Three-dimensional culturing of pluripotent stem cells for improved differentiability
Culturing PSCs in a 3D bioreactor with specific reagents addresses low yields and scalability issues, resulting in a stable and efficient population for cell therapy.
Patent Information
- Application Number
- PCT/US2025/034946
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-06-25
- Filing Date
- 2025-06-24
- Publication Date
- 2026-01-02
AI Technical Summary
Manufacture of cell therapy products from pluripotent stem cells (PSCs) is hindered by low yields, low reproducibility, and limited scalability due to PSC heterogeneity and activity changes in culture.
Culturing PSCs in a three-dimensional bioreactor, optionally in suspension, in the presence of WNT inhibitors, chroman1, emricasan, polyamines, and trans-ISRIB (CEPT), and/or FGF2 to produce an expanded PSC population with improved yield, replating efficiency, and genomic stability.
The method enhances the yield, replating efficiency, and genomic stability of PSCs, producing a population suitable for cell therapy with improved differentiability.
Smart Images

Figure US2025034946_02012026_PF_FP_ABST
Abstract
Description
Docket no. BRT-017WO THREE-DIMENSIONAL CULTURING OF PLURIPOTENT STEM CELLS FOR IMPROVED DIFFERENTIABILITY 1. CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the priority benefit of U.S. provisional application no. 63 / 663,842, filed June 25, 2024, the contents of which are incorporated herein in their entireties by reference thereto. 2. SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML Sequence Listing, created on June 17, 2025, is named BRT-017WO_SL.xml and is 3,858 bytes in size. 3. BACKGROUND
[0003] Cell therapy provides great promise for the treatment of a variety of diseases and conditions. In cell therapy, autologous or allogeneic cells are transplanted into a patient to replace or repair defective or damaged tissue or cells that may have arisen from any of a multitude of medical conditions including genetic disorders, cancer, neurologic disorders, cardiac disorders, or eye-related issues. Pluripotent stem cells (PSCs) can serve as a renewable source of differentiated cells and tissues due to their capacity for extensive expansion and commitment to various somatic cell fates and thus are especially useful for cell therapy.
[0004] Manufacture of cell therapy products from PSCs has been hindered by low yields, low reproducibility, and limited scalability due to PSC heterogeneity and activity changes in culture. Thus, there is a need for reproducible and / or large-scale methods of manufacturing cell therapy products from PSCs. 4. SUMMARY
[0005] The present disclosure addresses the need for reproducible methods of manufacturing cell therapy products containing differentiated cells from PSCs. It is based, at least in part, on the realization that 3D expanded PSCs, relative to 2D expanded PSCs canhave certain deficiencies (e.g., lower yield, higher frequency of unwanted variants in genes like BCOR, and cause of diminished functionality in cells differentiated from the PSCs), but that certain culture conditions and presence of certain reagents during the PSC expansion can alleviate these deficiencies.
[0006] In some aspects, the disclosure provides methods of producing an expanded pluripotent stem cell (PSC) population comprising culturing a starting PSC under expansion conditions in a three-dimensional bioreactor, optionally in suspension, in the presence of one or more WNT inhibitors in order to produce an expanded PSC population. In some embodiments, the starting PSC is cryopreserved, and the method comprises thawing and optionally reactivation of the cryopreserved PSC.
[0007] In one aspect, the disclosure provides methods of producing an expanded PSC population comprising culturing a starting PSC under expansion conditions in a three- dimensional bioreactor, optionally in suspension, in the presence of (i) chroman1, emricasan, polyamines, and trans-ISRIB (CEPT) and / or (ii) FGF2 in order to produce an expanded PSC population. In some embodiments, the starting PSC is cryopreserved, and the method comprises thawing and optionally reactivation of the cryopreserved PSC.
[0008] In another aspect, the disclosure provides methods of improving the yield, replating efficiency, differentiability, and / or genomic stability of an expanded PSC population comprising culturing a starting PSC under expansion conditions in a three-dimensional bioreactor in a medium comprising (i) CEPT, (ii) FGF2, (iii) one or more WNT inhibitors, or (iv) any combination of (i)-(iii), thereby producing an expanded PSC population having an improved yield, replating efficiency, differentiability, and / or genomic stability as compared to a corresponding culture lacking (i), (ii), (iii), or (iv). As used herein, the term “corresponding culture lacking (i), (ii), (iii), or (iv)” means a culture in the same type of cell culture container and comprising an equivalent number of starting cells and media and cultured under the same conditions, such that the only measurable difference is the presence or absence of (i), (ii), (iii), or (iv).
[0009] In some aspects, the disclosure provides methods of producing an expanded PSC population comprising culturing a starting PSC under expansion conditions in a two- dimensional vessel in the in the presence of one or more WNT inhibitors.
[0010] Cells from the expanded PSC population produced by any of the methods of producing an expanded PSC population of the disclosure can then be cultured under differentiation conditions, thereby producing a population of differentiated cells, e.g. differentiated cells suitable for cell therapy.
[0011] In another aspect, the disclosure provides compositions comprising PSCs (e.g., PSC aggregates) and a medium comprising CEPT, FGF2, one or more WNT inhibitors, or a combination thereof.
[0012] In another aspect, the disclosure provides a kit comprising a PSC and CEPT, FGF2, one or more WNT inhibitors, or a combination thereof.
[0013] Methods of producing expanded PSC populations, methods of producing populations of differentiated cells, and cell populations are further described in Sections 6.3 and 6.4 and numbered embodiments 1 to 28 and 33 to 84 in Section 7. Compositions, kits, pharmaceutical compositions, uses thereof, and methods of producing pharmaceutical compositions are described in Section 6.5 and numbered embodiments 29 to 32 and 85 to 101 in Section 7. 5. BRIEF DESCRIPTION OF THE FIGURES
[0014] FIGS.1A-1B depict 2D and 3D expansions of PSCs. FIG.1A is a schematic process showing exemplary steps of 2D expansion of PSCs comprising passaging of the starting PSCs in 2D culturing vessels until harvesting. FIG.1B is a schematic process showing exemplary steps of 3D expansion of PSCs comprising preparation of starting PSCs from a cryopreservation vial (e.g., thawing and 2D pre-culturing of PSCs) followed by culturing the starting PSCs in a 3D bioreactor, e.g., in the presence of a WNT inhibitor as described herein. Starting PSCs that have been expanded in a 3D bioreactor are referred to herein as “3D expanded PSCs”. When expanded in the presence of a WNT inhibitor such as XAV939, the expanded PSCs are referred to as “3D+expanded PSCs”. When expanded in the absence of a WNT inhibitor, the expanded PSCs are referred to as “3D- expanded PSCs”.
[0015] FIGS.2A-2D show exemplary results of assessments of 3D expanded PSCs grown in 0.3c scale bioreactors in comparison to 2D expanded PSCs. FIG.2A is a graph that shows the results of flow cytometry for pluripotency markers as a percentage of cells positive for each pluripotency marker. FIG.2B is a graph that shows the percent re-plateconfluency of 3D expanded PSCs and 2D expanded PSCs. FIG.2C is a graph that shows fold expansion of 3D expanded PSCs and 2D expanded PSCs. FIG.2D is a graph that shows the results of a qPCR assessment depicting the changes of gene expression in 3D expanded PSCs relative to 2D expanded PSCs. The arrow points to the gene SP5, the expression of which displayed the largest increase in 3D expanded PSCs.
[0016] FIGS.3A-3C show the effect of different concentrations of WNT pathway inhibitor XAV939 (herein referred to as “XAV939”) on SP5 expression in 3D expanded PSCs or 2D expanded PSCs in small scale 6-well 3D culture plates with agitation. FIGS.3A and 3B are graphs that show the normalized ΔCq values for SP5 obtained from 3D- expanded PSCs and 3D+(5 µM) expanded PSCs or 3D+(10 µM) expanded PSCs vs.2D expanded PSCs, respectively. FIG.3C is a graph that shows the normalized ΔCq values for SP5 obtained from 3D- expanded PSCs, 3D+(2.5 µM) expanded PSCs, 3D+(5 µM) expanded PSCs or 3D+(10 µM).
[0017] FIGS.4A-4B show the differences in aggregation of 3D-0.3c expanded PSCs and 3D-1c expanded PSCs.
[0018] FIGS.5A-5E show exemplary results of assessments of 3D expanded PSCs grown in 1c scale bioreactors (3D-1c expanded PSCs) in comparison to 2D expanded PSC controls. FIG.5A is a graph that shows the results of flow cytometry for pluripotency markers as a percentage of cells positive for each pluripotency marker. FIG.5B is a graph that shows the percent re-plate confluency of 3D-1c and 2D expanded PSCs. FIG.5C is a graph that shows fold expansion of 3D-1c and 2D expanded PSCs. FIG.5D is a graph that shows the results of a qPCR assessment depicting the changes of gene expression in 3D+(2.5 µM XAV939) expanded PSCs relative to 2D expanded PSC controls. FIG.5E is a graph that shows normalized ΔCq values for SP5 obtained with 2D, 3D--0.3c, 3D+-0.3c (2.5 µM XAV939), 3D--1c and 3D+-1c (2.5 µM XAV939) expanded PSCs.
[0019] FIGS.6A-6D show exemplary results of assessments with DA neurons differentiated from 3D expanded PSCs grown in 0.3 c or 1c scale bioreactors in comparison to cells differentiated from 2D expanded PSC controls. FIG.6A is a graph displaying the post differentiation flow cytometry results for on-target and off-target genes obtained from DA neurons differentiated from 2D expanded PSCs, 3D--0.3c expanded PSCs, 3D--1c expanded PSCs, and from 3D+-0.3c expanded PSCs. FIG.6B is a graph that displays the qPCRchanges in DA neurons differentiated from 3D--0.3c expanded PSCs and from 3D+-0.3c expanded PSCs relative to those differentiated from 2D expanded PSCs. FIG.6C is a graph that shows differences in correlated neural activity of DA neurons differentiated from 3D-- 0.3c expanded PSCs or from 3D+-0.3c expanded PSCs in comparison to assay control cells or DA neurons differentiated from 2D expanded PSC controls. FIG.6D is a graph that shows dopamine release from DA neurons differentiated from 3D--0.3c expanded PSCs or from 3D+-0.3c expanded PSCs in comparison to assay control cells or DA neurons differentiated from 2D expanded PSC controls.
[0020] FIG.7 is a graph displaying the post differentiation flow cytometry results for on- target and off-target genes obtained from 3D-DA neurons differentiated from 2D expanded PSCs, from 3D--1c expanded PSCs and from 3D+-1c expanded PSCs, as well as results for on-target and off-target genes obtained from DA neurons differentiated from 3D--1c expanded PSCs in the presence of 1µM IWP-2.
[0021] FIGS.8A-8E show the effect of XAV939 on SP5 expression, pluripotency, confluency, and harvest density of 3D expanded PSCs. FIG.8A and 8B are graphs that show the normalized ΔCq values for SP5 obtained from and 3D-0.3c and 3D-1c expanded PSCs treated with 2.5 µM XAV939 and controls. FIG.8C is a graph that shows the results of flow cytometry for pluripotency markers as a percentage of 3D-0.3c expanded PSCs treated with 2.5 µM XAV939 and control cells positive for each pluripotency marker. FIG.8D is a graph that shows the percent re-plate confluency of 3D-0.3c expanded PSCs treated with 2.5 µM XAV939 and controls. FIG.8E is a graph that shows the harvest cell density of 3D- 0.3c expanded PSCs treated with 2.5 µM XAV939 and controls. In FIGS.8A-8E, “XAV” stands for XAV939, and “0.3c” stands for 3D-0.3c expanded PSC cultures.
[0022] FIGS.9A-9C show differences between aggregates of 3D-1c and 3D-0.3c expanded PSC cultures. FIG.9A shows the diameters of aggregates of 3D-1c and 3D-0.3c expanded PSC cultures on Day 9 (D9). FIG.9B shows the diameters of aggregates of 3D-1c and 3D- 0.3c expanded PSC cultures on Day 12 (D12). FIG.9C shows immunofluorescence of pluripotency markers on aggregates of 3D-1c and 3D-0.3c expanded PSC cultures.
[0023] FIGS.10A-10B show the effect of IWP-2 on on-target and off-target markers and dopamine release from DA neurons differentiated from 3D expanded PSC cultures. FIG. 10A shows the percentages of cells positive for on-target markers and off-target markers onDay 9. FIG.10B shows differences in dopamine release from cells differentiated from 3D expanded PSCs and controls (FIG.10B).
[0024] FIGS.11A-11C show the effect of culture media supplements on fractional abundance of a single nucleotide polymorphism (SNP) of BCL6 corepressor (BCOR) gene (BCOR SNP1) and harvest yields. FIG.11A shows BCOR SNP1 fractional abundance differences between 2D and 3D expanded PSC cultures. FIG.11B shows the differences in BCOR SNP1 fractional abundance in 3D expanded PSCs that were cultured in Stemscale (SS) media supplemented with Y-27632 (“Y”) and passaged with Accutase or EDTA, and 3D expanded PSCs that were cultured in Stemscale (SS) media supplemented with CEPT cocktail or supplemented with Y and pluronic. FIG.11C shows the differences in harvest yield in the same groups of cells in FIG.11B.
[0025] FIGS.12A-12C show the effect of cell culture media and supplements on health measures of 3D expanded PSCs. FIG.12A is a graph that shows the percent confluency of 3D expanded PSCs cultured in different media and supplement combinations. FIG.12B shows lactate dehydrogenase (LDH) levels of the same groups of 3D expanded PSCs in FIG.12A. FIG.12C shows lactate levels of the same groups of 3D expanded PSCs in FIG. 12A.
[0026] FIGS.13A-13E show the results of further assessments of the effect of cell culture media and supplements on health measures of 3D expanded PSCs on a small scale. FIG. 13A shows differences in BCOR SNP1 fractional abundance, FIG.13B shows differences in normalized ΔCq values for SP5, and FIG.13C shows differences in cell harvest yield for 3D expanded PSCs cultured on a small scale with different media-supplement combinations. FIG.13D shows the results of flow cytometry for pluripotency markers as a percentage of 3D expanded PSCs cultured on a small scale with different media-supplement combinations. FIG.13E shows the percent confluency of 3D expanded PSCs cultured on a small scale with different media-supplement combinations.
[0027] FIGS.14A-14E show the results of further assessments of the effect of cell culture media and supplements on health measures of 3D expanded PSCs on a large scale. FIG. 14A shows differences in BCOR SNP1 fractional abundance, FIG.14B shows differences in Iso 20q copy number variants (CNV), and FIG.14C shows differences in cell harvest yield for 3D expanded PSCs cultured on a large scale with different media-supplementcombinations. FIG.14D shows the results of flow cytometry for pluripotency markers as a percentage of 3D expanded PSCs cultured on a large scale with different media-supplement combinations. FIG.14E shows the percent confluency of 3D expanded PSCs cultured on a large scale with different media-supplement combinations.
