251] (8) Store the EP tubes in a 4°C refrigerator for later use. After mixing the cells in the EP tubes well by blowing, transfer them to the corresponding cell flow tubes for flow cytometer analysis. The results of the cell flow cytometry analysis are shown in FIGS. 3A-3D.

[0252] Table 5

[0253] The effects of different doses of AAV hFLT3LG on the reconstruction of human CD45 cells and human CD33 myeloid cells in all mice were observed after injection for 13 weeks, and the results are shown in FIGS. 7A and 7B.

[0254] As can be seen from FIG. 7A and FIG. 7B, in the NV-NSG mice, the AAV-expressed hFLT3LG can greatly increase the proportion of hCD33 myeloid cells in hCD45 cells, and is dose-dependent, but the proportion of hCD45 in total CD45 cells decreases, which indicates that human FLT3LG has a proliferative effect on mouse mCD45 cells, thus reducing the proportion of hCD45 cells in total CD45 (hCD45 + mCD45). As can also be seen from FIG. 7A and FIG. 7B, in the FLT3KO NV-NSG mice, a low dose of AAV FLT3LG (2x10^8GC) can increase the proportion of myeloid cells without inhibiting the proportion of hCD45 cells, while a high dose of AAV FLT3LG (2x10^9GC) can increase the proportion of hCD33 cells, but still reduces the proportion of hCD45, which indicates that there is a FLT3LG receptor other than FLT3 in mice, and a high dose of human FLT3LG can still stimulate the proliferation of mouse mCD45. Knocking out FLT3 cannot completely eliminate the interference of human FLT3LG on the proliferation of mouse myeloid cells. Experiments show that only under the stimulation of a low dose of FLT3LG, both the proportion of human CD33 cells can be effectively increased, and the proportion of human CD45 cell reconstruction can not be reduced due to excessive promotion of the proliferation of mouse mCD45 cells.

[0255] Example 6 Comparison of the immune system reconstruction efficiency of different cytokines in NV-NSG mice and NV-NSG FLT3KO mice

[0256] According to FIG. 5, the parts represented by cytokines in FIG. 5 are hSCF, hIL3, hGM-CSF, hIL6 and hFLT3LG respectively, the promoter is CAG promoter, and the terminator is BGH pA terminator. The AAV9 vector expressing the cDNA of hSCF, the AAV9 vector expressing the cDNA of hIL3, the AAV9 vector expressing the cDNA of hGM-CSF, the AAV9 vector expressing the cDNA of hIL6 and the AAV9 vector expressing the cDNA of hFLT3LG are constructed, and each expression frame is flanked by AAV 5'UTR (SEQ ID No: 12) and AAV 3'UTR (SEQ ID No: 13). The AAV9 expressing different cytokines is dose optimized so that the expression level of each cytokine in serum is between 100 pg / ml and 200 pg / ml after intraperitoneal injection of AAV9 for four weeks, thereby determining the dose of each AAV9 expressing different cytokines, wherein the injection amount of the AAV vector containing hSCF, the AAV vector containing hIL3, the AAV vector containing hGM-CSF, the AAV vector containing hIL6 and the AAV vector containing hFLT3LG is 5X10^9 GC / mouse, 1X10^10 GC / mouse, 5X10^9 GC / mouse, 1X10^9 GC / mouse and 2X10^8 GC / mouse respectively. Subsequently, 30 NV-NSG mice are randomly divided into 6 groups, one group is not injected with AAV, and the other 5 groups are intraperitoneally injected with AAV hSCF, AAV hIL3, AAV hIL6, AAV hGM-CSF and AAV hFLT3LG respectively; 30 NV-NSG FLT3KO mice (the preparation method is referred to Example 1) are randomly divided into 6 groups, one group is not injected with AAV, and the other 5 groups are intraperitoneally injected with AAV hSCF, AAV hIL3, AAV hIL6, AAV hGM-CSF and AAV hFLT3LG respectively; after 1 week of injection, the mice are irradiated with a dose of 100 cGy, and the next day, 5x10^4 CD34 cells are injected through the tail vein; after 12 weeks, cell flow cytometry is performed to detect the proportion of hCD45 in total CD45 cells (hCD45+mCD45), and the results are shown in FIG. 8.

