Method for controlling weevil infestations or preventing same

The use of RNAi molecules in agricultural areas and trap plant strips targets beet weevil infestations, addressing inefficiencies and environmental concerns of current methods, providing a sustainable and effective control strategy.

WO2026003285A1PCT designated stage Publication Date: 2026-01-02AGRANA BET AG
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2025/068287
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-27
Filing Date
2025-06-27
Publication Date
2026-01-02

AI Technical Summary

Technical Problem

Current methods for controlling beet weevil infestations in sugar beet production are often inefficient, costly, and have negative environmental impacts, and there is a risk of resistance development with chemical treatments, while biological methods require careful planning and have not shown effective results in the field.

Method used

A method using nucleic acid molecules, particularly RNAi molecules, is applied to agricultural areas or trap plant strips to inhibit the metabolism, development, and reproduction of weevils, combined with precise application techniques and attractants to target the beet weevils effectively.

Benefits of technology

This approach efficiently prevents weevil infestations with minimal environmental harm, is economically viable, and does not require genetic modification of crops, offering a sustainable and effective control strategy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000005_0001
    Figure IMGF000005_0001
  • Figure 00000030_0000
    Figure 00000030_0000
  • Figure 00000031_0000
    Figure 00000031_0000
Patent Text Reader

Abstract

The present invention relates to a method for controlling a weevil infestation, in particular a beet weevil infestation, in the agricultural production of crop plants, wherein: (i) either a composition comprising one or more types of nucleic acid molecules, in particular interference RNA (RNAi) molecules, which inhibit the metabolism, development, reproductive ability or survivability of weevils (Curculionidae), in particular beet weevils (sugar beet weevils; Asproparthenis punctiventris), is applied to an area of agricultural land; or (ii) a composition which comprises one or more types of nucleic acid molecules, in particular of RNAi molecules, which inhibit the metabolism, the development, reproductive capacity or survivability of weevils, is applied to bait-plant strips at the edge of, in and / or around the area of agricultural land, wherein these bait-plant strips are sown with a bait-plant density of at least 50 plants / m2; such that the weevils, in particular the beet weevils, come into contact with the nucleic acid molecules, in particular the RNAi molecules, such that the development, reproductive capacity or survivability of the weevils is inhibited.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Methods for controlling or preventing weevil infestations

[0002] The present invention relates to a method for controlling beet weevil infestations, in particular the control of the sugar beet weevil (Beet weevil; Asproarthenis punctiventris, formerly Bothynoderes punctiventris), especially in connection with the agricultural production of sugar beets (Beta vulgaris ssp. vulgaris).

[0003] Weevils, particularly those of the family Curculionidae (weevils "in the narrower sense"), pose a significant threat to crops such as cereals, legumes, fruit trees, and ornamental plants. The effects of these infestations are far-reaching and can lead to substantial crop losses and economic damage. In sugar beet production, the beet weevil causes massive damage in some areas. Especially in Central, Southern, Southeastern, and Eastern Europe, as well as in Central Asia, the beet weevil is among the most economically significant pests. The risk of total crop failure is particularly high in the plains of northeastern Austria. Low rainfall and high average temperatures during the months of April to June favor the development of the beet weevil.

[0004] Controlling the beet weevil is a crucial aspect of securing crop yields. A combination of different control methods and techniques, including chemical, biological, and agronomic measures, must currently be employed to suppress the population. Even when all available control measures are used, it is not always possible to safeguard the crop.

[0005] 1. Chemical control methods:

[0006] The use of insecticides is one method for controlling the beet weevil in sugar beet fields. Chemically synthesized insecticides are applied either as a seed dressing directly to the seed and / or as a spray application during the growth cycle. This group of insecticides primarily acts as a contact insecticide, meaning the pest must be hit by the insect. Weather conditions and vibrations cause the beetle to migrate to the topsoil, which in turn makes the use of contact insecticides more difficult. The beetle must be directly hit by the insecticide to keep the population below the damage threshold (Eigner et al. 2020, 77th Brussels (IIRC Congress); https: / / www.iirb.org / fileadmin / IIRB / Congresses / 77th_IIRB_Congress / 3_Buch_Abstract_brochure_2020_final.pdf). However, with repeated use, there is a risk of resistance developing. This danger can hardly be avoided at present, as no alternative active ingredient is available.The timing of treatment depends on the beetle's activity and the weather; at high temperatures, treatment is usually carried out in the evening or morning. Neonicotinoid seed treatments showed good results at low beet weevil infestation levels. The use of neonicotinoids has been banned in the EU since 2018; however, in recent years with severe infestations, emergency authorizations for sugar beet cultivation were granted in some German states. At high infestation levels, however, seed treatment is insufficient. Since 2023, active ingredients from the neonicotinoid group have no longer been available as seed treatments. 2. Biological and physical control methods:

[0007] Biological control methods include the use of natural enemies and parasites to regulate weevil populations. One example is certain nematode species that can parasitize weevil larvae and kill them (Drmic et al., J. Centr. Europ. Agric. 21 (2020), 649-656; Zottele et al., Pathogens 12 (2023), 90). However, effective results have not yet been demonstrated in the field. No approved nematode products are available for controlling the beet weevil (Asproarthenis punctiventris). While some bird species and ground beetles can act as natural enemies of weevils, they do not contribute sufficiently to regulating their populations. The use of biological methods always requires careful planning and implementation to ensure effectiveness. Physical control methods include creating furrows in the soil.Firstly, in the fields following sugar beet cultivation (i.e., the previous year's area), measures are taken to block migration, and secondly, in the current sugar beet fields to prevent migration into the young beet stands. Additionally, both established and newly planted areas are equipped with pheromone traps to reduce the number of migrating beetles. In cases of severe infestation, the spacing between pheromone traps should be reduced to 10 meters. The use of traps with attractant baits (e.g., pheromones) in fields from the previous year can significantly reduce the infestation in newly planted areas. A laboratory comparison of the behavioral differences between mated females during egg-laying and unmated females during maturation feeding showed that – regardless of mating status – the females located the host plants by smell. Unmated females consume the largest amount of leaf mass of Beta vulgaris spp. due to their maturation feeding.Mated females generally consumed more leaf mass than unmated females, especially from plants with lower nutritional value. The larvae feed and develop not only on sugar beet roots, but also on weeds and other plants, e.g., from the Amaranthaceae family.

[0008] 3. Cultural measures:

[0009] Cultural measures aim to reduce the occurrence of the beet weevil to harmful levels by manipulating environmental conditions and cultivation practices. These include measures such as crop rotation, soil cultivation techniques, early sowing, and promoting early plant development. Furthermore, it is recommended not to plant beets directly adjacent to the previous year's beet fields. The first control measures in the annual cycle must be implemented in the older stands (the subsequent crop to the sugar beet), as this is where the egg-laying and development of the beetles in the soil took place.

[0010] Mechanical soil cultivation in autumn after harvest brings the pupal chambers and the beetles that have developed in them to the surface. This process can potentially destroy the chambers and contribute to a reduction in the beetle population. It is important to prevent the migration of the beetles from older crops to new fields as much as possible. One possibility – currently only theoretical – to divert the beetles away from the sugar beet is the planting of catch crops around the beet fields. The trap crop system is based on the idea of ​​accumulating the pests in an attractive food plant in order to selectively eliminate them there.

[0011] Based on current knowledge, a number of measures must be taken to protect sugar beets from the beet weevil and thus ensure a maximum harvest that extends (more or less) throughout the entire growing season: The first control measure targets the young beetles in the previous year's beet fields. From these fields, usually winter wheat fields, the pests migrate into the young beet fields. Both sexes locate their host plants by the scent or aroma (the "scent bouquet") of their leaves.

[0012] To prevent as many beetles as possible from migrating, the old beet fields are surrounded by aggregation traps (attractant: Grandlure III-IV). Ideally, up to 25% of the pests attempting to migrate can be captured. Similar aggregation traps are placed around the beet fields themselves to prevent migration. The first control measure involves applying a seed treatment. The active ingredient, flupyradifurone, which is distributed systemically in the plant sap, provides the sugar beet plants with temporary protection. Subsequently, depending on the pest pressure, approved insecticides (pyrethroids) are applied broadly to the beet crop. In Austria, this is possible up to three times. The accumulation of these treatments can worsen the habitat conditions for beet weevils. The success of all measures depends heavily on soil temperature and rainfall.A damp and cool spring leads to a scattered occurrence of the pest, which enhances the effectiveness of all control measures. In contrast, under hot and dry conditions, even the simultaneous application of all possible measures is insufficient to suppress the population.

[0013] Current methods for controlling the beet weevil are often inefficient, costly and can have negative environmental impacts, especially if they are based solely on chemical control methods.