[0028] FIGS.15A-15D show differences in expression patterns of OCT4 and PAX6 in 3D expanded PSCs cultured with different media-supplement combinations when cultured in ectoderm differentiation media. FIG.15A shows the percentage of cells from 3D expanded PSC cultures in SS media that are positive for OCT4 between Days 2 and 4 relative to controls. FIG.15B shows the percentage of cells from 3D expanded PSC cultures in SS media that are positive for PAX6 between Days 2 and 4 relative to controls. FIG.15C shows the percentage of cells from 3D expanded PSC cultures in mTeSR Plus™ media supplemented with CEPT cocktail that are positive for OCT4 between Days 2 and 4 relative to controls. FIG.15D shows the percentage of cells from 3D expanded PSC cultures in mTeSR Plus™ media supplemented with CEPT cocktail that are positive for PAX6 between Days 2 and 4 relative to controls.
[0029] FIGS.16A-16G show the results of DA neuron differentiation assessments with cells 2D differentiated from 3D expanded PSCs cultured in different media-supplement combinations. FIG.16A shows changes lactate levels over time in 2D differentiated DA neurons. FIG.16B displays cell yields in 2D differentiated DA neurons on Day 16. FIG.16C shows the results of flow cytometry for pluripotency markers as a percentage of cells positive for each pluripotency marker in each treatment condition. FIG.16D shows the results of qPCR marker analysis obtained with cells 2D differentiated from small scale and from large scale 3D expanded PSCs cultured with different media-supplement combinations. FIG.16E shows the BCOR SNP1 fractional abundance, FIG.16F shows differences in correlated neural activity, and FIG.16G shows differences in dopamine release from DA neurons 2D differentiated from 3D expanded PSCs cultured with different media-supplement combinations.
[0030] FIGS.17A-17G show the results of DA neuron differentiation assessments with cells 3D differentiated from 3D expanded PSCs cultured in different media-supplement combinations. FIG.17A shows changes lactate levels over time in 3D differentiated DA neurons. FIG.17B displays cell yields in 3D differentiated DA neurons on Day 16. FIG.17Cshows the results of flow cytometry for pluripotency markers as a percentage of cells positive for each pluripotency marker in each treatment condition. FIG.17D shows the results of qPCR marker analysis obtained with cells that were 3D differentiated from small scale and from large scale 3D expanded PSCs cultured with different media-supplement combinations. FIG.17E shows the BCOR SNP1 fractional abundance, FIG.17F shows differences in correlated neural activity, and FIG.17G shows differences in dopamine release from DA neurons 3D differentiated from 3D expanded PSCs cultured with different media-supplement combinations. 6. DETAILED DESCRIPTION 6.1. Definitions
[0031] Unless otherwise defined herein, scientific and technical terms used in connection with the present disclosure shall have the meanings that are commonly understood by those of ordinary skill in the art. Exemplary methods and materials are described below, although methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure. In case of conflict, the present specification, including definitions, will control. Generally, nomenclature used in connection with, and techniques of, cell and tissue culture, molecular biology, immunology, microbiology, genetics, analytical chemistry, synthetic organic chemistry, medicinal and pharmaceutical chemistry, and protein and nucleic acid chemistry and hybridization described herein are those well-known and commonly used in the art. Enzymatic reactions and purification techniques are performed according to manufacturer’s specifications, as commonly accomplished in the art or as described herein. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. Throughout this specification and embodiments, the words “have” and “comprise,” or variations such as “has,” “having,” “comprises,” or “comprising,” will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers. All publications and other references mentioned herein are incorporated by reference in their entirety. Although a number of documents are cited herein, this citation does not constitute an admission that any of these documents forms part of the common general knowledge in the art.
[0032] The practice of some methods disclosed herein employ, unless otherwise indicated, conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics and recombinant DNA, which are within the skill of the art. See for example Sambrook and Green, Molecular Cloning: A Laboratory Manual, 4th Edition (2012); the series Current Protocols in Molecular Biology (F. M. Ausubel, et al. eds.); the series Methods In Enzymology (Academic Press, Inc.), PCR 2: A Practical Approach (M. J. MacPherson, B.D. Hames and G.R. Taylor eds. (1995)), Harlow and Lane, eds. (1988) Antibodies, A Laboratory Manual, and Culture of Animal Cells: A Manual of Basic Technique and Specialized Applications, 6th Edition (R.I. Freshney, ed. (2010)); Barbare Detrick, Robert Hamilton, John L Schmitz, Manual of Molecular and Clinical Lab Immunology (2016).
[0033] A, An, The: As used herein, the articles “a,” “an,” and “the” are used herein to refer to one or to more than one (e.g., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.
[0034] The use of the alternative (e.g., “or”) should be understood to mean either one, both, or any combination thereof of the alternatives.
[0035] Aggregate, Cell Aggregate: As used herein, the terms “aggregate” and “cell aggregate” refer to multicellular assemblies of cultured cells. The cell aggregates used herein can be of various shapes, such as, for example, spherical, cylindrical, cuboidal, or elongated (e.g., rod-like, spindle-like, etc.), or can be of other regular (e.g., C-shaped, spiral- shaped, etc.) or irregular shapes. The number of cells in cell aggregates can vary. For instance, cell aggregates may comprise a minimal number of cells (e.g., two to twenty cells, etc.) per aggregate or may comprise tens, hundreds, or thousands of cells per aggregate. Typically, cell aggregates comprise hundreds to thousands of cells per aggregate. In some embodiments, the cell aggregate is not an organoid.
[0036] The number of cells in cell aggregates can vary. For instance, cell aggregates may comprise a minimal number of cells (e.g., two to twenty cells, etc.) per aggregate or may comprise tens, hundreds, or thousands of cells per aggregate. In some embodiments, cell aggregates comprise 50-400 cells per aggregate. In some embodiments, the average cell aggregate in a population from which a sample is prepared and / or in a sample comprises between 2 cells and 100 cells or between 2 cells and 50 cells per aggregate. In some embodiments, a cell aggregate on average comprises at most 100 cells (e.g., at most 100cells, at most 80 cells, at most 60 cells, at most 50 cells, at most 40 cells, at most 30 cells, at most 25 cells, at most 20 cells, or at most 10 cells). In some embodiments, a cell aggregate on average comprises at least 2 cells (e.g., at least 2 cells, at least 5 cells, at least 10 cells, at least 15 cells, or at least 20 cells).
[0037] The cell aggregates in a cell population can be of various shapes, such as, for example, spherical, cylindrical, cuboidal, or elongated (e.g., rod-like, spindle-like, etc.), or can be of other regular (e.g., C-shaped, spiral-shaped, etc.) or irregular shapes.
[0038] In some embodiments, the cell aggregates are of spherical shapes. In some embodiments, cell aggregates are up to 500 μm in diameter.
[0039] In some embodiments, the spherical cell aggregates are spheroids.
[0040] Cell Culture Container, Culture Container, Cell Culture Vessel: As used herein, the terms “cell culture container,” “culture container” and “cell culture vessel” refer to any container or receptacle suitable for or specifically designed to contain cell cultures and are preferably suitable to grow and expand cells in or on a medium. Typical cell culture containers are flasks, plates, tubes, multi-well plates, bioreactors and the like. Culture containers can be reusable or disposable. Typically, culture containers are made of plastic, typically optically transparent plastic, such as polystyrene or polycarbonate. Glass cell culture containers can also be used. In some embodiments, disposable cell culture containers are used to reduce the risk of contamination. In some embodiments, cell culture containers are made of polystyrene.
[0041] Cell culture plates refer to multi-well containers, typically rectangular structures comprising a plurality (such as, e.g., 4, 6, 8,12, 24, 48, 96, 384 or 1536) of shallow wells that are often round. Cell culture dishes may refer to single-well shallow containers such as, e.g., Petri dishes, which are circular shallow dishes, and are typically lidded. Cell culture dishes may also refer to rectangular cell culture dishes. Cell culture tubes refer to cylindrical or conical containers which can have a round or flat bottom surface, and are typically lidded. Cell culture flasks refer to containers that have a wider vessel “body” and one or more narrower tubular sections called necks that connect the body to an opening, which is typically lidded. Commonly used cell culture flasks have a parallelepiped shape with a flat and typically rectangular bottom surface.
[0042] In some embodiments, for 3D culture, PSCs are cultured in bioreactors, e.g., single use bioreactors such as Eppendorf BioBlu bioreactors (e.g., 0.3c, 1c, 5c, or 10c BioBlu bioreactors), Ambr® 250 High Throughput Perfusion Bioreactors, Applikon MiniBio bioreactors (e.g., MiniBio 250, MiniBio 500, and MiniBio 1000 bioreactors), Univessel® SU bioreactors, and the like. Bioreactors for performing 3D culture are sometimes referred to herein as “three-dimensional bioreactors” for convenience.
[0043] In some embodiments, for 2D culture, PSCs and their differentiated progeny are cultured in T-flasks, cell factories, cell stacks and the like. Cell culture vessels for performing 2D culture are sometimes referred to herein as “two-dimensional vessels” for convenience.
[0044] Cryopreservation: The freezing of cells is ordinarily destructive, such as due to ice crystal formation, osmotic dehydration and increased intracellular solute concentration during cooling and / or freezing. These injurious effects can be circumvented by (a) use of a cryoprotective agent, (b) control of the freezing rate, and (c) storage at a temperature sufficiently low to minimize degradative reactions. Cells can be stored using conventional equipment and methods, which include, but are not limited to, placing the container containing the cells in a freezer (e.g., ultra-low temperature freezer), and bringing the cells into contact with a low temperature medium (e.g., liquid nitrogen, etc.) and preserving them in a freezer or cryopreservation system).
[0045] In some embodiments, a program cooling method may be used. Cryopreserving cells with a program cooling method can be achieved by providing a freezing means set to a desired temperature in contact with a container containing cells directly or after accommodating the container in a freezing treatment container, e.g., a freezing treatment container such as a BICELLTM, Mr. Frosty or CoolCell container. The freezing temperature is typically not more than 0° C, preferably not more than −20°C, more preferably not more than −40°C, and in some embodiments not more than −80°C. The freezing treatment container may have a function of controlling the rate of temperature decrease inside the container to a predetermined speed. For instance, the cooling rate can be achieved by using a freezer whose cooling rate can be controlled by setting a program, such as a program freezer (e.g., KryoMed (Thermo Fisher), PDF-2000G (Strex), KRYO-560-16 (Asahi Life Science)). The cooling rate in the freezing operation is typically a cooling rate of 1-5 hours, for example 2-4 hours, particularly about 3 hours, from the start of cooling at 4°C to reach −80°C. A typicalcooling program comprises a cooling rate of -1°C / min to -2°C / min; when the temperature reaches below -25°C, the cooling rate can be adjusted to -5°C / min to -10°C / min; when the temperature reaches -100°C, the cell container can be quickly immersed in liquid nitrogen. Cells can be stored in liquid nitrogen for decades or longer.
[0046] The freezing operation can be performed using a culture medium in which colonies were immersed, a physiological buffer solution, or the like as a cryoprotective solution, and treating the solution by adding a cryoprotective agent, or replacing the culture medium with a cryoprotective solution containing a cryoprotective agent. When replacing the culture medium with a cryoprotective solution, the cryoprotective solution may be added after substantially removing all the culture medium, or the cryoprotective solution may be added while leaving a part of the culture medium. The cryoprotective solution may be commercially available and, for example, CryoStorTMCS10, and STEM-CELLBANKERTM(ZENOAQ) can be used.
[0047] The nonlimiting examples of cryoprotective agents include dimethyl sulfoxide (DMSO), ethylene glycol (EG), propylene glycol (PG), 1,2-propanediol (1,2-PD), 1,3- propanediol (1,3-PD), butyleneglycol (BG), isopreneglycol (IPG), dipropylene glycol (DPG), and glycerol. The cryoprotective agent may be used alone or two, three or more cryoprotective agents may be used in combination. Moreover, the cryoprotective agent may be used in combination with an extracellular cryoprotective agent. Nonlimiting examples of the extracellular cryoprotective agent include polyethylene glycol, carboxymethylcellulose sodium, polyvinylpyrrolidone, hydroxyethylstarch (HES), dextran, and albumin.
[0048] The concentration of the cryoprotective agent added to the culture medium, or the concentration of the cryoprotective agent in the cryoprotective solution, is typically 2%-20% (v / v), for example 5%-15% and in some embodiments 8%-13%, of the total culture medium or cryoprotective solution. The above-mentioned concentration ranges can be appropriately adjusted by the type of cryoprotective agent. For example, when DMSO is used as the cryoprotective agent, concentration of DMSO is typically 2%-20% (v / v), typically 2.5%- 12.5%, for example 5%-10%, of the total culture medium or cryoprotective solution.
[0049] A cryopreservation container can be used. Specific examples of cryopreservation containers include but are not limited to aseptic vials (e.g., glass ampoule, polymer vial (AT- closed vial) etc.).
[0050] Cryopreservation Container: As used herein, the term “cryopreservation container” refers to any container or receptacle suitable for cryopreservation of cells, e.g., a sterile or aseptic vial or ampoule. In some embodiments, the vial or ampoule has a volume of 1 mL – 3 mL (e.g., 1.5 mL, 1.8 mL or 2 mL).
[0051] Differentiation: As used herein, the term “differentiation”, and its grammatical equivalents, refers to a process by which a stem cell or progenitor cell alters from one cell type to a more specialized cell type. Each specialized cell type in an organism can express a subset of all the genes that constitute the genome of the cell. Each cell type can be defined by its particular pattern of regulated gene expression. Cell differentiation can thus be described as a transition of a cell from one cell type to another cell type coincident with a switch from one pattern of gene expression to another.
[0052] Expanding, Expansion: The methods of the present disclosure may include a step of culturing cells, e.g., from a cell bank (such as, but not limited to, a seed cell bank, master cell bank, or a working cell bank) in order to expand a population, e.g., prior to differentiation, selection and / or banking. As used herein, the terms “expanding” and “expansion” refers to culturing cells under proliferation conditions to increase the cell number. A cell culture undergoing expansion might be subject to one or more rounds of passaging, e.g., to maintain suitable conditions for expansion and / or for the health of dividing cells.
[0053] Expansion Phase: As used herein, the term “expansion phase” refers to a period of culturing cells between passages. In some embodiments, an expansion phase is performed under conditions in which the PSCs maintain expression of markers of pluripotency. Exemplary markers of pluripotency are disclosed in WO2022 / 204567 A1, the contents of which are incorporated by reference herein in their entireties.
[0054] Expansion Media: As used herein, the term “expansion media” refers to cell culture media suitable for expanding cells, e.g., PSCs. In some embodiments, expansion media is not supplemented with exogenous factors (e.g., sMAD inhibitors) that result in PSC differentiation.
[0055] Isogenic: As used herein, the term “isogenic” refers to cells having the same or closely similar genotypes. Cells that are isogenic share the same genetic background but may have a small number of genetic differences (e.g., 2, 3, 4, 5, 10 or 20 geneticdifferences), for example differences that spontaneously arise during cell culture. The term “isogenic” encompasses the term “monogenic,” which refers to cells of the same genotype.
