Modified RNA for increasing protein expression

Abstract

Described herein are modified RNA molecules where a modified NTP is covalently attached to the 3' end of the poly-A region of the RNA molecule. Methods of synthesizing said RNAs are also provided herein.

Description

Attorney Docket No.: 095109-001300WO-1513793 MODIFIED RNA FOR INCREASING PROTEIN EXPRESSION CROSS-REFERENCE TO PRIORITY APPLICATION

[0001] This application claims priority to U.S. Provisional Application No. 63 / 666,949, filed July 2, 2024, the contents of which are incorporated herein by reference in its entirety. SEQUENCE LISTING

[0002] A Sequence Listing conforming to the rules of WIPO Standard ST.26 is hereby incorporated by reference. Said Sequence Listing has been filed as an electronic document via PatentCenter encoded as XML in UTF-8 text. The electronic document, created on June 27, 2025, is entitled “095109-001300WO-1513793_ST26.xml”, and is 109,423 bytes in size. TECHNICAL FIELD

[0003] The field of this disclosure relates to modified RNA and methods of producing the same. Additionally, the disclosure relates to using said modified RNAs to efficiently produce protein. BACKGROUND

[0004] Eukaryotic mRNA has five important parts, which include the cap at the 5'- end, the 5'-untranslated region (5'-UTR), the open reading frame (ORF), the 3'-untranslated region (3'-UTR) and the 3'-tail consisting of 100–250 adenyl residues (poly-A-tail), the length of which varies in different cell types (Youn, H. and Chung, J.K., (2015) Expert Opin. Biol. Ther.15:1337-1348).

[0005] While mRNA therapeutics are promising, they face concerns regarding their instability and high immunogenicity (Kormann et al., (2011) Nature Biotech.29:154-157). As mRNAs naturally degrade in biological systems, high dose or repeated administration is commonly required. The main pathway of mRNA degradation in eukaryotic cells occurs in the cytoplasm within the ribonucleic complexes called P-bodies, which contain 5'-3'- exonucleases, decapping and deadenylating enzymes. Once the poly-A-tail is shortened to 12 residues or less, mRNA degradation occurs through cap cleavage and 5' 3' or 3' 5' cleavage (Melo et al., (2019) Mol. Ther.27:2080-2090). Endonucleases may also be involvedAttorney Docket No.: 095109-001300WO-1513793 in mRNA degradation.

[0006] The use of chemical modifications in mRNA allowed for increasing its stability and improving translational properties and immunogenicity of mRNA (Anderson et al., (2010) Nucleic Acids Res.38:5884-5892; Jemielity et al., (2010) New J Chem.34:829- 844; Kariko et al., (2012) Mol. Ther.20:948-953; Sahin et al., (2014) Nat. Rev. Drug Discov. 13:759-780).

[0007] One of the structural elements that affects mRNA half-life and translation is the 5′ terminal 7-methylguanosine cap (Topisirovic et al., (2011) Interdiscip. Rev. RNA 2:277-298). Modifications of the 5′ cap may lead to augmented mRNA stability and expression in living cells (Ziemniak et al., (2013) Future Med. Chem.5:1141-1172; Kowalska et al., (2014) Nucleic Acids Res.42:10245-10264; WO2017 / 053297).

[0008] The poly-A-tail is another key element responsible for efficient translation and increased mRNA stability (Chang et al., (2014) Mol. Cell 53:1044-1052). The role of the poly-A-tail in translation consists of binding with numerous polyadenosyl-binding proteins (PABP), which in their turn bind with the eukaryotic translation initiation factor 4G (eIF4G). The ring structure with the cap-eIF4E-eIF4G-PABP- poly-A closed loop is formed, which facilitates ribosome binding and protects mRNA from nuclease degradation (Newbury, S.F., (2006) Biochem. Soc. Trans.34:30-34).

[0009] Woolf et al. described modifications of the poly-A tail that increase stability against nucleases (WO 1999014346). They recognized that phosphorothioate linkages, or other stabilizing modifications of RNA, may be incorporated into a poly-A tail to add further stabilization to an mRNA molecule and that other modifications may be made downstream of the poly-A tail to retain the poly-A binding sites and further block 3' exonucleases.

[0010] Despite recent clinical successes, mRNA therapeutics still face challenges of instability, toxicity, short-term efficacy, and potential immunological responses. Thus, increasing the stability of mRNAs to enhance their efficacy and reduce their immunogenicity in vivo remains an important problem that must be solved to increase the feasibility of mRNA therapeutics for clinical applications. BRIEF SUMMARY OF THE INVENTION

[0011] Described herein are RNA molecules where one modified NTP is covalently linked to the 3’ end of the poly-A region of the RNA molecule.

[0012] In an aspect, provided herein is an RNA molecule comprising: a) a 5’-capAttorney Docket No.: 095109-001300WO-1513793 structure; b) a 5’ untranslated region (5’ UTR); c) an open reading frame (ORF) encoding a polypeptide of interest; d) a 3’ untranslated region (3’ UTR); and e) a poly-A region having a 3’ end, wherein one modified nucleotide triphosphate (NTP) is covalently linked to the 3’ end of the poly-A region.

[0013] In embodiments, the modified NTP is covalently linked to the 3’ end of the poly-A region using a polymerase. In embodiments, the polymerase is a poly U polymerase.

[0014] In embodiments, the modified NTP increases the nuclease resistance of the RNA molecule as compared to an RNA molecule without the modified NTP covalently linked to the 3’ end of the poly-A region.

[0015] In embodiments, the modified NTP comprises a modified phosphate and / or a modified nucleobase and / or a modified sugar.

[0016] In embodiments, the modified NTP comprises a modified nucleobase. In embodiments, the modified nucleobase is a modified uracil, a modified cytosine, a modified guanine, or a modified adenine. In embodiments, the modified nucleobase is pseudouracil (^), 2-thio-uracil, 4-thio-uracil, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy- uracil, 5-halo-uracil, 3-methyl-uracil, 5-aza-uracil, or 2-thio-5-aza-uracil.

[0017] In embodiments, the modified nucleobase is 5-aza-cytosine, 6-aza-cytosine, pseudoisocytidine, 3-methyl-cytosine, 5-methyl-cytosine, 5-halo-cytosine, 2-thio-cytosine, N4-acetyl cytosine, or 2-thio-5-methyl-cytosine.

[0018] In embodiments, the modified nucleobase is 2-amino-purine, 2,6- diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido- adenine, 7-deaza-adenine, N6-methyl-adenine, or 2-methylthio-N6-methyl-adenine.

[0019] In embodiments, the modified nucleobase is inosine, 1-methyl-inosine, 7- cyano-7-deaza-guanine, 7-aminomethyl-7-deaza-guanine, 6-thio-guanine, 6-thio-7-deaza- guanine, or 6-methoxy-guanine.

[0020] In embodiments, the modified NTP comprises a modified sugar. In embodiments, the modified sugar comprises a 5-membered ring, a 6-membered ring, or is a modified ribose. In embodiments, the modified sugar is a modified ribose and wherein the modified ribose is 2 '-thioribose, 2', 3 '-dideoxyribose, 2'-amino-2'-deoxyribose, 2' deoxyribose, 2'- azido-2 '-deoxyribose, 2'-fluoro-2'-deoxyribose, 2'-O-methylribose, 2'-O- methyldeoxyribose, or 3'- amino-2 ',3 '-dideoxyribose. In embodiments, the modified sugar isAttorney Docket No.: 095109-001300WO-1513793 a modified ribose and the modified orisomer thereof.NTP comprises a morpholino ring. In embodiments, the modified NTP comprises a modified phosphate.

[0022] In embodiments, the modified phosphate is phosphorothioate, phosphorodithioate, thiophosphate, 5'-O-methylphosphonate, 3'-O-methylphosphonate, 5'- hydroxyphosphonate, hydroxyphosphanate, phosphoroselenoate, selenophosphate, phosphoramidate, carbophosphonate, phenylphosphonate, ethylphosphonate, H-phosphonate, guanidinium ring, triazole ring, boranophosphate, methylphosphonate, or guanidinopropyl phosphoramidate.

[0023] In embodiments, the modified NTP is selected from the group consisting of 2- amino-6-chloropurineriboside-5'-triphosphate, 6-chloropurineriboside-5'-triphosphate, 5- iodocytidine-5'-triphosphate, 5-iodouridine-5'-triphosphate, 2'-O-methyladenosine-5'- triphosphate, 2'-O-methylguanosine-5'-triphosphate, puromycin-5'-triphosphate, 4- thiouridine-5'-triphosphate, 2'-amino-2'-deoxycytidine-5'-triphosphate, 2'-amino-2'- deoxyuridine-5’-triphosphate, 2'-azido-2'-deoxyuridine-5'-triphosphate, 2-thiouridine-5'- triphosphate, arabinoseuridine-5'-triphosphate, 2-thiocytidine-5'-triphosphate, 6-azacytidine-Attorney Docket No.: 095109-001300WO-1513793 5'-triphosphate, 6-azauridine-5'-triphosphate, 2'-O-methyl-2-aminoadenosine-5'-triphosphate, 2'-O-methylpseudouridine-5'-triphosphate, 2'-O-methyl-5-methyluridine-5'-triphosphate, 2'- azido-2'-deoxyadenosine-5'-triphosphate, 8-azidoadenosine-5'-triphosphate, 5-bromocytidine- 5'-triphosphate, 5-bromouridine-5'-triphosphate, 3'-O-methyladenosine-5'-triphosphate, 3'-O- methylcytidine-5'-triphosphate, 3'-O-methylguanosine-5'-triphosphate, 3'-O-methyluridine-5'- triphosphate, 7-deazaadenosine-5'-triphosphate, 5-aminoallyluridine-5'-triphosphate, 2'-azido- 2'-deoxyguanosine-5'-triphosphate, 5-aminoallylcytidine-5'-triphosphate, 2-aminopurine- riboside-5'-triphosphate, pseudoisocytidine-5'-triphosphate, N4-methylcytidine-5'- triphosphate, 5,6-dihydro-5-methyl-uridine-5'-triphosphate, 5-carboxycytidine-5'- triphosphate, 5-formylcytidine-5'-triphosphate, 5-hydroxymethylcytidine-5'-triphosphate, 5- hydroxycytidine-5'-triphosphate, 5-formyluridine-5'-triphosphate, 5-carboxyuridine 5'- triphosphate, 5-hydroxyuridine-5'-triphosphate, 5-methoxycytidine-5’-triphosphate, thienouridine-5'-triphosphate, 5-carboxymethylesteruridine-5'-triphosphate, thienocytidine-5'- triphosphate, 8-oxoadenosine-5'-triphosphate, isoguanosine-5'-triphosphate, 2'-O- methyluridine-5'-triphosphate, 2'-O-methylcytidine-5'-triphosphate, 2'-O-methyl-N6- methyladenosine-5'-triphosphate, guanosine-5'-O-(1-thiotriphosphate), uridine-5'-O-(1- thiotriphosphate), N1-propylpseudouridine-5'-triphosphate, N1-methylpseudouridine-5'- triphosphate, N1-ethylpseudouridine-5'-triphosphate, N1-methyl-2’-O-methylpseudouridine- 5'-triphosphate, 5-methylcytidine-5'-triphosphate, N6-methyladenosine-5'-triphosphate, 2'- fluoro-2'-deoxyuridine-5'-triphosphate, 2'-fluoro-2'-deoxycytidine-5'-triphosphate, 5- methoxyuridine-5'-triphosphate, 5,6-dihydrouridine-5'-triphosphate, 5-methyluridine-5'- triphosphate, 8-oxoguanosine-5'-triphosphate, arabinoseguanosine-5'-triphosphate, 2’,3’- dideoxyadenosine-5'-triphosphate, adenosine-5'-O-(1-thiotriphosphate), 7-deaza-7- aminoethynyl-2’-deoxyadenosine-5'-triphosphate, 2’-deoxyadenosine-5'-triphosphate, 2’- Fluoro-2’-deoxyadenosine-5'-triphosphate, 2’-dexoyadenosine-5'-O-(1-thiotriphosphate), 2- aminoadenosine-5'-triphosphate, 2’,3’-dideoxyguanosine-5'-triphosphate, thienoguanosine-5'- triphosphate, 7-deaza-7-aminoethynyl-2’-deoxyguanosine-5'-triphosphate, 5-aminoethynyl- 2’-deoxycytidine-5'-triphosphate, 5-aminoethynyl-2’, 3’-dideoxycytidine-5'-triphosphate, 5- aminoethynyl-2’-deoxyuridine-5'-triphosphate, N1-methoxymethylpseudouridine-5'- triphosphate, and N1-methyladenosine-5'-triphosphate.

[0024] In embodiments, the modified NTP is selected from the group consisting of 2’-deoxyadenosine-5'-triphosphate, 2'-O-methylguanosine-5'-triphosphate, 8-oxoguanosine- 5'-triphosphate, 6-azacytidine-5'-triphosphate, 2'-O-methyl-2-aminoadenosine-5'- triphosphate, 2'-O-methylguanosine-5'-triphosphate, arabinoseuridine-5'-triphosphate, 2'-O-Attorney Docket No.: 095109-001300WO-1513793 methylcytidine-5'-triphosphate, 8-oxoadenosine-5'-triphosphate, 2'-amino-2’-deoxycytidine- 5'-triphosphate, arabinoseguanosine-5'-triphosphate, and 6-azauridine-5'-triphosphate.

[0025] In embodiments, the modified NTP is selected from the group consisting of 2'- O-methyl-2-aminoadenosine-5'-triphosphate, 8-oxoadenosine-5'-triphosphate, 2'-amino-2'- deoxycytidine-5'-triphosphate, 2'-O-methylcytidine-5'-triphosphate, 6-azacytidine-5'- triphosphate, N1-methylpseudouridine-5'-triphosphate, N1-methyl-2’-O- methylpseudouridine-5'-triphosphate, 2'-O-methylguanosine-5'-triphosphate, 3'-O- methylguanosine-5'-triphosphate, 6-azauridine-5'-triphosphate, and 8-oxoguanosine-5'- triphosphate.

[0026] In embodiments, the poly-A region is 10 or greater nucleotides in length. In embodiments, the poly-A region is 30 or greater nucleotides in length. In embodiments, the poly-A region is 70 or greater nucleotides in length. In embodiments, the poly-A region is 100 or greater nucleotides in length. In embodiments, the poly-A region is from 2 to 500 nucleotides in length. In embodiments, the poly-A region is from 5 to 250 nucleotides in length. In embodiments, the poly-A region is from 10 to 200 nucleotides in length. In embodiments, the poly-A region is from 15 to 150 nucleotides in length.

[0027] In embodiments, the RNA molecule is a messenger RNA (mRNA).

[0028] In an aspect, provided herein is a cell comprising an RNA molecule as described herein, including in embodiments. In embodiments, the cell is an isolated cell.

[0029] In an aspect, provided herein is a cell comprising a protein or a peptide translated from an RNA molecule described herein, including in embodiments, optionally wherein the cell is isolated.

[0030] In an aspect, provided herein is a pharmaceutical composition, comprising an RNA molecule as described herein, including in embodiments, and a pharmaceutically acceptable carrier. In embodiments, the pharmaceutically acceptable carrier is a solvent, dispersion media, diluent, surface active agent, isotonic agent, thickening or emulsifying agent, lipid, liposome, nanoparticle, lipid nanoparticle (LNP), polymer, lipoplex, protein, or a mixture thereof. In embodiments, the pharmaceutically acceptable carrier is an LNP.

[0031] In an aspect, provided herein is a pharmaceutical composition comprising a cell comprising an RNA molecule as described herein, including in embodiments.

[0032] In an aspect, provided herein is a method of increasing the expression of a protein or a peptide of interest in a cell, comprising contacting the cell with the RNA molecule described herein, including in embodiments, wherein the RNA molecule encodes the protein or peptide of interest, wherein the expression is increased when compared to thatAttorney Docket No.: 095109-001300WO-1513793 of an RNA molecule without the modified NTP at the 3’ end of the poly-A region, optionally wherein the cell is isolated, in vitro, or ex vivo.

[0033] In an aspect, provided herein is a method of expressing a protein or a peptide of interest in a cell, comprising contacting the cell with the RNA molecule described herein, including in embodiments, wherein the RNA molecule encodes the protein or peptide of interest and the cell translates the protein or peptide of interest from the RNA molecule, optionally wherein the cell is isolated, in vitro, or ex vivo.

[0034] In an aspect, provided herein is a method of increasing the half-life of an RNA molecule in a cell comprising contacting the cell with the RNA molecule described herein, including in embodiments, wherein the RNA molecule encodes the protein or peptide of interest and the cell translates the protein or peptide of interest from the RNA molecule, optionally wherein the cell is isolated, in vitro, or ex vivo.

