Senecavirus a (SVA) vaccine compositions and methods thereof

Abstract

The present disclosure provides immunogenic compositions and vaccines as well as associated methods for control of Senecavirus A (SVA) in pigs. Advantageously, the compositions and methods described herein can be administered using a single dose and can be delivered to pigs via different routes. The compositions and methods utilize a live attenuated vaccine strategy that provides robust efficacy and near sterilizing immunity in pigs.

Description

SENECAVIRUS A (SVA) VACCINE COMPOSITIONS AND METHODS THEREOFCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application Serial No. 63 / 664,021, filed on June 25, 2024, the entire disclosures of which is incorporated herein by reference.GOVERNMENT RIGHTS

[0002] This work was supported by USDA National Institute of Food and Agriculture (Award no. 2019-67015-29830). The government may have certain rights to this invention.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0003] The Sequence Listing associated with this application is provided in xml format in lieu of paper copy and is hereby incorporated by reference into the specification. The name of the .xml file containing the Sequence Listing is “85007- 426974 Sequence Listing”. The .xml file is 44.3 KB, was created on June 25, 2025, and is submitted electronically via Patent Center.BACKGROUND AND SUMMARY

[0004] Vesicular diseases (VD) are economically important diseases affecting livestock and are major causes of foreign animal diseases (FAD) investigations according to the USDA APHIS Veterinary Services. In the United States, the number of investigations has surged over the past ten years and is largely attributed to the resurgence of Senecavirus A (USDA APHIS Veterinary Services, 2024).

[0005] Senecavirus A (SVA; also known as Senecavirus valles) is a nonenveloped, single-stranded RNA virus belonging to the Picornaviridae family, Senecavirus genus. The virus affects pigs by causing vesicular lesions on the snout and feet (e.g., dewclaw, interdigital space, sole) that are indistinguishable from those causedby other important VD viruses such as foot-and-mouth virus (FMDV), vesicular stomatitis virus (VSS), and swine vesicular disease virus (SVD).

[0006] SVA has been shown lead to significant economic losses due to FAD investigations, with cost related to movement restrictions, quarantine, and withholding animals at slaughter. Additionally, SVA can lead to persistent infections, thus complicating control efforts since carrier animals can act as a source of infection for other susceptible pigs.

[0007] Senecavirus A (SVA) was first isolated and identified as a picomavirus that was originally named Seneca Valley virus strain SVV 001, now known as the historical strain. A pathogenicity study comparing SVV 001 with a contemporary strain referred to as SD 15-26 demonstrated that the historical strain SVV 001 exhibited low virulence and was non-pathogenic in pigs but that the contemporary strain SD 15-26 was virulent and pathogenic.

[0008] Currently, there are no commercially available vaccines for SVA in the U.S. Experimental SVA vaccines have been tested but all have limitations. Although certain inactivated and VLP vaccines protect pigs against disease, they require booster doses to maintain immunity. Live attenuated vaccines could induce protection with a single dose but present safety risks due to their use of live attenuated strains. Thus, there exists a need for new SVA vaccines with desirable efficacy and improved safety profiles.

[0009] Accordingly, the present disclosure provides immunogenic compositions and vaccines as well as associated methods for control of SVA in pigs. Advantageously, the compositions and methods described herein can be administered using a single dose and can be delivered to pigs via different routes. Furthermore, the compositions and methods utilize a live attenuated vaccine strategy that provides robust efficacy and near sterilizing immunity in pigs.

[0010] Other objects, features and advantages of the present disclosure will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the invention, are given by way of illustration only, since variouschanges and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.BRIEF DESCRIPTIONS OF THE DRAWINGS

[0011] The detailed description particularly refers to the accompanying figures in which:

[0012] FIGURES 1A-1C show the design of the sequences / immunogenic compositions of the present disclosure.

[0013] FIGURES 2A-2B show a multiple-step growth curve of cells comprising the sequences / immunogenic compositions post-infection (Fig. 2A) and a single-step growth curve of cells comprising the sequences / immunogenic compositions postinfection (Fig. 2B).

[0014] FIGURE 3 shows a summary of the experimental design of Examples 3 and 4.

[0015] FIGURES 4A-4G show post-immunization analyses of various treatment groups. Fig. 4A shows viremia analyzed post-immunization; Fig. 4B shows SVA measured on a nasal swab and analyzed post-immunization; Fig. 4C shows SVA measured on an oral swab and analyzed post-immunization; Fig. 4D shows SVA measured on a rectal swab and analyzed post-immunization; Fig. 4E shows infectious virus measured on a nasal swab and analyzed post-immunization; Fig. 4F shows infectious virus measured on an oral swab and analyzed post-immunization; and Fig. 4G shows infectious virus measured on a fecal swab and analyzed post-immunization.

[0016] FIGURES 5A-5B show evaluation of vesicular lesions in pigs following challenge. Fig. 5A shows no lesions were present in pigs administered the vaccines but lesions were present in mock control. Fig. 5B shows lesions localized on the feet of mock control pigs.

[0017] FIGURES 6A-6C show analysis of neutralizing antibodies (NA) evaluated in the various treatment groups. Fig. 6A shows NA when tested with the SVA strain SD 15-26; Fig. 6B shows NA when tested with the SVA historical strain SVV 001; and Fig. 6C shows NA when tested with the contemporary SVA strain MN- 15-84-22.

[0018] FIGURES 7A-7G show post-challenge analyses of various treatment groups. Fig. 7A shows viremia for SVA RNA analyzed post-challenge; Fig. 7B shows SVA RNA measured on a nasal swab and analyzed post-challenge; Fig. 7C shows SVA RNA measured on an oral swab and analyzed post-challenge; Fig. 7D shows SVA RNA measured on a rectal swab and analyzed post-challenge; Fig. 7E shows infectious virus measured on a nasal swab and analyzed post-challenge; Fig. 7F shows infectious virus measured on an oral swab and analyzed post-challenge; and Fig. 7G shows infectious virus measured on a fecal swab and analyzed post-challenge.

[0019] FIGURES 8A-8C show analyses of tissues and evaluated for the presence of SVA RNA after the end of the experimental period. Fig. 8A shows SVA RNA measured in the tonsil after the end of the experimental period; Fig. 8B shows SVA RNA measured in the mesenteric lymph nodes after the end of the experimental period; and Fig. 8C shows SVA RNA measured in the mediastinal lymph nodes after the end of the experimental period.DETAILED DESCRIPTION

[0020] Various embodiments of the invention are described herein as follows. In an illustrative aspect, a nucleic acid sequence comprising a sequence having at least 80% sequence identity to SEQ ID NO: 1 is provided.

[0021] As described herein, the nucleic acid sequence of SEQ ID NO: 1 refers to rSVA mSacII SVV001 Pl and is as follows:GGTTTGAAAGGAAGGACTGGGCATGAGGGCCCAGTCCTTCCTTTCCCCTTCCG GGGGGTAAACCGGCTGTGTTTGCTAGAGGCACAGAGGAGCAACATCCAACCT GCTTTTGTGGGGAACGGTGCGGCTCCAATTCCTGCGTCGCCAAAGGTGTTAGC GCACCCAAACGGCGCATCTACCAATGCTATTGGTGTGGTCTGCGAGTTCTAGC CTACTCGTTTCTCCCCTACTCACTCATTCACACACAAAAACTGTGTTGTAACT ACAAGATTTGGCCCTCGCACGGGATGTGCGATAACCGCAAGATTGACTCAAG CGCGGAAAGCGCTGTAACCACATGCTGTTAGTCCCTTTATGGCTGCGAGATG GCTATCCACCTCGGATCACTGAACTGGAGCTCGACCCTCCTTAGTAAGGGAACCGAGAGGCCTTCCTGCAACAAGCTCCGACACAGAGTCCACGTGATTGCTACCACCATGAGTACATGGTTCTCCCCTCTCGACCCAGGACTTCTTTTTGAATATCCACGGCTCGATCCAGAGGGTGGGGCATGATCCCCCTAGCATAGCGAGCTACAGCGGGAACTGTAGCTAGGCCTTAGCGTGCCTTGGATACTGCCTGATAGGGCGACGGCCTAGTCGTGTCGGTTCTATAGGTAGCACATACAAATATGCAGAACTCTCATTTTTCTTTCGATACAGCCTCTGGCACCTTTGAAGATGTAACCGGAACAAAAGTCAAGATCGTTGAATACCCCAGATCGGTGAACAATGGTGTTTACGATTCGTCTACTCATTTGGAGATACTGAACCTACAGGGTGAAATTGAAATTTTAAGGTCTTTCAATGAATACCAAATTCGCGCCGCCAAACAACAACTCGGACTGGACATCGTGTACGAACTACAGGGTAATGTTCAGACAACGTCAAAGAATGATTTTGATTCCCGTGGCAATAATGGTAACATGACCTTCAATTACTACGCAAACACTTATCAGAATTCAGTAGACTTCTCGACCTCCTCGTCGGCGTCAGGCGCCGGACCCGGGAACTCCCGGGGCGGATTAGCGGGTCTCCTCACAAATTTCAGTGGAATCTTGAACCCTCTTGGCTACCTCAAAGATCACAACACCGAAGAAATGGAAAACTCTGCTGATCGAGTCACAACGCAAACGGCGGGCAACACTGCCATAAACACGCAATCATCATTGGGTGTGTTGTGTGCCTACGTTGAAGACCCGACCAAATCTGATCCTCCGTCCAGCAGCACAGATCAACCCACCACCACTTTCACTGCCATCGACAGGTGGTACACTGGACGTCTCAATTCTTGGACAAAAGCTGTAAAAACCTTCTCTTTTCAGGCCGTCCCGCTTCCCGGGGCCTTTCTGTCTAGGCAGGGAGGCCTCAACGGAGGGGCCTTCACAGCTACCCTACATAGACACTTTTTGATGAAGTGCGGGTGGCAGGTGCAGGTCCAATGTAATTTGACACAATTCCACCAAGGCGCTCTTCTTGTTGCCATGGTTCCTGAAACCACCCTTGATGTCAAGCCCGACGGTAAGGCAAAGAGCTTACAGGAGCTGAATGAAGAACAGTGGGTGGAAATGTCTGACGATTACCGGACCGGGAAAAACATGCCTTTTCAGTCTCTTGGCACATACTATCGGCCCCCTAACTGGACTTGGGGTCCCAATTTCATCAACCCCTATCAAGTAACGGTTTTCCCACACCAAATTCTGAACGCGAGAACCTCTACCTCGGTAGACATAAACGTCCCATACATCGGGGAGACCCCCACGCAATCCTCAGAGACACAGAACTCCTGGACCCTCCTCGTTATGGTGCTCGTTCCCCTAGACTATAAGGAAGGAGCCACAACTGACCCAGAAATTACATTTTCTGTAAGGCCTACAAGTCCCTACTTCAATGGGCTTCGCAACCGCTACACGGCCGGGACGGACGAAGAACAGGGGCCCATTCCTACGGCACCCAGAGAAAATTCGCTTATGTTTCTCTCAACCCTCCCTGACGACACTGTCCCTGCTTACGGGAATGTGCGTACCCCTCCTGTCAATTACCTCCCTGGTGAAATAACCGACCTTTTGCAACTGGCCCGCATACCCACTCTCATGGCATTTGAGCGGGTGCCTGAACCCGTGCCTGCCTCAGACACATATGTGCCCTACGTTGCCGTTCCCACCCAGTTCGATGACAGGCCTCTCATCTCCTTCCCGATCACCCTTTCAGATCCCGTCTATCAGAACACCCTGGTTGGCGCCATCAGTTCAAATTTCGCCAATTACCGTGGGTGTATCCAAATCACTCTGACATTTTGTGGACCCATGATGGCGAGAGGGAAATTCCTGCTCTCGTATTCTCCCCCAAATGGAACGCAACCACAGACTCTTTCCGAAGCTATGCAGTGCACATACTCTATTTGGGACATAGGCTTGAACTCTAGTTGGACCTTCGTCGTCCCCTACATCTCGCCCAGTGACTACCGTGAAACTCGAGCCATTACCAACTCGGTTTACTCCGCTGATGGTTGGTTTAGCCTGCACAAGTTGACCAAAATTACTCTACCACCTGACTGTCCGCAAAGTCCCTGCATTCTCTTTTTCGCTTCTGCTGGTGAGGATTACACTCTCCGTCTCCCCGTTGATTGTAATCCTTCCTATGTGTTCCACTCCACCGACAACGCCGAGACCGGGGTTATTGAGGCGGGTAACACTGACACCGATTTCTCTGGTGAACTGGCGGCTCCTGGCTCTAACCACACTAATGTCAAGTTCCTGTTTGATCGATCTCGATTATTGAATGTAATCAAGGTACTGGAGAAGGACGCCGTTTTCCCCCGCCCTTTCCCTACACAAGAAGGTGCGCAGCAGGATGATGGTTACTTTTGTCTTCTGACCCCCCGCCCAACAGTCGCTTCCCGACCCGCCACTCGTTTCGGCCTGTACGCCAATCCGTCCGGCAGTGGTGTTCTTGCTAACACTTCACTGGACTTCAATTTTTATAGCTTGGCCTGTTTCACTTACTTTAGATCGGACCTTGAGGTTACGGTGGTCTCACTAGAGCCGGATCTGGAATTTGCTGTAGGGTGGTTTCCTTCTGGCAGTGAATACCAGGCTTCCAGCTTTGTCTACGACCAGCTGCATGTGCCCTTCCACTTTACTGGGCGCACTCCCCGCGCTTTCGCTAGCAAGGGTGGGAAGGTATCTTTCGTGCTCCCTTGGAACTCTGTCTCGTCTGTGCTCCCCGTGCGCTGGGGGGGGGCTTCCAAGCTCTCTTCTGCTACGCGGGGTCTACCGGCGCATGCTGATTGGGGGACTATTTACGCCTTTGTCCCCCGTCCTAATGAGAAGAAAAGCACCGCTGTAAAACACGTGGCCGTGTACATTCGGTACAAGAACGCACGTGCCTGGTGCCCCAGCATGCTTCCCTTTCGCAGCTACAAGCAGAAGATGCTGATGCAATCAGGCGACGTCGAGACCAACCCTGGCCCTGCTTCTGACAACCCGATCTTGGAGTTTCTTGAAGCGGAAAACGATCTAGTCACTCTGGCCTCTCTCTGGAAGATGGTACACTCTGTTCAACAGACCTGGAGAAAGTATGTGAAGAACGACAATTTTTGGCCCAACTTGCTCAGTGAGCTAGTGGGGGAAGGCTCCATCGCCTTGGCCGCCACGCTATCTAACCAAGCTTCAGTGAAAGCTCTCTTGGGCCTGCATTTTCTCTCTCGAGGGCTCAATTACACAGATTTTTACTCTTTACTGATAGAGAAATGCTCTAGTTTCTTTACTGTAGAACCGCCTCCTCCACCAGCTGAAAATCTGATGACCAAGCCCTCCGTGAAGTCGAAATTCCGAAAGCTGTTTAAGATGCAAGGACCCATGGACACAGTCAAAGACTGGAACCAAATAGCCGCCGGCTTGAAGAATTTCCAATTTGTTCGTGACCTAGTCAAAGAGGTGGTCGACTGGCTCCAGGCCTGGATCAATAAAGAGAAAGCCAGCCCTGTCCTCCAGTACCAGCTGGAGATGAAGAAGCTCGGGCCCGTGGCTTTGGCTCATGATGCCTTCATGGCCGGTTCCGGGCCCCCTCTTGGTGACGACCAGATTGAATACCTCCAGAACCTCAAATCTCTTGCCCTAACACTGGGAAAGACTAATTTGGCCCAAAGTCTCACCACTATGATCAATGCCAAGCAGAGCTCCGCCCAACGAGTCGAACCCGTTGTGGTGGTCCTCAGAGGCAAGCCGGGATGCGGCAAAAGCTTGGCCTCCACGTTGATTGCCCAGGCTGTGTCCAAGCGTCTCTACGGCTCGCAAAGTGTGTATTCTCTTCCTCCGGACCCAGACTTCTTCGACGGATATAAAGGACAGTTTGTAACCTTGATGGACGATCTGGGACAAAACCCGGATGGGCAAGATTTCTCCACCTTTTGTCAGATGGTGTCGACCGCCCAATTTCTTCCCAACATGGCGGACCTTGCAGAGAAGGGGCGTCCCTTCACCTCCAATCTTATCATTGCAACTACAAACCTCCCTCACTTTAGCCCTGTCACCATTGCTGATCCTTCTGCAGTCTCTCGGCGTATCAACTACGACCTGACTCTAGAAGTATCTGAGGCCTACAAGAAGCACACACGGCTGAATTTCGACCTGGCTTTCAGACGCACTGACGCCCCCCCCATTTATCCTTTTGCTGCCCATGTGCCCTTCGTGGACGTGGCTGTGCGCTTCAAAAATGGTCATCAAAGCTTCAATCTCCTAGAGTTGGTCGACTCCATTTGTGCAGACATTCGGGCCAAGCAACAAGGTGCCCGAAATATGCAGACTCTGGTTCTACAGAATCCTAACGAGAACGACGACACCCCCGTCGACGAGGCGTTGGGTAGAGTTCTCACCCCCGCTGCGGTCGACGAGGCGCTTGTCGACCTCGCTCCAGATGCCGACCCGGTTGGCCGCTTGGCTATTCTCGCCAAGCTAGGTCTTGCCCTAGCTGCGGTCACCCCTGGTTTGATAATCTTGGCAGTGGGACTCTACAAGTACTTCTCTGGCTCTGATACAGACCAAGAAGAAACAGAAAGTGAGGAGCCTGCTAAAGCGCCTAGGAGCGAGAATGCTTATGATGGCCCGAAGAAAAACTCCAAGCCCCCTGGAGCGCTCTCTCTTATGGAAATGCAACAGCCCAACGTGGACATGGGCTTTGAGGCTGCAGTTGCTAAGAAAGTGGTCGTCCCCATTACCTTCATGGTTCCCAACAGACCTTCTGGACTTACACAGTCCGCTCTTCTTGTGGCCGGCCGGACCTTCCTAATCAATGAGCATACATGGTCCAACCCCTCCTGGACCAGCTTCACAATCCGTGGTGAGGTGCACACTCGTGATGAGCCTTTCCAAACGGTTCATTTTACTCACCATGGTCTTCCCACAGATCTGATGATGGTACGTCTCGGACCGGGCAACTCTTTCCCTAACAATCTAGACAAGTTTGGACTTGACCAGATGCCGGCACGTAACTCCCGTGTGGTTGGCGTTTCGGCTAGTTACGGTAACTTCTTCTTCTCTGGGAACTTCCTCGGGTTTGTTGACTCCATCACCTCTGACCAAGGAACCTATGCGAGACTTTTCAGGTACAGGGTGACGACTTACAAGGGATGGTGCGGTTCGGCCCTGGTCTGTGAGGCCGGTGGTGTCCGACGCATCATTGGCATGCATTCTGCTGGTGCCGCTGGTATCGGCGCCGGGACTTACATCTCAAAATTAGGACTGATCAAAGCCCTTAAACACCTCGGTGAGCCTCTGGCTACAATGCAAGGACTGATGACTGAGCTAGAGCCTGGAGTCACCGTACATGTACCCCGAAAATCTAAATTGAGAAAGACGACCGCACACGCGGTGTACAAACCGGAGTTTGAACCTGCTGTGTTGTCAAAATTTGATCCCAGACTGAACAAGGATGTTGACCTAGATGAGGTAATTTGGTCTAAACACACCGCCAACGTCCCTTATCAACCTCCTTTGTTCTACACATACATGTCAGAGTACGCTCATCGGGTTTTCTCCTTTTTGGGAAAAGACAATGACATTCTGACCGTCAAAGAAGCAATCCTGGGCATCCCTGGACTAGACCCTATGGATCCCCACACAGCTCCGGGTTTGCCCTACGCCATTAGCGGTCTTCGACGTACTGATCTCGTCGATTTTGCGAACGGCACGGTAGACCCGGCACTGGCCATGCAGATCCAGAAATTCTTAGACGGTGACTACTCTGATCATGTCTTCCAAACTTTTCTAAAAGATGAAATCAGACCCTCAGAGAAGGTCCGGGCGGGAAAAACCCGCATTGTCGATGTGCCCTCCCTGGCGCACTGCATTGTGGGCAGAATGCTGCTTGGGCGCTTTGCCGCCAAGTTTCAATCCCATCCTGGCTTTCTCCTTGGCTCCGCTATCGGGTCTGACCCCGATGTCTTCTGGACCGTCATAGGGGCTCAGCTCGAGGGAAGAAAGAACACGTATGACGTGGACTACAGTGCCTTTGACTCTTCACACGGCACTGGCTCCTTCGAGGCTCTCATCTCTCACTTTTTCACCGTGGACAATGGTTTCAGCCCTGCGCTGGGACCGTATCTCAGATCCCTGGCTGTCTCGGTGCACGCTTACGGCGAGCGTCGCATCAAGATTACCGGAGGCCTCCCCTCTGGTTGTGCCGCGACCAGCCTGCTGAACACAGTGCTCAACAATGTGATCATCAGGACTGCTCTGGCATTGACCTACAAGGAATTTGAATATGACATGGTTGATATCATCGCCTACGGTGACGACCTTCTGGTTGGTACGGATTACGATCTGGACTTCAATGAGGTGGCGCGGCGCGCTGCCAAACTGGGGTATAAGATGACTCCTGCCAACAAGGGTTCTGTCTTCCCTCCGACTTCCTCTCTCTCCGATGCTGTTTTTCTAAAACGCAAATTCGTCCAAAACAATGACGGCTTATATAAACCAGTTATGGATTTAAAGAATTTGGAAGCCATGCTCTCCTACTTCAAACCAGGAACACTACTCGAGAAGCTGCAATCTGTTTCTATGTTGGCTCAACATTCTGGAAAAGAAGAATATGATAGATTGATGCACCCCTTCGCTGACTACGGTGCCGTACCGAGTCACGAGTACCTGCAGGCAAGATGGAGGGCCTTGTTCGACTGACCTGGATAGCCCAACGCGCTTCGGTGCTGCCGGCGATTCTGGGAGAACCCAGTCGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO: 1)

