Method for enhancing efficiency of homologous recombination in in-vitro and in-vivo genome editing
By employing an ATM inhibitor with donor DNA and a sequence-specific nucleic acid cleaving molecule, the method enhances homologous recombination efficiency in genome editing, addressing the low efficiency issue and enabling precise genome editing in cells like hematopoietic stem cells and fertilized eggs.
Patent Information
- Application Number
- PCT/JP2025/023203
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-06-28
- Filing Date
- 2025-06-27
- Publication Date
- 2026-01-02
AI Technical Summary
The efficiency of homologous recombination in genome editing is low, particularly in cells with slow cell cycles such as hematopoietic stem cells, leading to inaccurate repair processes like non-homologous end joining, which hampers precise genome editing.
A method involving the use of an ATM inhibitor in conjunction with donor DNA and a sequence-specific nucleic acid cleaving molecule to introduce a double-strand break, followed by culturing cells to enhance homologous recombination efficiency.
The method significantly increases the efficiency of homologous recombination, allowing for precise genome editing by promoting the use of donor DNA for accurate repair in various cell types, including hematopoietic stem cells and fertilized eggs.
Smart Images

Figure JPOXMLDOC01-APPB-I000002 
Figure JPOXMLDOC01-APPB-I000003 
Figure JPOXMLDOC01-APPB-I000005
Abstract
Description
Methods for increasing the efficiency of homologous recombination in in vitro and in vivo genome editing
[0001] The present disclosure relates to methods for increasing the efficiency of homologous recombination in genome editing in vitro and in vivo in the presence of donor DNA (recombinant template DNA). The present disclosure provides a method for culturing cells having a double-strand break in a target sequence in the presence of donor DNA and an ATM inhibitor.
[0002] Genome editing technology has been developed, and a homologous recombination repair method has been developed to replace target regions in the genome of cells with desired sequences. At the end of 2023, the world's first genome therapy drug (CASGEVY™) using the CRISPR / Cas9 system was approved for the treatment of sickle cell disease and beta-thalassemia (https: / / www.fda.gov / news-events / press-announcements / fda-approves-first-gene-therapies-treat-patients-sickle-cell-disease). CASGEVY treats these diseases by disrupting the BCL11A gene, stopping the production of mutated adult hemoglobin and promoting the production of functional fetal hemoglobin.
[0003] In genome editing, double-strand breaks are specifically introduced at target sites in the genome using various sequence-specific nucleic acid cleaving molecules. Double-strand break repair induces errors, and thus is used for gene disruption as described above. However, in the presence of donor DNA (recombinant template DNA), the double-strand break induces homology-directed repair (HDR) at the break site using the donor DNA, resulting in the precise replacement of the region between the left and right homology arms of the donor DNA with the corresponding genomic sequence. Because of the precision of the editing, genome editing via homology-directed repair is desirable for many medical purposes, but low editing efficiency remains a challenge (Frangoul et al. NEJM, 2021). Homologous recombination occurs particularly between the S and G2 phases. However, in cells with slow cell cycles, such as hematopoietic stem cells, the efficiency of homologous recombination is low, making them prone to other inaccurate repair processes, such as non-homologous end joining (NHEJ).
[0004] The present disclosure provides a method for increasing the efficiency of homologous recombination in genome editing in the presence of donor DNA (recombinant template DNA). The present disclosure provides a method for culturing a cell having a double-strand break in a target sequence in the presence of donor DNA and an ATM inhibitor.
[0005] According to the present disclosure, it has been found that ATM inhibitors increase the efficiency of homologous recombination in genome editing in the presence of linear donor DNA (recombination template DNA). Specifically, ATM inhibitors increased the efficiency of homologous recombination in genome editing in the presence of donor DNA (recombination template DNA) in various cells such as pluripotent stem cells, hematopoietic stem cells, and fertilized eggs.
[0006] According to the present disclosure, for example, the following inventions are provided: (1) A method for inducing homologous recombination in a target cell, comprising: introducing a double-strand break at a target site in DNA in the target cell; culturing the target cell in the presence of donor DNA and an ATM inhibitor, wherein the donor DNA comprises an upstream homology arm homologous to an upstream portion of the target site and a downstream homology arm homologous to an downstream portion of the target site, and either further comprises a sequence of interest between the upstream homology arm and the downstream homology arm, or does not comprise any sequence; and obtaining, after culturing, cells having DNA in which the sequence of interest has been inserted between the upstream and downstream portions of the target site or DNA in which the sequence of interest has been deleted between the upstream and downstream portions of the target site. (2) The method according to (1), wherein the introduction of a double-strand break at the target site in DNA is performed using a sequence-specific nucleic acid cleaving molecule comprising a zinc finger nuclease (ZFN), a TALEN, or a CRISPR / Cas-based nuclease that targets and cleaves the site. (3) The method according to (1) or (2) above, wherein the donor DNA is linear DNA, for example, single-stranded DNA (ssDNA) or double-stranded DNA (dsDNA). (4) The method according to (1) or (2) above, wherein the donor DNA is derived from circular DNA containing a target sequence of a sequence-specific nucleic acid cleaving molecule, and is linear DNA generated by cleavage of the target sequence with the sequence-specific nucleic acid cleaving molecule. (5) The method according to any one of (1) to (3) above, wherein the donor DNA is single-stranded DNA and is introduced into cells by an adeno-associated virus vector carrying the sequence of the donor DNA. (6) The method according to any one of (1) to (5) above, wherein the target cells comprise blood cells. (7) The method according to any one of (1) to (5) above, wherein the target cells comprise hematopoietic stem cells. (8) The method according to any one of (1) to (5) above, wherein the target cells comprise fertilized eggs. (9) The method according to any one of (1) to (5) above, wherein the target cells comprise bone marrow stromal cells.(10) A method for editing a genome in a subject, comprising administering to the subject effective amounts of a sequence-specific nucleic acid cleaving molecule or a sequence-specific nucleic acid cleaving molecule complex or a nucleic acid encoding the same, template DNA, and an ATM inhibitor, to induce homologous recombination repair in the subject to induce homologous recombination between a target site in the subject and the template DNA, wherein the template DNA comprises an upstream homology arm homologous to the upstream of the target site and a downstream homology arm homologous to the downstream of the target site, and either further comprises a sequence of interest between the upstream homology arm and the downstream homology arm, or does not comprise a sequence of interest. (11) A genome editing kit for use in the method described in (10), comprising one or more components selected from the group consisting of an effective amount of (i) a sequence-specific nucleic acid cleaving molecule or a sequence-specific nucleic acid cleaving molecule complex, or a nucleic acid encoding the same, (ii) template DNA, and (iii) an ATM inhibitor. (12) In the manufacture of a genome editing kit for use in the method described in (10) above, use of one or more components selected from the group consisting of: (i) a sequence-specific nucleic acid cleaving molecule, or a sequence-specific nucleic acid cleaving molecule complex, or a nucleic acid encoding the same; (ii) template DNA; and (iii) an ATM inhibitor.
[0007] This figure shows the homologous recombination repair efficiency of various ATM inhibitors in hematopoietic stem progenitor cells (HSPCs). Treatment with ATM inhibitors tends to increase knock-in efficiency, and the efficiency of knock-in is significantly improved in CD150, a hematopoietic stem cell fraction. + CD201 +Knock-in efficiency has also been improved in KSL cells. Ibid.
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098] [009 ...9]
[0099]
[0099] [
[0033] Figure 1 shows the percentage of cells that underwent HDR in each fraction of bone marrow cells of the animal after the transplantation. Figure 2 shows the efficiency of homologous recombination repair by ATM inhibitors in pig fertilized eggs. Figure 3 shows the efficiency of blastocyst acquisition from pig fertilized eggs after knock-in in the presence of various AAV concentrations and an ATM inhibitor (AZ32), and the effect of the ATM inhibitor on the percentage of knock-in embryos in blastocysts. Figure 4 shows the percentage of knock-in offspring in 32-day pig embryos obtained from fertilized eggs after knock-in in the presence of AAV and an ATM inhibitor (AZ32).
[0008] As used herein, the term "cell" refers to a basic unit of life that contains at least genomic DNA, cytoplasm, and a membrane structure that encases these. Examples of cells include, but are not limited to, prokaryotic cells and eukaryotic cells. Genomic DNA includes endogenous DNA of the cell, but is not necessarily composed solely of endogenous factors of the cell.
[0009] As used herein, a "cell population" refers to a composition comprising a plurality of cells.
[0010] As used herein, "isolation" refers to the separation of a cell of interest from at least one other component. Isolation can be performed, for example, by separating and removing a cell in its natural state from other components with which it exists in its natural state. Isolation can be performed, for example, by separating and removing a portion of cells from a multicellular organism. Techniques that involve isolated cells are referred to herein as in vitro techniques.
[0011] As used herein, "purification" refers to further separating isolated cells of interest from other components that coexist with them. Purification can be performed, for example, by separating cells of interest from other components based on morphology or surface markers. Purification can be performed by limiting dilution and / or cloning of cells. Cloned cells are cells replicated from a single cell. Purification can be performed by establishing a cell line of interest. If the cells of interest have a marker gene, such as a drug resistance gene or a gene encoding a fluorescent protein, purification can be performed based on the expression of the marker gene. As used herein, "enrichment" refers to increasing the density of cells of interest.
[0012] As used herein, the terms "genome modification" and "genome editing" are used interchangeably and refer to the introduction of mutations at desired locations (target regions) in a genome. Genome modification may involve the use of sequence-specific nucleic acid cleaving molecules (e.g., sequence-specific or sequence-dependent endonucleases) designed to cleave target sites. In a preferred embodiment, genome modification may involve the use of nucleases engineered to cleave DNA in the target region. In a preferred embodiment, genome modification may involve the use of nucleases engineered to cleave target sequences with specific base sequences in the target region (e.g., TALENs or zinc finger nucleases (ZFNs)). In a particularly preferred embodiment, genome modification may involve the use of nucleases engineered to cleave target sequences with specific base sequences in the target region (e.g., CRISPR-Cas systems). Typically, a double-strand break (DSB) is induced in the target sequence using a sequence-specific nuclease, and the genome is then repaired by endogenous cellular processes such as homologous directed repair (HDR) and non-homologous end-joining repair (NHEJ). NHEJ is a repair method that joins the ends of double-strand breaks without using donor DNA, and insertions and / or deletions (indels) are frequently induced during repair. HDR is a repair mechanism that uses donor DNA and can also introduce desired mutations into the target region. A preferred example of a genome modification technique is the CRISPR / Cas system (more preferably the CRISPR / Cas9 system). Other genome editing systems such as CRISPR / Cas3, CRISPR / Cas12, CRISPR-StAR, and MAD7 can also be used.
[0013] The term "target sequence" refers to a DNA sequence in a genome that is the target of cleavage by a sequence-specific nucleic acid cleaving molecule. When the sequence-specific nucleic acid cleaving molecule is a Cas protein, the target sequence refers to a DNA sequence in a genome that is the target of cleavage by the Cas protein. When a Cas9 protein is used as the Cas protein, the target sequence must be a sequence adjacent to the 5' side of a protospacer adjacent motif (PAM). The target sequence is typically selected as a sequence of 17 to 30 bases (preferably 18 to 25 bases, more preferably 19 to 22 bases, and even more preferably 20 bases) immediately adjacent to the 5' side of the PAM. Known design tools such as CRISPR DESIGN (crispr.mit.edu / ) can be used to design the target sequence.
