Method for producing heparin-like substance

Abstract

Provided is a method by which a heparin-like substance having higher activity can be produced. The present invention provides a method for producing a heparin-like substance, the method comprising the steps of: (1) preparing a mammalian cell that produces a heparin-like substance; and (2) culturing the mammalian cell prepared in the step (1), which produces the heparin-like substance, at a temperature effective for suppressing cell proliferation, and causing the mammalian cell to produce the heparin-like substance. The temperature effective for suppressing proliferation is preferably a temperature which is 2 to 14°C lower than the optimum temperature for the proliferation.

Description

Method for producing heparin-like substances

[0001] The present invention relates to a method for producing a heparin-like substance by genetic engineering, and to the heparin-like substance produced thereby.

[0002] Heparin is an essential anticoagulant used in medical settings such as dialysis and extracorporeal circulation. Heparin used in pharmaceuticals is mainly extracted and purified from pig small intestine or bovine lung.

[0003] Meanwhile, efforts have been made to produce heparin-like substances using genetic engineering techniques. The present inventors have attempted to produce heparin-like substances using cultured animal cells that produce heparin-like substances. They have found that heparin-like substances can be secreted into the culture supernatant and efficiently produced by recombinant CHO cells (CHO / NH-SDC) transfected with (1) a gene encoding a bifunctional heparan sulfate N-deacetylase / N-sulfotransferase (hereinafter abbreviated as NDST2) and (2) a gene encoding heparan sulfate glucosamine 3 sulfotransferase 1 (hereinafter abbreviated as Hs3st1), both of which are involved in the production of heparin-like substances (Patent Document 1). Furthermore, they have found that heparin-like substances with improved activity can be obtained by transfecting cells with a polynucleotide encoding a 6-O-sulfotransferase in addition to these three modifications (Patent Document 2).

[0004] On the other hand, it has been reported that productivity and specific activity of heparin-like substances produced by recombinant CHO cells expressing two exogenous enzymes of the heparin / heparan sulfate biosynthetic pathway were improved by examining nutrients added to the culture medium (Non-Patent Document 1). Furthermore, a cell culture method for producing soluble CTLA4 molecules has been proposed, which includes: (a) culturing host cells that produce soluble CTLA4 molecules at a first temperature of 37°C under cell culture conditions and for a period allowing cell growth; (b) subsequently culturing the cells at a second temperature of 34°C; (c) subsequently culturing the cells at a third temperature of 32°C; and (d) subsequently culturing the cells at a fourth temperature of 30°C, wherein the cells are cultured at the second temperature starting on the fifth to seventh day of culture, with a four-day interval between the start of the second temperature and the start of the third temperature, and the start of the fourth temperature two weeks after the start of culture and continuing until the end of the cell culture process (Patent Document 3).

[0005] International Publication WO2021 / 066167, International Publication WO2023 / 157899, International Publication WO2004 / 058800 (Patent No. 4541157)

[0006] Biotechnol J. 2015 Jul; 10(7): 1067-1081.

[0007] The heparin-like substance produced by the present inventors' method (Patent Document 2) has a lower specific activity than currently commercially available heparins. Heparin-like substances with higher activity are desired.

[0008] The present inventors discovered that by setting the culture temperature of genetically modified CHO cells that produce heparin-like substances low, the specific activity of the resulting heparin-like substances is dramatically improved, and thus completed the present invention.

[0009] The present invention provides the following: [1] A method for producing a heparin-like substance, comprising the following steps: (1) preparing mammalian cells that produce a heparin-like substance; and (2) culturing the heparin-like substance-producing mammalian cells prepared in step (1) at a temperature effective for inhibiting the growth of the cells, thereby producing the heparin-like substance. [2] The production method according to item 1, wherein the effective temperature for inhibiting growth is 2 to 14°C lower than the optimal temperature for growth. [3] The production method according to item 1 or 2, wherein the mammalian cells are CHO cells. [4] The production method according to any one of items 1 to 3, comprising a step of recovering the heparin-like substance on days 1 to 4 of culture. [5] The production method according to any one of items 1 to 4, wherein the culture is carried out continuously for 4 weeks or more. [6] The production method according to any one of items 1 to 5, wherein the effective temperature for inhibiting growth is 23 to 35°C. [7] The production method according to any one of items 1 to 5, wherein the effective temperature for inhibiting growth is 24 to 34°C. [8] The production method according to any one of items 1 to 7, wherein the mammalian cells that produce a heparin-like substance have been modified by at least one selected from the group consisting of: introduction of a polynucleotide encoding heparan sulfate N-deacetylase / N-sulfotransferase (NDST2); introduction of a polynucleotide encoding heparan sulfate glucosamine 3 sulfotransferase 1 (Hs3st1); introduction of a polynucleotide encoding the extracellular domain of syndecan (SDC); and introduction of a polynucleotide encoding a 6-O-sulfotransferase. [9] The production method according to item 8, wherein the mammalian cells that produce a heparin-like substance have been modified by all of the modifications defined in the group consisting of items 8.

[10] A recombinant heparin-like substance produced by a production method comprising the following steps: (1) preparing CHO cells having at least one modification selected from the group consisting of: - introduction of a polynucleotide encoding NDST2; - introduction of a polynucleotide encoding Hs3st1; - introduction of a polynucleotide encoding the extracellular domain of SDC; and - introduction of a polynucleotide encoding Hs6st3.- Knockout of chondroitin sulfate N-acetylgalactosaminyltransferase 2 (CS-GalNAcT2) (2) A step of culturing the CHO cells prepared in step (1) at 24 to 33°C to produce a heparin-like substance in the culture supernatant

[11] The recombinant heparin-like substance according to 10, having an anticoagulant factor Xa activity (specific activity per mg) of 100 IU / mg or more

[12] The recombinant heparin-like substance according to 10 or 11, having an anticoagulant factor IIa activity (specific activity per mg) of 75 IU / mg or more

[0010] Construction of gRNA / Cas9 expression vector for CS2 gene knockout. Confirmation of CS2 gene disruption by sequence analysis in CHO / 3F-S_CKO (#24) cells. Comparison of sGAG concentration, anti-FXa and anti-FIIa activity in the culture supernatant of CHO / 2F-S, CHO / 3F-S, and CHO / 3F-S_CKO cells on day 3 of culture. n=3, *p<0.05 vs. CHO / 2F-S, #p<0.05 vs. CHO / 3F-CHO / 2F-S. Time course of viable cell concentration and sGAG concentration in suspension batch cultures of CHO / 3F-S and CHO / 3F-S_CKO cells at 37℃ and 33℃. Time course of anti-FXa activity and anti-FIIa activity in suspension batch cultures of CHO / 2F-S, CHO / 3F-S, and CHO / 3F-S_CKO cells at 37℃ and 33℃. CHO / 2F-S, Changes over time in anti-FXa and anti-FIIa specific activities when the culture temperature was 37℃ and 33℃ in suspension batch cultures of CHO / 3F-S and CHO / 3F-S_CKO cells. Effect of culture temperature in suspension batch cultures of CHO / 3F-S_CKO cells. Comparison of anti-FXa and anti-FIIa specific activities in the culture supernatants on day 3 of suspension batch cultures of cell lines of different origins. Comparison of anti-FXa and anti-FIIa specific activities in the culture supernatants of #24; CHO / 3F-S_CKO, #16; CHO / 3F(+)-S_CKO, and #30; CHO / 3F(++)-S_CKO cell lines on day 3 of suspension batch culture. Comparison of sGAG concentrations in the culture supernatants of #24 cell line on day 3 of suspension batch culture. Continuous production of heparin-like glycans by high-density semi-continuous suspension culture of CHO / 3F-S_CKO cells. Construction of expression units in vectors used for genetic modification of CHO cells.

[0011] I. Method for Producing Heparin-Like Substance This embodiment provides a method for producing a heparin-like substance, comprising the following steps: (1) preparing mammalian cells that produce a heparin-like substance; and (2) culturing the mammalian cells that produce a heparin-like substance prepared in step (1) at a temperature effective for inhibiting the proliferation of the cells, thereby producing the heparin-like substance.

[0012] <Step of preparing mammalian cells that produce heparin-like substances> [Heparin-like substances] In the present invention, the term "heparin-like substance" refers to heparin, heparan sulfate, or a mixture thereof. Heparin can be said to be a highly sulfated heparan sulfate. Heparin and heparan sulfate are linear polysaccharides in which a disaccharide unit of uronic acid (β-D-glucuronic acid and α-L-iduronic acid) and glucosamine (D-N-acetylglucosamine and D-N-glucosamine sulfate) is repeatedly linked by α- or β-1,4 bonds. Heparin and heparan sulfate are available in which the 2-position of the uronic acid is O-sulfated, the 3- and 6-positions of the glucosamine are O-sulfated, and the amino group at the 2-position is N-sulfated.