[0022] In an embodiment, the sequence has at least 85% sequence identity toSEQ ID NO: 1. In an embodiment, the sequence has at least 90% sequence identity toSEQ ID NO: 1. In an embodiment, the sequence has at least 91% sequence identity toSEQ ID NO: 1. In an embodiment, the sequence has at least 92% sequence identity toSEQ ID NO: 1. In an embodiment, the sequence has at least 93% sequence identity toSEQ ID NO: 1. In an embodiment, the sequence has at least 94% sequence identity toSEQ ID NO: 1. In an embodiment, the sequence has at least 95% sequence identity toSEQ ID NO: 1. In an embodiment, the sequence has at least 96% sequence identity toSEQ ID NO: 1. In an embodiment, the sequence has at least 97% sequence identity toSEQ ID NO: 1. In an embodiment, the sequence has at least 98% sequence identity toSEQ ID NO: 1. In an embodiment, the sequence has at least 99% sequence identity toSEQ ID NO: 1.

[0023] These nucleic acid sequence embodiments include the Pl genomic region (i.e., nucleotides 667-3477) from the SVA strain SVV-001 in the backbone genome of SVA strain SD 15-26 containing a 12 nucleotide (nt) deletion in the 3’ UTR. Without being bound by any theory, it is believed that the Pl genomic region of the SVA strain SD 15-26 provides for the pathogenicity and virulence of the SD 15-26 virus. Thus, these nucleic acid sequence embodiments contain structural proteins (e.g., Pl) of SVA strain SVV 001.

[0024] As described throughout herein, any described sequence can alternatively i) consist essentially of or ii) consist of a sequence with a particular percentage of sequence identity instead of ‘comprising’ the described percentage of sequence identity.

[0025] In an illustrative aspect, a chimeric sequence comprising i) a Pl sequence region of SVA strain SVV-001 and ii) one or more backbone sequence regions of SVA strain SD 15-26 is provided.

[0026] In an embodiment, the Pl sequence region of SVA strain SVV-001 is a sequence having at least 80% sequence identity to SEQ ID NO: 3. SEQ ID NO: 3 refers to the Pl region of SVV001 and is as follows:ATGCAGAACTCTCATTTTTCTTTCGATACAGCCTCTGGCACCTTTGAAGATGT AACCGGAACAAAAGTCAAGATCGTTGAATACCCCAGATCGGTGAACAATGGT GTTTACGATTCGTCTACTCATTTGGAGATACTGAACCTACAGGGTGAAATTGA AATTTTAAGGTCTTTCAATGAATACCAAATTCGCGCCGCCAAACAACAACTC GGACTGGACATCGTGTACGAACTACAGGGTAATGTTCAGACAACGTCAAAGA ATGATTTTGATTCCCGTGGCAATAATGGTAACATGACCTTCAATTACTACGCA AACACTTATCAGAATTCAGTAGACTTCTCGACCTCCTCGTCGGCGTCAGGCGC CGGACCCGGGAACTCCCGGGGCGGATTAGCGGGTCTCCTCACAAATTTCAGT GGAATCTTGAACCCTCTTGGCTACCTCAAAGATCACAACACCGAAGAAATGG AAAACTCTGCTGATCGAGTCACAACGCAAACGGCGGGCAACACTGCCATAAA CACGCAATCATCATTGGGTGTGTTGTGTGCCTACGTTGAAGACCCGACCAAAT CTGATCCTCCGTCCAGCAGCACAGATCAACCCACCACCACTTTCACTGCCATC GACAGGTGGTACACTGGACGTCTCAATTCTTGGACAAAAGCTGTAAAAACCTTCTCTTTTCAGGCCGTCCCGCTTCCCGGGGCCTTTCTGTCTAGGCAGGGAGGCCTCAACGGAGGGGCCTTCACAGCTACCCTACATAGACACTTTTTGATGAAGTGCGGGTGGCAGGTGCAGGTCCAATGTAATTTGACACAATTCCACCAAGGCGCTCTTCTTGTTGCCATGGTTCCTGAAACCACCCTTGATGTCAAGCCCGACGGTAAGGCAAAGAGCTTACAGGAGCTGAATGAAGAACAGTGGGTGGAAATGTCTGACGATTACCGGACCGGGAAAAACATGCCTTTTCAGTCTCTTGGCACATACTATCGGCCCCCTAACTGGACTTGGGGTCCCAATTTCATCAACCCCTATCAAGTAACGGTTTTCCCACACCAAATTCTGAACGCGAGAACCTCTACCTCGGTAGACATAAACGTCCCATACATCGGGGAGACCCCCACGCAATCCTCAGAGACACAGAACTCCTGGACCCTCCTCGTTATGGTGCTCGTTCCCCTAGACTATAAGGAAGGAGCCACAACTGACCCAGAAATTACATTTTCTGTAAGGCCTACAAGTCCCTACTTCAATGGGCTTCGCAACCGCTACACGGCCGGGACGGACGAAGAACAGGGGCCCATTCCTACGGCACCCAGAGAAAATTCGCTTATGTTTCTCTCAACCCTCCCTGACGACACTGTCCCTGCTTACGGGAATGTGCGTACCCCTCCTGTCAATTACCTCCCTGGTGAAATAACCGACCTTTTGCAACTGGCCCGCATACCCACTCTCATGGCATTTGAGCGGGTGCCTGAACCCGTGCCTGCCTCAGACACATATGTGCCCTACGTTGCCGTTCCCACCCAGTTCGATGACAGGCCTCTCATCTCCTTCCCGATCACCCTTTCAGATCCCGTCTATCAGAACACCCTGGTTGGCGCCATCAGTTCAAATTTCGCCAATTACCGTGGGTGTATCCAAATCACTCTGACATTTTGTGGACCCATGATGGCGAGAGGGAAATTCCTGCTCTCGTATTCTCCCCCAAATGGAACGCAACCACAGACTCTTTCCGAAGCTATGCAGTGCACATACTCTATTTGGGACATAGGCTTGAACTCTAGTTGGACCTTCGTCGTCCCCTACATCTCGCCCAGTGACTACCGTGAAACTCGAGCCATTACCAACTCGGTTTACTCCGCTGATGGTTGGTTTAGCCTGCACAAGTTGACCAAAATTACTCTACCACCTGACTGTCCGCAAAGTCCCTGCATTCTCTTTTTCGCTTCTGCTGGTGAGGATTACACTCTCCGTCTCCCCGTTGATTGTAATCCTTCCTATGTGTTCCACTCCACCGACAACGCCGAGACCGGGGTTATTGAGGCGGGTAACACTGACACCGATTTCTCTGGTGAACTGGCGGCTCCTGGCTCTAACCACACTAATGTCAAGTTCCTGTTTGATCGATCTCGATTATTGAATGTAATCAAGGTACTGGAGAAGGACGCCGTTTTCCCCCGCCCTTTCCCTACACAAGAAGGTGCGCAGCAGGATGATGGTTACTTTTGTCTTCTGACCCCCCGCCCAACAGTC GCTTCCCGACCCGCCACTCGTTTCGGCCTGTACGCCAATCCGTCCGGCAGTGG TGTTCTTGCTAACACTTCACTGGACTTCAATTTTTATAGCTTGGCCTGTTTCAC TTACTTTAGATCGGACCTTGAGGTTACGGTGGTCTCACTAGAGCCGGATCTGG AATTTGCTGTAGGGTGGTTTCCTTCTGGCAGTGAATACCAGGCTTCCAGCTTT GTCTACGACCAGCTGCATGTGCCCTTCCACTTTACTGGGCGCACTCCCCGCGC TTTCGCTAGCAAGGGTGGGAAGGTATCTTTCGTGCTCCCTTGGAACTCTGTCT CGTCTGTGCTCCCCGTGCGCTGGGGGGGGGCTTCCAAGCTCTCTTCTGCTACG CGGGGTCTACCGGCGCATGCTGATTGGGGGACTATTTACGCCTTTGTCCCCCG TCCTAATGAGAAGAAAAGCACCGCTGTAAAACACGTGGCCGTGTACATTCGG TACAAGAACGCACGTGCCTGGTGCCCCAGCATGCTTCCCTTTCGCAGCTACA AGCAGAAGATGCTGATGCAA (SEQ ID NO: 3)

[0027] In an embodiment, the Pl sequence region of SVA strain SVV-001 is a sequence having at least 85% sequence identity to SEQ ID NO: 3. In an embodiment, the Pl sequence region of SVA strain SVV-001 is a sequence having at least 90% sequence identity to SEQ ID NO: 3. In an embodiment, the Pl sequence region of SVA strain SVV-001 is a sequence having at least 91% sequence identity to SEQ ID NO: 3. In an embodiment, the Pl sequence region of SVA strain SVV-001 is a sequence having at least 92% sequence identity to SEQ ID NO: 3. In an embodiment, the Pl sequence region of SVA strain SVV-001 is a sequence having at least 93% sequence identity to SEQ ID NO: 3. In an embodiment, the Pl sequence region of SVA strain SVV-001 is a sequence having at least 94% sequence identity to SEQ ID NO: 3. In an embodiment, the Pl sequence region of SVA strain SVV-001 is a sequence having at least 95% sequence identity to SEQ ID NO: 3. In an embodiment, the Pl sequence region of SVA strain SVV-001 is a sequence having at least 96% sequence identity to SEQ ID NO: 3. In an embodiment, the Pl sequence region of SVA strain SVV-001 is a sequence having at least 97% sequence identity to SEQ ID NO: 3. In an embodiment, the Pl sequence region of SVA strain SVV-001 is a sequence having at least 98% sequence identity toSEQ ID NO: 3. In an embodiment, the Pl sequence region of SVA strain SVV-001 is a sequence having at least 99% sequence identity to SEQ ID NO: 3.

[0028] In an embodiment, one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 80% sequence identity to SEQ ID NO: 4. SEQ ID NO: 4 refers to a backbone sequence region of SVA strain SD15-26 and is as follows:GGTTTGAAAGGAAGGACTGGGCATGAGGGCCCAGTCCTTCCTTTCCCCTTCCG GGGGGTAAACCGGCTGTGTTTGCTAGAGGCACAGAGGAGCAACATCCAACCT GCTTTTGTGGGGAACGGTGCGGCTCCAATTCCTGCGTCGCCAAAGGTGTTAGC GCACCCAAACGGCGCATCTACCAATGCTATTGGTGTGGTCTGCGAGTTCTAGC CTACTCGTTTCTCCCCTACTCACTCATTCACACACAAAAACTGTGTTGTAACT ACAAGATTTGGCCCTCGCACGGGATGTGCGATAACCGCAAGATTGACTCAAG CGCGGAAAGCGCTGTAACCACATGCTGTTAGTCCCTTTATGGCTGCGAGATG GCTATCCACCTCGGATCACTGAACTGGAGCTCGACCCTCCTTAGTAAGGGAA CCGAGAGGCCTTCCTGCAACAAGCTCCGACACAGAGTCCACGTGATTGCTAC CACCATGAGTACATGGTTCTCCCCTCTCGACCCAGGACTTCTTTTTGAATATC CACGGCTCGATCCAGAGGGTGGGGCATGATCCCCCTAGCATAGCGAGCTACA GCGGGAACTGTAGCTAGGCCTTAGCGTGCCTTGGATACTGCCTGATAGGGCG ACGGCCTAGTCGTGTCGGTTCTATAGGTAGCACATACAAAT (SEQ ID NO: 4)

[0029] In an embodiment, one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 85% sequence identity to SEQ ID NO: 4. In an embodiment, one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 90% sequence identity to SEQ ID NO: 4. In an embodiment, one or more backbone sequence regions of SVA strain SD15-26 is a sequence having at least 91% sequence identity to SEQ ID NO: 4. In an embodiment, one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 92% sequence identity to SEQ ID NO: 4. In an embodiment, one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 93% sequence identity to SEQ ID NO: 4. In an embodiment, one or more backbone sequence regions of SVA strain SD15-26 isa sequence having at least 94% sequence identity to SEQ ID NO: 4. In an embodiment, one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 95% sequence identity to SEQ ID NO: 4. In an embodiment, one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 96% sequence identity to SEQ ID NO: 4. In an embodiment, one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 97% sequence identity to SEQ ID NO: 4. In an embodiment, one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 98% sequence identity to SEQ ID NO: 4. In an embodiment, one or more backbone sequence regions of SVA strain SD15-26 is a sequence having at least 99% sequence identity to SEQ ID NO: 4.