[0056] Passaging, Passage: As used herein in the context of a cell culture, the terms “passaging” and “passage” shall refer to the transfer of all or a portion cells, e.g., from a previous cell culture, into a new cell culture. The transfer can be done into a new cell culture container, such as a dish, bottle or flask, having fresh cell culture medium that allows for further culturing and / or expansion of the cells.
[0057] Pluripotent Stem Cell, PSC: As used herein, the term “pluripotent stem cell”, and its grammatical equivalents, refers to a stem cell that has the capacity for self-renewal and the potential to differentiate into a more specified cell type. Examples of pluripotent stem cells include embryonic stem cells, fetal stem cells, embryonic germ cells, induced pluripotent stem cells, and the like. A stem cell established by cultivating an early embryo generated by transplantation of the nucleus of a somatic cell is also a pluripotent stem cell. The pluripotent stem cell may be an animal cell, a vertebrate cell, a mammalian cell, a primate cell, or human cell.
[0058] PSCs produced by 3D expansion of starting PSCs are referred to for convenience as “3D expanded PSCs”. PSCs produced by 3D expansion of starting PSCs in the presence of one or more WNT inhibitors as described herein are referred to for convenience as “3D+expanded PSCs”. PSCs produced by 3D expansion of starting PSCs in the absence of WNT inhibitors are referred to for convenience as “3D- expanded PSCs”. PSCs produced by 2D expansion of starting PSCs are referred to for convenience as “2D expanded PSCs”.
[0059] SP5: SP5 is a member of the Sp family of zinc finger transcription factors. The SP5 gene is downstream target in WNT signaling, and its expression leads to termination of the transcriptional program initiated by WNT signaling. Huggins et al., 2017, Nat Commun 8(1):1034. A representative SP5 gene is the human SP5 gene, NCBI gene ID 389058 (www.ncbi.nlm.nih.gov / gene / 389058), and a representative SP5 cDNA is set forth as SEQ ID NO:1: gcgagcgagcggggcgcggcgaggggcaagggcggggagggccccggcgc tcagagcaggcgccagggaggcaggctgggcggcccttcgtcctcgcctt cgggtgtccatgcctcggcggcggcgtcccgctccgcagccaggggcctg caagccgtagccatggccgcggtggccgtcctccggaacgactcgctgca ggcctttctccaggaccgcacccccagcgcctccccggacctgggcaagcactcgcccctggcattgctggccgccacctgtagccgcatcggccagccg ggcgcggcggcgcccccggacttcctgcaggtgccctacgaccccgcgct gggctcaccctccaggctcttccacccgtggaccgccgacatgccggcgc actcgccaggcgcactgccgcccccgcatcccagcttggggctgacgccg cagaagacgcacctgcagccgtccttcggggctgcgcacgagcttcccct tacaccccccgccgacccctcgtacccctacgagttctcgccggtcaaga tgctgccctcgagcatggcggctctgcccgccagctgcgcgcccgcctac gtgccctacgcggcgcaggccgcgctgccgccaggctactccaacctgct gcctccgccgccgccaccgcccccgccgcccacctgccgccagttgtcac ccaacccggcccccgacgacctcccgtggtggagcatcccgcaggcgggc gccgggccgggggcctccggggttccgggaagcggcctctccggcgcctg tgccggggccccccacgcgccccgcttccccgcctctgcggccgctgctg ctgcggccgccgccgccctacaaagaggcctggtgttgggcccgtcggac tttgcgcagtaccagagccagatcgccgcgctgctgcagaccaaggcccc cctggcggccacggccaggaggtgccgccgctgccgctgtcccaactgcc aggcggcgggcggcgcccccgaggcggagccggggaagaagaagcagcac gtgtgccacgtgccgggctgcggcaaggtgtacgggaagacgtcgcacct gaaggcgcacctgcgctggcacacgggcgagcgacccttcgtgtgcaact ggctcttctgcgggaagagcttcacgcgctcggacgagctgcagcggcac ctgcggactcacacgggcgagaagcgctttgcctgtcccgagtgcggcaa gcgcttcatgcgcagcgaccacctcgcgaagcacgtcaagactcaccaga ataagaagctcaaagtcgctgaggccggggttaagcgggaggacgcgcgg gacctgtgagccctcccggaggtggacccccttcccagcacctctgcgag agatccggggacctgtgggcagctggcggaggggagactcagcagacgga ccctctccgttgcctgcctcccaaaatggagccaggcttccaacttccgc tgccttcggacatgggacccagttcccaggagcggggaggtagggttggg gctggggcatttggattgtaattgggagctctgccgtacgccagggcggt tccaaactctaaaccgttcccaccgtcagggagacctacagtttcggggg accaccctgggctggccttgtatataggaaatgctgctgaactgaataga aaggaacttgggagatttgaaacagtgctcgggttttcgctaggaccggt ttgggctttgtacaggttatttaatagctttgttaaagataattataata attataacattaataaaaatgttgcttttgtcttcagctccatgcagagc tacagcatgatatgtctctgtaaagtgatcagcagttgcagcgtgaaaat aaatactttaactcaggggtcactacaggaagaccccgttg (SEQ ID NO:1)
[0060] Spheroid: As used herein, the term “spheroid” refers to a self-assembling cell aggregate or cluster, which is able to form without requiring a scaffolding. Typically, spheroids are spherical in shape and formed in conditions where cell-cell interactions predominate over cell-substrate interactions. A spheroid may be highly organized with a well-defined morphology and mimic different in vivo cell interactions, or it may be a simple mass of cells that have clustered or adhered together with minimal organization that relates to the tissue of origin.6.2. Starting PSCs
[0061] The present disclosure relates, in part, to methods that comprise culturing PSCs in 3D cell culture in the presence of a WNT inhibitor.
[0062] The PSCs that are seeded into 3D cell culture and cultured in the presence of a WNT inhibitor as described herein are referred to herein as “starting PSCs”.
[0063] The present disclosure further relates, in part, to methods that comprise culturing PSCs in 3D cell culture in the presence of CEPT and / or FGF2.
[0064] PSCs that are seeded into 3D cell culture and cultured in the presence of a CEPT and / or FGF2 as described herein are also referred to herein as “starting PSCs”.
[0065] In some embodiments, the starting PSCs are iPSCs. Methods of preparing iPSCs are known in the art and include, for example, inducing expression of one or more genes (e.g., POU5F1 / OCT4 (Gene ID: 5460) in combination with, but not restricted to, SOX2 (Gene ID: 6657), KLF4 (Gene ID: 9314), c-MYC (Gene ID: 4609, NANOG (Gene ID: 79923), and / or LIN28 / LIN28A (Gene ID: 79727)). Reprogramming factors may be delivered by various means (e.g., viral, non-viral, RNA, DNA, or protein delivery); alternatively, endogenous genes may be activated by using, e.g., CRISPR and other gene editing tools, to reprogram non-pluripotent cells into PSCs.
[0066] In some embodiments, the PSCs are generated from somatic cells (e.g., hematopoietic cells) using a non-integrating vector or episomal vector, e.g., an alphavirus vector, encoding reprogramming factors. In some embodiments, the iPSCs are generated by reprogramming a hematopoietic cell using any combination of the reprogramming factors, alphavirus vectors, reprogramming methods described in WO2022 / 204567 A1 and / or WO2013 / 177133A2, the contents of each of which are incorporated by reference herein in their entireties.
[0067] Methods of isolating and maintaining PSCs, including ESCs and iPSCs, are well known in the art. See, e.g., Thomson et al., 1998, Science 282(5391):1145-7; Hovatta et al., 2003, Human Reprod.18(7):1404-09; Ludwig et al., 2006, Nat Methods 3:637-46; Kennedy et al., 2007, Blood 109:2679-87; Chen et al., 2011, Nat Methods 8:424-9; and Wang et al., 2013, Stem Cell Res.11(3): 1103-16.
[0068] In some embodiments, the starting PSCs are prepared from cryopreserved cells, e.g., as described in Section 6.2.1.
[0069] The started PSCs can be in the form of single cells or cell aggregates. 6.2.1. Cryopreserved Cells
[0070] In some embodiments, the starting PSCs are prepared from a cell in storage, e.g., cryopreserved cells from a cell bank.
[0071] The term “cell bank” refers to a repository of cells in storage. Typically, the cells are preserved, e.g., in a cryopreservation solution. The cells in a cell bank may be cells of any organism. In some embodiments, the cells of a cell bank are human cells. Cells in a cell bank can be kept for years, decades or longer.
[0072] In some embodiments, the starting PSCs are the progeny of at least one (e.g., one) cryopreservation and reactivation cycle.
[0073] In some embodiments, the starting PSCs are the progeny of at least two (e.g., two) cryopreservation and reactivation cycles, optionally separated by an expansion cycle (e.g., a 2D expansion cycle).
[0074] In some embodiments, the starting PSCs are the progeny of at least three (e.g., three) cryopreservation and reactivation cycles, optionally separated by expansion cycles (e.g., 2D expansion cycles).
[0075] In some embodiments, the starting PSCs are prepared from a PSC or population of PSCs from a cell bank.
[0076] In some embodiments, the cells in the cell bank are banked individually, and thus the starting PSCs are prepared from a single cell.
[0077] In other embodiments, the cells in the cell bank are banked in clumps, and thus the starting PSCs are prepared from a PSC population.
[0078] Typically, preparing cryopreserved cells in a cell bank for culture comprises reactivating the cells, e.g., as described in Section 6.2.2.6.2.2. Reactivation
[0079] In some embodiments, the starting PSCs are prepared by reactivating cryopreserved cells prior to 3D expansion. The terms “cell reactivation” and “reactivation” refer to the process of reactivation of dormant cells, e.g., cryopreserved cells in a cell bank.
[0080] In some embodiments, a cryopreservation container containing one or more cryopreserved cells is collected from a cell bank and then contacted with a solid, liquid or gaseous medium (e.g., water, culture medium) having a temperature higher than the cryopreservation temperature, e.g., by using a water bath, an incubator, or the like. The temperature of the medium is typically 4°C-50°C, preferably 30°C-40°C, more preferably 36°C-38°C. The thawing time is typically within 2 minutes, and in some embodiments about 20 seconds, whereby a decrease in the survival rate of the cell can be drastically suppressed. The thawing time can be adjusted by, for example, changing the thawing means, temperature of immersion medium, volume or composition of the culture medium or cryoprotective solution during freezing, and the like.
[0081] Following thawing, the thawed cells can be washed by a known method. For example, the method includes, but is not limited to, suspending the cells in a cell washing (e.g., culture medium or biological buffer etc. containing serum, serum components (serum albumin and the like)), centrifuging same, discarding the supernatant, and collecting the precipitated cells. In the process of washing the cells, the cycle of suspending, centrifugation, and recovery may be performed once or plural times (e.g., 2, 3, 4, 5 or more). In one embodiment, the process of washing the cells is performed immediately after the process of thawing banked cells. Examples of commercially available cell washing solutions that can be used include CELLOTION (Japan ZENYAKU KOGYO) and the like.
[0082] In some embodiments, the thawed cells are pre-cultured. The pre-culture can be performed for an appropriate culture period according to the purpose, including restarting the metabolism of the previously cryopreserved cells, maintaining the cells in culture, and / or to achieve a sufficient number of cells to seed a larger culture vessel. In some embodiments, the pre-culture is not less than 1 day (e.g., 5, 6, 7 days) and not more than 10 days (e.g., 7, 8, 9, 10 days). The pre-culture temperature is not particularly limited and in some embodiment ranges between 30°C and 40°C, and is preferably 37°C. Pre-culture can be performed in the presence of CO2-containing air, e.g., at a CO2concentration of about2%-5%. In some embodiments, the pre-culturing (a) is performed two-dimensionally (“2D”), e.g., on a surface treated for increased PSC adherence, optionally wherein the surface is treated for increased hydrophilicity and / or (b) is performed under conditions that do not lead to differentiation, e.g., loss of pluripotency markers as described in WO2022 / 204567 A1. In some embodiments, cells are fed (e.g., daily, every other day, etc.) during the pre-culture period. In some embodiments, cells are not passaged during the pre-culture period. In other embodiments, pre-culturing includes passaging PSCs, e.g., once, twice, three times, four time, five times or more.
[0083] In the methods of the current disclosure, the term “reactivation” can refer to any one of a combination of steps to which a PSC or PSC population is subjected between the cryopreserved state and expanding PSCs in 3D cell culture as disclosed in Section 6.3 below.
[0084] In some embodiments, reactivating a PSC or population of PSCs comprises (a) thawing the PSC or population of PSCs; (b) washing the PSC or population of PSCs; (c) pre-culturing the PSC or population of PSCs to restart the cell(s)’ metabolism; and, optionally, (d) continuing the pre-culture for an additional period, with or without passaging. Typically, pre-culturing is carried in a smaller cell culture container than the container to which the cells are to be transferred for 3D cell culture.
[0085] Following pre-culture, the pre-cultured cells can be passaged to a 3D bioreactor as described in Section 6.3. In some embodiments, passaging is performed by introducing a detachment or dissociation reagent (e.g., a chelating agent such EDTA, EGTA, EDDS, BAPTA and the like or an enzyme such as Accutase) to cells, allowing time for the dissociation reagent to work, collecting the suspension of dissociation reagent and cells, centrifuging this suspension and resuspending cells in new media. 6.3. Expansion Conditions
[0086] Traditional cell culture involves growing cells in a flat, two-dimensional (2D) dish, where the cells typically grow as a monolayer. In contrast, 3D cell culture allows cells to grow and interact in all three dimensions. In some embodiments of the PSC expansion methods of the disclosure, a starting PSC is cultured in the presence of a WNT inhibitor, CEPT, FGF2, or a combination thereof. Advantageously, culturing a starting PSC in 3Dculture the presence of a WNT inhibitor results in improved differentiability of the PSCs into cells of an ectodermal, including neuroectodermal, lineage, such as DA neurons.
[0087] In some embodiments, the 3D culture can utilize a scaffold that provides support and guidance for cell growth. In some embodiments, the scaffolds are hydrogel-based scaffolds. In other embodiments, the 3D culture is performed under conditions where the PSCs themselves form clusters of spheroids. Clusters or spheroids can be generated when cells are cultured on low-adhesion culture plates or micropatterned surfaces that induce cell clumping and extracellular matrix production. Thus, in some embodiments, the term “3D culture” as used herein encompasses 2D culture methods on low adherence materials, resulting in formation of cell clumps (aggregates), including spheroids, in suspension.
[0088] In some embodiments, the 3D culture is performed in a bioreactor. In some embodiments, the bioreactor is a small-scale bioreactor. Small scale bioreactor systems are known in the art, e.g., as described by Grün et al., 2020, Processes 8:1656; doi:10.3390 / pr8121656. In some embodiments, the bioreactor conditions allow the growth of PSCs into spheroids. In some embodiments, the bioreactor is a stirred system bioreactor or a spinner flask.