[0013] Heparin-like substances can be quantified as sulfated glycosaminoglycans (sGAG) by methods well known to those skilled in the art. Furthermore, the activity of heparin-like substances can be measured as anticoagulant factor Xa (FXa) activity by methods well known to those skilled in the art. Activity can also be expressed as specific activity (activity per mass of sGAG). The heparin-like substances produced according to this embodiment have a high level of sulfation, resulting in improved anticoagulant activity. Generally, low-molecular-weight heparins and synthetic heparins exhibit only anti-FXa activity, but not anticoagulant factor IIa (FIIa) activity. In contrast, the heparin-like substances produced according to this embodiment may have both anti-FXa activity and anti-FIIa activity. This suggests that the heparin-like substances produced according to the present invention may have a similar structure to commercially available heparins.

[0014] [Animal Cells] Examples of animal cells used in this embodiment include Chinese hamster ovary cells (CHO cells) [Journal of Experimental Medicine, 108, 945 (1958); Proc. Natl. Acad. Sci. USA, 60, 1275 (1968); Genetics, 55, 513 (1968); Chromosoma, 41, 129 (1973); Methods in Cell Science, 18, 115 (1996); Radiation Research, 148, 260 (1997); Proc. Natl. Acad. Sci. USA, 77, 4216 (1980); Proc. Natl. Acad. Sci., 60, 1275 (1968); Cell, 6, 121 (1975); Journal of Bioscience and Bioengineering, 137, 471 (2024); Molecular Cell Genetics, Appendix I, II (pp. 883-900)], dihydrofolate reductase gene-deficient CHO cells (CHO / DG44 cells) [Proc. Natl. Acad. Sci. USA, 77, 4216 (1980)], CHO-K1 (ATCC CCL-61), DUkXB11 (ATCC CCL-9096), Pro-5 (ATCC CCL-1781), CHO-S (Life Technologies, Cat. #11619), Pro-3, human umbilical vein endothelial cells (HUVEC), human umbilical artery endothelial cells (HUAEC), human pulmonary microvascular endothelial cells (HLMVEC), human aortic endothelial cells (HAoEC), human coronary artery endothelial cells (HCAEC), human pulmonary artery endothelial cells (HPAEC), human embryonic kidney (HEK), rat myeloma cells YB2 / 3HL. P2. G11.16Ag.20 (also called YB2 / 0), monkey COS cells, mouse myeloma cells NSO and SP2 / 0-Ag14, Syrian hamster cells BHK and HBT5637 (Japanese Patent Laid-Open Publication No. 63-000299), and mammalian-derived mast cells.

[0015] In one embodiment, from the viewpoint of production efficiency and the like, CHO cells, CHO / DG44 cells, CHO-K1 (ATCC CCL-61), or CHO-S cells are transformed as described below and used.

[0016] In another embodiment, mast cells, which are naturally capable of producing heparin, are used. Examples of mammalian mast cells include HMC-1.2 (human mast cell line), IC-2 (a clone of mast cell precursor cells), LT4Tr (a cell line spontaneously transformed from the LT4 clone of mast cell precursor cells), P-815 (a mouse mastocytoma), MEDMC-NT2 (a mouse mast cell line), and MEDMC-BRC6 (a mouse mast cell line derived from mouse ES cells (BRC6; AES0010), C57BL / 6 strain).

[0017] In one preferred aspect of the production method of this embodiment, animal cells can be used that have been modified with at least one of the following: (i) a polynucleotide encoding heparan sulfate N-deacetylase / N-sulfotransferase (NDST2); (ii) a polynucleotide encoding heparan sulfate glucosamine 3-sulfotransferase 1 (Hs3st1); (iii) introduction of a polynucleotide encoding the extracellular domain of syndecan (SDC); and (iv) a polynucleotide encoding a protein (transporter, enzyme, etc.) involved in each step of the sulfation pathway.

[0018] Of the above group, it is preferred that at least two modifications, more particularly modifications (i) and (ii), have been made, more preferably at least three modifications, more particularly modifications (i), (ii), and (iii), and even more preferably all modifications have been made.

[0019] [Heparan sulfate N-deacetylase / N-sulfotransferase (NDST2)] A polynucleotide encoding NDST2 may be introduced into the animal cells used in the production method of this embodiment. NDST2 is a member of the N-deacetylase / N-sulfotransferase subfamily of sulfotransferase 1 proteins and is an enzyme with two functions: N-deacetylation and N-sulfation. Instead of a polynucleotide encoding a bifunctional enzyme, heparan sulfate N-deacetylase / N-sulfotransferase, two polynucleotides may be introduced: one encoding an enzyme with N-deacetylation function, and the other encoding an enzyme with N-sulfation function.

[0020] Preferred examples of polynucleotides encoding NDST2 include any of the following: (A2) a polynucleotide consisting of the sequence set forth in SEQ ID NO: 1 or 13; (B2) a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting of a sequence complementary to the sequence set forth in SEQ ID NO: 1 or 13 and encodes a protein having NDST2 activity; (C2) a polynucleotide that consists of a sequence having 90% or more identity to the sequence set forth in SEQ ID NO: 1 or 13 and encodes a protein having NDST2 activity; (D2) a polynucleotide that encodes a protein having the amino acid sequence set forth in SEQ ID NO: 2 or 14; (E2) a polynucleotide that consists of an amino acid sequence in which multiple amino acids have been substituted, deleted, inserted, and / or added in the amino acid sequence set forth in SEQ ID NO: 2 or 14 and encodes a protein having NDST2 activity; (F2) a polynucleotide that consists of an amino acid sequence having 90% or more identity to the amino acid sequence set forth in SEQ ID NO: 2 or 14 and encodes a protein having NDST2 activity.

[0021] [Heparan sulfate glucosaminyl 3-O-sulfotransferase 1 (Hs3st1)] A polynucleotide encoding Hs3st1 may be introduced into the animal cells used in the production method of this embodiment. Hs3st1 is a member of the heparan sulfate biosynthetic enzyme family and has both heparan sulfate glucosaminyl 3-O-sulfotransferase activity and anticoagulant heparan sulfate conversion activity, and is the rate-limiting enzyme in anticoagulant heparan synthesis.

[0022] Preferred examples of polynucleotides encoding Hs3st1 are any of the following: (A3) a polynucleotide consisting of the sequence set forth in SEQ ID NO: 9, 15, or 19; (B3) a polynucleotide which hybridizes under stringent conditions to a polynucleotide consisting of a sequence complementary to the sequence set forth in SEQ ID NO: 9, 15, or 19 and encodes a protein having Hs3st1 activity; (C3) a polynucleotide which consists of a sequence having 90% or more identity to the sequence set forth in SEQ ID NO: 9, 15, or 19 and encodes a protein having Hs3st1 activity; (D3) a polynucleotide which encodes a protein having the amino acid sequence set forth in SEQ ID NO: 10, 16, or 20; (E3) a polynucleotide which consists of an amino acid sequence in which multiple amino acids have been substituted, deleted, inserted, and / or added in the amino acid sequence set forth in SEQ ID NO: 10, 16, or 20, and encodes a protein having Hs3st1 activity; (F3) a polynucleotide which consists of an amino acid sequence which has 90% or more identity to the amino acid sequence set forth in SEQ ID NO: 10, 16, or 20, and encodes a protein having Hs3st1 activity.

[0023] [Extracellular domain of syndecan (SDC)] A polynucleotide encoding the extracellular domain of syndecan may be introduced into the animal cells used in the production method of this embodiment. Syndecans are members of a family of four cell surface proteoglycans that have a retained plasma membrane domain and a cytoplasmic domain. The structure of syndecan consists of an extracellular domain, a transmembrane domain, and a cytoplasmic domain. Of these, the extracellular domain contains a glycosaminoglycan-binding site.

