Skin prebiotics composition comprising glycerol and disaccharides

Abstract

The present invention relates to a skin prebiotics composition comprising glycerol and disaccharides. The composition optimizes the content of glycerol and disaccharides to induce the balance of skin microbiota, thereby having an excellent skin improvement effect.

Description

Skin prebiotic composition comprising glycerol and disaccharide

[0001] It relates to a skin prebiotic composition.

[0002] The skin ecosystem provides a diverse habitat for microorganisms, housing a wide range of microorganisms. Humans, as hosts, form a symbiotic relationship with these microorganisms, and their presence is known to have numerous positive effects on the host. Skin is generally cool, acidic, and dry. Structurally, the epidermis forms a barrier, playing a crucial role in blocking the penetration of microorganisms and toxins and retaining moisture. The uppermost layer of the epidermis is composed of the stratum corneum.

[0003] The skin microbiome refers to the community of microorganisms that live on the skin and plays an important role in maintaining the health and balance of the skin. If the balance of the microorganisms that live on normal skin is disrupted, various skin diseases can occur.

[0004] Therefore, there is a need to develop a new composition that induces balance in the skin microbiome.

[0005] One aspect provides a skin prebiotic composition comprising glycerol; and at least one disaccharide selected from the group consisting of lactose, sucrose, and maltose.

[0006] Another aspect provides a cosmetic composition comprising the above skin prebiotics composition.

[0007] Another aspect provides a composition for external application to the skin comprising the above skin prebiotics composition.

[0008] Another aspect provides a pharmaceutical composition for preventing or treating a disease associated with increased skin sebum production, comprising a prebiotic composition.

[0009] Another aspect provides the use of the skin prebiotic composition for the preparation of a cosmetic composition for improving skin condition.

[0010] Another aspect provides the use of the skin prebiotics composition for the preparation of a skin topical composition for improving skin condition.

[0011] Another aspect provides the use of the skin prebiotic composition for the manufacture of a medicament for preventing or treating a disease associated with increased skin sebum production.

[0012] Another aspect provides a method of preventing, improving, or treating a skin condition or a condition related to sebum secretion, comprising the step of treating or administering an effective amount of the above skin prebiotic composition to a subject in need thereof.

[0013] Other purposes and advantages of this application will be further clarified by the detailed description below, taken in conjunction with the appended claims and drawings. Any details not described herein will be readily apparent and inferred by those skilled in the technical field of this application or similar technical fields, and therefore, their description will be omitted.

[0014] Each description and embodiment disclosed in this application may also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions described below.

[0015] One aspect provides a skin prebiotic composition comprising glycerol; and at least one disaccharide selected from the group consisting of lactose, sucrose, and maltose.

[0016] In one experimental example, we sought to identify a saccharide that induces the growth of Staphylococcus epidermidis while inhibiting the growth of Cutibacterium acnes, an acne bacterium. As a result, it was confirmed that disaccharides, specifically lactose, sucrose, and maltose, induced the growth of Staphylococcus epidermidis while maintaining or inhibiting the growth of Cutibacterium acnes.

[0017] As used herein, the term "prebiotics" refers to food that induces the growth of beneficial bacteria. "Skin prebiotics" may refer to food that induces the growth of beneficial bacteria among skin-derived strains. Therefore, a "skin prebiotic composition" may be a composition containing food that induces the growth of beneficial skin bacteria.

[0018] The composition may include glycerol, lactose, and sucrose.