[0014] The term "Cas protein" refers to a CRISPR-associated protein. In a preferred embodiment, the Cas protein forms a complex with a guide RNA and exhibits endonuclease activity or nickase activity. Examples of Cas proteins include, but are not limited to, the Cas9 protein. Cas proteins include wild-type Cas proteins and their homologs (paralogs and orthologs), as well as mutants thereof, as long as they exhibit endonuclease activity or nickase activity in cooperation with a guide RNA. In a preferred embodiment, the Cas protein is involved in a class 2 CRISPR / Cas system, more preferably a type II CRISPR / Cas system. A preferred example of a Cas protein is the Cas9 protein.
[0015] The term "Cas9 protein" refers to a Cas protein involved in the type II CRISPR / Cas system. The Cas9 protein forms a complex with a guide RNA and exhibits the activity of cleaving DNA in a target region in cooperation with the guide RNA. The Cas9 protein includes wild-type Cas9 proteins and their homologs (paralogs and orthologs), as well as mutants thereof, as long as they have the above-mentioned activity. The wild-type Cas9 protein has a RuvC domain and an HNH domain as nuclease domains, but the Cas9 protein herein may have either the RuvC domain or the HNH domain inactivated. Cas9 in which either the RuvC domain or the HNH domain is inactivated introduces a single-strand break (nick) into double-stranded DNA. Therefore, when using Cas9 in which either the RuvC domain or the HNH domain has been inactivated to cleave double-stranded DNA, a modified system can be constructed in which the Cas9 target sequence is set for each of the sense and antisense strands, and the nicks between the sense and antisense strands are generated at positions sufficiently close to induce double-stranded cleavage. The biological species from which the Cas9 protein is derived is not particularly limited, but preferred examples include bacteria belonging to the genus Streptococcus, Staphylococcus, Neisseria, or Treponema. More specifically, S. pyogenes, S. thermophilus, S. aureus, N. meningitidis, or T. Preferred examples of the Cas9 protein include Cas9 proteins derived from S. denticola, etc. In a preferred embodiment, the Cas9 protein is a Cas9 protein derived from S. pyogenes.
[0016] The terms "guide RNA" and "gRNA" are used interchangeably and refer to an RNA that can form a complex with a Cas protein and guide the Cas protein to a target region. In a preferred embodiment, the guide RNA comprises a CRISPR RNA (crRNA) and a trans-activating CRISPR RNA (tracrRNA). The crRNA is involved in binding to a target region on the genome, and the tracrRNA is involved in binding to the Cas protein. In a preferred embodiment, the crRNA comprises a spacer sequence and a repeat sequence, and the spacer sequence binds to the complementary strand of the target sequence in the target region. In a preferred embodiment, the tracrRNA comprises an anti-repeat sequence and a 3' tail sequence. The anti-repeat sequence has a sequence complementary to the repeat sequence of the crRNA and forms base pairs with the repeat sequence, and the 3' tail sequence usually forms three stem-loops. The guide RNA may be a single guide RNA (sgRNA) in which the 5' end of the tracrRNA is linked to the 3' end of the crRNA, or the crRNA and tracrRNA may be separate RNA molecules in which base pairs are formed at the repeat and anti-repeat sequences. In a preferred embodiment, the guide RNA is an sgRNA.
[0017] The crRNA repeat sequence and tracrRNA sequence can be appropriately selected depending on the type of Cas protein, and those derived from the same bacterial species as the Cas protein can be used. As the CRISPR-Cas9 system, the Cas9 protein, crRNA, and tracrRNA (or sgRNA) derived from S. pyogenes can be used. Various crRNA repeat sequences and tracrRNA sequences for sgRNA design have been proposed, and those skilled in the art can design sgRNAs based on known techniques (e.g., Jinek et al. (2012) Science, 337, 816-21; Mali et al. (2013) Science, 339: 6121, 823-6; Cong et al. (2013) Science, 339: 6121, 819-23; Hwang et al. (2013) Nat. Biotechnol. 31: 3, 227-9; Jinek et al. (2013) eLife, 2, e00471).
[0018] As used herein, "ATM" (Ataxia telangiectasia mutated) refers to a gene that causes the hereditary disease ataxia-telangiectasia (AT). ATM is known to function as a sensor for double-strand breaks in DNA. If ATM does not function normally for a long period of time, DNA damage will not be properly repaired, which may affect cell division and proliferation. The amino acid sequence of human ATM may be, for example, the amino acid sequence registered under Genbank registration number AAI37170.1. Many ATM inhibitors have been developed, and are expected to be used as anticancer agents that inhibit DNA repair, thereby accumulating damage in cancer cells and killing them.
[0019] <Method of the present disclosure> The present disclosure provides a method for inducing homologous recombination in a target cell. The method of the present disclosure may be an in vitro or ex vivo method. The method of the present disclosure is an industrially applicable method. Since the method of the present disclosure can increase the rate of homologous recombination in a target cell, the method of the present disclosure can be interpreted as a method for increasing the rate of homologous recombination in a target cell.
[0020] The method of the present disclosure includes introducing a double-strand break into a target site in DNA in a subject cell, or providing a cell in which a double-strand break has been introduced into a target site in DNA in a subject cell. To introduce a double-strand break into the target site, the above-described sequence-specific nucleic acid cleaving molecule (preferably the CRISPR / Cas9 system) can be used. To introduce a double-strand break into the target site, a cleavage enzyme such as a megabase cutter, which has only one target sequence present in the genome, may be used. In the method of the present disclosure, the method for introducing the double-strand break is not limited, as long as a cell in which a double-strand break has been introduced, is provided.
[0021] A cell with a double-stranded break in DNA attempts to repair the DNA using its own DNA repair mechanism. If donor DNA (e.g., double-stranded DNA or preferably single-stranded DNA) coexists within the cell and / or nucleus, the broken DNA is repaired by homologous recombination using the donor DNA. This type of repair is called homologous recombination repair. Details of genome editing using the CRISPR / Cas9 system are disclosed, for example, in FA Ran et al., Nature Protocols, Vol. 8, No. 11, 2281-2301, 2013, which is incorporated herein by reference in its entirety. The method of the present disclosure may further include a step of introducing donor DNA into the cell. The donor DNA can be introduced into the cell by transfection or, if the donor DNA is integrated into a viral genome, by a viral vector.
[0022] In one aspect, the method of the present disclosure is a method for inducing homologous recombination in a subject cell, which may include introducing into the subject cell a sequence-specific nucleic acid cleaving molecule capable of cleaving a target sequence in the genome, or DNA encoding the molecule, and donor DNA. The method of the present disclosure may further include culturing the subject cell in the presence of donor DNA and an ATM inhibitor, wherein the donor DNA comprises an upstream homology arm homologous to the upstream of the target site and a downstream homology arm homologous to the downstream of the target site, and either further comprises a sequence of interest between the upstream homology arm and the downstream homology arm, or does not comprise any sequence, and obtaining, after culturing, cells having DNA in which the sequence of interest is inserted between the upstream and downstream of the target site or DNA in which the sequence of interest is deleted between the upstream and downstream of the target site.
[0023] In one aspect, the method of the present disclosure is a method for inducing homologous recombination in a target cell, the method comprising: providing a cell in which a double-strand break has been introduced into a target site in DNA within the target cell; culturing the target cell in the presence of donor DNA and an ATM inhibitor; wherein the donor DNA comprises an upstream homology arm homologous to an upstream site of the target site and a downstream homology arm homologous to an downstream site of the target site, and either further comprises a sequence of interest between the upstream homology arm and the downstream homology arm, or does not comprise any sequence; and after culturing, obtaining cells having DNA in which the sequence of interest has been inserted between the upstream and downstream sites of the target site or DNA in which the sequence of interest has been deleted between the upstream and downstream sites.
[0024] The donor DNA and ATM inhibitor are present in the subject cell and promote homologous recombination repair between the donor DNA and the genome containing the double-strand break.
[0025] The donor DNA is a template that undergoes homologous recombination with genomic DNA and is incorporated into the genomic DNA. The donor DNA comprises an upstream homology arm homologous to the upstream of the target site and a downstream homology arm homologous to the downstream of the target site, and may further comprise a target sequence between the upstream and downstream homology arms. When cells containing DNA with a double-strand break at the target site are cultured in the presence of an effective amount of donor DNA, the DNA is repaired by homologous recombination so that the sequence between the upstream and downstream of the target site on the genome is replaced with the sequence between the upstream and downstream homology arms. That is, if the donor DNA contains a target sequence between the upstream and downstream homology arms, the sequence between the upstream and downstream of the target site on the genome is replaced with the target sequence, and if the donor DNA does not contain a target sequence, the sequence between the upstream and downstream of the target site on the genome is deleted. In this way, DNA is repaired so that the sequence between the upstream and downstream of the target site on the genome is replaced with the sequence between the upstream and downstream homology arms of the donor DNA. The donor DNA is sometimes called a donor template. By designing the target sequence in advance, the upstream and downstream regions can be replaced with the designed sequence, allowing the sequence on the edited genome to be designed and modified as designed. If the length of the target sequence is zero (i.e., if the target sequence does not exist or does not contain the sequence), the sequence between the upstream and downstream of the target site will be completely missing (deleted). Seamless or scarless editing can be achieved if a marker sequence or an artificially introduced recombination sequence is not used as the target sequence.Seamless or scarless editing is utilized during the editing process and is a desirable embodiment in situations where it is required that the edited genomic DNA is not affected by residual sequences that are no longer needed after editing (see, e.g., Xi et al., Genome Biol., 16:231, 2015; Roger Askew et al., Mol. Cel. Biol., 4115-4124, 1993; WO2019 / 018534; and WO2021 / 206054, which are incorporated by reference in their entireties).
[0026] The upstream homology arm and downstream homology arm of the donor DNA can be designed appropriately by one skilled in the art, and may have a length of, for example, 300 to 2000 nucleotides, 300 to 1500 nucleotides, or 300 to 1000 nucleotides, e.g., 350 to 700 nucleotides. The target sequence of the donor DNA can be 0 nucleotides in length (i.e., absent or deleted), or 1 to 10,000 nucleotides in length, e.g., 1 to 5000 nucleotides, 1 to 1000 nucleotides, or 1 to 300 nucleotides. The target sequence of the donor DNA can also be designed appropriately by one skilled in the art depending on the DNA sequence obtained after repair.
[0027] The donor DNA can be designed near the double-strand break (DSB) introduction site. There are no particular limitations on the location of the homology arm as long as it does not significantly reduce the efficiency of homologous recombination. For example, any homology arm can be designed within 200 base pairs, preferably within 100 base pairs, more preferably within 50 base pairs from the DSB introduction site. Even more preferably, the homology arms can be designed upstream and downstream of the DSB introduction site.
[0028] Various modifications can be introduced into the recombinant sequence, and the modifications can include, for example, one or more selected from the group consisting of addition, deletion, insertion, deletion, and substitution, and combinations thereof. Modifications can include those that confer activity to a loss-of-function mutation (e.g., revert to wild-type), those that reduce the activity of a gain-of-function mutation (e.g., revert to wild-type), those that introduce a loss-of-function mutation into the wild-type, or those that introduce a gain-of-function mutation into the wild-type.