[0257] As can be seen from FIG. 8, in both NV-NSG mice and NV-NSG FLT3KO, except for hFLT3LG, the other four cytokines can increase the proportion of hCD45, but the effect is more obvious in NV-NSG FLT3KO. hFLT3LG has an inhibitory effect on the proportion of hCD45 in NV-NSG mice, and has no obvious inhibitory effect on the proportion of hCD45 in NV-NSG FLT3KO mice, but also has no promoting effect.

[0258] The above experiment can be seen that SCF, IL3, GM-CSF and IL6 can effectively increase the proportion of hCD45 cells, therefore, in order to increase the proportion of CD33 myeloid cells and human CD45 cells at the same time, 5X10^9GC / mouse of AAV hSCF, 1X10^10GC / mouse of AAV hIL3, 1X10^9GC / mouse of AAV hIL6 and 5X10^9GC / mouse of AAV hGM-CSF four kinds of AAV vectors (named AAV Plus4) are injected at the same time with 2X10^8GC / mouse of AAV hFLT3LG. 20 NV-NSG FLT3KO mice (preparation method refer to example 1) are randomly divided into 4 groups, one group is not injected with AAV, and the other 3 groups are injected with AAV hFLT3LG, AAV Plus4 and AAV hFLT3LG Plus4 respectively through intraperitoneal injection. After 1 week of injection, the mice are irradiated with a dose of 100 cGy, and the next day, 100,000 cord blood-derived CD34 cells are injected through the tail vein. After 14 weeks, the proportion of hCD45 in total CD45 cells, the proportion of hCD3T in hCD45, the proportion of hCD19B in hCD45, the proportion of hCD56 cells in hCD45 and the proportion of hCD33 in hCD45 in each group of mice are detected, and the results are shown in Figures 9A-9E. As can be seen from the results, these immune system reconstruction-related human cytokines can be roughly divided into two categories. FLT3LG mainly promotes the proliferation of myeloid cells, T cells and NK cells. Due to the species cross-reactivity of FLT3LG, hFLT3LG has an effect on the proportion of human CD45 in NV-NSG mice, but in NV-NSG FLT3KO mice, hFLT3LG has no significant inhibitory effect on the proportion of human CD45. And because SCF, IL3, IL6 and GM-CSF have no cross-reaction with mouse cells, Plus4 cytokines can greatly increase the proportion of hCD45 cells, although their effect on the proliferation of human myeloid cells is not obvious, but when Plus4 cytokines are used together with hFLT3LG, the two types of cytokines have a synergistic effect, which can greatly increase the proportion of myeloid cells, NK cells and T cells in human white blood cells (hCD45 cells).

[0259] Example 7 Effect of AAV Plus4 on the efficiency of cord blood CD34 immune system reconstruction in NV-NSG mice and NV-NSG FLT3KO mice

[0260] Take 30 NV-NSG mice, randomly divided into 6 groups, the first to the third group without injection of AAV, the fourth to the sixth group by intraperitoneal injection of AAV Plus4 (prepared according to the method of reference example 4); take 30 NV-NSG FLT3KO mice (preparation method according to example 1), randomly divided into 6 groups, the first to the third group without injection of AAV, the fourth to the sixth group by intraperitoneal injection of AAV Plus4; one week later, 100 cGy irradiation of bone marrow, the next day by tail vein injection of CD34 cells, wherein, the first to the third group of NV-NSG mice were injected with 100,000, 300,000, 1 million CD34 cells by tail vein, the fourth to the sixth group of NV-NSG mice were injected with 100,000, 300,000, 1 million CD34 cells by tail vein, the first to the third group of NV-NSG FLT3KO mice were injected with 100,000, 300,000, 1 million CD34 cells by tail vein, the fourth to the sixth group of NV-NSG FLT3KO mice were injected with 100,000, 300,000, 1 million CD34 cells by tail vein. After 12 weeks, the proportion of human CD45 in total CD45 (hCD45+ and mCD45+) was detected, and the experimental results are shown in Figure 10. Compared with the genetic background of NV-NSG, the transplantation efficiency of AAV Plus4 for low-dose CD34 cells in NV-NSG FLT3KO mice is more obvious, which may be because the number of bone marrow immune cells, especially dendritic cells, in FLT3KO mice is less, providing a more open vacancy microenvironment for the development of human CD34 in mouse bone marrow. Using AAV Plus4 and NV-NSG FLT3KO mice can use less CD34 cells to reconstruct more than 100 single-donor humanized mice.