[0019] In the above composition, the weight ratio of glycerol and disaccharide is 2:1 to 100:1, 2:1 to 90:1, 2:1 to 80:1, 2:1 to 70:1, 2:1 to 60:1, 2:1 to 50:1, 2:1 to 40:1, 2:1 to 35:1, 5:1 to 100:1, 5:1 to 90:1, 5:1 to 80:1, 5:1 to 70:1, 5:1 to 60:1, 5:1 to 50:1, 5:1 to 40:1, 5:1 to 35:1, 10:1 to 100:1, 10:1 to 90:1, 10:1 to 80:1, 10:1 to 70:1, 10:1 to 60:1, 10:1 to 50:1, 10:1 to 40:1, 10:1 to 35:1, 15:1 to 100:1, 15:1 to 90:1, 15:1 to 80:1, 15:1 to 70:1, 15:1 to 60:1, 15:1 to 50:1, 15:1 to 40:1, 15:1 to 35:1, 20:1 to 100:1, 20:1 to 90:1, 20:1 to 80:1, 20:1 to 70:1, 20:1 to 60:1, 20:1 to 50:1, 20:1 to 40:1, 20:1 to 35:1, It may be 25:1 to 100:1, 25:1 to 90:1, 25:1 to 80:1, 25:1 to 70:1, 25:1 to 60:1, 25:1 to 50:1, 25:1 to 40:1, 25:1 to 35:1, 30:1 to 100:1, 30:1 to 90:1, 30:1 to 80:1, 30:1 to 70:1, 30:1 to 60:1, 30:1 to 50:1, 30:1 to 40:1, or 30:1 to 35:1. For example, it may be 34.33:1.More specifically, the weight ratio of glycerol, lactose, and sucrose in the composition may be 5 to 200: 1 to 10: 1 to 10, 5 to 200: 1 to 5: 1 to 5, 5 to 100: 1 to 10: 1 to 10, 5 to 100: 1 to 5: 1 to 5, 50 to 100: 1 to 10: 1 to 10, or 50 to 100: 1 to 5: 1 to 5. For example, it may be 69: 1: 1.

[0020] Outside the above range, the prebiotic composition may not sufficiently induce the growth of Staphylococcus epidermidis but may not sufficiently inhibit or suppress the growth of Cutibacterium acnes, thereby failing to induce a healthy skin flora balance.

[0021] In this specification, the term "skin flora" may be used interchangeably with "skin microbiome" and refers to the community of microorganisms living on the skin. The balance of skin flora plays a crucial role in maintaining skin health and balance, and disruption of the microbial community residing on normal skin can lead to various skin diseases.

[0022] In this specification, the term “growth” may be used interchangeably with “activity,” “growth,” and “proliferation,” and may specifically mean increasing the number of strains within the skin.

[0023] According to one experimental example, a skin prebiotic composition containing glycerol and disaccharide in an appropriate weight ratio can induce the growth of Staphylococcus epidermidis while inhibiting the growth of Cutibacterium acnes, thereby increasing the relative abundance of Staphylococcus epidermidis in the skin and inducing the balance of skin flora.

[0024]

[0025] Staphylococcus epidermidis, a Gram-positive bacterium commonly found on the skin, can generate microcurrents. This current is generated by the release of electrons generated during the metabolism of carbon-rich carbohydrates, which are then released into the cell.

[0026] The above composition may generate microcurrents of Staphylococcus epidermidis.

[0027] According to one experimental example, the balance of the skin's flora can appropriately induce the growth of Staphylococcus epidermidis, generating microcurrents that can then inhibit the growth of Cutibacterium acnes.

[0028]

[0029] Another aspect provides a cosmetic composition comprising the prebiotic composition. In the cosmetic composition, the same elements as those already mentioned among the mentioned terminological elements are as described above.

[0030] The above composition may be used to improve skin condition.

[0031] The above skin condition improvement may be acne improvement, sebum secretion improvement, or a combination thereof.

[0032] The term “acne” in this specification may be caused by Cutibacterium acnes, and improvement of acne may specifically mean a decrease in the number of open and closed comedones.

[0033] As used herein, the term "improvement" may mean any action that at least reduces the severity of a symptom, for example, a parameter associated with alleviating or treating a condition.