[0089] Any suitable medium for expanding PSCs can be used for the 3D culture. In some embodiments, the medium is a defined or serum free culture medium, e.g., STEMPRO® hESC SFM (Life Technologies), Essential 8™ (Life Technologies), StemFit® AK02N (Ajinomoto Co., Inc.), and StemScale PSC Suspension Medium (Thermo Fisher Scientific). The culture media can be supplemented with a ROCK inhibitor such as ROCKi AS1892802, fasudil hydrochloride, GSK 269962, GSK 429286, H 1152, HA 1100, OXA 06, RKI 1447, SB 772077B, SR 3677, TC-S 7001, thiazovivin, Y-27632, or a combination of two or more of the foregoing. In some embodiments, the ROCK inhibitor is Y-27632.
[0090] In some embodiments, the medium comprises a basal medium, such as DMEM, or DMEM / F12 and one or more additives. Exemlary additives include fibroblast growth factor 2 (FGF2), e.g., heat-stabilized FGF2, TGF-β1, insulin, human serum albumin, a buffer, LiCl, and L-ascorbic acid. In some embodiments, the medium comprises FGF2. In some embodiments, the medium comprises TGF-β1. In some embodiments, the medium comprises FGF2 (e.g., heat-stabilized FGF2), TGF-β1, insulin, human serum albumin, a buffer, LiCl, L-ascorbic acid, or a combination thereof. In some embodiments, the mediumcomprises FGF2 (e.g., heat-stabilized FGF2), TGF-β1, insulin, human serum albumin, a buffer, LiCl, and L-ascorbic acid. In some embodiments, mTESR Plus™ medium (Stemcell Technologies, cat. no.100-1130) is used.
[0091] In some embodiments, the starting PSCs are cultured in a medium comprising CEPT cocktail, which comprises chroman1, emricasan, polyamines (e.g., putrescine, spermine, spermidine or a combination thereof), and trans-ISRIB. CEPT cocktails are commercially available, for example Thermo Fisher catalog number A56799. CEPT cocktails are commercially available as a 1000X stock, which can be diluted in culture medium, e.g., to 1X or 0.5 to 2X.
[0092] In some embodiments, the starting PSCs are cultured as a suspension in the presence of one or more WNT inhibitors, e.g., as described in Section 6.3.1 below.
[0093] In some embodiments, the starting PSCs are cultured as a suspension in a medium having a low amount of one or more protein kinase Cβ (PKCβ) inhibitors or none. In some embodiments, the medium includes less than 25 nM of a PKCβ inhibitor. In some embodiments, the medium includes less than 1 μM of the PKCβ inhibitor Ly333531.
[0094] The term “protein kinase Cβ (PKCβ) inhibitor” means a substance that inhibits or suppresses the activity of PKCβ, and in particular a substance that inhibits at least PKCβI and / or PKCβII. Specific examples of PKCβ inhibitors include Go6983, GF109203X, LY- 333531, Enzastaurin, Sotrastaurin, Ro-31-8220-mesylate, Ro-32-0432-hydrochloride, Go6976, Rottlerin, Midostaurin, Daphnetin, Dequalinium Chloride, Baicalein, Quercetin, Luteolin, Bisindolylmaleimide II, Calphostin C, Chelerythrine chloride, L-threo Dihydrosphingosine, and Melittin. In some embodiments, the starting PSCs are cultured as a suspension in a medium comprising none of the foregoing PKCβ inhibitors. In some embodiments, the starting PSCs are cultured as a suspension in a medium comprising none of the PKCβ inhibitors described in US 2025 / 0145965, the contents of which are incorporated herein by reference in their entireties.
[0095] Advantageously, oxygen is delivered to the 3D culture to allow proper oxygenation of cell aggregates. In some embodiments, dissolved oxygen in the culture is maintained by an oxygenator, in-line sparging and / or delivery of at least one oxygen-containing compound that releases dissolved oxygen into cell culture.
[0096] In some embodiments, the 3D culture is a perfusion culture. Perfusion is characterized by the continuous replacement of medium from the reactor by fresh medium while retaining cells in the vessel by specific systems (see, e.g., Kropp et al., 2017, Process Biochemistry 59:244-254). Perfusion is an operation mode for biopharmaceutical production processes enabling highest cell densities and productivity. Besides the advantage that cells in perfusion are constantly provided with fresh nutrients and growth factors, potentially toxic waste products are washed out, ensuring more homogeneous conditions in the bioreactor. Moreover, compared to repeated batch processes, perfusion processes support process automation and improved feedback control of the culture environment, including dissolved oxygen, pH, and nutrient concentrations.
[0097] The 3D PSC culture can be passaged, for example once or more than once (e.g., twice). In some embodiments, passaging is performed by introducing a dissociation reagent (e.g., a chelating agent such EDTA, EGTA, EDDS, BAPTA and the like or an enzyme such as Accutase) to cells, allowing time for the dissociation reagent to work, collecting the suspension of dissociation reagent and cells, centrifuging this suspension and resuspending cells in new media. In some embodiments, the 3D PSC culture is passaged no more than twice, no more than 3 times, no more than 4 times, no more than 5 times, no more than 6 times, no more than 7 times, no more than 8 times, no more than 9 times, no more than 10 times, no more than 11 times, no more than 12 times, no more than 20 times, no more than 30 times, or no more than 40 times. In some embodiments, the 3D PSC culture is passaged 2-4 times, 2-10 times, 5-10 times, 10-20 times, 15-25 times, 20-30 times, 25-35 times, or 30- 40 times.
[0098] PSCs produced by 3D expansion of starting PSCs in the presence of one or more WNT inhibitors as described herein are referred to for convenience as “3D+expanded PSCs”. PSCs produced by 3D expansion of starting PSCs in the absence of WNT inhibitors are referred to for convenience as “3D- expanded PSCs”. PSCs produced by 2D expansion of starting PSCs are referred to for convenience as “2D expanded PSCs”.
[0099] Following expansion, the 3D expanded PSCs can be cryopreserved. In some embodiments, the 3D expanded PSCs are cryopreserved as single cells. In some embodiments, the 3D expanded PSCs are cryopreserved as clumped (aggregated) cells.The cryopreserved PSCs can be reactivated, e.g., as described in Section 6.2.2, prior to differentiation, e.g., as described in Section 6.4.
[0100] In some aspects, an expanded PSC population is produced by culturing a starting PSC under expansion conditions in a two-dimensional vessel in the in the presence of one or more WNT inhibitors. Performing a 2D culture in the presence of one or more WNT inhibitors can be useful, for example, when relatively high expression of SP5 is observed in a 2D culture performed in the absence of the one or more WNT inhibitors. In some embodiments, culturing a starting PSC under expansion conditions comprises 2D culturing the presence of one or more WNT inhibitors and one or more agents that encourage PSC division, for example a growth factor such as fibroblast growth factor 2 (FGF2) and / or leukemia inhibitory factor (LIF). Media and media components described elsewhere in this Section 6.3 can be applied to the 2D expansion culture described in this paragraph. 6.3.1. WNT Inhibitors
[0101] Different classes of WNT pathway inhibitors are known to function at different levels of the pathway, from production and secretion of WNT ligands, their binding to membrane receptors, and the β-catenin destruction complex to the expansive β-catenin transcriptional complex.
[0102] In various embodiments, WNT inhibitors suitable for use in methods of the disclosure can include on or more of the following classes of inhibitors and / or one or more inhibitors within a class: (1) inhibitors of Wnt secretion (e.g. inhibitors of Pore, such as LGK974, IWP-1 or IWP-2); 2) competitive and non-competitive inhibitors of the interaction between Wnt or Rspondin and their respective receptors (e.g. OMP-18R5, OMP54F28); (3) factors that promote the degradation of components of the Wnt receptor complex, such as LRP (e.g. niclosamide) and factors that promote the degradation of Rspondin receptors, such as Znrf3 and / or Rnf43 or factors that activate Znrf3 and / or Rnf 3; (4) inhibitors of Dishevelled family proteins, such as inhibitors that reduce the binding of Dishevelled family proteins to Frizzled receptors and / orcomponents of the destruction complex (e.g., Dapper family proteins, FJ9, sulindac, 3289-8625, J01-017a, NSC668036) or inhibitors that downregulate the expression of Dishevelled family proteins (e.g. niclosamide); (5) factors that promote destruction complex activity, including (a) inhibitors of phosphatases (e.g. PPl, PP2A and / or PP2C) that dephosphorylate components of the destruction complex, such as axin and / or APC (e.g. okadaic acid or tautomycin) and (b) inhibitors of kinases (e.g. p38 MAPK, PKA, PKB, PKC, p90RSK or p70S6K) that phosphorylate GSK-3 (e.g. SB239063, SB203580 or Rp-8-Br-cAMP); (6) inhibitors of the deoligomerization of the destruction complex, such as inhibitors of Tankyrases 1 and / or 2 (e.g., XAV939, IWR1, JW74, JW55, 2-[4- (4-fluorophenyl)piperazin-l-yl]-6- methylpyrimidin-4(3H)-one or PJ34); and (7) inhibitors of β-catenin target gene expression, including inhibitors of the P- catenin:TCF / Lef transcription complex, such as inhibitors that disrupt the P- catenin:TCF-4 complex (e.g., iCRT3, CGP049090, PKF118310, PKF115- 584, ZTM000990, PNU-74654, BC21, iCRT5, iCRT14 or FH535) and inhibitors of the histone deacetylase SIRTl (e.g., cambinol).
[0103] In some embodiments, the one or more WNT inhibitors comprise one or more of XAV939, DKK1 (Dickkopf protein 1), IWR1, C59, IWR-1, IWP-2, and IWP-4.
[0104] In some embodiments, the one or more WNT inhibitors comprise one or more of inhibitors of the deoligomerization of the destruction complex, such XAV939, IWR1, JW74, JW55, 2-[4-(4-fluorophenyl)piperazin-l-yl]-6- methylpyrimidin-4(3H)-one and PJ34.
[0105] In some embodiments, the expansion conditions result in reduced SP5 expression as compared to expansion conditions lacking a WNT inhibitor.
[0106] In some embodiments, SP5 expression is reduced by at least 20%, by at least 30%, by at least 40%, by at least 50%, by at least 100%, by at least 500%, or by at least 1,000% as compared to a culture lacking the WNT inhibitor. As used herein, the term “corresponding culture lacking a WNT inhibitor” means a culture in the same type of cell culture container and comprising an equivalent number of starting cells and media andcultured under the same conditions, such that the only measurable difference is the presence or absence of the WNT inhibitor(s).
[0107] In some embodiments, SP5 expression is reduced by at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold,at least 10-fold, at least 50-fold, at least 100-fold, at least 500-fold, or at least 1000-fold as compared to a culture lacking the WNT inhibitor.
[0108] In some embodiments, SP5 expression levels are assayed by quantitative PCR (qPCR) of SP5 transcript levels, e.g., as disclosed in Example 1. In some embodiments, when SP5 expression levels are assayed by quantitative PCR, the decrease in SP5 expression results in cycle threshold (Ct) value (i.e., the number of amplification cycles required for a signal to reach a predetermined fluorescence level) that is at least 1, at least 2, at least 3, at least 4 or at least 5 above the Ct value in a corresponding culture lacking a WNT inhibitor. As used herein, the term “corresponding culture lacking a WNT inhibitor” means a culture in the same type of cell culture container and comprising an equivalent number of starting cells and media and cultured under the same conditions, such that the only measurable difference is the presence or absence of the WNT inhibitor(s).
[0109] Quantitative PCR analysis can be a dye-based qPCR (e.g., SYBR green method) or a probe-based qPCR (e.g., TaqMan method). TaqMan probes comprise a 5' fluorescent reporter dye and a 3' quencher dye, and qPCR analyses with TaqMan probes rely on binding of target-specific probes to the DNA sequence of interest during the annealing step and displacement of the TaqMan probe during the extension phase, and the cleavage of the 5' reporter dye by Taq polymerase. Once the reporter dye has been separated from the quencher dye, its fluorescent signal at the end of every qPCR cycle is measured.
[0110] SP5 expression can be assessed with commercially available SP5 TaqMan assays (e.g., ThermoFisher Assay ID Hs01370227_mH). In some embodiments, the decrease in SP5 expression results in cycle threshold (Ct) value (i.e., the number of amplification cycles required for a signal to reach a predetermined fluorescence level) that is at least 1, at least 2, at least 3, at least 4 or at least 5 above the Ct value in a corresponding culture lacking a WNT inhibitor as measured using a ThermoFisher Assay ID Hs01370227_mH according to the manufacturer’s instructions.
[0111] In some embodiments, WNT inhibitor concentration in the 3D PSC culture is maintained at a level that allows a sustained reduction in SP5 expression.
[0112] In various embodiments, wherein the one or more WNT inhibitors are added to a total WNT inhibitor concentration in the 3D culture of at least 1 µM, at least 2 µM. at least 3 µM, or at least 5 µM and / or a concentration of up to 10 µM, up to 15 µM, or up to 20 µM. For example, the WNT inhibitor concentration may range between 1 µM and 15 µM, between 2 µM and 20 µM, between 2 µM and 15 µM, or between 3 µM and 10µM.
[0113] In some embodiments, the one or more WNT inhibitors are added only once at the beginning of the 3D PSC expansion culture. In other embodiments, the one or more WNT inhibitors are added more than once during the cell culture, for example once at the beginning of the cell culture and one or more times during the culture. In some embodiments, one or more WNT inhibitors are added at different times in the 3D PSC expansion culture to a maintain total WNT inhibitor concentration in the culture of at least 1 µM, at least 3 µM, or at least 5 µM and / or a concentration of up to 10 µM, up to 15 µM, or up to 20 µM. For example, the WNT inhibitor concentration may be maintained at a range between 1 µM and 15 µM, between 2 µM and 20 µM, between 2 µM and 15 µM, or between 3 µM and 10µM. 6.4. PSC Differentiation
[0114] Cells of the expanded PSC populations produced by the methods of the disclosure can be differentiated, e.g., to produce a differentiated cell for use in cell therapy.
[0115] In some embodiments, cells of the expanded PSC populations are differentiated into cells of an ectodermal lineages.
[0116] In some embodiments, cells of the expanded PSC populations are differentiated into human nervous system cells. Examples of human nervous system cells include, but are not limited to optionally selected from dopaminergic neurons, microglial cells, oligodendrocytes, astrocytes, cortical neurons, spinal or oculomotor neurons, enteric neurons, placode-derived cells, Schwann cells, and trigeminal or sensory neurons.
[0117] In some embodiments, cells of the expanded PSC populations are differentiated into human ocular system cells. Examples of human ocular system cells include, but are notlimited to, retinal pigment epithelial cells, photoreceptor cone cells, photoreceptor rod cells, bipolar cells, and ganglion cells.
[0118] In some embodiments, cells of the expanded PSC populations are differentiated into dopaminergic (“DA”) neurons. Exemplary methods of differentiating PSCs into DA neurons are disclosed, e.g., in US10,017,734 B2, US10,280,398 B2, US9,968,637 B2, WO2010 / 096496A2; WO2011 / 149762A2; WO2013 / 067362A1; and WO2016 / 196661A1, the contents of each of which are incorporated by reference herein in their entireties.