[0035] In an aspect, provided herein is a method of preparing the RNA molecule described herein, including in embodiments, comprising covalently linking a modified NTP to the 3’end of the poly-A region of an RNA molecule comprising providing an RNA molecule comprising: a) a 5’-cap structure; b) a 5’ untranslated region (5’ UTR); c) an open reading frame (ORF) encoding a polypeptide of interest; d) a 3’ untranslated region (3’ UTR); and e) a poly-A region having a 3’ end, and covalently linking one modified NTP to the 3’ end of the poly-A region of the RNA molecule. In embodiments, the modified NTP is linked to the 3’end of the poly-A region of an RNA molecule using a polymerase. In embodiments, the polymerase is a poly U polymerase.

[0036] In an aspect, provided herein is a method of treating a disease in a subject in need thereof comprising introducing an effective amount of the RNA molecule described herein, including in embodiments, the cell described herein, including in embodiments, or the pharmaceutical composition described herein, including in embodiments.

[0037] In an aspect, provided herein is a method of preventing a disease in a subject in need thereof comprising introducing an effective amount of the RNA molecule described herein, including in embodiments, the cell described herein, including in embodiments, or the pharmaceutical composition described herein, including in embodiments.

[0038] In embodiments, provided herein is the RNA molecule described herein, including in embodiments, the cell described herein, including in embodiments, or the pharmaceutical composition described herein, including in embodiments, for use in therapy.

[0039] In embodiments, provided herein is use of the RNA molecule describedAttorney Docket No.: 095109-001300WO-1513793 herein, including in embodiments, the cell described herein, including in embodiments, or the pharmaceutical composition described herein, including in embodiments, for the manufacture of a medicament. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] FIG.1A-C show HPLC traces of (A) 40-mer oligo - Sequence 2a; (B) 40-mer oligo Sequence 2b; and (C) 40-mer oligo Sequence 2c.

[0041] FIG.2A-B show the results following digestion of 40-mer oligo models with CNOT7. FIG.2A are HPLC chromatograms of Sequence 2a at t=0 hrs., t=24 hrs., and t=48 hrs. following digestion. FIG.2B are bar graphs showing the remaining fraction of various modified 40-mer oligos, following digestion, at t=24 hrs. Negative control, designated as H2O on the bar graphs was a 39-mer oligo with adenosine as the last nucleoside (i.e. SEQ ID NO:1).

[0042] FIG.2C provides the full NTP names for the NTP abbreviations used in FIG. 2B.

[0043] FIG.3A-B show translation of eGFP encoding mRNA, SEQ ID NO:5 with one modified NTP at the 3’ end (the modified NTP is indicated below the graph), in HeLa cells (A) shows the fluorescence intensity as a function of time; and (B) shows the total fluorescence intensity for mRNAs at 24 hrs., 48 hrs., and 72 hrs. Negative control, indicated as H2O poly, is an eGFP encoding mRNA where water is added during the polymerization process instead of a modified NTP.

[0044] FIG.3C provides the full NTP names for the NTP abbreviations used in FIG. 3A and FIG.3B.

[0045] FIG.4 is a bar graph showing translation of eGFP encoding mRNA, SEQ ID NO:4 with one modified NTP at the 3’ end (N1-Me ^TP is N1-methylpseudouridine-5’- triphosphate and N1-Me-2’-OMe^^TP is N1-methyl-2’-O-methylpseudouridine-5’- triphosphate), in Expi293F cells, after 4 hrs., 24 hrs., 48 hrs., and 72 hrs. Negative control, indicated as Control eGFP, is an eGFP encoding mRNA where water is added during the polymerization process instead of a modified NTP.

[0046] FIG.5A-B show HPLC traces of (A) Bottom trace is of eGFP mRNA and top trace is of Sequence 5c1 / 5c2; and (B) overlaid spectra of eGFP mRNA and Sequence 5c1 / 5c2.

[0047] FIG.6A-B show HPLC traces of (A) top trace is of eGFP mRNA and bottomAttorney Docket No.: 095109-001300WO-1513793 trace is of Sequence 5d1 / 5d2; and (B) overlaid spectra of eGFP mRNA and Sequence 5d1 / 5d2. DETAILED DESCRIPTION Definitions:

[0048] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art to which this disclosure belongs. All patents, applications, published applications and other publications referred to herein are incorporated by reference in their entireties. If a definition set forth in this section is contrary to or otherwise inconsistent with a definition set forth in a patent, application, or other publication that is herein incorporated by reference, the definition set forth in this section prevails over the definition incorporated herein by reference.

[0049] As used herein, “a” or “an” means “at least one” or “one or more”. For example, reference to “a transcript” may include a plurality of transcripts.

[0050] As used herein “or” is used in the inclusive sense, i.e., equivalent to “and / or”, unless the context clearly indicates otherwise.

[0051] As used herein “or a mixture thereof” means any combination of the recited components including any amounts of each and in any combination. The components can be present individually or in combination with each other (at any ratio). For example, when stated that a material is composed of substances A, B, C, or a mixture thereof, it means that the material can consist of either A alone, B alone, C alone, or a combination (mixture) of A and B, A and C, B and C, or all A, B, and C.

[0052] The use of any and all examples or exemplary language (e.g., “such as”) provided herein, is intended merely to better illustrate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed.

[0053] The terms “may,” “may be,” “can,” and “can be,” and related terms are intended to convey that the subject matter involved is optional (that is, the subject matter is present in some examples and is not present in other examples), not a reference to a capability of the subject matter or to a probability, unless the context clearly indicates otherwise.

[0054] The terms “optional” and “optionally” mean that the subsequently described event, circumstance, or material may or may not occur or be present, and that the description includes instances where the event, circumstance, or material occurs or is present as well as instances where it does not occur or is not present.Attorney Docket No.: 095109-001300WO-1513793

[0055] As used herein, the term "about” means a range of values including the specified value, which a person of ordinary skill in the art would consider reasonably similar to the specified value. In embodiments, about means within a standard deviation using measurements generally acceptable in the art. In embodiments, about means a range extending to + / - 10% of the specified value. In embodiments, about includes the specified value.

[0056] The abbreviations used herein have their conventional meaning within the chemical and biological arts. The chemical structures and formulae set forth herein are constructed according to the standard rules of chemical valency known in the chemical arts.

[0057] Ranges include the endpoints of the range. For example, “between 0 and 2” includes 0, 1, 2, and (unless the context requires otherwise) fractional values greater than 0 and less than 2.

[0058] Where substituent groups are specified by their conventional chemical formulae, written from left to right, they equally encompass the chemically identical substituents that would result from writing the structure from right to left, e.g., -CH2O- is equivalent to -OCH2-.

[0059] As used herein, the term “cap analog” means a structural derivative of the natural RNA cap. "Natural 5'-cap" refers to a cap structure found on the 5'-end of an mRNA molecule and generally consists of a guanosine 5'-triphosphate (Gppp) which is connected via its triphosphate moiety to the 5'-end of the next nucleotide of the mRNA (i.e., the guanosine is connected via a 5' to 5' triphosphate linkage to the rest of the mRNA). The guanosine may be methylated at position N7(resulting in the cap structure m7Gppp). Cap analogs include those described in International Patent Publications Nos. WO2017 / 053297, WO2023 / 147352, WO2021 / 162566, WO2021 / 162567, WO2022 / 006368, WO2022 / 086140, WO2023 / 033551, WO2018 / 075827, WO2023 / 07019, WO2025024563, and WO2025054401, the cap structures of each of which are incorporated herein by reference. In embodiments, the term 5’-cap as used herein refers to a cap analog as described herein or to any moiety with the biological function of a cap.

[0060] As used herein, the term “complement,” “complementary,” or “complementarity” refers to specific base pairing between nucleotides or nucleic acids. Complementary nucleotides are, generally, A and T (or A and U), and G and C. Complementarity, for example, between a capped oligonucleotide primer and a DNA template, may be “complete” or "total" where all of the nucleotide bases of two nucleic acid strands are matched according to recognized base pairing rules, it may be “partial” in whichAttorney Docket No.: 095109-001300WO-1513793 only some of the nucleotide bases of an initiating capped oligonucleotide primer and a DNA template are matched according to recognized base pairing rules, or it may be “absent” where none of the nucleotide bases of two nucleic acid strands are matched according to recognized base pairing rules. Complementarity can also be “substantial complementarity” where the nucleotide bases of two nucleic acids are matched according to recognized base pairing rules, but include one or more mismatches (e.g., 1, 2, 3, 4) from total complementarity.

[0061] As used herein, a “deoxyribonuclease” (abbreviated as “DNase”) is an enzyme that catalyzes the hydrolytic cleavage of phosphodiester linkages in the DNA backbone, thus degrading DNA.

[0062] As used herein, the term “impurities” refers to substances which differ from the chemical composition of the target material (e.g., mRNA transcripts). Impurities are also referred to as contaminants.

[0063] “Inorganic pyrophosphatase” refers to an enzyme that catalyzes the conversion of one ion of pyrophosphate to two phosphate ions, thus inhibiting aggregation and in some instances preventing interaction of pyrophosphate with magnesium ions during T7 transcription reactions.

[0064] As used herein, the term “in vitro” refers to a process that takes place outside a living organism (e.g., a multi-cellular organism, such as a human or a non-human animal), for example, in a test tube, culture dish, or elsewhere outside a living organism.

[0065] As used herein, the term “in vivo” refers to events that occur within a living organism.

[0066] As used herein the term “in vivo assays” refer to methods used to detect and / or measure capacity of one or more of the compounds or molecules including the compounds (e.g., mRNA molecules in, for example, a therapeutic dose) to increase or decrease a property relative to a control (e.g., biomarker levels). Optionally, in vivo assays as described herein can be used to determine a subject’s tolerability levels to a given compound or molecule. Exemplary measurements for assessing tolerability include one or more of body weight, organ weight, aspartate aminotransferase (AST) levels, alanine transaminase (ALT) levels, C- reactive protein (CRP) levels, procalcitonin (PCT) levels, interleukin-6 (IL-6) levels, erythrocyte sedimentation rate (ESR), serum amyloid A levels, and serum ferritin levels.

[0067] As used herein, “locked nucleic acid” (LNA) means a ribonucleotide having a bridge between the 2’O and 4’C methylene bicyclonucleotide monomers. An LNA moiety can have the following structure:Attorney Docket No.: 095109-001300WO-1513793.

[0068] As used herein, “messenger RNA transcript,” or “mRNA transcript,” is a transcript transcribed from a DNA template encoding a desired polypeptide. The mRNA transcript may contain coding and non-coding regions. The coding region is referred to as “open reading frame” or ORF and it encodes the polypeptide of interest. There are two main types of non-coding regions in an mRNA, 5’UTR (untranslated region) located at the 5’ end of the mRNA molecule, upstream of the protein coding region, and 3’ UTR, downstream of the protein coding region. The mRNA may comprise a 5’cap structure upstream of the 5’UTR region. The mRNA may comprise a poly-A region downstream of the 3’UTR region. In embodiments, the DNA template can comprise an RNA polymerase promoter sequence, a 5’ UTR sequence, an open reading frame, and a 3’ UTR sequence. In embodiments, the DNA template also comprises a nucleic acid sequence encoding a poly-A tail. In embodiments, the DNA template can comprise a 5’ UTR sequence, an open reading frame, and a 3’ UTR sequence.

[0069] As used herein, the term “nucleoside” refers to a nitrogenous base linked to a 5 or 6-carbon sugar (e.g., ribose, deoxyribose, glucose, fructose). The term includes all nucleosides, including all forms of nucleoside bases, furanoses, and pyranoses. There are five natural unmodified nucleosides: adenosine (A), Guanosine (G), Cytidine (C), Thymidine (T), and Uridine (U). According to Aduri et al (Aduri, R. et al., AMBER force field parameters for the naturally occurring modified nucleotides in RNA. Journal of Chemical Theory and Computation.2006.3(4):1464-75) there are 107 naturally occurring modified nucleosides, including 1-methyladenosine, 2-methylthio-N6-hydroxynorvalyl carbamoyladenosine, 2- methyladenosine, 2-O-ribosylphosphate adenosine, N6-methyl-N6- threonylcarbamoyladenosine, N6-acetyladenosine, N6-glycinylcarbamoyladenosine, N6- isopentenyladenosine, N6-methyladenosine, N6-threonylcarbamoyladenosine, N6,N6- dimethyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, N6- hydroxynorvalylcarbamoyladenosine, 1,2-O-dimethyladenosine, N6,2-O-dimethyladenosine, 2-O-methyladenosine, N6,N6,O-2-trimethyladenosine, 2-methylthio-N6-(cis- hydroxyisopentenyl) adenosine, 2-methylthio-N6-methyladenosine, 2-methylthio-N6- isopentenyladenosine, 2-methylthio-N6-threonyl carbamoyladenosine, 2-thiocytidine, 3- methylcytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-methylcytidine,Attorney Docket No.: 095109-001300WO-1513793 5-hydroxymethylcytidine, lysidine, N4-acetyl-2-O-methylcytidine, 5-formyl-2-O- methylcytidine, 5,2-O-dimethylcytidine, 2-O-methylcytidine, N4,2-O-dimethylcytidine, N4,N4,2-O-trimethylcytidine, 1-methylguanosine, N2,7-dimethylguanosine, N2- methylguanosine, 2-O-ribosylphosphate guanosine, 7-methylguanosine, under modified hydroxywybutosine, 7-aminomethyl-7-deazaguanosine, 7-cyano-7-deazaguanosine, N2,N2- dimethylguanosine, 4-demethylwyosine, epoxyqueuosine, hydroxywybutosine, isowyosine, N2,7,2-O-trimethylguanosine, N2,2-O-dimethylguanosine, 1,2-O-dimethylguanosine, 2-O- methylguanosine, N2,N2,2-O-trimethylguanosine, N2,N2,7-trimethylguanosine, peroxywybutosine, galactosyl-queuosine, mannosyl-queuosine, queuosine, archaeosine, wybutosine, methylwyosine, wyosine, 2-thiouridine, 3-(3-amino-3-carboxypropyl)uridine, 3- methyluridine, 4-thiouridine, 5-methyl-2-thiouridine, 5-methylaminomethyluridine, 5- carboxymethyluridine, 5-carboxymethylaminomethyluridine, 5-hydroxyuridine, 5- methyluridine, 5-taurinomethyluridine, 5-carbamoylmethyluridine, 5- (carboxyhydroxymethyl)uridine methyl ester, dihydrouridine, 5-methyldihydrouridine, 5- methylaminomethyl-2-thiouridine, 5-(carboxyhydroxymethyl)uridine, 5- (isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl)-2-thiouridine, 3,2-O- dimethyluridine, 5-carboxymethylaminomethyl-2-O-methyluridine, 5-carbamoylmethyl-2-O- methyluridine, 5-methoxycarbonylmethyl-2-O-methyluridine, 5-(isopentenylaminomethyl)-2- O-methyluridine, 5,2-O-dimethyluridine, 2-O-methyluridine, 2-thio-2-O-methyluridine, uridine 5-oxyacetic acid, 5-methoxycarbonylmethyluridine, uridine 5-oxyacetic acid methyl ester, 5-methoxyuridine, 5-aminomethyl-2-thiouridine, 5-carboxymethylaminomethyl-2- thiouridine, 5-methylaminomethyl-2-selenouridine, 5-methoxycarbonylmethyl-2-thiouridine, 5-taurinomethyl-2-thiouridine, pseudouridine, 1-methyl-3-(3-amino-3- carboxypropyl)pseudouridine, 1-methylpseudouridine, 3-methylpseudouridine, 2-O- methylpseudouridine, inosine, 1-methylinosine, 1,2-O-dimethylinosine and 2-O- methylinosine. All other nucleosides are considered unnatural nucleosides. Each of these nucleosides, whether naturally occurring modified nucleosides, unnatural nucleosides or the modified nucleobase thereof may be components of nucleic acids of the present disclosure.

[0070] Modified nucleosides also include nucleosides having modified base or / and sugar moieties, with or without protecting groups and include, for example, 2’-deoxy-2’- fluorouridine, 5-fluorouridine and the like. The compounds and methods provided herein include such base rings and synthetic analogs thereof, as well as unnatural heterocycle- substituted base sugars, and acyclic substituted base. In embodiments, a modified nucleoside may include a 5- or 6-membered ring, alternatively, the ring may be replaced by an acyclicAttorney Docket No.: 095109-001300WO-1513793 structure. Examples of acyclic nucleosides include, but are not limited to, acyclovir, ganciclovir, valacyclovir, famciclovir, adefovir, and the like. Other modified nucleosides that may be utilized with the present disclosure include, for example, LNA nucleosides, halogen- substituted purines (e.g., 6-fluoropurine), halogen-substituted pyrimidines, N6-ethyladenine, N4-(alkyl)-cytosines, 5-ethylcytosine, and the like (U.S. Patent No.6,762,298).