[0014] WO 2017 / 205751 Al concerns insect control measures using pheromones and RNAi. Zhang et al. (Insect Mol. Biol. 19 (2010), 683-693) describe chitosan / dsRNA nanoparticle-mediated RNA interference for silencing chitin synthase genes. Yu et al. (Insect Sci. 20 (2013), 4-14) is a review article on the administration of dsRNA for RNAi in insects. WO 2021 / 204594 Al discloses nucleic acid-chaperone mixtures for insect control. Information on "Trapping Plants - Encyclopedia of Biology" (January 18, 2022) is available at the following URL: Ma et al. (Crop Sequence 53 (2013), 260-270) report on the potential of some hybrid maize lines to induce sunflower broomrape germination. Hirthe reports on “trapping plants to distract the pollen beetle” (2010), 32-38; available via the URL: https: / / www.landwirtschaft-mv.de / Fachinformationen / Gemuesebau / Oekologischer_Anbau / ?id=462&processor=processor.sa.lfaf (see article). Laudani et al. (Open Life Sequence 12 (2017), 214-222) describe RNAi-mediated gene silencing in Rhynchophorus ferrugines; The authors also point out that the effect of iRNA may differ in closely related beetles (here: in comparison with the model organism red flour beetle (Tribolium castaneum Herbst)).

[0015] Although some success has been achieved with the approaches described above at low infestation densities, they often remain insufficient.

[0016] Overall, controlling weevil infestations in sugar beet fields requires an integrated approach that combines various control methods and is tailored to the specific conditions of the growing area and the dynamics of the weevil populations. The challenge lies in developing effective and sustainable strategies that significantly minimize weevil damage to sugar beets while simultaneously reducing environmental impacts.

[0017] The object of the present invention is therefore to provide an efficient and specific method for controlling weevil infestations, particularly beet weevil infestations, in the agricultural production of crops at risk of weevil infestation, especially sugar beet production. This method should preferably be combinable with known measures for controlling such infestations and should be sustainable and environmentally friendly. It should also avoid harming other animals and plants, and in particular, should not harm beneficial organisms. Preferred objectives are to provide methods that are superior to known methods in terms of effectiveness, environmental compatibility, and economic efficiency.

[0018] Therefore, the present invention relates to a method for combating a weevil infestation, in particular a beet weevil infestation, in the agricultural production of crops, preferably for crops that are at risk of weevil infestation, in particular in the agricultural production of sugar beets (Beta vulgaris ssp. vulgaris) that are at risk of a beet weevil infestation, wherein

[0019] (i) either a composition which is applied to an agricultural area, in particular a beet field from the previous year, containing one or more types of nucleic acid molecules, in particular interference RNA (RNAi) molecules, which inhibit the metabolism, development, reproduction or viability of weevils (Curculionidae), in particular beet weevils (Asproarthenis punctiventris); or

[0020] (ii) a composition which applies one or more types of nucleic acid molecules, in particular RNAi molecules, which inhibit the metabolism, development, reproduction or viability of weevils, to trap plant strips at the edge of or around the agricultural area, in particular at the edge of or around the previous year's beet field, wherein these trap plant strips are sown with a trap plant density of at least 50 plants / m² 2 are planted; so that the weevils, especially the beet weevils, come into contact with the nucleic acid molecules, especially the RNAi molecules, so that the development, reproduction or survival of the weevils is inhibited.

[0021] Preferred weevils that are particularly suitable for control according to the invention, besides the beet weevil, are the large rapeseed stem weevil (Ceutorrhynchus napus) and the spotted cabbage stem weevil (Ceutorrhynchus pallidactylus), which are of particular importance as plant pests in rapeseed.

[0022] The present invention provides an innovative method that causes no or at least no significant damage to agricultural and ecological systems, and with which weevil infestations, in particular beet weevil infestations, can be efficiently and specifically controlled or prevented, at least to the extent that the infestation does not spread into a plague. The method according to the invention therefore has significant advantages in terms of effectiveness, environmental compatibility, and economic efficiency compared to methods known in the prior art.

[0023] The method according to the invention also represents an agricultural strategy that does not involve the genetic transformation of the crop, thus preserving the crop's natural state. The present invention therefore represents a methodology that does not require genetic modification of the plant or the lengthy breeding of resistances within the plant, and is thus particularly consumer-friendly. However, such a method presents a challenge in practice, as the pest must be specifically targeted (by bringing it into contact with the nucleic acid or even requiring it to ingest it), whereas with a transformed plant, one can wait until the pest appears, since the active agent cannot be washed off the plant by environmental influences (wind, rain) and therefore may no longer be effective against the beetle.Surprisingly, it has been shown that the strategy according to the present invention can still efficiently prevent or mitigate weevil infestations, particularly when the timing of the application of the composition and the planting of the trapping strip are coordinated with the beetle's life cycle (see below). This also provides the advantage of the invention that its use is not limited (spatially) to the beet field itself, but can also be used outside the field, and thus its use does not necessarily result in damage to the beet plants (through feeding).

[0024] The method according to the invention thus offers a novel approach to weevil control based on advanced technologies and biological principles. By combining precise sensors, which can advantageously be used in site-specific or spot-spraying applications, e.g., via GPS, with artificial intelligence that uses a neural network to recognize the pests and feeding damage and then triggers an application, and with targeted intervention, an efficient and environmentally friendly method is developed to control weevil populations and minimize potential damage to agricultural crops. RNAi therefore presents a significant challenge in weevil control, as the weevils are active at a stage in sugar beet development (mostly the cotyledon stage) where the plants are very small and are therefore quickly killed.

[0025] Crops at risk of weevil infestation (especially sugar beets, which are at risk of beet weevil infestation) are plants that an expert reasonably believes are likely to be affected. For example, an expert considers such a risk to exist if a crop field, particularly a sugar beet field, is located in a climatic and geographical area where weevil infestation has already occurred, or if the sugar beet field is geographically close to a region where weevil infestation has already taken place and the climatic conditions are such that a spread to the sugar beet field in question is not unlikely.

[0026] In particular, the inventive approach using a trap crop is an efficient variant that requires only minimal use of nucleic acid molecules and other chemical and biological pesticides, thus protecting the environment as a whole, but also specifically the crop being harvested, especially sugar beets, by minimizing or eliminating contact with pesticides. When applied to trap crops, no beet seedlings need to be damaged by ingestion to achieve the desired effect; this task is performed by the trap crop, ideally resulting in an undamaged beet field. Furthermore, the use of trap crops reduces the number of passes required, thereby lowering cross-compliance (CC) emissions.

[0027] The present invention also relates to a method for controlling weevil infestation in the agricultural production of crops that are at risk of weevil infestation, wherein a composition comprising one or more types of nucleic acid molecules that inhibit the metabolism, development, reproductive capacity or survival of weevils (Curculionidae),

[0028] (i) is applied to agricultural land; and / or

[0029] (ii) is applied to trap plant strips at the edge of, in and / or around the agricultural area; so that the weevils come into contact with the nucleic acid molecules, thereby inhibiting the development, reproductive capacity or survival of the weevils.

[0030] Preferably, the weevil infestation is a beet weevil (sugar beet weevil; Asproarthenis punctiventris) infestation.

[0031] According to a preferred embodiment of the present invention, the agricultural production of crops is the agricultural production of sugar beets (Beta vulgaris ssp. vulgaris) that are at risk of beet weevil infestation. Particularly preferred nucleic acid molecules according to the invention are interference RNA (RNAi) molecules.

[0032] Preferably, the agricultural land is a beet field from the previous year, in particular a beet field from the previous year that already showed signs of beetle infestation in the respective previous year.

[0033] Preferably, the trap plant strip is planted with a dense stand of trap plants. The denser the trap plant strips are planted with trap plants, the greater the trapping effect. Depending on the trap plant, the trap plant strips should contain at least one trap plant (especially if it is a trap shrub), preferably at least 5 trap plants per meter. 2 , preferably at least 10 trap plants / m² 2 , preferably at least 20 trap plants / m² 2 , in particular at least 50 trap plants / m² 2The trap plant strip is planted. According to the invention, the establishment of the trap plant strip is preferably carried out as an active process ("planting") of the trap plant strips with the trap plants. Although already established trap plants are also suitable for achieving a certain trapping effect, targeted planting, including quantitative planning, can better counteract the risk of infestation. In particular, consideration can be given to making the type and density of the plants in the trap strip, as well as the quantity of the applied composition, dependent on the extent of the previous year's infestation. If there was already an infestation in the previous year on or near the agricultural land, the quantity of trap plants and / or composition according to the invention used should be correspondingly higher than if there was no infestation in the previous year.Efficient application of the composition according to the invention is necessary simply because of the costs of producing the nucleic acid composition according to the invention, as is its interaction with methods known per se for controlling snout beetle infestations.