[0119] In some embodiments, cells of the expanded PSC populations are differentiated into photoreceptor precursor cells. Exemplary methods of differentiating PSCs into photoreceptor precursor cells are disclosed, e.g., in WO2019 / 204817A1, the contents of which are incorporated by reference herein in their entireties.
[0120] In some embodiments, cells of the expanded PSC populations are differentiated into retinal pigment epithelial (RPE) cells. Exemplary methods of differentiating PSCs into RPEs are disclosed, e.g., in WO2017 / 044483A1, WO2021 / 243203A1, and WO2021 / 243256A1, the contents of each of which are incorporated by reference herein in their entireties. 6.5. Pharmaceutical Formulations
[0121] Differentiated cells prepared by the methods of the disclosure can be formulated with a pharmaceutically acceptable carrier or excipient for use in cell therapy.
[0122] Suitable carriers and excipients include, but are not limited to, salts, diluents, (e.g., Tris-HCl, acetate, phosphate), preservatives (e.g., Thimerosal, benzyl alcohol, parabens), binders, fillers, solubilizers, disintegrants, sorbents, solvents, pH modifying agents, antioxidants, anti-infective agents, suspending agents, wetting agents, viscosity modifiers, tonicity agents, stabilizing agents, and other components and combinations thereof. Suitable pharmaceutically acceptable excipients can be selected from materials which are generally recognized as safe (GRAS) and may be administered to an individual without causing undesirable biological side effects or unwanted interactions. Suitable excipients and their formulations are described in Remington's Pharmaceutical Sciences, 16th ed.1980, Mack Publishing Co. Suitable dosage forms for administration, e.g., parenteral administration, include solutions, suspensions, and emulsions.
[0123] The pharmaceutically acceptable carrier or excipient may be cell culture medium that optionally does not contain any animal-derived component. For storage and transportation, cells may be cryopreserved at < -70°C (e.g., on dry ice or in liquid nitrogen). Prior to use, the cells may be thawed, and diluted in a sterile cell medium that is supportive of the cell type of interest.
[0124] In some cases, formulations can include one or more tonicity agents to adjust the isotonic range of the formulation. Suitable tonicity agents are well known in the art and include glycerin, mannitol, sorbitol, sodium chloride, and other electrolytes. In some cases, the formulations can be buffered with an effective amount of buffer necessary to maintain a pH suitable for parenteral administration. Suitable buffers are well known by those skilled in the art and some examples of useful buffers are acetate, borate, carbonate, citrate, and phosphate buffers.
[0125] In some embodiments, the formulation can be distributed or packaged in a liquid form, or alternatively, as a solid, obtained, for example by lyophilization of a suitable liquid formulation, which can be reconstituted with an appropriate carrier or diluent prior to administration. The pharmaceutical compositions can be formulated for medical and / or veterinary use. 7. SPECIFIC EMBODIMENTS
[0126] The present disclosure is exemplified by the specific embodiments below. 1. A method of producing a population of differentiated cells, comprising culturing a starting pluripotent stem cell (PSC) under expansion conditions in a three-dimensional bioreactor in the presence of one or more WNT inhibitors, thereby producing an expanded PSC population. 2. The method of embodiment 1, which further comprises preparing the starting PSC. 3. The method of embodiment 2, wherein the starting PSC is prepared from a cryopreserved PSC. 4. The method of embodiment 3, wherein preparing the starting PSC comprises reactivating the cryopreserved PSC.5. The method of embodiment 4, wherein reactivating the cryopreserved PSC comprises thawing the PSC. 6. The method of embodiment 5, wherein reactivating the cryopreserved PSC further comprises washing the PSC. 7. The method of embodiment 5 or embodiment 6, wherein reactivating the cryopreserved PSC further comprises pre-culturing the PSC. 8. The method of embodiment 7, wherein pre-culturing the PSC comprises two- dimensional culturing of the PSC under conditions to restart cellular metabolism. 9. The method of embodiment 7 or embodiment 8, wherein pre-culturing the PSC comprises two-dimensional culture of the PSC under conditions to maintain the PSC in culture and / or to increase PSC number. 10. The method of any one of embodiments 1 to 9, wherein the expansion conditions comprise culturing the starting PSC in suspension. 11. The method of any one of embodiments 1 to 10, wherein the one or more WNT inhibitors comprise or consist of XAV939, DKK1 (Dickkopf protein 1), IWR1, C59, IWR-1, IWP-2, IWP-4, or any combination of two or more of the foregoing. 12. The method of any one of embodiments 1 to 11, wherein the one or more WNT inhibitors are used at a concentration sufficient to reduce SP5 expression to reduce SP5 expression to become detectable by quantitative PCR at a cycle threshold (Ct) value that is at least 1, at least 2, at least 3, at least 4 or at least 5 above the Ct value of a corresponding PSC culture lacking a WNT inhibitor, e.g., as measured using ThermoFisher Assay ID Hs01370227_mH according to the manufacturer’s instructions. 13. The method of any one of embodiments 1 to 12, wherein the one or more WNT inhibitors are used at a concentration sufficient to reduce SP5 expression by at least 20%, by at least 30%, by at least 40%, by at least 50%, by at least 100%, by at least 500%, or by at least 1,000% a corresponding PSC culture lacking a WNT inhibitor.14. The method of any one of embodiments 1 to 13, wherein the one or more WNT inhibitors are used at a concentration of at least 1 µM, at least 2 µM, at least 3 µM, or at least 5 µM. 15. The method of any one of embodiments 1 to 14, wherein the one or more WNT inhibitors are used at a concentration of up to 10 µM, up to 15 µM, or up to 20 µM. 16. The method of any one of embodiments 1 to 15, wherein the three-dimensional bioreactor is supplemented with one or more WNT inhibitors during the culture, e.g., daily. 17. The method of any one of embodiments 1 to 16, wherein the PSC is an induced pluripotent stem cell (iPSC) or embryonic stem cell (ESC). 18. The method of any one of embodiments 1 to 17, wherein the PSC is a human PSC. 19. The method of any one of embodiments 1 to 18, which further comprises cryopreserving cells of the expanded PSC population. 20. The method of embodiment 19, wherein cells of the expanded PSC population are cryopreserved individually. 21. The method of embodiment 19 or embodiment 20, which further comprises reactivating the cells of the expanded PSC population. 22. The method of embodiment 21, wherein reactivating the cells of the expanded PSC population is according to the method of any one of embodiments 5 to 9. 23. The method of any one of embodiments 1 to 18, which further comprises culturing cells from the expanded PSC population under differentiation conditions, thereby producing a population of differentiated cells. 24. The method of embodiment 23, wherein differentiation conditions result into differentiation into ectodermal lineage cells. 25. The method of embodiment 24, wherein the ectodermal lineage cells comprise or consist of:(a) human nervous system cells, optionally selected from dopaminergic neurons, microglial cells, oligodendrocytes, astrocytes, cortical neurons, spinal or oculomotor neurons, enteric neurons, placode-derived cells, Schwann cells, trigeminal or sensory neurons, or progenitors or precursors of any one of the aforementioned cells; or (b) human ocular system cells, optionally selected from retinal pigment epithelial cells, photoreceptor cone cells, photoreceptor rod cells, bipolar cells, ganglion cells, or progenitors or precursors of any one of the aforementioned cells. 26. The method of embodiment 24, wherein the population of differentiated cells comprises dopaminergic neurons. 27. The method of any one of embodiments 24 to 26, wherein the differentiation conditions comprise culturing PSCs in the presence of at least two sMAD inhibitors, optionally wherein the at least two sMAD inhibitors comprise Noggin and SB431542. 28. A differentiated cell population produced by the method of any one of embodiments 1 to 27. 29. The method of any one of embodiments 1 to 27, which further comprises formulating cells from the population of differentiated cells with a pharmaceutically acceptable excipient, thereby producing a pharmaceutical composition comprising differentiated cells and the pharmaceutically acceptable excipient. 30. A pharmaceutical composition comprising differentiated cells produced by the method of any one of embodiments 1 to 27, and a pharmaceutically acceptable excipient. 31. A pharmaceutical composition produced by the method of embodiment 29. 32. A method of treating a subject with a cell therapy, comprising administering to a subject in need thereof differentiated cells produced by the method of any one of embodiments 1 to 27, the differentiated cell population of embodiment 28, a pharmaceutical composition produced by the method of embodiment 29, or the pharmaceutical composition of embodiment 30 or embodiment 31.33. A method of producing an expanded pluripotent stem cell (PSC) population, comprising culturing a starting PSC under expansion conditions in a two-dimensional vessel or three-dimensional bioreactor in the presence of one or more WNT inhibitors, thereby producing an expanded PSC population. 34. A method of producing an expanded pluripotent stem cell (PSC) population, comprising culturing a starting PSC under expansion conditions in a two-dimensional vessel or three-dimensional bioreactor in a medium comprising (i) chroman1, emricasan, polyamines, and trans-ISRIB (CEPT) and / or (ii) FGF2; and, optionally, one or more WNT inhibitors, thereby producing an expanded PSC population. 35. A method of improving the yield, replating efficiency, differentiability, and / or genomic stability of an expanded pluripotent stem cell (PSC) population, comprising culturing a starting PSC under expansion conditions in a two-dimensional vessel or three-dimensional bioreactor in a medium comprising (i) chroman1, emricasan, polyamines, and trans-ISRIB (CEPT), (ii) FGF2, (iii) one or more WNT inhibitors, or (iv) any combination of (i)-(iii), thereby producing an expanded PSC population having an improved yield, replating efficiency, differentiability, and / or genomic stability as compared to a corresponding culture lacking (i), (ii), (iii), or (iv). 36. The method of embodiment 35, wherein the method is a method of improving the yield of an expanded PSC population. 37. The method of embodiment 35 or embodiment 36, wherein the method is a method of improving the replating efficiency of an expanded PSC population. 38. The method of any one of embodiments 35 to 37, wherein the method is a method of improving the differentiability of an expanded PSC population. 39. The method of any one of embodiments 35 to 37, wherein the method is a method of improving the genomic stability of an expanded PSC population. 40. The method of any one of embodiments 33 to 40, wherein culturing a starting PSC under expansion conditions comprises culturing the starting PSC in a two-dimensional vessel.41. The method of any one of embodiments 33 to 40, wherein culturing a starting PSC under expansion conditions comprises culturing the starting PSC in a three-dimensional bioreactor. 42. The method of any one of embodiments 33 to 41, wherein culturing the starting PSC under expansion conditions comprises culturing the PSC in a medium supplemented with or more WNT inhibitors. 43. The method of any one of embodiments 33 to 41, wherein culturing the starting PSC under expansion conditions comprises culturing the PSC in a medium not supplemented with or more WNT inhibitors. 44. The method of any one of embodiments 33 to 43, wherein culturing the starting PSC under expansion conditions comprises culturing the PSC in a medium comprising less than 25 nM of a protein kinase Cβ (PKCβ) inhibitor. 45. The method of any one of embodiments 33 to 44, wherein culturing the starting PSC under expansion conditions comprises culturing the PSC in a medium that does not include a PKCβ inhibitor. 46. The method of any one of embodiments 33 to 45, wherein culturing the starting PSC under expansion conditions comprises culturing the PSC in a medium comprising less than 1 μM Ly333531. 47. The method of any one of embodiments 33 to 46, wherein culturing the starting PSC under expansion conditions comprises culturing the PSC in a medium comprising chroman1, emricasan, polyamines, and trans-ISRIB (CEPT). 48. The method of any one of embodiments 33 to 47, wherein culturing the starting PSC under expansion conditions comprises culturing the PSC in a medium comprising FGF2 (e.g., stabilized FGF2), TGF-β1, insulin, human serum albumin, a buffer, LiCl, L-ascorbic acid, or a combination thereof, e.g., FGF2 (e.g., stabilized FGF2), TGF-β1, insulin, human serum albumin, a buffer, LiCl, and L-ascorbic acid.49. The method of any one of embodiments 33 to 48, wherein culturing the starting PSC under expansion conditions comprises culturing the PSC in a medium comprising one or more agents that promote PSC division, e.g., FGF2 and / or LIF. 50. The method of any one of embodiments 33 to 49, which further comprises preparing the starting PSC. 51. The method of embodiment 50, wherein the starting PSC is prepared from a cryopreserved PSC. 52. The method of embodiment 51, wherein the cryopreserved PSC is a PSC cryopreserved in single cell form. 53. The method of embodiment 51, wherein the cryopreserved PSC is a PSC cryopreserved in cell aggregates. 54. The method of any one of embodiments 51 to 53, wherein preparing the starting PSC comprises reactivating the cryopreserved PSC. 55. The method of embodiment 54, wherein reactivating the cryopreserved PSC comprises thawing the PSC. 56. The method of embodiment 55, wherein reactivating the cryopreserved PSC further comprises washing the PSC. 57. The method of embodiment 55 or embodiment 56, wherein reactivating the cryopreserved PSC further comprises pre-culturing the PSC. 58. The method of embodiment 57, wherein pre-culturing the PSC comprises two- dimensional culturing of the PSC under conditions to restart cellular metabolism. 59. The method of embodiment 57 or embodiment 58, wherein pre-culturing the PSC comprises two-dimensional culture of the PSC under conditions to maintain the PSC in culture and / or to increase PSC number.60. The method of any one of embodiments 33 to 59, wherein the expansion conditions comprise culturing the starting PSC in suspension. 61. The method of any one of embodiments 33 to 60, wherein the one or more WNT inhibitors comprise or consist of XAV939, DKK1 (Dickkopf protein 1), IWR1, C59, IWR-1, IWP-2, IWP-4, or any combination of two or more of the foregoing. 62. The method of any one of embodiments 33 to 61, wherein the one or more WNT inhibitors are used at a concentration sufficient to reduce SP5 expression to become detectable by quantitative PCR at a cycle threshold (Ct) value that is at least 1, at least 2, at least 3, at least 4 or at least 5 above the Ct value of a corresponding PSC culture lacking a WNT inhibitor, e.g., as measured using ThermoFisher Assay ID Hs01370227_mH according to the manufacturer’s instructions. 63. The method of any one of embodiments 33 to 62, wherein the one or more WNT inhibitors are used at a concentration sufficient to reduce SP5 expression by at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 50-fold, at least 100-fold, at least 500-fold, or at least 1000-fold as compared to a culture lacking the WNT inhibitor. 64. The method of any one of embodiments 33 to 62, wherein the one or more WNT inhibitors are used at a concentration sufficient to reduce SP5 expression by at least 20%, by at least 30%, by at least 40%, by at least 50%, by at least 100%, by at least 500%, or by at least 1,000% a corresponding PSC culture lacking a WNT inhibitor. 