[0261] From the economic benefit, the success rate of humanized mice must reach more than 25%, and more than 50 CD34 humanized mice from the same donor are needed for each experiment. One unit of cord blood can only isolate 1x10^6-2x10^6 CD34 cells. Using NV-NSG mice can only reconstruct 10-20 mice. Using NV-NSG Plus4 can reconstruct 30-40 mice at a low level. And using NV-NSG FLT3KO Plus4 mice can reconstruct more than 100 mice. After knocking out FLT3, the reconstruction efficiency of hCD45 does not improve significantly, and FLT3 knockout and AAV Plus4 have a synergistic effect on the reconstruction of the immune system.

[0262] Example 8 Effect of AAV Plus4 on the reconstruction efficiency of adult CD34 immune system in NV-NSG mice and NV-NSG FLT3KO mice

[0263] Another research hotspot in the field of humanized mice is that the immune system cannot be reconstructed using low-quality adult CD34 cells. Adult CD34 cells are derived from the bone marrow of patients or G-CSF-mobilized PBMC-derived CD34 cells. Take 20 NV-NSG mice and randomly divide them into 4 groups. The first and second groups do not inject AAV, and the third and fourth groups inject AAV Plus4 (prepared according to the method of Reference Example 4) through intraperitoneal injection. Take 20 NV-NSG FLT3KO mice (prepared according to Example 1), and randomly divide them into 4 groups. The first and second groups do not inject AAV, and the third and fourth groups inject AAV Plus4 through intraperitoneal injection. One week later, the mice are subjected to 100 cGy irradiation to clear the marrow, and the next day, CD34 cells are injected through the tail vein. Among them, the first and third groups of NV-NSG mice are injected with 2x10^6 G-CSF-mobilized PBMC-derived CD34 cells through the tail vein, and the second and fourth groups of NV-NSG mice are injected with 2x10^6 patient bone marrow-derived CD34 cells through the tail vein. The first and third groups of NV-NSG FLT3KO mice are injected with 2x10^6 G-CSF-mobilized PBMC-derived CD34 cells through the tail vein, and the second and fourth groups of NV-NSG FLT3KO mice are injected with 2x10^6 patient bone marrow-derived CD34 cells through the tail vein. After 14 weeks, immune system reconstruction identification is performed, and the results are shown in Figure 11. Neither NV-NSG mice nor NV-NSG FLT3KO mice can be used for adult CD34-derived immune system humanization reconstruction. The efficiency of human immune system reconstruction in NV-NSG FLT3KO mice injected with AAV Plus4 is higher than that in NV-NSG mice injected with AAV Plus4, which may be due to the more open microenvironment in the mouse bone marrow after FLT3KO. This microenvironment is more suitable for cytokine-assisted human immune system reconstruction, including adult CD34-derived immune system reconstruction.

[0264] Traditional immune system humanized mice are derived from the umbilical cord blood CD34 of a mother. Only the human immune system can be reconstructed, but the patient's immune system cannot be reconstructed. Patient hematopoietic stem cells are taken from patient bone marrow CD34 cells or G-CSF-mobilized PBMC-derived CD34 cells, which have poor quality and are difficult to reconstruct the human immune system. The Plus4 cytokine of the present application can improve the reconstruction efficiency of adult CD34 immune system in NV-NSG mice, but the reconstruction efficiency is relatively low. However, the Plus4 cytokine can significantly improve the reconstruction efficiency of the human immune system in NV-NSG FLT3KO mice. In addition, NV-NSG FLT3KO mice do not significantly promote the reconstruction of adult CD34 cell-derived immune system.