[0034] In one specific example, the composition is present in an amount of 0.001 wt% to 80 wt%, for example, 0.01 wt% to 60 wt%, 0.01 wt% to 40 wt%, 0.01 wt% to 30 wt%, 0.01 wt% to 20 wt%, 0.01 wt% to 10 wt%, 0.01 wt% to 5 wt%, 0.05 wt% to 60 wt%, 0.05 wt% to 40 wt%, 0.05 wt% to 30 wt%, 0.05 wt% to 20 wt%, 0.05 wt% to 10 wt%, 0.05 wt% to 5 wt%, 0.1 wt% to 60 wt%, 0.1 wt% to 40 wt%, 0.1 wt% to 30 wt%, It may be included in an amount of 0.1 wt% to 20 wt%, 0.1 wt% to 10 wt%, 0.1 wt% to 5 wt%, 0.1 wt% to 3 wt%, or 0.1 wt% to 2 wt%.

[0035] The above cosmetic composition may have, for example, a cosmetic formulation of a softening toner, a nourishing toner, a massage cream, a nourishing cream, an essence, a pack, a patch, a mask sheet, a gel, an ointment, an ampoule, or a skin adhesive type.

[0036] The ingredients included in the above cosmetic composition may include ingredients commonly used in cosmetic compositions in addition to the composition as an active ingredient, and may include, for example, conventional auxiliary agents and carriers such as stabilizers, solubilizers, vitamins, pigments, and fragrances.

[0037]

[0038] Another aspect provides a composition for external application of skin comprising the above-mentioned skin prebiotic composition. In the composition for external application of skin, the same elements as those already mentioned among the mentioned terminological elements are as described above.

[0039] The above skin external preparation may be a cream, gel, ointment, skin emulsifier, skin suspension, transdermal patch, drug-containing bandage, lotion, or a combination thereof.

[0040] The above skin external preparation may be appropriately mixed with ingredients commonly used in skin external preparations such as cosmetics or medicines, such as aqueous ingredients, oily ingredients, powder ingredients, alcohols, moisturizers, thickeners, UV absorbers, whitening agents, preservatives, antioxidants, surfactants, fragrances, coloring agents, various skin nutrients, or combinations thereof, as needed. The above skin external preparation may also appropriately mix with metal sequestering agents such as disodium edetate, trisodium edetate, sodium citrate, sodium polyphosphate, sodium metaphosphate, and gluconic acid, caffeine, tannin, bellapamil, licorice extract, glablidin, various herbal medicines, tocopheryl acetate, glycyrrhizic acid, tranexamic acid and derivatives or salts thereof, vitamin C, magnesium ascorbate phosphate, ascorbic acid glucoside, arbutin, or kojic acid.

[0041] In one specific example, the composition is present in an amount of 0.001 wt% to 80 wt%, for example, 0.01 wt% to 60 wt%, 0.01 wt% to 40 wt%, 0.01 wt% to 30 wt%, 0.01 wt% to 20 wt%, 0.01 wt% to 10 wt%, 0.01 wt% to 5 wt%, 0.05 wt% to 60 wt%, 0.05 wt% to 40 wt%, 0.05 wt% to 30 wt%, 0.05 wt% to 20 wt%, 0.05 wt% to 10 wt%, 0.05 wt% to 5 wt%, 0.1 wt% to 60 wt%, 0.1 wt% to 40 wt%, 0.1 wt% to 30 wt%, It may be included in an amount of 0.1 wt% to 20 wt%, 0.1 wt% to 10 wt%, 0.1 wt% to 5 wt%, 0.1 wt% to 3 wt%, or 0.1 wt% to 2 wt%.

[0042]

[0043] Another aspect provides a pharmaceutical composition for the prevention or treatment of a disease associated with increased skin sebum production, comprising a prebiotic composition. In the pharmaceutical composition, the elements of the terminology mentioned above are identical to those already mentioned.

[0044] As used herein, the term “prevention” means any action that inhibits or delays the possibility of developing a skin-related disease by administering the composition of the present invention.

[0045] As used herein, the term “treatment” means any action that improves or beneficially changes the symptoms of a skin-related disease by administering the composition of the present invention.

[0046] Diseases associated with increased sebum production may include acne, seborrheic dermatitis, or folliculitis.

