Compositions and methods for low glucosinolate brassica

Abstract

Provided are plants, cells, tissues, and germplasm thereof comprising one or more targeted alterations of the genomic sequences of the MYB28 gene which encodes a transcription factor and regulates the biosynthesis of glucosinolates, as well as meal made from such plant materials. Also provided are methods and compositions to make altered MYB28 gene variants; breeding methods and methods of identifying and selecting plant materials having the disclosed MYB28 variants.

Description

COMPOSITIONS AND METHODS FOR LOW GLUCOSINOLATE BRASSICA REFERENCE TO A SEQUENCE LISTING SUBMITTTED ELECTRONICALLY

[0001] The official copy of the sequence listing is submitted electronically via Patent Center as an XML formatted sequence listing with a file named 212390-US-PRV-1.xml created on July 1, 2024, and having a size of 181,927 bytes and is filed concurrently with the specification. The sequence listing comprised in this XML formatted document is part of the specification and is herein incorporated by reference in its entirety.

[0002] The sequence descriptions (Table 1) and sequence listing attached hereto comply with the rules governing nucleotide and amino acid sequence disclosures in patent applications as set forth in 37 C.F.R. §§1.831-1.835. FIELD OF THE DISCLOSURE

[0003] The disclosure relates to glucosinolate metabolism in Brassica, variants of MYB28 gene that reduce glucosinolate in Brassica grain and meal made thereof. BACKGROUND OF THE INVENTION

[0004] Brassica napus (also referred to herein as canola or oilseed rape) is an allotetraploid (2n= 4x = 38, AACC) comprising two full genome sets, four component genomes, and total of 38 chromosomes. The A genome includes 10 chromosomes and is derived from B. rapa (2n = 2x = 20, AA). The C genome includes 9 chromosomes and is derived from B. oleracea (2n = 2x = 18, CC). B. napus is one of the most important vegetable oilseed crops in the world, especially in China, Canada, the European Union and Australia. Canola meal, the fraction of the seed remaining after crushing and oil extraction, is approximately 55% of the volume of canola seed.

[0005] While canola meal is rich in protein and capable of providing a substantial amount of energy when used in animal feed, its high fiber content decreases its digestibility and its value as an animal feed. Because of its high dietary fiber, canola meal has about 20% less metabolizable energy (ME) than soybean meal. As a result, the value of the meal has remained low relative to other oilseed meals such as soybean meal, particularly in rations for pigs and poultry. Rakow (2004a) Canola meal quality improvement through the breeding of yellow-seeded varieties—an historical perspective, in AAFC Sustainable Production Systems Bulletin.

[0006] In addition to the high dietary fiber content, the presence of glucosinolates in canola meals also decreases its value. Glucosinolate constitute a large family of over 100 related molecules with a common sulfur containing core structure and with side chains of varying size and chemistry (Fahey et al., 2001; Halkier and Gershenzon, 2006). While glucosinolates are found in many plant structures (leaf, vascular tissue, stem, root, and flowers, to cite some examples), they are accumulated in high concentrations in the seed (Bellostas et al., 2004). This is particularly true for the oil seed Brassicas. These compounds and their metabolites can impact the taste of the meal, reducing its palatability and can also adversely impact the animal's health directly. For example, hydrolysis products of beta hydroxyalkenyl glucosinolates have been shown to possess goitrogenic activity in animal models (reviewed in Fahey et al., 2001). This is particularly an issue in monogastic animals such as swine, but poultry and cattle can be susceptible to varying degrees. Thus, there is a desire to modify genes and develop new varieties of Brassica napus with reduced glucosinolate in oil seed meal which can have significant benefits in terms of meal value. SUMMARY OF THE INVENTION

[0007] The disclosed compositions and methods are based, at least in part, on the surprising discovery that levels of glucosinolate in Brassica napus can be decreased by a targeted alteration of the genomic sequence of MYB28 (myb domain protein 28) gene which encodes a transcription factor and regulates the biosynthesis of glucosinolates. The evidence herein demonstrates that targeted alterations of MYB28 lead to significantly decreased glucosinolate levels in Brassica napus plants and meal therefrom. Moreover, the evidence herein demonstrates that the disclosed targeted alterations of MYB28 lead to significantly decreased glucosinolate levels in Brassica napus and meal made therefrom. The term Brassica napus as used herein includes crop varieties of the species such as spring oilseed rape, winter oilseed rape, and low erucic cultivars of the foregoing which are called canola.

[0008] Provided herein is a method of decreasing glucosinolate in Brassica napus plant, cell, seed, tissue or germplasm thereof, that comprises introducing a targeted alteration to the sequence of a MYB28 gene. Targeted alterations can be made to a MYB28 gene to thereby generate a Brassica napus plant, cell, seed, tissue or germplasm thereof that comprises one or more MYB28 variants which can provide a decreased level of glucosinolate relative to the plant, seed, tissue or germplasm thereof prior to introducing the one or more MYB28 variants. In oneaspect, the method comprises introducing a targeted alteration of one or more alleles of MYB28 on chromosome A2, A3, C2, C7, or C9. The types of targeted alterations that can be used to create MYB28 variants disclosed herein include nonsense mutations, missense mutations, and deletions that eliminate or reduce MYB28 gene function. For example, the targeted alteration can be a premature termination codon that reduces or eliminates expression of a full-length protein encoded by the altered MYB28 variant. Particular examples of a targeted alteration are shown in Table 3, Table 4, or Table 5 herein for chromosome A2 (MYB28.A2), chromosome A3 (MYB28.A3), chromosome C2 (MYB28.C2), chromosome C7 (MYB28.C7), or chromosome C9 (MYB28.C9). Each of the following includes an example of a targeted alteration disclosed herein: SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, or SEQ ID NO:67.

[0009] Disclosed herein is a method of decreasing glucosinolate in Brassica napus plant, cell, seed, tissue or germplasm thereof, that comprises introducing a targeted alteration to the sequence of the MYB28 gene to generate a Brassica napus plant, cell, seed, tissue or germplasm thereof comprising a homozygous variant of MYB28. For example, targeted alterations can be introduced to make Brassica napus plant, cell, seed, tissue or germplasm thereof comprising homozygous knockouts of MYB28 (null for MYB28.A2, MYB28.A3, MYB28.C2, MYB28.C7, MYB28.C9, or combinations thereof). Particular examples of such targeted alterations that can be used to generate MYB28 alleles are shown in Table 3, Table 4, or Table 5 herein. Additionally, examples of targeted alterations that can be used are shown in each of SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ IDNO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, or SEQ ID NO:67.

[0010] In particular examples, the disclosed method comprises introducing a targeted alteration into MYB28 genes of Brassica napus plant, cell, seed, tissue or germplasm thereof, thereby introducing MYB28 variant alleles, which are disclosed by reference to the variant alleles disclosed in Table 3, Table 4, or Table 5 herein, such that the term “MYB28.A2 Variant” refers to MYB28.A2_v1, MYB28.A2_v2, MYB28.A2_v3, MYB28.A2_v4, MYB28.A2_v 5, MYB28.A2_v6, MYB28.A2_v7, MYB28.A2_v8, MYB28.A2_v9, or MYB28.A2_v10; “MYB28.A3 Variant” refers to MYB28.A3_v1, MYB28.A3_v2, MYB28.A3_v3, MYB28.A3_v4, MYB28.A3_v 5, MYB28.A3_v6, or MYB28.A3_v7; the term “MYB28.C2 Variant” refers to MYB28.C2_v1, MYB28.C2_v2, MYB28.C2_v3, MYB28.C2_v4, MYB28.C2_v5, or MYB28.C2_v10; the term “MYB28.C7 Variant” refers to MYB28.C7_v1, MYB28.C7_v2, MYB28.C7_v3, MYB28.C7_v4, MYB28.C7_v5,MYB28.C7_v10; the term “MYB28.C9 Variant” refers to MYB28.C9_v1, MYB28.C9_v2, MYB28.C9_v3, MYB28.C9_v4, MYB28.C9_v5, MYB28.C9_v6, MYB28.C9_v7, MYB28.C9_v8, MYB28.C9_v9, or MYB28.C9_v10. For example, the method includes introducing (i) any homozygous MYB28.A3 Variant described herein combined with any heterozygous or homozygous MYB28.C2 Variant, MYB28.C7 Variant, or MYB28.C9 Variant described herein; (ii) any homozygous MYB28.C2 Variant described herein combined with any heterozygous or homozygous MYB28.A3 Variant, MYB28.C7 Variant, or MYB28.C9 Variant described herein; (iii) any homozygous MYB28.C7 Variant described herein combined with any heterozygous or homozygous MYB28.A3 Variant, MYB28.C2 Variant, or MYB28.C9 Variant described herein; or (iv) any homozygous MYB28.C9 Variant described herein combined with any heterozygous or homozygous MYB28.A3 Variant, MYB28.C2 Variant, or MYB28.C7 Variant described herein.

[0011] In each of the foregoing methods of introducing targeted alterations to one or more MYB28 gene alleles, the Brassica napus plant, cell, seed, tissue or germplasm thereof that is altered can also further comprise an altered or variant gene that provides additional desirablemeal quality. Thus, the method can comprise introducing targeted alterations that generate one or more MYB28 variants in Brassica napus plant, cell, seed, tissue or germplasm thereof that further includes a targeted alteration, mutation or variant of one or more of LPA1, TT2, TT8, DFR, F3H, ANR, LDOX, MAM1, MRP1, or MRP2. The desirable meal quality provided by each of LPA1, MRP1, and MRP2 is reduced phytate and / or increased inorganic phosphate content. Each of TT2, TT8, DFR, and F3H, ANR, and LDOX can reduce fiber content. MAM1 can reduce glucosinolate content. The method can also comprise introducing targeted alterations that generate one or more MYB28 variants in Brassica napus plant, cell, seed, tissue or germplasm thereof that provides increased Brassica napus meal protein and / or low fiber. Such germplasm, for example, are disclosed in US Patent Nos.9,375,025 and 10,791,692; as well as International Patent Application Publication Nos. WO 2020 / 131600.

[0012] Also provided herein are Brassica napus plant materials produced by the methods disclosed herein. Accordingly, provided herein is a Brassica napus plant, cell, seed, tissue or germplasm thereof that comprises one or more MYB28 variants, wherein the variants comprise a targeted alteration of MYB28.A2, MYB28.A3, MYB28.C2, MYB28.C7, or MYB28.C9. The MYB28 variants can be one or more alleles of MYB28 on chromosome A2, A3, C2, C7, or C9. The types of targeted alterations include nonsense mutations, missense mutations, and deletions that eliminate or reduce MYB28 gene function. For example, the targeted alteration can be a premature termination codon that reduces or eliminates expression of a full-length protein encoded by the altered MYB28 allele. Particular examples of a targeted alteration are shown in Table 3, Table 4, or Table 5 herein for MYB28 on chromosome A2 (MYB28.A2), on chromosome A3 (MYB28.A3), on chromosome C2 (MYB28.C2), on chromosome C7 (MYB28.C7), or on chromosome C9 (MYB28.C9). An example of a targeted alteration comprising a premature termination codon is shown in each of SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ IDNO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, or SEQ ID NO:67.

[0013] In other examples, the disclosure provides Brassica napus plant, cell, seed, tissue or germplasm thereof comprising any combination of MYB28 variant alleles disclosed herein including (see definition above of terms “MYB28.A2 Variant”, “MYB28.A3 Variant”, “MYB28.C2 Variant”, “MYB28.C7 Variant”, or “MYB28.C9 Variant” and variants disclosed in Table 3, Table 4, or Table 5 herein): (i) any homozygous MYB28.A2 Variant described herein combined with any heterozygous or homozygous MYB28.A3 Variant, MYB28.C2 Variant, MYB28.C7 Variant, or MYB28.C9 Variant described herein; (ii) any homozygous MYB28.A3 Variant described herein combined with any heterozygous or homozygous MYB28.A2 Variant, MYB28.C2 Variant, MYB28.C7 Variant, or MYB28.C9 Variant described herein; (iii) any homozygous MYB28.C2 Variant described herein combined with any heterozygous or homozygous MYB28.A2 Variant, MYB28.A3 Variant, MYB28.C7 Variant, or MYB28.C9 Variant described herein; (iv) any homozygous MYB28.C7 Variant described herein combined with any heterozygous or homozygous MYB28.A2 Variant, MYB28.A3 Variant, MYB28.C2 Variant, or MYB28.C9 Variant described herein; or (v) any homozygous MYB28.C9 Variant described herein combined with any heterozygous or homozygous MYB28.A2 Variant, MYB28.A3 Variant, MYB28.C2 Variant, or MYB28.C7 Variant described herein.