[0265] Example 9 Effect of AAV Plus4 on the efficiency of iPS-derived CD34 immune system reconstruction in vivo in NV-NSG mice and NV-NSG FLT3KO mice

[0266] Take 20 NV-NSG mice, randomly divide them into 4 groups, the first and second groups do not inject AAV, the third and fourth groups inject AAV Plus4 (prepared according to the method of Reference Example 4) through intraperitoneal injection; take 20 NV-NSG FLT3KO mice (prepared according to the method of Example 1), randomly divide them into 4 groups, the first and second groups do not inject AAV, the third and fourth groups inject AAV Plus4 through intraperitoneal injection; one week later, perform 100 cGy irradiation to clear the marrow, the next day inject CD34 cells through the tail vein, wherein the first and third groups of NV-NSG mice respectively inject 100,000 iPS-derived CD34 cells (purchased from ATCC (ACS-7020)) through the tail vein, the second and fourth groups of NV-NSG mice respectively inject 1,000,000 iPS-derived CD34 cells through the tail vein, the first and third groups of NV-NSG FLT3KO mice respectively inject 100,000 iPS-derived CD34 cells (purchased from ATCC (ACS-7020)) through the tail vein, and the second and fourth groups of NV-NSG FLT3KO mice respectively inject 1,000,000 iPS-derived CD34 cells through the tail vein; 14 weeks later, perform immune system reconstruction identification, the results are shown in Figure 12, only in the case of injecting 1,000,000 (1x10^6) iPS-derived CD34 cells into NV-NSG FLT3KO Plus4 mice, can the human immune system (hCD45>25%) be reconstructed in mice. Therefore, in theory, one can use human iPS cells to reconstruct the same human immune system humanized mice in mice without limitation. One can also edit the human immune system by modifying iPS cells, and reconstruct the genetically modified humanized immune system in mice.

[0267] Example 10

[0268] According to Figure 5, the part represented by the cytokine in Figure 5 is replaced by hIL15 promoter CAG promoter, terminator BGH pA terminator, to construct an AAV9 vector (AAV9hIL15) expressing the cDNA of hIL15 (SEQ ID No: 19), and each expression frame is flanked by AAV 5’UTR (SEQ ID No: 12) and AAV 3’UTR (SEQ ID No: 13).

[0269] Take 10 4-week-old NV-NSG mice and randomly divide them into 2 groups, one group does not inject AAV9hIL15, only injects the same volume of PBS as the control group 1 (NV-NSG group), the other group injects 5x10 9GC / mouse were injected intraperitoneally with AAV9hIL15 as control group 2 (NV-NSG+AAV hIL15 group); 10 NV-NSG FLTKO mice (4 weeks old) were randomly divided into two groups, one group was injected with PBS as control group 3 (NV-NSG F group), and the other group was injected with 5x10 9 GC / mouse were injected intraperitoneally with AAV9hIL15 as control group 2 (NV-NSG+AAV hIL15 group); 10 NV-NSG FLTKO mice (4 weeks old) were randomly divided into two groups, one group was injected with PBS as control group 3 (NV-NSG F group), and the other group was injected with 5x10 6 GC / mouse were injected intraperitoneally with AAV9hIL15 as control group 2 (NV-NSG+AAV hIL15 group); 10 NV-NSG FLTKO mice (4 weeks old) were randomly divided into two groups, one group was injected with PBS as control group 3 (NV-NSG F group), and the other group was injected with 5x10 + GC / mouse were injected intraperitoneally with AAV9hIL15 as control group 2 (NV-NSG+AAV hIL15 group); 10 NV-NSG FLTKO mice (4 weeks old) were randomly divided into two groups, one group was injected with PBS as control group 3 (NV-NSG F group), and the other group was injected with 5x10 + GC / mouse were injected intraperitoneally with AAV9hIL15 as control group 2 (NV-NSG+AAV hIL15 group); 10 NV-NSG FLTKO mice (4 weeks old) were randomly divided into two groups, one group was injected with PBS as control group 3 (NV-NSG F group), and the other group was injected with 5x10 + GC / mouse were injected intraperitoneally with AAV9hIL15 as control group 2 (NV-NSG+AAV hIL15 group); 10 NV-NSG FLTKO mice (4 weeks old) were randomly divided into two groups, one group was injected with PBS as control group 3 (NV-NSG F group), and the other group was injected with 5x10

[0270] The above is only the preferred embodiment of the present application, not other forms of the application limit, any skilled in the art of the technical personnel may use the disclosed technology content to change or modification of equivalent changes in the equivalent embodiment. But without departing from the technical solutions of the present application, according to the technical essence of the present application to the above examples of any simple modification, equivalent changes and modification, still belongs to the scope of protection of the present application technical solutions.