[0034] The placement, extent, and size (including planting density) of the trapping plant strips can also be selected based on such boundary conditions. According to the invention, the term "trapping plant strip" is not limited to a specific area or shape; a trapping plant strip according to the invention can also be provided, for example, as a rectangular or circular field, within or at the edge of the agricultural area. However, an elongated rectangle extending along the edge of an (usually also rectangular) agricultural area is the preferred embodiment for a trapping strip.

[0035] The application of the nucleic acid molecule-containing composition according to the invention can be carried out over the entire surface or only partially. For example, the application can be carried out only at the edge of the agricultural area, particularly if the application is carried out on agricultural land that was not infested in the previous year and is therefore only at risk from the migration of beetles from neighboring fields. According to a preferred embodiment, the application is carried out on a significant part of the agricultural area, e.g., on 30% or more of the area (especially the area from the previous year), particularly on 50% more of the area (especially the area from the previous year), or e.g., only on the side or part of the field where infestation is expected.Preferably, the trap plants are provided in at least one row, preferably in at least three rows, and most preferably in at least five rows, particularly if the trap plants are located at the edge of the agricultural area. "Edge" can refer to the entire perimeter of the agricultural area (e.g., the beet field); however, in special cases, only one side of the perimeter may be supplied with the trap plants (or nucleic acid compositions applied), for example, if infestation is expected only from one side. These specific configurations are intended to enable a particularly economical and environmentally friendly application of the measure.

[0036] The composition according to the invention is preferably applied as a spray, in particular as a spray that can be applied with conventional agricultural application methods. This preferred embodiment is particularly practical, as no special equipment needs to be purchased.

[0037] The composition according to the invention can include further components. Substances that particularly attract the beetles are especially preferred. The aim of the present invention is to inhibit the beetles by ingesting the nucleic acid. Accordingly, the provision of aggregation attractants and / or sex attractants, in particular pheromones, is particularly preferred. These can be applied together or separately with the nucleic acid composition. According to a preferred embodiment, the nucleic acid molecule comprises a polynucleotide that is a weevil RNAi, in particular a beet weevil RNAi, with which a corresponding mRNA of the weevil, in particular of the beet weevil, is degraded or its translation is blocked.Preferably, the nucleic acid molecule comprises a polynucleotide that is a weevil RNAi, in particular a beet weevil RNAi, directed against the chitin synthase gene, against a digestive enzyme in the weevil, in particular in the beet weevil, or against genes of the weevil, in particular in the beet weevil, involved in the detoxification and defense mechanisms of the weevil, in particular in the beet weevil. Further preferred examples are dre4 (SPT16 homolog, facilitates chromatin remodeling, subunit dre4), ncm (pre-mRNA splicing factor nucampholine), and Rpll 140 (RNA polymerase II subunit Rpl 1140).

[0038] Particularly preferred nucleic acids that can be used according to the invention are the proteasome subunit beta type 5 mRNA (this blocks the intracellular substrate (protein) degradation), the β-(beta)-actin mRNA (controls cell growth and migration), the mesh (dvssj2) mRNA (protein of the smooth septal junction, which is important for the structural integrity of the midgut epithelium), the α-COP mRNA (a subunit of the coatomer-protein complex I (COPI); involved in the intracellular vesicular transport of proteins), and α-amylase (a digestive enzyme that breaks down starch into smaller sugars).(It is expressed in the midgut), V-ATPase (a proton pump complex that pumps protons into organelles or across membranes to regulate pH), and the ecdysone receptor (a nuclear hormone receptor that responds to the steroid hormone 20-hydroxyecdysone) or combination (co-targeting) of these genes (or, more generally, the combination of two genes simultaneously; preferably involving at least one of the four mRNAs specifically mentioned here).

[0039] The inventive control of weevils in general, and in particular of the beet weevil, by means of inhibitory nucleic acids, especially RNAi molecules, is a promising approach based on molecular biology. RNAi is a natural process in which mRNA molecules are neutralized and degraded by RNAi, thereby inhibiting translation. This mechanism can be used to specifically influence the expression of genes in weevils, especially beet weevils, that are essential for their development, reproduction, or survival.

[0040] The implementation of RNAi to control weevils, especially beet weevils, usually takes place in several steps:

[0041] 1. Identification of suitable target genes:

[0042] First, specific genes in weevils, particularly turnip weevils, are identified whose suppression could lead to the beetles' death or impair their reproductive capacity. These genes could, for example, be responsible for vital metabolic processes, organ development, or the production of proteins essential for the beetles' survival.

[0043] 2. Design and manufacture of RNAi drugs:

[0044] Based on the identified target genes, specific RNAi agents are developed that can selectively reduce or suppress the expression of these genes in weevils, particularly beet weevils. These RNAi agents typically consist of double-stranded RNA molecules (dsRNA) that bind specifically to the target mRNA of the genes and inhibit their degradation or translation. Stabilization methods for the developed RNAi agent should be mentioned to ensure long-term stability of the RNAi composition until application. Cationic liposomes, chitosan nanoparticles, sodium tripolyphosphate nanoparticles, quantum dots, and silicon dioxide nanoparticles have proven effective for the formulation and stabilization of dsRNA.

[0045] Particularly preferred for transport methods by which the nucleic acid can be introduced into weevils, especially beet weevils, according to the invention are the following non-transgenic delivery technologies: i) Polymer or liposomic nanoparticles: These technologies could contribute to delivering dsRNA molecules to pest insects more efficiently. ii) Peptide-based delivery vehicles: Peptides could serve as carriers for dsRNA and enable targeted delivery to pest insects. iii) Virus-like particles: These could also serve as delivery vehicles and improve the efficiency of RNAi.

[0046] 3. Application of the RN Ai active ingredients:

[0047] The RNAi agents are applied to weevils, particularly beet weevils, either by using dsRNA-containing sprays on plants or other surfaces colonized by the beetles. The dsRNA enters the weevil cells, where it interacts with the target mRNA, triggering its degradation or inhibiting translation, ultimately leading to the suppression of protein synthesis.

[0048] 4. Monitoring of effectiveness and safety:

[0049] The efficacy and safety of the RNAi-based approach to controlling weevils, particularly beet weevils, can be carefully monitored and evaluated. This includes assessing the effects on target beetle populations as well as potential unintended effects on other organisms and the environment.

[0050] RNAi-based methods for controlling weevils, particularly beet weevils, have already shown promising results in laboratory studies. The present invention now presents, for the first time, a practically realized concept for a method that plays a crucial role in the development of sustainable and environmentally friendly pest control strategies, as it enables sufficient effectiveness, safety, and practical applicability of this technology while simultaneously ensuring economic viability. Compared to the use of chemical-synthetic pesticides, RNAi technology offers decisive advantages: a highly selective effect based on a natural mechanism; a short residence time (e.g., complete degradation after approximately 3 days) in the environment; and the possibility of combining different objectives in one and the same pest or even in different pests.

[0051] In particular, specific RNAi molecules were identified and tested that could potentially be used to control weevils, especially turnip weevils, e.g. the proteasome subunit beta type 5 mRNA, the β-(beta)-actin, the mesh (dvssj2) mRNA, the a (alpha) COP mRNA or the combination (co-targeting) of at least two genes simultaneously; in particular, at least one of the four mRNAs specifically mentioned here is used.

[0052] RNAi against the chitin synthase gene: Chitin is an essential component of the exoskeleton of insects, including beetles. Some studies have shown that suppressing the expression of the chitin synthase gene using RNAi leads to developmental disorders and death in weevils because their exoskeleton does not form properly.

[0053] RNAi against digestive enzymes: Digestive enzymes play a crucial role in the digestive system of weevils, particularly beet weevils, and are essential for the absorption of nutrients from their food. By selectively suppressing the expression of certain digestive enzymes using RNAi, weevils can be impaired in their food intake and nutrient utilization, ultimately leading to their death.

[0054] RNAi against detoxification and defense mechanisms: Weevils, especially beet weevils, possess various mechanisms for detoxifying chemical compounds and defending against harmful substances in their environment. Some studies have shown that suppressing the expression of genes involved in these detoxification and defense mechanisms using RNAi increases the sensitivity of weevils to insecticides or other harmful substances.