[0014] In particular examples, each of the foregoing Brassica napus plant, cell, seed, tissue or germplasm thereof comprising one or more MYB28 variants can further include a targeted alteration, mutation or variant of one or more of the following genes: LPA1, TT2, TT8, DFR, F3H, ANR, LDOX, MAM1, MRP1 or MRP2, which can provide additional desirable meal quality. In additional examples, each of the foregoing Brassica napus plant, cell, seed, tissue or germplasm thereof comprising one or more MYB28 variants can further include increased Brassica napus meal protein and / or low fiber. Such germplasm, for example, are disclosed in US Patent Nos.9,375,025 and 10,791,692; as well as International Patent Application Publication Nos. WO 2020 / 131600.

[0015] Each of the Brassica napus plant, seed, tissue or germplasm thereof comprising one or more MYB28 variants disclosed herein can be used to produce oilseed or grain which is milled to produce meal, e.g., canola meal. In preferred embodiments, the meal produced from the disclosed Brassica napus oilseed comprises decreased levels of glucosinolate relative to controlseed or grain lacking the one or more MYB28 variants. In further preferred embodiments, the oilseed or grain comprises total glucosinolate content equal to or less than 7.0 µmole / g, 6.0 µmole / g, or 5.0 µmole / g. As used herein “control” refers to seed or grain that lacks the one or more MYB28 variants but is otherwise isogenic or substantially isogenic to the Brassica napus disclosed herein.

[0016] Accordingly provided herein is a method of producing reduced glucosinolate Brassica napus meal, the method comprising providing or selecting any of the Brassica napus seed or grain disclosed herein that comprises one or more MYB28 variants, wherein the variants comprise a targeted alteration of MYB28 and the selected seed or grain comprise decreased glucosinolate relative to control seed or grain lacking the one or more MYB28 variants. The method then comprises milling the selected seed or grain to produce reduced glucosinolate Brassica napus meal. In any of the aspects, embodiments or examples of this method disclosed herein, the method can further include providing this reduced glucosinolate Brassica napus meal in feed to an animal, e.g., a monogastric animal. Preferred monogastric animals include swine and chickens (e.g., egg-laying hens, broilers, pullets, etc.) as well as other poultry such as turkeys, ducks, geese, guinea fowl, etc. Feed containing this reduced glucosinolate Brassica napus meal can also be fed to horses, rabbit, or any other commercially raised animal.

[0017] In one aspect, a method of producing reduced glucosinolate Brassica napus meal comprises milling Brassica napus seed or grain that comprises a targeted alteration to one or more alleles of MYB28 on chromosome A2, A3, C2, C7, or C9. The types of targeted alterations include nonsense mutations, missense mutations, and deletions that eliminate or reduce MYB28 gene function. For example, the targeted alteration can be a premature termination codon that reduces or eliminates expression of a full-length protein encoded by the altered MYB28 allele. Particular examples of a targeted alteration are shown in Table 3, Table 4, or Table 5 herein for MYB28 on chromosome A2, A3, C2, C7, or C9. An example of a targeted alteration is shown in each of SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ IDNO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, or SEQ ID NO:67. In other examples of this method of producing reduced glucosinolate meal, the method comprises milling seed or grain that comprises any combination of MYB28 variants disclosed herein (see definition above of terms “MYB28.A2 Variant”, “MYB28.A3 Variant”, “MYB28.C2 Variant”, “MYB28.C7 Variant”, or “MYB28.C9 Variant” and variants disclosed in Table 3, Table 4, or Table 5 herein): (i) any homozygous MYB28.A2 Variant described herein combined with any heterozygous or homozygous MYB28.A3 Variant, MYB28.C2 Variant, MYB28.C7 Variant, or MYB28.C9 Variant described herein; (ii) any homozygous MYB28.A3 Variant described herein combined with any heterozygous or homozygous MYB28.A2 Variant, MYB28.C2 Variant, MYB28.C7 Variant, or MYB28.C9 Variant described herein; (iii) any homozygous MYB28.C2 Variant described herein combined with any heterozygous or homozygous MYB28.A2 Variant, MYB28.A3 Variant, MYB28.C7 Variant, or MYB28.C9 Variant described herein; (iv) any homozygous MYB28.C7 Variant described herein combined with any heterozygous or homozygous MYB28.A2 Variant, MYB28.A3 Variant, MYB28.C2 Variant, or MYB28.C9 Variant described herein; or (v) any homozygous MYB28.C9 Variant described herein combined with any heterozygous or homozygous MYB28.A2 Variant, MYB28.A3 Variant, MYB28.C2 Variant, or MYB28.C7 Variant described herein.

[0018] In another aspect, provided herein is a screening method for identifying Brassica napus plant, cell, seed, tissue or germplasm thereof comprising one or more MYB28 variants associated with decreased glucosinolate level (e.g., relative to control lacking the one or more MYB28 variants). The method comprises providing a Brassica napus plant, cell, seed, tissue or germplasm thereof comprising one or more MYB28 variants disclosed herein (e.g., any of the foregoing disclosed examples of a Brassica napus plant, cell, seed, tissue or germplasm thereof comprising one or more MYB28 variants), obtaining a sample comprising nucleic acid from the plant, cell, seed, tissue or germplasm thereof, then screening the sample for any of the following: a) the one or more MYB28 variants or b) one or more marker alleles that are genetically linked to the one or more of the MYB28 variants. The method can then further comprise detecting the one or more (i) MYB28 variants or (ii) marker alleles in the sample to thereby identify the Brassicanapus plant, cell, seed, tissue or germplasm thereof as having an MYB28 variant associated with decreased glucosinolate level.

[0019] In still further embodiments, the method can additionally include selecting the Brassica napus plant, cell, seed, tissue or germplasm thereof identified as having an MYB28 variant associated with decreased glucosinolate level. The selected plant material can be used for breeding or trait introgression.

[0020] For example, the method of identifying can include screening the sample for the presence of a marker allele linked to each of the one or more the MYB28 variant, e.g., by 5 cM, 4 cM, 3 cM, 2 cM, 1 cM, 0.9 cM, 0.8 cM, 0.7 cM, 0.6 cM, 0.5 cM, 0.4 cM, 0.3 cM, 0.2 cM, 0.1 cM, or less on a single meiosis-based genetic map, and associated. In other examples, the method can include detecting one or more targeted alteration to one or more alleles of MYB28 on chromosome A2, A3, C2, C7, or C9. The types of targeted alterations include nonsense mutations, missense mutations, and deletions that eliminate or reduce MYB28 gene function (e.g., a premature termination codon that reduces or eliminates expression of a full-length protein encoded by the altered MYB28 allele). Particular examples of a targeted alteration that can be detected in accordance with the method are shown in Table 3, Table 4, or Table 5 for MYB28 on chromosome A2 (MYB28.A2), on chromosome A3 (MYB28.A3), chromosome C2 (MYB28.C2), chromosome C7 (MYB28.C7), or chromosome C9 (MYB28.C9). The method can include detecting a targeted alteration shown in each of SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, or SEQ ID NO:67. In other examples, this method can include detecting any combination of MYB28 variants disclosed herein (see definition above of terms “MYB28.A2 Variant”, “MYB28.A3 Variant”, “MYB28.C2 Variant”, “MYB28.C7 Variant”, or “MYB28.C9 Variant” and variants disclosed in Table 3, Table 4, or Table 5 herein):(i) any homozygous MYB28.A2 Variant described herein combined with any heterozygous or homozygous MYB28.A3 Variant, MYB28.C2 Variant, MYB28.C7 Variant, or MYB28.C9 Variant described herein; (ii) any homozygous MYB28.A3 Variant described herein combined with any heterozygous or homozygous MYB28.A2 Variant, MYB28.C2 Variant, MYB28.C7 Variant, or MYB28.C9 Variant described herein; (iii) any homozygous MYB28.C2 Variant described herein combined with any heterozygous or homozygous MYB28.A2 Variant, MYB28.A3 Variant, MYB28.C7 Variant, or MYB28.C9 Variant described herein; (iv) any homozygous MYB28.C7 Variant described herein combined with any heterozygous or homozygous MYB28.A2 Variant, MYB28.A3 Variant, MYB28.C2 Variant, or MYB28.C9 Variant described herein; or (v) any homozygous MYB28.C9 Variant described herein combined with any heterozygous or homozygous MYB28.A2 Variant, MYB28.A3 Variant, MYB28.C2 Variant, or MYB28.C7 Variant described herein.

[0021] In another aspect, disclosed herein is a method that includes crossing a Brassica napus plant disclosed herein comprising one or more MYB28 variants to a second plant that does not have the one or more MYB28 variants, thereby producing one or more progeny plants whose genome comprises the one or more MYB28 variants, i.e., any of the MYB28 variants or combinations disclosed herein and / or selected by the screening method disclosed herein. In a one example of this aspect, the second plant is one of a plant line (a “recurrent parent line”) and the method further includes crossing the progeny plant with another plant of the recurrent parent line to produce a second-generation progeny whose genome comprises the one or more MYB28 variants. Optionally, the second-generation progeny can be crossed with the recurrent parent line to produce a third-generation progeny whose genome comprises the one or more MYB28 variants. This process can be repeated three, four, five, six, seven, or more times, such that each subsequent generation progeny is crossed with the recurrent parent line, thereby introgressing the one or more MYB28 variants into the recurrent parent line.

[0022] In an alternative method, a plant having the one or more MYB28 variants disclosed herein is crossed with a second plant to produce progeny plants. The progeny plants are screened for the one or more MYB28 variants in accordance with the screening method disclosed herein. Generally, such screening includes obtaining a nucleic acid sample from each of the progeny plants and screening the sample for the presence of MYB28 variants; thereby identifying novel progeny plants comprising at least one of the MYB28 variants disclosed herein.

[0023] Provided herein is an isolated recombinant nucleic acid comprising one or more of SEQ ID NOs: 16-67. In particular example, the isolated recombinant nucleic acid is a gene editing construct comprising a guide RNA comprising SEQ ID NO:68 or SEQ ID NO:71 for introducing an MYB28 variant disclosed herein. In another example, provided herein is a combination of primers for detecting an MYB28 variant disclosed herein, e.g., SEQ ID NO:69 and SEQ ID NO:70; or SEQ ID NO:72 and SEQ ID NO:73; or SEQ ID NO:74 and SEQ ID NO:75.

[0024] In another aspect, provided herein is a method of introducing an MYB28 variant into Brassica napus, the method comprising delivering to a cell or tissue of the Brassica napus a Cas endonuclease and a guide RNA targeting a sequence (target site) of a MYB28 gene on chromosome A2, A3, C2, C7, or C9. The endonuclease / guide RNA complex indues a targeted alteration at the target site which reduces or eliminates expression of the protein encoded by the targeted MYB28 gene, thereby introducing an MYB28 variant to the Brassica napus cell or tissue. In some examples, the method further comprises regenerating Brassica napus plant, cell, seed, tissue or germplasm thereof comprising the MYB28 variant. The guide RNA can be any one or more comprising SEQ ID NO:68 or SEQ ID NO:71. The MYB28 variant can be any MYB28 variant disclosed herein and shown in Table 3, Table 4, or Table 5 herein for MYB28 on chromosome A2 (MYB28.A2), chromosome A3 (MYB28.A3), chromosome C2 (MYB28.C2), chromosome C7 (MYB28.C7), or chromosome C9 (MYB28.C9). Thus, the variant can include the targeted alteration shown in each of SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, or SEQ ID NO:67. Additionally the method can include introducing any combination of MYB28 variant alleles disclosed herein (see definition above of terms “MYB28.A2 Variant”, “MYB28.A3 Variant”, “MYB28.C2 Variant”, “MYB28.C7 Variant”, or “MYB28.C9 Variant” and variants disclosed in Table 3, Table 4, or Table 5 herein): (i) anyhomozygous MYB28.A2 Variant described herein combined with any heterozygous or homozygous MYB28.A3 Variant, MYB28.C2 Variant, MYB28.C7 Variant, or MYB28.C9 Variant described herein; (ii) any homozygous MYB28.A3 Variant described herein combined with any heterozygous or homozygous MYB28.A2 Variant, MYB28.C2 Variant, MYB28.C7 Variant, or MYB28.C9 Variant described herein; (iii) any homozygous MYB28.C2 Variant described herein combined with any heterozygous or homozygous MYB28.A2 Variant, MYB28.A3 Variant, MYB28.C7 Variant, or MYB28.C9 Variant described herein; (iv) any homozygous MYB28.C7 Variant described herein combined with any heterozygous or homozygous MYB28.A2 Variant, MYB28.A3 Variant, MYB28.C2 Variant, or MYB28.C9 Variant described herein; or (v) any homozygous MYB28.C9 Variant described herein combined with any heterozygous or homozygous MYB28.A2 Variant, MYB28.A3 Variant, MYB28.C2 Variant, or MYB28.C7 Variant described herein.