[0024] Preferred examples of polynucleotides encoding the extracellular domain of syndecan are any of the following: (A4) a polynucleotide consisting of the sequence set forth in SEQ ID NO: 11; (B4) a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting of a sequence complementary to the sequence set forth in SEQ ID NO: 11 and encodes a protein that, when introduced into heparin-like substance-producing animal cells, has the function of increasing the amount of heparin-like substance in the culture supernatant; (C4) a polynucleotide that consists of a sequence having 90% or more identity to the sequence set forth in SEQ ID NO: 11 and encodes a protein that, when introduced into heparin-like substance-producing animal cells, has the function of increasing the amount of heparin-like substance in the culture supernatant; (D4) a polynucleotide that encodes a protein consisting of the amino acid sequence set forth in SEQ ID NO: 12; (E4) a polynucleotide that consists of an amino acid sequence in which multiple amino acids have been substituted, deleted, inserted, and / or added in the amino acid sequence set forth in SEQ ID NO: 12 and encodes a protein that, when introduced into heparin-like substance-producing animal cells, has the function of increasing the amount of heparin-like substance in the culture supernatant; (F4) A polynucleotide encoding a protein consisting of an amino acid sequence having 90% or more identity to the amino acid sequence set forth in SEQ ID NO: 12, and having the function of increasing the amount of heparin-like substance in the culture supernatant when introduced into a heparin-like substance-producing animal cell.

[0025] With respect to a polynucleotide encoding the extracellular domain of a syndecan, "having the function of increasing the amount of heparin-like substances in the culture supernatant" means that when a target polynucleotide is introduced into heparin-like substance-producing animal cells that have not been introduced with a polynucleotide encoding the extracellular domain of a syndecan, the amount of heparin-like substances in the culture supernatant increases compared to before introduction. An example of a heparin-like substance-producing animal cell referred to here is a CHO cell into which a polynucleotide encoding NDST2 and a polynucleotide encoding Hs3st1 have been introduced. A more specific example is CHO-S / NH cell (see Patent Document 1).

[0026] [Proteins (transporters, enzymes, etc.) involved in each step of the sulfation pathway] Polynucleotides encoding proteins (transporters, enzymes, etc.) involved in each step of the sulfation pathway may be introduced into the animal cells used in the production method of this embodiment. Polynucleotides encoding proteins involved in each step of the sulfation pathway include the following.

[0027] - Genes encoding intracellular sulfate ion transporters (e.g., SLC26A1, SLC26A2, SLC13A1, SLC13A4), - Genes encoding enzymes that synthesize PAPS from sulfate ions (e.g., SLC26A1, SLC26A2, SLC13A1, SLC13A4), - Genes encoding transporters of PAPS to the Golgi apparatus (e.g., PAPSS1, PAPSS2), - Genes encoding sugar chain conversion enzymes (e.g., Glce), - Genes encoding N-deacetylase / N-sulfotase enzymes (e.g., NDST1, NDST2), - Genes encoding 2-O-sulfotase enzymes (e.g., Hs2st), - Genes encoding 6-O-sulfotase enzymes (e.g., Hs6st1, Hs6st2, Hs6st3), - Genes encoding 3-O-sulfotase enzymes (e.g., Hs3st1, Hs3st5).

[0028] According to the studies of the present inventors, among the genes encoding proteins involved in each step of the sulfation pathway, the introduction of a 6-O-sulfotase gene is preferable, and the introduction of the Hs6st3 gene is more preferable, because the introduction increases the sulfation level of the heparin-like substance produced by the heparin-like substance-producing animal cells, thereby improving the anticoagulant factor Xa activity.

[0029] Preferred examples of the Hs6st3 gene, i.e., the polynucleotide encoding Hs6st3, are any of the following: (A) a polynucleotide consisting of the sequence set forth in SEQ ID NO: 7 or 17; (B) a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting of a sequence complementary to the sequence set forth in SEQ ID NO: 7 or 17 and encodes a protein having the function of improving the anticoagulant factor Xa activity of a heparin-like substance produced by heparin-like substance-producing animal cells; (C) a polynucleotide that consists of a sequence having 90% or more identity to the sequence set forth in SEQ ID NO: 7 or 17 and encodes a protein having the function of improving the anticoagulant factor Xa activity of a heparin-like substance produced by heparin-like substance-producing animal cells; (D) a polynucleotide that encodes a protein consisting of the amino acid sequence set forth in SEQ ID NO: 8 or 18; (E) a polynucleotide that consists of an amino acid sequence in which multiple amino acids have been substituted, deleted, inserted, and / or added in the amino acid sequence set forth in SEQ ID NO: 8 or 18 and encodes a protein having the function of improving the anticoagulant factor Xa activity of a heparin-like substance produced by heparin-like substance-producing animal cells; (F) A polynucleotide encoding a protein consisting of an amino acid sequence having 90% or more identity to the amino acid sequence set forth in SEQ ID NO: 8 or 18 and having the function of improving the anticoagulant factor Xa activity of a heparin-like substance produced by a heparin-like substance-producing animal cell.

[0030] Preferred examples of the Hs6st1 gene, i.e., the polynucleotide encoding Hs6st1, are any of the following: (A5) a polynucleotide consisting of the sequence set forth in SEQ ID NO: 3; (B5) a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting of a sequence complementary to the sequence set forth in SEQ ID NO: 3 and encodes a protein having the function of improving the anticoagulant factor Xa activity of a heparin-like substance produced by heparin-like substance-producing animal cells; (C5) a polynucleotide that consists of a sequence having 90% or more identity to the sequence set forth in SEQ ID NO: 3 and encodes a protein having the function of improving the anticoagulant factor Xa activity of a heparin-like substance produced by heparin-like substance-producing animal cells; (D5) a polynucleotide that encodes a protein consisting of the amino acid sequence set forth in SEQ ID NO: 4; (E5) a polynucleotide that consists of an amino acid sequence in which multiple amino acids have been substituted, deleted, inserted, and / or added in the amino acid sequence set forth in SEQ ID NO: 4 and encodes a protein having the function of improving the anticoagulant factor Xa activity of a heparin-like substance produced by heparin-like substance-producing animal cells; (F5) A polynucleotide encoding a protein consisting of an amino acid sequence having 90% or more identity to the amino acid sequence set forth in SEQ ID NO: 4 and having the function of improving the anticoagulant factor Xa activity of a heparin-like substance produced by heparin-like substance-producing animal cells.

[0031] Preferred examples of the Hs6st2 gene, i.e., the polynucleotide encoding Hs6st2, are any of the following: (A6) a polynucleotide consisting of the sequence set forth in SEQ ID NO: 5; (B6) a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting of a sequence complementary to the sequence set forth in SEQ ID NO: 5 and encodes a protein having the function of improving the anticoagulant factor Xa activity of a heparin-like substance produced by heparin-like substance-producing animal cells; (C6) a polynucleotide that consists of a sequence having 90% or more identity to the sequence set forth in SEQ ID NO: 5 and encodes a protein having the function of improving the anticoagulant factor Xa activity of a heparin-like substance produced by heparin-like substance-producing animal cells; (D6) a polynucleotide that encodes a protein consisting of the amino acid sequence set forth in SEQ ID NO: 6; (E6) a polynucleotide that consists of an amino acid sequence in which multiple amino acids are substituted, deleted, inserted, and / or added in the amino acid sequence set forth in SEQ ID NO: 6 and encodes a protein having the function of improving the anticoagulant factor Xa activity of a heparin-like substance produced by heparin-like substance-producing animal cells; (F6) A polynucleotide encoding a protein consisting of an amino acid sequence having 90% or more identity to the amino acid sequence set forth in SEQ ID NO: 6 and having the function of improving the anticoagulant factor Xa activity of a heparin-like substance produced by heparin-like substance-producing animal cells.

[0032] With respect to a polynucleotide encoding a 6-O-sulfotase, the phrase "having the function of improving the anticoagulant factor Xa activity of a heparin-like substance produced by a heparin-like substance-producing animal cell" means that when the polynucleotide of interest is introduced into heparin-like substance-producing animal cells that have not been introduced with a polynucleotide encoding a 6-O-sulfotase, the anticoagulant factor Xa activity of the heparin-like substance produced by the heparin-like substance-producing animal cell is improved compared to that before introduction. An example of the heparin-like substance-producing animal cell referred to here is a CHO cell introduced with a polynucleotide encoding NDST2, a polynucleotide encoding Hs3st1, and a polynucleotide encoding the extracellular domain of SDC. A more specific example is CHO-S / NH-SDC cells (see Patent Document 1).