65. The method of any one of embodiments 33 to 64, wherein the one or more WNT inhibitors are used at a concentration of at least 1 µM, at least 2 µM, at least 3 µM, or at least 5 µM. 66. The method of any one of embodiments 33 to 65, wherein the one or more WNT inhibitors are used at a concentration of up to 10 µM, up to 15 µM, or up to 20 µM. 67. The method of any one of embodiments 33 to 66, wherein the two-dimensional vessel or three-dimensional bioreactor is supplemented with one or more WNT inhibitors during the culture, e.g., daily or with every media change.68. The method of any one of embodiments 33 to 67, wherein the two-dimensional vessel or three-dimensional bioreactor is continually perfused with fresh culture medium. 69. The method of any one of embodiments 33 to 68, wherein the culturing comprises no more than 2 passages, no more than 3 passages, no more than 4 passages, no more than 5 passages, no more than 6 passages, no more than 7 passages, no more than 8 passages, no more than 9 passages, no more than 10 passages, no more than 11 passages, no more than 12 passages, no more than 20 passages, no more than 30 passages, or no more than 40 passages. 70. The method of any one of embodiments 33 to 69, wherein the culturing comprises 2- 4 passages, 2-10 passages, 5-10 passages, 10-20 passages, 15-25 passages, 20-30 passages, 25-35 passages, or 30-40 passages. 71. The method of any one of embodiments 33 to 70, wherein the PSC is an induced pluripotent stem cell (iPSC) or embryonic stem cell (ESC). 72. The method of any one of embodiments 33 to 71, wherein the PSC is a human PSC. 73. The method of any one of embodiments 33 to 72, which further comprises cryopreserving cells of the expanded PSC population. 74. The method of embodiment 73, wherein cells of the expanded PSC population are cryopreserved as single cells. 75. The method of embodiment 73, wherein cells of the expanded PSC population are cryopreserved as cell aggregates. 76. The method of any one of embodiments 73 to 75, which further comprises reactivating the cells of the expanded PSC population. 77. The method of embodiment 76, wherein reactivating the cells of the expanded PSC population is according to the method of any one of embodiments 55 to 59.78. The method of any one of embodiments 33 to 77, which further comprises culturing cells from the expanded PSC population under differentiation conditions, thereby producing a population of differentiated cells. 79. The method of embodiment 78, wherein the differentiation conditions comprising culturing cells from the expanded PSC population in the presence of a WNT inhibitor, e.g., IWP-2. 80. The method of embodiment 78 or embodiment 79, wherein differentiation conditions result into differentiation into ectodermal lineage cells. 81. The method of embodiment 80, wherein the ectodermal lineage cells comprise or consist of: (a) human nervous system cells, optionally selected from dopaminergic neurons, microglial cells, oligodendrocytes, astrocytes, cortical neurons, spinal or oculomotor neurons, enteric neurons, placode-derived cells, Schwann cells, trigeminal or sensory neurons, or progenitors or precursors of any one of the aforementioned cells; or (b) human ocular system cells, optionally selected from retinal pigment epithelial cells, photoreceptor cone cells, photoreceptor rod cells, bipolar cells, ganglion cells, or progenitors or precursors of any one of the aforementioned cells. 82. The method of embodiment 80, wherein the population of differentiated cells comprises dopaminergic neurons. 83. The method of any one of embodiments 80 to 82, wherein the differentiation conditions comprise culturing PSCs in the presence of at least two sMAD inhibitors, optionally wherein the at least two sMAD inhibitors comprise Noggin and SB431542. 84. An expanded PSC population or differentiated cell population produced by the method of any one of embodiments 33 to 83.85. A composition comprising PSC aggregates and a medium comprising (i) chroman1, emricasan, polyamines, and trans-ISRIB (CEPT), (ii) FGF2, (iii) one or more WNT inhibitors, or (iv) any combination of (i)-(iii). 86. The composition of embodiment 85, wherein the medium comprises CEPT. 87. The composition of embodiment 85 or embodiment 86, wherein the medium comprises FGF2 and, optionally TGF-β1, insulin, human serum albumin, a buffer, LiCl, L- ascorbic acid, or a combination thereof. 88. The composition of any one of embodiments 85 to 87, which comprises one or more WNT inhibitors, optionally wherein the one or more WNT inhibitors comprise or consist of XAV939, DKK1 (Dickkopf protein 1), IWR1, C59, IWR-1, IWP-2, IWP-4, or any combination of two or more of the foregoing. 89. The composition of any one of embodiments 85 to 88, which comprises the PSC aggregates and medium in a two-dimensional vessel. 90. The composition of any one of embodiments 85 to 88, which comprises the PSC aggregates and medium in a three-dimensional bioreactor. 91. The composition of any one of embodiments 85 to 90, wherein the medium is supplemented with one or more WNT inhibitors. 92. The composition of any one of embodiments 85 to 90, wherein the medium is not supplemented with one or more WNT inhibitors. 93. A kit comprising a PSC and (i) chroman1, emricasan, polyamines, and trans-ISRIB (CEPT), (ii) FGF2, (iii) one or more WNT inhibitors, or (iv) any combination of (i)-(iii). 94. The kit of embodiment 93, further comprising a medium. 95. A kit comprising a PSC and a medium comprising (i) chroman1, emricasan, polyamines, and trans-ISRIB (CEPT), (ii) FGF2, (iii) one or more WNT inhibitors, or (iv) any combination of (i)-(iii).96. The kit of any one of embodiments 93 to 95, further comprising a two-dimensional vessel. 97. The kit of any one of embodiments 93 to 95, further comprising a three-dimensional bioreactor. 98. The method of any one of embodiments 33 to 83, which further comprises formulating cells from the expanded PSC population or population of differentiated cells with a pharmaceutically acceptable excipient, thereby producing a pharmaceutical composition comprising PSCs or differentiated cells and the pharmaceutically acceptable excipient. 99. A pharmaceutical composition comprising expanded PSCs or differentiated cells produced by the method of any one of embodiments 33 to 83, and a pharmaceutically acceptable excipient. 100. A pharmaceutical composition produced by the method of embodiment 98. 101. A method of treating a subject with a cell therapy, comprising administering to a subject in need thereof PSCs or differentiated cells produced by the method of any one of embodiments 33 to 83, the expanded PSC or differentiated cell population of claim 84, a pharmaceutical composition produced by the method of embodiment 85, or the pharmaceutical composition of embodiment 99 or embodiment 100. 8. EXAMPLES 8.1. Materials and Methods 8.1.1. 2D Culturing Protocol 8.1.1.1. Media and Reagent Preparation
[0127] Media was prepared by thawing E8 supplement overnight at 4°C and adding the full volume of the supplement to either cold or warmed base media. During thaw, passage, and harvest days (Days 0, 4, 8, 12), 10 mM ROCK inhibitor Y-27632 or CEPT (Fujifilm) was added to the complete media at a 1:1000 dilution to the appropriate volume of media.8.1.1.2. Vessel Coating
[0128] Vessels were coated with 10 µg / mL (10ul / cm2) of LMN521 in PBS + / + and placed on a level surface overnight at 4°C. The coating solution was removed from the vessel immediately prior to seeding. 8.1.1.3. Vial Thawing and T-Flask Seeding
[0129] Vials were thawed in a water bath, diluted and resuspended in complete E8 Media. Cells were counted using an NC-200™ cell counter and seeded at specific seeding densities. 8.1.1.4. Vessel Feed and Observation
[0130] Vessel media was exchanged daily. Cell confluency was assessed daily, and cells on vessels were passaged on days 4 (D4) and 8 (D8). Bottles of E8 complete media were used to feed the cells on T175 vessels and CF4 cell factories or Ambr® 250 cell factories. 8.1.1.5. First Passage and Seeding
[0131] After four days of growth, the cells on vessels were clump-passaged into Cell Factories. T-flasks were first rinsed with PBS - / -, followed by addition of warmed 0.5 mM EDTA in PBS - / -. T-flasks were incubated for approximately 5-15 minutes until 50-75% of cells have detached. After approximately 10 minutes in the incubator at 37°C, the T-flasks were checked for detachment every 2 minutes. The cell suspension was then gently removed from the flask and collected in one appropriately sized container per vessel for both the cell suspension and the wash. The T-flasks were washed with E8 + 10 µM Y-27632 which was then transferred to the container containing the EDTA cell suspension to dilute. The cell suspensions were then centrifuged at 200g for 5 minutes. Supernatant was aspirated, the cell pellets were resuspended in CTS E8 + 10 µM Y-27632, pooled and counted using an NC200™ cell counter. The viable cell density was calculated and used to seed cell factories at a specific density with 600 mL of warmed E8 + 10 µM Y-27632. The CF4 cell factories were incubated at 37°C and 5% CO2 with full humidity. 8.1.1.6. Second Passage and Seeding
[0132] After four days of growth, the process in Section 8.1.1.5 was repeated with the use of Accutase at 37°C for 30 minutes, without a wash step prior to Accutase addition. Cells were resuspended in media (Stemscale, mTeSR+, or E8) with 10 µM Y-27632 or CEPT. Inconditions where XAV939 (Tocris) was tested, XAV939 was added to the media for the full length of the expansion in bioreactors. 8.1.2. 3D Culturing with Bioreactors
[0133] Bioreactors were seeded at full volume and cells incubated for four days using the parameters listed below in Table E1 for each Bioreactor platform. Table E1 Bioreactor DASbox 0.3c Ambr® 250 1C
[0134] Cells were collected from bioreactors and centrifuged for 5 min at 300g. Pellets were resuspended in half volume Accutase and placed on rollers at 37°C for 30 minutes. Accutase was then quenched with media, cells were centrifuged again and resuspended in media for cell counts. Finally, cells were resuspended in FreSR-S cryopreservant at up to 30M cells / mL typically in 1mL or 4mL cryovials. A Controlled Rate Freezer was used to freeze cells in cryoprotectant. 8.1.4. Lineage Screening
[0135] Cells were plated in 12-well plates at 4k cells / cm2in an ectoderm differentiation media supplemented with 100 µg / ml Noggin and 10.8mM SB431542. Media was replaced daily. At each of the time points at 48, 72 and 96 hours after seeding, a well of cells was harvested with a 30-minute Accutase incubation. Cells were then fixed and once the final sample was collected on D5, the fixed samples were stained for OCT4 and PAX6 and assessed by flow cytometry.8.2. Example 1: Generation of 3D EPI Cells in 0.3c Scale Bioreactors and Initial Assessments 8.2.1. Methods 8.2.1.1. PSC Expansion Protocol using 0.3 Scale Bioreactors
[0136] To generate 3D expanded PSC cells, starting PSCs were prepared. A PSC population was plated on Day 0 in Stemscale media with L-glutamine and rock inhibitor medium and placed in an incubator set to 37° C and 5% CO2. Media was replaced daily with Stemscale media with L-Glutamine. At Day 4, cells were dissociated using standard methods utilizing EDTA, resuspended in medium, and replated. Media was replaced daily with Stemscale media with L-Glutamine. At Day 8, cells were dissociated using standard methods utilizing Accutase resuspended in medium, thereby preparing the starting PSCs for 3D culture.
[0137] The starting PSCs were seeded into 0.3c (250 ml) bioreactors (Eppendorf).
[0138] The general steps of this protocol are illustrated in FIG.1.
[0139] Starting PSCs were also cultured under 2D conditions to obtain a 2D expanded control PSC population.2D-expansion control PSCs were placed in an incubator set to 37° C and 5% CO2,and media was replaced daily with fresh Stemscale media with L-Glutamine. 8.2.1.2. Evaluation of 3D Expanded PSCs
[0140] The re-plate confluency and fold expansion of 2D and 3D expanded PSCs were assessed. Flow cytometry was used to determine the percentage of 3D expanded PSCs cells that are positive for pluripotency markers NANOG, OCT4, SOX2, SSEA4, and TRA160. Changes in gene expression in 3D expanded PSCs relative to 2D expanded PSCs were assessed with qPCR. 8.2.2. Results
[0141] The pluripotency markers evaluated in this assessment were expressed by nearly 100% of 3D expanded PSCs generated using the protocol described in Section 8.2.1.1 (FIG. 2A). The replating confluency percentages of 3D expanded PSCs were within the bounds of those obtained with 2D expanded controls (FIG.2B). These results suggested that 3D expanded cells maintained their pluripotency and had similar replating characteristics as the 2D expanded controls. However, fold expansion values obtained with 3D expanded PSCswere approximately half of those obtained with 2D expanded PSC controls (FIG.2C). Furthermore, qPCR assessments revealed that the expression of certain genes in 3D expanded PSCs differed from 2D expanded cells (FIG.2D). Among these genes, the expression of SP5 differed the most (FIG.2D, black arrow), which was nearly 5 cycles higher than the controls. Given that SP5, a downstream target of the Wnt pathway, can negatively affect cell differentiation of iPSCs, these results suggested that further optimization of 3D expanded PSCs was needed in order to generate cells that can be used for cell differentiation. 8.3. Example 2: Effect of XAV939 Treatment on 3D PSC Expansion 8.3.1. Methods
[0142] XAV939 is a WNT pathway inhibitor which degrades β-catenin. To determine whether 3D expansion of PSCs in the presence of XAV939 would result in the reduction of the differences in 3D expanded PSCs relative to 2D expanded controls, PSCs were seeded onto small scale 6-well plates with agitation and incubated with in the presence or absence of XAV939 for up to 4 days. The expression of SP5 at the end of the culture was assessed with qPCR using a SP5 TaqMan assay (ThermoFisher Assay ID. Hs01370227_mH) following the manufacturer’s protocol. The qPCR cycle conditions are listed in Table E2 below. Table E2. qPCR Conditions °8.3.2. Results
[0143] PSCs expanded in 3D in the presence of 10 µM XAV939 started to show a sizable difference in SP5 expression at 48 hours relative to untreated cells (FIG.3A). This difference was maintained throughout the assessment period. PSCs expanded in 3D in the presence of 5 µM XAV939 also showed a difference in SP5 expression compared to cells cultured in the absence of XAV939, but the difference was smaller. PSCs expanded in 2D in the presence of either 5 µM XAV939 or 10 µM XAV939 treatments differed from theuntreated cells (FIG.3B). All XAV939 concentrations (2.5 µM, 5 µM, and 10 µM XAV939) resulted in robust reduction of SP5 expression in 2D-expanded PSCs after 4 days in 3D culture relative to untreated control cells (FIG.3C). These assessments of the 2D- and 3D- expanded PSCs in 3D culture plates in the presence of XAV939 suggested that the expression of SP5 can be prevented if it is not yet expressed by the cells. However, the expression of SP5 is more difficult to control in PSCs that express SP5. Therefore, the presence of XAV939 from the beginning of 3D expansion is desirable to achieve the maximal reduction of SP5 expression. 8.4. Example 3: Generation of 3D Expanded PSCs in 1c Scale Bioreactors 8.4.1. Methods 8.4.1.1. 3D EPI Protocol using 1c Scale Bioreactors
[0144] The generation of 3D expanded PSCs at a larger scale was evaluated.
[0145] Starting PSCs were prepared by plating PSCs on Day 0 in Stemscale media with L- Glutamine. The plated PSCs were placed in an incubator set to 37°C and 5% CO2. At Day 4, cells were dissociated using standard methods utilizing EDTA, resuspended in medium, and replated. At Day 8, cells were dissociated using standard methods utilizing Accutase and resuspended in medium, thereby producing the starting PSCs for 3D expansion.