[0047] The pharmaceutical composition may additionally comprise a pharmaceutically acceptable diluent or carrier. The diluent may be lactose, corn starch, soybean oil, microcrystalline cellulose, or mannitol, and the lubricant may be magnesium stearate, talc, or a combination thereof. The carrier may be an excipient, a disintegrant, a binder, a glidant, or a combination thereof. The excipient may be microcrystalline cellulose, lactose, low-substituted hydroxycellulose, or a combination thereof. The disintegrant may be calcium carboxymethylcellulose, sodium starch glycolate, calcium dihydrogen phosphate anhydrous, or a combination thereof. The binder may be polyvinylpyrrolidone, low-substituted hydroxypropylcellulose, hydroxypropylcellulose, or a combination thereof. The lubricant may be magnesium stearate, silicon dioxide, talc, or a combination thereof.

[0048] The pharmaceutical composition may be formulated as an oral or parenteral dosage form. The oral dosage form may be a granule, powder, liquid, tablet, capsule, dry syrup, or a combination thereof. The parenteral dosage form may be an injection.

[0049]

[0050] Another aspect provides a method for preventing, improving, or treating a condition of a subject, comprising administering an effective amount of the above-described composition to a subject in need thereof. The condition of the subject may be a skin condition or a condition related to sebum secretion. The condition related to sebum secretion may be a disease associated with increased sebum production in the skin.

[0051] The above prebiotics may be administered in combination with probiotics. Specifically, the prebiotics may be administered simultaneously, separately, or sequentially.

[0052] The terms "administering," "introducing," and "implanting" are used interchangeably and may refer to placement of a composition according to one embodiment into a subject by a method or route that results in at least partial localization of the composition to a desired site according to one embodiment.

[0053] Administration may be by any method known in the art. Administration may be administered directly to the subject by any means, including intravenous, intramuscular, oral, transdermal, mucosal, intranasal, intratracheal, or subcutaneous administration. Administration may be systemic or local.

[0054] The subject may be a mammal, such as a human, cow, horse, pig, dog, sheep, goat, or cat. The subject may be an individual in need of an effect to improve a skin condition, such as improving acne, improving sebum secretion, or a combination thereof.

[0055] The above administration may be 0.1 mg to 1,000 mg of the composition according to one specific example per subject per day, for example, 0.1 mg to 500 mg, 0.1 mg to 100 mg, 0.1 mg to 50 mg, 0.1 mg to 25 mg, 1 mg to 1,000 mg, 1 mg to 500 mg, 1 mg to 100 mg, 1 mg to 50 mg, 1 mg to 25 mg, 5 mg to 1,000 mg, 5 mg to 500 mg, 5 mg to 100 mg, 5 mg to 50 mg, 5 mg to 25 mg, 10 mg to 1,000 mg, 10 mg to 500 mg, 10 mg to 100 mg, 10 mg to 50 mg, or 10 mg to 25 mg. However, the dosage may be prescribed in various ways depending on factors such as the formulation method, administration method, patient age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and response sensitivity, and a person skilled in the art can appropriately adjust the dosage by considering these factors. The frequency of administration may be once a day or twice or more within the range of clinically acceptable side effects, and the administration may be done in one or more sites, and the total number of administration days may be from 1 to 30 days per treatment, daily or at intervals of 2 to 5 days. If necessary, the same treatment may be repeated after an appropriate period. For animals other than humans, the same dosage as for humans per kg may be used, or the above dosage may be converted into an amount based on the volume ratio (e.g., average value) of the organs (e.g., heart) of the target animal and the human.

[0056]

[0057] Another aspect provides the use of the skin prebiotic composition for the preparation of a cosmetic composition for improving skin condition.

[0058] Another aspect provides the use of the skin prebiotics composition for the preparation of a skin topical composition for improving skin condition.

[0059] Another aspect provides the use of the skin prebiotic composition for the manufacture of a medicament for preventing or treating a disease associated with increased skin sebum production.

[0060] Since the above method or use includes or utilizes the aforementioned skin prebiotic composition as it is, description of common contents between them is omitted to avoid excessive complexity of the present specification.

[0061] The composition according to the daily aspect has an excellent skin condition improvement effect by inducing the balance of skin flora by optimizing the content of glycerol and disaccharide.