[0025] Methods for introducing Cas endonucleases and guide RNAs are described in more detail herein. BRIEF DESCRIPTION OF DRAWINGS AND SEQUENCE LISTING

[0026] Figure 1 is a bar graph showing glucosinolate levels in seed of the following inbred plants grown in a field in 2023: triple homozygous knockouts (KO) of MYB28.A2, C2 and C9; quintuple homozygous knockouts (KO) of MYB28.A2, A3, C2, C7 and C9; wild-type inbred MC (WT).

[0027] Figure 2 is a bar graph showing glucosinolate levels in seed of the following inbred plants grown in a field in 2023: triple homozygous knockouts (KO) of MYB28.A2, C2 and C9; quintuple homozygous knockouts (KO) of MYB28.A2, A3, C2, C7 and C9; wild-type inbred BC (WT).

[0028] Figure 3 is a bar graph showing glucosinolate levels in seed of the following hybrid plants grown in a field in 2023: triple homozygous knockouts (KO) of MYB28.A2, C2 and C9; quintuple homozygous knockouts (KO) of MYB28.A2, A3, C2, C7 and C9; wild-type hybrid (WT).

[0029] Nucleic acid sequences listed in the accompanying sequence listing and referenced herein are shown using standard letter abbreviations for nucleotide bases. While only one strand of each nucleic acid sequence is shown, the complementary strand is understood to be included in any reference to the displayed strand. Sequence listings are described in the following Table 1.Table 1 SEQ ID NO: DESCRIPTION 1 MYB28.A3 WT genomic37 MYB28.A2_v5 / Insertion 38 MYB28.A2 v6 / DeletionDETAILED DESCRIPTION OF THE INVENTION

[0030] As used herein the singular forms “a”, “and”, and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a cell” includes a plurality of such cells and reference to “the protein” includes reference to one or more proteins and equivalents thereof, and so forth. All technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs unless clearly indicated otherwise.

[0031] A gene or allele is “associated with” a trait when it is part of or linked to a DNA sequence or allele that affects the expression of the trait. The presence of the allele is an indicator of how the trait will be expressed.

[0032] “Brassica” refers to any one of Brassica napus (AACC, 2n=38), Brassica juncea (AABB, 2n=36), Brassica carinata (BBCC, 2n= 34), Brassica rapa (syn. B. campestris) (AA, 2n=20), Brassica oleracea (CC, 2n=18) or Brassica nigra (BB, 2n= 16).

[0033] “Backcrossing” refers to the process whereby hybrid progeny are repeatedly crossed back to one of the parents. In a backcrossing scheme, the “donor” parent refers to the parental plant with the desired gene or locus to be introgressed. The “recipient” parent (used one or more times) or “recurrent” parent (used two or more times) refers to the parental plant into which the gene or locus is being introgressed.

[0034] “CRISPR” (Clustered Regularly Interspaced Short Palindromic Repeats) loci refers to certain genetic loci encoding components of DNA cleavage systems, for example, used by bacterial and archaeal cells to destroy foreign DNA (Horvath and Barrangou, 2010, Science 327:167-170; International Application Publication WO2007 / 025097, published 01 March 2007). A CRISPR locus can consist of a CRISPR array, comprising short direct repeats (CRISPR repeats) separated by short variable DNA sequences (called spacers), which can be flanked by diverse Cas (CRISPR-associated) genes.

[0035] The term “Cas protein” refers to a polypeptide encoded by a Cas (CRISPR-associated) gene. A Cas protein includes but is not limited to: a Cas9 protein, a Cpf1 (Cas12) protein, a C2c1 protein, a C2c2 protein, a C2c3 protein, Cas3, Cas3-HD, Cas 5, Cas7, Cas8, Cas10, or combinations or complexes of these. A Cas protein may be a “Cas endonuclease” or “Cas effector protein”, that when in complex with a suitable polynucleotide component, is capable ofrecognizing, binding to, and optionally nicking or cleaving all or part of a specific polynucleotide target sequence. A Cas endonuclease described herein comprises one or more nuclease domains. The endonucleases of the disclosure may include those having one or more RuvC nuclease domains. A Cas protein is further defined as a functional fragment or functional variant of a native Cas protein, or a protein that shares at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with a native Cas protein, and retains at least partial activity.

[0036] A “Cas endonuclease” may comprise domains that enable it to function as a double- strand-break-inducing agent. A “Cas endonuclease” may also comprise one or more modifications or mutations that abolish or reduce its ability to cleave a double-strand polynucleotide (dCas). In some aspects, the Cas endonuclease molecule may retain the ability to nick a single-strand polynucleotide (for example, a D10A mutation in a Cas9 endonuclease molecule) (nCas9).

[0037] The term “crossed” or “cross” refers to a sexual cross and involved the fusion of two haploid gametes via pollination to produce diploid progeny (e.g., cells, seeds or plants). The term encompasses both the pollination of one plant by another and selfing (or self-pollination, e.g., when the pollen and ovule are from the same plant).

[0038] An “elite line” is any line that has resulted from breeding and selection for superior agronomic performance.

[0039] A “favorable allele” is the allele at a particular locus (a marker, a QTL, a gene etc.) that confers, or contributes to, an agronomically desirable phenotype, e.g., disease resistance, and that allows the identification of plants with that agronomically desirable phenotype. A favorable allele of a marker is a marker allele that segregates with the favorable phenotype.

[0040] “Gene” includes a nucleic acid fragment that expresses a functional molecule such as, but not limited to, a specific protein, including regulatory sequences preceding (5’ non-coding sequences) and following (3’ non-coding sequences) the coding sequence, as well as intervening intron sequences. “Native gene” refers to a gene as found in its natural endogenous location with its own regulatory sequences.

[0041] “Genetic markers” are nucleic acids that are polymorphic in a population and where the alleles of which can be detected and distinguished by one or more analytic methods, e.g., RFLP,AFLP, isozyme, SNP, SSR, and the like. The term also refers to nucleic acid sequences complementary to the genomic sequences, such as nucleic acids used as probes. Markers corresponding to genetic polymorphisms between members of a population can be detected by methods well-established in the art. These include, e.g., PCR-based sequence specific amplification methods, detection of restriction fragment length polymorphisms (RFLP), detection of isozyme markers, detection of polynucleotide polymorphisms by allele specific hybridization (ASH), detection of amplified variable sequences of the plant genome, detection of self-sustained sequence replication, detection of simple sequence repeats (SSRs), detection of single nucleotide polymorphisms (SNPs), or detection of amplified fragment length polymorphisms (AFLPs). Well established methods are also known for the detection of expressed sequence tags (ESTs) and SSR markers derived from EST sequences and randomly amplified polymorphic DNA (RAPD).

[0042] “Germplasm” refers to genetic material of or from an individual (e.g., a plant), a group of individuals (e.g., a plant line, variety or family), or a clone derived from a line, variety, species, or culture, or more generally, all individuals within a species or for several species (e.g., maize germplasm collection or Andean germplasm collection). The germplasm can be part of an organism, cell, or can be separate from the organism or cell. In general, germplasm provides genetic material with a specific molecular makeup that provides a physical foundation for some or all of the hereditary qualities of an organism or cell culture. As used herein, germplasm includes cells, seed or tissues from which new plants may be grown, or plant parts, such as leaves, stems, pollen, or cells, that can be cultured into a whole plant.

[0043] The term “genome” as it applies to a prokaryotic and eukaryotic cell or organism cells encompasses not only chromosomal DNA found within the nucleus, but organelle DNA found within subcellular components (e.g., mitochondria, or plastid) of the cell.

[0044] As used herein, a “genomic sequence” or “genomic region” is a segment of a chromosome in the genome of a cell that is present on either side of the target site or, alternatively, also comprises the target site or a portion thereof. An “endogenous genomic sequence” refers to genomic sequence within a plant cell, (e.g. an endogenous genomic sequence of a MYB28 gene present within the genome of a Brassica plant cell).

[0045] A “genomic locus” as used herein refers to the genetic or physical location on a chromosome of a gene. As used herein, “gene” includes a nucleic acid fragment that expresses afunctional molecule such as, but not limited to, a specific protein coding sequence and regulatory elements, such as those preceding (5’ non-coding sequences) and following (3’ non-coding sequences) the coding sequence.

[0046] As used herein, “genotype” is the actual nucleic acid sequence at one or more loci in an individual plant. As used herein, “phenotype” means the detectable characteristics (e.g. increased free phosphate) of a cell or organism which can be influenced by genotype.

[0047] “Glucosinolates” are β-thioglucoside N-hydroxysulfates with a variable side chain (R) and a sulfur-linked β-d-glucopyranose moiety. They represent a large and heterogeneous family of naturally occurring compounds; more than 120 varieties are known to occur in nature (Fahey, et al., 2001). Glucosinolates are found in many species of plants, particularly those within the order Brassicales, but also among plants of the genus Drypetes and the genus Putranjiva (both genera of the Putranjivaceae family). They are accumulated to high levels in the seed, as well as other plant tissues. This is particularly true for the oil seed Brassicas. The glucosinolates found in meal samples of oilseeds include sinigrin, sinalbin, gluconapin, and gluconasturtin, among others, and their relative proportions can vary significantly depending on the species. These compounds and their metabolites can impact the taste of the meal, reducing its palatability and in some cases (dependent on the type of glucosinolate and glucosinolate metabolites present) can also adversely impact the health of an animal that has consumed plant material containing glucosinolates. Glucosinolate reduction in oil seed meal is an important and desirable objective and can have significant benefits in terms of meal value for animal feed.

[0048] Brassica MYB28 genes are homologs of Arabidopsis MYB28 (At5g61420) which encodes a transcription factor and regulates the biosynthesis of glucosinolates. Brassica MYB28 homologs include but are not limited to BnaA03g40190D, BnaCnng43220D, and BnaC09g05300D + BnaC09g05290D. In some aspects, the CRISPR-Cas9 system is used to edit Brassica MYB28 genes to generate loss-of-function variants to reduce glucosinolates in Brassica seed. In other aspects, MYB28 knockout mutants from an EMS mutagenesis population are generated.

[0049] As used herein, the term “guide polynucleotide”, relates to a polynucleotide sequence that can form a complex with a Cas endonuclease, including the Cas endonuclease described herein, and enables the Cas endonuclease to recognize, optionally bind to, and optionally cleave a DNAtarget site. The guide polynucleotide sequence can be a RNA sequence, a DNA sequence, or a combination thereof (a RNA-DNA combination sequence).

[0050] The terms “single guide RNA" and “sgRNA” are used interchangeably herein and relate to a synthetic fusion of two RNA molecules, a crRNA (CRISPR RNA) comprising a variable targeting domain (linked to a tracr mate sequence that hybridizes to a tracrRNA), fused to a tracrRNA (trans-activating CRISPR RNA). The single guide RNA can comprise a crRNA or crRNA fragment and a tracrRNA or tracrRNA fragment of the type II CRISPR / Cas system that can form a complex with a type II Cas endonuclease, wherein said guide RNA / Cas endonuclease complex can direct the Cas endonuclease to a DNA target site, enabling the Cas endonuclease to recognize, optionally bind to, and optionally nick or cleave (introduce a single or double-strand break) the DNA target site.

[0051] As used herein, the terms “guide polynucleotide / Cas endonuclease complex”, “guide polynucleotide / Cas endonuclease system”, “ guide polynucleotide / Cas complex”, “guide polynucleotide / Cas system”, “guided Cas system”, “Polynucleotide-guided endonuclease”, and “PGEN” are used interchangeably herein and refer to at least one guide polynucleotide and at least one Cas endonuclease, that are capable of forming a complex, wherein said guide polynucleotide / Cas endonuclease complex can direct the Cas endonuclease to a DNA target site, enabling the Cas endonuclease to recognize, bind to, and optionally nick or cleave (introduce a single or double-strand break) the DNA target site. A guide polynucleotide / Cas endonuclease complex herein can comprise Cas protein(s) and suitable polynucleotide component(s) of any of the known CRISPR systems (Horvath and Barrangou, 2010, Science 327:167-170; Makarova et al.2015, Nature Reviews Microbiology Vol.13:1-15; Zetsche et al., 2015, Cell 163, 1-13; Shmakov et al., 2015, Molecular Cell 60, 1-13).