[0146] The starting PSCs were seeded into 1c (1 liter) bioreactors (Eppendorf). Cells in 1c bioreactors were continuously perfused with alternating tangential flow (ATF) perfusion to facilitate media exchange and generate smaller aggregates. At Day 12, cells were harvested for assessments. Control 2D expanded PSCs were generated as described in Section 8.2.1.1. 8.4.1.2. Evaluation of 3D EPI Cells
[0147] The replate confluency was assessed with Incucyte™ Live Cell Imaging System using a nuclear dye. A combination of fluorescent and phase images provide cell counts and percent confluency. Fold expansion of 2D expanded PSCs and 3D expanded PSCs were assessed using cell counts at the time of harvest as compared to the starting cell count used to seed the bioreactors. Flow cytometry was used to determine the percentage of 3D expanded PSCs that are positive for pluripotency markers NANOG, OCT4, SOX2, SSEA4, and TRA160. Changes in gene expression in 3D expanded PSCs relative to 2D expanded PSCs were assessed with qPCR.8.4.2. Results
[0148] Relative to 3D expanded PSCs generated in 0.3c bioreactors (3D-0.3c expanded cells), 3D expanded PSCs generated in 1c bioreactors (3D-1c expanded cells) had smaller aggregates (FIGS.4A and 4B). The pluripotency markers evaluated in this assessment were expressed by nearly 100% of 3D-1c expanded PSCs (FIG.5A). The replating confluency percentages of 3D-1c expanded PSCs were within the bounds of those obtained with 2D expanded PSC controls (FIG.5B). Again, these results suggested that 3D-1c expanded PSCs maintained their pluripotency and had similar replating characteristics as the 2D expanded PSC controls. This time, however, fold expansion values obtained with 3D-1c expanded PSCs were more similar to those obtained with 2D expanded PSC controls (FIG. 5C) than was the case with 3D-0.3c expanded PSCs (FIG.2C). Moreover, 3D-1c expanded PSCs culturing in the presence of 2.5 µM XAV939 resulted in reduction of the gene expression differences between 3D-1c expanded PSCs and 2D expanded PSC control relative to the gene expression differences between 3D-0.3c expanded PSCs and 2D expanded PSC controls (See FIGS.5D and 2D). Finally, qPCR results revealed that 3D-1c expanded PSCs cultured in the presence of XAV939 has similar SP5 expression to that in 2D expanded PSC controls (FIG.5E). Although XAV939 treatment of 3D-0.3c expanded PSCs also reduced the expression of SP5, this reduction was not as robust as the reduction observed in the 3D-1c expanded PSCs. 8.5. Example 4: Differentiation of 3D Expanded PSCs into Dopaminergic Neurons 8.5.1. Methods 8.5.1.1.1. Differentiation Protocol
[0149] To evaluate whether 3D expansion of PSCs in the presence of XAV939 would enable differentiation into specialized cells successfully, 3D-0.3 expanded PSCs that had been expanded in the presence or absence of XAV939 were differentiated into dopaminergic (DA) neurons. 8.5.1.2. Evaluation of DA Neurons
[0150] Flow cytometry was used on Day 16 to determine the percentage of differentiated cells that are positive for on-target markers FoxA2 and Otx2 and off-target markers Pax6 and Crabp1. qPCR was used to assess changes in gene expression in DA neurons differentiated from 3D-0.3c expanded PSCs that had been expanded in the presence orabsence of XAV939, relative to gene expression in DA neurons differentiated from 2D expanded PSCs.
[0151] To determine whether differentiated cells displayed functional characteristics of DA neurons, correlated neural activity of differentiated DA cells was assessed with Incucyte® Neuroburst Orange, using the manufacturer’s protocol. Additionally, dopamine release was assessed. 8.5.2. Results
[0152] Percentage of DA neurons differentiated from 3D-0.3 expanded PSCs that had been expanded in the absence of a WNT inhibitor (“3D--0.3 expanded PSCs”) was lower than the percentage of DA neurons differentiated from 2D expanded PSC controls. Percentage of DA neurons differentiated from 3D expanded PSCs that had been expanded in the presence of XAV939 (“3D+-0.3 expanded PSCs”) and DA neurons differentiated from 3D-1c expanded PSCs that had been expanded in the absence of a WNT inhibitor (“3D--1c expanded PSCs”) were similar to those differentiated from 2D expanded PSCs (FIG.6A).
[0153] DA neurons differentiated from 3D+-0.3c expanded PSCs were associated with a reduction of the gene expression differences between DA neurons differentiated from 3D-- 0.3c expanded PSCs and those differentiated from 2D expanded PSC controls (FIG.6B).
[0154] Assessments of neuronal functionality revealed that correlated neural activities of DA neurons differentiated from 3D+-0.3c expanded PSCs were similar to those of DA neurons differentiated from 2D expanded PSC controls (FIG.6C), both of which showed a comparable sigmoidal increase in correlated activity over time. However, DA neurons differentiated from 3D-0.3 c expanded PSCs that had been expanded in the absence of XAV939 displayed no correlated neural activity for the duration of the assessments (FIG. 6C). Similarly, levels of dopamine release from DA neurons differentiated from 3D-0.3c expanded PSCs that had been expanded in the presence of XAV939 were similar to those released from DA neurons differentiated from 2D expanded PSCs (FIG.6D). Although, dopamine release increased over time for DA neurons differentiated from 3D-0.3c expanded PSCs expanded in the absence of XAV939, the amount of dopamine was about half of the amount released from counterpart PSCs that had been expanded in the presence of XAV939. Taken together, these results suggest that cells differentiated from PSCs expanded in 3D in the presence of 2.5 µM XAV939 (3D+expanded PSCs), but not cellsdifferentiated from PSCs expanded in 3D in the absence of a WNT inhibitor (3D- expanded PSCs), functionally resemble those derived from 2D expanded PSC controls.
[0155] Next, DA neurons differentiated from 3D expanded PSCs were assessed with flow cytometry for on-target and off-target markers. This time, DA neurons were 3D differentiated from 3D--1c expanded PSCs, from 3D+-1c expanded PSCs that had been expanded in the presence of 2.5 µM XAV939, from 3D+-1c expanded PSCs (“3D+-1c expanded PSCs”) that had been expanded in the absence of XAV939 but differentiated in the presence of 1µM IWP-2 (“3D--1c PSCs +IWP2”), and from 2D expanded control PSCs. The percent positive DA neurons differentiated from 3D+-1c expanded PSCs resembled those differentiation from 2D expanded control PSCs for on-target and off-target markers (FIG.7). In contrast, only 60% to 70% of cells differentiated from 3D--1c expanded PSCs and 3D--1c expanded PSCs that were differentiated in the presence of IPW2 were positive for the on-target marker FoxA2 and only 10% to 20 % of DA neurons differentiated from 3D--1c expanded PSCs that were differentiated in the presence of IPW2 were positive for the on-target marker Otx2 (FIG.7). 8.6. Example 5: Effect of XAV939 Treatment on 3D PSC Expansion 8.6.1. Methods
[0156] In Example 2, the effect of XAV939 on the expression of SP5 was assessed. To further determine the effects of XAV939 on 3D expanded PSCs, PSCs 3D expanded in 0.3c or 1c bioreactors were incubated in the presence or absence of 2.5μM XAV939 for up to 4 days as described in Section 8.3.1.
[0157] The replate confluency was assessed with Incucyte™ Live Cell Imaging System using a nuclear dye. A combination of fluorescent and phase images provide cell counts and percent confluency. Fold expansion of 3D expanded PSCs were assessed using cell counts at the time of harvest as compared to the starting cell count used to seed the bioreactors. Flow cytometry was used to determine the percentage of 3D expanded PSCs that are positive for pluripotency markers NANOG, OCT4, SOX2, SSEA3, SSEA4, and TRA160. Changes in SP5 gene expression were assessed with qPCR. 8.6.2. Results
[0158] Relative to control 3D expanded PSCs, 3D-0.3c and 3D-1c expanded PSCs treated with XAV939 (“XAV”) had lower SP5 expression (FIGS.8A and 8B). All five of thepluripotency markers evaluated in this assessment were expressed by nearly 100% of 3D- 0.3c expanded PSCs treated with XAV939 (FIG.8C). The replating confluency percentages of 3D expanded PSCs were not affected by XAV939 (FIG.8D). However, cell density was reduced by XAV939 at harvest (FIG.8E). These results suggest that XAV939 was able to reduce the increases in SP5 expression without impacting pluripotency or confluency, confirming the findings of Example 2, but cell yield was impacted by XAV939 treatment. 8.7. Example 6: Comparison of 3D-1c and 3D-0.3c Expanded PSC Aggregates 8.7.1. Methods
[0159] 3D expanded PSCs in 1c (large scale) bioreactors and 3D expanded PSCs in 0.3c (small scale) scale bioreactors were produced as described in Sections 8.4.1.1 and 8.2.1.1. The resulting 3D-1c and 3D-0.3c PSCs were compared in terms of aggregate size and expression of pluripotency markers OCT4, SSEA4, and TRA160. 8.7.2. Results
[0160] The diameters of aggregates were comparable at the initial phase of 3D culturing on Day 9 (D9) for both 3D-1c and 3D-0.3c PSC cultures (FIG.9A). However, aggregate diameters increased in size in 3D-0.3c PSC cultures by Day 12 (D12) but remained relatively small in 3D-1c PSC cultures (FIG.9B). These results supported the observations described in Example 3 (see FIGS.4A and 4B). The expression of pluripotency markers was also comparable between the PSCs in large scale and small scale bioreactors (FIG.9C). 8.8. Example 7: Further Characterization of DA Neurons Differentiated from 3D-1c Expanded PSCs 8.8.1. Methods
[0161] In Example 4, differentiation of 3D expanded PSCs into DA neurons was evaluated. This time, DA neurons differentiated from 3D-1c expanded PSCs that had been expanded in the presence of XAV939 and differentiated in the absence or presence of 1µM IWP-2 were further assessed with flow cytometry for on-target (FoxA and Otx2) and off-target (Pax6) markers on Day 9. Additionally, dopamine release was assessed between Days 14 and 30. 8.8.2. Results
[0162] The presence of IWP-2 increased the percentage of cells positive for Otx2 (FIG. 10A). In terms of dopamine release, the presence of IWP-2 was associated with a relativelysmall increase, which was still lower than the dopamine release from cells differentiated from 2D expanded PSCs and positive controls (FIG.10B). 8.9. Example 8: Effect of Media Supplements on BCOR SNP Abundance in PSCs Expanded with 3D Cell Culture Protocol 8.9.1. Methods
[0163] Genetic mutations accumulating in PSC cultures can affect differentiation. For instance, single nucleotide polymorphisms (SNPs) of BCL6 corepressor (BCOR) gene impair differentiation of PSCs and have been observed in 2D cultures (Rouhani et al., 2022, Nat. Genet.54:1406-1416). The percent fractional abundance of a SNP of BCOR (572 G>A, herein referred to as BCOR SNP1) was assessed in small scale perfused 3D expanded cultures in Ambr® 250 bioreactors, in the presence of ROCK inhibitor Y-27632 (added at seeding), Y-27632 (added at seeding) and a nonionic surfactant (Pluronic; present throughout the culturing), or a commercially available cell culture supplement cocktail of Chroman 1, Emricasan, polyamines, and Trans-ISRIB (CEPT cocktail; added at seeding). 8.9.2. Results
[0164] The median percentage of BCOR SNP1 fractional abundance was higher in 3D expanded PSCs relative to 2D expanded PSCs (FIG.11A). The presence of Y-27632 (“Y”) resulted in an increase in BCOR SNP1 fractional abundance relative to 2D expanded PSCs, and further adjustments, such as coadministration of Y-27632 with Pluronic or passaging of PSCs using EDTA instead of Accutase, did not reduce this increase in BCOR SNP1 fractional abundance (FIG.11B). In contrast, the addition of CEPT cocktail was associated with a BCOR SNP1 fractional abundance in 3D expanded PSCs that is similar to the BCOR SNP1 fractional abundance in 2D expanded PSCs (FIG.11B). Further, CEPT cocktail also had a higher harvest yield than PSCs in Y-treatment conditions (FIG.11C). These results suggest that addition of CEPT cocktail can benefit the 3D expanded PSC cultures. 8.10. Example 9: Effect of Culture Medium on Health of PSCs Expanded with 3D Cell Culture Protocol 8.10.1. Methods
[0165] All assessments in previous Examples have been performed using Stemscale (SS) medium. In this Example, the effect of using another cell culture medium, mTeSR Plus™ was assessed, which contains heat-stabilized FGF2 and has enhanced buffering to reducemedium pH acidification. Percent confluency and LDH / lactate balance as a measure of PSC health was assessed in small scale 3D expanded cultures in Ambr® 250 bioreactors, in SS or mTeSR Plus™ media in the presence of ROCK inhibitor Y-27632 (added at seeding) or CEPT cocktail (added at seeding). 8.10.2. Results
[0166] Combination of mTeSR Plus™ and CEPT cocktail performed overall better than the other combinations as it was associated with high harvest yield (FIG.12A), lowest levels of LDH (FIG.12B), and highest levels of lactate (FIG.12C). These results suggest that the combination of mTeSR Plus™ and CEPT cocktail can help improve the health markers of 3D expanded PSC cultures. 8.11. Example 10: Effect of CEPT and mTeSR Plus in Perfused 3D PSC Cultures 8.11.1. Methods
[0167] Additional assessments were performed to determine whether the 3D expanded cell culturing protocol utilizing the combination of mTeSR Plus™ and CEPT cocktail is applicable to both small and large scale bioreactors. In this set of assessments, Ambr®250 perfused platforms were used for small scale 3D expanded cultures and Eppendorf BioBLU® perfused 1c platforms were used for large scale 3D expanded cultures. 8.11.2. Results
[0168] The combination of mTeSR Plus™ medium and CEPT cocktail was associated with 3D expanded PSCs with lower BCOR SNP1 fractional abundance than with SS medium combined with Y-27632 (FIG.13A) and less SP5 expression than SS medium combined with CEPT cocktail (FIG.13B) in small scale assessments. The combination of mTeSR Plus™ medium and CEPT cocktail was also associated with better yield than with SS medium combined with Y-27632 (FIG.13C), while also maintaining pluripotency of PSCs (FIG.13D) and high replate efficiency (FIG.13E). Similar results were observed when the assessments were performed with the large scale platform: the combination of mTeSR Plus™ medium and CEPT cocktail was associated with 3D expanded PSCs with lower BCOR SNP1 fractional abundance FIG.14A), better yield (FIG.14C), maintained pluripotency (FIG.14D), and high replate efficiency (FIG.14E) relative to SS medium combined with Y.