[0030] In an embodiment, one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 80% sequence identity to SEQ ID NO: 5. SEQ ID NO: 5 refers to a backbone sequence region of SVA strain SD15-26 and is as follows:TCAGGCGACGTCGAGACCAACCCTGGCCCTGCTTCTGACAACCCGATCTTGG AGTTTCTTGAAGCGGAAAACGATCTAGTCACTCTGGCCTCTCTCTGGAAGATG GTACACTCTGTTCAACAGACCTGGAGAAAGTATGTGAAGAACGACAATTTTT GGCCCAACTTGCTCAGTGAGCTAGTGGGGGAAGGCTCCATCGCCTTGGCCGC CACGCTATCTAACCAAGCTTCAGTGAAAGCTCTCTTGGGCCTGCATTTTCTCT CTCGAGGGCTCAATTACACAGATTTTTACTCTTTACTGATAGAGAAATGCTCT AGTTTCTTTACTGTAGAACCGCCTCCTCCACCAGCTGAAAATCTGATGACCAA GCCCTCCGTGAAGTCGAAATTCCGAAAGCTGTTTAAGATGCAAGGACCCATG GACACAGTCAAAGACTGGAACCAAATAGCCGCCGGCTTGAAGAATTTCCAAT TTGTTCGTGACCTAGTCAAAGAGGTGGTCGACTGGCTCCAGGCCTGGATCAA TAAAGAGAAAGCCAGCCCTGTCCTCCAGTACCAGCTGGAGATGAAGAAGCTC GGGCCCGTGGCTTTGGCTCATGATGCCTTCATGGCCGGTTCCGGGCCCCCTCT TGGTGACGACCAGATTGAATACCTCCAGAACCTCAAATCTCTTGCCCTAACA CTGGGAAAGACTAATTTGGCCCAAAGTCTCACCACTATGATCAATGCCAAGC AGAGCTCCGCCCAACGAGTCGAACCCGTTGTGGTGGTCCTCAGAGGCAAGCCGGGATGCGGCAAAAGCTTGGCCTCCACGTTGATTGCCCAGGCTGTGTCCAAGCGTCTCTACGGCTCGCAAAGTGTGTATTCTCTTCCTCCGGACCCAGACTTCTTCGACGGATATAAAGGACAGTTTGTAACCTTGATGGACGATCTGGGACAAAACCCGGATGGGCAAGATTTCTCCACCTTTTGTCAGATGGTGTCGACCGCCCAATTTCTTCCCAACATGGCGGACCTTGCAGAGAAGGGGCGTCCCTTCACCTCCAATCTTATCATTGCAACTACAAACCTCCCTCACTTTAGCCCTGTCACCATTGCTGATCCTTCTGCAGTCTCTCGGCGTATCAACTACGACCTGACTCTAGAAGTATCTGAGGCCTACAAGAAGCACACACGGCTGAATTTCGACCTGGCTTTCAGACGCACTGACGCCCCCCCCATTTATCCTTTTGCTGCCCATGTGCCCTTCGTGGACGTGGCTGTGCGCTTCAAAAATGGTCATCAAAGCTTCAATCTCCTAGAGTTGGTCGACTCCATTTGTGCAGACATTCGGGCCAAGCAACAAGGTGCCCGAAATATGCAGACTCTGGTTCTACAGAATCCTAACGAGAACGACGACACCCCCGTCGACGAGGCGTTGGGTAGAGTTCTCACCCCCGCTGCGGTCGACGAGGCGCTTGTCGACCTCGCTCCAGATGCCGACCCGGTTGGCCGCTTGGCTATTCTCGCCAAGCTAGGTCTTGCCCTAGCTGCGGTCACCCCTGGTTTGATAATCTTGGCAGTGGGACTCTACAAGTACTTCTCTGGCTCTGATACAGACCAAGAAGAAACAGAAAGTGAGGAGCCTGCTAAAGCGCCTAGGAGCGAGAATGCTTATGATGGCCCGAAGAAAAACTCCAAGCCCCCTGGAGCGCTCTCTCTTATGGAAATGCAACAGCCCAACGTGGACATGGGCTTTGAGGCTGCAGTTGCTAAGAAAGTGGTCGTCCCCATTACCTTCATGGTTCCCAACAGACCTTCTGGACTTACACAGTCCGCTCTTCTTGTGGCCGGCCGGACCTTCCTAATCAATGAGCATACATGGTCCAACCCCTCCTGGACCAGCTTCACAATCCGTGGTGAGGTGCACACTCGTGATGAGCCTTTCCAAACGGTTCATTTTACTCACCATGGTCTTCCCACAGATCTGATGATGGTACGTCTCGGACCGGGCAACTCTTTCCCTAACAATCTAGACAAGTTTGGACTTGACCAGATGCCGGCACGTAACTCCCGTGTGGTTGGCGTTTCGGCTAGTTACGGTAACTTCTTCTTCTCTGGGAACTTCCTCGGGTTTGTTGACTCCATCACCTCTGACCAAGGAACCTATGCGAGACTTTTCAGGTACAGGGTGACGACTTACAAGGGATGGTGCGGTTCGGCCCTGGTCTGTGAGGCCGGTGGTGTCCGACGCATCATTGGCATGCATTCTGCTGGTGCCGCTGGTATCGGCGCCGGGACTTACATCTCAAAATTAGGACTGATCAAAGCCCTTAAACACCTCGGTGAGCCTCTGGCTACAATGCAAGGACTGATGACTGAGCTAGAGCCTGGAGTCACCGTACATGTACCCCGAAAATCTAAATTGAGAAAGACGACCGCACACGCGGTGTACAAACCGGAGTTTGAACCTGCTGTGTTGTCAAAATTTGATCCCAGACTGAACAAGGATGTTGACCTAGATGAGGTAATTTGGTCTAAACACACCGCCAACGTCCCTTATCAACCTCCTTTGTTCTACACATACATGTCAGAGTACGCTCATCGGGTTTTCTCCTTTTTGGGAAAAGACAATGACATTCTGACCGTCAAAGAAGCAATCCTGGGCATCCCTGGACTAGACCCTATGGATCCCCACACAGCTCCGGGTTTGCCCTACGCCATTAGCGGTCTTCGACGTACTGATCTCGTCGATTTTGCGAACGGCACGGTAGACCCGGCACTGGCCATGCAGATCCAGAAATTCTTAGACGGTGACTACTCTGATCATGTCTTCCAAACTTTTCTAAAAGATGAAATCAGACCCTCAGAGAAGGTCCGGGCGGGAAAAACCCGCATTGTCGATGTGCCCTCCCTGGCGCACTGCATTGTGGGCAGAATGCTGCTTGGGCGCTTTGCCGCCAAGTTTCAATCCCATCCTGGCTTTCTCCTTGGCTCCGCTATCGGGTCTGACCCCGATGTCTTCTGGACCGTCATAGGGGCTCAGCTCGAGGGAAGAAAGAACACGTATGACGTGGACTACAGTGCCTTTGACTCTTCACACGGCACTGGCTCCTTCGAGGCTCTCATCTCTCACTTTTTCACCGTGGACAATGGTTTCAGCCCTGCGCTGGGACCGTATCTCAGATCCCTGGCTGTCTCGGTGCACGCTTACGGCGAGCGTCGCATCAAGATTACCGGAGGCCTCCCCTCTGGTTGTGCCGCGACCAGCCTGCTGAACACAGTGCTCAACAATGTGATCATCAGGACTGCTCTGGCATTGACCTACAAGGAATTTGAATATGACATGGTTGATATCATCGCCTACGGTGACGACCTTCTGGTTGGTACGGATTACGATCTGGACTTCAATGAGGTGGCGCGGCGCGCTGCCAAACTGGGGTATAAGATGACTCCTGCCAACAAGGGTTCTGTCTTCCCTCCGACTTCCTCTCTCTCCGATGCTGTTTTTCTAAAACGCAAATTCGTCCAAAACAATGACGGCTTATATAAACCAGTTATGGATTTAAAGAATTTGGAAGCCATGCTCTCCTACTTCAAACCAGGAACACTACTCGAGAAGCTGCAATCTGTTTCTATGTTGGCTCAACATTCTGGAAAAGAAGAATATGATAGATTGATGCACCCCTTCGCTGACTACGGTGCCGTACCGAGTCACGAGTACCTGCAGGCAAGATGGAGGGCCTTGTTCGACTGACCTGGATAGCCCAACGCGCTTCGGTGCTGCCGGCGATTCTGGGAGAACCCAGTCGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO: 5)

[0031] In an embodiment, one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 85% sequence identity to SEQ ID NO: 5. In an embodiment, one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 90% sequence identity to SEQ ID NO: 5. In an embodiment, one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 91% sequence identity to SEQ ID NO: 5. In an embodiment, one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 92% sequence identity to SEQ ID NO: 5. In an embodiment, one or more backbone sequence regions of SVA strain SD15-26 is a sequence having at least 93% sequence identity to SEQ ID NO: 5. In an embodiment, one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 94% sequence identity to SEQ ID NO: 5. In an embodiment, one or more backbone sequence regions of SVA strain SD15-26 is a sequence having at least 95% sequence identity to SEQ ID NO: 5. In an embodiment, one or more backbone sequence regions of SVA strain SD15-26 is a sequence having at least 96% sequence identity to SEQ ID NO: 5. In an embodiment, one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 97% sequence identity to SEQ ID NO: 5. In an embodiment, one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 98% sequence identity to SEQ ID NO: 5. In an embodiment, one or more backbone sequence regions of SVA strain SD15-26 is a sequence having at least 99% sequence identity to SEQ ID NO: 5.

[0032] In an illustrative aspect, a first immunogenic composition is provided, wherein the first immunogenic composition comprises the nucleic acid sequence comprising an embodiment of SEQ ID NO: 1 is provided. In an illustrative aspect, a second immunogenic composition is provided, wherein the second immunogenic composition comprises the chimeric sequence comprising i) a Pl sequence region of SVA strain SVV-001 and ii) one or more sequence regions of SVA strain SD 15-26 isprovided. For instance, the Pl sequence region of SVA strain SVV-001 can be a sequence comprising an embodiment of SEQ ID NO: 3. For instance, the one or more sequence regions of SVA strain SD15-26 can be a sequence comprising an embodiment of SEQ ID NO: 4, a sequence comprising an embodiment of SEQ ID NO: 5, or both.

[0033] In an illustrative aspect, a first vaccine comprising the first immunogenic composition and one or more veterinary acceptable carriers is provided. In an illustrative aspect, a second vaccine comprising the second immunogenic composition and one or more veterinary acceptable carriers is provided. Veterinary acceptable carriers are well known to the skilled person

[0034] In an illustrative aspect, a method of preventing disease in an animal is provided. The method comprises the step of administering a vaccine to the animal, wherein the vaccine provides an immunomodulatory benefit to Senecavirus A (SVA) to the animal.

[0035] In an embodiment, the vaccine is the first vaccine as described herein. In an embodiment, the vaccine is the second vaccine as described herein. In an embodiment, the animal is a pig.

[0036] In an embodiment, the immunomodulatory benefit comprises a decrease in lesion formation on the animal. In an embodiment, the decrease in lesion formation is observed on one or more feet of the animal. In an embodiment, the decrease in lesion formation is observed on a snout of the animal. In an embodiment, the decrease in lesion formation is observed on a coronary band of the animal. In an embodiment, the decrease in lesion formation is observed on a sole of the animal. In an embodiment, the decrease in lesion formation is observed on a dewclaw of the animal.

[0037] In an embodiment, the immunomodulatory benefit comprises an increase in neutralizing antibody (NA) in the animal. In an embodiment, the immunomodulatory benefit comprises a decrease in SVA RNA in the animal. In an embodiment, the immunomodulatory benefit comprises a decrease in SVA infectious virus in the animal. In an embodiment, the immunomodulatory benefit comprises a decrease in SVA RNA one or more mesenteric lymph nodes of the animal. In an embodiment, theimmunomodulatory benefit comprises a decrease in SVA RNA one or more mediastinal lymph nodes of the animal.

[0038] In an embodiment, the vaccine is administered as a single dose to the animal. In an embodiment, the vaccine is administered as via multiple doses to the animal.

[0039] In an embodiment, the vaccine is administered to the animal via a parenteral administration. In an embodiment, the parenteral administration is selected from the group consisting of intravenous, intraarterial, intraperitoneal, intrathecal, intradermal, epidural, intracerebroventricular, intraurethral, intrasternal, intracranial, intratumoral, intramuscular and subcutaneous. In an embodiment, the parenteral administration is intravenous. In an embodiment, the parenteral administration is intraarterial. In an embodiment, the parenteral administration is intraperitoneal. In an embodiment, the parenteral administration is intrathecal. In an embodiment, the parenteral administration is intradermal. In an embodiment, the parenteral administration is epidural. In an embodiment, the parenteral administration is intraurethral. In an embodiment, the parenteral administration is intrasternal. In an embodiment, the parenteral administration is intracranial. In an embodiment, the parenteral administration is intratumoral. In an embodiment, the parenteral administration is intramuscular. In an embodiment, the parenteral administration is subcutaneous.

[0040] In an embodiment, the vaccine is administered to the animal via an intranasal administration.

[0041] In an illustrative aspect, a method of preventing a Senecavirus A (SVA) infection in an animal is provided. The method comprises the step of administering a vaccine to the animal in need thereof, wherein the vaccine provides prevention of the SVA infection in the animal.

[0042] In an embodiment, the vaccine is the first vaccine as described herein. In an embodiment, the vaccine is the second vaccine as described herein. In an embodiment, the animal is a pig.

[0043] In an embodiment, the method comprises a decrease in lesion formation on the animal. In an embodiment, the decrease in lesion formation is observed on one or more feet of the animal. In an embodiment, the decrease in lesion formation is observed on a snout of the animal. In an embodiment, the decrease in lesion formation is observed on a coronary band of the animal. In an embodiment, the decrease in lesion formation is observed on a sole of the animal. In an embodiment, the decrease in lesion formation is observed on a dewclaw of the animal.

[0044] In an embodiment, the vaccine provides an increase in neutralizing antibody (NA) in the animal. In an embodiment, the vaccine provides a decrease in SVA RNA in the animal. In an embodiment, the vaccine provides a decrease in SVA infectious virus in the animal.

[0045] In an embodiment, the vaccine provides a decrease in SVA RNA one or more mesenteric lymph nodes of the animal. In an embodiment, the vaccine provides a decrease in SVA RNA one or more mediastinal lymph nodes of the animal.

[0046] In an embodiment, the vaccine is administered as a single dose to the animal. In an embodiment, the vaccine is administered as via multiple doses to the animal.

[0047] In an embodiment, the vaccine is administered to the animal via a parenteral administration. In an embodiment, the parenteral administration is selected from the group consisting of intravenous, intraarterial, intraperitoneal, intrathecal, intradermal, epidural, intracerebroventricular, intraurethral, intrasternal, intracranial, intratumoral, intramuscular and subcutaneous. In an embodiment, the parenteral administration is intravenous. In an embodiment, the parenteral administration is intraarterial. In an embodiment, the parenteral administration is intraperitoneal. In an embodiment, the parenteral administration is intrathecal. In an embodiment, the parenteral administration is intradermal. In an embodiment, the parenteral administration is epidural. In an embodiment, the parenteral administration is intraurethral. In an embodiment, the parenteral administration is intrasternal. In an embodiment, the parenteral administration is intracranial. In an embodiment, the parenteral administrationis intratumoral. In an embodiment, the parenteral administration is intramuscular. In an embodiment, the parenteral administration is subcutaneous.

[0048] In an embodiment, the vaccine is administered to the animal via an intranasal administration.

[0049] In an illustrative aspect, a method of preventing a Senecavirus A (SVA) infection in an animal is provided. The method comprises the step of administering a vaccine to the animal in need thereof, wherein the vaccine provides prevention of the SVA infection in the animal.

[0050] In an embodiment, the vaccine is the first vaccine as described herein. In an embodiment, the vaccine is the second vaccine as described herein. In an embodiment, the animal is a pig.

[0051] In an embodiment, the vaccine is administered as a single dose to the animal. In an embodiment, the vaccine is administered as via multiple doses to the animal.

[0052] In an embodiment, the vaccine is administered to the animal via a parenteral administration. In an embodiment, the parenteral administration is selected from the group consisting of intravenous, intraarterial, intraperitoneal, intrathecal, intradermal, epidural, intracerebroventricular, intraurethral, intrasternal, intracranial, intratumoral, intramuscular and subcutaneous. In an embodiment, the parenteral administration is intravenous. In an embodiment, the parenteral administration is intraarterial. In an embodiment, the parenteral administration is intraperitoneal. In an embodiment, the parenteral administration is intrathecal. In an embodiment, the parenteral administration is intradermal. In an embodiment, the parenteral administration is epidural. In an embodiment, the parenteral administration is intraurethral. In an embodiment, the parenteral administration is intrasternal. In an embodiment, the parenteral administration is intracranial. In an embodiment, the parenteral administration is intratumoral. In an embodiment, the parenteral administration is intramuscular. In an embodiment, the parenteral administration is subcutaneous.

[0053] In an embodiment, the vaccine is administered to the animal via an intranasal administration.