[0071] As used herein, the terms “nucleoside base” or “nucleobase” refer to a nitrogenous base. A “natural nucleoside base” includes purine and pyrimidine rings. Purine rings include, for example, adenine and guanine. Pyrimidine rings include, for example, cytosine, thymine, and uracil.

[0072] As used herein, the terms “modified nucleoside base” or “modified nucleobase” refer to, for example, modified uracil, modified cytosine, modified guanine, or modified adenine, including but not limited to, pseudouracil (^), 2-thio-uracil, 4-thio-uracil, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uracil, 5-halo-uracil, 3-methyl-uracil, 5-aza-uracil, 2-thio-5-aza-uracil, 5-aza-cytosine, 6-aza-cytosine, pseudoisocytidine, 3-methyl- cytosine, 5-methyl-cytosine, 5-halo-cytosine, 2-thio-cytosine, N4-acetyl cytosine, 2-thio-5- methyl-cytosine, 2-amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido-adenine, 7-deaza-adenine, N6-methyl-adenine, 2- methylthio-N6-methyl-adenine, inosine, 1-methyl-inosine, 7-cyano-7-deaza-guanine, 7- aminomethyl-7-deaza-guanine, 6-thio-guanine, 6-thio-7-deaza-guanine, or 6-methoxy- guanine.

[0073] As used herein, the term “nucleoside triphosphate,” “nucleoside 5’ triphosphate” or “NTP” refers to a nucleoside linked to three phosphate groups. The term encompasses natural NTPs (for example, adenosine triphosphate (ATP), uridine triphosphate (UTP), guanine triphosphate (GTP), and cytosine triphosphate (CTP)) as well as modified NTPs.

[0074] As used herein, the terms “modified nucleotide triphosphate” or “modified NTP” refers to a nucleoside 5’-triphosphate having a chemical moiety group bound at any position or substituted at any position, including the sugar, base, triphosphate chain, or any combination of these three locations. In embodiments, the sugar may be replaced by an acyclic group as described above for the modified nucleosides. Optionally, the chemical moiety group may be a group of any nature compatible with the process of transcription. Examples of such NTPs include, but are not limited to, inosine triphosphate, dihydrouridine triphosphate, 2’-fluoro-2’-deoxycytidine triphosphate, pseudouridine triphosphate, N1-Attorney Docket No.: 095109-001300WO-1513793 methylpseudouridine triphosphate, ganciclovir triphosphate, valganciclovir triphosphate, penciclovir triphosphate, and 5-methyluridine triphosphate, and can be found, for example in “Nucleoside Triphosphates and Their Analogs: Chemistry, Biotechnology and Biological Applications,” Vaghefi, M., ed., Taylor and Francis, Boca Raton (2005).

[0075] As used herein, the term “modified RNA” or “modified mRNA” includes, for example, an RNA containing at least one modified nucleoside and / or at least one modified internucleotide linkage, or having any combination of modified nucleosides and internucleotide linkages. Non-limiting examples of internucleotide linkage modifications include, but are not limited to, phosphorothioate, phosphotriester and methylphosphonate derivatives (Stec, W.J., et al., Chem. Int. Ed. Engl., 33:709-722 (1994); Lebedev, A.V., et al., E., Perspect. Drug Discov. Des., 4:17-40 (1996); and Zon, et al., U.S. Patent Application No. . Other of internucleotide linkage modifications may be found inWaldner, et 6:2363-2366 (1996).

[0076] As used herein, the term “hydrophobic group” refers to a water insoluble (or poorly soluble) non-polar molecule. In embodiments, the hydrophobic group includes, for example, but is not limited to C6-C24 alkyl, C4-C24 alkenyl, C4-C24 alkynyl, C3-C8 cycloalkyls, C6-C10 aryls, silyl compounds, trityl compounds, lipids, dyes, steroids, DBCO compounds, vinyl ether compounds, modified and unmodified Fmoc compounds, and the like, and any combinations thereof. As used herein, the terms “hydrophobic moiety” or “hydrophobic group” may be used interchangeably and refer to hydrophobic substituent or a combination of hydrophobic substituents that are carbon rich. The hydrophobicity of a substituent can be determined, measured or calculated through the value of its partition coefficient (log P). The partition coefficient (log P) of a substance defines the ratio of its solubility in two immiscible solvents, normally octanol:water. When this value is calculated rather than measured, it is called cLog P. In embodiments, a hydrophobic group has a cLog P of at least 2 or a combination of two, three or four “partial hydrophobic groups” has a collective value of cLog P of at least 2. Nucleoside bases cytosine, thymine, uracil, adenine, and guanine, whose cLog P is less than 2, are not considered “hydrophobic groups” as defined herein.

[0077] As used herein, the term “internucleotide linkage” refers to the bond or bonds that connect two nucleosides of an oligonucleotide or nucleic acid and may be a natural phosphodiester linkage or modified linkage. Some non-limiting examples of modified internucleotide linkage include, for example, phosphorothioate, phosphorodithioate, thiophosphate, 5'-O-methylphosphonate, 3'-O-methylphosphonate, 5'-hydroxyphosphonate, hydroxyphosphanate, phosphoroselenoate, selenophosphate, phosphoramidate,Attorney Docket No.: 095109-001300WO-1513793 carbophosphonate, phenylphosphonate, ethylphosphonate, H-phosphonate, guanidinium ring, triazole ring, boranophosphate, and methylphosphonate. As used herein, “phosphorothioate linkage” refers to a linkage between nucleosides in which the phosphorodiester linkage is modified by replacing one of the oxygen atoms, connected to a phosphorus atom, with a sulfur atom.

[0078] As used herein, “oligo dT purification” is an affinity chromatography method for purification of mRNA comprising or including a poly-A tail. The process specifically targets and isolates RNA molecules based on their poly-A tails (RNA molecules with poly-A tails bind to the solid support comprising oligo dT, enabling their separation from the RNA molecules without poly-A tails).

[0079] The term “promoter” as used herein refers to a nucleotide sequence in a DNA template that directs and controls the initiation of transcription of a particular DNA sequence. Promoters are typically immediately adjacent to (or partially overlap with) the DNA sequence to be transcribed. Promoter sequences are typically located directly upstream or at the 5' end of the transcription initiation site. Nucleotide positions in the promoter are designated relative to the transcriptional start site, where transcription of DNA begins (position +1).

[0080] As used herein, the term “purified” or “purify” refers to separating a substance from at least some of the components (e.g., impurities or contaminants) with which it was associated when initially produced. For example, RNA transcripts are purified by removal of contaminating proteins or other undesired nucleic acid species (e.g., double-stranded RNA, DNA, and / or incomplete or aborted RNA transcripts). Purified substances (e.g., capped mRNA transcripts) can be separated from 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more than 99% of the other components with which they were initially associated.

[0081] As used herein, the term “RNase inhibitor” or “ribonuclease inhibitor” refers to a protein that inhibits RNAse activity for example, during an in vitro transcription reaction.

[0082] As used herein, the term “RNA polymerase” refers to an enzyme that synthesizes RNA using a DNA template. For in vitro transcription methods, single subunit phage RNA polymerases derived from T7, T3, SP6, K1-5, K1E, K1F or K11 bacteriophages, or variants thereof, are typically used. This family of polymerases has simple, minimal promoter sequences of about 17 nucleotides which require no accessory proteins and have minimal constraints of the initiating nucleotide sequence.

[0083] As used herein, “self-amplifying RNA,” or “saRNA,” is a linear, single- stranded RNA molecule that encodes the gene of interest. saRNA is a type of mRNA, butAttorney Docket No.: 095109-001300WO-1513793 also includes non-structural proteins that encode a viral replicase. The viral replicase enables the RNA to self-replicate once delivered into the cell.

[0084] As used herein, the term “substantially free” refers to a state in which relatively little or no amount of an undesired substance (e.g., prematurely aborted RNA sequences, DNA, and / or double-stranded RNA) is present in a sample. “Substantially free of impurities” means impurities are present at a level less than approximately 5%, 4%, 3%, 2%, 1.0%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1% or less (w / w) in a sample. For example, “substantially free of double-stranded RNA” means double-stranded RNA is present at a level less than approximately 5%, 4%, 3%, 2%, 1.0%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1% or less (w / w) in a sample.

[0085] As used herein, “tangential flow filtration (TFF)” is a type of filtration wherein the material to be filtered is passed tangentially across a filter rather than through it. In TFF, undesired permeate passes through the filter, while the desired retentate passes along the filter and is collected downstream. In TFF, the desired material is typically contained in the retentate, which is the opposite of what is encountered when performing traditional membrane or dead-end filtration.

[0086] As used herein, the term “transcription” refers to enzymatically making or synthesizing RNA that is complementary to a DNA template, thereby producing a number of RNA copies of a DNA sequence. The RNA molecule synthesized in a transcription reaction is an “RNA transcript,” “primary transcript,” or “transcript.” Transcription reactions involving the compositions and methods provided herein employ initiating capped oligonucleotide primers described herein. Transcription of a DNA template may be exponential, nonlinear or linear. A DNA template may be a double-stranded linear DNA, a partially double-stranded linear DNA, circular double-stranded DNA, DNA plasmid, PCR amplified product, or a modified nucleic acid template that is compatible with RNA polymerase.

[0087] As used herein, the term “prematurely aborted RNA transcript” refers to incomplete products of an in vitro transcription reaction. Prematurely aborted RNA sequences may be any length that is less than the intended length of the desired transcriptional product.

[0088] As used herein, the term “subject” or “patient” can be a vertebrate, such as a mammal, a fish, a bird, a reptile, or an amphibian. Thus, the subject of the herein disclosed methods can be a human, non-human primate, horse, pig, rabbit, dog, sheep, goat, cow, cat, guinea pig or rodent. The term does not denote a particular age or sex. Thus, adult andAttorney Docket No.: 095109-001300WO-1513793 newborn subjects, as well as fetuses, whether male or female, are intended to be covered. In one aspect, the subject is a mammal. A patient refers to a subject afflicted with a disease or disorder. The term “patient” includes human and veterinary subjects.

[0089] The terms "effective amount", “therapeutically effective amount” or “effective dose” or related terms may be used interchangeably and refer to an amount of the therapeutic agent that when administered to a subject, is sufficient to achieve the desired therapeutic result or to have an effect on undesired symptoms, but is generally insufficient to cause adverse side effects. Therapeutically effective amounts of the therapeutic agents provided herein will vary depending upon the relative activity of the therapeutic agent, and depending upon the subject and disease condition being treated, the weight and age and sex of the subject, the severity of the disease condition in the subject, the manner of administration, drugs used in combination or coincidental with the specific compound employed and the like, which can readily be determined by one of ordinary skill in the art. In one embodiment, a therapeutically effective amount will depend on certain aspects of the subject to be treated and the disorder to be treated and may be ascertained by one skilled in the art using known techniques. In addition, as is known in the art, adjustments for age as well as the body weight, general health, sex, diet, time of administration, drug interaction, and the severity of the disease may be necessary. For example, it is well within the skill of the art to start doses of a compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. If desired, the effective daily dose can be divided into multiple doses for purposes of administration. Consequently, single dose compositions can contain such amounts or submultiples thereof to make up the daily dose. The dosage can be adjusted by the individual physician in the event of any contraindications. Dosage can vary, and can be administered in one or more dose administrations daily, for one or several days. Guidance can be found in the literature for appropriate dosages for given classes of pharmaceutical products. In further various aspects, a preparation can be administered in a “prophylactically effective amount”; that is, an amount effective for prevention of a disease or condition.

[0090] As used herein, “dosage form” means a pharmacologically active material in a medium, carrier, vehicle, or device suitable for administration to a subject. A dosage form can comprise a disclosed compound, a product of a disclosed method of making, or a salt, solvate, or polymorph thereof, in combination with a pharmaceutically acceptable excipient, such as a preservative, buffer, saline, or phosphate buffered saline. Dosage forms can be made using conventional pharmaceutical manufacturing and compounding techniques. Dosage forms canAttorney Docket No.: 095109-001300WO-1513793 comprise inorganic or organic buffers (e.g., sodium or potassium salts of phosphate, carbonate, acetate, or citrate) and pH adjustment agents (e.g., hydrochloric acid, sodium or potassium hydroxide, salts of citrate or acetate, amino acids and their salts), antioxidants (e.g., ascorbic acid, alpha-tocopherol), surfactants (e.g., polysorbate 20, polysorbate 80, polyoxyethylene9- 10 nonyl phenol, sodium deoxycholate), solution and / or cryo / lyo stabilizers (e.g., sucrose, lactose, mannitol, trehalose), osmotic adjustment agents (e.g., salts or sugars), antibacterial agents (e.g., benzoic acid, phenol, gentamicin), antifoaming agents (e.g., polydimethylsilozone), preservatives (e.g., thimerosal, 2-phenoxyethanol, EDTA), polymeric stabilizers and viscosity-adjustment agents (e.g., polyvinylpyrrolidone, poloxamer 488, carboxymethylcellulose) and co-solvents (e.g., glycerol, polyethylene glycol, ethanol). A dosage form formulated for injectable use can have a disclosed compound, a product of a disclosed method of making, or a salt, solvate, or polymorph thereof, suspended in sterile saline solution for injection together with a preservative.

[0091] As used herein, “kit” means a collection of at least two components constituting the kit. Together, the components constitute a functional unit for a given purpose. Individual member components may be physically packaged together or separately. For example, a kit comprising an instruction for using the kit may or may not physically include the instruction with other individual member components. Instead, the instruction can be supplied as a separate member component, either in a paper form or an electronic form which may be supplied on computer readable memory device or downloaded from an internet website, or as recorded presentation.

[0092] The term “administering”, “administered” and grammatical variants refers to the physical introduction of a therapeutic agent to a subject, using any of the various methods and delivery systems known to those skilled in the art. Exemplary routes of administration for the formulations disclosed herein include intravenous, intramuscular, subcutaneous, intraperitoneal, spinal or other parenteral routes of administration, for example by injection or infusion. The phrase “parenteral administration” as used herein means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intralymphatic, intralesional, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion, as well as in vivo electroporation. In one embodiment, the formulation is administered via a non-parenteral route, e.g., orally. Other non-parenteral routes include a topical, epidermal or mucosal routeAttorney Docket No.: 095109-001300WO-1513793 of administration, for example, intranasally, vaginally, rectally, sublingually or topically. Administering can also be performed, for example, once, a plurality of times, and / or over one or more extended periods. Administration can be continuous or intermittent. In various aspects, a preparation can be administered therapeutically; that is, administered to treat an existing disease or condition. In further various aspects, a preparation can be administered prophylactically; that is, administered for prevention of a disease or condition.

[0093] “Treating” is to be understood broadly and encompasses any beneficial effect, including, e.g., delaying, slowing, or arresting the worsening of symptoms associated with a viral disease or remedying such symptoms, at least in part. The term is intended to include the cure or elimination of the disease, disorder or condition. Those in need of treatment include those who already have the disease or disorder, as well as those who should prevent the disease or disorder. The patient to be treated is preferably a mammal, in particular a human being.

[0094] As used herein, the term “prevent” or “preventing” refers to precluding, averting, obviating, forestalling, stopping, or hindering something from happening, especially by advance action. It is understood that where reduce, inhibit or prevent are used herein, unless specifically indicated otherwise, the use of the other two words is also expressly disclosed.