[0052] A “haplotype” is the genotype of an individual at a plurality of genetic loci, i.e. a combination of alleles. Typically, the genetic loci described by a haplotype are physically and genetically linked, i.e., on the same chromosome segment.

[0053] The term “heterogeneity” is used to indicate that individuals within the group differ in genotype at one or more specific loci.

[0054] The term “homogeneity” indicates that members of a group have the same genotype at one or more specific loci.

[0055] The term “hybrid” refers to the progeny obtained between the crossing of at least two genetically dissimilar parents.

[0056] The term “inbred” refers to a line that has been bred for genetic homogeneity.

[0057] The term “introgression” refers to the transmission of a desired allele of a genetic locus from one genetic background to another. For example, introgression of a desired R gene allele at a specified locus can be transmitted to at least one progeny via a sexual cross between two parents of the same species, where at least one of the parents has the desired allele in its genome. Alternatively, for example, transmission of an allele can occur by recombination between two donor genomes, e.g., in a fused protoplast, where at least one of the donor protoplasts has the desired allele in its genome. The desired allele can be, e.g., detected by a marker that is associated with a phenotype, at a QTL, a transgene, or the like. Offspring comprising the desired allele may be repeatedly backcrossed to a line having a desired genetic background and selected for the desired allele, to result in the allele becoming fixed in a selected genetic background.

[0058] The process of “introgressing” is often referred to as “backcrossing” when the process is repeated two or more times.

[0059] A “line” or “strain” is a group of individuals of identical parentage that are generally inbred to some degree and that are generally homozygous and homogeneous at most loci (isogenic or near isogenic). A “subline” refers to an inbred subset of descendants that are genetically distinct from other similarly inbred subsets descended from the same progenitor.

[0060] The term “plant material” includes whole plants, plant cells, plant protoplast, plant cell or tissue culture from which plants can be regenerated, plant calli, plant clumps and plant cells that are intact in plants, or parts of plants, such as seeds, flowers, cotyledons, leaves, stems, buds, roots, root tips and the like. As used herein, a “modified plant” means any plant that has a genetic change due to human intervention. A modified plant may have genetic changes introduced through plant transformation, genome editing, mutagenesis, or conventional plant breeding.

[0061] A “marker” is a means of finding a position on a genetic or physical map, or else linkages among markers and trait loci (loci affecting traits). The position that the marker detects may be known via detection of polymorphic alleles and their genetic mapping, or else by hybridization, sequence match or amplification of a sequence that has been physically mapped. A marker can be a DNA marker (detects DNA polymorphisms), a protein (detects variation at an encodedpolypeptide), or a simply inherited phenotype (such as a low-erucic acid oil profile). A DNA marker can be developed from genomic nucleotide sequence or from expressed nucleotide sequences (e.g., from a spliced RNA or a cDNA). Depending on the DNA marker technology, the marker may consist of primers complementary to sequence flanking the locus and / or probes that hybridize to polymorphic alleles at the locus. A DNA marker, or a genetic marker, may also be used to describe the gene, DNA sequence or nucleotide on the chromosome itself (rather than the components used to detect the gene or DNA sequence) and is often used when that DNA marker is associated with a particular trait in human genetics (e.g. a marker for breast cancer). The term marker locus is the locus (gene, sequence or nucleotide) that the marker detects.

[0062] Markers can be defined by the type of polymorphism that they detect and also the marker technology used to detect the polymorphism. Marker types include but are not limited to, e.g., detection of restriction fragment length polymorphisms (RFLP), detection of isozyme markers, randomly amplified polymorphic DNA (RAPD), amplified fragment length polymorphisms (AFLPs), detection of simple sequence repeats (SSRs), detection of amplified variable sequences of the plant genome, detection of self-sustained sequence replication, or detection of single nucleotide polymorphisms (SNPs). SNPs can be detected e.g. via DNA sequencing, PCR-based sequence specific amplification methods, detection of polynucleotide polymorphisms by allele specific hybridization (ASH), dynamic allele-specific hybridization (DASH), molecular beacons, microarray hybridization, oligonucleotide ligase assays, Flap endonucleases, 5’ endonucleases, primer extension, single strand conformation polymorphism (SSCP) or temperature gradient gel electrophoresis (TGGE). DNA sequencing, such as the pyrosequencing technology has the advantage of being able to detect a series of linked SNP alleles that constitute a haplotype. Haplotypes tend to be more informative (detect a higher level of polymorphism) than SNPs.

[0063] “Marker assisted selection” (of MAS) is a process by which individual plants are selected based on marker genotypes. “Marker assisted counter-selection” is a process by which marker genotypes are used to identify plants that will not be selected, allowing them to be removed from a breeding program or planting. A “marker haplotype” refers to a combination of alleles at a marker locus.

[0064] The term “molecular marker” may be used to refer to a genetic marker, as defined above, or an encoded product thereof (e.g., a protein) used as a point of reference when identifying a linked locus. A molecular marker can be derived from genomic nucleotide sequences or fromexpressed nucleotide sequences (e.g., from a spliced RNA, a cDNA, etc.), or from an encoded polypeptide. The term also refers to nucleic acid sequences complementary to or flanking the marker sequences, such as nucleic acids used as probes or primer pairs capable of amplifying the marker sequence. A “molecular marker probe” is a nucleic acid sequence or molecule that can be used to identify the presence of a marker locus, e.g., a nucleic acid probe that is complementary to a marker locus sequence. Alternatively, in some aspects, a marker probe refers to a probe of any type that is able to distinguish (i.e., genotype) the particular allele that is present at a marker locus. Nucleic acids are “complementary” when they specifically hybridize in solution. Some of the markers described herein are also referred to as hybridization markers when located on an indel region, such as the non-collinear region described herein. This is because the insertion region is, by definition, a polymorphism vis a vis a plant without the insertion. Thus, the marker need only indicate whether the indel region is present or absent. Any suitable marker detection technology may be used to identify such a hybridization marker, e.g. SNP technology is used in the examples provided herein.

[0065] “Meal” refers to the remaining fraction of the seed content after extraction of the oil and consists mainly of protein.

[0066] As used herein, a ‘nucleic acid molecule” is a polymeric form of nucleotides, which can include both sense and anti-sense strands of RNA, cDNA, genomic DNA, and synthetic forms and mixed polymers of the above. A nucleotide refers to a ribonucleotide, deoxynucleotide, or a modified form of either type of nucleotide. A "nucleic acid molecule" as used herein is synonymous with "nucleic acid", "nucleotide sequence", "nucleic acid sequence", and "polynucleotide." The term includes single- and double-stranded forms of DNA. A nucleic acid molecule can include either or both naturally occurring and modified nucleotides linked together by naturally occurring and / or non-naturally occurring nucleotide linkages.

[0067] Nucleic acid molecules may be modified chemically or biochemically, or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those of skill in the art. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications, such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), pendent moieties (e.g., peptides), intercalators (e.g., acridine, psoralen, etc.), chelators, alkylators, and modifiedlinkages (e.g., alpha anomeric nucleic acids, etc.). The term "nucleic acid molecule" also includes any topological conformation, including single-stranded, double-stranded, partially duplexed, triplexed, hairpinned, circular, and padlocked conformations. An "endogenous nucleic acid sequence" refers to a nucleic acid sequence within a plant cell, (e.g. an endogenous allele of an IND gene present within the genome of a Brassica plant cell).

[0068] “Oilseed” refers to any crop species where oil is extracted from the seeds of these grains for food or industrial purposes, and includes Brassicaceae oilseeds such as canola, and non- Brassicaceae oilseeds, such as flaxseed, soybean, safflower, and sunflower. An example of a crop species that produces a seed used primarily for the production of edible oil is Brassica napus.

[0069] A “protospacer adjacent motif” (PAM) herein refers to a short nucleotide sequence adjacent to a target sequence (protospacer) that is recognized (targeted) by a guide polynucleotide / Cas endonuclease system described herein. The Cas endonuclease may not successfully recognize a target DNA sequence if the target DNA sequence is not followed by a PAM sequence. The sequence and length of a PAM herein can differ depending on the Cas protein or Cas protein complex used. The PAM sequence can be of any length but is typically 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides long.

[0070] As used herein, the term “plant material” refers to any processed or unprocessed material derived, in whole or in part, from a plant. For example, and without limitation, a plant material may be a plant part, a seed, a fruit, a leaf, a root, a plant tissue, a plant tissue culture, a plant explant, or a plant cell.

[0071] A “polymorphism” is a variation in the DNA between two or more individuals within a population. A polymorphism preferably has a frequency of at least 1% in a population. A useful polymorphism can include a single nucleotide polymorphism (SNP), a simple sequence repeat (SSR), or an insertion / deletion polymorphism, also referred to herein as an “indel”.

[0072] The term “quantitative trait locus” or “QTL” refers to a region of DNA that is associated with the differential expression of a quantitative phenotypic trait in at least one genetic background, e.g., in at least one breeding population. The region of the QTL encompasses or is closely linked to the gene or genes that affect the trait in question.

[0073] The terms “target site”, “target sequence”, “target site sequence, ”target DNA”, “target locus”, “genomic target site”, “genomic target sequence”, “genomic target locus”, and “targetpolynucleotide”, can be used interchangeably herein and refer to a polynucleotide sequence such as, but not limited to, a nucleotide sequence on a chromosome, episome, a locus, or any other DNA molecule in the genome (including chromosomal, chloroplastic, mitochondrial DNA, plasmid DNA) of a cell, at which a guide polynucleotide / Cas endonuclease complex can recognize, bind to, and optionally nick or cleave. The target site can be an endogenous site in the genome of a cell, or alternatively, the target site can be heterologous to the cell and thereby not be naturally occurring in the genome of the cell, or the target site can be found in a heterologous genomic location compared to where it occurs in nature. As used herein, terms “endogenous target sequence” and “native target sequence” are used interchangeable herein to refer to a target sequence that is endogenous or native to the genome of a cell and is at the endogenous or native position of that target sequence in the genome of the cell.

[0074] A “targeted alteration” or “variant” is a gene (e.g., MYB28 gene) sequence that has been altered through human intervention. Such an “altered” or “modified” gene has a sequence that differs from the sequence of the corresponding native or non-altered gene by at least one nucleotide (i) insertion (i.e., addition of a nucleotide in a sequence), (ii) deletion, (iii) substitution (i.e., replacement of at least one nucleotide), or (iv) a combination of the foregoing alterations. An “altered” or “modified” plant is a plant comprising an altered gene sequence, e.g., a deletion. As used herein, a “targeted alteration” in a gene (referred to as the target gene) can be made by altering a target sequence within the target gene using any method known to one skilled in the art, including a method involving a guided Cas endonuclease system as disclosed herein or a method involving the human controlled use of mutagenesis and subsequent recovery of an altered target sequence (e.g., MYB28 gene).

[0075] A virus or vector “transforms” or “transduces” a cell when it transfers nucleic acid molecules into the cell. A cell is “transformed” by a nucleic acid molecule transduced into the cell when the nucleic acid molecule becomes stably replicated by the cell, either by incorporation of the nucleic acid molecule into the cellular genome, or by episomal replication. As used herein, the term “transformation” encompasses all techniques by which a nucleic acid molecule can be introduced into such a cell. Examples include, but are not limited to, transfection with viral vectors, transformation with plasmid vectors, electroporation (Fromm et al., 1986, Nature 319:791-3), lipofection (Feigner et al., 1987, Proc. Natl. Acad. Sci. USA 84:7413-7), microinjection (Mueller et al., 1978, Cell 15:579-85), Agrobacterium-mediated transfer (Fraleyet al., 1983, Proc. Natl. Acad. Sci. USA 80:4803-7), direct DNA uptake, and microprojectile bombardment (Klein et al., 1987, Nature 327:70).

[0076] The term “variants” refer to substantially similar sequences. For polynucleotides, a variant comprises a deletion and / or addition of one or more nucleotides at one or more internal sites within the native polynucleotide and / or a substitution of one or more nucleotides at one or more sites in the native polynucleotide (e.g. a MYB28 variant disclosed herein). As used herein, a “native” polynucleotide or polypeptide comprises a naturally occurring nucleotide sequence or amino acid sequence, respectively.