[0033] [Chondroitin sulfate N-acetylgalactosaminyltransferase (CSGALNACT)] The animal cells used in the production method of this embodiment preferably have reduced or non-functional chondroitin sulfate N-acetylgalactosaminyltransferase (CSGALNACT). Examples of CSGALNACT include type I (CS1) and type II (CS2). Reduced or non-functionality can be achieved by knocking out the gene encoding the enzyme in the animal cells used. In one embodiment, at least one of the CSGalNAcT1 (Chondroitin sulfate N-acetylgalactosaminyltransferase 1, CS1) gene and the CSGalNAcT2 (Chondroitin sulfate N-acetylgalactosaminyltransferase 2, CS2) gene is knocked out in the animal cells used. The CS2 gene is knocked out, as this is expected to result in a sufficient increase in specific activity. A genome editing CRISPR / Cas9 system can be used for knockout.

[0034] Preferred examples of the CS1 gene, i.e., a polynucleotide encoding CS1, are any of the following: (A7) a polynucleotide consisting of the sequence set forth in SEQ ID NO: 21; (B7) a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting of a sequence complementary to the sequence set forth in SEQ ID NO: 21 and encodes a protein having CS1 activity; (C7) a polynucleotide that consists of a sequence having 90% or more identity to the sequence set forth in SEQ ID NO: 21 and encodes a protein having CS1 activity; (D7) a polynucleotide that encodes a protein having the amino acid sequence set forth in SEQ ID NO: 22; (E7) a polynucleotide that consists of an amino acid sequence in which multiple amino acids have been substituted, deleted, inserted, and / or added in the amino acid sequence set forth in SEQ ID NO: 22 and encodes a protein having CS1 activity; (F7) a polynucleotide that consists of an amino acid sequence having 90% or more identity to the amino acid sequence set forth in SEQ ID NO: 22 and encodes a protein having CS1 activity.

[0035] Preferred examples of the CS2 gene, i.e., the polynucleotide encoding CS2, are any of the following: (A8) a polynucleotide consisting of the sequence set forth in SEQ ID NO: 23; (B8) a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting of a sequence complementary to the sequence set forth in SEQ ID NO: 23 and encodes a protein having CS2 activity; (C8) a polynucleotide that consists of a sequence having 90% or more identity to the sequence set forth in SEQ ID NO: 23 and encodes a protein having CS2 activity; (D8) a polynucleotide that encodes a protein having the amino acid sequence set forth in SEQ ID NO: 24; (E8) a polynucleotide that consists of an amino acid sequence in which multiple amino acids have been substituted, deleted, inserted, and / or added in the amino acid sequence set forth in SEQ ID NO: 24 and encodes a protein having CS2 activity; (F8) a polynucleotide that consists of an amino acid sequence that has 90% or more identity to the amino acid sequence set forth in SEQ ID NO: 24 and encodes a protein having CS2 activity.

[0036] According to the studies by the present inventors, knocking out the CS2 gene can improve the anti-FXa specific activity and anti-FIIa specific activity compared to the original cells that are not knocked out.

[0037] [Preparation of Animal Cells] In the manufacturing method of this embodiment, in the step of preparing mammalian cells that produce heparin-like substances, specific animal cells are prepared, and preparation refers to preparing the cells to be cultured in the required quantity depending on the culture scale.

[0038] <Step of culturing at a temperature effective in inhibiting proliferation and producing a heparin-like substance> The method for producing a heparin-like substance of this embodiment involves culturing the animal cells prepared in the above step to produce a heparin-like substance, and one of its features is that the production of this heparin-like substance is carried out at a temperature effective in inhibiting proliferation.

[0039] [Temperature] The temperature effective for inhibiting proliferation refers to a temperature at which proliferation is inhibited when target cells are cultured compared to when they are cultured at the optimal temperature for proliferation. The optimal temperature for proliferation refers to a temperature at which proliferation is most rapid. The degree of proliferation inhibition can vary, but for example, at an appropriate cell density (e.g., 1 × 10 6 This refers to the fact that the cell count on the fourth day of culture when culture is started at a constant temperature (80% or less, 70% or less, 60% or less, 50% or less, 40% or less, 30% or less, 20% or less, 10% or less, or 5% of that when cultured at the optimal temperature. In the present invention, the cell count refers to the number of viable cells unless otherwise specified.

[0040] A temperature effective for inhibiting proliferation can be a temperature obtained by shifting the optimal temperature for proliferation downward. The degree of downward shift is not particularly limited as long as the cells can perform the desired function. Generally, in the culture of animal cells, if the temperature is too low, not only will the cells not grow, but the desired function will be suppressed, and growth may become unsustainable. Therefore, a temperature effective for proliferation can be a temperature obtained by shifting the optimal temperature for proliferation downward, for example, by 2 to 15°C, 2 to 14°C, 3 to 14°C, or 4 to 13°C.

[0041] In the method for producing a heparin-like substance of this embodiment, when transformed CHO cells are used, the temperature effective for inhibiting proliferation is 23 to 35°C, preferably 23 to 34°C, and more preferably 24 to 34°C, for example, 24°C, 26°C, 28°C, 30°C, or 33°C.

[0042] In the present invention, the temperature of animal cell culture refers to the temperature of the culture medium during culture, unless otherwise specified. The temperature of the culture medium during culture can be measured and controlled by conventional methods.

[0043] [Other Conditions] Conditions other than temperature during culture are preferably conditions that promote the production of heparin-like substances.

[0044] The medium preferably contains sufficient carbon, nitrogen, oxygen and other nutrients, growth factors, buffers, cofactors and any other substances to at least maintain cell viability and allow expression of the heparin-like substance. In embodiments in which the gene encoding the heparin-like substance is under the control of or includes an inducible promoter, the medium may further include an inducer.

[0045] Examples of media include RPMI or DMEM supplemented with 10% fetal calf serum (FCS), as well as tissue culture media supplemented with factors such as antibiotics, growth factors, and other cytokines (e.g., Cell Biology (Third Edition) A Laboratory Handbook, vol. 1, 2006, Elsevier Inc.). Specific examples include medium formulations known to those skilled in the art, such as RPMI, IMDM, DMEM, DMEM / F12, and serum-free or serum-reduced EMEM. These media may contain additional nutritional supplements such as antibiotics, lipids, transferrin, insulin, and amino acids, and cofactors as needed.

[0046] In one aspect, a serum-free medium or a medium free of animal-derived components is used as the medium, from the viewpoints of simplifying the purification of the produced substance and reducing the risk of contamination of the purified product with impurities. Such media are widely used for producing useful substances such as antibodies and can be appropriately used for the production method of this embodiment. For this embodiment, commercially available animal-derived component-free media may also be used. Examples of such media include FreeStyle CHO Expression Medium (Thermo Fisher Scientific), FreeStyle 293 Expression Medium (Thermo Fisher Scientific), FreeStyle F17 (Thermo Fisher Scientific), Viral Production Medium (Thermo Fisher Scientific), BalanCD Transfectory CHO (Fujifilm Wako Pure Chemical Corporation), and BalanCD HEK293 medium (Fujifilm Wako Pure Chemical Corporation).

[0047] From the viewpoint of promoting the production of heparin-like substances, the medium preferably contains at least one selected from glucose, sulfate, and phosphate. The glucose concentration in the medium is usually preferably 5 to 75 mM, more preferably 10 to 60 mM, and even more preferably 15 to 35 mM. The sulfate concentration in the medium is usually preferably 0.5 to 50 mM, more preferably 10 to 50 mM, and even more preferably 30 to 50 mM. The phosphate concentration in the medium is usually preferably 0.5 to 50 mM, more preferably 1 to 50 mM, and even more preferably 10 to 50 mM.

[0048] Heparin-like substances can be produced by producing and accumulating them in the culture supernatant and then collecting them from the culture supernatant. Recombinant cells can be cultured in a medium according to conventional methods. Culture is typically performed under conditions such as pH 6-8 and in the presence of 5% CO2. Suspension culture is preferred because it allows for relatively high cell density and facilitates cell recovery.

[0049] Cultivation may be performed using batch, fed-batch, or continuous culture. The heparin-like substance produced can be recovered by harvesting the culture medium. In batch culture, cells are initially cultured in a medium that is not removed, replaced, or added. The desired product is harvested at the end of the culture run. In fed-batch culture, fresh medium is supplied as needed throughout the culture period. Supply may include daily (consecutive days), every other day, or every two days, more than once a day, or less than once a day. In continuous culture, fresh medium is replenished as needed, and a portion of the culture medium is harvested. If appropriate, a portion of the cells may be harvested at each harvest to maintain an appropriate cell density. In continuous culture, the culture can be continuously performed for several weeks or more, for example, 2 weeks or more, 4 weeks or more, 8 weeks or more, 12 weeks or more, or 24 weeks or more. Harvesting may be performed daily or every few days, for example, every 2 to 4 days.