[0055] To achieve an effective effect, sufficient uptake of the RNA is crucial, which is complicated by the poor environmental stability of RNA and the sometimes limited uptake capacity of living organisms. Therefore, stabilizing formulations are preferably used to protect the RNA, for example, by adsorption to small clay particles or by encapsulation in liposomes. It is also possible to produce the RNA directly in microorganisms and simultaneously use them as protective and transport vehicles. Suitable, practically relevant formulations for the RNA are known to experts and are described, for example, in WO 2015 / 089543 Al, WO 2015 / 089590 Al, WO 2016 / 201523 Al, and WO 2016 / 164987 Al.Particularly preferred according to the invention are the provision of "layered double hydroxide (LDH) particles" (i.e., two-dimensional, layered double hydroxide nanomaterials belonging to the family of anionic clays (where the LDH ratio to dsRNA is preferably increased, in particular at least about 1 x dsRNA to 5 x LDH)) or silicon dioxide vesicles. Additionally, adsorption of dsRNA molecules onto clay complexes can protect the dsRNA molecules from naturally occurring nucleases and UV light.

[0056] Sugar beet is an important crop cultivated worldwide in temperate climates and is a key source of sugar production. The agricultural production of sugar beet fields involves a series of steps requiring careful planning, soil preparation, sowing, maintenance, and harvesting.

[0057] Soil preparation is a crucial step in sugar beet production and encompasses various measures to prepare the soil for sowing. These include plowing, harrowing, rolling, and possible tillage to loosen the soil and remove weeds. Soil preparation aims to create optimal soil structure and fertility to promote the growth and development of sugar beet plants.

[0058] Sowing is a crucial step in the process of introducing sugar beet seeds into prepared soil. Sowing is typically done in rows with a specific planting distance to ensure optimal plant development and effective weed control. Seed drills are the preferred method for sowing sugar beets, guaranteeing precise seed placement and even distribution across the field. Sugar beet cultivation encompasses a range of measures to promote growth and development throughout the growing season. These include irrigation, weed control, fertilization, and protection against pests and diseases. Irrigation plays a vital role in ensuring the sugar beets receive sufficient moisture, particularly during dry periods.

[0059] Weed control is an important aspect of sugar beet production, as weeds can impair the growth of the sugar beets and reduce the yield. Herbicides are frequently used to control weeds without harming the growth of the sugar beet plants.

[0060] Fertilization is generally based on soil analyses and the nutrient requirements of the sugar beet plants. Nitrogen, phosphorus, and potassium are essential nutrients needed for healthy sugar beet growth and are usually supplied in the form of mineral fertilizers.

[0061] Protection against pests and diseases is another important aspect of sugar beet production. Various pests such as weevils, aphids, and wireworms can cause significant damage to sugar beet plants and require timely control through the use of insecticides or other methods.

[0062] Sugar beets are typically harvested when the roots have grown sufficiently and reached a high sugar content. Modern harvesting machines, such as beet harvesters, are used to lift the sugar beets from the ground, clean them, and store them. The harvested sugar beets are then transported to sugar factories, where they are processed to extract the sugar.

[0063] Overall, the agricultural production of sugar beet fields requires careful planning, maintenance, and monitoring to achieve high yields and quality. Optimizing production practices and employing modern technologies and methods play a crucial role in increasing the efficiency and profitability of sugar beet farms.

[0064] One of the most common agricultural production methods for sugar beet fields involves a combination with the cultivation of winter wheat:

[0065] The combination of sugar beet cultivation with winter wheat as a preceding crop is therefore a proven practice in many agricultural regions, offering various advantages, including the diversification of cropping systems, the utilization of soil and resource efficiency, and the reduction of risks from environmental and market factors. Accordingly, this combination is also a preferred embodiment of the present invention.

[0066] 1. Crop rotation and planning:

[0067] The combination of sugar beets and winter wheat is usually part of a crop rotation, in which different crops are grown on the same field in successive years. Careful crop rotation planning is crucial to maintain soil fertility, control diseases and pests, and ensure optimal use of available resources.

[0068] The crop rotation of sugar beets and winter wheat offers advantages such as the suppression of weeds and diseases, the improvement of soil health through the supply of different nutrients, and the reduction of the risk of crop failure due to adverse weather conditions or pests, as the susceptibility to certain diseases and pests is reduced by rotating different crops.

[0069] 2. Soil preparation and sowing:

[0070] Soil preparation for winter wheat cultivation is similar to that for the sole production of sugar beets. The soil is plowed, leveled, and prepared to create optimal conditions for sowing. Modern agricultural machinery and equipment are used to ensure efficient soil preparation and sowing.

[0071] Sowing is carried out according to the requirements of winter wheat in row crops or in a mixed cropping system, with the planting distance and seeding density adjusted to the specific needs of both crops. Precise seed placement and even distribution in the field are crucial for successful plant establishment and development.

[0072] 3. Field maintenance:

[0073] Field management encompasses a range of measures to promote the growth and development of winter wheat during the growing season. These include irrigation, weed control, fertilization, and protection against pests and diseases relevant to both crops.

[0074] Irrigation is adjusted according to the needs of the two crops, with care taken to ensure adequate moisture supply, especially during dry periods.

[0075] Weed control is achieved through the use of herbicides, mechanical weed control, or manual labor to reduce weed competition and avoid negatively impacting the growth and yield of sugar beets and winter wheat.

[0076] Fertilization is based on soil analyses and the specific nutrient requirements of the two crops, taking into account nitrogen, phosphorus, potassium and other important nutrients to achieve healthy growth and high yields.

[0077] Protection against pests and diseases is achieved through timely monitoring and control of pests and diseases that can affect both crops. The use of insecticides, fungicides, and other pest control methods is carried out according to requirements and recommendations. 4. Harvesting and follow-up:

[0078] Sugar beets and winter wheat are harvested at different times, depending on the plants' stage of development and the optimal harvesting conditions. Modern harvesting machines and equipment are used to ensure efficient harvesting and post-harvest processing, including cleaning, storage, and marketing of the products.

[0079] Overall, combining sugar beet cultivation with winter wheat offers numerous benefits for farmers, including improved soil fertility, a diversified income source, and sustainable use of agricultural resources. With careful planning, management, and monitoring, farms can achieve successful and profitable production of sugar beet fields in combination with winter wheat.

[0080] A particularly advantageous method according to the invention is one in which the composition further comprises an attractant for the weevil, in particular the beet weevil, or in which the attractant is applied in conjunction with the application of the composition containing the nucleic acid molecule. The attractants tested were R,2S-cis-l-methyl-2-isopropenylcyclobutaneethanol (Grandlure I: CAS No: 26532-22-9) and (Z)-2-(3,3-dimethyl)-

[0081] Cyclohexylideneethanol (Grandlure II: CAS No: 26532-23-0), (Z)-(3,3-Dimethyl)-

[0082] Cyclohexylideneacetaldehyde (Grandlure III: CAS No: 26532-24-1) and (E)-(3,3-

[0083] Dimethylcyclohexylidene)acetaldehyde (Grandlure IV: CAS No: 26352-25-2). The mixture of (Z)-(3,3-dimethyl)-cyclohexylideneacetaldehyde with (E)-(3,3-dimethylcyclohexylidene)acetaldehyde is particularly attractive to the beet weevil. Alternative attractants can also include crushed or ground [unclear text].

[0084] Sugar beet components such as sugar beet leaves, or also crushed or ground components of plants that are attractive to the pest (e.g. trap plants), which have been preserved by drying and / or freezing, or extracts of sugar beet components such as sugar beet leaves, or of plants that are attractive to the pest (e.g. trap plants), whereby the scent or aroma (the "fragrance bouquet") of the (intact) plants or leaves is imitated.

[0085] The planting of the trap plant strips should be as dense as possible and can advantageously consist of at least 10, preferably at least 50, and in particular at least 100, trap plants per m². 2 or more. Trap planting strips sown with a trap plant density of 100 to 700, preferably 200 to 500, trap plants per m² 2 Planted areas have proven to be particularly advantageous according to the invention.

[0086] Preferably, the trap plant in the trap plant strips comes from the family Amaranthaceae, preferably from the genus Chenopodium, in particular white goosefoot; or from the genus Beta, in particular chard or beetroot.