[0054] In an illustrative aspect, a nucleic acid sequence comprising a sequence having at least 80% sequence identity to SEQ ID NO: 2 is provided. As described herein, the nucleic acid sequence of SEQ ID NO: 2 refers to rSVA mSacII SVV001 P2 and is as follows:GGTTTGAAAGGAAGGACTGGGCATGAGGGCCCAGTCCTTCCTTTCCCCTTCCG GGGGGTAAACCGGCTGTGTTTGCTAGAGGCACAGAGGAGCAACATCCAACCT GCTTTTGTGGGGAACGGTGCGGCTCCAATTCCTGCGTCGCCAAAGGTGTTAGC GCACCCAAACGGCGCATCTACCAATGCTATTGGTGTGGTCTGCGAGTTCTAGC CTACTCGTTTCTCCCCTACTCACTCATTCACACACAAAAACTGTGTTGTAACT ACAAGATTTGGCCCTCGCACGGGATGTGCGATAACCGCAAGATTGACTCAAG CGCGGAAAGCGCTGTAACCACATGCTGTTAGTCCCTTTATGGCTGCGAGATG GCTATCCACCTCGGATCACTGAACTGGAGCTCGACCCTCCTTAGTAAGGGAA CCGAGAGGCCTTCCTGCAACAAGCTCCGACACAGAGTCCACGTGATTGCTAC CACCATGAGTACATGGTTCTCCCCTCTCGACCCAGGACTTCTTTTTGAATATC CACGGCTCGATCCAGAGGGTGGGGCATGATCCCCCTAGCATAGCGAGCTACA GCGGGAACTGTAGCTAGGCCTTAGCGTGCCTTGGATACTGCCTGATAGGGCG ACGGCCTAGTCGTGTCGGTTCTATAGGTAGCACATACAAATATGCAGAACTC TCATTTTTCTTTCGATACAGCCTCTGGCACCTTTGAAGACGTAACCGGAACAA AAGTCAAGATCGTTGAATACCCCAGATCGGTGAACAATGGTGTTTACGATTC GTCCACTCATTTAGAGATACTGAACCTACAGGGTGAAATTGAAATTTTAAAG TCTTTCAACGAATACCAAATTCGCGCCGCCAAACAACAACTTGGACTGGACA TCGTATACGAACTACAGGGTAATGTTCAGACAACCTCAAAGAATGATTTTGA TTCCCGAGGCAATAATGGTAACATGACCTTCAATTACTACGCAAACACTTACC AGAATTCAGTAGACTTCTCGACCTCCTCGTCGGCGTCAGGCGCCGGACCCGG GAACTCCCGGGGCGGATTAGCGGGTCTCCTCACAAATTTCAGTGGAATCTTG AACCCTCTTGGCTACCTCAAAGATCACAATACCGAAGAAATGGAAAACTCTGCTGATCGAGTCATAACGCAAACGGCGGGCAACACTGCCATAAACACGCAATCATCACTGGGTGTGTTGTGTGCCTACGTTGAAGACCCGACCAAATCTGACCCTCCGTCCAGCAGCACAGATCAACCCACCACCACTTTTACTGCCATCGACAGGTGGTACACTGGACGCCTCAATTCTTGGACAAAAGCTGTAAAAACCTTCTCTTTTCAGGCCGTCCCGCTCCCTGGAGCCTTCCTGTCTAGACAGGGAGGCCTCAACGGAGGGGCCTTCACGGCCACCCTACATAGACATTTCTTAATGAAGTGCGGGTGGCAGGTGCAGGTTCAATGCAATTTGACGCAATTCCACCAAGGTGCTCTTCTTGTTGCCATGGTCCCCGAAACCACCCTTGATGTCAAACCTGACGGCAAGGCAAAGAGCTTACAGGAGCTGAATGAAGAGCAGTGGGTGGAAATGTCTGACGACTACCGGACCGGGAAAAACATGCCTTTTCAGTCTCTTGGTACATACTACCGACCCCCTAACTGGACTTGGGGCCCCAATTTCATCAACCCCTATCAAGTAACAGTTTTCCCACACCAAATTCTGAACGCGAGAACCTCTACCTCGGTAGACATAAGTGTCCCGTACATCGGGGAGACTCCTACACAATCCTCAGAGACACAGAACTCCTGGACCCTCCTTGTTATGGTGCTTGTCCCCCTGGACTACAAGGAGGGAGCCACAACTGACCCAGAAATTACATTTTCTGTAAGGCCTACAAGTCCCTACTTCAATGGGCTTCGTAACCGTTTCACGACCGGGACGGACGAGGAACAGGGGCCCATTCCCACAGCACCCAGAGAAAATTCGCTTATGTTTCTCTCAACCATCCCTGATGACACTGTTCCTGCTTACGGGAATGTGCGTACCCCTCCCGTCAATTACCTCCCCGGTGAAATAACCGACCTCTTACAACTGGCCCGTATACCCACTCTCATGGCGTTTGGGCGGGCGTCCGAACCCGAGCCTGCCTCAGACGCATATGTGCCCTACGTTGCCGTTCCTGCCCAGTTCGACGACAAGCCTCTCATCTCCTTCCCGATCACCCTTTCAGATCCTGTCTACCAGAACACTCTGGTAGGCGCCATCAGTTCGAACTTCGCCAACTACCGGGGGTGTATCCAAATCACTTTGACATTTTGTGGACCCATGATGGCAAGAGGGAAATTCCTGCTCTCGTATTCTCCCCCAAATGGAGCACAACCACAGACCCTTTCTGAAGCTATGCAGTGCACATACTCTATTTGGGATATAGGCTTGAACTCTAGTTGGACCTTTGTCATCCCCTACATCTCGCCCAGTGATTACCGTGAAACTCGGGCTATTACCAACTCAGTTTATTCTGCTGATGGTTGGTTTAGCTTGCACAAGCTGACCAAAATTACTCTACCACCTGACTGCCCGCAGAGTCCCTGTATTCTCTTTTTCGCCTCTGCTGGTGAGGATTACACCCTCCGTCTCCCTGTTGATTGTAATCCTTCCTACGTGTTCCACTCCACCGACAACGCCGAGACTGGGGTTATTGAGGCAGGTAACACTGACACCGATTTTTCTGGTGAACTGGCGGCTCCTGGCTCTAACCATACTAATGTCAAATTCCTGTTTGACCGATCTCGACTACTGAATGTAATTAAGGTACTGGAGAAGGACGCCGTCTTCCCCCGTCCTTTCCCCACAGCAACAGGTGCACAGCAGGACGATGGTTACTTTTGTCTTCTAACACCCCGCCCAACAGTCGCTTCCCGACCCGCCACTCGTTTCGGCCTGTACGTCAACCCGTCTGACAGTGGCGTTCTCGCTAACACTTCACTGGATTTCAATTTTTACAGTTTGGCCTGTTTCACTTACTTTAGATCAGACCTTGAAGTCACGGTGGTCTCACTGGAGCCAGATTTGGAATTCGCCGTGGGGTGGTTCCCCTCTGGCAGTGAGTACCAGGCTTCTAGCTTTGTTTACGACCAACTGCATGTACCCTACCACTTTACTGGGCGCACTCCCCGCGCTTTCACCAGCAAGGGTGGAAAGGTATCTTTCGTGCTCCCTTGGAACTCTGTCTCTTCCGTGCTTCCCGTGCGCTGGGGGGGCGCCTCCAAGCTTTCTTCTGCCACGCGGGGTCTGCCGGCTCATGCTGACTGGGGGACCATTTACGCCTTTATCCCCCGTCCTAACGAGAAGAAAAGCACCGCTGTAAAGCACGTGGCGGTGTACGTTCGGTACAAGAACGCGCGTGCCTGGTGCCCCAGCATGCTTCCCTTTCGCAGCTACAAGCAGAAGATGCTGATGCAATCTGGCGATATCGAGACCAATCCTGGTCCTGCTTCTGACAACCCAATTTTGGAGTTTCTTGAAGCAGAAAATGATCTAGTCACTCTGGCCTCTCTCTGGAAGATGGTGCACTCTGTTCAACAGACCTGGAGAAAGTATGTGAAGAACGATGATTTTTGGCCCAATTTACTCAGCGAGCTAGTGGGGGAAGGCTCTGTCGCCTTGGCCGCCACGCTATCCAACCAAGCTTCAGTAAAGGCTCTTTTGGGCCTGCACTTTCTCTCTCGGGGGCTCAATTACACTGACTTTTACTCTTTACTGATAGAGAAATGCTCTAGTTTCTTTACCGTAGAACCACCTCCTCCACCAGCTGAAAACCTGATGACCAAGCCCTCAGTGAAGTCGAAATTCCGAAAACTGTTTAAGATGCAAGGACCCATGGACAAAGTCAAAGACTGGAACCAAATAGCTGCCGGCTTGAAGAATTTTCAATTTGTTCGTGACCTAGTCAAAGAGGTGGTCGATTGGCTGCAGGCCTGGATCAACAAAGAGAAAGCCAGCCCTGTCCTCCAGTACCAGTTGGAGATGAAGAAGCTCGGGCCTGTGGCCTTGGCTCATGACGCTTTCATGGCTGGTTCCGGGCCCCCTCTTAGCGACGACCAGATTGAATACCTCCAGAACCTCAAATCTCTTGCCCTAACACTGGGGAAGACTAATTTGGCCCAAAGTCTCACCACTATGATCAATGCCAAACAAAGTTCAGCCCAACGAGTTGAACCCGTTGTGGTGGTCCTTAGAGGCAAGCCGGGATGCGGCAAGAGCTTGGCCTCTACGTTGATTGCCCAGGCTGTGTCCAAGCGCCTCTATGGCTCCCAAAGTGTATATTCTCTTCCCCCAGATCCAGATTTCTTCGATGGATACAAAGGACAGTTCGTGACCTTGATGGATGATTTGGGACAAAACCCGGATGGACAAGATTTCTCCACCTTTTGTCAGATGGTGTCGACCGCCCAATTTCTCCCCAACATGGCGGACCTTGCAGAGAAAGGGCGTCCCTTTACCTCCAATCTCATCATTGCAACTACAAATCTCCCCCACTTCAGTCCTGTCACCATTGCTGATCCTTCTGCAGTCTCTCGCCGTATCAACTACGATCTGACTCTAGAAGTATCTGAGGCCTACAAGAAACACACACGGCTGAATTTTGACTTGGCTTTCAGGCGCACAGACGCCCCCCCCATTTATCCTTTTGCTGCCCATGTGCCCTTTGTGGACGTAGCTGTGCGCTTCAAAAATGGTCACCAGAATTTTAATCTCCTAGAGTTGGTCGATTCCATTTGTACAGACATTCGAGCCAAGCAACAAGGTGCCCGAAACATGCAGACTCTGGTTCTACAGAATCCTAACGAGAACGACGACACCCCCGTCGACGAGGCGTTGGGTAGAGTTCTCACCCCCGCTGCGGTCGACGAGGCGCTTGTCGACCTCGCTCCAGATGCCGACCCGGTTGGCCGCTTGGCTATTCTCGCCAAGCTAGGTCTTGCCCTAGCTGCGGTCACCCCTGGTTTGATAATCTTGGCAGTGGGACTCTACAAGTACTTCTCTGGCTCTGATACAGACCAAGAAGAAACAGAAAGTGAGGAGCCTGCTAAAGCGCCTAGGAGCGAGAATGCTTATGATGGCCCGAAGAAAAACTCCAAGCCCCCTGGAGCGCTCTCTCTTATGGAAATGCAACAGCCCAACGTGGACATGGGCTTTGAGGCTGCAGTTGCTAAGAAAGTGGTCGTCCCCATTACCTTCATGGTTCCCAACAGACCTTCTGGACTTACACAGTCCGCTCTTCTTGTGGCCGGCCGGACCTTCCTAATCAATGAGCATACATGGTCCAACCCCTCCTGGACCAGCTTCACAATCCGTGGTGAGGTGCACACTCGTGATGAGCCTTTCCAAACGGTTCATTTTACTCACCATGGTCTTCCCACAGATCTGATGATGGTACGTCTCGGACCGGGCAACTCTTTCCCTAACAATCTAGACAAGTTTGGACTTGACCAGATGCCGGCACGTAACTCCCGTGTGGTTGGCGTTTCGGCTAGTTACGGTAACTTCTTCTTCTCTGGGAACTTCCTCGGGTTTGTTGACTCCATCACCTCTGACCAAGGAACCTATGCGAGACTTTTCAGGTACAGGGTGACGACTTACAAGGGATGGTGCGGTTCGGCCCTGGTCTGTGAGGCCGGTGGTGTCCGACGCATCATTGGCATGCATTCTGCTGGTGCCGCTGGTATCGGCGCCGGGACTTACATCTCAAAATTAGGACTGATCAAAGCCCTTAAACACCTCGGTGAGCCTCTGGCTACAATGCAAGGACTGATGACTGAGCTAGAGCCTGGAGTCACCGTACATGTACCCCGAAAATCTAAATTGAGAAAGACGACCGCACACGCGGTGTACAAACCGGAGTTTGAACCTGCTGTGTTGTCAAAATTTGATCCCAGACTGAACAAGGATGTTGACCTAGATGAGGTAATTTGGTCTAAACACACCGCCAACGTCCCTTATCAACCTCCTTTGTTCTACACATACATGTCAGAGTACGCTCATCGGGTTTTCTCCTTTTTGGGAAAAGACAATGACATTCTGACCGTCAAAGAAGCAATCCTGGGCATCCCTGGACTAGACCCTATGGATCCCCACACAGCTCCGGGTTTGCCCTACGCCATTAGCGGTCTTCGACGTACTGATCTCGTCGATTTTGCGAACGGCACGGTAGACCCGGCACTGGCCATGCAGATCCAGAAATTCTTAGACGGTGACTACTCTGATCATGTCTTCCAAACTTTTCTAAAAGATGAAATCAGACCCTCAGAGAAGGTCCGGGCGGGAAAAACCCGCATTGTCGATGTGCCCTCCCTGGCGCACTGCATTGTGGGCAGAATGCTGCTTGGGCGCTTTGCCGCCAAGTTTCAATCCCATCCTGGCTTTCTCCTTGGCTCCGCTATCGGGTCTGACCCCGATGTCTTCTGGACCGTCATAGGGGCTCAGCTCGAGGGAAGAAAGAACACGTATGACGTGGACTACAGTGCCTTTGACTCTTCACACGGCACTGGCTCCTTCGAGGCTCTCATCTCTCACTTTTTCACCGTGGACAATGGTTTCAGCCCTGCGCTGGGACCGTATCTCAGATCCCTGGCTGTCTCGGTGCACGCTTACGGCGAGCGTCGCATCAAGATTACCGGAGGCCTCCCCTCTGGTTGTGCCGCGACCAGCCTGCTGAACACAGTGCTCAACAATGTGATCATCAGGACTGCTCTGGCATTGACCTACAAGGAATTTGAATATGACATGGTTGATATCATCGCCTACGGTGACGACCTTCTGGTTGGTACGGATTACGATCTGGACTTCAATGAGGTGGCGCGGCGCGCTGCCAAACTGGGGTATAAGATGACTCCTGCCAACAAGGGTTCTGTCTTCCCTCCGACTTCCTCTCTCTCCGATGCTGTTTTTCTAAAACGCAAATTCGTCCAAAACAATGACGGCTTATATAAACCAGTTATGGATTTAAAGAATTTGGAAGCCATGCTCTCCTACTTCAAACCAGGAACACTACTCGAGAAGCTGCAATCTGTTTCTATGTTGGCTCAACATTCTGGAAAAGAAGAATATGATAGATTGATGCACCCCTTCGCTGACTACGGTGCCGTACCGAGTCACGAGTACCTGCAGGCAAGATGGAGGGCCTTGTTCGACTGACCTGGATAGCCCAACGCGCTTCGGTGCTGCCGGCGATTCTGGGAGAACCCAGTCGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO: 2)

[0055] In an embodiment, the sequence has at least 85% sequence identity toSEQ ID NO: 2. In an embodiment, the sequence has at least 90% sequence identity toSEQ ID NO: 2. In an embodiment, the sequence has at least 91% sequence identity toSEQ ID NO: 2. In an embodiment, the sequence has at least 92% sequence identity toSEQ ID NO: 2. In an embodiment, the sequence has at least 93% sequence identity toSEQ ID NO: 2. In an embodiment, the sequence has at least 94% sequence identity toSEQ ID NO: 2. In an embodiment, the sequence has at least 95% sequence identity toSEQ ID NO: 2. In an embodiment, the sequence has at least 96% sequence identity toSEQ ID NO: 2. In an embodiment, the sequence has at least 97% sequence identity toSEQ ID NO: 2. In an embodiment, the sequence has at least 98% sequence identity toSEQ ID NO: 2. In an embodiment, the sequence has at least 99% sequence identity toSEQ ID NO: 2.

[0056] These nucleic acid sequence embodiments include the P2 genomic region (i.e., nucleotides 3478-4854) from the SVA strain SVV-001 and one or more sequence regions of SVA strain SD15-26 containing a single point mutation in the P2 region and a deletion of 12 nt in the 3’UTR of the virus genome. Thus, these nucleic acid sequence embodiments contain non-structural proteins (e.g., 2A, 2B, and 2C) of SVA strain SW 001.

[0057] As described throughout herein, any described sequence can alternatively i) consist essentially of or ii) consist of a sequence with a particular percentage of sequence identity instead of ‘comprising’ the described percentage of sequence identity.

[0058] In an illustrative aspect, a chimeric sequence comprising i) a P2 sequence region of SVA strain SVV-001 and ii) one or more backbone sequence regions of SVA strain SD 15-26 is provided.

[0059] In an embodiment, the P2 sequence region of SVA strain SVV-001 is a sequence having at least 80% sequence identity to SEQ ID NO: 6. SEQ ID NO: 6 refers to the P2 region of SVV001 and is as follows:TCTGGCGATATCGAGACCAATCCTGGTCCTGCTTCTGACAACCCAATTTTGGA GTTTCTTGAAGCAGAAAATGATCTAGTCACTCTGGCCTCTCTCTGGAAGATGG TGCACTCTGTTCAACAGACCTGGAGAAAGTATGTGAAGAACGATGATTTTTG GCCCAATTTACTCAGCGAGCTAGTGGGGGAAGGCTCTGTCGCCTTGGCCGCC ACGCTATCCAACCAAGCTTCAGTAAAGGCTCTTTTGGGCCTGCACTTTCTCTC TCGGGGGCTCAATTACACTGACTTTTACTCTTTACTGATAGAGAAATGCTCTA GTTTCTTTACCGTAGAACCACCTCCTCCACCAGCTGAAAACCTGATGACCAAG CCCTCAGTGAAGTCGAAATTCCGAAAACTGTTTAAGATGCAAGGACCCATGG ACAAAGTCAAAGACTGGAACCAAATAGCTGCCGGCTTGAAGAATTTTCAATT TGTTCGTGACCTAGTCAAAGAGGTGGTCGATTGGCTGCAGGCCTGGATCAAC AAAGAGAAAGCCAGCCCTGTCCTCCAGTACCAGTTGGAGATGAAGAAGCTCG GGCCTGTGGCCTTGGCTCATGACGCTTTCATGGCTGGTTCCGGGCCCCCTCTT AGCGACGACCAGATTGAATACCTCCAGAACCTCAAATCTCTTGCCCTAACAC TGGGGAAGACTAATTTGGCCCAAAGTCTCACCACTATGATCAATGCCAAACA AAGTTCAGCCCAACGAGTTGAACCCGTTGTGGTGGTCCTTAGAGGCAAGCCG GGATGCGGCAAGAGCTTGGCCTCTACGTTGATTGCCCAGGCTGTGTCCAAGC GCCTCTATGGCTCCCAAAGTGTATATTCTCTTCCCCCAGATCCAGATTTCTTCG ATGGATACAAAGGACAGTTCGTGACCTTGATGGATGATTTGGGACAAAACCC GGATGGACAAGATTTCTCCACCTTTTGTCAGATGGTGTCGACCGCCCAATTTC TCCCCAACATGGCGGACCTTGCAGAGAAAGGGCGTCCCTTTACCTCCAATCT CATCATTGCAACTACAAATCTCCCCCACTTCAGTCCTGTCACCATTGCTGATC CTTCTGCAGTCTCTCGCCGTATCAACTACGATCTGACTCTAGAAGTATCTGAG GCCTACAAGAAACACACACGGCTGAATTTTGACTTGGCTTTCAGGCGCACAG ACGCCCCCCCCATTTATCCTTTTGCTGCCCATGTGCCCTTTGTGGACGTAGCT GTGCGCTTCAAAAATGGTCACCAGAATTTTAATCTCCTAGAGTTGGTCGATTCCATTTGTACAGACATTCGAGCCAAGCAACAAGGTGCCCGAAACATGCAGACT CTGGTTCTACAG (SEQ ID NO: 6)

[0060] In an embodiment, the P2 sequence region of SVA strain SVV-001 is a sequence having at least 85% sequence identity to SEQ ID NO: 6. In an embodiment, the P2 sequence region of SVA strain SVV-001 is a sequence having at least 90% sequence identity to SEQ ID NO: 6. In an embodiment, the P2 sequence region of SVA strain SVV-001 is a sequence having at least 91% sequence identity to SEQ ID NO: 6. In an embodiment, the P2 sequence region of SVA strain SVV-001 is a sequence having at least 92% sequence identity to SEQ ID NO: 6. In an embodiment, the P2 sequence region of SVA strain SVV-001 is a sequence having at least 93% sequence identity to SEQ ID NO: 6. In an embodiment, the P2 sequence region of SVA strain SVV-001 is a sequence having at least 94% sequence identity to SEQ ID NO: 6. In an embodiment, the P2 sequence region of SVA strain SVV-001 is a sequence having at least 95% sequence identity to SEQ ID NO: 6. In an embodiment, the P2 sequence region of SVA strain SVV-001 is a sequence having at least 96% sequence identity to SEQ ID NO: 6. In an embodiment, the P2 sequence region of SVA strain SVV-001 is a sequence having at least 97% sequence identity to SEQ ID NO: 6. In an embodiment, the P2 sequence region of SVA strain SVV-001 is a sequence having at least 98% sequence identity to SEQ ID NO: 6. In an embodiment, the P2 sequence region of SVA strain SVV-001 is a sequence having at least 99% sequence identity to SEQ ID NO: 6.