[0050] The appropriate timing for collection may be determined based on the concentration or activity of the target substance in the culture supernatant, for example, when at least one of the anti-FXa activity and anti-FIIa activity of the culture supernatant has reached a sufficiently high level.

[0051] The production of heparin-like substances can be confirmed by adding an enzyme solution containing heparin lyases I, II, and III to the culture supernatant, followed by enzymatic treatment and quantifying the amount by HPLC for unsaturated disaccharide analysis. The secretion and production of heparin-like substances from recombinant cells can also be confirmed by measuring the amount of sGAG in the culture supernatant.

[0052] In one embodiment, the cells secrete proteoglycans, glycoproteins containing a core protein bound to a heparin-like GAG, into the culture supernatant. Proteins are isolated from the culture supernatant by methods known in the art. For example, a tag that facilitates isolation of the heparin-like substance, such as an affinity tag, may be used. Examples of tags include polyhistidine (His6 tag), nickel matrix, chitin-binding protein (CBP), maltose-binding protein (MBP), glutathione S-transferase (GST), FLAG tag, and epitope tag.

[0053] Isolation of the heparin-like material from the core protein is accomplished by methods conventionally known in the art, such as enzymatic digestion with heparinase, or treatment with sodium hydroxide or alkaline borohydride.

[0054] The resulting heparin-like substance may contain repeating disaccharide units of various lengths, preferably UA-GlcNAc(6S), UA(2S)-GlcNAc, UA-(2S)-GlcNAc(6S), UA-GlcNS, UA-GlcNS(6S), UA(2S)-GlcNS, or UA(2S)-GlcNS(6S), which may be present in any order in the heparin-like substance.

[0055] In the above, UA is a uronic acid residue (i.e., glucuronic acid or iduronic acid), Ac is acetyl, GlcNAc is N-acetylglucosamine, GlcNS is glucosamine-N-sulfate, 2S is 2-O-sulfate, and 6S is 6-O-sulfate.

[0056] <Heparin-like substance obtained> In one aspect, the heparin-like substance obtained by the production method of this embodiment is a low-molecular-weight heparin-like substance. In a specific aspect, the molecular weight of the heparin-like substance obtained by the production method of this embodiment is 3,000 to 10,000.

[0057] The production method of this embodiment can produce a heparin-like substance having an anticoagulant factor Xa (FXa) specific activity of 50 IU / mg or more. In a preferred embodiment, the anti-FXa specific activity can be 90 IU / mg or more, 100 IU / mg or more, 110 IU / mg or more, 120 IU / mg or more, 130 IU / mg or more, 150 IU / mg or more, 170 IU / mg or more, 200 IU / mg or more, or 250 IU / mg or more.

[0058] Furthermore, the production method of this embodiment can produce a heparin-like substance having an anticoagulant factor IIa (FIIa) specific activity of 20 IU / mg or more. In a preferred embodiment, the anti-FIIa specific activity can be 40 IU / mg or more, 50 IU / mg or more, 75 IU / mg or more, 100 IU / mg or more, 130 IU / mg or more, 150 IU / mg or more, or 200 IU / mg or more.

[0059] In the present invention, when anti-FXa specific activity or anti-FIIa specific activity is expressed numerically, unless otherwise specified, it is a value calculated by dividing the value measured as heparin activity using a method based on the measurement principle below by the value measured as the concentration of total glycosaminoglycan using the measurement principle below.

[0060] Principle of heparin activity (anti-FXa activity) measurement: Antithrombin III is added to a sample to form a heparin-antithrombin III complex. A certain excess of coagulation factor Xa is then added to the complex and allowed to react. The heparin-antithrombin III complex binds to coagulation factor Xa in proportion to the amount of coagulation factor Xa, forming an inactive heparin-antithrombin III-coagulation factor Xa complex. Addition of a substrate (N-benzoyl-L-isoleucyl-L-glutamyl (γ-OR)-glycyl-L-arginyl-p-nitroanilide hydrochloride) liberates p-nitroaniline, which corresponds to the residual coagulation factor Xa activity. This residual coagulation factor Xa activity reflects the heparin activity (anti-FXa activity) in the sample. Therefore, the heparin activity (anti-FXa activity) of the sample can be determined by colorimetrically quantifying the liberated p-nitroaniline at 405 nm.

[0061] Measurements based on this principle can be performed using commercially available heparin assay kits, such as Testteam Heparin S#30564000 (Sekisui Medical). Anti-FXa activity can be measured using BIOPHEN HEPARIN ANTI-Xa 2-stage (HBM) and anti-FIIa activity can be measured using BIOPHEN HEPARIN ANTI-IIa 2-stage (HBM). In these cases, commercially available standards, such as heparin sodium (product codes 081-00131, 085-00134, 081-00136, and 087-00133, Fujifilm Wako Pure Chemical Industries, Ltd.), can be used.

[0062] Principle of glycosaminoglycan measurement: Blyscan Dye (1,9-dimethyl-methylene blue), which specifically binds to sulfated glycans, is added to the sample, and the soluble sulfated proteoglycans and sulfated glycosaminoglycans in the sample are pelleted. The dye is eluted from the pellet with a reagent, and the total glycosaminoglycan concentration in the sample can be determined by colorimetric quantification at 656 nm.

[0063] Measurement based on this principle can be performed using a commercially available glycosaminoglycan measurement kit, for example, Blyscan Glycosaminoglycan Assay Kit (product code B1000, Biocolor).

[0064] The heparin-like substance obtained by the production method of this embodiment may have a specific activity equivalent to that of commercially available heparin. Such a heparin-like substance may be novel. Therefore, this embodiment provides a recombinant heparin-like substance produced by the following production method: (1) a step of preparing CHO cells having at least one modification selected from the group consisting of: - introduction of a polynucleotide encoding NDST2; - introduction of a polynucleotide encoding Hs3st1; - introduction of a polynucleotide encoding the extracellular domain of SDC; and - introduction of a polynucleotide encoding Hs6st3. - knockout of chondroitin sulfate N-acetylgalactosaminyltransferase 2 (CS-GalNAcT2). (2) a step of culturing the CHO cells prepared in step (1) at 24 to 33°C to produce a heparin-like substance in the culture supernatant.

[0065] <Others> [Polynucleotides, Proteins] In the present invention, unless otherwise specified, polynucleotides or proteins may be derived from humans or non-human mammals, including pigs, mice, rats, and hamsters.

[0066] In the present invention, when polynucleotides are referred to as hybridizing under stringent conditions, unless otherwise specified, the hybridization conditions for any polynucleotide can be appropriately selected according to the polynucleotide to be obtained, as described in Molecular Cloning. A Laboratory Manual. 4th ed. (Sambrook et al., Cold Spring Harbor Laboratory Press) and Hybridization of Nucleic Acid Immobilization on Solid Supports (ANALYTICAL BIOCHEMISTRY 138, 267-284 (1984)). For example, to obtain DNA with 50% or more identity, hybridization can be performed at 40°C in the presence of a 6x SSC solution (1x SSC solution consists of 150 mM sodium chloride and 15 mM sodium citrate) and 5% formamide, followed by washing the filter with a 4x SSC solution at 49°C. To obtain DNA with 85% or more identity, hybridization can be performed in the presence of 2x SSC solution and 50% formamide at 40°C, followed by filter washing with 0.1x SSC solution at 57°C. To obtain DNA with 90% or more identity, hybridization can be performed in the presence of 2x SSC solution and 50% formamide at 45°C, followed by filter washing with 0.1x SSC solution at 62°C.

[0067] Furthermore, in the present invention, when a protein or amino acid sequence is referred to as an amino acid sequence in which one or more amino acids have been substituted, deleted, inserted, and / or added, the number of amino acids substituted, etc. is not particularly limited, unless otherwise specified, for any protein, as long as the protein consisting of that amino acid sequence has the desired function, but is generally about 1-250, 1-200, 1-150, 1-100, 1-50, 1-40, 1-30, 1-20, 1-15, 1-9, or 1-4 amino acids, or even greater numbers of substitutions, etc., are possible as long as the substitutions are with amino acids of similar properties. Means for preparing polynucleotides or proteins with such amino acid sequences are well known to those skilled in the art.