[0029] During homologous recombination repair, the efficiency of the above-mentioned homologous recombination repair can be increased by culturing cells in the presence of an effective amount of an ATM inhibitor (ATMi).
[0030] The donor DNA is a linear single-stranded DNA (ssDNA) or a linear double-stranded DNA (dsDNA). The donor DNA (particularly linear single-stranded DNA and linear double-stranded DNA) can be introduced into cells as appropriate, for example, together with a sequence-specific nucleic acid cleaving molecule for genome editing. The homology arms of the donor DNA may be designed to be complementary to either strand of the genomic DNA. The donor DNA has homology arms of at least 40 bases on both sides to increase the efficiency of homologous recombination. The donor DNA may be a circular DNA to which a recognition sequence for a sequence-specific nucleic acid cleaving molecule has been added. When the sequence-specific nucleic acid cleaving molecule cleaves the recognition sequence on the genome, the circular DNA is cleaved and converted into linear DNA, resulting in the same results as when linear DNA is used as the donor DNA.
[0031] In one embodiment, the donor DNA is integrated into the genome of a virus or viral vector having a single-stranded DNA genome. In another embodiment, the donor DNA is integrated into the genome of a virus or viral vector having a double-stranded DNA genome. In this embodiment, the donor DNA is incorporated into the cell together with the viral genome by culturing the cell in the presence of the virus or viral vector before, simultaneously with, or after the introduction of a sequence-specific nucleic acid cleaving molecule into the cell. This is advantageous in that the donor DNA can be introduced into the cell by utilizing the infectivity of the virus.
[0032] Examples of viruses with single-stranded DNA genomes include Parvoviridae viruses (e.g., Parvovirus B19), Circoviridae viruses, and Adeno-associated viruses. Viral vectors derived from these viruses also retain linear single-stranded DNA in their genomic DNA and are suitable for introducing linear single-stranded DNA into cells. In some embodiments, donor DNA is integrated into the genome of an adeno-associated virus (AAV) vector. AAV vectors can infect cells and deliver genomes containing donor DNA to the cells. Thus, the use of AAV vectors facilitates the extracellular introduction of donor DNA into cells. Various AAV serotypes exist, and vectors derived from any serotype may be used as long as they are capable of infecting target cells. Examples of AAV include, but are not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV9. AAV can typically introduce DNA of up to about 4.7 kb. When the total length of the upstream and downstream homology arms is about 0.6 kb to about 1.5 kb, the length of the target sequence can be up to about 3.2 kb to about 4.1 kb. In cells with a double-strand break in the DNA target site, the donor DNA portion in the AAV functions as donor DNA for homologous recombination.
[0033] Viruses having linear double-stranded DNA include adenoviruses, adenovirus vectors, herpes viruses, herpes virus vectors, pox viruses, and pox virus vectors. By incorporating double-stranded donor DNA into the genome of these viruses, the donor DNA, which is linear double-stranded DNA, can be introduced into cells. Adenovirus vectors lack the E1A, E1B, and E3 genes, and the E1A and E1B genes necessary for virus production are supplied by packaging cells. There are various serotypes of adenovirus, and the adenovirus vector can be, for example, an adenovirus serotype 5 (Ad5)-derived vector (see, e.g., Suzuki M, SaitoI et al., Gene Ther, 1-9, 2015; Miyake S, Saito I et al., PNAS, 93:1320-1324, 1996; and Bett AJ et al., JVirol, 67:5911-5921, 1993; WO2020 / 067004A). Herpesvirus vectors are characterized by their high gene loading capacity and the development of vector delivery technologies to targeted cells and tissues (e.g., Proc Natl Acad Sci USA 2015, 112: E1632-E1641; Nat Med 2022, 28: 780-788; Mol Ther 2013, 21: 61-569; J Virol 2010, 84: 12200-12209; Gene Ther 2016; 23:479-488). Herpesvirus vectors include first-generation herpesvirus vectors lacking the ICP4 or ICP27 gene; second-generation herpesvirus vectors lacking the ICP22 gene in addition to the ICP4 and ICP27 genes; and third-generation herpesvirus vectors lacking all immediate-early (IE) genes. Poxvirus vectors, including vaccinia virus vectors, are suitable for transferring relatively large genes (eg, having up to about 30 kbp).The vaccinia virus strain used is not limited, but examples include the Lister strain, the New York City Board of Health (NYBH) strain, the Wyeth strain, the Copenhagen strain, the Western Reserve (WR) strain, the Modified Vaccinia Ankara (MVA) strain, the EM63 strain, the Ikeda strain, the Dalian strain, and the Tian Tan strain. The Lister strain and the MVA strain are available from the American Type Culture Collection (ATCC VR-1549 and ATCC VR-1508, respectively). The vaccinia virus strains that can be used include the LC16 strain, the LC16m8 strain, and the LC16mO strain, which were established from the Lister strain. The LC16mO strain was created by low-temperature passage using the Lister strain as a parent strain, via the LC16 strain. The LC16m8 strain was created by further low-temperature passage of the LC16mO strain. A frameshift mutation was found in the B5R gene, which encodes a viral membrane protein, resulting in the loss of expression and function of this protein, resulting in an attenuated strain (Protein Nucleic Acid Enzyme, 2003, Vol. 48, pp. 1693-1700). The complete genome sequences of the Lister strain, the LC16m8 strain, and the LC16mO strain are known, for example, as Accession No. AY678276.1, Accession No. AY678275.1, and Accession No. AY678277.1, respectively. Viral vectors having a linear double-stranded DNA genome can be useful in that they can deliver to cells donor DNA, a nucleic acid encoding a sequence-specific nucleic acid cleavage molecule, and a nucleic acid encoding an ATM inhibitor. Therefore, such vectors can be preferably used for in vitro and in vivo applications. Viruses and viral vectors can be selected taking into consideration their tropism for infection with cells. Pseudotyped viruses that transiently express envelope proteins or specific proteins of other viruses can also be preferably used to confer cell infectivity.
[0034] Examples of circular double-stranded DNA include plasmid DNA and viral genome DNA. Circular double-stranded DNA can be cleaved in cells to form linear double-stranded DNA, and this linear double-stranded DNA includes donor DNA. For this purpose, the circular double-stranded DNA preferably has a cleavage site (target sequence) for a sequence-specific nucleic acid cleaving molecule, for example. Thus, upon contact with the sequence-specific nucleic acid cleaving molecule in cells, the circular double-stranded DNA is converted into linear double-stranded DNA. Linear double-stranded DNA can be used for HDR by including donor DNA. By introducing the same sequence as the target site in the cell's genome into the circular double-stranded DNA, the circular double-stranded DNA is cleaved into linear double-stranded DNA upon cleavage of the target site in the cell's genome, which is the preferred form of donor DNA. Examples of viruses include human papillomavirus, baculovirus, and polyomavirus. Human papillomavirus, baculovirus, and polyomavirus have each been converted into vectors, and human papillomavirus vectors, baculovirus vectors, and polyomavirus vectors can also be used. Viruses and viral vectors can be selected taking into consideration their tropism for infection with cells. Pseudotyped viruses that transiently express envelope proteins or specific proteins of other viruses to confer cell infectivity can also be preferably used.
[0035] The circular double-stranded DNA may further contain DNA encoding a sequence-specific nucleic acid cleaving molecule and DNA encoding a guide RNA. The circular double-stranded DNA may further contain a nucleic acid that inhibits ATM expression or DNA encoding the nucleic acid. This configuration allows the sequence-specific nucleic acid cleaving molecule, guide RNA, and donor DNA (and optionally a nucleic acid that inhibits ATM expression) to be introduced into cells using one or more circular double-stranded DNAs. Viral vectors having a genome comprising circular double-stranded DNA containing a sequence-specific nucleic acid cleaving molecule, guide RNA, donor DNA, and DNA encoding a nucleic acid that inhibits ATM expression, or viral vectors having a genome comprising linear double-stranded DNA containing guide RNA, donor DNA, and DNA encoding a nucleic acid that inhibits ATM expression, can supply all of the ATM inhibitor, donor DNA, and sequence-specific nucleic acid cleaving molecule to cells. For this reason, such vectors can be preferably used in vitro and in vivo. The cleavage site (target sequence) of the sequence-specific nucleic acid cleaving molecule is inserted in a location that does not significantly interfere with the expression.
[0036] The ATM inhibitor inhibits the ATM protein encoded by ataxia telangiectasia mutated (ATM), a gene that causes ataxia telangiectasia. The ATM inhibitor may be an ATM-selective inhibitor. Various ATM inhibitors have been developed, and any of them may be used. For example, ATM inhibitors disclosed in the following publications may be used: WO 2017 / 046216, WO 2015 / 170081, WO 2018 / 167203, WO 2017 / 153578, WO 2017 / 162611, WO 2017 / 162605, WO 2017 / 174446, WO 2017 / 076895, WO 2017 / 076898, WO 2017 / 194632, WO 2019 / 057757, and WO 2021 / 260580 (the entire specifications of which are incorporated herein by reference). The ATM inhibitor is used at a concentration suitable for ATM inhibition. The ATM inhibitor does not exhibit unacceptable cytotoxicity at concentrations suitable for ATM inhibition.
[0037] ATM inhibitors may also include, for example, compounds selected from the following: AZD1390: 7-fluoro-1-isopropyl-3-methyl-8-[6-[3-(1-piperidyl)propoxy]-3-pyridyl]imidazo[4,5-c]quinolin-2-one, and its deuterated forms: 4,6-dideutero-7-fluoro-1-isopropyl-3-methyl-8-[6-[3-(1-piperidyl)propoxy]-3-pyridyl]imidazo[4,5-c]quinolin-2-one, and 4-deutero-7-fluoro-1-isopropyl-3-methyl-8-[6-[3-(1-piperidyl)propoxy]-3-pyridyl]imidazo[4,5-c]quinolin-2-one. ci]-3-pyridyl]imidazo[4,5-c]quinolin-2-one; AZD0156: 8-[6-(3-dimethylaminopropoxy)pyridin-3-yl]-3-methyl-1-(oxan-4-yl)imidazo[5,4-c]quinolin-2-one; M4076: 8-(1,3-dimethyl-1H-pyrazol-4-yl)-1-(3-fluoro-5-methoxy-pyridin-4-yl)-7-methoxy-3-methyl-1,3-dihydroimidazo[4,5-c]quinolin-2-one; M3541: 3-fluoro-4-[7- Methoxy-3-methyl-8-(1-methyl-1H-pyrazol-4-yl)-2-oxo-2,3-dihydro-1H-imidazo[4,5-c]quinolin-1-yl]benzonitrile; KU-55933: 2-(4-morpholinyl)-6-(1-thianthrenyl)-4H-pyran-4-one; KU-60019: 2-[(2R,6S)-2,6-dimethyl-4-morpholinyl]-N-{5-[6-(4-morpholinyl)-4-oxo-4H-pyran-2-yl]-9H-thioxanthen-2-yl}acetamide; KU -59403: 3-(4-methyl-1-piperazinyl)-N-{6-[6-(4-morpholinyl)-4-oxo-4H-pyran-2-yl]-2-thianthrenyl}propanamide; CP466722: 2-(6,7-dimethoxyquinazolin-4-yl)-5-(2-pyridyl)-1,2,4-triazol-3-amine; NVP-BEZ235: 2-methyl-2-[4-[3-methyl-2-oxo-8-(3-quinolyl)imidazo[4,5-c]quinolin-1-yl]phenyl]propanenitrile (Dactolisib);6-[6-(Methoxymethyl)-3-pyridyl]-4-[[(1S)-1-tetrahydropyran-4-ylethyl]amino]quinoline-3-carboxamide; 7-Fluoro-6-[6-(methoxymethyl)-3-pyridyl]-4-[[(1S)-1-(1-methylpyrazol-3-yl)ethyl]amino]quinoline-3-carboxamide; 6-[6-[3-(dimethylamino)propoxy]-3-pyridyl]-N-methyl-4-[[(1S )-1-tetrahydropyran-4-ylethyl]amino]cinnoline-3-carboxamide; N-methyl-4-(6-phenylimidazo[1,2-a]pyrazin-3-yl)benzamide; 1-isopropyl-3-methyl-8-[6-[3-(1-piperidyl)propoxy]-3-pyridyl]imidazo[4,5-c]cinnolin-2-one; and 2-(7-methoxy-9H-thioxanthen-4-yl)-6-morpholino-pyran-4-one.