[0095] As used herein, the term “therapeutic agent” includes any synthetic or naturally occurring biologically active compound or composition of matter which, when administered to an organism (human or nonhuman animal), induces a desired pharmacologic, immunogenic, and / or physiologic effect by local and / or systemic action. The term therefore encompasses those compounds or chemicals traditionally regarded as drugs, vaccines, and biopharmaceuticals including molecules such as proteins, peptides, hormones, nucleic acids, gene constructs and the like. In addition to the RNA molecules described herein, provided below are some non-limiting examples of other therapeutic agents. The following therapeutic agents are described in well-known literature references such as the Merck Index (14thedition), the Physicians' Desk Reference (64thedition), and The Pharmacological Basis of Therapeutics (12thedition), and they include, without limitation, medicaments; vitamins; mineral supplements; substances used for the treatment, prevention, diagnosis, cure or mitigation of a disease or illness; substances that affect the structure or function of the body, or pro-drugs, which become biologically active or more active after they have been placed in a physiological environment. For example, the term “therapeutic agent” includes compounds or compositions for use in all of the major therapeutic areas including, but not limited to,Attorney Docket No.: 095109-001300WO-1513793 adjuvants; anti-infectives such as antibiotics and antiviral agents; analgesics and analgesic combinations, anorexics, anti-inflammatory agents, anti-epileptics, local and general anesthetics, hypnotics, sedatives, antipsychotic agents, neuroleptic agents, antidepressants, anxiolytics, antagonists, neuron blocking agents, anticholinergic and cholinomimetic agents, antimuscarinic and muscarinic agents, antiadrenergics, antiarrhythmics, antihypertensive agents, hormones, and nutrients, antiarthritics, antiasthmatic agents, anticonvulsants, antihistamines, antinauseants, antineoplastics, antipruritics, antipyretics; antispasmodics, cardiovascular preparations (including calcium channel blockers, beta-blockers, beta-agonists and antiarrythmics), antihypertensives, diuretics, vasodilators; central nervous system stimulants; cough and cold preparations; decongestants; diagnostics; hormones; bone growth stimulants and bone resorption inhibitors; immunosuppressives; muscle relaxants; psychostimulants; sedatives; tranquilizers; proteins, peptides, and fragments thereof (whether naturally occurring, chemically synthesized or recombinantly produced); and nucleic acid molecules (polymeric forms of two or more nucleotides, either ribonucleotides (RNA) or deoxyribonucleotides (DNA) including both double- and single-stranded molecules, gene constructs, expression vectors, antisense molecules and the like), small molecules (e.g., doxorubicin) and other biologically active macromolecules such as, for example, proteins and enzymes. The agent may be a biologically active agent used in medical, including veterinary, applications and in agriculture, such as with plants, as well as other areas. The term "therapeutic agent" also includes without limitation, medicaments; vitamins; mineral supplements; substances used for the treatment, prevention, diagnosis, cure or mitigation of disease or illness; or substances which affect the structure or function of the body; or pro- drugs, which become biologically active or more active after they have been placed in a predetermined physiological environment.

[0096] As used herein, the term “derivative” refers to a compound having a structure derived from the structure of a parent compound (e.g., a compound disclosed herein) and whose structure is sufficiently similar to those disclosed herein and based upon that similarity, would be expected by one skilled in the art to exhibit the same or similar activities and utilities as the claimed compounds, or to induce, as a precursor, the same or similar activities and utilities as the claimed compounds. Exemplary derivatives include salts, esters, amides, salts of esters or amides, and N-oxides of a parent compound.

[0097] “Analog,” or “analogue” is used in accordance with its plain ordinary meaning within Chemistry and Biology and refers to a chemical compound that is structurally similar to another compound (i.e., a so-called “reference” compound) but differs in composition, e.g.,Attorney Docket No.: 095109-001300WO-1513793 in the replacement of one atom by an atom of a different element, or in the presence of a particular functional group, or the replacement of one functional group by another functional group, or the absolute stereochemistry of one or more chiral centers of the reference compound. Accordingly, an analog is a compound that is similar or comparable in function and appearance but not in structure or origin to a reference compound.

[0098] “Pharmaceutically acceptable excipient” and “pharmaceutically acceptable carrier” refer to a substance that aids the administration of an active agent to and absorption by a subject and can be included in the compositions of the present disclosure without causing a significant adverse toxicological effect on the patient. Non-limiting examples of pharmaceutically acceptable excipients include water, NaCl, normal saline solutions, lactated Ringer’s, normal sucrose, normal glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavors, salt solutions (such as Ringer's solution), alcohols, oils, gelatins, carbohydrates such as lactose, amylose or starch, fatty acid esters, hydroxymethycellulose, polyvinyl pyrrolidine, and colors, and the like. Such preparations can be sterilized and, if desired, mixed with auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, and / or aromatic substances and the like that do not deleteriously react with the compounds of the disclosure. One of skill in the art will recognize that other pharmaceutical excipients are useful in the present disclosure.

[0099] Combination therapy or “in combination with” refer to the use of more than one therapeutic agent to treat a particular disorder or condition. By “in combination with,” it is not intended to imply that the therapeutic agents must be administered at the same time and / or formulated for delivery together, although these methods of delivery are within the scope of this disclosure. A therapeutic agent can be administered concurrently with, prior to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, 12 weeks, or 16 weeks before), or subsequent to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, 12 weeks, or 16 weeks after), one or more other additional agents. The therapeutic agents in a combination therapy can also be administered on an alternating dosing schedule, with or without a resting period (e.g., no therapeutic agent is administered on certain days of the schedule). The administration of a therapeutic agent “in combination with” another therapeutic agent includes, but is not limited to, sequential administration and concomitantAttorney Docket No.: 095109-001300WO-1513793 administration of the two agents. In general, each therapeutic agent is administered at a dose and / or on a time schedule determined for that particular agent.

[0100] In this disclosure, “comprises,” “comprising,” “containing” and “having” and the like can have the meaning ascribed to them in U.S. Patent law and can mean “includes,” “including,” and the like. “Consisting essentially of or “consists essentially” likewise has the meaning ascribed in U.S. Patent law and the term is open-ended, allowing for the presence of more than that which is recited so long as basic or novel characteristics of that which is recited is not changed by the presence of more than that which is recited, but excludes prior art embodiments. RNA molecules

[0101] Described herein are RNA molecules comprising: a 5’-cap structure, a 5’ untranslated region (5’ UTR), an open reading frame (ORF) encoding a polypeptide of interest, a 3’ untranslated region (3’ UTR), and a poly-A region, and where one modified nucleotide triphosphate (NTP) is covalently linked at the 3’ end of the poly-A region. Additionally, described herein are pharmaceutical compositions comprising said RNA molecules, and methods of preparing said RNA molecules.

[0102] In an aspect, provided herein is an RNA molecule comprising: a) a 5’-cap structure; b) a 5’ untranslated region (5’ UTR); c) an open reading frame (ORF) encoding a polypeptide of interest; d) a 3’ untranslated region (3’ UTR); and e) a poly-A region having a 3’ end, wherein one modified nucleotide triphosphate (NTP) is covalently linked to the 3’ end of the poly-A region.

[0103] In embodiments, the RNA molecule is an mRNA molecule. In embodiments, the RNA molecule is a linear RNA molecule. In embodiments, the RNA molecule is a circular RNA molecule. In embodiments, the RNA molecule is a linear mRNA molecule. In embodiments, the RNA molecule is a circular mRNA molecule. In embodiments, the RNA molecule is a self-amplifying RNA molecule.

[0104] In embodiments, modified NTP may include a modified nucleobase and / or a modified sugar and / or a modified phosphate. In embodiments, modified NTP may include a modified nucleobase, a modified sugar, and a modified phosphate. In embodiments, modified NTP may include a modified nucleobase. In embodiments, modified NTP may include a modified sugar. In embodiments, modified NTP may include a modified phosphate. In embodiments, modified NTP may include a modified nucleobase and a modified sugar. InAttorney Docket No.: 095109-001300WO-1513793 embodiments, modified NTP may include a modified nucleobase and a modified phosphate. In embodiments, modified NTP may include a modified phosphate and a modified sugar.

[0105] In embodiments, modified NTP may include a modified nucleobase and / or an acyclic structure and / or a modified phosphate. In embodiments, modified NTP may include a modified nucleobase, an acyclic structure, and a modified phosphate. In embodiments, modified NTP may include a modified nucleobase. In embodiments, modified NTP may include an acyclic structure. In embodiments, modified NTP may include a modified phosphate. In embodiments, modified NTP may include a modified nucleobase and an acyclic structure. In embodiments, modified NTP may include a modified nucleobase and a modified phosphate. In embodiments, modified NTP may include a modified phosphate and an acyclic structure.

[0106] In embodiments, the modified nucleobase is a modified uracil, a modified cytosine, a modified guanine, or a modified adenine. In embodiments, the modified nucleobase is a modified uracil. In embodiments, the modified nucleobase is a modified cytosine. In embodiments, the modified nucleobase is a modified guanine. In embodiments, the modified nucleobase is a modified adenine. In embodiments, the modified nucleobase, may be but is not limited to, pseudouracil (^), 2-thio-uracil, 4-thio-uracil, 4-thio- pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uracil, 5-halo-uracil, 3-methyl-uracil, 5-aza- uracil, or 2-thio-5-aza-uracil. In embodiments, the modified nucleobase is 5-aza-cytosine, 6- aza-cytosine, pseudoisocytidine, 3-methyl-cytosine, 5-methyl-cytosine, 5-halo-cytosine, 2- thio-cytosine, N4-acetyl cytosine or 2-thio-5-methyl-cytosine. In embodiments, the modified nucleobase is 2-amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, 2- amino-6-methyl-purine, 8-azido-adenine, 7-deaza-adenine, N6-methyl-adenine, or 2- methylthio-N6-methyl-adenine. In embodiments, the modified nucleobase is inosine, 1- methyl-inosine, 7-cyano-7-deaza-guanine, 7-aminomethyl-7-deaza-guanine, 6-thio-guanine, 6-thio-7-deaza-guanine, or 6-methoxy-guanine.

[0107] Some non-limiting examples of modified nucleosides and nucleobases include pseudouridine (ψ), pyridin-4-one ribonucleoside, 5-aza-uracil, 6-aza-uracil, 2-thio-5-aza- uracil, 2-thio-uracil (s2U), 4-thio-uracil (s4U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5- hydroxy-uracil (ho5U), 5-aminoallyl-uracil, 5-halo-uracil (e.g., 5-iodo-uracil or 5-bromo- uracil), 3-methyl-uracil (m3U), 5-methoxy-uracil (mo5U), uracil 5-oxyacetic acid (cmo5U), uracil 5-oxyacetic acid methyl ester (mcmo5U), 5-carboxymethyl-uracil (cm5U), 1- carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uracil (chm5U), 5-Attorney Docket No.: 095109-001300WO-1513793 carboxyhydroxymethyl-uracil methyl ester (mchm5U), 5-methoxycarbonylmethyl-uracil (mcm5U), 5-methoxycarbonylmethyl-2-thio-uracil (mcm5s2U), 5-aminomethyl-2-thio-uracil (nm5s2U), 5-methylaminomethyl-uracil (mnm5U), 5-methylaminomethyl-2-thio-uracil (mnm5s2U), 5-methylaminomethyl-2-seleno-uracil (mnm5se2U), 5-carbamoylmethyl-uracil (ncm5U), 5-carboxymethylaminomethyl-uracil (cmnm5U), 5-carboxymethylaminomethyl-2- thio-uracil (cmnm5s2U), 5-propynyl-uracil, 1-propynyl-pseudouracil, 5-taurinomethyl-uracil (τm5U), 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uracil(τm5s2U), 1- taurinomethyl-4-thio-pseudouridine, 5-methyl-uracil (m5U, i.e., having the nucleobase deoxythymine), 1-methyl-pseudouridine5 2, 5-methyl-2-thio-uracil (m s U), 1-methyl-4- thio- , 4-thio-1-methyl-pseu3douridine, 3-methyl-pseudouridine (m ψ), 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza- pseudouridine, dihydrouracil (D), dihydropseudouridine, 5,6-dihydrouracil, 5-methyl- dihydrouracil (m5D), 2-thio-dihydrouracil, 2-thio-dihydropseudouridine, 2-methoxy-uracil, 2- methoxy-4-thio-uracil, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1- methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uracil (acp3U), 1-methyl-3-(3-amino-3- carboxypropyl)pseudouridine (acp3ψ), 5-(isopentenylaminomethyl)uracil (inm5U), 5- (isopentenylaminomethyl)-2-thio-uracil (inm5s2U), 5,2′-O-dimethyl-uridine (m5Um), 2-thio- 2′-O-methyl-uridine (s2Um), 5-methoxycarbonylmethyl-2′-O-methyl-uridine (mcm5Um), 5- carbamoylmethyl-2′-O-methyl-uridine (ncm5Um), 5-carboxymethylaminomethyl-2′-O- methyl-uridine (cmnm5Um), 3,2′-O-dimethyl-uridine (m3Um), and 5- (isopentenylaminomethyl)-2′-O-methyl-uridine (inm5Um), 1-thio-uracil, deoxythymidine, 5- (2-carbomethoxyvinyl)-uracil, 5-(carbamoylhydroxymethyl)-uracil, 5-carbamoylmethyl-2- thio-uracil, 5-carboxymethyl-2-thio-uracil, 5-cyanomethyl-uracil, 5-methoxy-2-thio-uracil, 5- aza-cytosine, 6-aza-cytosine, pseudoisocytidine, 3-methyl-cytosine (m3C), N4-acetyl- cytosine (ac4C), 5-formyl-cytosine (f5C), N4-methyl-cytosine (m4C), 5-methyl-cytosine (m5C), 5-halo-cytosine (e.g., 5-iodo-cytosine), 5-hydroxymethyl-cytosine (hm5C), 1-methyl- pseudoisocytidine, pyrrolo-cytosine, pyrrolo-pseudoisocytidine, 2-thio-cytosine (s2C), 2-thio- 5-methyl-cytosine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1- methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza- zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy- cytosine, 2-methoxy-5-methyl-cytosine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl- pseudoisocytidine, lysidine (k2C), 5,2′-O-dimethyl-cytidine (m5Cm), N4-acetyl-2′-O-methyl- cytidine (ac4Cm), N4,2′-O-dimethyl-cytidine (m4Cm), 5-formyl-2′-O-methyl-cytidine (f5Cm), N4,N4,2′-O-trimethyl-cytidine (m42Cm), 1-thio-cytosine, 5-hydroxy-cytosine, 5-(3-Attorney Docket No.: 095109-001300WO-1513793 azidopropyl)-cytosine, 5-(2-azidoethyl)-cytosine 2-amino-purine, 2,6-diaminopurine, 2- amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2- amino-6-methyl-purine, 8-azido-adenine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza- 2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza- 2,6-diaminopurine, 1-methyl-adenine (m1A), 2-methyl-adenine (m2A), N6-methyl-adenine (m6A), 2-methylthio-N6-methyl-adenine (ms2m6A), N6-isopentenyl-adenine (i6A), 2- methylthio-N6-isopentenyl-adenine (ms2i6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyl- adenine (g6A), N6-threonylcarbamoyl-adenine (t6A), N6-methyl-N6-threonylcarbamoyl- adenine (m6t6A), 2-methylthio-N6-threonylcarbamoyl-adenine (ms2g6A), N6,N6-dimethyl- adenine (m62A), N6-hydroxynorvalylcarbamoyl-adenine (hn6A), 2-methylthio-N6- hydroxynorvalylcarbamoyl-adenine (ms2hn6A), N6-acetyl-adenine (ac6A), 7-methyl- adenine, 2-methylthio-adenine, 2-methoxy-adenine, N6,2′-O-dimethyl-adenosine (m6Am), N6,N6,2′-O-trimethyl-adenosine (m62Am), 1,2′-O-dimethyl-adenosine (mlAm), 2-amino- N6-methyl-purine, 1-thio-adenine, 8-azido-adenine, N6-(19-amino-pentaoxanonadecyl)- adenine, 2,8-dimethyl-adenine, N6-formyl-adenine, N6-hydroxymethyl-adenine, inosine (I), 1-methyl-inosine (m1I), wyosine (imG), methylwyosine (mimG), 4-demethyl-wyosine (imG- 14), isowyosine (imG2), wybutosine (yW), peroxywybutosine (o2yW), hydroxywybutosine (OHyW), undermodified hydroxywybutosine (OHyW*), 7-deaza-guanine, queuosine (Q), epoxyqueuosine (oQ), galactosyl-queuosine (galQ), mannosyl-queuosine (manQ), 7-cyano-7- deaza-guanine (preQ0), 7-aminomethyl-7-deaza-guanine (preQ1), archaeosine (G+), 7-deaza- 8-aza-guanine, 6-thio-guanine, 6-thio-7-deaza-guanine, 6-thio-7-deaza-8-aza-guanine, 7- methyl-guanine (m7G), 6-thio-7-methyl-guanine, 7-methyl-inosine, 6-methoxy-guanine, 1- methyl-guanine (m1G), N2-methyl-guanine (m2G), N2,N2-dimethyl-guanine (m22G), N2,7- dimethyl-guanine (m2,7G), N2, N2,7-dimethyl-guanine (m2,2,7G), 8-oxo-guanine, 7-methyl- 8-oxo-guanine, 1-methyl-6-thio-guanine, N2-methyl-6-thio-guanine, N2,N2-dimethyl-6-thio- guanine, N2-methyl-2′-O-methyl-guanosine (m2Gm), N2,N2-dimethyl-2′-O-methyl- guanosine (m22Gm), 1-methyl-2′-O-methyl-guanosine (m1Gm), N2,7-dimethyl-2′-O-methyl- guanosine (m2,7Gm), 2′-O-methyl-inosine (Im), 1,2′-O-dimethyl-inosine (m1Im), 1-thio- guanine, and O-6-methyl-guanine. In embodiments, the modified nucleobase may be any of the foregoing nucleobases.