[0061] In an embodiment, one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 80% sequence identity to SEQ ID NO: 7. SEQ ID NO: 7 refers to a backbone sequence region of SVA strain SD15-26 and is as follows:GGTTTGAAAGGAAGGACTGGGCATGAGGGCCCAGTCCTTCCTTTCCCCTTCCG GGGGGTAAACCGGCTGTGTTTGCTAGAGGCACAGAGGAGCAACATCCAACCT GCTTTTGTGGGGAACGGTGCGGCTCCAATTCCTGCGTCGCCAAAGGTGTTAGC GCACCCAAACGGCGCATCTACCAATGCTATTGGTGTGGTCTGCGAGTTCTAGCCTACTCGTTTCTCCCCTACTCACTCATTCACACACAAAAACTGTGTTGTAACTACAAGATTTGGCCCTCGCACGGGATGTGCGATAACCGCAAGATTGACTCAAGCGCGGAAAGCGCTGTAACCACATGCTGTTAGTCCCTTTATGGCTGCGAGATGGCTATCCACCTCGGATCACTGAACTGGAGCTCGACCCTCCTTAGTAAGGGAACCGAGAGGCCTTCCTGCAACAAGCTCCGACACAGAGTCCACGTGATTGCTACCACCATGAGTACATGGTTCTCCCCTCTCGACCCAGGACTTCTTTTTGAATATCCACGGCTCGATCCAGAGGGTGGGGCATGATCCCCCTAGCATAGCGAGCTACAGCGGGAACTGTAGCTAGGCCTTAGCGTGCCTTGGATACTGCCTGATAGGGCGACGGCCTAGTCGTGTCGGTTCTATAGGTAGCACATACAAATATGCAGAACTCTCATTTTTCTTTCGATACAGCCTCTGGCACCTTTGAAGACGTAACCGGAACAAAAGTCAAGATCGTTGAATACCCCAGATCGGTGAACAATGGTGTTTACGATTCGTCCACTCATTTAGAGATACTGAACCTACAGGGTGAAATTGAAATTTTAAAGTCTTTCAACGAATACCAAATTCGCGCCGCCAAACAACAACTTGGACTGGACATCGTATACGAACTACAGGGTAATGTTCAGACAACCTCAAAGAATGATTTTGATTCCCGAGGCAATAATGGTAACATGACCTTCAATTACTACGCAAACACTTACCAGAATTCAGTAGACTTCTCGACCTCCTCGTCGGCGTCAGGCGCCGGACCCGGGAACTCCCGGGGCGGATTAGCGGGTCTCCTCACAAATTTCAGTGGAATCTTGAACCCTCTTGGCTACCTCAAAGATCACAATACCGAAGAAATGGAAAACTCTGCTGATCGAGTCATAACGCAAACGGCGGGCAACACTGCCATAAACACGCAATCATCACTGGGTGTGTTGTGTGCCTACGTTGAAGACCCGACCAAATCTGACCCTCCGTCCAGCAGCACAGATCAACCCACCACCACTTTTACTGCCATCGACAGGTGGTACACTGGACGCCTCAATTCTTGGACAAAAGCTGTAAAAACCTTCTCTTTTCAGGCCGTCCCGCTCCCTGGAGCCTTCCTGTCTAGACAGGGAGGCCTCAACGGAGGGGCCTTCACGGCCACCCTACATAGACATTTCTTAATGAAGTGCGGGTGGCAGGTGCAGGTTCAATGCAATTTGACGCAATTCCACCAAGGTGCTCTTCTTGTTGCCATGGTCCCCGAAACCACCCTTGATGTCAAACCTGACGGCAAGGCAAAGAGCTTACAGGAGCTGAATGAAGAGCAGTGGGTGGAAATGTCTGACGACTACCGGACCGGGAAAAACATGCCTTTTCAGTCTCTTGGTACATACTACCGACCCCCTAACTGGACTTGGGGCCCCAATTTCATCAACCCCTATCAAGTAACAGTTTTCCCACACCAAATTCTGAACGCGAGAACCTCTACCTCGGTAGACATAAGTGTCCCGTACATCGGGGAGACTCCTACACAATCCTCAGAGACACAGAACTCCTGGACCCTCCTTGTTATGGTGCTTGTCCCCCTGGACTACAAGGAGGGAGCCACAACTGACCCAGAAATTACATTTTCTGTAAGGCCTACAAGTCCCTACTTCAATGGGCTTCGTAACCGTTTCACGACCGGGACGGACGAGGAACAGGGGCCCATTCCCACAGCACCCAGAGAAAATTCGCTTATGTTTCTCTCAACCATCCCTGATGACACTGTTCCTGCTTACGGGAATGTGCGTACCCCTCCCGTCAATTACCTCCCCGGTGAAATAACCGACCTCTTACAACTGGCCCGTATACCCACTCTCATGGCGTTTGGGCGGGCGTCCGAACCCGAGCCTGCCTCAGACGCATATGTGCCCTACGTTGCCGTTCCTGCCCAGTTCGACGACAAGCCTCTCATCTCCTTCCCGATCACCCTTTCAGATCCTGTCTACCAGAACACTCTGGTAGGCGCCATCAGTTCGAACTTCGCCAACTACCGGGGGTGTATCCAAATCACTTTGACATTTTGTGGACCCATGATGGCAAGAGGGAAATTCCTGCTCTCGTATTCTCCCCCAAATGGAGCACAACCACAGACCCTTTCTGAAGCTATGCAGTGCACATACTCTATTTGGGATATAGGCTTGAACTCTAGTTGGACCTTTGTCATCCCCTACATCTCGCCCAGTGATTACCGTGAAACTCGGGCTATTACCAACTCAGTTTATTCTGCTGATGGTTGGTTTAGCTTGCACAAGCTGACCAAAATTACTCTACCACCTGACTGCCCGCAGAGTCCCTGTATTCTCTTTTTCGCCTCTGCTGGTGAGGATTACACCCTCCGTCTCCCTGTTGATTGTAATCCTTCCTACGTGTTCCACTCCACCGACAACGCCGAGACTGGGGTTATTGAGGCAGGTAACACTGACACCGATTTTTCTGGTGAACTGGCGGCTCCTGGCTCTAACCATACTAATGTCAAATTCCTGTTTGACCGATCTCGACTACTGAATGTAATTAAGGTACTGGAGAAGGACGCCGTCTTCCCCCGTCCTTTCCCCACAGCAACAGGTGCACAGCAGGACGATGGTTACTTTTGTCTTCTAACACCCCGCCCAACAGTCGCTTCCCGACCCGCCACTCGTTTCGGCCTGTACGTCAACCCGTCTGACAGTGGCGTTCTCGCTAACACTTCACTGGATTTCAATTTTTACAGTTTGGCCTGTTTCACTTACTTTAGATCAGACCTTGAAGTCACGGTGGTCTCACTGGAGCCAGATTTGGAATTCGCCGTGGGGTGGTTCCCCTCTGGCAGTGAGTACCAGGCTTCTAGCTTTGTTTACGACCAACTGCATGTACCCTACCACTTTACTGGGCGCACTCCCCGCGCTTTCACCAGCAAGGGTGGAAAGGTATCTTTCGTGCTCCCTTGGAACTCTGTCTCTTCCGTGCTTCCCGTGCGCTGGGGGGGCGCCTCCAAGCTTTCTTCTGCCACGCGGGGTCT GCCGGCTCATGCTGACTGGGGGACCATTTACGCCTTTATCCCCCGTCCTAACG AGAAGAAAAGCACCGCTGTAAAGCACGTGGCGGTGTACGTTCGGTACAAGA ACGCGCGTGCCTGGTGCCCCAGCATGCTTCCCTTTCGCAGCTACAAGCAGAA GATGCTGATGCAA (SEQ ID NO: 7)

[0062] In an embodiment, one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 85% sequence identity to SEQ ID NO: 7. In an embodiment, one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 90% sequence identity to SEQ ID NO: 7. In an embodiment, one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 91% sequence identity to SEQ ID NO: 7. In an embodiment, one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 92% sequence identity to SEQ ID NO: 7. In an embodiment, one or more backbone sequence regions of SVA strain SD15-26 is a sequence having at least 93% sequence identity to SEQ ID NO: 7. In an embodiment, one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 94% sequence identity to SEQ ID NO: 7. In an embodiment, one or more backbone sequence regions of SVA strain SD15-26 is a sequence having at least 95% sequence identity to SEQ ID NO: 7. In an embodiment, one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 96% sequence identity to SEQ ID NO: 7. In an embodiment, one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 97% sequence identity to SEQ ID NO: 7. In an embodiment, one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 98% sequence identity to SEQ ID NO: 7. In an embodiment, one or more backbone sequence regions of SVA strain SD15-26 is a sequence having at least 99% sequence identity to SEQ ID NO: 7.

[0063] In an embodiment, one or more backbone sequence regions of SVA strain SD15-26 is a sequence having at least 80% sequence identity to SEQ ID NO: 8. SEQ ID NO: 8 refers to a backbone sequence region of SVA strain SD15-26 and is as follows:AATCCTAACGAGAACGACGACACCCCCGTCGACGAGGCGTTGGGTAGAGTTCTCACCCCCGCTGCGGTCGACGAGGCGCTTGTCGACCTCGCTCCAGATGCCGACCCGGTTGGCCGCTTGGCTATTCTCGCCAAGCTAGGTCTTGCCCTAGCTGCGGTCACCCCTGGTTTGATAATCTTGGCAGTGGGACTCTACAAGTACTTCTCTGGCTCTGATACAGACCAAGAAGAAACAGAAAGTGAGGAGCCTGCTAAAGCGCCTAGGAGCGAGAATGCTTATGATGGCCCGAAGAAAAACTCCAAGCCCCCTGGAGCGCTCTCTCTTATGGAAATGCAACAGCCCAACGTGGACATGGGCTTTGAGGCTGCAGTTGCTAAGAAAGTGGTCGTCCCCATTACCTTCATGGTTCCCAACAGACCTTCTGGACTTACACAGTCCGCTCTTCTTGTGGCCGGCCGGACCTTCCTAATCAATGAGCATACATGGTCCAACCCCTCCTGGACCAGCTTCACAATCCGTGGTGAGGTGCACACTCGTGATGAGCCTTTCCAAACGGTTCATTTTACTCACCATGGTCTTCCCACAGATCTGATGATGGTACGTCTCGGACCGGGCAACTCTTTCCCTAACAATCTAGACAAGTTTGGACTTGACCAGATGCCGGCACGTAACTCCCGTGTGGTTGGCGTTTCGGCTAGTTACGGTAACTTCTTCTTCTCTGGGAACTTCCTCGGGTTTGTTGACTCCATCACCTCTGACCAAGGAACCTATGCGAGACTTTTCAGGTACAGGGTGACGACTTACAAGGGATGGTGCGGTTCGGCCCTGGTCTGTGAGGCCGGTGGTGTCCGACGCATCATTGGCATGCATTCTGCTGGTGCCGCTGGTATCGGCGCCGGGACTTACATCTCAAAATTAGGACTGATCAAAGCCCTTAAACACCTCGGTGAGCCTCTGGCTACAATGCAAGGACTGATGACTGAGCTAGAGCCTGGAGTCACCGTACATGTACCCCGAAAATCTAAATTGAGAAAGACGACCGCACACGCGGTGTACAAACCGGAGTTTGAACCTGCTGTGTTGTCAAAATTTGATCCCAGACTGAACAAGGATGTTGACCTAGATGAGGTAATTTGGTCTAAACACACCGCCAACGTCCCTTATCAACCTCCTTTGTTCTACACATACATGTCAGAGTACGCTCATCGGGTTTTCTCCTTTTTGGGAAAAGACAATGACATTCTGACCGTCAAAGAAGCAATCCTGGGCATCCCTGGACTAGACCCTATGGATCCCCACACAGCTCCGGGTTTGCCCTACGCCATTAGCGGTCTTCGACGTACTGATCTCGTCGATTTTGCGAACGGCACGGTAGACCCGGCACTGGCCATGCAGATCCAGAAATTCTTAGACGGTGACTACTCTGATCATGTCTTCCAAACTTTTCTAAAAGATGAAATCAGACCCTCAGAGAAGGTCCGGGCGGGAAAAACCCGCATTGTCGATGTGCCCTCCCTGGC GCACTGCATTGTGGGCAGAATGCTGCTTGGGCGCTTTGCCGCCAAGTTTCAAT CCCATCCTGGCTTTCTCCTTGGCTCCGCTATCGGGTCTGACCCCGATGTCTTCT GGACCGTCATAGGGGCTCAGCTCGAGGGAAGAAAGAACACGTATGACGTGG ACTACAGTGCCTTTGACTCTTCACACGGCACTGGCTCCTTCGAGGCTCTCATC TCTCACTTTTTCACCGTGGACAATGGTTTCAGCCCTGCGCTGGGACCGTATCT CAGATCCCTGGCTGTCTCGGTGCACGCTTACGGCGAGCGTCGCATCAAGATT ACCGGAGGCCTCCCCTCTGGTTGTGCCGCGACCAGCCTGCTGAACACAGTGC TCAACAATGTGATCATCAGGACTGCTCTGGCATTGACCTACAAGGAATTTGA ATATGACATGGTTGATATCATCGCCTACGGTGACGACCTTCTGGTTGGTACGG ATTACGATCTGGACTTCAATGAGGTGGCGCGGCGCGCTGCCAAACTGGGGTA TAAGATGACTCCTGCCAACAAGGGTTCTGTCTTCCCTCCGACTTCCTCTCTCT CCGATGCTGTTTTTCTAAAACGCAAATTCGTCCAAAACAATGACGGCTTATAT AAACCAGTTATGGATTTAAAGAATTTGGAAGCCATGCTCTCCTACTTCAAACC AGGAACACTACTCGAGAAGCTGCAATCTGTTTCTATGTTGGCTCAACATTCTG GAAAAGAAGAATATGATAGATTGATGCACCCCTTCGCTGACTACGGTGCCGT ACCGAGTCACGAGTACCTGCAGGCAAGATGGAGGGCCTTGTTCGACTGACCT GGATAGCCCAACGCGCTTCGGTGCTGCCGGCGATTCTGGGAGAACCCAGTCGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO: 8)

[0064] In an embodiment, one or more backbone sequence regions of SVA strainSD15-26 is a sequence having at least 85% sequence identity to SEQ ID NO: 8. In an embodiment, one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 90% sequence identity to SEQ ID NO: 8. In an embodiment, one or more backbone sequence regions of SVA strain SD15-26 is a sequence having at least 91% sequence identity to SEQ ID NO: 8. In an embodiment, one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 92% sequence identity to SEQ ID NO: 8. In an embodiment, one or more backbone sequence regions of SVA strain SD15-26 is a sequence having at least 93% sequence identity to SEQ ID NO:8. In an embodiment, one or more backbone sequence regions of SVA strain SD15-26 is a sequence having at least 94% sequence identity to SEQ ID NO: 8. In an embodiment, one or more backbone sequence regions of SVA strain SD15-26 is a sequence having at least 95% sequence identity to SEQ ID NO: 8. In an embodiment, one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 96% sequence identity to SEQ ID NO: 8. In an embodiment, one or more backbone sequence regions of SVA strain SD15-26 is a sequence having at least 97% sequence identity to SEQ ID NO: 8. In an embodiment, one or more backbone sequence regions of SVA strain SD15-26 is a sequence having at least 98% sequence identity to SEQ ID NO: 8. In an embodiment, one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 99% sequence identity to SEQ ID NO: 8.

[0065] In an illustrative aspect, a third immunogenic composition is provided, wherein the third immunogenic composition comprises the nucleic acid sequence comprising an embodiment of SEQ ID NO: 2 is provided. In an illustrative aspect, a fourth immunogenic composition is provided, wherein the fourth immunogenic composition comprises the chimeric sequence comprising i) a P2 sequence region of SVA strain SVV-001 and ii) one or more sequence regions of SVA strain SD15-26 is provided. For instance, the P2 sequence region of SVA strain SVV-001 can be a sequence comprising an embodiment of SEQ ID NO: 6. For instance, the one or more sequence regions of SVA strain SD15-26 can be a sequence comprising an embodiment of SEQ ID NO: 7, a sequence comprising an embodiment of SEQ ID NO: 8, or both.

[0066] In an illustrative aspect, a third vaccine comprising the third immunogenic composition and one or more veterinary acceptable carriers is provided. In an illustrative aspect, a fourth vaccine comprising the fourth immunogenic composition and one or more veterinary acceptable carriers is provided. Veterinary acceptable carriers are well known to the skilled person.

[0067] In any of the methods described herein, the third vaccine comprising the third immunogenic composition and one or more veterinary acceptable carriers can be administered. In any of the methods described herein, the fourth vaccine comprising thefourth immunogenic composition and one or more veterinary acceptable carriers can be administered.