[0038] Examples of ATM inhibitors include, but are not limited to, dactolisib, wortmannin, KU55933, KU59403, KU60019, Torin2, AZD0156, Mirin, AZD1390, CP466722, CGK733, AZ31, AZ32, cinobufagin, raltesertib, SKLB197, NVP-BEZ235, and M3541. For example, oral administration of AZD1390 has been shown to deliver AZD1390 to the brain (Sci Adv. 2018;4(6):eaat1719).
[0039] An ATM inhibitor can be a nucleic acid that suppresses ATM gene expression. Examples of nucleic acids that suppress ATM gene expression include siRNA, shRNA, antisense oligonucleotides, gapmers, and mixers directed against the ATM gene. In siRNA, two RNA strands, typically about 21-23 nucleotides in length, bind complementarily to form a double-stranded complex. shRNA is a single-stranded RNA, typically consisting of two complementary hybridizing RNA strands, each about 21-23 nucleotides in length, linked by a hairpin. Gapmers have a structure in which modified nucleic acids (wing regions) are linked to both sides of an antisense DNA (gap region). Upon binding to a target RNA, gapmers induce cleavage in the target RNA through the action of RNase H. Those skilled in the art can appropriately determine the length, sequence, and modifications to design a nucleic acid suitable for suppressing ATM gene expression. RNA may also be produced intracellularly by introducing DNA encoding it into cells.
[0040] Nucleic acids may contain modified nucleic acids for stabilization or improved target binding. Various modified nucleic acids have been developed, and those skilled in the art can use them as appropriate. In a non-limiting example, knockdown nucleic acids consist solely of modified nucleic acids. Examples of modified nucleic acids include fluorescent dye-modified nucleic acids, biotinylated nucleic acids, and nucleic acids with cholesteryl groups introduced. To enhance RNA stability, the sugar moiety of the base may be modified with 2'-O-methyl, 2'-fluoro, or 2'-methoxyethyl (MOE). Nucleic acids in which the sugar moiety is replaced with a morpholino ring (PMO; see, for example, U.S. Pat. No. 9,469,664B) can also be used. U.S. Pat. No. 9,469,664B discloses modified nucleic acids in which the phosphorus of the intersubunit (internucleotide bond) is replaced with a tertiary amine. In U.S. Pat. No. 9,469,664B, the phosphorus of the intersubunit (internucleotide bond) is modified with dimethylamine, and the structure may be -P(=O)(-N(CH3)2)-O-. Furthermore, the phosphodiester bond between nucleotides may be replaced with a phosphorothioate bond. Furthermore, the phosphodiester bond between nucleotides may be replaced with a phosphorodiamidate bond. Furthermore, the phosphodiester bond between nucleotides may be replaced with a peptide bond (e.g., peptide nucleic acid). Examples of modified nucleic acids with modified sugars include nucleic acids in which the oxygen atom at the 2' position and the carbon atom at the 4' position are crosslinked. Examples of such artificial nucleic acids include locked nucleic acid (LNA), which is a crosslinked DNA in which the oxygen atom at the 2' position and the carbon atom at the 4' position are crosslinked via a methylene; ENA, in which the oxygen atom at the 2' position and the carbon atom at the 4' position are crosslinked via an ethylene; and BNA, in which the oxygen atom at the 2' position and the carbon atom at the 4' position are crosslinked via -CHOCH-. COC , a BNA in which the oxygen atom at the 2' position and the carbon atom at the 4' position are bridged via -NR-CH2- (where R is a methyl or hydrogen atom); NCExamples of such modified nucleic acids include bridged nucleic acids (BNAs) such as cMOE, in which the oxygen atom at the 2' position and the carbon atom at the 4' position are bridged via -CH(OCH)-, cEt, in which the oxygen atom at the 2' position and the carbon atom at the 4' position are bridged via -CH(CH)-, AmNA, in which the carbon atoms at the 2' position and the carbon atom at the 4' position are bridged via an amide, GluNA, in which the carbon atoms at the 2' position and the carbon atom at the 4' position are bridged via a guanidide, scpBNA, in which the oxygen atom at the 2' position and the carbon atom at the 4' position are bridged via a methylene to form a cyclopropane at the 6' position, and peptide nucleic acids (PNAs), in which the polymer backbone is formed by an amide bond between N-(2-aminoethyl)glycine instead of deoxyribose or ribose. The modified nucleic acid may provide one or more, two or more, or all of the following: improved nucleic acid stability, improved affinity for the target nucleic acid, reduced immunostimulatory activity, and improved duration of action.
[0041] The treatment time with the ATM inhibitor can be set appropriately. The treatment time is not particularly limited, but a sufficient effect can be obtained, for example, even for about 24 hours. The treatment time can be, for example, 16 to 48 hours. The treatment can be performed immediately after the cleavage treatment, and the treatment can be started before, during, or after cleavage. For example, a treatment to cleave the target site in the genomic DNA can be performed, and then donor DNA and an ATM inhibitor can be supplied to the cells. For example, cells can be cultured in a first medium in the presence of a sequence-specific nucleic acid cleaving molecule, and then cultured in a second medium in the presence of donor DNA and an ATM inhibitor, and then cultured in a third medium. The second medium may contain an ATM inhibitor, and the third medium may not contain donor DNA or an ATM inhibitor. Donor DNA not incorporated into a vector capable of infecting cells can be introduced into cells, for example, simultaneously with the introduction of the sequence-specific nucleic acid cleaving molecule into the cells. The donor DNA incorporated into a vector capable of infecting cells can be added to the second culture medium after, for example, treating the genomic DNA with double-strand breaks, thereby introducing the donor DNA into the cells.
[0042] The target cells are not particularly limited as long as they have functional ATM, and include eukaryotic cells, including, but not limited to, mammalian cells. Mammals include vertebrates, mammals (human or non-human mammals), primates (e.g., humans, chimpanzees, gorillas, orangutans, monkeys, marmosets, and bonobos), non-primate mammals such as mice, rats, pigs, cows, sheep, goats, llamas, camels, horses, cats, and dogs, fish, amphibians, reptiles, crustaceans, birds, insects, and plants. In some embodiments, the cells are human cells. In some embodiments, the cells are mouse cells. In some embodiments, the cells are pig cells.
[0043] Furthermore, the target cells may be, but are not limited to, pluripotent cells (pluripotent stem cells such as embryonic stem cells, induced pluripotent stem cells, and epiblast stem cells), tissue stem cells, progenitor cells, somatic cells, germ cells, and fertilized eggs or egg cells.
[0044] The target cells may be, for example, cells with a long cell cycle or non-dividing cells. Examples of such cells include cells other than epidermal cells and intestinal epithelial cells, and more specifically, include hematopoietic stem cells, hematopoietic progenitor cells (collectively referred to as "hematopoietic stem and progenitor cells"), neurons, and muscle cells (e.g., skeletal muscle cells and cardiac muscle cells). In some embodiments, the target cells are non-dividing cells. A long cell cycle is not particularly limited, but may be, for example, 48 hours or more, 72 hours or more, 144 hours or more, one week or more, or one month or more; or 72 hours or less, 144 hours or less, one week or less, one month or less, or several months or less (e.g., 5 to 7 months or less), for example, 48 hours to several months. Depending on the conditions, hematopoietic stem cells have been reported to divide once every 36 to 145 days (see E.M. Pietras, et al., J. Cell Biol., 195(5): 709-720, 2011). Therefore, the method of the present disclosure can be suitably used for cells with long cell cycles, such as dividing once every 1 to 5 months, and in principle, is also considered effective for cells with even longer cell cycles (e.g., cell cycles of 5 months to 1 year, 1 to 3 years, or 3 to 10 years, or longer) and non-dividing cells. Of course, the target cells do not necessarily have to have long cell cycles; they may also have cell cycles of 48 hours or less, 42 hours or less, 36 hours or less, or 30 hours or less. The cell cycle of embryonic pluripotent stem cells is typically about 24 hours ± 4 hours, while the cell cycle of stromal cells is typically about 36 hours ± 6 hours. Although cell cycles can vary depending on culture conditions and cell state, the method of the present disclosure may be effective regardless of the length of the cell cycle and may be effective even for cells with long cell cycles and low HDR efficiency.
[0045] In one aspect, the target cell may be a fertilized egg, for example, a mammalian fertilized egg. Genome editing in a fertilized egg may lead to editing of all cells that make up the body, which may be beneficial. Also, in one aspect, the target cell may be a pluripotent cell, for example, a mammalian pluripotent cell. Genome editing of an animal is possible by selecting, proliferating, and introducing the edited cell into an embryo. If the mammal is livestock, benefits may be enjoyed in animal husbandry. If the mammal is a human, benefits may be enjoyed in the treatment of disease.
[0046] When administered to humans, the target cells can be autologous or allogeneic (allogeneic). In the case of allogeneic transplantation, the cells are low-immunogenic cells. For example, cells in which HLA class I and II or their production have been disrupted are low-immunogenic to adaptive immunity. More specifically, cells in which β2-microglobulin has been disrupted no longer express HLA class I and do not activate adaptive immunity. Furthermore, cells in which CIITA has been disrupted no longer express HLA class II and do not activate adaptive immunity. Examples of such modifications include cell surface expression of immune checkpoint molecules and molecules that emit "don't eat me" signals, such as CD47. Cells suitable for allogeneic transplantation through such modifications are called low-immunogenic cells, and cells that can be administered to a variety of individuals are called universal donor cells. In the present disclosure, the cells are preferably low-immunogenic cells, more preferably universal donor cells.
[0047] In certain embodiments, blood diseases include sickle cell disease, β-thalassemia, X-linked severe combined immunodeficiency (X-SCID), chronic granulomatous disease (CGD), and other blood diseases caused by genetic mutations. The disclosed method can be used to correct the cellular abnormality by converting the genetic mutation to a normal sequence. The disclosed method can be an ex vivo method, in which cells containing the genetic mutation are removed from the body to obtain isolated cells, and then the method can be applied to the isolated cells. The disclosed method can be an in vivo method, in which effective amounts of donor DNA, a sequence-specific nucleic acid cleavage molecule or a nucleic acid encoding the molecule, and an ATM inhibitor, or, if the ATM inhibitor is a nucleic acid, a nucleic acid encoding the ATM inhibitor, are administered to a subject, thereby converting the genetic mutation to a normal sequence in the subject's body.