[0169] The presence of chromosomal abnormalities, such as trisomy 20q, can transform iPSCs by providing a more proliferative (e.g., cancerous) phenotype and mitigates the ability of these cells to differentiate. The combination of mTeSR Plus™ medium and CEPT cocktail neither in large nor in small scale platforms was associated with iso 20q copy number variants (CNV) (FIG.14B). 8.12. Example 11: Ectoderm Lineage Assessments of 3D PSC Cultures 8.12.1. Methods
[0170] Preliminary assessments showed that 2D expanded PSCs that successfully differentiate into DA neurons rapidly upregulate PAX6 and downregulate OCT4.3D PSCs can differ in the way they express these genes. In this Example, 3D expanded PSCs in Stemscale (SS) media (ThermoFisher Cat. No. A4965001) were cultured for four days in a simple ectoderm differentiation media of complete Neurobasal with Noggin and SB and expression of OCT4 and PAX6 was assessed by flow cytometry in mTeSR Plus™ media supplemented with CEPT as well as in 3D expanded PSCs in SS media. 8.12.2. Results
[0171] Expression pattern of OCT4 and PAX6 in 3D expanded PSCs in SS media supplemented with Y-27632 differed from the expression of these genes in 2D controls, regardless of culture scale or presence of XAV939 (FIGS.15A and 15B). However, expression pattern of these genes was more similar between 3D expanded PSCs cultured in mTeSR Plus™ medium supplemented with CEPT (FIGS.15C and 15D). These results provide further support for the benefits of utilizing mTeSR Plus™ medium supplemented with CEPT. 8.13. Example 12: Differentiation of 3D Expanded PSCs into Dopaminergic Neurons 8.13.1. Methods
[0172] To evaluate whether 3D expansion of PSCs cultured in mTeSR Plus™ medium supplemented with CEPT would successfully differentiate into specialized cells, control PSCs and small scale and large scale 3D-expanded PSCs cultured in mTeSR Plus™ medium supplemented with CEPT were 2D- or 3D-differentiated into dopaminergic (DA) neurons. More specifically, 2D adherent differentiations were performed using a T75 flask, and 3D differentiations were performed using a 0.3c bioreactor.
[0173] Lactate levels were assessed daily, and total number of viable cells was determined on Day 16. Flow cytometry was used on Day 16 to determine the percentage of differentiated cells that are positive for on-target and off-target markers. qPCR was used to assess changes in gene expression. BCOR SNP1 fractional abundance was determined for each condition. To determine whether differentiated cells displayed functional characteristics of DA neurons, correlated neural activity of differentiated DA cells was assessed with Incucyte® Neuroburst Orange, using the manufacturer’s protocol. Additionally, dopamine release was assessed. 8.13.2. Results
[0174] Cells that were 2D differentiated from 3D expanded PSCs cultured in mTeSR Plus™ medium supplemented with CEPT had lactate levels comparable to those obtained with controls differentiated from 2D expanded cells and were within the historical range (FIG. 16A). Total numbers of viable cells on Day 16 were similar in all groups (FIG.16B). Percentages of 2D differentiated cells positive for off-target markers were lowest in cells differentiated from small scale and from large scale 3D expanded PSCs cultured in mTeSR Plus™ medium supplemented with CEPT (FIG.16C). In addition, cells that were 2D differentiated from the 3D expanded PSCs cultured in SS media supplemented with Y- 27632 displayed a higher number of qPCR markers outside the historical range, whereas the qPCR marker analysis results obtained with cells 2D differentiated from small scale and from large scale 3D expanded PSCs cultured in mTeSR Plus™ medium supplemented with CEPT were comparable to those obtained with cells 2D differentiated from the 2D expanded PSCs (FIG.16D). Similarly, BCOR SNP1 fractional abundance was elevated in cells differentiated from 3D expanded PSCs cultured in SS media, whereas the BCOR SNP1 levels of cells differentiated from 3D expanded PSCs cultured in mTeSR Plus™ medium supplemented with CEPT were similar to those obtained with cells differentiated from 2D expanded PSCs and were within the historical range (FIG.16E). Furthermore, assessments of neuronal functionality revealed that correlated neural activities of DA neurons differentiated from large scale 3D expanded PSCs were similar to those of DA neurons differentiated from 2D expanded PSC controls (FIG.16F). Similarly, levels of dopamine release from cells differentiated from 3D expanded PSCs resembled the dopamine release from cells differentiated into DA neurons from 2D expanded PSC controls (FIG.16G).
[0175] The assessments were repeated with 3D differentiated cells. Cells that were 3D differentiated from 3D expanded PSCs cultured in mTeSR Plus™ medium supplemented with CEPT had lactate was closer to the historical range than the lactate levels associated with cells differentiated from 3D expanded PSCs cultured in SS medium supplemented with Y-27632 (FIG.17A). Cell yield on Day 16 was comparable for cells 3D differentiated from 3D expanded PSCs cultured in mTeSR Plus™ medium supplemented with CEPT and cells differentiated from 2D expanded controls (FIG.17B). Pattern of on-target and off-target gene expression was also comparable between cells differentiated from 3D expanded PSCs cultured in mTeSR Plus™ medium supplemented with CEPT and cells differentiated from 2D controls (FIG.17C). Again as it was the case with 2D differentiated cells, cells that were 3D differentiated from the 3D expanded PSCs cultured in SS media supplemented with Y- 27632 displayed a higher number of qPCR markers outside the historical range, whereas the qPCR marker analysis results obtained with cells 3D differentiated from 3D expanded PSCs cultured in mTeSR Plus™ medium supplemented with CEPT were comparable to those obtained with controls differentiated from the 2D expanded PSCs (FIG.17D). Similarly, BCOR SNP1 fractional abundance was elevated in cells differentiated from 3D expanded PSCs cultured in SS media, whereas the BCOR SNP1 levels of cells differentiated from 3D expanded PSCs cultured in mTeSR Plus™ medium supplemented with CEPT were low (FIG.17E). Assessments of neuronal functionality revealed that correlated neural activities of and levels of dopamine release from DA neurons differentiated from large scale 3D expanded PSCs resembled those of DA neurons differentiated from 2D expanded PSC controls (FIGS.17F and 17G).
[0176] Taken together, these results provide evidence that the optimized 3D PSC cell culture protocol can be used to produce PSCs that resemble PSCs produced with 2D protocols in terms of genomic stability and differentiation success measures. 9. CITATION OF REFERENCES
[0177] All publications, patents, patent applications and other documents cited in this application are hereby incorporated by reference in their entireties for all purposes to the same extent as if each individual publication, patent, patent application or other document were individually indicated to be incorporated by reference for all purposes. In the event that there is an inconsistency between the teachings of one or more of the referencesincorporated herein and the present disclosure, the teachings of the present specification are intended.
Claims
WHAT IS CLAIMED IS:
1. A method of producing an expanded pluripotent stem cell (PSC) population, comprising culturing a starting PSC under expansion conditions in a three-dimensional bioreactor in the presence of one or more WNT inhibitors, thereby producing an expanded PSC population.
2. A method of producing an expanded pluripotent stem cell (PSC) population, comprising culturing a starting PSC under expansion conditions in a three-dimensional bioreactor in a medium comprising (i) chroman1, emricasan, polyamines, and trans-ISRIB (CEPT) and / or (ii) FGF2; and, optionally, one or more WNT inhibitors, thereby producing an expanded PSC population.
3. A method of improving the yield, replating efficiency, differentiability, and / or genomic stability of an expanded pluripotent stem cell (PSC) population, comprising culturing a starting PSC under expansion conditions in a three-dimensional bioreactor in a medium comprising (i) chroman1, emricasan, polyamines, and trans-ISRIB (CEPT), (ii) FGF2, (iii) one or more WNT inhibitors, or (iv) any combination of (i)-(iii), thereby producing an expanded PSC population having an improved yield, replating efficiency, differentiability, and / or genomic stability as compared to an expanded PSC population cultured from a starting PSC under expansion conditions in a three-dimensional bioreactor in a corresponding culture lacking (i), (ii), (iii), or (iv).
4. The method of any one of claims 1 to 3, wherein culturing the starting PSC under expansion conditions comprises culturing the PSC in a medium comprising less than 25 nM of a protein kinase Cβ (PKCβ) inhibitor.
5. The method of any one of claims 1 to 4, wherein culturing the starting PSC under expansion conditions comprises culturing the PSC in a medium that does not include a PKCβ inhibitor.
6. The method of any one of claims 1 to 5, wherein culturing the starting PSC under expansion conditions comprises culturing the PSC in a medium comprising less than 1 μM Ly333531.
7. The method of any one of claims 1 to 6, wherein culturing the starting PSC under expansion conditions comprises culturing the PSC in a medium comprising chroman1, emricasan, polyamines, and trans-ISRIB (CEPT).
8. The method of any one of claims 1 to 7, wherein culturing the starting PSC under expansion conditions comprises culturing the PSC in a medium comprising FGF2 (e.g., stabilized FGF2), TGF-β1, insulin, human serum albumin, a buffer, LiCl, L-ascorbic acid, or a combination thereof, e.g., FGF2 (e.g., stabilized FGF2), TGF-β1, insulin, human serum albumin, a buffer, LiCl, and L-ascorbic acid.
9. The method of any one of claims 1 to 8, which further comprises preparing the starting PSC.
10. The method of claim 9, wherein the starting PSC is prepared from a cryopreserved PSC.
11. The method of claim 10, wherein preparing the starting PSC comprises reactivating the cryopreserved PSC.
12. The method of claim 11, wherein the cryopreserved PSC is a PSC cryopreserved in single cell form.
13. The method of claim 11, wherein the cryopreserved PSC is a PSC cryopreserved in cell aggregates.
14. The method of any one of claims 11 to 13, wherein reactivating the cryopreserved PSC comprises thawing the PSC.
15. The method of claim 14, wherein reactivating the cryopreserved PSC further comprises washing the PSC.
16. The method of claim 14 or claim 15, wherein reactivating the cryopreserved PSC further comprises pre-culturing the PSC.
17. The method of claim 16, wherein pre-culturing the PSC comprises two-dimensional culturing of the PSC under conditions to restart cellular metabolism.
18. The method of claim 16 or claim 17, wherein pre-culturing the PSC comprises two- dimensional culture of the PSC under conditions to maintain the PSC in culture and / or to increase PSC number.
19. The method of any one of claims 1 to 18, wherein the expansion conditions comprise culturing the starting PSC in suspension.
20. The method of any one of claims 1 to 19, wherein the one or more WNT inhibitors comprise or consist of XAV939, DKK1 (Dickkopf protein 1), IWR1, C59, IWR-1, IWP-2, IWP- 4, or any combination of two or more of the foregoing.
21. The method of any one of claims 1 to 20, wherein the one or more WNT inhibitors are used at a concentration sufficient to reduce SP5 expression to become detectable by quantitative PCR at a cycle threshold (Ct) value that is at least 1, at least 2, at least 3, at least 4 or at least 5 above the Ct value of a corresponding PSC culture lacking a WNT inhibitor, e.g., as measured using ThermoFisher Assay ID Hs01370227_mH according to the manufacturer’s instructions.
22. The method of any one of claims 1 to 21, wherein the one or more WNT inhibitors are used at a concentration sufficient to reduce SP5 expression by at least 2-fold, at least 3- fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9- fold, at least 10-fold, at least 50-fold, at least 100-fold, at least 500-fold, or at least 1000-fold as compared to a culture lacking the WNT inhibitor.
23. The method of any one of claims 1 to 21, wherein the one or more WNT inhibitors are used at a concentration sufficient to reduce SP5 expression by at least 20%, by at least 30%, by at least 40%, by at least 50%, by at least 100%, by at least 500%, or by at least 1,000% a corresponding PSC culture lacking a WNT inhibitor.
24. The method of any one of claims 1 to 23, wherein the one or more WNT inhibitors are used at a concentration of at least 1 µM, at least 2 µM, at least 3 µM, or at least 5 µM.
25. The method of any one of claims 1 to 24, wherein the one or more WNT inhibitors are used at a concentration of up to 10 µM, up to 15 µM, or up to 20 µM.
26. The method of any one of claims 1 to 25, wherein the three-dimensional bioreactor is supplemented with one or more WNT inhibitors during the culture, e.g., daily or with every media change.
27. The method of any one of claims 1 to 26, wherein the three-dimensional bioreactor is continually perfused with fresh culture medium.
28. The method of any one of claims 1 to 27, wherein the PSC is an induced pluripotent stem cell (iPSC) or embryonic stem cell (ESC).
29. The method of any one of claims 1 to 28, wherein the PSC is a human PSC.
30. The method of any one of claims 1 to 29, which further comprises cryopreserving cells of the expanded PSC population.
31. The method of claim 30, wherein cells of the expanded PSC population are cryopreserved as single cells.
32. The method of claim 30, wherein cells of the expanded PSC population are cryopreserved as cell aggregates.
33. The method of any one of claims 30 to 32, which further comprises reactivating the cells of the expanded PSC population.
34. The method of claim 33, wherein reactivating the cells of the expanded PSC population is according to the method of any one of claims 14 to 18.
35. The method of any one of claims 1 to 34, which further comprises culturing cells from the expanded PSC population under differentiation conditions, thereby producing a population of differentiated cells.
36. The method of claim 35, wherein the differentiation conditions comprising culturing cells from the expanded PSC population in the presence of a WNT inhibitor, e.g., IWP-2.
37. The method of claim 35 or claim 36, wherein differentiation conditions result into differentiation into ectodermal lineage cells.
38. The method of claim 37, wherein the ectodermal lineage cells comprise or consist of: (a) human nervous system cells, optionally selected from dopaminergic neurons, microglial cells, oligodendrocytes, astrocytes, cortical neurons, spinal or oculomotor neurons, enteric neurons, placode-derived cells, Schwann cells, trigeminal or sensory neurons, or progenitors or precursors of any one of the aforementioned cells; or (b) human ocular system cells, optionally selected from retinal pigment epithelial cells, photoreceptor cone cells, photoreceptor rod cells, bipolar cells, ganglion cells, or progenitors or precursors of any one of the aforementioned cells.
39. The method of claim 37, wherein the population of differentiated cells comprises dopaminergic neurons.
40. The method of any one of claims 37 to 39, wherein the differentiation conditions comprise culturing PSCs in the presence of at least two sMAD inhibitors, optionally wherein the at least two sMAD inhibitors comprise Noggin and SB431542.
41. An expanded PSC population or differentiated cell population produced by the method of any one of claims 1 to 40.
42. The method of any one of claims 1 to 40, which further comprises formulating cells from the expanded PSC population or population of differentiated cells with a pharmaceutically acceptable excipient, thereby producing a pharmaceutical composition comprising PSCs or differentiated cells and the pharmaceutically acceptable excipient.
43. A pharmaceutical composition comprising expanded PSCs or differentiated cells produced by the method of any one of claims 1 to 40, and a pharmaceutically acceptable excipient.
44. A pharmaceutical composition produced by the method of claim 42.
45. A method of treating a subject with a cell therapy, comprising administering to a subject in need thereof PSCs or differentiated cells produced by the method of any one of claims 1 to 40, the expanded PSC or differentiated cell population of claim 41, apharmaceutical composition produced by the method of claim 42, or the pharmaceutical composition of claim 43 or claim 44.
Citation Information
Patent Citations
Method for producing dopaminergic neurons
US10017734B2
Midbrain dopamine (DA) neurons for engraftment
US10280398B2
Production method for induced pluripotent stem cells
US20250145965A1
Dopaminergic neurons differentiated from pluripotent stem cells and uses thereof
US9968637B2
Methods of neural conversion of human embryonic stem cells
WO2010096496A2