[0062] Figure 1 is a diagram showing the average voltage (Mv) measured after treatment with a prebiotic composition in a culture medium of Staphylococcus epidermidis.

[0063] Figure 2 shows the results of examining the skin flora after treatment with a skin prebiotic composition of one aspect, based on Staphylococcus epidermidis.

[0064] Figure 3 shows the results of confirming the acne improvement effect after treatment with a skin prebiotic composition of one aspect.

[0065] Figure 4 shows the results of confirming the effect of reducing skin sebum after treatment with a skin prebiotic composition of one aspect.

[0066] Hereinafter, preferred examples are presented to aid in understanding the present invention. However, the following examples are provided solely to facilitate a better understanding of the present invention, and the scope of the present invention is not limited by the following examples.

[0067]

[0068] Experimental Example 1. Identification of a sugar that induces skin microflora balance.

[0069] In this experimental example, we aimed to identify a sugar that induces the growth of Staphylococcus epidermidis while inhibiting the growth of Cutibacterium acnes, an acne bacterium.

[0070]

[0071]

[0072]

[0073]

[0074]

[0075]

[0076] O: Growth promotion, X: Growth inhibition, Δ: Growth maintenance

[0077] As a result, as shown in Tables 1 to 3 above, it was confirmed that the disaccharide induced the growth of Staphylococcus epidermidis while maintaining or inhibiting the growth of Cutibacterium acnes.

[0078]

[0079] Experimental Example 2. Measurement of Microcurrent Generation from Skin Prebiotics

[0080] In this experimental example, a skin prebiotic composition was supplied to a culture medium of Staphylococcus epidermidis, and the generation of microcurrent was measured. Purified water was used as a control.

[0081] As a result, as shown in Fig. 1, it was confirmed that the skin prebiotics composition generated microcurrent in a Staphylococcus epidermidis culture solution.

[0082]

[0083] Experimental Example 3. Measurement of the relative abundance of skin strains in skin prebiotics.

[0084] In this experimental example, a skin prebiotic composition containing glycerol and disaccharides was prepared, and the relative abundance of C. acnes and S. aureus was measured based on S. epidermidis.

[0085] Specifically, glycerol, lactose, and sucrose were added to a solvent according to the contents and ratios of the raw materials in Table 4 below, mixed, and stirred to prepare a skin prebiotic composition. As a result, skin prebiotic compositions (Examples 1 to 3, Comparative Examples 1 and 2) containing different ratios of each mixed raw material were obtained.

[0086]

[0087]

[0088] After that, DNA was extracted from the co-culture solution of S. aures, S. epidermidis, and C. acnes containing the compositions of Examples 1 to 3 and Comparative Examples 1 to 3 using the QIAamp PowerFecal Pro DNA Kit (Qiagen). DNA was quantified using NanoDrop (NanoDrop One, ThermoFisher Scientific, USA) and Qubit (Qubit Fluorometer 4.0, ThermoFisher Scientific, USA) and then stored frozen until the experiment. dsDNA Quantification Assay Kits (ThermoFisher Scientific, USA) were used as the Qubit reagent. Thereafter, qPCR was performed under the conditions of Tables 5 to 7 below. Table 5 shows the primer information, and Tables 6 and 7 show the qPCR reaction conditions. qPCR was performed using a CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA).

[0089]

[0090]

[0091]

[0092]

[0093]

[0094]

[0095] After that, the Ct value was measured using the V5 primer to quantify all microorganisms present in each sample, and the Ct values ​​were measured using the greA, AD, and NUDIX primers to quantify the target microorganisms. The Ct value of each sample was converted to an expression value, and the greA, AD, and NUDIX expression values ​​were normalized based on the V5 expression value of each sample to unify the amount of all microorganisms in the sample through V5, thereby correcting for the relative comparison of the amount of target microorganisms present in different samples. The expression value of the S. epidermidis sample was fixed to 1, and the ratio of the expression value of the remaining groups to this was calculated to indicate the relative abundance of each microorganism. The results are shown in Table 8 and Fig. 2.