[0048] In certain aspects, the target cells may be blood cells. Blood cells are hematopoietic stem cells and cells resulting from the differentiation of hematopoietic stem cells. Blood cells are broadly classified into hematopoietic stem cells, hematopoietic progenitor cells, and blood cells according to the differentiation stage. Hematopoietic stem cells differentiate into blood cells via hematopoietic progenitor cells. More specifically, hematopoietic stem cells can differentiate into lymphocytes (e.g., T cells, B cells, NK cells) via lymphoblasts. Hematopoietic stem cells can also differentiate into monocytes via hematopoietic progenitor cells and monoblasts. Hematopoietic stem cells can also differentiate into hematopoietic progenitor cells, common myeloid progenitor cells (CMP), granulocytic / monocytic progenitor cells (GMP), and then into granulocytic leukocytes such as neutrophils, eosinophils, or basophils, or macrophages. Hematopoietic stem cells can also differentiate into red blood cells via hematopoietic progenitor cells, common myeloid progenitor cells (CMP), megakaryocyte / erythroid progenitor cells (MEP). Hematopoietic stem cells can also differentiate into platelets via hematopoietic progenitor cells, common myeloid progenitor cells (CMP), megakaryocyte / erythroid progenitor cells (MEP), megakaryocytes. All cells derived from these hematopoietic stem cells are blood cells. Human hematopoietic stem cells are CD34 positive and CD38 negative. Whether they are positive or negative can be determined by flow cytometry by those skilled in the art.
[0049] In some embodiments, the target cells may be primary cells, established cells, or immortalized cells. The target cells are preferably isolated cells. In a preferred embodiment, the target cells may be primary cells that have not been established or immortalized, in consideration of the safety of transplantation into humans. The cells may also be pluripotent stem cells or cells derived from pluripotent stem cells.
[0050] When cells having a double-strand break at a target site in DNA are cultured in the presence of donor DNA, the break is repaired by homology-directed repair (HDR) of the DNA present in the cells, using the donor DNA as a template. During repair, not only accurate repair by HDR but also inaccurate repair such as NHEJ occurs. In this case, the presence of an effective amount of an ATM inhibitor promotes the repair by homology-directed repair. That is, by inducing HDR in cells in the presence of an ATM inhibitor, the efficiency of HDR is increased (i.e., the proportion of cells in which HDR is induced is increased) compared to when HDR is induced in cells under all other conditions except in the absence of the ATM inhibitor. Therefore, the method of the present disclosure includes culturing cells having a double-strand break at a target site in DNA in the presence of donor DNA and an ATM inhibitor. The ATM inhibitor is as described above.
[0051] The culture is carried out under conditions suitable for the growth and / or maintenance of the cells. The medium may be serum-free, albumin-free, and / or cytokine-free. Such a medium includes a chemically defined medium. The medium includes a basal medium. The basal media include S-clone SF-3 medium, F12 medium, StemSpan or StemSpan SFEM (Stem Cell technologies), STEMα (STEM ALPHA), StemPro-34 serum-free medium (Gibco Invitrogen), StemPro MSC serum-free medium (Invitrogen), HSC-CFU medium (Miltenyl Biotech), S-Clone serum-free medium (SF-02, SF-03, CM-B, SF-B) (Sanko Junyaku), HPGM medium (Sanko Junyaku), AIM V medium (Invitrogen), Marrow MAX bone marrow medium (Invitrogen), and KnockOut. DMEM / F-12 medium (Invitrogen), Stemline hematopoietic stem cell growth medium (Sigma), SYN serum-free medium (SYN H, SYN B) (AbCys SA), SPE IV medium (AbCys SA), MyeloCult medium (StemCell Technologies), HPG serum-free medium (Lonza), UltraCULTURE medium (Lonza), Opti-MEM medium (Gibco Invitrogen and others), MEM medium (Gibco Invitrogen and others), MEMα (Gibco Invitrogen and others), DMEM medium (Gibco Invitrogen and others), DMEM, IMDM medium (Gibco Examples of culture media that can be used include RPMI 1640 medium (Invitrogen et al.), RPMI 1640 medium (Gibco Invitrogen et al.), Ham's F-12 medium (Gibco et al.), RD medium, PZM medium, and modified media thereof. Examples of culture media include basal media. Culture media may contain, for example, one or more or all of insulin, transferrin (apo), sodium selenite, and ethanolamine. Culture media may also contain HEPES, sodium pyruvate, vitamins, amino acids, heparin, heparan sulfate, chondroitin sulfate, and the like.The culture medium may contain antibiotics (e.g., penicillin and streptomycin). The culture medium may contain glutamine. The culture medium may contain, for example, insulin, transferrin (apo), sodium selenite, ethanolamine, and antibiotics, and may further contain HEPES. For serum-free, albumin-free, and cytokine-free media for culturing blood cells, see Wilkinson et al., Nature, 571:117-121, 2019, WO2021 / 049617A, WO2021 / 149799A, and WO2023 / 176709A, the entire contents of which are incorporated herein by reference. The medium composition can be determined and used appropriately by those skilled in the art. Furthermore, the culture conditions can also be determined and used appropriately by those skilled in the art.
[0052] The present disclosure may further include obtaining, after culturing, cells having DNA in which the target sequence is inserted between the upstream and downstream of the target site or DNA in which the target sequence is deleted between the upstream and downstream of the target site. Such cells can be obtained by nucleic acid amplification (such as polymerase chain reaction (PCR)) and sequencing of the target site.
[0053] According to the present disclosure, a person skilled in the art can appropriately introduce a double-strand break at a target site, culture cells having the double-strand break in the presence of donor DNA to induce homologous recombination repair, and obtain cells having DNA in which the target sequence is inserted between the upstream and downstream of the target site or DNA in which the sequence is deleted between the upstream and downstream of the target site.
[0054] According to the present disclosure, the obtained cells or cell population can be administered to a subject in need of such cells or cell population. The administered cells or cell population can be cloned or non-cloned cells. For example, a cell population treated to induce HDR can be administered as is. The disease can be treated in a subject by administering to the subject cells whose gene mutation causing the disease has been corrected to a normal sequence using the method of the present disclosure, or whose sequence has been corrected to alleviate the abnormality.
[0055] In some embodiments of the present disclosure, the method of the present disclosure may be performed in a subject's body to induce genome modification by homologous recombination or treat a disease in the subject. For example, the in vivo method of the present disclosure includes administering to a subject effective amounts of a sequence-specific nucleic acid cleaving molecule (or a sequence-specific nucleic acid cleaving molecule complex) or a nucleic acid encoding the same, template DNA (e.g., single-stranded DNA or double-stranded DNA), and an ATM inhibitor (if the ATM inhibitor is a nucleic acid, a nucleic acid encoding the ATM inhibitor), thereby inducing homologous recombination repair in the subject to induce homologous recombination between the target region of the subject and the template DNA. The template DNA is preferably linear. Furthermore, for example, the in vivo method of the present disclosure may include administering to a subject having a genetic mutation (e.g., a disease-causing one) effective amounts of a sequence-specific nucleic acid cleaving molecule (or a sequence-specific nucleic acid cleaving molecule complex) or a nucleic acid encoding the same, template DNA (e.g., single-stranded DNA or double-stranded DNA), and an ATM inhibitor (if the ATM inhibitor is a nucleic acid, a nucleic acid encoding the ATM inhibitor) to induce homologous recombination repair in the subject to repair the genetic mutation to a sequence on the template DNA (particularly a sequence encoding a functional protein or a portion thereof). In one embodiment, the subject has a genetic mutation and a disease caused by the genetic mutation, and the method of the present disclosure may repair the genetic mutation and treat or prevent the disease.
[0056] The sequence-specific nucleic acid cleaving molecule (or sequence-specific nucleic acid cleaving molecule complex) or the nucleic acid encoding the same, template DNA (e.g., single-stranded DNA or double-stranded DNA), and ATM inhibitor {if the ATM inhibitor is a nucleic acid, the nucleic acid encoding the ATM inhibitor} can be encapsulated in a carrier such as, but not limited to, a micelle, liposome, lipid nanoparticle, or polyion complex, and then administered. Thus, according to the present disclosure, there are provided a carrier (e.g., lipid nanoparticle) comprising one or more or all selected from the group consisting of the sequence-specific nucleic acid cleaving molecule (or sequence-specific nucleic acid cleaving molecule complex) or the nucleic acid encoding the same, template DNA (e.g., single-stranded DNA or double-stranded DNA), and ATM inhibitor {if the ATM inhibitor is a nucleic acid, the nucleic acid encoding the ATM inhibitor}, a composition or pharmaceutical composition comprising the carrier, and these compositions for editing purposes.
[0057] When the template DNA is introduced via a virus, the sequence-specific nucleic acid cleaving molecule (or sequence-specific nucleic acid cleaving molecule complex) or the nucleic acid encoding the same and the ATM inhibitor (or the nucleic acid encoding the ATM inhibitor when the ATM inhibitor is a nucleic acid) can be administered by being encapsulated in a carrier such as, but not limited to, a micelle, liposome, lipid nanoparticle, or polyion complex, and the template DNA can be administered by being loaded onto a vector such as a virus. The carrier and the vector such as a virus may be administered simultaneously or sequentially. Alternatively, the ATM inhibitor does not necessarily need to be encapsulated in a carrier; the carrier may contain the sequence-specific nucleic acid cleaving molecule (or sequence-specific nucleic acid cleaving molecule complex) or the nucleic acid encoding the same, and may be used in combination with the ATM inhibitor and template DNA. In this case, the order of administration is not particularly limited, and the administration may be simultaneous or sequential. For example, the template DNA and the sequence-specific nucleic acid cleaving molecule (or sequence-specific nucleic acid cleaving molecule complex) or the nucleic acid encoding the same may be administered after the ATM inhibitor is administered.
[0058] The lipid nanoparticles may be, but are not limited to, lipid nanoparticles described in US Pat. Nos. 9,364,435B, 8,822,668B, 8,802,644B, and 8,058,069B2. Alternatively, mRNA may be encapsulated in a polyion complex micelle or a polyion complex polymersome (Miyata et al., Chem. Soc. Rev., 2012, 41, 2562-2574). Lipid nanoparticles can deliver encapsulated nucleic acids to, for example, B cells (e.g., Loomis et al., Exp. Mol. Pahol., 88(2):238-249, 2010).
[0059] The lipid nanoparticles may include, but are not limited to, one or more, or preferably all, selected from the group consisting of ionized lipids (e.g., DLin-MC3-MDA, ALC-0315, and SM-102), PEG lipids (e.g., DMG-PEG(2000), and ALC-0159), phospholipids (e.g., 1,2-DSPC), and cholesterol. DLin-MC3-MDA represents (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butanoic acid, ALC-0315 represents (4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate), and SM-102 represents (heptadecan-9-yl-8-((2-hydroxyethyl)(6-oxo-6 -(undecyloxy)hexyl)amino)octanoate}, 1,2-DSPC represents 1,2-distearoyl-sn-glycero-3-phosphocholine, DMG-PEG(2000) represents alpha-(3'-{[1,2-di(myristyloxy)propanoxy]carbonylamino}propyl)-ω-methoxy, polyoxyethylene, and ALC-0159 represents 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide. Ionized lipids are neutral at physiological pH but cationic in acidic environments.