[0077] The term “yield” refers to the productivity per unit area of a particular plant product of commercial value. Yield is affected by both genetic and environmental factors. “Agronomics,” “agronomic traits,” and “agronomic performance” refer to the traits (and underlying genetic elements) of a given plant variety that contribute to yield over the course of growing season. Individual agronomic traits include emergence vigor, vegetative vigor, stress tolerance, disease resistance or tolerance, herbicide resistance, branching, flowering, seed set, seed size, seed density, standability, threshability and the like. Yield can therefore be considered the final culmination of all agronomic traits.

[0078] The disclosed targeted alterations or variants of a MYB28 gene refer to human-made, intentionally produced and selected nucleic acid changes that can be generated by any known methods, including the use of targeted mutagenesis, Targeting Induced Local Lesions IN Genomes or TILLING (see e.g., McCallum et al., 2000, Nat Biotechnol 18:455-457), or the use of double-strand-break inducing agents (DSB Agents) or by chemical treatment, including the use of ethyl methane sulfonate (EMS), methyl N-nitrosoguanidine (MNNG), ethidium bromide, diepoxybutane, or other mutagens known in the art.

[0079] Double-Strand-Break (DSB) Inducing Agents (DSB Agents). Double-strand breaks can be induced by agents such as endonucleases that cleave the phosphodiester bond within a polynucleotide chain, can result in the induction of DNA repair mechanisms, including the non- homologous end-joining pathway, and homologous recombination. Endonucleases include a range of different enzymes, including restriction endonucleases (see e.g. Roberts et al., 2003 Nucleic Acids Res 1:418-20, Roberts et al., 2003, Nucleic Acids Res 31:1805-12, and Belfort et al., 2002 in Mobile DNA II, pp.761-783, Eds. Craigie et al., (ASM Press, Washington, DC)), meganucleases (see e.g., International Application Publication WO 2009 / 114321; Gao et al.,2010, Plant Journal 1:176-187), and TAL effector nucleases or TALENs (see e.g., US Application Publication US 20110145940 and Christian et al., 2010, Genetics 186(2): 757-61). Methods of targeting DNA double-strand breaks have been described for TALENs (Christian et al., 2010, Genetics 186(2): 757-61 and Boch et al., 2009, Science 326(5959):1509-12), zinc finger nucleases (see e.g. Kim, et al., 1996, Proc. Nat’l Acad. Sci USA 93(3)1156-1160) and CRISPR-Cas endonucleases (see e.g. International Application Publication WO2007 / 025097).

[0080] Any DSB or -nick or -modification inducing agent may be used for the methods described herein, including for example but not limited to: Cas endonucleases, recombinases, TALENs, zinc finger nucleases, restriction endonucleases, meganucleases, and deaminases.

[0081] Methods and compositions are provided for polynucleotide modification with a CRISPR Associated (Cas) endonuclease. Class I Cas endonucleases comprise multi-subunit effector complexes (Types I, III, and IV), while Class 2 systems comprise single protein effectors (Types II, V, and VI) (Makarova et al., 2015, Nature Reviews Microbiology 13:1-15; Zetsche et al., 2015, Cell 163:1-13; Shmakov et al., 2015, Molecular Cell 60, 1-13; Haft et al., 2005, Computational Biology, PLoS Comput Biol 1(6): e60; and Koonin et al., 2017, Curr Opinion Microbiology 37:67-78). In Class 2 Type II systems, the Cas endonuclease acts in complex with a guide RNA (gRNA) that directs the Cas endonuclease to cleave the DNA target to enable target recognition, binding, and cleavage by the Cas endonuclease. The gRNA comprises a Cas endonuclease recognition (CER) domain that interacts with the Cas endonuclease, and a Variable Targeting (VT) domain that hybridizes to a nucleotide sequence in a target DNA. In some aspects, the gRNA comprises a CRISPR RNA (crRNA) and a trans-activating CRISPR RNA (tracrRNA) to guide the Cas endonuclease to its DNA target. The crRNA comprises a spacer region complementary to one strand of the double strand DNA target and a region that base pairs with the tracrRNA, forming an RNA duplex. In many systems, the Cas endonuclease-guide polynucleotide complex recognizes a short nucleotide sequence adjacent to the target sequence (protospacer), called a “protospacer adjacent motif” (PAM).

[0082] Examples of a Cas endonuclease include but are not limited to Cas9, Cas12f, Cas12a or Cpf1, and variants thereof (See e.g., US Patent No.10,934,536 and International Application Publication WO 2022 / 082179). Cas9 (formerly referred to as Cas5, Csn1, or Csx12) is a Class 2 Type II Cas endonuclease (Makarova et al., 2015, Nature Reviews Microbiology 13:1-15). For Cas9 and Cas12f, a Cas-gRNA complex recognizes a 3’ PAM sequence at the target site,permitting the spacer of the guide RNA to invade the double-stranded DNA target, and, if sufficient homology between the spacer and protospacer exists, generate a DSB cleavage. Cas9 endonucleases comprise RuvC and HNH domains that together produce DSBs, and separately can produce single strand breaks. For the S. pyogenes Cas9 endonuclease, the DSB leaves a blunt end. Cpf1 is a Class 2 Type V Cas endonuclease and comprises nuclease RuvC domain but lacks an HNH domain (Yamane et al., 2016, Cell 165:949-962). Cas12f can generate 5’ staggered overhangs at DSB sites (Karvelis et al., Nucl Acids Res 48(12):5016-5023). Cpf1 endonucleases create “sticky” overhang ends.

[0083] Some uses for Cas-gRNA systems at a genomic target site include but are not limited to insertions, deletions, substitutions, or modifications of one or more nucleotides at the target site; modifying or replacing nucleotide sequences of interest (such as a regulatory elements); insertion of polynucleotides of interest; gene dropout; gene knock-out; gene knock in; modification of splicing sites and / or introducing alternate splicing sites; modifications of nucleotide sequences encoding a protein of interest; amino acid and / or protein fusions; and gene silencing by expressing an inverted repeat into a gene of interest. Genome editing using DSB-inducing agents, such as Cas9-gRNA complexes, has been described, for example in U.S. Patent Application No.2015 / 0082478, US Patent No.10,934,536, International Application Publication WO2015 / 026886 A1, International Application Publication WO2016007347, International Application Publication WO201625131, and International Application Publication WO 2022 / 082179 all of which are incorporated by reference herein.

[0084] In some aspects of the disclosure, a targeted genomic modification is introduced in a B. napus plant cell, wherein the targeted modification includes a targeted alteration of the genomic sequence of a MYB28 gene in the B. napus plant cell. In a further aspect, the targeted genomic modification is induced by a DSB Agent, such as a CRISPR-associated (Cas) nuclease. A Cas nuclease is introduced into the B. napus cell with a first and second guide RNAs as Cas-gRNA complexes that recognizes target sequences in the genome of the B. napus cell and is able to induce DSBs in the genomic sequence, e.g., thereby altering the endogenous target MYB28 gene.

[0085] Recombinant Constructs and Transformation of Cells. The disclosed guide polynucleotides can be introduced into a cell with the disclosed DSB agents e.g., CRISPR-Cas endonucleases. Cells include, but are not limited to, human, non-human, animal, bacterial, fungal, insect, yeast, non-conventional yeast, and plant cells as well as plants and seeds producedby the methods described herein. In a preferred aspect of the disclosure, the cells are B. napus cells.

[0086] Standard recombinant DNA and molecular cloning techniques used herein are known in the art and are described more fully in Sambrook et al., Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory: Cold Spring Harbor, NY (1989). Transformation methods are well known to those skilled in the art and are described infra.

[0087] Vectors and constructs include circular plasmids, and linear polynucleotides, comprising a polynucleotide of interest and optionally other components including linkers, adapters, regulatory or analysis. In some examples a recognition site and / or target site can be comprised within an intron, coding sequence, 5' UTRs, 3' UTRs, and / or regulatory regions.

[0088] In one aspect, the constructs of the disclosure comprise a promoter operably linked to a nucleotide sequence encoding a DSB Agent, such as a CAS nuclease (e.g., gene encoding a Streptococcus pyrogenes Cas9 gene or Cas12f gene) and a promoter operably linked to a guide RNA of the present disclosure. The promoter is capable of driving expression of an operably linked nucleotide sequence in a prokaryotic or eukaryotic cell / organism. In some aspects, target specific guide RNAs are built as a fusion of CRISPR RNA (crRNA) fused to trans-activating CRISPR RNA (tracrRNA) of Streptococcus pyrogenes.

[0089] In accordance with the methods disclosed herein, a guide RNA comprising SEQ ID NO:68 or SEQ ID NO:71, can be used to alter endogenous genomic MYB28 sequence in the B. napus plant cell. The resulting targeted alterations can produce a MYB28 variant comprising a premature termination codon as shown in any of SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, or SEQ ID NO:67.

[0090] The isolated polynucleotides, constructs and vectors disclosed herein (e.g., for expression of endonucleases or guide RNAs) can comprise a selectable marker to identify or select for or against a molecule or a cell that comprises the construct or vector. Examples of selectable markers that can be used in a construct or vector disclosed herein include DsRed and Glyphosate N-Acetyltransferase (GAT) gene variant 4621 for herbicide resistance.

[0091] Isolated Nucleic Acid Molecules and Variants and Fragments Thereof. Isolated or recombinant nucleic acid molecules comprising MYB28 variants disclosed herein as well as active portions thereof, as well as nucleic acid molecules sufficient for use as hybridization probes to identify MYB28 variants by sequence homology are provided. As used herein, the term “nucleic acid molecule” refers to DNA molecules (e.g., recombinant DNA, cDNA, genomic DNA, plastid DNA, mitochondrial DNA) and RNA molecules (e.g., mRNA) and analogs of the DNA or RNA generated using nucleotide analogs. In some examples, the nucleic acid molecule can be single-stranded. In some examples, the nucleic acid molecule can be double-stranded.

[0092] An “isolated” nucleic acid molecule (e.g., RNA or DNA) is used herein to refer to a nucleic acid sequence (e.g., RNA or DNA) that is no longer in its natural environment, for example in vitro. A “recombinant” nucleic acid molecule (e.g., RNA or DNA) is used herein to refer to a nucleic acid sequence (e.g., RNA or DNA) that is in a recombinant bacterial or plant host cell; has been edited from its native sequence; or is located in a different location than the native sequence. In some embodiments, an “isolated” or “recombinant” nucleic acid is free of sequences (preferably protein encoding sequences) that naturally flank the nucleic acid (i.e., sequences located at the 5′ and 3′ ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For purposes of the disclosure, “isolated” or “recombinant” when used to refer to nucleic acid molecules excludes isolated chromosomes. For example, in various embodiments, the recombinant nucleic acid molecules can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of nucleic acid sequences that naturally flank the MYB28 variant in the genome of the cell.

[0093] In some embodiments, an isolated nucleic acid molecule comprising a MYB28 variant has one or more change in the nucleic acid sequence compared to the native or genomic nucleic acid sequence. In some embodiments, the change in the native or genomic nucleic acid sequence includes but is not limited to: changes in the nucleic acid sequence due to the degeneracy of the genetic code; changes in the nucleic acid sequence due to the amino acid substitution, insertion,deletion and / or addition compared to the native or genomic sequence; removal of one or more intron; deletion of one or more upstream or downstream regulatory regions; and deletion of the 5’ and / or 3’ untranslated region associated with the genomic nucleic acid sequence. In some embodiments, the nucleic acid molecule comprising one of SEQ ID NOs:16-67 is non-genomic sequence.

[0094] A variety of polynucleotides comprising MYB28 variants disclosed herein are contemplated. Such polynucleotides are useful for production of encoded polypeptides in host cells when operably linked to a suitable promoter, transcription termination and / or polyadenylation sequences. Such polynucleotides are also useful as probes for isolating homologous or substantially homologous polynucleotides that are MYB28 variants or related to MYB28 variants disclosed herein.

[0095] Provided herein are nucleic acid molecules comprising one or more of SEQ ID NOs:16- 67 and variants, fragments and complements thereof. “Complement” is used herein to refer to a nucleic acid sequence that is sufficiently complementary to a given nucleic acid sequence such that it can hybridize to the given nucleic acid sequence to thereby form a stable duplex. A reverse complement is a complement formed by exchanging each A with T, T with A, C with G, and G with C in a sequence and then reversing the 5’ to 3’ order of the exchanged sequence, such that the reverse complement of 5’-ACCTGAG-3’ is 5’-CTCAGGT-3’. “Polynucleotide sequence variants” is used herein to refer to a nucleic acid sequence that except for the degeneracy of the genetic code encodes the same polypeptide.