[0068] In the present invention, when referring to a nucleotide sequence (sometimes referred to as a base sequence) or an amino acid sequence, the term "identity" refers to the percentage of identical nucleotides or amino acids shared between two sequences when the two sequences are optimally aligned, unless otherwise specified. That is, identity can be calculated as follows: (number of identical positions / total number of positions) × 100, and can be calculated using commercially available algorithms. Such algorithms are also incorporated into the NBLAST and XBLAST programs described in Altschul et al., J. Mol. Biol. 215 (1990) 403-410. More specifically, searches and analyses of sequence identity can be performed using algorithms or programs well known to those skilled in the art (e.g., BLASTN, BLASTP, BLASTX, ClustalW). When using a program, parameters can be appropriately set by those skilled in the art, or the default parameters of each program can be used. Specific techniques for these analysis methods are also well known to those skilled in the art. The identity may be calculated using genetic information processing software GENETIX (registered trademark) (Genetics Co., Ltd.). If the subject sequence for which the identity percentage is to be determined has an additional sequence at the end that is not present in the sequence being compared, such as a tag sequence, the additional sequence portion is not included in the identity percentage calculation.

[0069] In the present invention, when referring to identity with respect to a nucleotide sequence or an amino acid sequence, unless otherwise specified, it refers to sequence identity of at least 50%, for example, 60% or more, 70% or more, preferably 80% or more, more preferably 85% or more, even more preferably 90% or more, even more preferably 95% or more, even more preferably 97.5% or more, and even more preferably 99% or more.

[0070] The polynucleotides or genes, and proteins or enzymes used in this embodiment can be prepared by those skilled in the art using conventional techniques.

[0071] The default parameters are: G (Cost to open gap) is 5 for nucleotide sequences and 11 for amino acid sequences; -E (Cost to extend gap) is 2 for nucleotide sequences and 1 for amino acid sequences; -q (Penalty for nucleotide mismatch) is -3; -r (reward for nucleotide match) is 1; -e (expect value) is 10; -W (wordsize) is 11 residues for nucleotide sequences and 3 residues for amino acid sequences; -y [Dropoff (X) for blast extensions in bits] is 20 for blastn and 7 for programs other than blastn; -X (X dropoff value for gapped alignment in bits) is 15; and -Z (final X dropoff value for gapped alignment in bits) is 50 for blastn and 25 for programs other than blastn (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi?PAGE_TYPE=BlastSearch).

[0072] Polypeptides having an amino acid sequence of interest in which one to several amino acids have been deleted, substituted, or added can be obtained by introducing site-specific mutations into DNA encoding a polypeptide comprising, for example, the amino acid sequence of SEQ ID NOs: 1 to 3, using methods such as site-directed mutagenesis [Molecular Cloning, A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press (1989); Current Protocols in Molecular Biology, John Wiley & Sons (1987-1997); Nucleic Acids Research, 10, 6487 (1982); Proc. Natl. Acad. Sci. USA, 79, 6409 (1982); Gene, 34, 315 (1985); Nucleic Acids Research, 13, 4431 (1985); Proc. Natl. Acad. Sci. USA, 82, 488 (1985)].

[0073] [Recombinant Cells] In the present invention, modification of animal cells can be achieved by introducing a recombinant vector containing a predetermined polynucleotide into the animal cell that will serve as the host cell.

[0074] Any recombinant vector can be used as long as it is capable of autonomous replication in the host cell to be used or of being integrated into the chromosome and contains a suitable promoter in a position where the DNA encoding the polypeptide can be transcribed.

[0075] Although a transcription termination sequence is not necessarily required in a recombinant vector, it is preferable to place a transcription termination sequence immediately downstream of the structural gene. Furthermore, the recombinant vector may contain a gene that controls the promoter.

[0076] As the recombinant vector, it is preferable to use a plasmid in which a Kozak sequence, which is a ribosome binding sequence, is appropriately positioned around the initiation codon.

[0077] In the DNA base sequence, bases can be substituted to create codons that are optimal for expression in the host, thereby improving the production rate of the desired NDST2 and Hs3st1.

[0078] Any recombinant vector can be used as long as it can function in animal cells. Examples of such vectors include pcDNA I, pcDM8 (Funakoshi Co., Ltd.), pAGE107 [JP Patent Publication No. 03-22979; Cytotechnology, 3, 133 (1990)], pAS3-3 (JP Patent Publication No. 02-227075), pcDM8 [Nature, 329, 840 (1987)], pcDNA I / Amp (Invitrogen Co., Ltd.), pcDNA3.1 (Invitrogen Co., Ltd.), pREP4 (Invitrogen Co., Ltd.), and pAGE103 [J. Biochemistry, 101, 1307 (1990)]. (1987)], pAGE210, pME18SFL3, pKANTEX93 (WO 97 / 10354), N5KG1val (U.S. Pat. No. 6,001,358), INPEP4 (Biogen-IDEC), and transposon vectors (WO 2010 / 143698).

[0079] Any promoter that can function in animal cells can be used, including, for example, the promoter of the immediate early (IE) gene of cytomegalovirus (CMV), the SV40 early promoter, a retrovirus promoter, a metallothionein promoter, a heat shock promoter, an SRα promoter, or a promoter or enhancer of Moloney murine leukemia virus. The enhancer of the IE gene of human CMV may also be used together with the promoter.

[0080] Recombinant vectors may contain a selectable marker. A selectable marker is a gene that allows for the selection of cells containing the gene. Selection can be positive or negative. Positive selection refers to the process of selecting cells containing the selectable marker through positive selection. Drug resistance is an example of a positive selectable marker; cells containing the marker survive in culture medium containing the drug, while cells lacking the marker die. Selectable markers include drug resistance genes such as neo, which confers resistance to G418; hygr, which confers resistance to hygromycin; and puro, which confers resistance to puromycin. Other positive selectable marker genes include genes that allow for the identification or screening of cells containing the marker. These genes include, among others, fluorescent protein (GFP and GFP-like chromophores, luciferase) genes, lacZ genes, alkaline phosphatase genes, and surface markers such as CD8. Negative selection refers to the process of killing cells containing the negative selectable marker by exposure to an appropriate negative selection drug. For example, cells containing the herpes simplex virus thymidine kinase (HSV-tk) gene [Wigler et al., Cell 11:223 (1977)] are sensitive to the drug ganciclovir (GANC). Similarly, the gpt gene makes cells sensitive to 6-thioxanthine.

[0081] Any method for introducing a recombinant vector into a host cell can be used as long as it is a method for introducing DNA into animal cells, such as electroporation [Cytotechnology, 3, 133 (1990)], calcium phosphate method (Japanese Patent Laid-Open Publication No. 02-227075), or lipofection [Proc. Natl. Acad. Sci. USA, 84, 7413 (1987)].

[0082] II. Heparin-like Substances and Pharmaceutical Compositions Comprising The Same This embodiment provides heparin-like substances or fragments thereof produced by the methods described herein, and pharmaceutical compositions comprising the same. The heparin-like substances or fragments thereof contained in the pharmaceutical compositions may be bound to a core protein. The pharmaceutical compositions may also contain other therapeutic agents. In addition, pharmaceutical compositions can be formulated, for example, by using conventional vehicles or diluents and pharmaceutical additives (e.g., excipients, binders, preservatives) of a type appropriate for the desired method of administration.

[0083] The form of the pharmaceutical composition can be, for example, a sterile injectable aqueous solution. The sterile injectable aqueous solution can be formulated according to known techniques using appropriate dispersing or wetting agents and suspending agents. The sterile injectable aqueous solution can be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent, such as a solution in 1,3-butanediol. Acceptable vehicles and solvents that can be used include water, Ringer's solution, and isotonic saline.

[0084] The dosage form of the pharmaceutical composition is not particularly limited and can be a wide variety of dosage forms. Examples of dosage forms for administering the pharmaceutical composition include tablets, capsules, sachets, lozenges, pills, powders, granules, elixirs, tinctures, liquids, suspensions, elixirs, syrups, ointments, creams, intravenous administration or injection, pastes, emulsions, or solutions. Also included are transdermal administration, for example, via a patch mechanism or ointment. Any of these may be modified into sustained-release and / or extended-release formulations.

[0085] Pharmaceutically acceptable carriers include, but are not limited to, vehicles, adjuvants, surfactants, suspending agents, emulsifiers, inert fillers, diluents, excipients, wetting agents, binders, lubricants, buffers, disintegrants, and carriers. Typically, pharmaceutically acceptable carriers are chemically inert to the active compounds and have no adverse side effects or toxicity under the conditions of use. The nature of the pharmaceutically acceptable carrier may vary depending on the particular dosage form used and other characteristics of the composition.