[0060] The lipid nanoparticles preferably contain an ionizable lipid (e.g., DLin-MC3-MDA, ALC-0315, and SM-102), a PEG lipid (e.g., DMG-PEG (2000), and ALC-0159), a phospholipid (e.g., 1,2-DSPC), and cholesterol, and the lipid molar ratio (ionizable lipid / PEG lipid / phospholipid / cholesterol) may be 45-50 / 5-15 (preferably 8-10) / 35-45 (preferably 37-42) / 1-2 (provided that the total is 100 or less). For details of lipid nanoparticles, see, for example, Int. J. Pharm., 601:120586, 2021.
[0061] For example, Patisiran (Onpattro TM ) uses lipid nanovesicles containing siRNA as an active ingredient and contains Lin-MC3-DMA / 1,2-DSPC / DMG-PEG(2000) / cholesterol in a molar ratio of 50 / 10 / 38.5 / 1.5. Lipid nanoparticles containing lipids in this molar ratio may also be used in the present disclosure.
[0062] In one aspect, lipid nanoparticles comprising Lin-MC3-DMA, 1,2-DSPC, DMG-PEG(2000), and cholesterol are provided, which comprise a knockdown nucleic acid of the present disclosure, and the lipid nanoparticles preferably contain Lin-MC3-DMA / 1,2-DSPC / DMG-PEG(2000) / cholesterol in a molar ratio of 45-50 / 5-15 (preferably 8-10) / 35-45 (preferably 37-42) / 1-2 (provided that the total is 100 or less).
[0063] In one aspect, lipid nanoparticles comprising Lin-MC3-DMA, 1,2-DSPC, DMG-PEG(2000), and cholesterol are provided, comprising a knockdown nucleic acid of the present disclosure, wherein the lipid nanoparticles contain Lin-MC3-DMA / 1,2-DSPC / DMG-PEG(2000) / cholesterol, preferably in a molar ratio of 50 / 10 / 38.5 / 1.5.
[0064] The lipid nanoparticles can be obtained, for example, by preparing an alcohol solution containing a lipid mixture and an aqueous solution containing nucleic acid, and then mixing the two solutions using a microfluidic device, etc. The lipid nanoparticles can include, for example, but are not limited to, micelles (e.g., reverse micelles) in which nucleic acid is encapsulated by ionized lipid and cholesterol inside an outer shell formed by PEG lipid and cholesterol.
[0065] ATM inhibitors for use in the methods of the present disclosure The present disclosure provides an ATM inhibitor or a composition comprising an ATM inhibitor for use in the methods of the present disclosure. The present disclosure also provides use of an ATM inhibitor in the manufacture of a composition for use in the methods of the present disclosure.
[0066] <Kit for use in the method of the present disclosure> The present disclosure provides a kit, particularly a kit for use in the method of the present disclosure. The kit may include: (A) one or more components selected from the group consisting of (i) a sequence-specific nucleic acid cleaving molecule, or a sequence-specific nucleic acid cleaving molecule complex, or a nucleic acid encoding the same; (ii) a template DNA; and (iii) an ATM inhibitor; (B) (i) and (ii); (C) (ii) and (iii); (D) (i) and (iii); or (E) (i), (ii), and (iii). For example, the kit may include an ATM inhibitor. The kit may include a viral vector having a single-stranded DNA genome (preferably an AAV vector), a plasmid for constructing the viral vector containing the genome of a viral vector having a linear double-stranded DNA genome (e.g., an adenovirus vector, a herpesvirus vector, or a poxvirus vector), a plasmid for constructing the viral vector containing the genome of a viral vector having a circular double-stranded genome containing double-stranded donor DNA (e.g., a human papillomavirus vector, a polyomavirus vector, or a baculovirus vector), and / or a helper plasmid. The viral vector genome may have, for example, two inverted repeat sequences (ITRs), preferably a cloning site (preferably a multiple cloning site) between them, allowing the integration of donor DNA. Therefore, the resulting viral vector contains the sequence of the donor DNA between the two ITRs. A helper plasmid is used when producing the viral vector. Therefore, the kit may further include such a helper plasmid. In the case of an AAV vector, the helper plasmid may contain, for example, a gene encoding a capsid (e.g., VP1, VP2, and VP3) and a gene region responsible for the adenovirus helper function (e.g., E1A, E1B, E2A, VA, and E4orf6). When the packaging cell is a 293 cell, factors other than E1A and E1B that the cell originally contains can be supplied by the helper plasmid.The kit of the present disclosure may include a helper plasmid in addition to the plasmid for constructing the viral vector. The kit of the present disclosure may further include one or more ATM inhibitors. The present disclosure provides the use of a plasmid for constructing the viral vector, a helper plasmid, and / or an ATM inhibitor in the manufacture of the kit. When the method of the present disclosure is performed in vivo, the present disclosure provides a composition comprising one or more of a sequence-specific nucleic acid cleaving molecule (or a sequence-specific nucleic acid cleaving molecule complex) or a nucleic acid encoding the same, template DNA (e.g., single-stranded DNA or double-stranded DNA), and an ATM inhibitor (or, if the ATM inhibitor is a nucleic acid, a nucleic acid encoding the ATM inhibitor) for use in such a method. For example, the present disclosure provides an ATM inhibitor or a composition comprising the ATM inhibitor for use in the above-described in vivo method. When the ATM inhibitor is RNA, the ATM inhibitor may be incorporated into the viral vector genome as DNA encoding the RNA operably linked to a promoter. In this case, the kit may not separately include an ATM inhibitor, or may further include an ATM inhibitor.
[0067] <Compositions Comprising Modified Cells Obtained by the Methods of the Present Disclosure> The present disclosure provides modified cells obtainable by the methods of the present disclosure, and compositions comprising the modified cells. The modified cells and compositions obtainable by the methods of the present disclosure may contain an ATM inhibitor.
[0068] <Viral Vectors for Use in the Methods of the Present Disclosure> The present disclosure provides a viral vector (preferably an AAV vector) containing linear single-stranded donor DNA or a composition containing the viral vector for use in the methods of the present disclosure. The present disclosure also provides a viral vector (e.g., an adenovirus vector, a herpesvirus vector, and a poxvirus vector such as a vaccinia virus vector) containing linear double-stranded donor DNA for use in the methods of the present disclosure. The present disclosure also provides a circular double-stranded viral vector (e.g., a human papillomavirus vector, a polyomavirus vector, and a baculovirus vector) containing double-stranded donor DNA for use in the methods of the present disclosure. The present disclosure also provides the use of the viral vector (preferably an AAV vector) in the manufacture of a composition or medicament for use in the methods of the present disclosure. Examples of AAV vectors are described above. When the ATM inhibitor is RNA, the ATM inhibitor may be incorporated into the viral vector genome as DNA encoding the RNA operably linked to a promoter.
[0069] Example 1: Effect of ATM inhibitors on genome editing efficiency by homology-directed repair (HDR) The present inventors screened 174 small molecule compounds using a reporter ES cell line that can distinguish between double-strand breaks (DSBs), non-homologous end joining (NHEJ), and homology-directed repair (HDR) as editing results in genome editing in the presence of donor nucleic acid. An adeno-associated virus (AAV) vector was used as the donor nucleic acid, and the CRISPR / Cas9 system was used for genome editing.
[0070] Mouse embryonic stem (ES) cells were cultured on 0.1% (w / v) gelatin-coated tissue culture plates in 2i medium: Glasgow minimum essential medium (Sigma-Aldrich), 10% fetal bovine serum (FBS) (Moregate), 1000 U / mL leukemia inhibitory factor (Fujifilm), 3 μM CHIR99021 (StemCell Technologies), 1 μM PD032591 (StemCell Technologies), 0.1 mM β-mercaptoethanol (Thermo Fisher Scientific), 1× GlutaMAX (Thermo Fisher Scientific), 1 mM sodium pyruvate (Thermo Fisher Scientific), 1× non-essential amino acids (Thermo Fisher Scientific), and penicillin-streptomycin (Thermo Fisher Scientific). Cells were cultured at 37°C in 5% CO2 and passaged every 2 days. Mouse bone marrow-derived stromal cells were immortalized with SV40 large T antigen (stromal cell line). Stromal cell lines were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 20% FBS, 1x GlutaMAX, and penicillin-streptomycin. Cells were cultured at 37°C in 5% CO2 and passaged every two days.
[0071] To prepare the Cas9 / ribonucleoprotein (RNP) complex, tracrRNA (IDT) and target-specific crRNA (IDT) were mixed, incubated at 95°C for 5 minutes, and cooled to room temperature to form a duplex. The target-specific duplex was mixed with Cas9 protein (final concentration: 18.6 μM) (IDT) and incubated at room temperature for an additional 20 minutes. AAV6 was produced using the AAVpro Helper-Free System (Takara Bio) according to the minimal purification method (17). A mixture of pAAV-Reporter-donor or pAAV-Actb-donor was added to AAV6. EGFP, pHelper, and pRC6 encoding the AAV2 rep and AAV6 capsid genes were prepared at a molecular ratio of 1:2:2. HEK293T cells were transfected with a mixture of circular plasmid DNA and PEI Max (Polysciences) at a mass ratio of 1:6. After 24 hours, the medium was replaced with FBS-free DMEM, and the cells were cultured for 5 days. The medium was collected and filtered through a 0.22 μm filter (Merck Millipore). The AAV in the filtrate was concentrated using a Vivaspin 20 column (Sigma-Aldrich) with a 100k molecular weight cutoff at 2600 rpm for 3 hours. To measure AAV concentration, DNA was extracted using the phenol-chloroform-isoamyl alcohol method. AAV vector genome (vg) was quantified using qPCR.