[0068] SEQ ID NO: 9 refers to the backbone sequence of SVA strain SD 15-26 and is as follows:GGTTTGAAAGGAAGGACTGGGCATGAGGGCCCAGTCCTTCCTTTCCCCTTCCGGGGGGTAAACCGGCTGTGTTTGCTAGAGGCACAGAGGAGCAACATCCAACCTGCTTTTGTGGGGAACGGTGCGGCTCCAATTCCTGCGTCGCCAAAGGTGTTAGCGCACCCAAACGGCGCATCTACCAATGCTATTGGTGTGGTCTGCGAGTTCTAGCCTACTCGTTTCTCCCCTACTCACTCATTCACACACAAAAACTGTGTTGTAACTACAAGATTTGGCCCTCGCACGGGATGTGCGATAACCGCAAGATTGACTCAAGCGCGGAAAGCGCTGTAACCACATGCTGTTAGTCCCTTTATGGCTGCGAGATGGCTATCCACCTCGGATCACTGAACTGGAGCTCGACCCTCCTTAGTAAGGGAACCGAGAGGCCTTCCTGCAACAAGCTCCGACACAGAGTCCACGTGATTGCTACCACCATGAGTACATGGTTCTCCCCTCTCGACCCAGGACTTCTTTTTGAATATCCACGGCTCGATCCAGAGGGTGGGGCATGATCCCCCTAGCATAGCGAGCTACAGCGGGAACTGTAGCTAGGCCTTAGCGTGCCTTGGATACTGCCTGATAGGGCGACGGCCTAGTCGTGTCGGTTCTATAGGTAGCACATACAAATATGCAGAACTCTCATTTTTCTTTCGATACAGCCTCTGGCACCTTTGAAGACGTAACCGGAACAAAAGTCAAGATCGTTGAATACCCCAGATCGGTGAACAATGGTGTTTACGATTCGTCCACTCATTTAGAGATACTGAACCTACAGGGTGAAATTGAAATTTTAAAGTCTTTCAACGAATACCAAATTCGCGCCGCCAAACAACAACTTGGACTGGACATCGTATACGAACTACAGGGTAATGTTCAGACAACCTCAAAGAATGATTTTGATTCCCGAGGCAATAATGGTAACATGACCTTCAATTACTACGCAAACACTTACCAGAATTCAGTAGACTTCTCGACCTCCTCGTCGGCGTCAGGCGCCGGACCCGGGAACTCCCGGGGCGGATTAGCGGGTCTCCTCACAAATTTCAGTGGAATCTTGAACCCTCTTGGCTACCTCAAAGATCACAATACCGAAGAAATGGAAAACTCTGCTGATCGAGTCATAACGCAAACGGCGGGCAACACTGCCATAAACACGCAATCATCACTGGGTGTGTTGTGTGCCTACGTTGAAGACCCGACCAAATCTGACCCTC CGTCCAGCAGCACAGATCAACCCACCACCACTTTTACTGCCATCGACAGGTGGTACACTGGACGCCTCAATTCTTGGACAAAAGCTGTAAAAACCTTCTCTTTTCAGGCCGTCCCGCTCCCTGGAGCCTTCCTGTCTAGACAGGGAGGCCTCAACGGAGGGGCCTTCACGGCCACCCTACATAGACATTTCTTAATGAAGTGCGGGTGGCAGGTGCAGGTTCAATGCAATTTGACGCAATTCCACCAAGGTGCTCTTCTTGTTGCCATGGTCCCCGAAACCACCCTTGATGTCAAACCTGACGGCAAGGCAAAGAGCTTACAGGAGCTGAATGAAGAGCAGTGGGTGGAAATGTCTGACGACTACCGGACCGGGAAAAACATGCCTTTTCAGTCTCTTGGTACATACTACCGACCCCCTAACTGGACTTGGGGCCCCAATTTCATCAACCCCTATCAAGTAACAGTTTTCCCACACCAAATTCTGAACGCGAGAACCTCTACCTCGGTAGACATAAGTGTCCCGTACATCGGGGAGACTCCTACACAATCCTCAGAGACACAGAACTCCTGGACCCTCCTTGTTATGGTGCTTGTCCCCCTGGACTACAAGGAGGGAGCCACAACTGACCCAGAAATTACATTTTCTGTAAGGCCTACAAGTCCCTACTTCAATGGGCTTCGTAACCGTTTCACGACCGGGACGGACGAGGAACAGGGGCCCATTCCCACAGCACCCAGAGAAAATTCGCTTATGTTTCTCTCAACCATCCCTGATGACACTGTTCCTGCTTACGGGAATGTGCGTACCCCTCCCGTCAATTACCTCCCCGGTGAAATAACCGACCTCTTACAACTGGCCCGTATACCCACTCTCATGGCGTTTGGGCGGGCGTCCGAACCCGAGCCTGCCTCAGACGCATATGTGCCCTACGTTGCCGTTCCTGCCCAGTTCGACGACAAGCCTCTCATCTCCTTCCCGATCACCCTTTCAGATCCTGTCTACCAGAACACTCTGGTAGGCGCCATCAGTTCGAACTTCGCCAACTACCGGGGGTGTATCCAAATCACTTTGACATTTTGTGGACCCATGATGGCAAGAGGGAAATTCCTGCTCTCGTATTCTCCCCCAAATGGAGCACAACCACAGACCCTTTCTGAAGCTATGCAGTGCACATACTCTATTTGGGATATAGGCTTGAACTCTAGTTGGACCTTTGTCATCCCCTACATCTCGCCCAGTGATTACCGTGAAACTCGGGCTATTACCAACTCAGTTTATTCTGCTGATGGTTGGTTTAGCTTGCACAAGCTGACCAAAATTACTCTACCACCTGACTGCCCGCAGAGTCCCTGTATTCTCTTTTTCGCCTCTGCTGGTGAGGATTACACCCTCCGTCTCCCTGTTGATTGTAATCCTTCCTACGTGTTCCACTCCACCGACAACGCCGAGACTGGGGTTATTGAGGCAGGTAACACTGACACCGATTTTTCTGGTGAACTGGCGGCTCCTGGCTCTAACCATACTAATGTCAAATTCCTGTTTGACCGATCTCGACTACTGAATGTAATTAAGGTACTGGAGAAGGACGCCGTCTTCCCCCGTCCTTTCCCCACAGCAACAGGTGCACAGCAGGACGATGGTTACTTTTGTCTTCTAACACCCCGCCCAACAGTCGCTTCCCGACCCGCCACTCGTTTCGGCCTGTACGTCAACCCGTCTGACAGTGGCGTTCTCGCTAACACTTCACTGGATTTCAATTTTTACAGTTTGGCCTGTTTCACTTACTTTAGATCAGACCTTGAAGTCACGGTGGTCTCACTGGAGCCAGATTTGGAATTCGCCGTGGGGTGGTTCCCCTCTGGCAGTGAGTACCAGGCTTCTAGCTTTGTTTACGACCAACTGCATGTACCCTACCACTTTACTGGGCGCACTCCCCGCGCTTTCACCAGCAAGGGTGGAAAGGTATCTTTCGTGCTCCCTTGGAACTCTGTCTCTTCCGTGCTTCCCGTGCGCTGGGGGGGCGCCTCCAAGCTTTCTTCTGCCACGCGGGGTCTGCCGGCTCATGCTGACTGGGGGACCATTTACGCCTTTATCCCCCGTCCTAACGAGAAGAAAAGCACCGCTGTAAAGCACGTGGCGGTGTACGTTCGGTACAAGAACGCGCGTGCCTGGTGCCCCAGCATGCTTCCCTTTCGCAGCTACAAGCAGAAGATGCTGATGCAATCAGGCGACGTCGAGACCAACCCTGGCCCTGCTTCTGACAACCCGATCTTGGAGTTTCTTGAAGCGGAAAACGATCTAGTCACTCTGGCCTCTCTCTGGAAGATGGTACACTCTGTTCAACAGACCTGGAGAAAGTATGTGAAGAACGACAATTTTTGGCCCAACTTGCTCAGTGAGCTAGTGGGGGAAGGCTCCATCGCCTTGGCCGCCACGCTATCTAACCAAGCTTCAGTGAAAGCTCTCTTGGGCCTGCATTTTCTCTCTCGAGGGCTCAATTACACAGATTTTTACTCTTTACTGATAGAGAAATGCTCTAGTTTCTTTACTGTAGAACCGCCTCCTCCACCAGCTGAAAATCTGATGACCAAGCCCTCCGTGAAGTCGAAATTCCGAAAGCTGTTTAAGATGCAAGGACCCATGGACACAGTCAAAGACTGGAACCAAATAGCCGCCGGCTTGAAGAATTTCCAATTTGTTCGTGACCTAGTCAAAGAGGTGGTCGACTGGCTCCAGGCCTGGATCAATAAAGAGAAAGCCAGCCCTGTCCTCCAGTACCAGCTGGAGATGAAGAAGCTCGGGCCCGTGGCTTTGGCTCATGATGCCTTCATGGCCGGTTCCGGGCCCCCTCTTGGTGACGACCAGATTGAATACCTCCAGAACCTCAAATCTCTTGCCCTAACACTGGGAAAGACTAATTTGGCCCAAAGTCTCACCACTATGATCAATGCCAAGCAGAGCTCCGCCCAACGAGTCGAACCCGTTGTGGTGGTCCTCAGAGGCAAGCCGGGATGCGGCAAAAGCTTGGCCTCCACGTTGATTGCCCAGGCTGTGTCCAAGCGTCTCTACGGCTCGCAAAGTGTGTATTCTCTTCCTCCGGACCCAGACTTCTTCGACGGATATAAAGGACAGTTTGTAACCTTGATGGACGATCTGGGACAAAACCCGGATGGGCAAGATTTCTCCACCTTTTGTCAGATGGTGTCGACCGCCCAATTTCTTCCCAACATGGCGGACCTTGCAGAGAAGGGGCGTCCCTTCACCTCCAATCTTATCATTGCAACTACAAACCTCCCTCACTTTAGCCCTGTCACCATTGCTGATCCTTCTGCAGTCTCTCGGCGTATCAACTACGACCTGACTCTAGAAGTATCTGAGGCCTACAAGAAGCACACACGGCTGAATTTCGACCTGGCTTTCAGACGCACTGACGCCCCCCCCATTTATCCTTTTGCTGCCCATGTGCCCTTCGTGGACGTGGCTGTGCGCTTCAAAAATGGTCATCAAAGCTTCAATCTCCTAGAGTTGGTCGACTCCATTTGTGCAGACATTCGGGCCAAGCAACAAGGTGCCCGAAATATGCAGACTCTGGTTCTACAGAATCCTAACGAGAACGACGACACCCCCGTCGACGAGGCGTTGGGTAGAGTTCTCACCCCCGCTGCGGTCGACGAGGCGCTTGTCGACCTCGCTCCAGATGCCGACCCGGTTGGCCGCTTGGCTATTCTCGCCAAGCTAGGTCTTGCCCTAGCTGCGGTCACCCCTGGTTTGATAATCTTGGCAGTGGGACTCTACAAGTACTTCTCTGGCTCTGATACAGACCAAGAAGAAACAGAAAGTGAGGAGCCTGCTAAAGCGCCTAGGAGCGAGAATGCTTATGATGGCCCGAAGAAAAACTCCAAGCCCCCTGGAGCGCTCTCTCTTATGGAAATGCAACAGCCCAACGTGGACATGGGCTTTGAGGCTGCAGTTGCTAAGAAAGTGGTCGTCCCCATTACCTTCATGGTTCCCAACAGACCTTCTGGACTTACACAGTCCGCTCTTCTTGTGGCCGGCCGGACCTTCCTAATCAATGAGCATACATGGTCCAACCCCTCCTGGACCAGCTTCACAATCCGTGGTGAGGTGCACACTCGTGATGAGCCTTTCCAAACGGTTCATTTTACTCACCATGGTCTTCCCACAGATCTGATGATGGTACGTCTCGGACCGGGCAACTCTTTCCCTAACAATCTAGACAAGTTTGGACTTGACCAGATGCCGGCACGTAACTCCCGTGTGGTTGGCGTTTCGGCTAGTTACGGTAACTTCTTCTTCTCTGGGAACTTCCTCGGGTTTGTTGACTCCATCACCTCTGACCAAGGAACCTATGCGAGACTTTTCAGGTACAGGGTGACGACTTACAAGGGATGGTGCGGTTCGGCCCTGGTCTGTGAGGCCGGTGGTGTCCGACGCATCATTGGCATGCATTCTGCTGGTGCCGCTGGTATCGGCGCCGGGACTTACATCTCAAAATTAGGACTGATCAAAGCCCTTAAACACCTCGGTGAGCCTCTGGCTACAATGCAAGGACTGATGACTGAGCTAGAGCCTGGAGTCACCGTACATGTACCCCGAAAATCTAAATTGAGAAAGACGACCGCACACGCGGTGTACAAACCGGAGTTTGAACCTGCTGTGTTGTCAAAATTTGATCCCAGACTGAACAAGGATGTTGACCTAGATGAGGTAATTTGGTCTAAACACACCGCCAACGTCCCTTATCAACCTCCTTTGTTCTACACATACATGTCAGAGTACGCTCATCGGGTTTTCTCCTTTTTGGGAAAAGACAATGACATTCTGACCGTCAAAGAAGCAATCCTGGGCATCCCTGGACTAGACCCTATGGATCCCCACACAGCTCCGGGTTTGCCCTACGCCATTAGCGGTCTTCGACGTACTGATCTCGTCGATTTTGCGAACGGCACGGTAGACCCGGCACTGGCCATGCAGATCCAGAAATTCTTAGACGGTGACTACTCTGATCATGTCTTCCAAACTTTTCTAAAAGATGAAATCAGACCCTCAGAGAAGGTCCGGGCGGGAAAAACCCGCATTGTCGATGTGCCCTCCCTGGCGCACTGCATTGTGGGCAGAATGCTGCTTGGGCGCTTTGCCGCCAAGTTTCAATCCCATCCTGGCTTTCTCCTTGGCTCCGCTATCGGGTCTGACCCCGATGTCTTCTGGACCGTCATAGGGGCTCAGCTCGAGGGAAGAAAGAACACGTATGACGTGGACTACAGTGCCTTTGACTCTTCACACGGCACTGGCTCCTTCGAGGCTCTCATCTCTCACTTTTTCACCGTGGACAATGGTTTCAGCCCTGCGCTGGGACCGTATCTCAGATCCCTGGCTGTCTCGGTGCACGCTTACGGCGAGCGTCGCATCAAGATTACCGGAGGCCTCCCCTCTGGTTGTGCCGCGACCAGCCTGCTGAACACAGTGCTCAACAATGTGATCATCAGGACTGCTCTGGCATTGACCTACAAGGAATTTGAATATGACATGGTTGATATCATCGCCTACGGTGACGACCTTCTGGTTGGTACGGATTACGATCTGGACTTCAATGAGGTGGCGCGGCGCGCTGCCAAACTGGGGTATAAGATGACTCCTGCCAACAAGGGTTCTGTCTTCCCTCCGACTTCCTCTCTCTCCGATGCTGTTTTTCTAAAACGCAAATTCGTCCAAAACAATGACGGCTTATATAAACCAGTTATGGATTTAAAGAATTTGGAAGCCATGCTCTCCTACTTCAAACCAGGAACACTACTCGAGAAGCTGCAATCTGTTTCTATGTTGGCTCAACATTCTGGAAAAGAAGAATATGATAGATTGATGCACCCCTTCGCTGACTACGGTGCCGTACCGAGTCACGAGTACCTGCAGGCAAGATGGAGGGCCTTGTTCGACTGACCTGGATAGCCCAACGCGCTTCGGTGCTGCCGGCGATTCTGGGAGAACCCAGTCGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO: 9)