[0087] The composition to be used according to the invention may contain further substances that are agriculturally or technically necessary or advantageous. The composition may also be combined with further compositions that can be used separately from the composition to be used according to the invention on the agricultural land, at the edge of the agricultural land, or in the catch strip. The composition to be used according to the invention preferably further comprises at least one adjuvant and / or at least one surfactant, and / or at least one suitable carrier or base material, and / or at least one suitable diluent. Particularly preferred additives are penetrators, binders, and / or conventional wetting agents. Penetrators serve to improve uptake and wetting in the leaf or pest. Examples include ethanol, surfactants, silicone oils, and / or calcium.Stickers increase the UV stability of the active ingredient and improve rainfastness, thus extending its duration of action. Particularly preferred examples include classic wetting agents that lower the surface tension of the spray solution, thereby improving the distribution of the active ingredient on the plant and reducing losses due to beading. Preferred classic wetting agents according to the invention include paraffin oils, rapeseed oil methyl ester, organosilicon, polyether-polymethylsiloxane copolymer, synthetic latex, aliphatic alcohols, siloxanes, rapeseed oil ethyl ester, rapeseed oil methyl ester, non-ionic surfactants, alkoxylated soybean oil, tall oil fatty acids, alkyl polyglycosides, acetic acid, synthetic latex, and combinations thereof, in particular the following combinations: synthetic latex / aliphatic alcohols / siloxanes, rapeseed oil ethyl ester / rapeseed oil methyl ester / non-ionic surfactants, alkoxylated soybean oil / tall oil fatty acids / alkyl polyglycosides / acetic acid.

[0088] The expert has many different options for choosing the sequence of the polynucleotide, so that after ingestion by the weevil, especially the turnip weevil, the polynucleotide leads to inhibition of growth and / or death and / or infertility of the weevil, especially the turnip weevil.

[0089] The application of the composition according to the invention to agricultural land or in the trap (plant) strip can be carried out in a conventional manner. Thus, existing equipment can be used to implement the method according to the invention. Advantageously, the composition is applied as a spray solution using a field sprayer as part of a broadcast application, preferably with an air-assisted field sprayer, particularly at a pressure of 3 bar or higher. The application is preferably selected so that the composition according to the invention is efficiently and precisely applied to the trap plants or the crop plants (e.g., sugar beets), with minimal loss to the soil. The sprayer settings are adjusted accordingly and can be easily adapted to each individual case and field geometry.

[0090] The method according to the invention is ideally suited for combination with other methods and measures known per se to those skilled in the art for controlling weevil infestations, in particular the chemical, biological, and physical measures described above. Therefore, a preferred embodiment of the present invention comprises a method in which one or more control methods known per se for weevils, in particular for beet weevils, are further applied, preferably at least one further chemical control method, at least one physical control method, and / or at least one further biological control method, and / or at least one further cultural and / or physical measure.

[0091] The timing of the application of the composition according to the invention should advantageously be coordinated with the life cycle of the weevils, i.e., for example, when the beetle appears on the surface or at the beginning of feeding in spring or at the transition from the larval stage to the adult beetle or immediately thereafter, so that the beetle population is still very small or very young (or just before), so that the development, reproductive capacity or survival of the weevils is inhibited as early as possible or the number of beetles is still relatively low.

[0092] The beet weevil usually overwinters in the previous year's beet fields in a vertical chamber in the soil at a depth of 10-20 cm, although pupal chambers at depths of 15-50 cm have also been described. The beetles become active when soil temperatures rise above +8°C and burrow to just below the surface. They emerge at the surface when air temperatures reach +8°C. Depending on the weather, the beetle appears from mid-March to April, with the timing being crucially dependent on dry soil and warm temperatures. After its emergence, the beetle begins feeding, with its food requirements influenced by temperature, but only increasing significantly above approximately 15°C. To reach sexual maturity, especially before mating and egg-laying, increased feeding ("maturation feeding") is necessary, during which a single beetle can destroy up to 8-10 young beet plants per day.Warm weather, due to increased food intake, usually leads to faster ripening and a higher number of eggs laid. Therefore, the beet weevil is most active as a beet pest between March and June, as it is most active at the soil surface during this time (Master's thesis by Lydia Jarmer, 2022).

[0093] Preferably, the composition is applied at an outside temperature of 8°C, preferably at 10°C, preferably between February and June, and particularly between March and May. Alternatively, the composition according to the invention can also be applied shortly before the adult beetles emerge from the pupa, so that the newly emerged beetles come into contact with the nucleic acid-containing composition during or immediately after the transition from the larval stage to the adult beetle. The adult beetles emerge from the soil and begin to feed. The beetles become active at a temperature of around 8 to 10 degrees Celsius, and the feeding phase then begins. Development from egg to young beetle takes 2 to 2.5 months, from egg to pupa: 45 days, and from pupa to young beetle: 13 days (Thielecke, Beitr. Enomol. 2 (1952), 256-315; DOI: 10.21248 / contrib.entomoL2.2-3.256-315).

[0094] The process according to the invention can also be carried out in combination with conventional plant protection products, such as in combination with one or more insecticides, in particular with flupyradifurone or with a pyrethroid. Flupyradifurone is a chemical compound from the butenolide group, which is effective as an insecticide, but, like neonicotinoids, is an nAChR agonist that permanently opens the nicotinic acetylcholine receptors and thus disrupts chemical signal transmission. It is less harmful to bees than most other neonicotinoids. Pyrethroids are synthetic insecticides based on the main active ingredients of the natural insecticide pyrethrum. The structure of a pyrethroid is generally derived from one of the natural pyrethrins, and its biological properties are essentially the same as those of known pyrethroids.Pyrethroids are typically characterized by their rapid action ("knockdown") even at low doses, their low toxicity to warm-blooded animals, their lipophilicity, and their low vapor pressure. Pyrethroids are cheaper and can be produced in larger quantities than pyrethrum, and are usually more effective.

[0095] The inventive method is particularly well suited to agricultural land, especially a sugar beet field from the previous year, on which winter wheat has been cultivated. The crop rotation of winter wheat and sugar beet is particularly well suited to the inventive method because it allows the life cycle of the weevils to be well integrated into the harvesting schedule and the treatment schedule according to the invention.

[0096] Depending on the species and climate, the trap plants can preferably be cultivated either in autumn or in early spring (i.e., in any case before the target crops, especially sugar beets) and can advantageously also be treated according to the invention before the crops begin to grow.

[0097] The present invention also relates to a method for controlling a beet weevil (Asproarthenis punctiventris) infestation, particularly when this spreads or has spread as a plague or calamity (i.e., severe damage to the crop, especially total crop failure), in the agricultural production of sugar beets (Beta vulgaris ssp. vulgaris), which occurs on or adjacent to an agricultural area intended for the cultivation of sugar beets or on which sugar beets are cultivated, the application of a composition containing a nucleic acid molecule comprising a polynucleotide, wherein uptake of the polynucleotide by the beet weevil leads to effective control of the beet weevil.

[0098] The present invention is described in more detail with reference to the following examples and the drawing figures, without, however, being limited thereto.

[0099] Fig. 1 shows the life cycle of the beet weevil and the preferred time periods for the application of the nucleic acids according to the invention to the agricultural land or the trap plants.

[0100] Figures 2 and 3 show application strategies of the concept according to the invention: Figure 2 shows the application in the previous year's crop (winter wheat) from an outside temperature of (10°C); Figure 3 shows the application on the sugar beet itself.

[0101] Materials and methods for preferred application scenarios of an RNAi spray according to the invention:

[0102] 1) Application technology in the previous year's inventory: Mounted field sprayer / Trailed field sprayer / Self-propelled field sprayer:

[0103] Nozzle type: 0.25 - 0.3 injector nozzles

[0104] Pressure: 3 bar

[0105] Driving speed: 8 km / h

[0106] Distance of spray bar from top edge of crop: 30-40 cm

[0107] Number of applications: lx

[0108] Application rate: 10g dsRNAi / ha

[0109] Water application rate: 200-250 l / ha

[0110] Air-assisted field sprayer (e.g. Twin Force from Hardy)

[0111] Nozzle type: 0.25 - 0.3 mm injector nozzles, although other droplet sizes will also work. Pressure: 3 bar

[0112] Driving speed: 8 km / h

[0113] Distance of spray bar from top edge of crop: 30-40 cm

[0114] Number of applications: lx

[0115] Application rate: 10g dsRNAi / ha

[0116] Water application rate: open) Application technology in sugar beet

[0117] Mounted field sprayer / Trailed field sprayer / Self-propelled field sprayer:

[0118] Nozzle type: IDKT (compact injector nozzle as a double flat jet nozzle)

[0119] Pressure: 3 bar

[0120] Driving speed: 8 km / h

[0121] Number of applications: lx

[0122] Application rate: 10g dsRNAi / ha

[0123] Water application rate: 200-250 l / ha ) Cultivation of catch crops to concentrate the pest

[0124] Cultivation of trap crops (e.g., chard, beetroot, etc.) around the new sugar beet fields and / or previous year's crops.