[0108] In embodiments, the modified sugar comprises a 5-membered ring, a 6- membered ring, or is a modified ribose. In embodiments, the ribose is replaced with a morpholino ring. In embodiments, the modified NTP comprises a morpholino ring. InAttorney Docket No.: 095109-001300WO-1513793 embodiments, the modified sugar is a modified ribose where the modified ribose is 2'- thioribose, 2', 3'-dideoxyribose, 2'-amino-2'-deoxyribose, 2' deoxyribose, 2'- azido-2'- deoxyribose, 2'-fluoro-2'-deoxyribose, 2'-O-methylribose, 2'-O-methyldeoxyribose, or 3'- amino-2',3'-dideoxyribose.

[0109] In embodiments, the modified ribose is 2'-thioribose. In embodiments, the modified ribose is 2', 3'-dideoxyribose. In embodiments, the modified ribose is 2'-amino-2'- deoxyribose. In embodiments, the modified ribose is 2' deoxyribose. In embodiments, the modified ribose is 2'- azido-2'-deoxyribose. In embodiments, the modified ribose is 2'-fluoro- 2'-deoxyribose. In embodiments, the modified ribose is 2'-O-methylribose. In embodiments, the modified ribose is 2'-O-methyldeoxyribose. In embodiments, the modified ribose is 3'- amino-2',3'-dideoxyribose. In embodiments, the modified ribose is is ribose isAttorney Docket No.: 095109-001300WO-1513793 ismodifications of the 2’-hydroxy group of the ribose ring, replacement of the oxygen in the ribose ring, expansion or contraction of the ribose ring. In embodiments, a modified sugar may comprise any of the foregoing modifications. In embodiments, the 2’-hydroxy group of the ribose ring can be replaced with a hydrogen, halo, methoxy, azido, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl.

[0111] In embodiments, the 2’-hydroxy group of the ribose ring can be replaced with a hydrogen. In embodiments, the 2’-hydroxy group of the ribose ring can be replaced with a halogen. In embodiments, the 2’-hydroxy group of the ribose ring can be replaced with an azido group. In embodiments, the 2’-hydroxy group of the ribose ring can be replaced with a methoxy. In embodiments, the 2’-hydroxy group of the ribose ring can be replaced with a substituted or unsubstituted alkyl. In embodiments, the 2’-hydroxy group of the ribose ring can be replaced with a substituted or unsubstituted heteroalkyl. In embodiments, the 2’- hydroxy group of the ribose ring can be replaced with a substituted or unsubstituted cycloalkyl. In embodiments, the 2’-hydroxy group of the ribose ring can be replaced with aAttorney Docket No.: 095109-001300WO-1513793 substituted or unsubstituted heterocycloalkyl. In embodiments, the 2’-hydroxy group of the ribose ring can be replaced with a substituted or unsubstituted aryl. In embodiments, the 2’- hydroxy group of the ribose ring can be replaced with a substituted or unsubstituted heteroaryl.

[0112] In embodiments, the 2’-hydroxy group on the ribose ring can be replaced with a hydrophobic group. For example, the 2’-hydroxy group on the ribose ring can be replaced with an azido group which can then undergo a click reaction with DBCO-NHS (dibenzocyclooctyne-NHS ester) or a substituted DBCO-NHS. In embodiments, the hydrophobic group can be, for example, dibenzocyclooctyne. In embodiments, the hydrophobic group is covalently linked to the 2’-position on the ribose ring via a linker. In embodiments, the hydrophobic group includes, for example, but is not limited to C6-C24 alkyl, C4-C24alkenyl, C4-C24alkynyl, C3-C8cycloalkyls, C6-C10aryls, silyl compounds, trityl compounds, lipids, dyes, steroids, DBCO compounds, vinyl ether compounds, modified and unmodified Fmoc compounds, and the like, and any combinations thereof.

[0113] In embodiments, the hydrophobic group includes a C6-C24 alkyl. In embodiments, the hydrophobic group includes a C4-C24 alkenyl. In embodiments, the hydrophobic group includes a C4-C24 alkynyl. In embodiments, the hydrophobic group includes a C3-C8cycloalkyl. In embodiments, the hydrophobic group includes a C6-C10aryl. In embodiments, the hydrophobic group includes a silyl compound. In embodiments, the hydrophobic group includes a trityl compound. In embodiments, the hydrophobic group includes a lipid. In embodiments, the hydrophobic group includes a steroid. In embodiments, the hydrophobic group includes DBCO compounds. In embodiments, the hydrophobic group includes a vinyl ether compound. In embodiments, the hydrophobic group includes a modified Fmoc compound. In embodiments, the hydrophobic group includes an unmodified Fmoc compound.

[0114] In embodiments, the hydrophobic group includes for example, but is not limited to propyl, butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, undecyl, dodecyl, tridecyl, tetradecyl, and pentadecyl. In embodiments, the hydrophobic group includes for example, but is not limited to phenyl, benzyl, (ethyl)carbonyl(azadibenzocyclooctyne) (DBCO), 4- ethylphenol, dibenzohexyltriazoloazocine, and 1’-O-butyl 3’, 4’, 6’-triacetyl GalNAc.

[0115] In embodiments, the hydrophobic group isAttorney Docket No.: 095109-001300WO-1513793 (ethyl)carbonyl In embodiments, thehydrophobic group is 4- . In embodiments, the hydrophobicgroup embodiments, the hydrophobic group is1’-Attorney Docket No.: 095109-001300WO-1513793 -Se-, -NH-, or -CH2-. In embodiments, the oxygen in the ribose ring can be replaced with a -S-. In embodiments, the oxygen in the ribose ring can be replaced with a -Se-. In embodiments, the oxygen in the ribose ring can be replaced with a -NH-. In embodiments, the oxygen in the ribose ring can be replaced with a -CH2-. In embodiments, the ribose ring can be replaced with another ring, for example, the ring can be a cyclobutene, mannitol, cyclohexanyl, or a morpholino ring. In embodiments, the ribose ring can be replaced with a locked ring (LNA). In embodiments, the ribose ring can be replaced with a morpholino ring. In embodiments, the ribose ring can be replaced with a cyclobutene. In embodiments, the ribose ring can be replaced with a mannitol. In embodiments, the ribose ring can be replaced with cyclohexanyl.

[0117] In embodiments, the ribose ring of the NTP may be replaced by an acyclic structure. Examples of NTPs comprising an acyclic structure include, but are not limited to, acyclovir triphosphate, ganciclovir triphosphate, valacyclovir triphosphate, famciclovir triphosphate, adefovir triphosphate, and the like.

[0118] In embodiments, the modified NTP comprises a modified phosphate. In embodiments, the modified phosphate may be, but is not limited to, phosphorothioate, phosphorodithioate, thiophosphate, 5'-O-methylphosphonate, 3'-O-methylphosphonate, 5'- hydroxyphosphonate, hydroxyphosphanate, phosphoroselenoate, selenophosphate, phosphoramidate, carbophosphonate, phenylphosphonate, ethylphosphonate, H-phosphonate, guanidinium ring, triazole ring, boranophosphate, methylphosphonate, or guanidinopropyl phosphoramidate.

[0119] In embodiments, the modified phosphates include, for example, phosphorothioates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, and phosphotriesters. In embodiments, the modified phosphate is phosphorothioate. In embodiments, the modified phosphate is phosphoramidate. In embodiments, the modified phosphates may be phosphorodithioates where both non-linking oxygens are replaced by sulfur. In embodiments, the modified phosphates may include replacing the linking oxygen with -HN-, -S-, or -CH2-. In embodiments, the modified phosphates may include replacing the linking oxygen with -HN-. In embodiments, the modified phosphates may include replacing the linking oxygen with -S-. In embodiments, the modified phosphates may include replacing the linking oxygen with -CH2-. In embodiments, the modified phosphates may include replacing the non-linking oxygen (single bond to phosphor) with methyl, ethyl, methoxy, -SH, or -BH3, or any combination thereof. In embodiments, the modifiedAttorney Docket No.: 095109-001300WO-1513793 phosphates may include replacing the non-linking oxygen (single bond to phosphor) with methyl. In embodiments, the modified phosphates may include replacing the non-linking oxygen (single bond to phosphor) with ethyl. In embodiments, the modified phosphates may include replacing the non-linking oxygen (single bond to phosphor) with methoxy. In embodiments, the modified phosphates may include replacing the non-linking oxygen (single bond to phosphor) with -SH. In embodiments, the modified phosphates may include replacing the non-linking oxygen (single bond to phosphor) with -BH3.

[0120] Various 5’-cap structures may be used in the synthesis of the RNA molecules described herein. The 5’-cap structure increases the stability of RNA and its resistance to exonuclease degradation. The 5’-cap is also essential for the initiation of translation, where it serves as a recognition site for the translation initiation complex.

[0121] 5’-cap structures include those described in International Patent Publications Nos. WO 2017 / 053297, WO 2023 / 147352, WO 2021 / 162566, WO 2021 / 162567, WO 2022 / 006368, WO 2022 / 086140, WO 2023 / 033551, WO 2018 / 075827, WO 2023 / 007019, WO2025024563, and WO2025054401, the cap structures of each of which are incorporated herein by reference.

[0122] In embodiments, 5’-cap structures (cap analogs) may cap the RNA molecules during the in vitro transcription (IVT) reaction. In embodiments, RNA molecules may be capped using enzymes following transcription reaction. In embodiments, the RNA molecules described herein may contain a cap analog. In embodiments, the cap analogs may increase the stability of the RNA molecules. In embodiments, the cap analogs may increase the half-life of the RNA molecules. In embodiments, the cap analogs may increase the translational efficiency of the RNA molecules.

[0123] Some non-limiting examples of cap analogs include, but are not limited to,m7G3’OMepppA2’OMepG,m7G3’OMeppp(N-6methyladenine)2’OMepG,m7G3’OMepppApG,m7G3’OMeppp(N-6methyladenine)pG,m7G3’OMepppG2’OMepG,m7G3’OMepppGpG,m7GpppA2’OMepG,m7Gppp(N-6methyladenine)2’OMepG,m7GpppApG,m7Gppp(N- 6methyladenine)pG,m7GpppG2’OMepG,m7GpppGpG,m7GpppA2’OMepU,m7GpppApU,m7G3’OMepppA2’OMepU, andm7G3’OMepppApU.

[0124] In embodiments, a 5’-UTR is upstream of the translation initiation site. In embodiments, 5’-UTR is adjacent to the 5’-end of the open reading frame (ORF) encoding a protein and downstream of the 5’-cap.

[0125] In embodiments, a 3’-UTR is downstream of the translation initiation site. In embodiments, 3’-UTR is adjacent to the 3’-end of the open reading frame (ORF) encoding aAttorney Docket No.: 095109-001300WO-1513793 protein. In embodiments, a 3’-UTR is upstream of the poly-A region.

[0126] In embodiments, the poly-A region includes from about 2 to about 500 nucleotides in length. In embodiments, the poly-A region is 10 or greater nucleotides in length. In embodiments, the poly-A region is 20 or greater nucleotides in length. In embodiments, the poly-A region is 30 or greater nucleotides in length. In embodiments, the poly-A region is 40 or greater nucleotides in length. In embodiments, the poly-A region is 50 or greater nucleotides in length. In embodiments, the poly-A region is 60 or greater nucleotides in length. In embodiments, the poly-A region is 70 or greater nucleotides in length. In embodiments, the poly-A region is 80 or greater nucleotides in length. In embodiments, the poly-A region is 90 or greater nucleotides in length. In embodiments, the poly-A region is 100 or greater nucleotides in length. In embodiments, the poly-A region is 200 or greater nucleotides in length. In embodiments, the poly-A region is 300 or greater nucleotides in length. In embodiments, the poly-A region is 400 or greater nucleotides in length. In embodiments, the poly-A region is 500 or greater nucleotides in length.

[0127] In embodiments, the poly-A region is from 2 to 500 nucleotides in length. In embodiments, the poly-A region is from 5 to 500 nucleotides in length. In embodiments, the poly-A region is from 5 to 400 nucleotides in length. In embodiments, the poly-A region is from 5 to 300 nucleotides in length. In embodiments, the poly-A region is from 5 to 350 nucleotides in length. In embodiments, the poly-A region is from 10 to 300 nucleotides in length. In embodiments, the poly-A region is from 10 to 250 nucleotides in length. In embodiments, the poly-A region is from 10 to 200 nucleotides in length. In embodiments, the poly-A region is from 10 to 150 nucleotides in length. In embodiments, the poly-A region is from 15 to 150 nucleotides in length. In embodiments, the poly-A region is from 15 to 100 nucleotides in length. In embodiments, the poly-A region is from 15 to 90 nucleotides in length. In embodiments, the poly-A region is from 15 to 80 nucleotides in length. In embodiments, the poly-A region is from 15 to 70 nucleotides in length. In embodiments, the poly-A region is from 15 to 60 nucleotides in length. In embodiments, the poly-A region is from 15 to 50 nucleotides in length. In embodiments, the poly-A region is from 15 to 40 nucleotides in length.

[0128] In embodiments, a modified nucleoside comprises a modified nucleobase and / or a modified sugar. In embodiments, a modified nucleoside comprises a modified nucleobase and a modified sugar. In embodiments, a modified nucleoside comprises a modified nucleobase. In embodiments, a modified nucleoside comprises a modified sugar.

[0129] In embodiments, an RNA molecule comprises one modified nucleotideAttorney Docket No.: 095109-001300WO-1513793 triphosphate (NTP), which is covalently linked to the 3’ end of the poly-A region, of the RNA molecule.