[0096] “Percent (%) sequence identity” with respect to a reference sequence (subject) is determined as the percentage of amino acid residues or nucleotides in a candidate sequence (query) that are identical with the respective amino acid residues or nucleotides in the reference sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any amino acid conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent sequence identity can be achieved in various ways, for instance, using publicly available computer software such as BLAST, BLAST-2. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences(e.g., percent identity of query sequence = number of identical positions between query and subject sequences / total number of positions of query sequence ×100).

[0097] Nucleotide Constructs, Expression Cassettes and Vectors. The use of the term “construct” in connection with isolated and / or heterologous polynucleotides herein is not intended to limit the disclosure to constructs comprising DNA. Polynucleotide constructs, particularly polynucleotides and oligonucleotides composed of ribonucleotides and combinations of ribonucleotides and deoxyribonucleotides, may also be employed in the methods disclosed herein. The isolated polynucleotide constructs, nucleic acids, and nucleotide sequences disclosed herein additionally encompass all complementary forms (e.g., the reverse complement) of each sequence disclosed for such a construct. Further, polynucleotide constructs and nucleotide sequences disclosed herein can encompass any such constructs, molecules, and sequences suitable for use in a method for transforming plant material disclosed herein. Such constructs can include naturally occurring molecules and / or synthetic analogues. The disclosed nucleotide constructs, nucleic acids, and nucleotide sequences also encompass all forms of nucleotide constructs including, but not limited to, single-stranded forms, double-stranded forms, hairpins, stem-and-loop structures and the like.

[0098] Transformed organisms disclosed herein include plant cells, bacteria, yeast, baculovirus, protozoa, nematodes and algae. The transformed organism comprises a disclosed sequence (e.g., as part of a construct, expression cassette, or vector comprising the nucleotide sequence disclosed herein which are associated with increased disease resistance.

[0099] The disclosed sequences can be used in constructs for expression in the organism of interest. Constructs can include 5’ and 3’; regulatory sequences operably linked to an R gene sequence, variant or fragment disclosed herein. The term “operably linked” as used herein refers to a functional linkage between a promoter and / or a regulatory sequence and a second sequence, wherein the promoter and / or regulatory sequence initiates, mediates, and / or affects transcription of the DNA sequence corresponding to the second sequence. Generally, operably linked means that the nucleic acid sequences being linked are contiguous and, where necessary, to join two protein coding regions in the same reading frame. The construct may additionally contain at least one additional gene to be cotransformed into the organism. Alternatively, the additional gene(s) can be provided on multiple DNA constructs.

[0100] Such a DNA construct is provided with a plurality of restriction sites for insertion of the polypeptide gene sequence of the disclosure to be under the transcriptional regulation of the regulatory regions. The DNA construct may additionally contain selectable marker genes.

[0101] The DNA construct will generally include in the 5' to 3' direction of transcription: a transcriptional and translational initiation region (e.g., a promoter), a DNA sequence of the embodiments, and a transcriptional and translational termination region (e.g., termination region) functional in the organism serving as a host. The transcriptional initiation region (e.g., the promoter) may be native, analogous, foreign or heterologous to the host organism and / or to the sequence of the embodiments. Additionally, the promoter or regulatory sequence may be the natural sequence or alternatively a synthetic sequence. The term “foreign” as used herein indicates that the promoter is not found in the native organism into which the promoter is introduced. As used herein, the term “heterologous” in reference to a sequence means a sequence that originates from a foreign species or, if from the same species, is substantially modified from its native form in composition and / or genomic locus by deliberate human intervention. As used herein, a chimeric gene comprises a coding sequence operably linked to a transcription initiation region that is heterologous to the coding sequence. Where the promoter is a native or natural sequence, the expression of the operably linked sequence is altered from the wild-type expression, which results in an alteration in phenotype.

[0102] In some embodiments the DNA construct comprises a polynucleotide comprising one or more of SEQ ID NOs:16-67 or a fragment or variant thereof.

[0103] A DNA construct may also include a transcriptional enhancer sequence. An “enhancer” refers to a DNA sequence which can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue-specificity of a promoter. Various enhancers include, for example, introns with gene expression enhancing properties in plants (US Patent Application Publication Number 2009 / 0144863, the ubiquitin intron (i.e., the maize ubiquitin intron 1 (see, for example, NCBI sequence S94464)), the omega enhancer or the omega prime enhancer (Gallie et al.1989 Molecular Biology of RNA ed. Cech (Liss, New York) 237-256 and Gallie et al.1987 Gene 60: 217-25), the CaMV 35S enhancer (see, e.g., Benfey et al.1990 EMBO J.9:1685-96) and the enhancers of US Patent Number 7,803,992 may also be used. The above list of transcriptional enhancers is not meant to be limiting. Any appropriate transcriptional enhancer can be used in the embodiments.

[0104] The termination region may be native with the transcriptional initiation region, may be native with the operably linked DNA sequence of interest, may be native with the plant host or may be derived from another source (i.e., foreign or heterologous to the promoter, the sequence of interest, the plant host or any combination thereof).

[0105] Convenient termination regions are available from the Ti-plasmid of A. tumefaciens, such as the octopine synthase and nopaline synthase termination regions. See also, Guerineau et al. 1991 Mol. Gen. Genet.262:141-144; Proudfoot 1991 Cell 64:671-674; Sanfacon et al.1991 Genes Dev.5:141-149; Mogen et al.1990 Plant Cell 2:1261-1272; Munroe et al.1990 Gene 91:151-158; Ballas et al.1989 Nucleic Acids Res.17:7891-7903 and Joshi et al.1987 Nucleic Acid Res.15:9627-9639.

[0106] Where appropriate, a nucleic acid may be optimized for increased expression in the host organism. Thus, where the host organism is a plant, the synthetic nucleic acids can be synthesized using plant-preferred codons for improved expression. See, for example, Campbell and Gowri 1990 Plant Physiol.92:1-11 for a discussion of host-preferred usage. For example, although nucleic acid sequences of the embodiments may be expressed in both monocotyledonous and dicotyledonous plant species, sequences can be modified to account for the specific preferences and GC content preferences of monocotyledons or dicotyledons as these preferences have been shown to differ (Murray et al.1989 Nucleic Acids Res.17:477-498). Thus, the plant-preferred for a particular amino acid may be derived from known gene sequences from plants.

[0107] Additional sequence modifications are known to enhance gene expression in a cellular host. These include elimination of sequences encoding spurious polyadenylation signals, exon- intron splice site signals, transposon-like repeats, and other well-characterized sequences that may be deleterious to gene expression. The GC content of the sequence may be adjusted to levels average for a given cellular host, as calculated by reference to known genes expressed in the host cell. The term “host cell” as used herein refers to a cell which contains a vector and supports the replication and / or expression of the expression vector is intended. Host cells may be prokaryotic cells such as E. coli or eukaryotic cells such as yeast, insect, amphibian or mammalian cells or monocotyledonous or dicotyledonous plant cells. An example of a monocotyledonous host cell is a maize host cell. When possible, the sequence is modified to avoid predicted hairpin secondary mRNA structures.

[0108] In preparing the expression cassette, the various DNA fragments may be manipulated so as to provide for the DNA sequences in the proper orientation and, as appropriate, in the proper reading frame. Toward this end, adapters or linkers may be employed to join the DNA fragments or other manipulations may be involved to provide for convenient restriction sites, removal of superfluous DNA, removal of restriction sites or the like. For this purpose, in vitro mutagenesis, primer repair, restriction, annealing, resubstitutions, e.g., transitions and transversions, may be involved.

[0109] A number of promoters can be used in the practice of the embodiments. The promoters can be selected based on the desired outcome. The nucleic acids can be combined with constitutive, tissue-preferred, inducible, or other promoters for expression in Brassica plants. “Tissue-preferred” promoters can be utilized to target enhanced expression of the gene of interest within a particular plant tissue. Such promoters can be modified, if necessary, for weak expression. “Seed-preferred” promoters include both “seed development” promoters (those promoters preferentially active during seed development such as promoters of seed storage proteins) as well as “seed-germinating” promoters (those promoters preferentially active during seed germination). An "inducible” promoter refers to a promoter that selectively express a coding sequence or functional RNA in response to the presence of an endogenous or exogenous stimulus, for example by chemical compounds (chemical inducers) or in response to environmental, hormonal, chemical, and / or developmental signals. Inducible or regulated promoters include, for example, promoters induced or regulated by light, heat, stress, flooding or drought, salt stress, osmotic stress, phytohormones, wounding, or chemicals such as ethanol, abscisic acid (ABA), jasmonate, salicylic acid, or safeners.

[0110] Plant Transformation. Any suitable techniques known in the art for introduction of transgenes into plants may be used to produce a transformed plant or plant cell disclosed herein. Suitable methods for transformation of plants may include virtually any method by which DNA can be introduced into a cell, such as: by electroporation as illustrated in U.S. Patent No. 5,384,253; by microprojectile bombardment, as illustrated in U.S. Patent Nos.5,015,580, 5,550,318, 5,538,880, 6,160,208, 6,399,861, and 6,403,865; by Agrobacterium-mediated transformation as illustrated in U.S. Patent Nos.5,635,055, 5,824,877, 5,591,616; 5,981,840, and 6,384,301; and by protoplast transformation, as set forth in U.S. Patent No.5,508,184, etc. These techniques can be used to transform plant cells and these cells may be developed into transgenicplants by techniques known to those of skill in the art. Techniques for transforming Brassica plants in particular are disclosed, for example, in U.S. Patent No.5,750,871.

[0111] After effecting delivery of exogenous DNA to recipient cells, transformed cells are identified for further culturing and plant regeneration. In order to improve the ability to identify transformants, one may desire to employ a selectable marker gene with the transformation vector used to generate the transformant. In this case, the potentially transformed cell population can be assayed by exposing the cells to a selective agent or agents, or the cells can be screened for the desired marker.

[0112] Cells that survive the exposure to the selective agent, or cells that have been scored positive in a screening assay, may be cultured in media that supports regeneration of plants. In some embodiments, any suitable plant tissue culture media may be modified by including further substances, such as growth regulators. Tissue may be maintained on a basic media with growth regulators until sufficient tissue is available to begin plant regeneration efforts, or following repeated rounds of manual selection, until the morphology of the tissue is suitable for regeneration (e.g., at least 2 weeks), then transferred to media conducive to shoot formation. Cultures are transferred periodically until sufficient shoot formation has occurred. Once shoots are formed, they are transferred to media conducive to root formation. Once sufficient roots are formed, plants can be transferred to soil for further growth and maturity.

[0113] The alteration (e.g., introduction of a stop codon, mutation or deletion) of an endogenous gene (e.g., MYB28) in regenerating plants can be confirmed by one or more assays, for example, a molecular biological assay, such as Southern blotting, Northern blotting, or PCR; a biochemical assay, such as detecting the absence of a protein product by immunoassay (ELISA or Western blot) or by screening for reduced enzymatic function; plant part assays, such as leaf or root assays; and analysis of the phenotype of the whole regenerated plant.

[0114] Using the methods disclosed herein, MYB28 variant-containing plants are generated. For example, a plant comprising an altered endogenous genomic sequence containing one or more of the following MYB28 variants: SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ IDNO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, or SEQ ID NO:67. In some examples, the modified B. napus plant comprises multiple homozygous variants of MYB28.A2, MYB28.A3, MYB28.C2, MYB28.C7, or MYB28.C9.

[0115] “Stable transformation” as used herein means that the nucleotide construct introduced into a plant integrates into the genome of the plant and is capable of being inherited by the progeny thereof. “Transient transformation” as used herein means that a polynucleotide is introduced into the plant and does not integrate into the genome of the plant or a polypeptide is introduced into a plant. “Plant” as used herein refers to whole plants, plant organs (e.g., leaves, stems, roots, etc.), seeds, plant cells, propagules, embryos and progeny of the same. Plant cells can be differentiated or undifferentiated (e.g. callus, suspension culture cells, protoplasts, leaf cells, root cells, phloem cells and pollen).