[0125] Planting time: from mid-February

[0126] Concentrated application of the RNAi spray in the area of ​​the trap plants; application of attractants (e.g., Grandlure III-IV) in combination with the RNAi spray

[0127] To achieve optimal results, the area must be completely enclosed with traps, with one trap placed every 15 meters. The RNAi spray is applied to the trap plants. These are sown at high density around the previous year's field and / or sugar beet. Application scenarios for the RNAi spray

[0128] 1) Application in the previous year's crop (especially winter wheat):

[0129] From an outside temperature of 10°C, the RNAi spray is applied according to the specifications mentioned in point 1 (the following scenarios (including those in points 2 and 3) are part of the general description of the present invention and are therefore generally applicable to all embodiments of the present invention): a. Broad coverage: the RNAi spray is applied to the entire area from the previous year or a significant part thereof, e.g., to 30% or more of the area from the previous year, in particular to 50% or more of the area from the previous year, or e.g., only to the side or part of the field where infestation is expected (Fig. 2a). b. Catch crop: In the marginal area, as described in point 2, trap crops are sown at a high density around the area from the previous year (which also includes the margin around only one side or e.g., on only two or three sides of the area from the previous year, in particular on the side or sides that border the nearest beet field).The application of the RNAi spray, with or without attractants or the scent / aroma ("scent bouquet") of sugar beet leaves, is concentrated in the area of ​​the trap crops (Fig. 2b). c. Catch Crop + Attractant (e.g., Grandlure): As described in point 2, trap crops are sown at a high density around the previous year's field or on one or more sides of it. Additionally, the RNAi spray, in combination with an attractant (e.g., Grandlure) or the scent / aroma ("scent bouquet") of sugar beet leaves, is applied either in the form of attractant traps (at intervals of, for example, 15 m in the trap crop strip) and / or as a spray (Fig. 2c).

[0130] 2) Application in sugar beet a. Broad-area application: The RNAi spray is applied to the entire sugar beet field or a portion thereof (e.g., 30% or more of the previous year's area, particularly 50% or more of the previous year's area) or, for example, only to the side or part of the field where infestation is expected (Fig. 3a). b. Catch crop: As described in point 2, trap plants are sown at a high density around the current sugar beet field (which also includes the edge around only one side or, for example, only two or three sides of the previous year's area, particularly the side or sides adjacent to the nearest beet field). The application of the RNAi spray, with or without attractants or the scent or aroma ("scent bouquet") of sugar beet leaves, is concentrated in the area of ​​the trap plants (Fig. 3b). c. Catch crop + attractant (e.g.,Grandlure): As described in point 2, trap plants are sown at high density around the current sugar beet field. Additionally, the RNAi spray is applied in combination with the attractant (Grandlure) or the scent / aroma ("scent bouquet") of the sugar beet leaves, either in the form of attractant traps (at intervals of, for example, 15 m in the trap plant strip) and / or as a spray (Fig. 2c).

[0131] 3) Application in the previous year's crop and sugar beet (combination of points 1 & 2) a. Broad-area application: The RNAi spray is applied to the entire area, both the previous year's area and the current sugar beet field (or a significant part thereof, e.g., 30% or more of the previous year's area, especially 50% or more of the previous year's area), or, for example, only to the side or part of the field where infestation is expected (Fig. 2a + Fig. 3a). b. Catch crop: In the marginal area, as described in point 2, trap crops are sown at high density around the previous year's area (which also includes the margin around only one side or, for example, only two or three sides of the previous year's area, especially the side or sides adjacent to the nearest beet field) and the current sugar beet field. The application of the RNAi spray, with or without the scent bouquet of sugar beet leaves, is concentrated in the area of ​​the trap plants (Fig. 2b + Fig. 3b). c.Catch Crop + Attractant (e.g., Grandlure): As described in point 2, trap crops are sown at high density around the previous year's field and the current sugar beet field, or on one or more sides of it. Additionally, the RNAi spray, in combination with an attractant (e.g., Grandlure) or the scent or aroma ("scent bouquet") of sugar beet leaves, is applied either in the form of attractant traps (at 15m intervals in the trap crop strip) and / or as a spray (Fig. 2c + Fig. 3c).

[0132] Example

[0133] To test the lethal effects of dsRNA molecules on A. punctiventris, artificial insect feeding is used. Artificial insect feeding is employed for mass breeding, nutritional studies, toxicity testing, and similar purposes, and is therefore widely used in science (Vanderzant (Ann. Rev. Entomology, 19 (1974), 139-160); Cohen (Am. Entomologist 47 (2001), 198-206); Pourkhatoon et al. (J. Econ. Entomol. 109 (2016), 1273-1282); Schlesener et al. (Entomol. Exp. Appl. 166 (2018), 932-936)). The feeding experiment investigates whether orally administered dsRNA molecules have lethal effects on *A. punctiventris* within a defined time period. For this purpose, the beetles are fasted for 12 hours prior to the experiment. Afterwards, they are transferred to Petri dishes and each given a 1 cm leaf disc (goosefoot) to eat. These leaf discs have been previously treated with the respective treatment (water, dsGFP, or dsRPII33).

[0134] (GCCAAGAGTGCAGTGTGGAATTCACCCTCGACGTAAAGTGTACAGATGACCAAACCAGACATGTAACCACAG CAGATCTGAAATCAAGTGATCCTCGAGTAATACCAGCCACTTCCAAACACAGAGAATGAAGACTCTGCTGAATAT GGAGAGACTGATGAAATTCTGATAGTGAAACTACGTAAGGGTCAAGAGTTGAAGTGCGCGCATATGCTAAA AAGGGGTTTGGGAAAGAACATGCTAAATGGAACCCCACTTGTGGGGTTGCCTTTGAA). The amount of dsRNA used was 20 pl of the dsRNA treatment (0.75 g / L). The following day, the beet weevils were transferred to a cage on a plant, with all animals from one treatment placed together in one cage. Mortality was then determined. If unformulated dsRNA (RPII33) preparations do not show sufficient efficacy, formulated variants based on nanoparticulate lipid systems are tested. Experimental animals are captured in the wild under natural conditions and stored at 6°C until use (Cohen, Am. Entomol. 47 (2001), 198-206; Pourkhatoon et al., J. Econ. Entomol 109 (2016), 1273-1282; Hoffmann Schlesener et al., Entomol. Exp. Appl.).166 (2018): 932-936; Vanderzant, Ann. Rev. Entomol. 19 (1974), 139-160).

[0135] The following sequences are used:

[0136] Gene name, then the specific dsRNA construct and the PCR product size, e.g. “202” for dre4) dre4

[0137] GGTGGTGCAAAAGGTGTGGAAAAAGTCAGAAAAAATACAATATCTTACAAGAATGTTAATCAGATGCCA AGAGTTTCTGAAGTTAAAGAAATGAAAATTTATGTTGATCAGAAATATGAAACAGTCATATTACCAATTTATGG TGTTCCTGTTCCATTCCATATTTCAACCATAAAAAATGCTGTCCCATCAGTGGAAGGAG 202 dre4

[0138] CGAGATGATAGCGGCGACAGGCACAAATCGAAAAAGTTCCAAAAAATAATTTTTTTCTCGTTGTTTACAAT TTAGTCAGTCGGCAACAATTGATATCTGAATATTTTCGTTCCGTTGACGAATCAGCCAGCCAATATAGTGAATA TTGGTTCCTTAATAACTTTCGTGCTATTTTTGAGCCTTTGAAAGTCTTTAAGAATATTTATAAATATGTATGAGAT AGTTCCGAGTCGGTTTTCTGTTTCTTGTCCTTGGAGAAAGGCGGCAAACT 270 ncm

[0139] AGCACAAGCTGCCTCCCAACATTTACAAATGTTTATGCAGCTTTAGTTGCAGTTATTCCAAAATTTCC AAACATTGGTGAACTTTTATTGAAGCGTTTAGTATTGCAGTTTAAAAGGGGGTTAACAAAATAATAAAACAA TTTGCATATCTGCAGCAACATTCATTGCTCACCTAGTTAACCAATCTGTAGCACATGAAATATTAGCTCTGGAAA TCTTAACACTACTAATAGAAACTCCTACGGATGATTCTGTTGAAGTTGCTATTGC 276 ncm

[0140] TGTGGAGCCCTTTCAACAGATTTTCAGACACATATTCCCAACACATAGACTGGACACAAAACAGATTA AGGAATGTTAGCAAATCTTTGCCCATTTGTTTTTTACTGCCATAAGCTGGGAAGTGTTAGAAATTATGAA AATGAATGAAGAAGACACTAATAGTTCAAGTAAATTGATTGATTGATTGAATTAGCAACATTA TGGGACTGGGAAACTGAATCAGAGGTTGAAGGATCCGACACTTCAAGGTCATTTTGCGGGTC 281 dre4 ACAAGAAATAGAATTCGATACGCCTTTCCGAATTAGGATTTCCAGGTGTACCATTCAGATCAACAGTA