[0086] III. Methods of Treatment and Prevention This embodiment provides a method for treating or preventing blood coagulation or a condition related to or caused by blood coagulation in a subject in need thereof, comprising administering a heparin-like substance or a fragment thereof produced by the method of this embodiment. In this embodiment, the heparin-like substance or a fragment thereof may be bound to a core protein. Examples of blood coagulation or a condition related to or caused by blood coagulation include acute coronary syndrome, atrial fibrillation, deep vein thrombosis, and pulmonary embolism.

[0087] The subject refers to a mammal. Mammals include, for example, humans, primates, livestock animals (e.g., sheep, cows, horses, donkeys, pigs), companion animals (e.g., dogs, cats), laboratory test animals (e.g., mice, rabbits, rats, guinea pigs, hamsters), and captive wild animals (e.g., foxes, deer). Mammals are typically humans or primates, and more typically humans.

[0088] The dosage and timing of administration are preferably those that provide a therapeutic benefit in the treatment, prevention, or management of blood clotting or blood clotting-related conditions. The specific effective dosage and timing can vary depending on factors such as the subject's condition, medical history, size, weight, age, etc.

[0089] Examples are shown below, but the present invention is not limited to the following examples.

[0090] 1. CHO Cell Culture (1) Medium Composition: FreeStyle CHO Expression Medium (Cat. No. 12651014, Invitrogen) was used to culture CHO-S (Cat. No. R80007, Invitrogen), CHO / 2F-S, CHO / 3F-S, and CHO / 3F-S_CKO cells. Penicillin (Cat. No. 021-07732, Wako) and streptomycin (Cat. No. 194-08512, Wako) were added as antibiotics. L-glutamine (Cat. No. 074-00522, Wako) was also added to the medium to a final concentration of 8 mM. Cells were typically cultured at 1.2 × 10 cells / well in a 24-well tissue culture plate (Cat. No. 150466, Nunc). 5 Cells were seeded at 1000 cells / well and cultured in a humidified 5% CO2 incubator at 37°C.

[0091] CHO / 2F-S cells are CHO-S cells transfected with genes encoding NDST2, Hs3st1, and the extracellular domain of syndecan 1 (SDC1) (SEQ ID NOs: 13, 15, and 11, respectively) (see Patent Document 1). CHO / 3F-S cells are CHO / 2F-S cells transfected with the Hs6st3 gene (SEQ ID NO: 7) (see Patent Document 2). CHO / 3F-S_CKO cells are CHO / 3F-S cells in which the CSGalNAcT2 (CS2) gene has been knocked out (described below).

[0092] (2) Cell culture using bioreactor tubes For suspension culture, cells were cultured in bioreactor tubes (#87050, TPP, Techno Plastic Products AG, Trasadingen, Switzerland) placed at a 45° angle in a shaking incubator (model number 0081704-000, Taitec) at 37°C, 33°C, or 30°C in a 5% CO2 incubator.

[0093] For suspension batch cultures, cells were cultured at 0.5 × 10 610 mL of cells / mL were inoculated into a 50 mL bioreactor tube and cultured for 8 days. For continuous production at high cell densities, 2.0 × 10 7 10 mL of cells were seeded into a 50 mL bioreactor tube at a cell density of 2.0 × 10 cells / mL and cultured for 30 days. The medium was replaced with fresh medium every other day, and the medium was collected and the cell number was counted at each replacement. 7 The cells were reseeded to a density of 100 cells / mL and the culture was continued.

[0094] 2. Evaluation method of cell products (1) Measurement of anti-FXa activity and anti-FIIa activity of culture supernatant The anticoagulant activity of the heparin-like substance contained in the cell culture supernatant was evaluated by measuring the anti-FXa activity and anti-FIIa activity (anti-FXa activity or anti-FIIa activity per sGAG mass (IU / mg)). Each cell line was cultured at 0.6 × 10 6 Cells were seeded in a 6-well plate (Cat. No. 130184, Thermo Scientific) at a cell density of 100 cells / well and 2 mL / well using FreeStyle CHO-S Expression Medium, and the supernatant was collected on day 3 of culture. The undiluted culture supernatant was used as a sample.

[0095] Anti-FXa activity was measured using BIOPHEN HEPARIN ANTI-Xa 2-stage (Cat. No. 221005, HBM), and anti-FIIa activity was measured using BIOPHEN HEPARIN ANTI-IIa 2-stage (Cat. No. 220005, HBM) according to the kit manual.

[0096] The kit's antithrombin powder (R1), FXa (or FIIa) powder (R2), and FXa (or FIIa)-specific luminescent substrate powder (R3) were dissolved in 1 mL of sterile water as instructed. These reagents are usually stored refrigerated and were gently mixed (100 rpm, 30 min, 25°C) in a deep-well maximizer (Model No. M-BR-022UP, Taitec) before the assay. The required amounts were then dispensed, and R1 and R2 solutions were diluted 5-fold with Tris NaCl EDTA BSA buffer, pH 8.40 (Cat. No. AR031K, HBM), and R3 solution was diluted 5-fold with sterile water. Just before use in the assay, the solutions were dispensed into microtubes and incubated at 37°C for 3 minutes in a heating bucket (Cat. No. Electronic Heating Bucket, Taitec).

[0097] Standards were prepared by dissolving BIOPHEN UFH Calibrator (Cat. No. 222301, HBM) powder with known activity in 1 mL of sterile water. Standards were typically stored at -80°C in 5 μL aliquots in PCR tubes. They were thawed at room temperature immediately before use and diluted 15-fold with Tris-NaCl-EDTA buffer. Once thawed, the standard was used only for that assay; any remaining material was discarded. Culture supernatants were centrifuged (10,000 × g, 10 min, RT) before the assay, and 10 μL of each was diluted appropriately with Freestyle CHO medium and used as samples. Commercially available heparin was measured by repeatedly diluting the previously mentioned heparin solution (BIOPHEN UFH Calibrator powder dissolved in sterile water) 10-fold to 0.17 IU / mL.

[0098] (2) Measurement of sGAG content in culture supernatants The sGAG concentration was measured using the Blyscan Glycosaminoglycan Assay Kit (Cat. No. B1000, Biocolor) with some modifications to the protocol. The procedure is as follows:

[0099] Heparan sulfate (Cat. No. H7640-1MG, Merck, bovine kidney-derived) was used as a standard. It was diluted with sterile water to the desired concentrations (0, 0.3125, 0.625, 1.25, 2.5, and 5 μg / mL). After preparing a 5 μg / mL solution, other concentrations were prepared by repeated two-fold dilutions. Culture supernatants were centrifuged (10,000 × g, 10 min, RT) and 150 μL was used before the assay. For commercial heparin, a heparin solution was diluted to 5 μg / mL, and 150 μL was used for the assay. Samples were placed in microtubes, 500 μL of Blyscan Dye Reagent was added, vortexed, and mixed in a deep-well maximizer (100 rpm, 30 min, 25°C). After vortexing again, the DMMB-sGAG complexes were precipitated at 4°C for 16 hours. The mixture was then centrifuged (15,000 × g, 30 min, 4°C), and the supernatant was removed to obtain a pellet. 250 μL of Dye Dissociation Reagent was added to the pellet and completely dissolved by vortexing. 200 μL of the solution was transferred to a 96-well ELISA plate (Cat. No. 3801-96, Iwaki), and the absorbance (656 nm) was measured using a plate reader. A linear approximation to the standard plot was used to create a calibration curve.

[0100] 3. Generation of Chondroitin Sulfate N-Acetylgalactosaminyltransferase 2 (CSGALNACT2 [CS2]) Knockout Cells This section describes the procedure for constructing the gRNA / Cas9 expression vector (pX330-mCherry / CS2) for knockout of the CSGalNAcT2 (Chondroitin sulfate N-acetylgalactosaminyltransferase 2; CS2) gene (NW_003614048) (SEQ ID NO: 23). First, pX330 (#42230, Addgene) was digested with BglII and EcoRI to prepare the donor plasmid. pU6-(BbsI)_CBh-Cas9-T2A-mCherry (#64324, Addgene) was digested with the same enzymes, and the resulting Cas9-2A-mCherry gene was used as the insert fragment. After ligation and transformation, pX330-mCherry was constructed. Next, transformation and plasmid extraction were performed to create pX330-mCherry as a donor plasmid. pX330-mCherry was digested with BbsI. pX330-mCherry / CS2 was generated by ligating the donor plasmid with a double-stranded oligo DNA containing a gRNA sequence targeting CS2 (gRNA / PAM: AACTTCAGCTCTGTCGATCT (SEQ ID NO:25) / GGG) (Figure 1).