[0116] Transformation protocols as well as protocols for introducing nucleotide sequences into plants may vary depending on the type of plant or plant cell, i.e., monocot or dicot, targeted for transformation. Suitable methods of introducing nucleotide sequences into plant cells and subsequent insertion into the plant genome include microinjection (Crossway et al. (1986) Biotechniques 4:320-334), electroporation (Riggs et al.1986 Proc. Natl. Acad. Sci. USA 83:5602-5606), Agrobacterium-mediated transformation (US Patent Numbers 5,563,055 and 5,981,840), direct gene transfer (Paszkowski et al.1984 EMBO J.3:2717-2722) and ballistic particle acceleration (see, for example, US Patent Numbers 4,945,050; 5,879,918; 5,886,244 and 5,932,782; Tomes et al.1995 in Plant Cell, Tissue, and Organ Culture: Fundamental Methods, ed. Gamborg and Phillips (Springer-Verlag, Berlin) and McCabe et al.1988 Biotechnology 6:923-926) and Lecl transformation (WO 00 / 28058). For potato transformation see, Tu et al. 1998 Plant Molecular Biology 37:829-838 and Chong et al.2000 Transgenic Research 9:71-78. Additional transformation procedures can be found in Weissinger et al.1988 Ann. Rev. Genet. 22:421-477; Sanford et al.1987 Particulate Science and Technology 5:27-37 (onion); Christou et al.1988 Plant Physiol.87:671-674 (soybean); McCabe et al.1988 Bio / Technology 6:923-926 (soybean); Finer and McMullen 1991 In Vitro Cell Dev. Biol.27P:175-182 (soybean); Singh etal.1998 Theor. Appl. Genet.96:319-324 (soybean); Datta et al.1990 Biotechnology 8:736-740 (rice); Klein et al.1988 Proc. Natl. Acad. Sci. USA 85:4305-4309 (maize); Klein et al.1988 Biotechnology 6:559-563 (maize); US Patent Numbers 5,240,855; 5,322,783 and 5,324,646; Klein et al. (1988) Plant Physiol.91:440-444 (maize); Fromm et al.1990 Biotechnology 8:833- 839 (maize); Hooykaas-Van Slogteren et al.1984 Nature (London) 311:763-764; US Patent Number 5,736,369 (cereals); Bytebier et al.1987 Proc. Natl. Acad. Sci. USA 84:5345-5349 (Liliaceae); De Wet et al.1985 in The Experimental Manipulation of Ovule Tissues, ed. Chapman et al. (Longman, New York), pp.197-209 (pollen); Kaeppler et al.1990 Plant Cell Reports 9:415-418 and Kaeppler et al.1992 Theor. Appl. Genet.84:560-566 (whisker-mediated transformation); D'Halluin et al.1992 Plant Cell 4:1495-1505 (electroporation); Li et al. (1993) Plant Cell Reports 12:250-255 and Christou and Ford 1995 Annals of Botany 75:407-413 (rice); Osjoda et al.1996 Nature Biotechnology 14:745-750 (maize via Agrobacterium tumefaciens).

[0117] Marker assisted selection. Molecular markers can be used in a variety of plant breeding applications (e.g. see Staub et al.1996 Hortscience 31:729-741; Tanksley 1983 Plant Molecular Biology Reporter.1:3-8). One of the main areas of interest is to increase the efficiency of backcrossing and introgressing genes using marker-assisted selection (MAS). Thus, MAS can be used for backcrossing and introgressing the MYB28 variants disclosed herein.

[0118] A molecular marker that demonstrates linkage with a locus affecting a desired phenotypic trait provides a useful tool for the selection of the trait in a plant population. This is particularly true where the phenotype is hard to assay. Since DNA marker assays are less laborious and take up less physical space than field phenotyping, much larger populations can be assayed, increasing the chances of finding a recombinant with the target segment from the donor line moved to the recipient line. The closer the linkage, the more useful the marker, as recombination is less likely to occur between the marker and the gene causing the trait, which can result in false positives. Having flanking markers decreases the chances that false positive selection will occur as a double recombination event would be needed. In the most preferred case, a marker is located within the gene itself, so that recombination cannot occur between the marker and the gene. In some embodiments, the methods targeted alteration disclosed herein produce a marker that can be used to identify the MYB28 variant.

[0119] Gene introgression by MAS can be used to diminish linkage drag and yield drag. Gepts 2002 Crop Sci; 42:1780-1790; Young et al.1998 Genetics 120:579-585; Tanksley et al.1989Biotechnology 7: 257-264. Markers disclosed herein, as well as other marker types such as SSRs and FLPs, can be used in marker assisted selection protocols. SSRs can be defined as relatively short runs of tandemly repeated DNA with lengths of 6 bp or less, which are often highly suited to mapping and MAS. Tautz 1989 Nucleic Acid Research 17: 6463-6471; Wang et al.1994 Theoretical and Applied Genetics, 88: 1-6; Levinson and Gutman 1987 Mol Biol Evol 4: 203- 221; Weber and May 1989 Am J Hum Genet.44:388-396; Rafalski et al.1996 Generating and using DNA markers in plants. In: Non-mammalian genomic analysis: a practical guide. Academic press. pp 75-135). FLP markers refer to fragment length polymorphisms that are in many ways similar to SSR markers, except that the region amplified by the primers is not typically a highly repetitive region. Bhattramakki et al.2002 Plant Mol Biol 48, 539-547; Rafalski 2002b, supra.

[0120] SNP markers detect single base pair nucleotide substitutions, which can be assayed at an even higher level of throughput than SSRs, in so-called “ultra-high-throughput” fashion, as SNPs do not require large amounts of DNA and automation of the assay may be straight-forward. SNPs also have the promise of being relatively low-cost systems. These three factors together make SNPs highly attractive for use in MAS. Several methods are available for SNP genotyping, including but not limited to, hybridization, primer extension, oligonucleotide ligation, nuclease cleavage, minisequencing, and coded spheres. Such methods have been reviewed in: Gut 2001 Hum Mutat 17: 475-492; Shi 2001 Clin Chem 47: 164-172; Kwok 2000 Pharmacogenomics 1: 95-100; and Bhattramakki and Rafalski 2001 Discovery and application of single nucleotide polymorphism markers in plants. In: R. J. Henry, Ed, Plant Genotyping: The DNA Fingerprinting of Plants, CABI Publishing, Wallingford. A wide range of commercially available technologies utilize these and other methods to interrogate SNPs including Masscode.TM. (Qiagen), INVADER®. (Third Wave Technologies) and Invader PLUS®, SNAPSHOT®. (Applied Biosystems), TAQMAN®. (Applied Biosystems) and BEADARRAYS®. (Illumina).

[0121] In addition to SSR's, FLPs and SNPs, as described above, other types of molecular markers are also widely used, including but not limited to expressed sequence tags (ESTs), SSR markers derived from EST sequences, randomly amplified polymorphic DNA (RAPD), and other nucleic acid-based markers. Isozyme profiles and linked morphological characteristics can, in some cases, also be indirectly used as markers. Even though they do not directly detect DNAdifferences, they are often influenced by specific genetic differences. However, markers that detect DNA variation are far more numerous and polymorphic than isozyme or morphological markers (Tanksley 1983 Plant Molecular Biology Reporter 1: 3-8).

[0122] The following are examples of specific embodiments of some aspects of the invention. The examples are offered for illustrative purposes only and are not intended to limit the scope of the invention in any way. EXAMPLES Example 1: Gene-edited MYB28 knockouts.

[0123] The Brassica napus inbred MC has five MYB28 genes, MYB28.A2, MYB28.A3, MYB28.C2, MYB28.C7 and MYB28.C9 localized on chromosome A2, A3, C2, C7, and C9, respectively. A guide RNA, BNA-MYB28-CR1 (Table 2), was designed to target the third exon of MYB28.A3 and MYB28.C7, while MYB28.A2, MYB28.C2 and MYB28.C9 were edited using the gRNA BNA-MYB28-CR2 (Table 2). The CRISPR-Cas9 system induces a double stranded cut in MYB28, leaving two free chromosomal ends. The plant’s repair mechanisms can attempt to repair the double-strand DNA break by non-homologous end joining (“NHEJ”), which can result in nucleotide insertions and deletions (Indel) at the cleavage site. Among these variants, those that result in a coding sequence frameshift are referred to as knockouts or “KOs”. Table 2: gRNA and genotyping PCR primer sequences for editing B. napus MYB28 genes SEQ ID 7 2,BNA- MYB28- CR2 MYB28A2 C2 [0y, p y p . p g m carrying a CRISPR-Cas9 plasmid for plant transformation (Chu et al., 2020). Regenerated plantlets (T0) were screened using a NGS sequencing assay to obtain knockout variants (Table 2 and Table 3). Positive T0 plants were self-pollinated to produce T1 seeds. T1 seeds were planted in growth chamber and seedlings were genotyped with the same NGS sequencing assay to identify homozygous knockout plants of singles and combination of MYB28 genes. T-DNA was incorporated into the genome in T0 plants. Therefore, PCR assays were used to screen T1 plants to select null segregants that contain desired MYB28 variants but are free of gene-editing reagent plasmids. Selected clean T1 plants were self-pollinated to generate T2 seeds. Table 3 shows the DNA sequences of MYB28 wildtype (WT) and knockout variants (v). The hyphen (-) represents base-pair deletion; small letters are insertion. Dots are used here to facilitate sequence alignment. Table 3: DNA sequences of MYB28 wildtype (WT) and knockout variants (v). SE Q C C CMYB28.A3 1075 - AGAATTTGCATTCCCTTGCtaTGCGCCTAGTTCCGACAAGCAATAC _v3 1136 TCCCGGTCGAGCTCAA MYB28 A3 1075 AGAATTTGCATTCCCTTGC TGCGCCTAGTTCCGACAAGCAATAC C A A A A A A G G G G G G G G -MYB28.A2 83 - ATATATATATATCGGAGAAAATGTCAAGAAAGCCATGTTGTGTC-- _v9 138 A..GAAGGGTTGAAGA MYB28 A2 83 ATATATATATATCGGAGAAAATGTCAAGAAAGCCATGTTGTGT -- G G G G G G G G - - - G G G G G G G - - - -

[0125] Knocking out MYB28 was intended to reduce glucosinolate concentrations in Brassica seeds. The glucosinolate content was determined via high performance liquid chromatography (HPLC). In brief, 10 mg of hexane-defatted and dried canola meal was added to 1 ml of 70:30 (v:v) methanol:water (both HPLC grade) in screw capped tubes and heated at 70 °C under sonication for 30 minutes with grinding using a Geno / Grinder at the 15-minute mark (10 seconds at 12,000 rpm). After 30 minutes, samples were ground at same time and speed and then centrifuged at 3,700 rpm for 5 minutes at room temperature. 250 µl of supernatant was then transferred and dried using a SpeedVac concentrator and then reconstituted in 250 µl water and filtered with 0.2 µm filter (Thomson filter vials). 5 µl of this solution was injected onto HPLC flowing at 0.18 ml / minute featuring a Waters Acquity UPLC HSS T3 column (2.1 x 150 mm). Aqueous phase (A) contained 5 mM ammonium acetate and organic contained 0.1% (v%) formic acid in acetronitrile. Gradient elution: 98% A for 0.5 minutes then ramped to 55% A over the next 10.25 minutes, then to 50% A over next 0.45 minutes, then ramped back to 98% A over next 0.3 minutes and re-equilibrated for the next 4 minutes. UV detector set at 229 nm at 9 nm bandwidth at 20 Hz. Sinigrin standard curve was collected at concentrations at approximately 8, 16, 3264, 128, 224, 320, 501 and 1001 nmoles / ml. Response factors used were 1.09 (progoitrin), 1.00 (sinigrin), 1.00 (glucoraphanin), 1.07 (glucoalyssin), 1.00 (gluconapoleiferin), 1.11 (gluconapin), 0.28 (4-hydroxyglucobrassicin), 1.15 (glucobrassicanapin), 1.00 (glucoerucin), 0.29 (glucobrassicin), 0.95 (gluconasturtiin) and 0.2 (neoglucobrassicin).