Claims

1. sgRNA targeting any one of the exons 1 to 24 of the mouse FLT3 gene.

2. The sgRNA according to claim 1, which targets exon 2 of the mouse FLT3 gene, wherein, The sgRNA includes two of sgRNA1, sgRNA2, sgRNA3 and sgRNA4; Both sgRNA1 and sgRNA2 are nucleotide sequences complementary to at least a portion of the first intron region of the mouse FLT3 gene, and both sgRNA3 and sgRNA4 are nucleotide sequences complementary to at least a portion of the second intron region of the mouse FLT3 gene.

3. The sgRNA according to claim 2, wherein, The sequence of the first intron region of the mouse FLT3 gene is shown in SEQ ID NO:6, and the sequence of the second intron region of the mouse FLT3 gene is shown in SEQ ID NO:7; Preferably, the nucleotide sequence of sgRNA1 is shown in SEQ ID NO:8; the nucleotide sequence of sgRNA2 is shown in SEQ ID NO:9; the nucleotide sequence of sgRNA3 is shown in SEQ ID NO:10; and the nucleotide sequence of sgRNA4 is shown in SEQ ID NO:

11.

4. The sgRNA according to any one of claims 1 to 3, wherein, The sgRNA consists of sgRNA1 and sgRNA3; or The sgRNA consists of sgRNA1 and sgRNA4; or The sgRNA consists of sgRNA2 and sgRNA3; or The sgRNA consists of sgRNA2 and sgRNA4.

5. A method for gene knockout in mice, wherein, The method includes: The FLT3 gene in mice is knocked out using the sgRNA targeting the mouse FLT3 gene as described in any one of claims 1 to 4.

6. The method according to claim 5, wherein, The techniques for knocking out the FLT3 gene in mice include zinc finger nuclease technology, TALEN gene editing technology, or CRISPR / Cas9 gene editing technology.

7. The method according to claim 5 or 6, wherein, The method includes the following steps: Prepare a gene editing solution containing Cas9 nuclease and sgRNA targeting the mouse FLT3 gene as described in any one of claims 1 to 4; Gene editing fluid was delivered into mouse fertilized eggs to obtain F0 generation mice.

8. The method of claim 7, wherein the method of delivering the gene-editing solution to mouse zygotes is microinjection or electroporation.

9. The method according to claim 7, wherein, The method further includes: F0 generation mice were bred with wild-type mice to obtain F1 generation mice.

10. A method for constructing FLT3 gene knockout mice, wherein, The method includes: The FLT3 gene in mice is knocked out using the sgRNA targeting the mouse FLT3 gene as described in any one of claims 1 to 4.

11. The method according to claim 10, wherein, The techniques for knocking out the FLT3 gene in mice include zinc finger nuclease technology, TALEN gene editing technology, or CRISPR / Cas9 gene editing technology.

12. The method according to claim 10 or 11, wherein, The method includes the following steps: Prepare a gene editing solution containing Cas9 nuclease and sgRNA targeting the mouse FLT3 gene as described in any one of claims 1 to 4; Gene editing fluid was delivered into mouse fertilized eggs to obtain F0 generation mice.

13. The method of claim 12, wherein the method of delivering the gene-editing solution to mouse zygotes is microinjection or electroporation.

14. The method according to claim 12, wherein, The method further includes: F0 generation mice were bred with wild-type mice to obtain F1 generation mice.

15. The use of a mouse generated by the method according to any one of claims 5 to 9, or a mouse constructed by the method according to any one of claims 10 to 14, or its offspring, in the preparation of an animal model.

16. The use of a mouse generated by the method according to any one of claims 5 to 9 or a mouse constructed by the method according to any one of claims 10 to 14 in a model system for pharmacological and immunological research.

17. A method for constructing humanized mice with an immune system, wherein, The method includes: An AAV vector containing cytokine genes was injected into FLT3 gene knockout mice; the FLT3 gene knockout mice were optionally irradiated; and artificial hematopoietic stem cells were injected into the FLT3 gene knockout mice.