[0130] In embodiments, a modified NTP is selected from a group consisting of 2- methylthio-N6-(cis-hydroxyisopentenyl)adenosine-5’-triphosphate, 2-methylthio-N6- methyladenosine-5’-triphosphate, 2-methylthio-N6-threonyl carbamoyladenosine-5’- triphosphate, N6-glycinylcarbamoyladenosine-5’-triphosphate, N6-isopentenyladenosine-5’- triphosphate, N6-methyladenosine-5’-triphosphate, N6-threonylcarbamoyladenosine-5’- triphosphate, 1,2'-0-dimethyladenosine-5’-triphosphate, 1-methyladenosine-5’-triphosphate, 2'-O-methyladenosine-5’-triphosphate, 2'-O-ribosyladenosine-5’-triphosphate, 2- methyladenosine-5’-triphosphate, 2-methylthio-N6 isopentenyladenosine-5’-triphosphate, 2- methylthio-N6-hydroxynorvalyl carbamoyladenosine-5’-triphosphate, 2'-O-methyladenosine- 5’-triphosphate, 2'-O-ribosyladenosine-5’-triphosphate, N6-(cis- hydroxyisopentenyl)adenosine-5’-triphosphate, N6,2'-O-dimethyladenosine-5’-triphosphate, N6,2'-O-dimethyladenosine-5’-triphosphate, N6,N6,2'-O-trimethyladenosine-5’-triphosphate, N6,N6 -dimethyladenosine-5’-triphosphate, N6-acetyladenosine-5’-triphosphate, N6- hydroxynorvalylcarbamoyladenosine-5’-triphosphate, N6-methyl-N6- threonylcarbamoyladenosine-5’-triphosphate, 2-methyladenosine-5’-triphosphate, 2- methylthio-N6-isopentenyladenosine-5’-triphosphate, 7-deaza-adenosine-5’-triphosphate, N1-methyl-adenosine-5’-triphosphate, 2-aminoadenosine-5’-triphosphate, 2- aminopropyladenosine-5’-triphosphate, 2-methylthio,N6-isopentenyladenosine-5’- triphosphate, 2-alkyladenosine-5’-triphosphate, 2-aminoalkyladenosine-5’-triphosphate, 2- aminopropyladenosine-5’-triphosphate, 2-haloadenosine-5’-triphosphate, 2-propyladenosine- 5’-triphosphate, 2’-Amino-2’-deoxy-adenosine-5’-triphosphate, 2’-Azido-2’-deoxy- adenosine -5’-triphosphate, 6-alkyladenosine-5’-triphosphate, 6-methyladenosine-5’- triphosphate, 8-aminoadenosine-5’-triphosphate, 8-thioalkyladenosine-5’-triphosphate, 8- haloadenosine-5’-triphosphate, 8-hydroxyadenosine-5’-triphosphate, 8-thioladenosine-5’- triphosphate, 7-deaza-8-aza-adenosine-5’-triphosphate, 7-methyladenosine-5’-triphosphate, 1-Deazaadenosine-5’-triphosphate, 2'-Fluoro-N6-Benzyl-deoxyadenosine-5’-triphosphate, 2'- OMe-2-Amino--5’-triphosphate, 2’-O-methyl-N6-Benzyl-deoxyadenosine-5’-triphosphate, 2- aminoadenosine-5’-triphosphate, 2-Azidoadenosine-5’-triphosphate, 2-Bromoadenosine-5’- triphosphate, 2-Chloroadenosine-5’-triphosphate, 2'-Deoxy-2',2'-difluoroadenosine-5’- triphosphate, 2-Fluoroadenosine-5’-triphosphate, 2-Iodoadenosine-5’-triphosphate, 2- Mercaptoadenosine-5’-triphosphate, 2-methylthio-adenosine-5’-triphosphate, 2- Trifluoromethyladenosine-5’-triphosphate, 3-Deaza-3-bromoadenosine-5’-triphosphate, 3-Attorney Docket No.: 095109-001300WO-1513793 Deaza-3-chloroadenosine-5’-triphosphate, 3-Deaza-3-fluoroadenosine-5’-triphosphate, 3- Deaza-3-iodoadenosine-5’-triphosphate, 3-Deazaadenosine-5’-triphosphate, 4'- Azidoadenosine-5’-triphosphate, 4'-Carbocyclic-adenosine-5’-triphosphate, 4'- Ethynyladenosine-5’-triphosphate, 8-Aza-adenosine-5’-triphosphate, 8-bromo-adenosine-5’- triphosphate, 8-Trifluoromethyladenosine-5’-triphosphate, 9-Deazaadenosine-5’- triphosphate, 2-aminopurine-5’-triphosphate, 7-deaza-2,6-diaminopurine-5’-triphosphate, 7- deaza-8-aza-2,6-diaminopurine-5’-triphosphate, 7-deaza-8-aza-2-aminopurine-5’- triphosphate, 2,6-diaminopurine-5’-triphosphate, 7-deaza-2-aminopurine-5’-triphosphate, 2- thiocytidine-5’-triphosphate, 3-methylcytidine-5’-triphosphate, 5-formylcytidine-5’- triphosphate, 5-hydroxymethylcytidine-5’-triphosphate, -5’-triphosphate, -5’-triphosphate, - 5’-triphosphate, -5’-triphosphate, 5 -methylcytidine-5’-triphosphate, N4-acetyl-cytidine-5’- triphosphate, 2'-O-methylcytidine-5’-triphosphate, 5,2'-O-dimethylcytidine-5’-triphosphate, 5-formyl-2'-O-methylcytidine-5’-triphosphate, N4,2'-O-dimethylcytidine-5’-triphosphate, N4-acetyl-2'-O-methylcytidine-5’-triphosphate, N4-methylcytidine-5’-triphosphate, N4,N4- Dimethyl-2'-OMe-Cytidine-5’-triphosphate, 4-methylcytidine-5’-triphosphate, 5-aza- cytidine-5’-triphosphate, Pseudo-iso-cytidine-5’-triphosphate, pyrrolo-cytidine-5’- triphosphate, 2’-Amino-2’-deoxy-cytidine-5’-triphosphate, 2'-Azido-2'-deoxy-cytidine-5’- triphosphate, 3-methylcytidine-5’-triphosphate, 4,2'-O-dimethylcytidine-5’-triphosphate, 5- methylcytidine-5’-triphosphate, 5-trifluoromethylcytidine-5’-triphosphate, 5-bromo-cytidine- 5’-triphosphate, 5-iodo-cytidine-5’-triphosphate, 5-propynylcytidine-5’-triphosphate, 6-aza- cytidine-5’-triphosphate, 1-methyl-1-deaza-pseudoisocytidine-5’-triphosphate, 1-methyl- pseudoisocytidine-5’-triphosphate, 2-methoxy-5-methyl-cytidine-5’-triphosphate, 2-methoxy- cytidine-5’-triphosphate, 2-thio-5-methyl-cytidine-5’-triphosphate, 4-methoxy-1-methyl- pseudoisocytidine-5’-triphosphate, 4-methoxy-pseudoisocytidine-5’-triphosphate, 4-thio- 1- methyl-1-deaza-pseudoisocytidine-5’-triphosphate, 4-thio-1-methyl-pseudoisocytidine-5’- triphosphate, 4-thio-pseudoisocytidine-5’-triphosphate, 5-aza-zebularine-5’-triphosphate, 5- methyl-zebularine-5’-triphosphate, pyrrolo-pseudoisocytidine-5’-triphosphate, 2'-Fluoro-N4- Benzyl-cytidine-5’-triphosphate, 2'-Fluoro-N4-acetyl-cytidine-5’-triphosphate, 2'-O-Methyl- N4-Acetyl-cytidine-5’-triphosphate, 2’-O-methyl-N4-Benzyl-cytidine-5’-triphosphate, 2'- Deoxy-2',2'-difluorocytidine-5’-triphosphate, 2'-O-Methyl-5-(1-propynyl)cytidine-5’- triphosphate, 3'-Ethynylcytidine-5’-triphosphate, 4'-Azidocytidine-5’-triphosphate, 4'- Carbocyclic cytidine-5’-triphosphate, 4'-Ethynylcytidine-5’-triphosphate, 5-(2-Chloro- phenyl)-2-thiocytidine-5’-triphosphate, 5-(4-Amino-phenyl)-2-thiocytidine-5’-triphosphate, 5-Aminoallyl-cytidine-5’-triphosphate, 5-Cyanocytidine-5’-triphosphate, 5-Ethynylara-Attorney Docket No.: 095109-001300WO-1513793 cytidine-5’-triphosphate, 5-Ethynylcytidine-5’-triphosphate, N4-Benzoyl-cytidine-5- Methoxy-cytidine-5’-triphosphate, 5-Trifluoromethyl-Cytidine-5’-triphosphate, N4-Amino- cytidine-5’-triphosphate, pseudoisocytidine-5’-triphosphate, 7-methylguanosine-5’- triphosphate, N2,2'-O-dimethylguanosine-5’-triphosphate, N2-methylguanosine-5’- triphosphate, 1,2'-O-dimethylguanosine-5’-triphosphate, 1-methylguanosine-5’-triphosphate, 2'-O-methylguanosine-5’-triphosphate, 2'-O-ribosylguanosine-5’-triphosphate, 2'-O- methylguanosine-5’-triphosphate, 2'-O-ribosylguanosine-5’-triphosphate, 7-aminomethyl-7- deazaguanosine-5’-triphosphate, 7-cyano-7-deazaguanosine-5’-triphosphate, N2,7- dimethylguanosine-5’-triphosphate, N2,N2,2'-O-trimethylguanosine-5’-triphosphate, N2,N2,7-trimethylguanosine-5’-triphosphate, N2,N2-dimethylguanosine-5’-triphosphate, N2,7,2'-O-trimethylguanosine-5’-triphosphate, 6-thio-guanosine-5’-triphosphate, 7-deaza- guanosine-5’-triphosphate, 8-oxo-guanosine-5’-triphosphate, N1-methyl-guanosine-5’- triphosphate, 2’-Amino-2’-deoxy-guanosine-5’-triphosphate, 2'-Azido-2'-deoxy-Guanosine- 5’-triphosphate, 6-methyl-guanosine-5’-triphosphate, 1-methyl-6-thio-guanosine-5’- triphosphate, 6-methoxy-guanosine-5’-triphosphate, 6-thio-7-deaza-8-aza-guanosine-5’- triphosphate, 6-thio-7-deaza-guanosine-5’-triphosphate, 6-thio-7-methyl-guanosine-5’- triphosphate, 7-deaza-8-aza-guanosine-5’-triphosphate, 7-methyl-8-oxo-guanosine-5’- triphosphate, -5’-triphosphate, N2,N2-dimethyl-6-thio-guanosine-5’-triphosphate, N2- methyl-6-thio-guanosine-5’-triphosphate, 2'-Fluoro-N2-isobutyl-guanosine-5’-triphosphate, 2'-O-methyl-N2-isobutyl-guanosine-5’-triphosphate, 2'-Deoxy-2',2'-diiluoroguanosine-5’- triphosphate, 4'-Azidoguanosine-5’-triphosphate, 4'-Carbocyclic guanosine-5’-triphosphate, 4'-Ethynylguanosine-5’-triphosphate, 8-bromo-guanosine-5’-triphosphate, 9- Deazaguanosine-5’-triphosphate, N2-isobutyl-guanosine-5’-triphosphate, 1 -methylinosine- 5’-triphosphate, inosine-5’-triphosphate, 1,2'-O-dimethylinosine-5’-triphosphate, 2’-O- methylinosine-5’-triphosphate, 7-methylinosine-5’-triphosphate, 2'-O-methylinosine-5’- triphosphate, 2’-O-methyluridine-5’-triphosphate, 2-thiouridine-5’-triphosphate, 3- methyluridine-5’-triphosphate, 5-carboxymethyluridine-5’-triphosphate, 5-hydroxyuridine- 5’-triphosphate, 5-methyluridine-5’-triphosphate, 5-taurinomethyl-2-thiouridine-5’- triphosphate, 5-taurinomethyluridine-5’-triphosphate, (3-(3-amino-3-carboxypropyl)uridine- 5’-triphosphate, 1-methyl- 3-(3-amino-5-carboxypropyl)pseudouridine-5’-triphosphate, 1- methylpseduouridine-5’-triphosphate, 2’-O-methyluridine-5’-triphosphate, 2'-O- methylpseudouridine-5’-triphosphate, 2-thio-2'-O-methyluridine-5’-triphosphate, 3-(3-amino- 3-carboxypropyl)uridine-5’-triphosphate, 3,2'-O-dimethyluridine-5’-triphosphate, 3-Methyl- pseudouridine-5’-triphosphate, 5-(carboxyhydroxymethyl)uridine-5’-triphosphate, 5,2'-O-Attorney Docket No.: 095109-001300WO-1513793 dimethyluridine-5’-triphosphate, 5,6-dihydro-uridine-5’-triphosphate, 5-aminomethyl-2- thiouridine-5’-triphosphate, 5-carbamoylmethyl-2'-O-methyluridine-5’-triphosphate, 5- carbamoylmethyluridine-5’-triphosphate, 5-carboxyhydroxymethyluridine-5’-triphosphate, 5- carboxymethylaminomethyl-2'-O-methyluridine-5’-triphosphate, 5- carboxymethylaminomethyl-2-thiouridine-5’-triphosphate, 5-carboxymethylaminomethyl-2- thiouridine-5’-triphosphate, 5-carboxymethylaminomethyluridine-5’-triphosphate, 5- Carbamoylmethyluridine-5’-triphosphate, 5-methoxycarbonylmethyl-2'-O-methyluridine-5’- triphosphate, 5-methoxycarbonylmethyl-2-thiouridine-5’-triphosphate, 5- methoxycarbonylmethyluridine-5’-triphosphate, 5-methoxyuridine-5’-triphosphate, 5-methyl- 2-thiouridine-5’-triphosphate, 5-methylaminomethyl-2-selenouridine-5’-triphosphate, 5- methylaminomethyl-2-thiouridine-5’-triphosphate, 5-methylaminomethyluridine-5’- triphosphate, 5 -Methyldihydrouridine-5’-triphosphate, 5-Oxyaceticacid-uridine-5’- triphosphate, N1-methyl-pseudo-uridine-5’-triphosphate, 3-(3-Amino-3-carboxypropyl)- uridine-5’-triphosphate, 5-(isopentenylaminomethyl)-2-thiouridine-5’-triphosphate, 5- (isopentenylaminomethyl)-2'-O-methyluridine-5’-triphosphate, 5- (isopentenylaminomethyl)uridine-5’-triphosphate, 1-Methyl-3-(3-amino-3- carboxypropyl)pseudouridine-5’-triphosphate, 1-Methyl-pseudouridine-5’-triphosphate, 2'- deoxyuridine-5’-triphosphate, 2'-fluorouridine-5’-triphosphate, 2’-Amino-2’-deoxyuridine- 5’-triphosphate, 2'-Azido-2'-deoxyuridine-5’-triphosphate, 2'-Azido-deoxyuridine-5’- triphosphate, 2’-O-methylpseudouridine-5’-triphosphate, 2'-deoxyuridine-5’-triphosphate, 2- methylpseudouridine-5’-triphosphate, 5-aminoallyl-uridine-5’-triphosphate, 5-bromo-uridine- 5’-triphosphate, 5-iodo-uridine-5’-triphosphate, 6-aza-uridine-5’-triphosphate, 4-Thio- pseudouridine-5’-triphosphate, 1-carboxymethyl-pseudouridine-5’-triphosphate, 1-methyl-1- deaza-pseudouridine-5’-triphosphate, 1-propynyl-uridine-5’-triphosphate, 1-taurinomethyl-1- methyl-uridine-5’-triphosphate, 1-taurinomethyl-4-thio-uridine-5’-triphosphate, 1- taurinomethyl-pseudouridine-5’-triphosphate, 2-methoxy-4-thio-pseudouridine-5’- triphosphate, 2-thio-1-methyl-1-deaza-pseudouridine-5’-triphosphate, 2-thio-1-methyl- pseudouridine-5’-triphosphate, 2-thio-5-aza-uridine-5’-triphosphate, 2-thio- dihydropseudouridine-5’-triphosphate, 2-thio-dihydrouridine-5’-triphosphate, 2-thio- pseudouridine-5’-triphosphate, 4-methoxy-2-thio-pseudouridine-5’-triphosphate, 4-methoxy- pseudouridine-5’-triphosphate, 4-thio-1-methyl-pseudouridine-5’-triphosphate, 4-thio- pseudouridine-5’-triphosphate, 1-(2,2-Diethoxyethyl)pseudouridine-5’-triphosphate, 5-aza- uridine-5’-triphosphate, 1-(2-Amino-ethyl)pseudouridine-5’-triphosphate, 1-(2- Methoxyethyl)pseudouridine-5’-triphosphate, 1-(3,4-Bis-Attorney Docket No.: 095109-001300WO-1513793 trifluoromethoxybenzyl)pseudouridine-5’-triphosphate, 1-(3,4- Dimethoxybenzyl)pseudouridine-5’-triphosphate, 1-(3-Amino-3- carboxypropyl)pseudouridine-5’-triphosphate, 1-(3-Amino-propyl)pseudouridine-5’- triphosphate, 1-(3-Cyclopropyl-prop-2-ynyl)pseudouridine-5’-triphosphate, 1-(4-Amino- benzyl)pseudouridine-5’-triphosphate, 1-(4-Amino-butyl)pseudouridine-5’-triphosphate, 1- (4-Amino-phenyl)pseudouridine-5’-triphosphate, 1-(4-Chlorobenzyl)pseudouridine-5’- triphosphate, 1-(4-Methanesulfonylbenzyl)pseudouridine-5’-triphosphate, 1-(4- Methoxybenzyl)pseudouridine-5’-triphosphate, 1-(4-Methoxy-phenyl)pseudouridine-5’- triphosphate, 1-(4-Nitro-benzyl)pseudouridine-5’-triphosphate, 1-(4-Nitro- phenyl)pseudouridine-5’-triphosphate, 1-(4-Thiomethoxybenzyl)pseudouridine-5’- triphosphate, 1-(4-Trifluoromethoxybenzyl)pseudouridine-5’-triphosphate, 1-(5-Amino- pentyl)pseudouridine-5’-triphosphate, 1-(6-Amino-hexyl)pseudouridine-5’-triphosphate, 1,6- Dimethyl-pseudo-5’-triphosphate, 1-Acetylpseudouridine-5’-triphosphate, 1-Alkyl-6-(1- propynyl)-pseudouridine-5’-triphosphate, 1-Alkyl-6-allyl-pseudouridine-5’-triphosphate, 1- Alkyl-6-ethynyl-pseudouridine-5’-triphosphate, 1-Alkyl-6-vinyl-pseudouridine-5’- triphosphate, 1-Allylpseudouridine-5’-triphosphate, 1-Aminomethyl-pseudouridine-5’- triphosphate, 1-Benzoylpseudouridine-5’-triphosphate, 1 -Benzyloxymethylpseudouridine-5’- triphosphate, 1-Benzyl-pseudouridine-5’-triphosphate, 1-Biotinylpseudouridine-5’- triphosphate, 1-Butyl-pseudouridine-5’-triphosphate, 1-Cyanomethylpseudouridine-5’- triphosphate, 1-Cyclobutylmethyl-pseudouridine-5’-triphosphate, 1-Cycloheptylmethyl- pseudouridine-5’-triphosphate, 1-Cyclohexylmethyl-pseudouridine-5’-triphosphate, 1- Cyclohexyl-pseudouridine-5’-triphosphate, 1-Cyclooctylmethyl-pseudouridine-5’- triphosphate, 1-Cyclopentylmethyl-pseudouridine-5’-triphosphate, 1-Cyclopentyl- pseudouridine-5’-triphosphate, 1-Cyclopropylmethyl-pseudouridine-5’-triphosphate, 1- Cyclopropyl-pseudouridine-5’-triphosphate, 1-Hydroxymethylpseudouridine-5’-triphosphate, 1-iso-propyl-pseudouridine-5’-triphosphate, 1 -Methyl-2-thio-pseudouridime-5’-triphosphate, 1-Methyl-4-thio-pseudouridine-5’-triphosphate, 1-Methanesulfonylmethylpseudouridine-5’- triphosphate, 1-Methoxymethylpseudouridine-5’-triphosphate, 1-Methyl- 6-(4-morpholino)- pseudouridine-5’-triphosphate, 1-Methyl-6-(4-thiomorpholino)-pseudouridine-5’- triphosphate, 1-Methyl-6-amino-pseudouridine-5’-triphosphate, 1-Methyl-6-azido- pseudouridine-5’-triphosphate, 1-Methyl-6-bromo-pseudouridine-5’-triphosphate, 1-Methyl- 6-butyl-pseudouridine-5’-triphosphate, 1-Methyl-6-chloro-pseudouridine-5’-triphosphate, 1- Methyl-6-cyano-pseudouridine-5’-triphosphate, 1-Methyl-6-ethoxy-pseudouridine-5’- triphosphate, 1-Methyl-6-ethyl-pseudouridine-5’-triphosphate, 1-Methyl-6-fluoro-Attorney Docket No.: 095109-001300WO-1513793 pseudouridine-5’-triphosphate, 1-Methyl-6-formyl-pseudouridine-5’-triphosphate, 1-Methyl- 6-hydroxy-pseudouridine-5’-triphosphate, 1-Methyl-6-iodo-pseudouridine-5’-triphosphate, 1- Methyl-6-methoxy-pseudouridine-5’-triphosphate, 1-Methyl-6-phenyl-pseudouridine-5’- triphosphate, 1-Pivaloylpseudouridine-5’-triphosphate, 1-Phenyl-pseudo-5’-triphosphate, 1- Propargylpseudouridine-5’-triphosphate, 1-propynyl-pseudouridine-5’-triphosphate, 1-p- tolyl-pseudouridine-5’-triphosphate, 1-Thiomethoxymethylpseudouridine-5’-triphosphate, 1- Trifluoroacetylpseudouridine-5’-triphosphate, 1-Trifluoromethyl-pseudouridine-5’- triphosphate, 1-Vinylpseudouridine-5’-triphosphate, 2,2'-anhydro-uridine-5’-triphosphate, 2'- bromo-deoxyuridine-5’-triphosphate, 2'-OMe-pseudouridine-5’-triphosphate, 2'-OMe-5- Methyluridine-5’-triphosphate, 2-methoxy-4-thio-uridine-5’-triphosphate, 2-methoxyuridine- 5’-triphosphate, 2'-O-Methyl-5-(1-propynyl)uridine-5’-triphosphate, 4’-azidouridine-5’- triphosphate, 4’-carbocyclicuridine-5’-triphosphate, 5-cyanouridine-5’-triphosphate, and 6- trifluoromethyl-psuedouridine-5’-triphosphate.