[0072] pActb-TagBFP: The sequence of TagBFP was ordered as a gBlock from Integrated DNA Technologies (IDT). It was then amplified by PCR using a primer set that added a linker sequence immediately before TagBFP (see Table 1). The 5' and 3' arms were amplified by PCR from mouse genomic DNA. These two PCR fragments were cloned into linearized pUC19 (Takara Bio) using the NEBuilder Cloning Kit (NEB). pActb-lacZ-mCherry: To extend the length of intron 3 of Actb, the sequence shown in Supplementary Table S2 was ordered as a gBlock and amplified by PCR. Oligonucleotides containing the splice acceptor and linker sequences and the recognition sequence for gRNA cleaving TagBFP were synthesized, and the sense and antisense strands were annealed. LacZ and mCherry were amplified by PCR. The 5' and 3' arms were obtained by PCR amplification of mouse genomic DNA. These five fragments were cloned into a linearized pUC19 backbone amplified using the primer set (see Table 1) and the NEBuilder cloning kit. pReporter-donor: Oligonucleotides containing linker and 2A sequences were synthesized and annealed for both the sense and antisense strands. The 5' arm, containing an upstream STOP sequence, and the 3' arm, containing a downstream STOP sequence, were generated from the pActb-lacZ-mCherry construct using PCR. EGFP was amplified by PCR. These five fragments were cloned into a linearized pUC19 backbone amplified with the primers listed in Table 1 using the NEBuilder cloning kit. pReporter-donor-HITI: The sense and antisense strands of the "homology-independent target insertion (HITI)" sequences designed at both the 5' and 3' ends were synthesized, annealed, and inserted into the pReporter-donor vector using the NEBuilder cloning kit.The 5' end was inserted between the HindIII and NotI sites located upstream of the 5' STOP sequence of the pReporter-donor vector using the NEBuilder cloning kit. The 3' HITI fragment was inserted between the AflII and SalI sites located downstream of the 3' STOP sequence. pAAV-Reporter-donor: The plasmid was digested with AflII and HindIII to excise the pReporter-donor construct. This fragment was cloned into a backbone derived from pAAV-CMV-EGFP (Takara Bio). pActb-EGFP: To replace TagBFP in pActb-TagBFP with EGFP, EGFP amplified with the primer set (Table 1) was cloned into a SphI-XhoI-digested backbone derived from pActb-TagBFP using the NEBuilder cloning kit. pAAV-Actb-EGFP: The plasmid was digested with HindIII and EcoRI to excise the pActb-EGFP construct. The excised fragment was cloned into a backbone derived from pAAV-CMV-EGFP (Takara Bio). This vector contained a gene encoding EGFP operably linked to a β-actin promoter, with an upstream homology arm (5' arm) capable of homologous recombination with the target site upstream, a downstream homology arm (3' arm) capable of homologous recombination with the 5' side of the EGFP-encoding gene and its downstream LacZ gene, and a nonsense mutation (STOP sequence). This vector was used as donor DNA for genome editing. Cas9 / gRNA expression vector: To introduce the gRNA sequence into the Cas9 expression vector, pX330-U6-Chimeric_BB-CBh-hSpCas9 (a gift from Feng Zhang, Addgene #42230) was digested with BbsI (16). Annealed oligonucleotides (listed in Table 1) were then inserted into the digested vector using DNA ligase (Toyobo).
[0073]
[0074] Mouse ES cells (1 x 106 The cells (800 cells) were suspended in 100 μL of Opti-MEM (Gibco) and either 3 μg of pX330-Actb-Exon6 and 10 μg of pActb-TagBFP or 1.5 μg of pX330-Actb-Intron3, 1.5 μg of pX330-Actb-Exon6, and 10 μg of pActb-lacZ-mCherry were added. Each mixture was transferred to a 2-mm electroporation cuvette and electroporated using NEPA21 (Nepagene). The electroporation settings were five 2-ms polling pulses at 145 V, followed by five 50-ms transfer pulses at 20 V. After 4 days, TagBFP-positive or mCherry-positive cells were single-cell sorted and cloned using an SH800 cell sorter (Sony Biotechnology). Heterozygous insertion clones were selected by PCR (see Table 2). The resulting reporter ES cells contained TagBFP on one allele and mCherry, a linker, lacZ, and mCherry on the other allele. The DSB detection ability of the reporter system (Actb-TagBFP) was verified using the Surveyor Mutation Detection Kit (IDT) and deep sequencing (see Table 2). Before cleavage, these reporter ES cells emitted blue and red fluorescence from BFP and mCherry. When indels were generated and ligated in-frame, they emitted red fluorescence from mCherry. When the donor was inserted into the target by HDR, they emitted yellow fluorescence from mCherry and EGFP. When the donor was inserted into the target by NHEJ, they emitted green fluorescence from EGFP. Therefore, the differences in fluorescence color allow us to distinguish between pre-editing and post-editing edits.
[0075]
[0076] For targeted insertion using circular plasmid DNA as the donor vector, 3 μg of pX330-TagBFP and 10 μg of pReporter-donor were electroporated with or without the HITI sequence under the same conditions as those used to establish reporter cells. Cells were plated on gelatin-coated dishes and cultured for 4 days. For targeted insertion using AAV as the targeting vector, 1 × 10 6 3 × 10 reporter ES cells were suspended in 100 μL of Opti-MEM containing the Cas9 / RNP complex (final: 0.744 μM), electroporated, and plated onto a gelatin-coated dish. 5 AAV (vg / cell) and 0.5 μg / mL iMatrix were added to the wells. To prevent serum-mediated inhibition of AAV transduction, cells were first cultured in serum-free 2i medium for 2 days, then switched to 2i medium containing 10% FBS for 2 days. Genome editing efficiency was assessed using flow cytometry (SH800) and stained with 7-AAD (BD Biosciences) to exclude dead cells.
[0077] For targeted insertion using circular plasmid DNA as a donor vector, 1 × 10 6 Stromal cells were suspended in 100 μL of Opti-MEM containing 3 μg of pX330-Actb-Exon6 and 10 μg of pActb-EGFP. The mixture was transferred to a 2 mm cuvette for a NEPA21 electroporator. The electroporation settings were five 2 ms polling pulses at 125 V, followed by five 50 ms transfer pulses at 20 V. Electroporated cells were cultured in DMEM containing 20% FBS for 4 days. For targeted insertion using AAV as the targeting vector, 1 × 10 cells were used. 6 The stromal cell line was suspended in 100 μL of Opti-MEM containing the Cas9 / RNP complex (final: 0.744 μM) and electroporated under the same conditions as for circular plasmid-mediated targeting. Then, 1 × 10 cells were electroporated. 6The cells were mixed with AAV-Actb-EGFP at 1000 vg / cell and cultured in serum-free DMEM for 24 hours, followed by culture in DMEM containing 20% FBS for 3 days. The efficiency of genome editing was assessed using flow cytometry (SH800) and DAPI staining to exclude dead cells.
[0078] For drug screening, electroporated reporter ES cells were treated with compounds from a DNA damage / DNA repair compound library (Selleck Chemicals) to assess the effect of the reagents on genome editing efficiency. This analysis was performed using an LSRFortessa X-20 flow cytometer (BD Bioscience) equipped with a sample loader.
[0079] Statistical analysis was performed using Prism version 10 (GraphPad Software). Data from all experiments are presented as mean ± standard deviation (sd). Percentage data were transformed using the Arcsine function in MS Excel (Microsoft Corporation). Distributions were tested using the Shapiro-Wilk test. Parametric or nonparametric tests were selected based on the results of normality tests. For unpaired t-tests, paired t-tests, Dunn's multiple comparison tests, and Dunnett's multiple comparison tests, a p<0.05 value was considered statistically significant (*p<0.05; **p<0.01; ***p<0.001, ***p<0.0001). Tests were performed according to normality.
[0080] Drug screening using ES cells yielded several compounds, including KU55933. KU55933 is an ATM inhibitor. ATM is known to be involved in double-strand break detection. To confirm whether other ATM inhibitors also enhance the efficiency of homologous recombination repair, we examined the effects of ATM inhibitors other than KU55933, including KU60019, AZD1390, M4076, and AZ32, on the efficiency of HDR via the CRISPR / Cas9 system. Here, donor DNA for recombination was provided by an AAV vector (AAV6-Actb-EGFP-1kb arm).
[0081] The results are shown in Figures 1A and 1B. Figures 1A and 1B show that both ATM inhibitors improved the efficiency of genome editing-mediated HDR in whole stromal cells (second row from the top in Figures 1A and 1B) and hematopoietic stem / progenitor cells (KSL cells). This demonstrates that ATM inhibitors enhance HDR efficiency using donor DNA (single-stranded DNA) delivered by AAV vectors in stromal cells and hematopoietic stem / progenitor cells. KU55933 and AZ32 also showed a tendency to enhance HDR efficiency using donor DNA delivered by AAV vectors. In contrast, ATM inhibitors reduced HDR efficiency using donor DNA delivered by circular plasmid DNA. Similar experiments were performed with immortalized stromal cell lines, and as shown in Figure 2A, ATM inhibitors were shown to enhance HDR efficiency using donor DNA (single-stranded DNA) delivered by AAV vectors. Furthermore, this effect was confirmed not only in ES cells, but also in mesenchymal stem cells (MSCs) and HEK293T cells (see Figure 2A).
[0082] Using the reporter ES cells, the efficiency of homologous recombination repair in the presence of double-stranded donor DNA and single-stranded donor DNA was compared. The dsODN used was double-stranded DNA excised from pReporter-donor with a restriction enzyme. The lsODN was prepared by converting the above dsODN into single strands using a denaturing buffer. 1 × 10 6 The reporter ES cells were seeded onto a gelatin-coated 10 cm culture dish and cultured in 2i medium with the above composition. After 24 hours, the medium was replaced with 10 mL of fresh medium containing 10 μM KU55933 as an ATM inhibitor. 8 × 10 5 The cells were suspended in 20 μL of nucleofection solution containing 5.5 μg of Cas9-RNP and 0.3 μg of lsODN or 0.6 μg of dsODN. Electroporation was performed using a Lonza nucleofector with the DS150 program. 1 × 10 cells were then transfected. 5Cells were seeded onto gelatin-coated 96-well plates. 24 hours after electroporation, the medium was replaced with fresh medium. 3 days after electroporation, HDR efficiency was assessed by flow cytometry. The results are shown in Figure 2B. As shown in Figure 2B, ATM inhibitors enhanced HDR efficiency when linear double-stranded DNA and linear single-stranded DNA were used as donor DNA.
[0083] Recombinant AAV6 was purchased from VectorBuilder after purification by cesium salt density gradient. scAAV6 was produced using the AAVpro Helper-Free System (Takara Bio) with minimal purification. A plasmid mixture was prepared by mixing pscAAV-Reporter-donor, pHelper, the AAV2 rep gene, and pRC6 encoding the AAV6 capsid gene at a mass ratio of 1:2:2. HEK293T cells were transfected with a mixture of plasmid DNA and PEI Max (Polysciences) at a mass ratio of 1:6. 24 hours after transfection, the medium was replaced with FBS-free DMEM, and the cells were cultured for 5 days. The culture supernatant was collected and filtered through a 0.22 μm filter (Merck Millipore). The AAV in the filtrate was concentrated by centrifugation at 2,600 rpm for 3 hours using a Vivaspin 20 column (Sigma-Aldrich) with a 100k molecular weight cutoff. The resulting AAV was washed twice in PBS using Vivaspin 20. To measure the AAV concentration, DNA was extracted using the phenol-chloroform-isoamyl alcohol method. To quantify the AAV vector genome (vg), we examined self-complementary AAV (scAAV), a double-stranded AAV, using qPCR. The scAAV responded similarly to AAV (see Figure 2C, upper right panel), suggesting that strand type is not a determining factor.
[0084] Next, we investigated whether the structural form (linear vs. circular) affected the response. To confirm this, we used a linear double-stranded DNA (dsDNA) donor excised from a circular plasmid (pReporter-donor) by restriction enzyme digestion. This linear dsDNA donor exhibited a similar response to ATM inhibition as AAV (see Figure 2C, lower left panel). ssDNA was obtained by digesting the plsODN-Reporter-donor plasmid with Nb.BbvCI and EcoRI (NEB). The digested DNA was separated by 1.2% agarose gel electrophoresis. DNA bands were visualized using crystal violet staining. The target band was excised and purified using the Long ssDNA Preparation Kit (BDL). Similar experiments were performed with the resulting ssDNA. As shown in the upper left panel of Figure 2C, ATMi significantly improved the knock-in efficiency.