18. The method according to claim 17, wherein, The FLT3 gene knockout mouse is a mouse generated by the method of any one of claims 5 to 9 or a mouse constructed by the method of any one of claims 10 to 14.

19. The method according to claim 17 or 18, wherein, The AAV vector containing cytokine genes is selected from any one or more of the following: AAV vector containing human FLT3LG gene, AAV vector containing human IL15 gene, AAV vector containing human SCF gene, AAV vector containing human IL3 gene, AAV vector containing human GM-CSF gene, and AAV vector containing human IL6 gene.

20. The method according to claim 19, wherein, The AAV vector containing cytokine genes is: AAV vectors including the human IL15 gene; and / or AAV vectors including the human FLT3LG gene; and / or AAV vectors including the human SCF gene, AAV vectors including the human IL3 gene, AAV vectors including the human GM-CSF gene, and AAV vectors including the human IL6 gene.

21. The method according to claim 19 or 20, wherein, Each of the AAV vectors containing cytokine genes independently has a serotype selected from any one of AAV2, AAV8, and AAV9, preferably having the AAV9 serotype.

22. The method according to claim 19 or 20, wherein, The AAV vector containing cytokine genes is injected into FLT3 gene knockout mice via intraperitoneal injection or tail vein injection, more preferably via intraperitoneal injection. Preferably, the amount of AAV vector containing the human IL15 gene injected into the FLT3 gene knockout mouse is 1x10^8 to 1x10^11 GC / mouse. Preferably, the amount of AAV vector containing the human FLT3LG gene injected into the FLT3 gene knockout mouse is 1x10^8 to 1x10^10 GC / mouse, more preferably 1x10^8 to 1x10^9 GC / mouse. The amounts of AAV vectors containing the human SCF gene, the human IL3 gene, the human GM-CSF gene, and the human IL6 gene injected into the FLT3 gene knockout mice were 1x10^9~1x10^10 GC / mouse, 5x10^9~5x10^10 GC / mouse, 1x10^9~1x10^10 GC / mouse, and 5x10^9~5x10^10 GC / mouse, respectively.

23. The method according to claim 17 or 18, wherein, The AAV vector containing cytokine genes also includes a promoter and a terminator, wherein the promoter is a CAG promoter, an EF1A promoter or a CMV promoter, preferably a CAG promoter or an EF1A promoter; Preferably, the sequence of the CAG promoter is shown in SEQ ID No:

14.

24. The method according to claim 17 or 18, wherein, The FLT3 gene knockout mouse was constructed using one of the following mouse types: NOD-scid IL2RγKO mouse, NRG mouse, B6RG mouse, and BRG mouse.

25. The method according to claim 17 or 18, wherein, The artificial hematopoietic stem cells are umbilical cord blood CD34 cells or adult CD34 cells; preferably, the adult CD34 cells are bone marrow-derived CD34 cells, G-CSF-mobilized peripheral blood-derived CD34 cells, or iPS-derived CD34 cells.

26. A method for constructing humanized mice with an immune system, wherein, The method includes: Human peripheral blood mononuclear cells were injected into the FLT3 gene knockout mice.

27. The method according to claim 26, wherein, The FLT3 gene knockout mouse is a mouse generated by the method of any one of claims 5 to 9 or a mouse constructed by the method of any one of claims 10 to 14.

28. The method according to claim 26 or 27, wherein, The FLT3 gene knockout mouse was constructed using one of the following mouse types: NOD-scid IL2RγKO mouse, NRG mouse, B6RG mouse, and BRG mouse.

Citation Information

Patent Citations

  • Crispr / cas 9-mediated integration of polynucleotides by sequential homologous recombination of AAV donor vectors

    US20200131539A1

  • Transgenic mouse models supporting innate immune function

    US20220136002A1

  • Transgenic mouse models supporting human innate immune function

    US20230340524A1

  • Method for performing genetic modification on non-human animal and method for constructing immunodeficient animal model

    WO2022012544A1

  • Human FLT3l transgenic rodent in which human dendritic cells differentiate

    WO2022138928A1