[0141] TTGCTTCAACCAACTTCAGGTTGTTTAGTGCACCTAACGGAATGGCCACCTTTCGTTATCACATTGGAAGACGTC GAACTAGTACACTTTGAACGTATCCAATTTCATCTCAAGAACTTTGATATGGTCTTTGTATTTAAAGATTACCAT AGAAAAACCGCTATGGTCACTGCCATACCAA 251 dre4 AGATGAAGAATTAGGTTCAGAAGAAGAATCTGGCAAAGACTGGTCTGATTTAGAAAGGGAAGCGGCCG AGGAGATCGCGAAAGGAACTACGATGTGTTTGAAGACGATCGAAAAGGAGGCCGTAAAAACAATTTCCCAT CGAAGATAAACACAAATCCTCTAGCAAACATTCCAGCTCGAAACATAGTTCTAGTAATCATAAAAAACAGCTCG CONTAINSCACAATTCGTCGGGCAAACATAACAGCA 251 ncm CATCAAGTTCAAGTGAGTAGTGATGACAGCTCAGATTCAAGCGAAAGTTCCAAGAACAAACCAACTA

[0142] AAAAGAGAAAAGAGTCTAATAAAAAACTGACCGATTCACACAAGTCGGAGAGGCGTCTGTCTAAAAAAAACT CGTTATCAGATCGGGAAGATCAAGATAGACGCTCTAAGAGGCAAAACCGCAATCGCAGTATATCAGAAGACC GAGGGGAATATCGTCAAAAACGTAGAAGATCGCCCGAA 251 ncm ATAATGAATAATGAAGAGAGTAGCTCTAGTTCCAGCTCATCAAGTTCAAGTGAGGATAGTGATGACAGCTCAG ATTCAAGCGAAAGTTCCAAGAACAAACCAACTAAAAAGAGAAAAGAGTCTAATAAAAAACTGACCGATTCACA CAAGTCGGAGAGGCGTCTGTCTAAAAAAAACTCGTTATCAGATCGGGAAGATCAAGATAGACGCTCTAAGAG GCAAAACCGCAATCGCAGTATATCAGAAGACCGAGGGGAATAT 251

[0143] RPII140 GACGCCGTTAACGTACAGAAGATTTCAACACTTTTGCAAGAGTATGGCTATCAGCTCAGAGGAAATGAG GTCATGTTCAACGGACACACTGGCAGGAAAATCAACGCCCAAATTTTCTTGGGCCCCACTTATTACCAACGTCT AAAGCACATGGTGGACGACAAAATCCACTCCAGAGCGAGAGGCCCCGTACAGATCCTCGTGAGGCAGCCTAT GGAAGGTAGGGCCCGAGACGGAGGACTGCGTTTCGG 251

[0144] RPII140 ATTTCAACACTTTTGCAAGAGTATGGCTATCAGCTCAGAGGAAATGAGGTCATGTTCAACGGACACACTG

[0145] GCAGGAAAATCAACGCCCAAATTTTCTTGGGCCCCACTTATTACCAACGTCTAAAGCACATGGTGGACGACAA AATCCACTCCAGAGCGAGAGGCCCCGTACAGATCCTCGTGAGGCAGCCTATGGAAGGTAGGGCCCGAGACGG AGGACTGCGTTTCGGCGAAATGGAACGGGACTGTCA 251

[0146] RPII33 GCCAAGAGTGCAGTGTGGAATTCACCCTCGACGTAAAGTGTACAGATGACCAAACCAGACATGTAACCA CAGCAGATCTGAAATCAAGTGATCCTCGAGTAATACCAGCCACTTCCAAACATAGAGATGAAGACTCTGCTGA ATATGGAGAGACTGATGAAATTCTGATAGTGAAACTACGTAAGGGTCAAGAGTTGAAGGTGCGCGCATATGC TAAAAAGGGGTTTGGGAAAGAACATGCTAAATGGAACCCCACTTGTGGGGTTGCCTTTGAA 275

[0147] Accordingly, the present invention relates to the following preferred embodiments: 1. A method for controlling weevil infestation in the agricultural production of crops, preferably for crops that are at risk of weevil infestation, comprising a composition containing one or more types of nucleic acid molecules that inhibit the metabolism, development, reproductive capacity or survival of weevils (Curculionidae),

[0148] (i) is applied to agricultural land; and / or

[0149] (ii) is applied to trap plant strips at the edge of, in and / or around the agricultural area; so that the weevils come into contact with the nucleic acid molecules, thereby inhibiting the development, reproductive capacity or survival of the weevils.

[0150] 2. Method according to embodiment 1, wherein the weevil infestation is a beet weevil (sugar beet weevil; Asproarthenis punctiventris) infestation.

[0151] 3. Method according to embodiment 1 or 2, wherein the agricultural production of crops is an agricultural production of sugar beets (Beta vulgaris ssp. vulgaris) for which there is a risk of beet weevil infestation.

[0152] 4. Method according to one of embodiments 1 to 3, wherein the nucleic acid molecule is an interference RNA (RNAi) molecule.

[0153] 5. Method according to one of embodiments 1 to 4, wherein the agricultural land is a beet field from the previous year and / or wherein the application is carried out on a significant part of the agricultural land, preferably on 30% or more of the land, in particular on 50% more of the land, or only on the side or part of the field where infestation is to be expected.

[0154] 6. Method according to one of embodiments 1 to 5, wherein the trap plant strips are planted with a dense trap plant seeding.

[0155] 7. Method according to one of embodiments 1 to 6, wherein the trap plant strips contain at least one trap plant, preferably at least 5 trap plants / m² 2 , preferably at least 10 trap plants / m² 2 , preferably at least 20 trap plants / m² 2 , in particular at least 50 trap plants / m² 2 , are planted.

[0156] 8. Method according to one of embodiments 1 to 7, wherein the trapping plant strips are provided within the agricultural area.

[0157] 9. Method according to one of embodiments 1 to 8, wherein the composition is applied over the entire surface or not over the entire surface, preferably only at the edge of the agricultural area, wherein an application not over the entire surface is preferably carried out on agricultural areas that were not infested in the respective previous year.

[0158] 10. Method according to one of embodiments 1 to 9, wherein the composition is applied as a spray, in particular as a spray that can be applied using conventional agricultural application methods.

[0159] 11. Method according to one of embodiments 1 to 10, wherein the composition further comprises an aggregation attractant and / or a sex attractant, in particular a pheromone, or crushed or pulverized sugar beet leaves preserved by drying and / or freezing, or extracts of sugar beet leaves.

[0160] 12. A method according to one of embodiments 1 to 11, wherein the nucleic acid molecule comprises a polynucleotide that is a weevil RNAi, in particular a beet weevil RNAi, with which an associated mRNA of the weevil, in particular of the beet weevil, is degraded or its translation is blocked, such as the proteasome subunit beta type 5 mRNA, the β-(beta)-actin, the mesh (dvssj2) mRNA, the α-COP mRNA, α-amylase, V-ATPase, and the ecdysone receptor, or the combination (co-targeting) of at least two genes simultaneously; wherein in particular at least one of the four mRNAs specifically mentioned herein is used.

[0161] 13. Method according to one of embodiments 1 to 12, wherein the nucleic acid molecule comprises a polynucleotide that is a weevil RNAi, in particular a beet weevil RNAi, directed against the chitin synthase gene, against a digestive enzyme in the weevil, in particular in the beet weevil, or against genes of the weevil, in particular of the beet weevil, which are involved in the detoxification and defense mechanisms of the weevil, in particular of the beet weevil.

[0162] 14. Method according to one of embodiments 1 to 13, wherein the composition further comprises an attractant for the weevil, in particular the beet weevil, or the attractant is applied in connection with the application of the composition containing the nucleic acid molecule.

[0163] 15. Method according to one of embodiments 1 to 14, wherein the composition includes a

[0164] Attractant selected from lR,2S-cis-l-methyl-2-isopropenylcyclobutanethanol (Grandlure I: CAS No: 26532-22-9), (Z)-2-(3,3-dimethyl)-cyclohexylideneethanol (Grandlure II: CAS No: 26532-23-0), (Z)-(3,3-dimethyl)-cyclohexylideneacetaldehyde (Grandlure III: CAS No: 26532-24-1), (E)-(3,3-

[0165] Dimethylcyclohexylidene)acetaldehyde (Grandlure IV: CAS No: 26352-25-2), or mixtures thereof, in particular (Z)-(3,3-Dimethyl)-cyclohexylideneacetaldehyde, (E)-(3,3-

[0166] Dimethylcyclohexylidene)acetaldehyde or a mixture of (Z)-(3,3-Dimethyl)-

[0167] It contains cyclohexylidene acetaldehyde and (E)-(3,3-Dimethylcyclohexylidene) acetaldehyde.