[0085] Furthermore, we used a circular plasmid donor flanked by HITI sequences (pReporter-donor-HITI), which was designed to be linearized at both ends of the homologous arms by Cas9. This donor also showed the same response to ATM inhibition as AAV (Fig. 2D).
[0086] These results indicate that the differential response to ATM inhibition is determined by the structural form of the donor, i.e., linear or cyclic.
[0087] Example 2: Genome editing of hematopoietic stem / progenitor cells Next, hematopoietic stem / progenitor cells were genome-edited using the above-mentioned method, and then administered to animals to observe engraftment. The cells used were bone marrow cells derived from the tibia and femur of B6 mice.
[0088] Erythrocytes were lysed, and bone marrow hematopoietic stem and progenitor cells were enriched using CD117-beads with the Direct Lineage Depletion Kit (DepleteS) and AutoMACS (PosselS). 1 × 10 cells were cultured in a single well of a fibronectin-coated 24-well plate in HemEx-Type 9A medium (10 ng / ml SCF, 100 ng / ml TPO). 6Bone marrow cells were seeded. 90% of the medium was replaced on day 2. This medium replacement was repeated every two days, and the bone marrow cells were cultured for a total of 7 days.
[0089] The gRNA and targeting vectors used in the mouse stromal cell experiments were introduced into cells by electroporation. Electroporation: 2-4 × 10 cells were added to 20 μl of nucleofection buffer (16.4 μl P3 nucleofection solution + 3.6 μl nucleofection supplement). 5 The cells were plated and 2.5 μg / cuvette of Cas9 / RNP was added, then the cells were transferred to a 16-well cuvette and electroporated using the CM137 program in a 4D Lonza nucleofector.
[0090] Cells were then seeded: after nucleofection, 80 μl of medium was added to the well of the cuvette, and then all cells were transferred to a 1.5 ml tube. ATM inhibitor treatment: 5 × 10 4 The cells were diluted in 200 μl of culture medium (containing 10 nM AZD1390) and seeded into one well of a fibronectin-coated 96-well plate.
[0091] AAV introduction: 1x10 4 vg / cell AAV (AAV6-Actb-EGFP-1kb arm) was added to the wells (5 × 10 8 vgAAV 5 × 10 4 (For cells). 24 hours after genome editing, 90% of the medium was replaced with fresh medium. In vitro evaluation was performed 3 days after genome editing by calculating HDR efficiency in the CD150+ CD201+ KSL fraction using flow cytometry.
[0092] In vivo evaluation was also performed. The genome-edited cell population (4 × 10 5 cells, CD45.1) and rescue cells derived from another mouse (2 × 10 5The genome-edited cells were suspended in 100 μL of medium. These cells were administered to C57BL / 6 (CD45.2) mice irradiated with 9.5 Gy of radiation. Eight weeks after transplantation, peripheral blood was collected from the facial vein and red blood cells were lysed. HDR efficiency was assessed for T, B, NK, and myeloid cells. Engraftment rate was assessed by counting CD45.1-positive cells. Additionally, 12 weeks after transplantation, bone marrow cells were collected from the tibia and femur. After red blood cell lysis, HDR efficiency was assessed by counting the CD150+ CD48- KSL fraction. KSL is a c-kit + Sca1 + Lineage - and HSCs are CD150 + CD48 - It's KSL.
[0093] The results are shown in Figures 3 and 4. Figures 3 and 4 compare the engraftment rates of genome-edited cells without ATM inhibitor treatment (GE) and genome-edited cells with ATM inhibitor treatment (GE+ATMi). Figure 3 shows that GE+ATMi showed a significantly higher percentage of cells than GE in peripheral blood 8 weeks after transplantation. GE+ATMi also showed a significantly higher percentage of CD45.1-positive cells (i.e., transplanted cells) than GE. GE+ATMi also showed a significantly higher percentage of cells than GE in bone marrow cells, T cells, B cells, and NK cells. Figure 3 shows that ATM inhibitor treatment increased the percentage of cells with HDR-mediated knock-in genes in peripheral blood. Figure 4 also shows that ATM inhibitor treatment increased the percentage of HDR-mediated knock-in genes in bone marrow KSL cells and HSC cells 12 weeks after transplantation.
[0094] Example 3: Genome editing of fertilized eggs In this example, the effect of an ATM inhibitor on the induction of homologous recombination in fertilized eggs was examined.
[0095] Oocyte collection, in vitro maturation (IVM), and in vitro fertilization (IVF) were performed as described in Reproduction in Domestic Animals 52:969-75, 2017. Pig ovaries were collected from prepubertal female pigs at a local slaughterhouse. Cumulus cell-oocyte complexes were collected and cultured in maturation medium for 44 hours. Matured oocytes were then transferred to a 2×10 sac with frozen-thawed ejaculated sperm from microminipigs (Fuji Micra Co., Shizuoka, Japan). 6 Oocytes were cultured in porcine fertilization medium (Functional Peptide Institute, Yamagata, Japan) for 5 h and then in porcine zygote medium (PZM-5; Functional Peptide Institute) for 7 h. Oocytes were cultured in a humidified incubator at 39°C with 5% CO2.
[0096] Electroporation and in vitro culture. Electroporation was performed as described in Sci Adv 2:e1600803, 2016. Fertilized zygotes were placed in the electrode gap of a chamber slide (LF501PT1-20; BEX, Tokyo, Japan) filled with Nuclease-Free Duplex Buffer (IDT) containing 100 ng / μL gRNA targeting porcine Rosa26 and 100 ng / μL Cas9 protein (Guide-it Recombinant Cas9; Takara Bio Inc., Shiga, Japan). The zygotes were then electroporated (5 pulses of 1 ms at 25 V) using a CUY21EDIT II electroporator (BEX). After electroporation, 3 × 10 zygotes were cultured. 9The zygotes and embryos were cultured in PZM-5 containing 1000µg / mL of AAV6 vector (AAV6-Rosa26-KuO) in the presence or absence of various concentrations of KU55933 for 24 hours, and then cultured in PZM-5 for 6 days. The zygotes and embryos were cultured in a humidified incubator with 5% CO2, 5% O2, and 90% N2 at 39°C. The guide RNA sequence was as follows: pROSA26 gRNA91: gtgagagttatctgaccgtaagg. The knock-in detection primers were as follows: pROSA26_KI_EGFP_F1: ACGAGCTGTACAAGTAAGCG R2: ggcatgtgtggaaaattgtg
[0097] The results are shown in Figure 5. No difference was observed in the rate of blastocyst development from fertilized eggs in the presence of an ATM inhibitor compared to its absence, but the efficiency of gene knock-in by homologous recombination was clearly increased.
[0098] Example 4: Editing of Fertilized Eggs and Development to Blastocysts. The relationship between AAV concentration and knock-in efficiency using the ATMi AZ32 was investigated. Specifically, pig fertilized eggs were infected with AAV at various concentrations using the same method as in Example 3 (except that AZ32 was used as the ATMi and mEGFP was knocked into the 3' end of the β-actin gene), knock-in was induced, and the embryos were cultured to the blastocyst stage. The knock-in efficiency was estimated based on the mEGFP positivity rate. As shown in Figure 6, ATMi significantly increased knock-in efficiency using AAV as template DNA over a wide range. Furthermore, 1 μM AZ32 did not have any significant adverse effects on blastocyst development.
[0099] Fertilized pig eggs were implanted into the oviducts of female pigs, and fetuses were collected by Caesarean section on day 32 of pregnancy. The genome was extracted and the presence or absence of knock-in was confirmed by PCR. 5' end primer: F: CTGGCACCACACCTTCTACA R: TCGCCCTTGCTCACCATTC 3' end primer: F: GACGTAAACGGCCACAAGTT R: TTTGCGCTGACAGTTCCATTT
[0100] The results are shown in Figure 7. Namely, knock-in was successful in 75% of the embryos, and no toxicity of AZ32 was observed.
[0101] All documents cited herein are incorporated by reference in their entirety.
Claims
1. A method for inducing homologous recombination in a target cell, comprising: introducing a double-strand break into a target site in DNA in the target cell; culturing the target cell in the presence of donor DNA and an ATM inhibitor; wherein the donor DNA comprises an upstream homology arm homologous to the upstream of the target site and a downstream homology arm homologous to the downstream of the target site, and either further comprises a target sequence between the upstream homology arm and the downstream homology arm, or does not comprise any sequence; and after culturing, obtaining cells having DNA in which the target sequence has been inserted between the upstream and downstream of the target site or DNA in which the target sequence has been deleted between the upstream and downstream of the target site.
2. The method of claim 1, wherein the introduction of a double-strand break into the target site in the DNA is carried out by a sequence-specific nucleic acid cleaving molecule comprising a zinc finger nuclease (ZFN), a TALEN, or a CRISPR / Cas-based nuclease that targets and cleaves the site.
3. The method of claim 1 or 2, wherein the donor DNA is linear single-stranded DNA or linear double-stranded DNA.
4. The method of claim 1 or 2, wherein the donor DNA is derived from a circular DNA containing the target sequence of the sequence-specific nucleic acid cleaving molecule and is a linear DNA generated by cleavage of the target sequence with the sequence-specific nucleic acid cleaving molecule.
5. The method according to any one of claims 1 to 3, wherein the donor DNA is introduced into the cell by an adeno-associated virus vector carrying the sequence of the donor DNA.
6. The method according to any one of claims 1 to 5, wherein the target cells include blood cells.
7. The method of any one of claims 1 to 5, wherein the target cells include hematopoietic stem cells.
8. The method according to any one of claims 1 to 5, wherein the target cell comprises a fertilized egg.
9. The method of any one of claims 1 to 5, wherein the target cells comprise bone marrow stromal cells.
10. A method for editing a genome in a subject, comprising administering to the subject effective amounts of a sequence-specific nucleic acid cleaving molecule or a sequence-specific nucleic acid cleaving molecule complex or a nucleic acid encoding the same, template DNA, and an ATM inhibitor, and inducing homology directed repair in the subject to induce homologous recombination between a target site in the subject and the template DNA, wherein the template DNA comprises an upstream homology arm homologous to the upstream of the target site and a downstream homology arm homologous to the downstream of the target site, and either further comprises a sequence of interest between the upstream homology arm and the downstream homology arm, or does not comprise a sequence of interest.
11. A genome editing kit for use in the method of claim 10, comprising an effective amount of one or more components selected from the group consisting of: (i) a sequence-specific nucleic acid cleaving molecule, or a sequence-specific nucleic acid cleaving molecule complex, or a nucleic acid encoding the same; (ii) template DNA; and (iii) an ATM inhibitor.
12. Use of one or more components selected from the group consisting of: (i) a sequence-specific nucleic acid cleaving molecule, or a sequence-specific nucleic acid cleaving molecule complex, or a nucleic acid encoding the same; (ii) template DNA; and (iii) an ATM inhibitor, in the manufacture of a genome editing kit for use in the method of claim 10.
Citation Information
Patent Citations
Methods and compositions for enhancing nuclease-mediated gene disruption
JP2016509063A
Methods and compositions for genetic modification by targeting using guide RNA pairs
JP2017535271A
Compounds for increasing genome editing efficiency
JP2020516258A
DNA-PK inhibitors
JP2021511038A
Method for modulating the efficiency of double-strand break-induced mutagenesis
US20120244131A1