[0096]

[0097]

[0098] As a result, as shown in Table 8 and Fig. 2, it was confirmed that the relative abundance of Staphylococcus epidermidis, a skin beneficial bacterium, was significantly increased in Examples 1 to 3 compared to the comparative examples.

[0099] In summary of the above results, the skin prebiotic compositions according to Examples 1 to 3 contain glycerol and disaccharides in an appropriate weight ratio to induce the growth of Staphylococcus epidermidis while inhibiting the growth of Cutibacterium acnes, thereby increasing the relative abundance of Staphylococcus epidermidis in the skin and inducing the balance of skin flora. In addition, it was confirmed that the balance of skin flora can appropriately induce the growth of Staphylococcus epidermidis to generate microcurrent, thereby inhibiting the growth of Cutibacterium acnes.

[0100]

[0101] Experimental Example 4. Confirming the Acne Improvement Effect of Skin Prebiotic Products

[0102] In this experimental example, the acne-improving effect of a skin prebiotic product was confirmed. Specifically, the skin prebiotic composition of Example 1 was applied to an individual with acne skin for 4 weeks, and the skin was visually evaluated.

[0103] As a result, as shown in Fig. 3, it was confirmed that the number of open and closed comedones in individuals with acne skin was significantly reduced.

[0104]

[0105] Experimental Example 5. Confirmation of the sebum reduction effect of skin prebiotic products.

[0106] In this experimental example, the effect of the skin prebiotic composition of Example 1 on skin sebum amount was confirmed. Specifically, the product was applied to an individual with acne skin for 4 weeks, and the skin sebum amount (%) was measured.

[0107] As a result, as shown in Fig. 4, it was confirmed that the amount of skin sebum in individuals with acne skin was significantly reduced.

[0108]

[0109] The foregoing description of the present invention is provided for illustrative purposes only. Those skilled in the art will readily appreciate that the present invention can be readily modified into other specific forms without altering the technical spirit or essential characteristics of the present invention. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive.

[0110] Sequence number 1: GGATTAGATACCCTGGTA

[0111] Sequence number 2:CCGTCAATTCMTTTRAGTTT

[0112] Sequence number 3:CCAGGTGATGAAGAGGAAAGTT

[0113] Sequence number 4: CCATTAGGTAGTGGAACACGAA

[0114] Sequence number 5: TTATGGKTGGATCGTGACTG

[0115] Sequence number 6: GTTGGAATCTCAATCGCCAC

[0116] Sequence number 7:GCGAGGCCMGAGAAGAAAC

[0117] Sequence number 8: GTAGACCRCACACCGGATGC

Claims

1. A skin prebiotic composition comprising glycerol and at least one disaccharide selected from the group consisting of lactose, sucrose, and maltose.

2. A skin prebiotics composition according to claim 1, wherein the weight ratio of glycerol and disaccharide in the composition is 2:1 to 100:

1.

3. In claim 1, the composition is a skin prebiotic composition comprising glycerol, lactose, and sucrose.

4. A skin prebiotics composition according to claim 3, wherein the weight ratio of glycerol, lactose, and sucrose in the composition is 5 to 200: 1 to 10: 1 to 10.

5. A skin prebiotic composition according to claim 1, wherein the composition induces skin flora balance.

6. A skin prebiotic composition according to claim 5, wherein the balance of the skin flora is achieved by inducing the growth of Staphylococcus epidermidis and inhibiting the growth of Cutibacterium acnes.

7. A skin prebiotic composition according to claim 1, wherein the composition is for improving skin condition.

8. A skin prebiotics composition according to claim 7, wherein the improvement in skin condition is improvement in acne, improvement in sebum secretion, or a combination thereof.

9. A cosmetic composition comprising the skin prebiotics composition of claim 1.

10. A skin external application composition comprising the skin prebiotics composition of claim 1.

11. A pharmaceutical composition for preventing or treating a disease associated with increased sebum secretion, comprising the skin prebiotic composition of claim 1.

Images