[0069] The following numbered embodiments are contemplated and are nonlimiting:1. A nucleic acid sequence comprising a sequence having at least 80% sequence identity to SEQ ID NO: 1.2. The nucleic acid sequence of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the sequence has at least 85% sequence identity to SEQ ID NO: 1.3. The nucleic acid sequence of clause 1 , any other suitable clause, or any combination of suitable clauses, wherein the sequence has at least 90% sequence identity to SEQ ID NO: 1.4. The nucleic acid sequence of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the sequence has at least 91% sequence identity to SEQ ID NO: 1.5. The nucleic acid sequence of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the sequence has at least 92% sequence identity to SEQ ID NO: 1.6. The nucleic acid sequence of clause 1 , any other suitable clause, or any combination of suitable clauses, wherein the sequence has at least 93% sequence identity to SEQ ID NO: 1.7. The nucleic acid sequence of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the sequence has at least 94% sequence identity to SEQ ID NO: 1.8. The nucleic acid sequence of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the sequence has at least 95% sequence identity to SEQ ID NO: 1.9. The nucleic acid sequence of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the sequence has at least 96% sequence identity to SEQ ID NO: 1.10. The nucleic acid sequence of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the sequence has at least 97% sequence identity to SEQ ID NO: 1.11. The nucleic acid sequence of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the sequence has at least 98% sequence identity to SEQ ID NO: 1.12. The nucleic acid sequence of clause 1, any other suitable clause, or any combination of suitable clauses, wherein the sequence has at least 99% sequence identity to SEQ ID NO: 1.13. A chimeric sequence comprising i) a Pl sequence region of SVA strain SVV-001 and ii) one or more backbone sequence regions of SVA strain SD 15-26.14. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein the Pl sequence region of SVA strain SVV-001 is a sequence having at least 80% sequence identity to SEQ ID NO: 3.15. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein the Pl sequence region of SVA strain SVV-001 is a sequence having at least 85% sequence identity to SEQ ID NO: 3.16. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein the Pl sequence region of SVA strain SVV-001 is a sequence having at least 90% sequence identity to SEQ ID NO: 3.17. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein the Pl sequence region of SVA strain SVV-001 is a sequence having at least 91% sequence identity to SEQ ID NO: 3.18. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein the Pl sequence region of SVA strain SVV-001 is a sequence having at least 92% sequence identity to SEQ ID NO: 3.19. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein the Pl sequence region of SVA strain SVV-001 is a sequence having at least 93% sequence identity to SEQ ID NO: 3.20. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein the Pl sequence region of SVA strain SVV-001 is a sequence having at least 94% sequence identity to SEQ ID NO: 3.21. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein the Pl sequence region of SVA strain SVV-001 is a sequence having at least 95% sequence identity to SEQ ID NO: 3.22. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein the Pl sequence region of SVA strain SVV-001 is a sequence having at least 96% sequence identity to SEQ ID NO: 3.23. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein the Pl sequence region of SVA strain SVV-001 is a sequence having at least 97% sequence identity to SEQ ID NO: 3.24. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein the Pl sequence region of SVA strain SVV-001 is a sequence having at least 98% sequence identity to SEQ ID NO: 3.25. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein the Pl sequence region of SVA strain SVV-001 is a sequence having at least 99% sequence identity to SEQ ID NO: 3.26. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15- 26 is a sequence having at least 80% sequence identity to SEQ ID NO: 4.27. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15- 26 is a sequence having at least 85% sequence identity to SEQ ID NO: 4.28. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15- 26 is a sequence having at least 90% sequence identity to SEQ ID NO: 4.29. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15- 26 is a sequence having at least 91% sequence identity to SEQ ID NO: 4.30. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15- 26 is a sequence having at least 92% sequence identity to SEQ ID NO: 4.31. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15- 26 is a sequence having at least 93% sequence identity to SEQ ID NO: 4.32. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15- 26 is a sequence having at least 94% sequence identity to SEQ ID NO: 4.33. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15- 26 is a sequence having at least 95% sequence identity to SEQ ID NO: 4.34. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15- 26 is a sequence having at least 96% sequence identity to SEQ ID NO: 4.35. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15- 26 is a sequence having at least 97% sequence identity to SEQ ID NO: 4.36. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15- 26 is a sequence having at least 98% sequence identity to SEQ ID NO: 4.37. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15- 26 is a sequence having at least 99% sequence identity to SEQ ID NO: 4.38. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15- 26 is a sequence having at least 80% sequence identity to SEQ ID NO: 5.39. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15- 26 is a sequence having at least 85% sequence identity to SEQ ID NO: 5.40. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15- 26 is a sequence having at least 90% sequence identity to SEQ ID NO: 5.41. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15- 26 is a sequence having at least 91% sequence identity to SEQ ID NO: 5.42. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15- 26 is a sequence having at least 92% sequence identity to SEQ ID NO: 5.43. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15- 26 is a sequence having at least 93% sequence identity to SEQ ID NO: 5.44. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15- 26 is a sequence having at least 94% sequence identity to SEQ ID NO: 5.45. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15- 26 is a sequence having at least 95% sequence identity to SEQ ID NO: 5.46. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15- 26 is a sequence having at least 96% sequence identity to SEQ ID NO: 5.47. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15- 26 is a sequence having at least 97% sequence identity to SEQ ID NO: 5.48. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15- 26 is a sequence having at least 98% sequence identity to SEQ ID NO: 5.49. The chimeric sequence of clause 13, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15- 26 is a sequence having at least 99% sequence identity to SEQ ID NO: 5.50. An immunogenic composition comprising the nucleic acid sequence of any one of clauses 1 to 12.51. An immunogenic composition comprising the chimeric sequence of any one of clauses 13 to 49.52. An immunogenic composition comprising the nucleic acid sequence of any one of clauses 148 to 159.53. An immunogenic composition comprising the chimeric sequence of any one of clauses 160 to 196.54. A vaccine comprising the immunogenic composition of clause 50 and one or more veterinary acceptable carriers.55. A vaccine comprising the immunogenic composition of clause 51 and one or more veterinary acceptable carriers.56. A vaccine comprising the immunogenic composition of clause 52 and one or more veterinary acceptable carriers.57. A vaccine comprising the immunogenic composition of clause 53 and one or more veterinary acceptable carriers.58. A method of preventing disease in an animal, the method comprising the step of administering a vaccine to the animal wherein the vaccine provides an immunomodulatory benefit to Senecavirus A (SVA) to the animal.59. The method of clause 58, any other suitable clause, or any combination of suitable clauses, wherein the vaccine is the vaccine of claim 54.60. The method of clause 58, any other suitable clause, or any combination of suitable clauses, wherein the vaccine is the vaccine of claim 55.61. The method of clause 58, any other suitable clause, or any combination of suitable clauses, wherein the vaccine is the vaccine of claim 56.62. The method of clause 58, any other suitable clause, or any combination of suitable clauses, wherein the vaccine is the vaccine of claim 57.63. The method of clause 58, any other suitable clause, or any combination of suitable clauses, wherein the animal is a pig.64. The method of clause 58, any other suitable clause, or any combination of suitable clauses, wherein the immunomodulatory benefit comprises a decrease in lesion formation on the animal.65. The method of clause 64, any other suitable clause, or any combination of suitable clauses, wherein the decrease in lesion formation is observed on one or more feet of the animal.66. The method of clause 64, any other suitable clause, or any combination of suitable clauses, wherein the decrease in lesion formation is observed on a snout of the animal.67. The method of clause 64, any other suitable clause, or any combination of suitable clauses, wherein the decrease in lesion formation is observed on a coronary band of the animal.68. The method of clause 64, any other suitable clause, or any combination of suitable clauses, wherein the decrease in lesion formation is observed on a sole of the animal.69. The method of clause 64, any other suitable clause, or any combination of suitable clauses, wherein the decrease in lesion formation is observed on a dewclaw of the animal.70. The method of clause 58, any other suitable clause, or any combination of suitable clauses, wherein the immunomodulatory benefit comprises an increase in neutralizing antibody (NA) in the animal.71. The method of clause 58, any other suitable clause, or any combination of suitable clauses, wherein the immunomodulatory benefit comprises a decrease in SVA RNA in the animal.72. The method of clause 58, any other suitable clause, or any combination of suitable clauses, wherein the immunomodulatory benefit comprises a decrease in SVA infectious virus in the animal.73. The method of clause 58, any other suitable clause, or any combination of suitable clauses, wherein the immunomodulatory benefit comprises a decrease in SVA RNA one or more mesenteric lymph nodes of the animal.74. The method of clause 58, any other suitable clause, or any combination of suitable clauses, wherein the immunomodulatory benefit comprises a decrease in SVA RNA one or more mediastinal lymph nodes of the animal.75. The method of clause 58, any other suitable clause, or any combination of suitable clauses, wherein the vaccine is administered as a single dose to the animal.76. The method of clause 58, any other suitable clause, or any combination of suitable clauses, wherein the vaccine is administered as via multiple doses to the animal.77. The method of clause 58, any other suitable clause, or any combination of suitable clauses, wherein the vaccine is administered to the animal via a parenteral administration.78. The method of clause 77, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is selected from the group consisting of intravenous, intraarterial, intraperitoneal, intrathecal, intradermal, epidural, intracerebroventricular, intraurethral, intrastemal, intracranial, intratumoral, intramuscular and subcutaneous.79. The method of clause 77, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is intravenous.80. The method of clause 77, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is intraarterial.81. The method of clause 77, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is intraperitoneal.82. The method of clause 77, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is intrathecal.83. The method of clause 77, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is intradermal.84. The method of clause 77, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is epidural.85. The method of clause 77, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is intraurethral.86. The method of clause 77, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is intrasternal.87. The method of clause 77, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is intracranial.88. The method of clause 77, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is intratumoral.89. The method of clause 77, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is intramuscular.90. The method of clause 77, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is subcutaneous.91. The method of clause 58, any other suitable clause, or any combination of suitable clauses, wherein the vaccine is administered to the animal via an intranasal administration.92. A method of preventing a Senecavirus A (SVA) infection in an animal, the method comprising the step of administering a vaccine to the animal in need thereof, wherein the vaccine provides prevention of the SVA infection in the animal.93. The method of clause 92, any other suitable clause, or any combination of suitable clauses, wherein the vaccine is the vaccine of claim 54.94. The method of clause 92, any other suitable clause, or any combination of suitable clauses, wherein the vaccine is the vaccine of claim 55.95. The method of clause 92, any other suitable clause, or any combination of suitable clauses, wherein the vaccine is the vaccine of claim 56.96. The method of clause 92, any other suitable clause, or any combination of suitable clauses, wherein the vaccine is the vaccine of claim 57.97. The method of clause 92, any other suitable clause, or any combination of suitable clauses, wherein the animal is a pig.98. The method of clause 92, any other suitable clause, or any combination of suitable clauses, wherein the method comprises a decrease in lesion formation on the animal.99. The method of clause 98, any other suitable clause, or any combination of suitable clauses, wherein the decrease in lesion formation is observed on one or more feet of the animal.100. The method of clause 98, any other suitable clause, or any combination of suitable clauses, wherein the decrease in lesion formation is observed on a snout of the animal.101. The method of clause 98, any other suitable clause, or any combination of suitable clauses, wherein the decrease in lesion formation is observed on a coronary band of the animal.102. The method of clause 98, any other suitable clause, or any combination of suitable clauses, wherein the decrease in lesion formation is observed on a sole of the animal.103. The method of clause 98, any other suitable clause, or any combination of suitable clauses, wherein the decrease in lesion formation is observed on a dewclaw of the animal.104. The method of clause 92, any other suitable clause, or any combination of suitable clauses, wherein the vaccine provides an increase in neutralizing antibody (NA) in the animal.105. The method of clause 92, any other suitable clause, or any combination of suitable clauses, wherein the vaccine provides a decrease in SVA RNA in the animal.106. The method of clause 92, any other suitable clause, or any combination of suitable clauses, wherein the vaccine provides a decrease in SVA infectious virus in the animal.107. The method of clause 92, any other suitable clause, or any combination of suitable clauses, wherein the vaccine provides a decrease in SVA RNA one or more mesenteric lymph nodes of the animal.108. The method of clause 92, any other suitable clause, or any combination of suitable clauses, wherein the vaccine provides a decrease in SVA RNA one or more mediastinal lymph nodes of the animal.109. The method of clause 92, any other suitable clause, or any combination of suitable clauses, wherein the vaccine is administered as a single dose to the animal.110. The method of clause 92, any other suitable clause, or any combination of suitable clauses, wherein the vaccine is administered as via multiple doses to the animal.111. The method of clause 92, any other suitable clause, or any combination of suitable clauses, wherein the vaccine is administered to the animal via a parenteral administration.112. The method of clause 111, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is selected from the group consisting of intravenous, intraarterial, intraperitoneal, intrathecal, intradermal, epidural, intracerebroventricular, intraurethral, intrastemal, intracranial, intratumoral, intramuscular and subcutaneous.113. The method of clause 111, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is intravenous.114. The method of clause 111, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is intraarterial.115. The method of clause 111, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is intraperitoneal.116. The method of clause 111, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is intrathecal.117. The method of clause 111, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is intradermal.118. The method of clause 111, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is epidural.119. The method of clause 111, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is intraurethral.120. The method of clause 111, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is intrasternal.121. The method of clause 111, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is intracranial.122. The method of clause 111, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is intratumoral.123. The method of clause 111, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is intramuscular.124. The method of clause 111, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is subcutaneous.125. The method of clause 92, any other suitable clause, or any combination of suitable clauses, wherein the vaccine is administered to the animal via an intranasal administration.126. A method of preventing a Senecavirus A (SVA) infection in an animal, the method comprising the step of administering a vaccine to the animal in need thereof, wherein the vaccine provides prevention of the SVA infection in the animal.127. The method of clause 126, any other suitable clause, or any combination of suitable clauses, wherein the vaccine is the vaccine of claim 54.128. The method of clause 126, any other suitable clause, or any combination of suitable clauses, wherein the vaccine is the vaccine of claim 55.129. The method of clause 126, any other suitable clause, or any combination of suitable clauses, wherein the vaccine is the vaccine of claim 56.130. The method of clause 126, any other suitable clause, or any combination of suitable clauses, wherein the vaccine is the vaccine of claim 57.131. The method of clause 126, any other suitable clause, or any combination of suitable clauses, wherein the vaccine is administered as a single dose to the animal.132. The method of clause 126, any other suitable clause, or any combination of suitable clauses, wherein the vaccine is administered as via multiple doses to the animal.133. The method of clause 126, any other suitable clause, or any combination of suitable clauses, wherein the vaccine is administered to the animal via a parenteral administration.134. The method of clause 133, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is selected from the group consisting of intravenous, intraarterial, intraperitoneal, intrathecal, intradermal, epidural, intracerebroventricular, intraurethral, intrastemal, intracranial, intratumoral, intramuscular and subcutaneous.135. The method of clause 133, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is intravenous.136. The method of clause 133, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is intraarterial.137. The method of clause 133, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is intraperitoneal.138. The method of clause 133, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is intrathecal.139. The method of clause 133, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is intradermal.140. The method of clause 133, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is epidural.141. The method of clause 133, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is intraurethral.142. The method of clause 133, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is intrastemal.143. The method of clause 133, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is intracranial.144. The method of clause 133, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is intratumoral.145. wherein the parenteral administration is intramuscular.146. The method of clause 133, any other suitable clause, or any combination of suitable clauses, wherein the parenteral administration is subcutaneous.147. The method of clause 126, any other suitable clause, or any combination of suitable clauses, wherein the vaccine is administered to the animal via an intranasal administration.148. A nucleic acid sequence comprising a sequence having at least 80% sequence identity to SEQ ID NO: 2.149. The nucleic acid sequence of clause 148, any other suitable clause, or any combination of suitable clauses, wherein the sequence has at least 85% sequence identity to SEQ ID NO: 2.150. The nucleic acid sequence of clause 148, any other suitable clause, or any combination of suitable clauses, wherein the sequence has at least 90% sequence identity to SEQ ID NO: 2.151. The nucleic acid sequence of clause 148, any other suitable clause, or any combination of suitable clauses, wherein the sequence has at least 91% sequence identity to SEQ ID NO: 2.152. The nucleic acid sequence of clause 148, any other suitable clause, or any combination of suitable clauses, wherein the sequence has at least 92% sequence identity to SEQ ID NO: 2.153. The nucleic acid sequence of clause 148, any other suitable clause, or any combination of suitable clauses, wherein the sequence has at least 93% sequence identity to SEQ ID NO: 2.154. The nucleic acid sequence of clause 148, any other suitable clause, or any combination of suitable clauses, wherein the sequence has at least 94% sequence identity to SEQ ID NO: 2.155. The nucleic acid sequence of clause 148, any other suitable clause, or any combination of suitable clauses, wherein the sequence has at least 95% sequence identity to SEQ ID NO: 2.156. The nucleic acid sequence of clause 148, any other suitable clause, or any combination of suitable clauses, wherein the sequence has at least 96% sequence identity to SEQ ID NO: 2.157. The nucleic acid sequence of clause 148, any other suitable clause, or any combination of suitable clauses, wherein the sequence has at least 97% sequence identity to SEQ ID NO: 2.158. The nucleic acid sequence of clause 148, any other suitable clause, or any combination of suitable clauses, wherein the sequence has at least 98% sequence identity to SEQ ID NO: 2.159. The nucleic acid sequence of clause 148, any other suitable clause, or any combination of suitable clauses, wherein the sequence has at least 99% sequence identity to SEQ ID NO: 2.160. A chimeric sequence comprising i) a P2 sequence region of SVA strain SVV-001 and ii) one or more backbone sequence regions of SVA strain SD 15-26.161. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein the P2 sequence region of SVA strain SVV-001 is a sequence having at least 80% sequence identity to SEQ ID NO: 6.162. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein the P2 sequence region of SVA strain SVV-001 is a sequence having at least 85% sequence identity to SEQ ID NO: 6.163. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein the P2 sequence region of SVA strain SVV-001 is a sequence having at least 90% sequence identity to SEQ ID NO: 6.164. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein the P2 sequence region of SVA strain SVV-001 is a sequence having at least 91% sequence identity to SEQ ID NO: 6.165. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein the P2 sequence region of SVA strain SVV-001 is a sequence having at least 92% sequence identity to SEQ ID NO: 6.166. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein the P2 sequence region of SVA strain SVV-001 is a sequence having at least 93% sequence identity to SEQ ID NO: 6.167. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein the P2 sequence region of SVA strain SVV-001 is a sequence having at least 94% sequence identity to SEQ ID NO: 6.168. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein the P2 sequence region of SVA strain SVV-001 is a sequence having at least 95% sequence identity to SEQ ID NO: 6.169. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein the P2 sequence region of SVA strain SVV-001 is a sequence having at least 96% sequence identity to SEQ ID NO: 6.170. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein the P2 sequence region of SVA strain SVV-001 is a sequence having at least 97% sequence identity to SEQ ID NO: 6.171. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein the P2 sequence region of SVA strain SVV-001 is a sequence having at least 98% sequence identity to SEQ ID NO: 6.172. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein the P2 sequence region of SVA strain SVV-001 is a sequence having at least 99% sequence identity to SEQ ID NO: 6.173. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 80% sequence identity to SEQ ID NO: 7.174. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 85% sequence identity to SEQ ID NO: 7.175. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15-26 is a sequence having at least 90% sequence identity to SEQ ID NO: 7.176. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15-26 is a sequence having at least 91% sequence identity to SEQ ID NO: 7.177. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15-26 is a sequence having at least 92% sequence identity to SEQ ID NO: 7.178. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15-26 is a sequence having at least 93% sequence identity to SEQ ID NO: 7.179. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15-26 is a sequence having at least 94% sequence identity to SEQ ID NO: 7.180. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 95% sequence identity to SEQ ID NO: 7.181. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 96% sequence identity to SEQ ID NO: 7.182. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 97% sequence identity to SEQ ID NO: 7.183. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 98% sequence identity to SEQ ID NO: 7.184. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15-26 is a sequence having at least 99% sequence identity to SEQ ID NO: 7.185. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15-26 is a sequence having at least 80% sequence identity to SEQ ID NO: 8.186. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15-26 is a sequence having at least 85% sequence identity to SEQ ID NO: 8.187. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15-26 is a sequence having at least 90% sequence identity to SEQ ID NO: 8.188. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15-26 is a sequence having at least 91% sequence identity to SEQ ID NO: 8.189. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 92% sequence identity to SEQ ID NO: 8.190. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 93% sequence identity to SEQ ID NO: 8.191. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 94% sequence identity to SEQ ID NO: 8.192. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 95% sequence identity to SEQ ID NO: 8.193. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15-26 is a sequence having at least 96% sequence identity to SEQ ID NO: 8.194. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15-26 is a sequence having at least 97% sequence identity to SEQ ID NO: 8.195. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15-26 is a sequence having at least 98% sequence identity to SEQ ID NO: 8.196. The chimeric sequence of clause 160, any other suitable clause, or any combination of suitable clauses, wherein one or more backbone sequence regions of SVA strain SD15-26 is a sequence having at least 99% sequence identity to SEQ ID NO: 8.EXAMPLESEXAMPLE 1Materials and Methods

[0070] Baby Hamster Kidney (BHK-21; ATCC® CCL-10) and NCI-H1299 nonsmall human lung carcinoma cell lines (ATCC® CRL-5803) were cultured at 37 °C with 5% CO2 in MEM (Coming®) or RPMI (Corning®) supplemented with 10% fetal bovine serum (FBS; VWR), penicillin / streptomycin (100 lU / mL; Corning®), gentamicin (50 ug / mL; Corning®) and 2mM L-glutamine (Coming®).