[0131] In embodiments, a modified NTP is selected from a group consisting of N6- methyladenosine-5'-triphosphate, N1-methyladenosine-5'-triphosphate, N2-methyladenosine- 5'-triphosphate, 2’-O-methyladenosine-5'-triphosphate, 2-methylthio-N6-methyladenosine-5'- triphosphate, N6-isopentenyladenosine-5'-triphosphate, N6-(cis-hydroxyisopentenyl)- adenosine-5'-triphosphate, 2-methylthio-N6-isopentenyladenosine-5'-triphosphate, 2- methylthio-N6-(cis-hydroxyisopentenyl)-adenosine-5'-triphosphate, N6- glycinylcarbamoyladenosine-5'-triphosphate, N6-threonylcarbamoyladenosine-5'- triphosphate, 2-methylthio-N6-threonylcarbamoyl-adenosine-5'-triphosphate, N6-methyl-N6- threonylcarbamoyladenosine-5'-triphosphate, N6-hydroxynorvalylcarbamoyladenosine-5'- triphosphate, 2-methylthio-N6-hydroxynorvalylcarbamoyladenosine-5'-triphosphate, 2’-O- ribosyladenosine-5'-triphosphate, inosine-5'-triphosphate, N1-inosine-5'-triphosphate, 1,2’-O- dimethylinosine-5'-triphosphate, N6,N6-dimethyladenosine-5'-triphosphate, 2’-O- methylinosine-5'-triphosphate, N6,2’-O-dimethyladenosine-5'-triphosphate, N6,N6,2’-O- trimethyladenosine-5'-triphosphate, N1,2’-O-dimethyladenosine-5'-triphosphate, N6- acetyladenosine-5'-triphosphate, 8-methyladenosine-5'-triphosphate, N6-formyladenosine-5'- triphosphate, cyclic N6-threonylcarbamoyladenosine-5'-triphosphate, N6- hydroxymethyladenosine-5'-triphosphate, 2,8-dimethyladenosine-5'-triphosphate, cyclic 2- methylthio-N6-threonylcarbamoyladenosine-5'-triphosphate, N6- hydroxythreonylcarbamoyladenosine-5'-triphosphate, 2-methylthiomethylenethio-N6- isopentenyladenosine-5'-triphosphate, 3-methylcytidine-5'-triphosphate, 5-methylcytidine -5'- triphosphate, 2’-O-methylcytidine-5'-triphosphate, 2-thiocytidine-5'-triphosphate, N4-Attorney Docket No.: 095109-001300WO-1513793 acetylcytidine-5'-triphosphate, 5-Formylcytidine-5'-triphosphate, 5,2’-O-dimethylcytidine-5'- triphosphate, lysidine-5'-triphosphate, N4-methylcytidine-5'-triphosphate, 4,2’-O- dimethylcytidine-5'-triphosphate, 5-hydroxymethylcytidine-5'-triphosphate, 5-Formyl-2’-O- methylcytidine-5'-triphosphate, N4,N4,2’-O-trimethylcytidine-5'-triphosphate, agmatidine-5'- triphosphate, 5-hydroxycytidine-5'-triphosphate, N4-acetyl-2’-O-methylcytidine-5'- triphosphate, N4,N4-dimethylcytidine-5'-triphosphate, 2-methylthiocytidine-5'-triphosphate, 2’-O-methyl-5-hydroxymethylcytidine-5'-triphosphate, 1-methylguanosine-5'-triphosphate, N2-methylguanosine-5'-triphosphate, 7-methylguanosine-5'-triphosphate, 2’-O- methylguanosine-5'-triphosphate, N2,N2-dimethylguanosine-5'-triphosphate, N2-2’-O- dimethylguanosine-5'-triphosphate, N2,N2,2’-O-trimethylguanosine-5'-triphosphate, 2’-O- ribosylguanosine-5'-triphosphate, wybutosine-5'-triphosphate, peroxywybutosine-5'- triphosphate, hydroxywybutosine-5'-triphosphate, wyosine-5'-triphosphate, methylwyosine- 5'-triphosphate, queuosine-5'-triphosphate, epoxyqueuosine-5'-triphosphate, galactosyl- queuosine-5'-triphosphate, mannosyl-queuosine-5'-triphosphate, glutamyl-queuosine-5'- triphosphate, pre-queuosine0-5'-triphosphate, pre-queuosine-1-5'-triphosphate, archaeosine- 5'-triphosphate, N2,7-dimethylguanosine-5'-triphosphate, N2,2-7-trimethylguanosine-5'- triphosphate, 1,2’-O-dimethylguanosine-5'-triphosphate, 4-demethylwyosine-5'-triphosphate, isowyosine-5'-triphosphate, N2,2’-O-7-trimethylguanosine-5'-triphosphate, 7- aminocarboxypropylwyosine methyl ester-5'-triphosphate, 7-aminocarboxypropyl- demethylwyosine-5'-triphosphate, 7-aminocarboxypropylwyosine-5'-triphosphate, 2- hydroxymethylguanosine-5'-triphosphate, pseudouridine-5'-triphosphate, dihydrouridine-5'- triphosphate, 5-methyluridine-5'-triphosphate, 2’-O-methyluridine-5'-triphosphate, 5,2’-O- dimethyluridine-5'-triphosphate, 1-methylpseudouridine-5'-triphosphate, 2’-O- methylpseudouridine-5'-triphosphate, 2-thiouridine-5'-triphosphate, 4-thiouridine-5'- triphosphate, 2-thio-2’-O-methyluridine-5'-triphosphate, 3-(3-amino-3- carboxypropyl)uridine-5'-triphosphate, 5-hydroxyuridine-5'-triphosphate, 5-methoxyuridine- 5'-triphosphate, uridine 5-oxyacetic acid-5'-triphosphate, uridine 5-oxyacetic acid methyl ester-5'-triphosphate, 5-carboxyhydroxymethyluridine-5'-triphosphate, 5- carboxyhydroxymethyluridine methyl ester-5'-triphosphate, 5- methoxycarbonylmethyluridine-5'-triphosphate, 5-methoxycarbonylmethyl-2’-O- methyluridine-5'-triphosphate, 5-aminomethyl-2-thiouridine-5'-triphosphate, 5- methylaminomethyluridine-5'-triphosphate, 5-methylaminomethyl-2-thiouridine-5'- triphosphate, 5-methylaminomethyl-2-selenouridine-5'-triphosphate, 5- carbamoylmethyluridine-5'-triphosphate, 5-carbamoylmethyl-2’-O-methyluridine-5'-Attorney Docket No.: 095109-001300WO-1513793 triphosphate, 5-carboxymethylaminomethyluridine-5'-triphosphate, 5- carboxymethylaminomethyl-2’-O-methyluridine-5'-triphosphate, 5- carboxymethylaminomethyl-2-thiouridine-5'-triphosphate, 3-methyluridine-5'-triphosphate, 1-methyl-3(3-amino-3-carboxypropyl)pseudouridine-5'-triphosphate, 5- carboxymethyluridine-5'-triphosphate, 3,2’-O-dimethyluridine-5'-triphosphate, 5- methyldihydrouridine-5'-triphosphate, 3-methylpseudouridine-5'-triphosphate, 5- taurinomethyluridine-5'-triphosphate, 5-taurinomethyl-2-thiouridine-5'-triphosphate, 5- (isopentenylaminomethyl)uridine-5'-triphosphate, 5-(isopentenylaminomethyl)-2-thiouridine- 5'-triphosphate, 5-(isopentenylaminomethyl)-2’-O-methyluridine-5'-triphosphate, 5- cyanomethyluridine-5'-triphosphate, 5-(carboxyhydroxymethyl)-2’-O-methyluridinemethyl ester-5'-triphosphate, 5-carboxymethylaminomethyl-2-selenouridine-5'-triphosphate, 5- carboxymethylaminomethyl-2-geranylthiouridine-5'-triphosphate, 5-methylaminomethyl-2- geranylthiouridine-5'-triphosphate, 5-aminomethyl-2-geranylthiouridine-5'-triphosphate, 5- methoxycarbonylmethyl-2-thiouridine-5'-triphosphate, 5-carbamoylmethyl-2-thiouridine-5'- triphosphate, 3(3-amino-3-carboxypropyl)-5,6-dihydrouridine-5'-triphosphate, 5- aminomethyl-2-selenouridine-5'-triphosphate, 5-carbamoylhydroxymethyluridine-5'- triphosphate, 5-carboxymethyl-2-thiouridine-5'-triphosphate, 5-methyl-2-thiouridine-5'- triphosphate, 2-geranylthiouridine-5'-triphosphate, 2-selenouridine-5'-triphosphate, 5- aminomethyluridine-5'-triphosphate, 2’-O-methyluridine 5-oxyacetic acid methyl ester-5'- triphosphate, 3-(3-amino-3-carboxypropyl)pseudouridine-5'-triphosphate, and 5- cyanomethyl-2-thiouridine-5'-triphosphate.

[0132] In embodiments, a modified NTP is selected from a group consisting of 2- amino-6-chloropurineriboside-5'-triphosphate, 6-chloropurineriboside-5'-triphosphate, 5- iodocytidine-5'-triphosphate, 5-iodouridine-5'-triphosphate, 2'-O-methyladenosine-5'- triphosphate, 2'-O-methylguanosine-5'-triphosphate, puromycin-5'-triphosphate, 4- thiouridine-5'-triphosphate, 2'-amino-2'-deoxycytidine-5'-triphosphate, 2'-amino-2'- deoxyuridine-5’-triphosphate, 2'-azido-2'-deoxyuridine-5'-triphosphate, 2-thiouridine-5'- triphosphate, arabinoseuridine-5'-triphosphate, 2-thiocytidine-5'-triphosphate, 6-azacytidine- 5'-triphosphate, 6-azauridine-5'-triphosphate, 2'-O-methyl-2-aminoadenosine-5'-triphosphate, 2'-O-methylpseudouridine-5'-triphosphate, 2'-O-methyl-5-methyluridine-5'-triphosphate, 2'- azido-2'-deoxyadenosine-5'-triphosphate, 8-azidoadenosine-5'-triphosphate, 5-bromocytidine- 5'-triphosphate, 5-bromouridine-5'-triphosphate, 3'-O-methyladenosine-5'-triphosphate, 3'-O- methylcytidine-5'-triphosphate, 3'-O-methylguanosine-5'-triphosphate, 3'-O-methyluridine-5'- triphosphate, 7-deazaadenosine-5'-triphosphate, 5-aminoallyluridine-5'-triphosphate, 2'-azido-Attorney Docket No.: 095109-001300WO-1513793 2'-deoxyguanosine-5'-triphosphate, 5-aminoallylcytidine-5'-triphosphate, 2-aminopurine- riboside-5'-triphosphate, pseudoisocytidine-5'-triphosphate, N4-methylcytidine-5'- triphosphate, 5,6-dihydro-5-methyl-uridine-5'-triphosphate, 5-carboxycytidine-5'- triphosphate, 5-formylcytidine-5'-triphosphate, 5-hydroxymethylcytidine-5'-triphosphate, 5- hydroxycytidine-5'-triphosphate, 5-formyluridine-5'-triphosphate, 5-carboxyuridine 5'- triphosphate, 5-hydroxyuridine-5'-triphosphate, 5-methoxycytidine-5’-triphosphate, thienouridine-5'-triphosphate, 5-carboxymethylesteruridine-5'-triphosphate, thienocytidine-5'- triphosphate, 8-oxoadenosine-5'-triphosphate, isoguanosine-5'-triphosphate, 2'-O- methyluridine-5'-triphosphate, 2'-O-methylcytidine-5'-triphosphate, 2'-O-methyl-N6- methyladenosine-5'-triphosphate, guanosine-5'-O-(1-thiotriphosphate), uridine-5'-O-(1- thiotriphosphate), N1-propylpseudouridine-5'-triphosphate, N1-methylpseudouridine-5'- triphosphate, N1-ethylpseudouridine-5'-triphosphate, N1-methyl-2’-O-methylpseudouridine- 5'-triphosphate, 5-methylcytidine-5'-triphosphate, N6-methyladenosine-5'-triphosphate, 2'- fluoro-2'-deoxyuridine-5'-triphosphate, 2'-fluoro-2'-deoxycytidine-5'-triphosphate, 5- methoxyuridine-5'-triphosphate, 5,6-dihydrouridine-5'-triphosphate, 5-methyluridine-5'- triphosphate, 8-oxoguanosine-5'-triphosphate, arabinoseguanosine-5'-triphosphate, 2’,3’- dideoxyadenosine-5'-triphosphate, adenosine-5'-O-(1-thiotriphosphate), 7-deaza-7- aminoethynyl-2’-deoxyadenosine-5'-triphosphate, 2’-deoxyadenosine-5'-triphosphate, 2’- Fluoro-2’-deoxyadenosine-5'-triphosphate, 2’-dexoyadenosine-5'-O-(1-thiotriphosphate), 2- aminoadenosine-5'-triphosphate, 2’,3’-dideoxyguanosine-5'-triphosphate, thienoguanosine-5'- triphosphate, 7-deaza-7-aminoethynyl-2’-deoxyguanosine-5'-triphosphate, 5-aminoethynyl- 2’-deoxycytidine-5'-triphosphate, 5-aminoethynyl-2’, 3’-dideoxycytidine-5'-triphosphate, 5- aminoethynyl-2’-deoxyuridine-5'-triphosphate, N1-methoxymethylpseudouridine-5'- triphosphate, and N1-methyladenosine-5'-triphosphate.