[0101] The gRNA / Cas9 expression vector (pX330-mCherry / CS2) described above was transfected into CHO / 3F-S cells using a gene transfection reagent. After 48 hours, red fluorescent-positive cells were sorted using a cell sorter and seeded onto 24-well plates to obtain bulk cells. Although a decrease in sGAG production was observed in the culture supernatant, a significant increase in the anti-FXa specific activity of heparin-like glycans was observed. The CS2-targeted cells were cloned by limiting dilution. The culture supernatant of the obtained clones was then collected and evaluated for anti-FXa specific activity. Among the clones obtained, clone #24, which showed consistently high anti-FXa specific activity, was subjected to PCR amplification of the target sequence within the CS2 gene and sequence analysis revealed gene disruption due to an 8-base deletion at the expected position (Figure 2). This resulted in the establishment of CS2 gene-disrupted CHO cells (CHO / 3F-S_CKO).

[0102] Anti-FXa and anti-FIIa activities were maintained at levels comparable to those before CS2 gene disruption (CHO / 3F-S). Meanwhile, sGAG concentrations were reduced to approximately half of those before gene disruption. This is likely due to a decrease in total glycan production caused by disruption of the CS2 gene, an enzyme involved in the early stage of chondroitin sulfate synthesis. The anti-FXa specific activity was increased 1.6-fold, and the anti-FIIa specific activity was increased 1.9-fold compared to the parent cells (Figure 3). Comparison of sGAG concentrations, anti-FXa, and anti-FIIa activities in the culture supernatants of CHO / 2F-S, CHO / 3F-S, and CHO / 3F-S_CKO cells on day 3 of culture.

[0103] 4. Production of Heparin-Like Glycans in Suspension Batch Culture. The time course of viable cell concentration, sGAG concentration (Fig. 4), anti-FXa activity, anti-FIIa activity (Fig. 5), and specific anti-FXa activity and anti-FIIa activity (Fig. 6) was measured during 8-day suspension batch culture at 37°C and 33°C. Cell growth was suppressed at 33°C. sGAG production was reduced in CHO / 3F-S_CKO cells at both temperatures, whereas anti-FXa and anti-FIIa specific activities were higher in CHO / 3F-S_CKO cells than in other cells. A comparison of anti-FXa and anti-FIIa activities at 37°C and 33°C revealed that they were higher at 33°C, but this effect was more pronounced in CHO / 3F-S_CKO cells. Furthermore, the improvement in anti-FIIa specific activity at lower temperatures was greater than that of anti-FXa specific activity.

[0104] The effects of temperature (37°C, 33°C, and 30°C) on CHO / 3F-S_CKO cells are summarized (Fig. 7). As the incubation temperature decreased, the anti-FXa and anti-FIIa activities increased significantly. The anti-FXa and anti-FIIa specific activities reached their maximum on days 2 and 3 of incubation.

[0105] The increase in the anti-FXa and anti-FIIa specific activities of heparin-like sugar chains produced by cells due to temperature lowering was also observed in cell lines of different origins (Fig. 8).

[0106] The anti-FXa and anti-FIIa specific activities (Fig. 9) and sGAG production levels (Fig. 10) were measured in cell line #24 at lower temperatures (37°C, 33°C, 30°C, 28°C, 26°C, and 24°C). Even at temperatures lower than 30°C, the anti-FXa and anti-FIIa specific activities increased (Fig. 9).

[0107] 5. Continuous production of heparin-like sugar chains by semi-continuous culture. Heparin-like sugar chains were continuously produced by semi-continuous culture of CHO / 3F-S_CKO cells in high-density suspension culture at temperatures of 30°C and 33°C for 30 days (Fig. 11). Both anti-FXa and anti-FIIa activities were nearly stable over 30 days. Heparin-like sugar chains with higher activity were produced by culture at 30°C.

[0108] [Sequences listed in the sequence listing] SEQ ID NO:1 Human NDST2 cDNA (NM_003635) SEQ ID NO:2 Human NDST2, PRT sequence SEQ ID NO:3 Mouse Hs6st1 cDNA (BC052316.1) SEQ ID NO:4 Mouse Hs6st1, PRT sequence SEQ ID NO:5 Mouse Hs6st2 cDNA (BC037659.1) SEQ ID NO:6 Mouse Hs6st2, PRT sequence SEQ ID NO:7 Mouse Hs6st3 cDNA (NM_015820.2) SEQ ID NO:8 Mouse Hs6st3, PRT sequence SEQ ID NO:9 Mouse Hs3st1 cDNA (NM_010474) SEQ ID NO:10 Mouse Hs3st1, PRT sequence SEQ ID NO:11 Human extracellular domain of SDC, nucleotide sequence (corresponding to SEQ ID NO:6 in Patent Document 1) SEQ ID NO:12 Human Extracellular domain of SDC, PRT sequence (corresponding to SEQ ID NO:1 in Patent Document 1) SEQ ID NO:13 Human NDST2, nucleotide sequence (corresponding to SEQ ID NO:4 in Patent Document 1) SEQ ID NO:14 Human NDST2, PRT sequence (corresponding to SEQ ID NO:2 in Patent Document 1) SEQ ID NO:15 Mouse Hs3st1, nucleotide sequence (corresponding to SEQ ID NO:5 in Patent Document 1) SEQ ID NO:16 Hs3st1, PRT sequence (corresponding to SEQ ID NO:3 in Patent Document 1) SEQ ID NO:17 Human heparan sulfate 6-O-sulfotransferase 3 (HS6ST3) (NM_153456) SEQ ID NO:18 Human HS6ST3,PRT sequence SEQ ID NO:19 Human heparan sulfate-glucosamine 3-sulfotransferase 1 (HS3ST1) (NM_005114) SEQ ID NO:20 Human HS3ST1, PRT sequence SEQ ID NO:21 Chondroitin sulfate N-acetylgalactosaminyltransferase 1; CS1 (NW_003613760) SEQ ID NO:22 CS1, PRT sequence SEQ ID NO:23 CSGalNAcT2 Chondroitin sulfate N-acetylgalactosaminyltransferase 2; CS2 (NW_003614048) SEQ ID NO:24 CS2, PRT sequence SEQ ID NO:25 gRNA Sequence,

Claims

1. A method for producing a heparin-like substance, comprising the following steps: (1) preparing mammalian cells that produce a heparin-like substance; and (2) culturing the mammalian cells that produce a heparin-like substance prepared in step (1) at a temperature effective for inhibiting the proliferation of the cells, thereby producing the heparin-like substance.

2. The method of claim 1, wherein the temperature effective in inhibiting proliferation is 2 to 14°C lower than the optimum temperature for proliferation.

3. The method of claim 1, wherein the mammalian cells are CHO cells.

4. The method of claim 1, further comprising the step of recovering the heparin-like substance on days 1 to 4 of culture.

5. The method of claim 1, wherein the culture is carried out continuously for at least 4 weeks.

6. The method according to any one of claims 1 to 5, wherein the temperature effective for inhibiting proliferation is 23 to 35°C.

7. The method of any one of claims 1 to 5, wherein the temperature effective for inhibiting proliferation is 24 to 34°C.

8. The method of any one of claims 1 to 5, wherein the mammalian cells that produce heparin-like substances have been modified with at least one of the following: introduction of a polynucleotide encoding heparan sulfate N-deacetylase / N-sulfotransferase (NDST2); introduction of a polynucleotide encoding heparan sulfate glucosamine 3 sulfotransferase 1 (Hs3st1); introduction of a polynucleotide encoding the extracellular domain of syndecan (SDC); and introduction of a polynucleotide encoding a 6-O-sulfotylase.

9. The method of claim 8, wherein the mammalian cells producing heparin-like substances have all the modifications of the group defined in claim 8.

10. A recombinant heparin-like substance produced by a production method comprising the following steps: (1) preparing CHO cells having at least one modification selected from the group consisting of: - introduction of a polynucleotide encoding NDST2; - introduction of a polynucleotide encoding Hs3st1; - introduction of a polynucleotide encoding the extracellular domain of SDC; and - introduction of a polynucleotide encoding Hs6st3. - knockout of chondroitin sulfate N-acetylgalactosaminyltransferase 2 (CS-GalNAcT2). (2) culturing the CHO cells prepared in step (1) at 24 to 33°C to produce a heparin-like substance in the culture supernatant.

11. The recombinant heparin-like substance according to claim 10, having an anticoagulant factor Xa activity (specific activity per mg) of 100 IU / mg or more.

12. A recombinant heparin-like substance according to claim 10 or 11, having an anticoagulant factor IIa activity (specific activity per mg) of 75 IU / mg or more.

Images