[0126] The glucosinolate content was reduced in MYB28 knockout variants relative to the wildtype inbred MC. The seed of quintuple (MYB28.A3 / C7 / A2 / C2 / C9), quadruple (MYB28.C7 / A2 / C2 / C9) and triple (MYB28.A2 / C2 / C9) homozygous plants contained 4.3, 4.9 and 4.1 µmoles g-1 of glucosinolates, respectively, while the WT inbred MC had 8.0 µmoles g-1 (Table 4). Both aliphatic and indolyl glucosinolates were reduced in the knockout variants (Table 4). The aromatic glucosinolate concentrations were very low in the wildtype MC and MYB28 knockouts. Table 4: Glucosinolate content in seed of MYB28 knockout variants and wild-type inbred MC. MYB28 GenotypeTotal GlucAliphatic Indolic Aromatic )WT WT Hom Hom Hom 4.1 1.22 2.89 0.00 WT WT WT WT WT 8.0 3.88 4.09 0.01Example 2: Seed germination

[0127] To determine if knocking out MYB28 affects seed germination, T2 seeds were placed in a row between two layers of filter papers wetted with deionized water. The filter papers were rolled up with a piece of waxed paper on the outside and set vertically in a beaker containing 1 inch (2.5 cm) of deionized water. The beaker was covered with plastic wrap to prevent evaporation and placed at 25°C in the dark. Germination was scored 5 days after seeding. The MYB28 knockouts had the same germination frequency as the WT inbred MC. To test germination under cold stress, the seeds rolled up in the filter papers were incubated at 8 °C in the dark for 7 days, or 4 °C for 5 days followed by 25 °C for 2 days. No significant difference in germination frequency was found between the homozygotes and the WT inbred MC under the cold-stressed conditions. Example 3: Gene-edited MYB28 knockouts in other genetic backgrounds

[0128] The effect of MYB28 knockout variants on glucosinolates were tested in additional inbred and hybrid genetic backgrounds. The female inbred BC was edited using the gRNA BNA- MYB28-CR1 and BNA-MYB28-CR2 (Table 1), and T1 plants were genotyped using the same assay as those described above in Example 1. Homozygous plants for MYB28 knockouts were selected, and T2 seed glucosinolates analyzed by HPLC. The glucosinolate content in quintuple (MYB28.A3 / C7 / A2 / C2 / C9) and triple (MYB28.A2 / C2 / C9) knockouts was 6.0 and 6.3 µmoles g- 1, respectively, and the wildtype inbred BC contained 13.7 µmoles g-1 of glucosinolates (Table 5). Like the inbred MC, knocking out MYB28 in the inbred BC also reduced both aliphatic and indolyl glucosinolates (Table 5). Table 5: Glucosinolate content in seed of MYB28 knockout variants and wild-type inbred BC. MYB28 GenotypeTotal GlucAliphatic Indolyl Aromatic )WT WT WT WT WT 13.7 4.55 9.14 0.00pollen to the cytoplasmic male-sterile line FC, followed by two additional generations of crossing using the gene-edited BC as pollen donor. Homozygous knockout FC (male sterile) plants were selected and hybrid F1 seeds were generated by crossing the gene-edited FC and MC. F2 seeds were produced in greenhouse. Glucosinolate contents were analyzed using a near infrared (NIR) spectrometer. The WT hybrid contained 7.5 µmoles g-1 of glucosinolates in seed, while the triple knockout hybrid (MYB28.A2 / C2 / C9) had 1.2 µmoles g-1. The glucosinolate content in seed of the quintuple knockout hybrid (MYB28.A3 / C7 / A2 / C2 / C9) was lower than the detection limit (< 1.0 µmoles g-1). Example 4: Field-grown agronomic performance and glucosinolate content

[0130] Inbred and hybrid versions of MYB28 knockouts were evaluated in the field for agronomic performance and glucosinolate content. Plants were grown in single-row plots in a randomized complete block design with three replications in Rockwood, ON, Canada. Fertilizer was applied to achieve maximum yields. Weeds and pests were controlled according to local practices. Number of emerged plants was counted 3 weeks after planting, plant vigor was rated on 1-9 scale (1=Low, 9=High) at 20 days after emergence, and flowering time was recorded as number of days after planting to the day when 50% of the plants in a plot have at least one flower in bloom. Seed samples were taken at maturity from plants in the middle of rows. Protein, oil and glucosinolate contents were analyzed using a near infrared (NIR) spectrometer. To reduce pollinators carrying pollen around the field, plants were covered up with white knitted shade cloth (20% density) during flowering time. However, wind and physical contact with plants in neighboring rows still can cause cross pollination; genotyping revealed that approximately 10% of the seeds from homozygous plants were heterozygous.

[0131] For both inbred MC and BC, the glucosinolate content in seed of MYB28 knockout variants was lower than that in WT controls under field conditions (Figure 1 and Figure 2). Reduced glucosinolates also were detected in MYB28 knockout hybrids. The triple and quintuple knockout hybrids contained 2.2 and 1.3 µmoles g-1 of glucosinolates, respectively, while the WT hybrid had 5.2 µmoles g-1 (Figure 3). Oil and protein contents were not different betweenknockout hybrids and the WT control. Knocking out MYB28 didn’t affect emergence, plant growth and flowering time. Example 5: MYB28 knockout mutants generated by EMS mutagenesis

[0132] MYB28 knockout mutants (nonsense mutation and splicing site mutation) also were identified from an ethyl methanesulfonate (EMS) mutagenesis population for reduced glucosinolates in canola seed. To develop a canola mutagenesis population, dry seeds of the inbred BC were treated with 0.3%, 0.5% and 0.8% of EMS, rinsed with distilled water, and the treated seeds (M1) were air-dried. M1 seeds were planted in the field and M2 seeds were harvested from 3,200 individual M1 plants. Three seeds from each M2 were planted out in greenhouse and 7,000 M2 plants were obtained. Leaf samples were taken from individual M2 plants for DNA extraction and M3 seeds were harvested. Of the 7,000 M2 plants, the genome of 550 lines were sequenced. Multiple lines carrying MYB28 knockout mutation were identified by sequence search. The MYB28 knockout mutants obtained are shown in Table 6. Table 6: MYB28 Knockout Mutants generated by EMS mutagenesis. SEQ ID Name of EMS knockout

[0133] Example 5: Stacks of low glucosinolate, low fiber and low phytate (high inorganic phosphate)

[0134] The MYB28 polynucleotides disclosed herein are engineered into a molecular stack. In each of the foregoing methods of introducing targeted alterations to one or more MYB28 gene alleles, the Brassica napus plant, cell, seed, tissue or germplasm thereof that is altered can also further comprise an altered or variant gene that provides additional desirable meal quality. Themethod can comprise introducing targeted alterations that generate one or more MYB28 variants in Brassica napus plant, cell, seed, tissue or germplasm thereof with a targeted alteration, mutation or variant of one or more of LPA1, TT2, TT8, DFR, F3H, ANR, LDOX, MAM1, MRP1, or MRP2, in order to create plants with a combination of low glucosinolate and additional desirable meal quality traits. The desirable meal quality provided by each of LPA1, MRP1, and MRP2 is reduced phytate and / or increased inorganic phosphate content. Each of TT2, TT8, DFR, F3H, ANR, and LDOX can reduce fiber content. MAM1 can reduce glucosinolate content.

Claims

CLAIMS 1. A method of decreasing glucosinolate in Brassica napus plant, seed, tissue or germplasm thereof, the method comprising introducing a targeted alteration to the sequence of one or more MYB28 genes and thereby generating a Brassica napus plant, seed, tissue or germplasm thereof comprising one or more MYB28 variants and decreased level of glucosinolate relative to the wild type plant, seed, tissue or germplasm thereof prior to introducing the one or more MYB28 variants.

2. The method of claim 1, comprising introducing a targeted alteration of one or more alleles of MYB28 on chromosome A2, A3, C2, C7, or C9 and thereby generating the Brassica napus plant, seed, tissue or germplasm thereof comprising one or more MYB28 variants.

3. The method of claim 1 or 2, wherein the targeted alteration is an insertion or deletion that reduces or eliminates expression of the full-length protein encoded by the targeted MYB28 gene sequence.

4. The method of claim 3, wherein the targeted alteration introduces a frameshift mutation or a premature termination codon in the one or more MYB28 variants.

5. The method of claim 1, wherein the targeted alteration introduces one or more of the insertions or deletions at the positions shown in the MYB28 variants in Table 3.

6. The method of claim 1, wherein each of the one or more MYB28 variants comprises one or more of the targeted alterations in SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, and SEQ ID NO:67, including combinations thereof.

7. The method of any one of claims 1-6, wherein the method comprises introducing double homozygous variants of MYB28 and thereby generating Brassica napus plant, seed, tissue or germplasm thereof comprising multiple homozygous variants of MYB28.

8. A method of producing decreased glucosinolate Brassica napus meal, the method comprising a) selecting Brassica napus seed or grain comprising one or more MYB28 variants, wherein the selected seed or grain comprise decreased glucosinolate relative to control seed or grain lacking the one or more MYB28 variants; and b) milling the selected seed or grain to produce decreased glucosinolate Brassica napus meal.

9. The method of claim 8, wherein the selected seed or grain comprises a targeted alteration to one or more alleles of MYB28 on chromosome A2, A3, C2, C7, or C9.

10. The method of claim 9, wherein the selected seed or grain comprises an insertion or deletion that reduces or eliminates expression of the full-length protein encoded by the targeted MYB28 genes.

11. The method of claim 10, wherein the insertion or deletion introduces a premature termination codon in the one or more MYB28 variants.

12. The method of claim 10, wherein the targeted alteration introduces one or more of the insertions or deletions at the position shown in Table 3 for MYB28.

13. The method of claim 8, wherein each of the one or more targeted alterations corresponds to the targeted alteration in SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, or SEQ ID NO:

67.

14. The method of any one of claims 8-13, wherein the selected seed or grain comprises multiple homozygous variants of MYB28.A2, MYB28.C2, MYB28.A3, MYB28.C7, or MYB28.C9.

15. The method of any one of claims 8-14, wherein the selected seed or grain further comprises a targeted alteration of one or more of the following genes: LPA1, TT2, TT8, DFR, F3H, ANR, LDOX, MAM1, MRP1 or MRP2.

16. The method of any one of claims 8-15, wherein the meal comprises a decreased level of glucosinolate relative to meal from control seed or grain lacking the one or more targeted alterations of MYB28.

17. The Brassica napus plant, seed, tissue or germplasm thereof comprising one or more MYB28 gene variants which are single homozygous MYB28 variants on chromosome A2, A3, C2, C7, or C9 or multiple homozygous MYB28 variants on chromosome A2, A3, C2, C7, or C9, wherein the Brassica napus plant, seed, tissue or germplasm thereof comprising the one or more MYB28 variants has a decreased level of glucosinolate relative to a control lacking the one or more MYB28 variants.

18. The Brassica napus plant, seed, tissue or germplasm thereof of claim 17, which comprises a (i) single homozygous MYB28 variants on chromosome A2, A3, C2, C7, or C9, or (ii) multiple homozygous MYB28 variants on chromosome A2, A3, C2, C7, or C9.

19. The Brassica napus plant, seed, tissue or germplasm thereof of claim 17 or 18, wherein each of the MYB28 variants comprises an insertion or deletion in the position shown in Table 3 for MYB28 on chromosome A2, A3, C2, C7, or C9.

20. The Brassica napus plant, seed, tissue or germplasm thereof of any one of claims 17-19, wherein each of the one or more MYB28 variants comprises one or more of the targeted alterations in SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, or SEQ ID NO:67, including combinations thereof.

21. The Brassica napus seed of any one of claims 17-20, further comprising total glucosinolate content of less than 7.0 µmole / g.

22. The Brassica napus plant, seed, tissue or germplasm thereof of any one of claims 17-21, further comprising a targeted alteration of one or more of the following genes: LPA1, TT2, TT8, DFR, F3H, ANR, LDOX, MAM1, MRP1 or MRP2.

23. A method of identifying a plant, seed, tissue or germplasm thereof comprising an MYB28 variant associated with decreased glucosinolate level, the method comprising: a) providing plant, seed, tissue or germplasm thereof comprising one or more MYB28 variants in accordance any one of claims 17-21; b) obtaining a sample comprising nucleic acid from the plant, seed, tissue or germplasm thereof; c) screening the sample for the one or more MYB28 variants; and d) detecting the one or more (i) MYB28 variants or (ii) marker alleles in the sample that are genetically linked to the one or more MYB28 variants and thereby identifying the plant as having a MYB28 variant associated with decreased glucosinolate level.

24. A method of introducing an MYB28 variant into a Brassica napus plant comprising: a) crossing a first parent Brassica napus plant with a second parent Brassica napus plant to produce progeny plants, wherein the first parent plant is a plant comprising one or more MYB28 variants in accordance with any one of claims 17-21; and b) selecting at least one progeny plant comprising the one or more MYB28 variants.

25. The method of claim 24 further comprising: c) crossing the selected progeny plants with the second parent plant to produce backcross progeny plants; and d) selecting for backcross progeny plants comprising the one or more MYB28 variants.

26. The method of claim 24 or 25, wherein seed of the selected progeny or backcross progeny plant comprises a decreased level of glucosinolate relative to seed from a control plant lacking the one or more MYB28 variants.

27. A recombinant nucleic acid construct comprising one or more of SEQ ID NOs:16-67.

Images