[0071] The SVA strain SD15-26 (Joshi et al., 2016), SVA strain SVV 001 (ATCC), and SVA strain MN-15-84-22 (Joshi et al., 2016) stocks were prepared at low passage and stored at -80 °C.EXAMPLE 2Generation and Analysis of Sequences / Immunogenic Compositions

[0072] The rSVA mSacII cDNA plasmid (Sharma et al., 2019) was used as the backbone for the construction of sequences described in the present disclosure. First, a sequence comprising the Pl (aa 667-3477) region of SVA strain SVV-001(NC_011349.1) and portions of SVA SD15-26 was created, also referred to herein as rSVA mSacII SVV 001 Pl. Second, a sequence comprising the P2 (aa 3478-4854) region of SVA strain SVV-001 (NC_011349.1) and portions of SVA SD15-26 was created, also referred to herein as rSVA mSacII SVV 001 P2. The sequence designs are summarized in Figs. 1A-1C.

[0073] Each cDNA fragment was synthesized (Biobasic) and flanked by unique restriction sites selected based on the sequences of both strains. Following digestion, the fragments were inserted into the cDNA clone plasmid, replacing the respective genomic regions.

[0074] Rescue of the sequences was performed according to previously established protocols and MiniOn platform (Nanopore) was employed to confirm the replacement of the targeted regions. A low passage stock of each sequence was obtained and stored at -80 °C.

[0075] Multiple or single-step growth curves were performed to evaluate the replication properties of SVA SD 15-26. H1299 cells were cultured in six-well plates and inoculated at multiplicities of infection (MOI) OF 0.1 and 10, respectively. The cells were harvested at multiple time points post-infection (e.g., 0, 4, 8, 12 and 24 hours).Virus titers were determined using Spearman and Karber’ s method, and the results were expressed as TCIDso / mL.Generation and growth kinetics of the sequences / imniunogenic compositions rSVA SacIISWOOl Pl andrSVA SacII SVV 001 P2

[0076] Both sequences / immunogenic compositions (rSVA mSacII SVV Pl and rSVA mSacII SVV P2) were successfully rescued via a protocol for recovering infectious clones. A replication kinetics study conducted in vitro using NCI-H1299 cells indicated that rSVA mSacII SVV Pl demonstrated a significant advantage in replication during the multiple-step growth curve observed between 8 and 24 hours post-infection when compared to rSVA mSacII SVV P2 and rSVA mSacII (Fig. 2A). This was also evident in the single-step growth curve at 8 and 12 hours post-infection (Fig. 2B). In contrast, rSVA mSacII SVV P2 exhibited lower titers than the others at both 8 and 24 hours postinfection in the single-step growth curve (Fig. 2B).EXAMPLE 3Analysis of Vaccines in Pigs

[0077] Twenty-four three-week-old piglets were randomly allocated into one of four experimental groups of six animals: i) mock control, ii) a vaccine including rSVA mSacII, iii) a vaccine including rSVA mSacII SVV Pl, or iv) a vaccine including rSVA mSacII SVV P2. The piglets were immunized on day 0 via the oronasal route with a suspension containing 107TCIDso / mL of live attenuated rSVA mSacII, rSVA mSacII SVV Pl or rSVA mSacII SVV P2 viruses. The control group received the same volume of RPMI media via the oronasal route.

[0078] A heterologous SVA strain, SVA MN- 15-84-22, which exhibits 97% nucleotide identity with SVA SD15-26 was utilized as the challenge virus on day 42 postimmunization (p.i .), corresponding to day 0 post-challenge (p.c.).

[0079] Animals were observed daily for any signs of illness or lesions during the experimental period. Blood samples were collected from animals on days 0, 3, 5, 7, 14, 21, 35, 42, 47, 49, and 56 p.i., and swabs (e.g., oral, nasal, and rectal / fecal) were collected on days 0, 3, 5, 7, 10, 14, 42, 45, 47, 49, 52, and 56 p.i. Animals wereeuthanized on day 56 p.i. and lymphoid tissues (e.g., tonsil, mesenteric lymph node, and mediastinal lymph node) were collected and stored at -80 °C until further processed. The experimental design is summarized in Fig. 3. rSVA mSacII SVV Pl and rSVA mSacII SW P2 are highly attenuated and safe in pigs

[0080] No clinical signs or lesions associated with Senecavirus A were observed in the pigs following immunization with the vaccines. SVA real-time reverse transcriptase PCR (RT-qPCR) analysis of serum revealed that all immunized groups, except the mock control group, experienced a small window of viremia from day 3 to 5 p.i. (see Fig. 4A).

[0081] Virus shedding was assessed in oral and nasal secretions, as well as in feces collected on days 0, 3, 5, 7, 10, and 14 p.i. using RT-qPCR and virus isolation / titration (Figs. 4B-4G). Notably, the rSVA mSacII SVV Pl group exhibited significantly lower viral shedding through nasal secretions compared to the rSVA mSacII group on days 3 to 7 p.i. by RT-qPCR, with only one positive animal (16.66%) on days 5, 7, and 14 p.i. (Fig. 4B). Similarly, infectious virus was recovered from nasal secretions in just one animal (16.66%) from the group on day 5 p.i. (Fig. 4E). SVA RNA and infectious virus were detected in the oral secretions and feces of animals between 3 to 7 days p.i. (see Figs. 4C, 4D, 4F, and 4G).

[0082] On day 3 p.i., the rSVA mSacII SVV P2 group showed a significantly lower amount of shedding as measured by rRT-PCR compared to the rSVA mSacII group, along with a reduced amount of infectious virus when compared to the rSVA mSacII SW Pl group. Decreased levels of infectious virus were also observed on day 5 p.i. in the rSVA mSacII SVV P2 group compared to the rSVA mSacII group.A single dose of any rSVA ntSaell-based vaccine protects against disease and induces a strong and long-lived antibody response

[0083] To evaluate the effectiveness of the vaccines, pigs in the vaccinated groups and the control group (which received RPMI) were challenged oronasally with theheterologous strain MN- 15-84-22 on day 42 p.i. (day 0 post challenge (p.c.)). After the challenge, pigs in the control group exhibited the onset of vesicular lesions starting on day 3 p.c., peaking on day 9 p.c. and enduring until the conclusion of the experimental period (Fig. 5A). The lesions were primarily localized on the feet, and affected the coronary band, sole, and dewclaw (Fig. 5B). In contrast, all vaccinated pigs exhibited a high level of protection with 100% of pig presenting no clinical signs or lesions (Fig. 5A).

[0084] The serological responses to immunization and post-challenge were evaluated using virus neutralization (VN) assays against SVA strains SD15-26, SVV 001 and MN-15-84-22 (Figs. 6A-6C). Serum samples were collected on days 0, 3, 5, 7, 14, 21, 35, 42 (0 p.c.), 47 (5 p.c.), 49 (7 p.c.), and 56 (14 p.c.) p.i. to assess protective antibody levels.

[0085] As shown in Figs. 6A, 6B, and 6C, all immunized animals began to seroconvert beginning on day 5 p.i. The peak levels of neutralizing antibodies (NA) prior to the challenge occurred on day 14 p.i. for all immunized groups, and these elevated NA levels remained until the end of the experiment (Figs. 6A-6C).

[0086] On day 14 p.i., the levels of NA in the rSVA mSacII and rSVA mSacII SVV P2 groups were significantly higher compared to the rSVA mSacII SVV Pl group when tested with the SVA strain SD 15-26 (Fig. 6A). Similarly, when evaluating the other contemporary strain MN-15-84-22, the rSVA mSacII SVV 001 group exhibited significantly lower levels of NA compared to rSVA mSacII SVV 001 P2 group on day 14 p.i., and also compared to both rSVA mSacII and rSVA mSacII SVV P2 groups on day 21 p.i. (Fig. 6C). While the mock control group rapidly seroconverted after the challenge (day 47 p.i , / 5 p.c.), all immunized groups only showed a slight increase in NA levels (Figs. 6A-6C).EXAMPLE 4SVA Isolation and Analysis Following Administration of Vaccines

[0087] Viral RNA was extracted from serum, swab samples, and lymphoid tissues using the MagMax Core extraction kit (Thermo Fisher) in conjunction with the automated KingFisher Flex nucleic acid extractor (Thermo Fisher). All samples contained the VetMAX™ Xeno™ Internal Positive Control - VIC™ Assay (Applied Biosystems™) to provide effective nucleic acid extraction and to check for any PCR inhibitors. Real-time reverse transcriptase PCR (rRT-PCR) was carried out with the RNA-to-Ct™ 1 Step Kit (Applied Biosystems™) and custom-designed primers and probes (PrimeTime qPCR probe assays, Integrated DNA Technologies Inc., USA) that specifically target the SVA 3D gene.

[0088] To establish a standard curve, ten-fold serial dilutions of the SVA SD15- 26 virus stock (108TCIDso / mL) were made, ranging from 10-1to 10‘8. The relative levels of viral genome copies were determined using this standard curve, with the results reported as log 10 (genome copy number) / mL.

[0089] Swab samples that tested positive for SVA via rRT-PCR underwent virus isolation and titration. Briefly, NCI-H1299 cells were seeded in 24-well plates approximately 24 hours before inoculating the samples, then 100 microliters of each sample were inoculated into the monolayers of confluent cells. Following three blind passages, IFA was conducted to verify the presence of infectious virus. At the same time, virus titrations were performed using an endpoint limiting dilution method along with IFA. The viral titers were calculated using the Spearman and Karber method and reported as TCIDso / mL.

[0090] The assessment of neutralizing antibody responses to SVA SD 15-26, SVA SVV-001, and the challenged virus SVA MN- 15-84-22 was conducted through virus neutralization assays. Neutralizing antibodies (NA) titers were reported as the reciprocal of the highest serum dilution that completely inhibited SVA replication, indicated by the absence of fluorescence following IFA staining. rSVA mSacII-based vaccines reduce viral shedding to a nearly sterile condition

[0091] Real-time reverse transcriptase PCR (RT-qPCR) was used to measure viremia levels in serum after challenge with SVA. Notably, the challenged mock control group exhibited viremia from days 3 to 7 p.c., while all immunized groups tested negative for SVA RNA on all sampled days (see Fig. 7A). Nasal, oral, and rectal swabs were collected on days 0, 3, 5, 7, 10, and 14 p.c. and were analyzed using RT-qPCR and virus isolation / titration to assess virus shedding.

[0092] All immunized groups presented significantly lower virus shedding in nasal secretions compared to the challenged mock control group from day 3 to 14 p.c. (Fig. 7B). Specifically, SVA RNA was detected in nasal secretions of the immunized group rSVA mSacII SVV Pl only on day 5 p.c., and in group rSVA mSacII SVV P2 on day 7 p.c. (Fig. 7B). Virus shedding in oral secretions also was significantly decreased on day 3 p.c. in the rSVA mSacII and rSVA mSacII SVV P2 groups, and on days 5, 7, and 14 p.c. in all immunized groups compared to the challenged mock control group (Fig. 7C).

[0093] In feces, SVA RNA was detected from days 3 to 14 p.c. in the challenged mock control group, while only one animal (16.66%) of group rSVA mSacII SVV Pl tested positive on day 7 p.c. (Fig. 7D). No infectious virus was recovered from the immunized animals. In contrast, infectious virus was recovered from the challenged mock control group on days 3 to 7 p.c. in both nasal and oral secretions, and on days 3 and 5 p.c. in feces (Figs. 7E-7G).Immunization using the chimeric vaccine significantly decreases the presence of Senecavirus A in the lymphoid tissues

[0094] Senecavirus A typically can be found in the lymphoid tissue after infection, particularly in the tonsil, which is a known site of viral persistence. To assess the presence of SVA RNA in the tonsil, mesenteric and mediastinal lymph nodes, these tissues were collected after the end of the experimental period and tested by rRT-PCR (Figs. 8A-8C). Surprisingly, the rSVA mSacII SVV Pl and rSVA mSacII SVV P2 groups demonstrated significantly fewer animals that tested positive for SVA RNA, withonly one animal that was positive (16.66%), compared to four animals (66.66%) that were positive in the challenged mock control group (Fig. 8A). The rSVA mSacII group showed three animals (50%) that were positive for SVA RNA (Fig. 8A).

[0095] All animals that were immunized with rSVA-based vaccines tested negative for SVA RNA in the mesenteric lymph nodes, and just one animal (16.66%) was positive in the mediastinal lymph node in the rSVA mSacII SVV P2 group, contrasting with three (50%) and four (66.66%), respectively, positives in the challenged mock control group (Figs. 8B and 8C).

Claims

1. CLAIMS1. A nucleic acid sequence comprising a sequence having at least 80% sequence identity to SEQ ID NO: 1.

2. The nucleic acid sequence of claim 1, wherein the sequence has at least 95% sequence identity to SEQ ID NO: 1.

3. The nucleic acid sequence of claim 1, wherein the sequence comprises SEQ ID NO: 1.

4. A chimeric sequence comprising i) a Pl sequence region of SVA strain SVV-001 and ii) one or more sequence regions of SVA strain SD 15-26.

5. The chimeric sequence of claim 4, wherein the Pl sequence region of SVA strain SVV-001 is a sequence having at least 95% sequence identity to SEQ ID NO: 3.

6. The chimeric sequence of claim 4, wherein one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 95% sequence identity to SEQ ID NO: 4.

7. The chimeric sequence of claim 4, wherein one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 95% sequence identity to SEQ ID NO: 5.

8. An immunogenic composition comprising the nucleic acid sequence of claim 3.

9. An immunogenic composition comprising the chimeric sequence of claim 4.

10. A vaccine comprising the immunogenic composition of claim 8 and one or more veterinary acceptable carriers.

11. A vaccine comprising the immunogenic composition of claim 9 and one or more veterinary acceptable carriers.

12. A method of preventing disease in an animal, the method comprising the step of administering a vaccine to the animal wherein the vaccine provides an immunomodulatory benefit to Senecavirus A (SVA) to the animal.

13. The method of claim 12, wherein the vaccine is the vaccine of claim10.

14. The method of claim 12, wherein the vaccine is the vaccine of claim11.

15. The method of claim 12, wherein the animal is a pig.

16. The method of claim 12, wherein the immunomodulatory benefit comprises a decrease in lesion formation on the animal.

17. The method of claim 16, wherein the decrease in lesion formation is observed on one or more feet of the animal.

18. The method of claim 12, wherein the immunomodulatory benefit comprises an increase in neutralizing antibody (NA) in the animal.

19. The method of claim 12, wherein the immunomodulatory benefit comprises a decrease in SVA RNA in the animal.

20. The method of claim 12, wherein the immunomodulatory benefit comprises a decrease in SVA infectious virus in the animal.

21. The method of claim 12, wherein the vaccine is administered as a single dose to the animal.

22. The method of claim 12, wherein the vaccine is administered to the animal via a parenteral administration.

23. The method of claim 22, wherein the parenteral administration is intramuscular.

24. The method of claim 12, wherein the vaccine is administered to the animal via an intranasal administration.

25. A method of preventing a Senecavirus A (SVA) infection in an animal, the method comprising the step of administering a vaccine to the animal in need thereof, wherein the vaccine provides prevention of the SVA infection in the animal.

26. The method of claim 25, wherein the vaccine is the vaccine of claim10.

27. The method of claim 25, wherein the vaccine is the vaccine of claim11.

28. The method of claim 25, wherein the animal is a pig.

29. The method of claim 25, wherein the vaccine is administered as a single dose to the animal.

30. The method of claim 25, wherein the vaccine is administered to the animal via a parenteral administration.

31. The method of claim 30, wherein the parenteral administration is intramuscular.

32. The method of claim 25, wherein the vaccine is administered to the animal via an intranasal administration.

33. A nucleic acid sequence comprising a sequence having at least 80% sequence identity to SEQ ID NO: 2.

34. The nucleic acid sequence of claim 33, wherein the sequence has at least 95% sequence identity to SEQ ID NO: 2.

35. The nucleic acid sequence of claim 33, wherein the sequence comprises SEQ ID NO: 2.

36. A chimeric sequence comprising i) a P2 sequence region of SVA strain SVV-001 and ii) one or more backbone sequence regions of SVA strain SD15-26.

37. The chimeric sequence of claim 36, wherein the P2 sequence region of SVA strain SVV-001 is a sequence having at least 80% sequence identity to SEQ ID NO: 6.

38. The chimeric sequence of claim 36, wherein one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 80% sequence identity to SEQ ID NO: 7.

39. The chimeric sequence of claim 36, wherein one or more backbone sequence regions of SVA strain SD 15-26 is a sequence having at least 80% sequence identity to SEQ ID NO: 8.

40. An immunogenic composition comprising the nucleic acid sequence of claim 35.

41. An immunogenic composition comprising the chimeric sequence of claim 36.

42. A vaccine comprising the immunogenic composition of claim 40 and one or more veterinary acceptable carriers.

43. A vaccine comprising the immunogenic composition of claim 41 and one or more veterinary acceptable carriers.

44. The method of claim 12, wherein the vaccine is the vaccine of claim42.

45. The method of claim 12, wherein the vaccine is the vaccine of claim43.

46. The method of claim 25, wherein the vaccine is the vaccine of claim 42.

47. The method of claim 25, wherein the vaccine is the vaccine of claim

Images