[0168] 16. Method according to one of embodiments 1 to 15, wherein the trap plant strips are sown with a trap plant density of 100 to 700, preferably 200 to 500, trap plants per m² 2 are planted.

[0169] 17. Method according to one of embodiments 1 to 16, wherein the trap plant in the trap plant strips is selected from plants of the family Amaranthaceae, preferably from the genus Chenopodium, in particular white goosefoot; or from the genus Beta, in particular chard or beetroot.

[0170] 18. Method according to one of embodiments 1 to 17, wherein the composition further comprises at least one adjuvant and / or at least one surfactant and / or at least one effective plant protection agent and / or at least one suitable carrier or base material and / or at least one suitable diluent, preferably wherein the composition comprises at least one or more penetrators, stickers, and / or classic wetting agents.

[0171] 19. Method according to one of embodiments 1 to 18, wherein the polynucleotide, after being ingested by the weevil, in particular the beet weevil, leads to the inhibition of growth and / or death and / or infertility of the weevil, in particular the beet weevil.

[0172] 20. Method according to one of embodiments 1 to 19, wherein the application of the composition as a spray solution is carried out using a field sprayer as part of a broad-area application, preferably using an air-assisted field sprayer, in particular with a pressure of 3 bar or higher.

[0173] 21. Method according to one of embodiments 1 to 20, wherein one or more control methods known per se for weevils, in particular for beet weevils, are further applied, preferably at least one further chemical control method, at least one physical control method and / or at least one further biological control method and / or at least one further cultural and / or physical measure.

[0174] 22. Method according to one of embodiments 1 to 21, wherein the application of the composition is carried out from an outside temperature of 10°C, preferably in the period from February to June, in particular from March to May; or during the transition from the larval stage to the adult beetle or immediately thereafter.

[0175] 23. Method according to one of embodiments 1 to 22, wherein the application of the composition is combined with the application of a plant protection product, preferably an insecticide, in particular flupyradifurone or a pyrethroid.

[0176] 24. Method according to one of embodiments 1 to 23, wherein winter wheat has been cultivated on the agricultural land, in particular on the previous year's beet field.

[0177] 25. Method according to one of embodiments 1 to 24, wherein the trap plants have been cultivated either in autumn or in early spring.

[0178] 26. Method for controlling a beet weevil (sugar beet weevil; Asproarthenis punct / ventr / s) infestation in the agricultural production of sugar beet (Beta vulgaris ssp. vulgaris), comprising on or adjacent to an agricultural area intended for or on which sugar beet is grown, the application of a composition containing a nucleic acid molecule comprising a polynucleotide, wherein uptake of the polynucleotide by the beet weevil leads to effective control of the beet weevil.

Claims

Patent claims 1. Methods for controlling weevil infestations, in particular beet weevil infestations, in the agricultural production of crops at risk of weevil infestation, especially in the agricultural production of sugar beets (Beta vulgaris ssp. vulgaris) at risk of weevil infestation, wherein (i) either a composition that is applied to agricultural land containing one or more types of nucleic acid molecules, in particular interference RNA (RNAi) molecules, which inhibit the metabolism, development, reproductive capacity or viability of weevils (Curculionidae), in particular beet weevils (Asproarthenis punctiventris); and / or (ii) a composition comprising one or more types of nucleic acid molecules, in particular RNAi molecules, which inhibit the metabolism, development, reproductive capacity or viability of weevils, applied to trap plant strips at the edge of, within and / or around the agricultural area, wherein these trap plant strips are sown with a trap plant density of at least 50 plants / m² 2 are planted; so that the weevils, especially the beet weevils, come into contact with the nucleic acid molecules, especially the RNAi molecules, so that the development, reproductive capacity or survival capacity of the weevils is inhibited.

2. Method according to claim 1, wherein the nucleic acid molecule comprises a polynucleotide that is a weevil RNAi, in particular a beet weevil RNAi, with which an associated mRNA of the weevil, in particular of the beet weevil, is degraded or its translation is blocked.

3. Method according to claim 1 or 2, wherein the nucleic acid molecule comprises a polynucleotide that is a weevil RNAi, in particular a beet weevil RNAi, directed against the chitin synthase gene, against a digestive enzyme in the weevil, in particular in the beet weevil, or against genes of the weevil, in particular of the beet weevil, involved in the detoxification and defense mechanisms of the weevil, in particular of the beet weevil, preferably dre4, ncm and Rpl 1140.

4. Method according to 1 to 3, wherein the composition further comprises an attractant for the weevil, in particular the beet weevil, or the attractant is applied in connection with the application of the composition containing the nucleic acid molecule.

5. A method according to any one of claims 1 to 4, wherein the composition includes an attractant selected from 1R,2S-cis-1-methyl-2-isopropenylcyclobutaneethanol (Grandlure I: CAS No: 26532-22- TI 9), (Z)-2-(3,3-dimethyl)-cyclohexylideneethanol (Grandlure II: CAS No: 26532-23-0), (Z)-(3,3-dimethyl)-cyclohexylideneacetaldehyde (Grandlure III: CAS No: 26532-24-1), (E)-(3,3- Dimethylcyclohexylidene)acetaldehyde (Grandlure IV: CAS No: 26352-25-2), or mixtures thereof, in particular (Z)-(3,3-Dimethyl)-cyclohexylideneacetaldehyde, (E)-(3,3- Dimethylcyclohexylidene)acetaldehyde or a mixture of (Z)-(3,3-Dimethyl)- It contains cyclohexylidene acetaldehyde and (E)-(3,3-Dimethylcyclohexylidene) acetaldehyde.

6. Method according to any one of claims 1 to 5, wherein the trap plant strips are sown with a trap plant density of 200 to 500 trap plants per m² 2 are planted.

7. Method according to any one of claims 1 to 6, wherein the trap plant in the trap plant strips is selected from plants of the family Amaranthaceae, preferably from the genus Chenopodium, in particular white goosefoot; or from the genus Beta, in particular chard or beetroot.

8. Method according to any one of claims 1 to 7, wherein the composition further comprises at least one adjuvant and / or at least one surfactant and / or at least one effective plant protection agent and / or at least one suitable carrier or base material and / or at least one suitable diluent, preferably wherein the composition comprises at least one or more penetrators, stickers, and / or classic wetting agents.

9. Method according to any one of claims 1 to 8, wherein the polynucleotide, after being ingested by the weevil, in particular the beet weevil, leads to the inhibition of growth and / or death and / or infertility of the weevil, in particular the beet weevil.

10. Method according to any one of claims 1 to 9, wherein the application of the composition as a spray solution is carried out using a field sprayer as part of a broad-area application, preferably using an air-assisted field sprayer, in particular with a pressure of 3 bar or higher.

11. Method according to any one of claims 1 to 10, wherein one or more control methods known per se for weevils, in particular for beet weevils, are further applied, preferably at least one further chemical control method or at least one further biological control method and / or at least one further cultural measure.

12. Method according to any one of claims 1 to 11, wherein the application of the composition is carried out from an outside temperature of 8°C, preferably 10°C, preferably during the period February to June, especially March to May; or during the transition from the larval stage to the adult beetle or immediately afterwards.

13. Method according to any one of claims 1 to 12, wherein the application of the composition is combined with the application of a plant protection product, preferably an insecticide, in particular flupyradifurone or a pyrethroid.

14. Method according to any one of claims 1 to 13, wherein winter wheat has been cultivated on the agricultural land, in particular on the previous year's beet field; and / or wherein the trap plants have been cultivated either in autumn or in early spring.

15. Method for controlling a beet weevil (Asproarthenis punct / ventr / s) infestation in the agricultural production of sugar beets (Beta vulgaris ssp. vulgaris), comprising on or adjacent to an agricultural area intended for or on which sugar beets are grown, the application of a composition containing a nucleic acid molecule comprising a polynucleotide, wherein uptake of the polynucleotide by the beet weevil leads to effective control of the beet weevil.

Citation Information

Patent Citations

  • Method of synthesis of silica vesicles and use thereof

    WO2015089590A1

  • Composition, particulate materials and methods for making particulate materials.

    WO2016164987A1

  • Plant-protecting RNAI compositions comprising plant-protecting double-stranded RNA adsorbed onto layered double hydroxide particles

    WO2015089543A1

  • composition

    WO2016201523A1

  • Improved insect control strategies utilizing pheromones and rnai

    WO2017205751A1