[0133] In embodiments, a modified NTP is 2-amino-6-chloropurineriboside-5'- triphosphate. In embodiments, a modified NTP is 6-chloropurineriboside-5'-triphosphate. In embodiments, a modified NTP is 5-iodocytidine-5'-triphosphate. In embodiments, a modified NTP is 5-iodouridine-5'-triphosphate. In embodiments, a modified NTP is 2'-O- methyladenosine-5'-triphosphate. In embodiments, a modified NTP is 2'-O-methylguanosine- 5'-triphosphate. In embodiments, a modified NTP is puromycin-5'-triphosphate. In embodiments, a modified NTP is 4-thiouridine-5'-triphosphate. In embodiments, a modified NTP is 2'-amino-2'-deoxycytidine-5'-triphosphate. In embodiments, a modified NTP is 2'- amino-2'-deoxyuridine-5-triphosphate. In embodiments, a modified NTP is 2'-azido-2'- deoxyuridine-5'-triphosphate. In embodiments, a modified NTP is 2-thiouridine-5'-Attorney Docket No.: 095109-001300WO-1513793 triphosphate. In embodiments, a modified NTP is arabinoseuridine-5'-triphosphate. In embodiments, a modified NTP is 2-thiocytidine-5'-triphosphate. In embodiments, a modified NTP is 6-azacytidine-5'-triphosphate. In embodiments, a modified NTP is 6-azauridine-5'- triphosphate. In embodiments, a modified NTP is 2'-O-methyl-2-aminoadenosine-5'- triphosphate. In embodiments, a modified NTP is 2'-O-methylpseudouridine-5'-triphosphate. In embodiments, a modified NTP is 2'-O-methyl-5-methyluridine-5'-triphosphate. In embodiments, a modified NTP is 2'-azido-2'-deoxyadenosine-5'-triphosphate. In embodiments, a modified NTP is 8-azidoadenosine-5'-triphosphate. In embodiments, a modified NTP is 5-bromocytidine-5'-triphosphate. In embodiments, a modified NTP is 5- bromouridine-5'-triphosphate. In embodiments, a modified NTP is 3'-O-methyladenosine-5'- triphosphate. In embodiments, a modified NTP is 3'-O-methylcytidine-5'-triphosphate. In embodiments, a modified NTP is 3'-O-methylguanosine-5'-triphosphate. In embodiments, a modified NTP is 3'-O-methyluridine-5'-triphosphate. In embodiments, a modified NTP is 7- deazaadenosine-5'-triphosphate. In embodiments, a modified NTP is 5-aminoallyluridine-5'- triphosphate. In embodiments, a modified NTP is 2'-azido-2'-deoxyguanosine-5'-triphosphate. In embodiments, a modified NTP is 5-aminoallylcytidine-5'-triphosphate. In embodiments, a modified NTP is 2-aminopurine-riboside-5'-triphosphate. In embodiments, a modified NTP is pseudoisocytidine-5'-triphosphate. In embodiments, a modified NTP is N4-methylcytidine-5'- triphosphate. In embodiments, a modified NTP is 5,6-dihydro-5-methyl-uridine-5'- triphosphate. In embodiments, a modified NTP is 5-carboxycytidine-5'-triphosphate. In embodiments, a modified NTP is 5-formylcytidine-5'-triphosphate. In embodiments, a modified NTP is 5-hydroxymethylcytidine-5'-triphosphate. In embodiments, a modified NTP is 2-aminothieno[3,4-d]pyrimidine-5'-triphosphate. In embodiments, a modified NTP is 5- hydroxycytidine-5'-triphosphate. In embodiments, a modified NTP is 5-formyluridine-5'- triphosphate. In embodiments, a modified NTP is 5-carboxyuridine 5'-triphosphate. In embodiments, a modified NTP is 5-hydroxyuridine-5'-triphosphate. In embodiments, a modified NTP is 5-methoxycytidine-5’-triphosphate. In embodiments, a modified NTP is thienouridine-5'-triphosphate. In embodiments, a modified NTP is 5- carboxymethylesteruridine-5'-triphosphate. In embodiments, a modified NTP is thienocytidine-5'-triphosphate. In embodiments, a modified NTP is 8-Oxoadenosine-5'- triphosphate. In embodiments, a modified NTP is isoguanosine-5'-triphosphate. In embodiments, a modified NTP is 2'-O-methyluridine-5'-triphosphate. In embodiments, a modified NTP is 2'-O-methylcytidine-5'-triphosphate. In embodiments, a modified NTP is 2'- O-methyl-N6-methyladenosine-5'-triphosphate. In embodiments, a modified NTP isAttorney Docket No.: 095109-001300WO-1513793 guanosine-5'-O-(1-thiotriphosphate). In embodiments, a modified NTP is uridine-5'-O-(1- thiotriphosphate). In embodiments, a modified NTP is N1-propylpseudouridine-5'- triphosphate. In embodiments, a modified NTP is N1-methylpseudouridine-5'-triphosphate. In embodiments, a modified NTP is N1-ethylpseudouridine-5'-triphosphate. In embodiments, a modified NTP is N1-methyl-2’-O-methylpseudouridine-5'-triphosphate. In embodiments, a modified NTP is 5-methylcytidine-5'-triphosphate. In embodiments, a modified NTP is N6- methyladenosine-5'-triphosphate. In embodiments, a modified NTP is 2'-fluoro-2'- deoxyuridine-5'-triphosphate. In embodiments, a modified NTP is 2'-fluoro-2'-deoxycytidine- 5'-triphosphate. In embodiments, a modified NTP is 5-methoxyuridine-5'-triphosphate. In embodiments, a modified NTP is 5,6-dihydrouridine-5'-triphosphate. In embodiments, a modified NTP is 5-methyluridine-5'-triphosphate. In embodiments, a modified NTP is 8- oxoguanosine-5'-triphosphate. In embodiments, a modified NTP is arabinoseguanosine-5'- triphosphate. In embodiments, a modified NTP is 2’,3’-dideoxyadenosine-5'-triphosphate. In embodiments, a modified NTP is adenosine-5'-O-(1-thiotriphosphate). In embodiments, a modified NTP is 7-deaza-7-aminoethynyl-2’-deoxyadenosine-5'-triphosphate. In embodiments, a modified NTP is 2’-deoxyadenosine-5'-triphosphate. In embodiments, a modified NTP is 2’-Fluoro-2’-deoxyadenosine-5'-triphosphate. In embodiments, a modified NTP is 2’dexoyadenosine-5'-O-(1-thiotriphosphate). In embodiments, a modified NTP is 2- aminoadenosine-5'-triphosphate. In embodiments, a modified NTP is 2’,3’- dideoxyguanosine-5'-triphosphate. In embodiments, a modified NTP is thienoguanosine-5'- triphosphate. In embodiments, a modified NTP is 7-deaza-7-aminoethynyl-2’- deoxyguanosine-5'-triphosphate. In embodiments, a modified NTP is 5-aminoethynyl-2’- deoxycytidine-5'-triphosphate. In embodiments, a modified NTP is 5-aminoethynyl-2’, 3’- dideoxycytidine-5'-triphosphate. In embodiments, a modified NTP is 5-aminoethynyl-2’- deoxyuridine-5'-triphosphate. In embodiments, a modified NTP is N1- methoxymethylpseudouridine-5'-triphosphate. In embodiments, a modified NTP is N1- methyladenosine-5'-triphosphate.

[0134] In embodiments, a modified NTP is selected from a group consisting of 2’- fluoro-2’-deoxyadenosine-5'-triphosphate, 2'-O-methyladenosine-5'-triphosphate, 2'-O- methyl-2-aminoadenosine-5'-triphosphate, 2'-O-methyl-N6-methyladenosine-5'-triphosphate, 8-oxoadenosine-5'-triphosphate, 2-aminoadenosine-5'-triphosphate, 2’-deoxyadenosine-5'- triphosphate, N1-methyladenosine-5'-triphosphate, 2’-fluoro-2’-deoxycytidine-5'- triphosphate, 2'-amino-2'-deoxycytidine-5'-triphosphate, 2'-O-methylcytidine-5'-triphosphate, 5-iodocytidine-5'-triphosphate, 5-methylcytidine-5'-triphosphate, 6-azacytidine-5'-Attorney Docket No.: 095109-001300WO-1513793 triphosphate, pseudoisocytidine-5'-triphosphate, thienocytidine-5'-triphosphate, N1- methylpseudouridine-5'-triphosphate, N1-methyl-2’-O-methylpseudouridine-5'-triphosphate, 2'-azido-2'-deoxyguanosine-5'-triphosphate, 2'-amino-2'-deoxyuridine-5-triphosphate, 2'-O- methylguanosine-5'-triphosphate, 2'-O-methylpseudouridine-5'-triphosphate, 2'-O- methyluridine-5'-triphosphate, 2-thiocytidine-5'-triphosphate, 3'-O-methylguanosine-5'- triphosphate, 5,6-dihydrouridine-5'-triphosphate, 5,6-dihydro-5-methyl-uridine-5'- triphosphate, 5-bromocytidine-5'-triphosphate, 5-bromouridine-5'-triphosphate, 5- carboxymethylesteruridine-5'-triphosphate, 6-azauridine-5'-triphosphate, 8-oxoguanosine-5'- triphosphate, arabinoseuridine-5'-triphosphate, guanosine-5'-O-(1-thiotriphosphate), isoguanosine-5'-triphosphate, N1-methoxymethylpseudouridine-5'-triphosphate, and thienouridine-5'-triphosphate.

[0135] In embodiments, a modified NTP is selected from a group consisting of 2’- deoxyadenosine-5'-triphosphate, 2'-O-methylguanosine-5'-triphosphate, 8-oxoguanosine-5'- triphosphate, 6-azacytidine-5'-triphosphate, 2'-O-methyl-2-aminoadenosine-5'-triphosphate, 2'-O-methylguanosine-5'-triphosphate, arabinoseuridine-5'-triphosphate, 2'-O-methylcytidine- 5'-triphosphate, 8-oxoadenosine-5'-triphosphate, 2'-amino-2’-deoxycytidine-5'-triphosphate, arabinoseguanosine-5'-triphosphate, and 6-azauridine-5'-triphosphate.

[0136] In embodiments, a modified NTP is selected from a group consisting of N1- methyl-2’-O-methylpseudouridine-5'-triphosphate, 2'-fluoro-2'-deoxycytidine-5'-triphosphate, 5-methylcytidine-5'-triphosphate, pseudoisocytidine-5'-triphosphate, 3'-O-methylguanosine- 5'-triphosphate, 5,6-dihydro-5-methyl-uridine-5'-triphosphate, 2'-O-methyluridine-5'- triphosphate, isoguanosine-5'-triphosphate, thienouridine-5'-triphosphate, 2'-azido-2'- deoxyguanosine-5'-triphosphate, 5-carboxymethylesteruridine-5'-triphosphate, N1- methyladenosine-5'-triphosphate, thienocytidine-5'-triphosphate, 2'-O-methylpseudouridine- 5'-triphosphate, and N1-methoxymethylpseudouridine-5'-triphosphate.

[0137] In embodiments, a modified NTP is selected from a group consisting of 8- oxoguanosine-5'-triphosphate, 3’-O-methylguanosine-5'-triphosphate, N1- methylpseudouridine-5'-triphosphate, N1-methyl-2’-O-methylpseudouridine-5'-triphosphate, 2’-O-methylguanosine-5'-triphosphate, 2’-amino-2’-deoxycytidine-5'-triphosphate, 6- azacytidine-5'-triphosphate, 6-azauridine-5'-triphosphate, 8-oxoadenosine-5'-triphosphate, 2’- O-methylcytidine-5'-triphosphate, and 2’-O-methyl-2-aminoadenosine-5'-triphosphate.

[0138] In embodiments, the modified NTP is covalently linked to the 3’ end of the poly-A region using a polymerase. In embodiments, the polymerase is poly A polymerase, poly U polymerase, or RNA nucleotidyl transferase. In embodiments, the polymerase is polyAttorney Docket No.: 095109-001300WO-1513793 A polymerase. In embodiments, the polymerase is poly U polymerase. In embodiments, the polymerase is poly RNA nucleotidyl transferase. In embodiments, a polymerase catalyzes the reaction between a polyphosphate group (such as for example, diphosphate, triphosphate, or tetraphosphate) of the modified NTP and a nucleophile (for example, hydroxyl, amine, or thiol) at the 3’-end of a poly-A tail of the RNA molecules described herein.

[0139] In embodiments, the modified NTP increases the nuclease resistance of the RNA molecules described herein. In embodiments, the modified NTP increases the nuclease resistance of the RNA molecules described herein as compared to an RNA molecule without the modified NTP covalently linked to the 3’ end of the poly-A region. In embodiments, the modified NTP increases the stability of the RNA molecules described herein. In embodiments, the modified NTP increases the stability of the RNA molecules described herein as compared to an RNA molecule without the modified NTP covalently linked to the 3’ end of the poly-A region. In embodiments, the modified NTP increases the half-life of the RNA molecules described herein. In embodiments, the modified NTP increases the half-life of the RNA molecules described herein as compared to an RNA molecule without the modified NTP covalently linked to the 3’ end of the poly-A region.

[0140] In embodiments, the modified NTP comprises a chain terminating nucleoside. In embodiments, the chain terminating nucleoside is blocked and is not able to react with any further NTPs. In embodiments, the chain terminating nucleoside is ddC, inverted dT, 3’- phosphate nucleoside, 3’-oxime nucleoside, 3’-azidomethyl nucleoside, or 3’-methyl nucleoside. In embodiments, the chain terminating nucleoside is ddC. In embodiments, the chain terminating nucleoside is inverted dT. In embodiments, the chain terminating nucleoside is 3’-phosphate nucleoside. In embodiments, the chain terminating nucleoside is 3’-oxime nucleoside. In embodiments, the chain terminating nucleoside is 3’-methyl nucleoside.

[0141] In embodiments, contemplated herein are RNA molecules comprising a modified NTP as described herein and a 5’-cap analog as described herein and in references incorporated herein. In embodiments, contemplated herein are RNA molecules comprising a 5’-cap analog as described herein and in references incorporated herein, a modified 5’-UTR as described herein, an ORF as described herein, a modified 3’-UTR as described herein, a poly-A tail as described herein and one modified NTP as described herein.Attorney Docket No.: 095109-001300WO-1513793 RNA Synthesis

[0142] In an aspect, provided herein is a method of preparing any one of the RNA molecules described herein, comprising providing an RNA molecule comprising: a) a 5’-cap structure; b) a 5’ untranslated region (5’ UTR); c) an open reading frame (ORF) encoding a polypeptide of interest; d) a 3’ untranslated region (3’ UTR); and e) a poly-A region having a 3’ end, and covalently linking one modified NTP to the 3’ end of the poly-A region of the RNA molecule.

[0143] In embodiments, the modified NTP is linked to the 3’ end of the poly-A region of an RNA molecule using a polymerase. In embodiments, the polymerase is poly A polymerase, poly U polymerase, or RNA nucleotidyl transferase. In embodiments, the polymerase is poly A polymerase. In embodiments, the polymerase is poly U polymerase. In embodiments, the polymerase is poly RNA nucleotidyl transferase. In embodiments, a polymerase catalyzes the reaction between a polyphosphate group (such as for example, diphosphate, triphosphate, or tetraphosphate) of the modified NTP and a nucleophile (for example, hydroxyl, amine, or thiol) at the 3’-end of a poly-A tail of the RNA molecules described herein.

[0144] In embodiments, provided herein are in vitro methods for synthesizing capped RNA transcripts, including capped messenger RNA (mRNA) transcripts. The methods described herein comprise (a) forming a reaction mixture comprising a cap analogue, a DNA template, and an RNA polymerase; and (b) incubating the reaction mixture under conditions that allow transcription of the DNA template to produce capped mRNA transcripts. In the methods described herein, the reaction mixture comprises NTPs, including ATP, CTP, GTP and UTP. One or more of the NTPs in the in vitro transcription reaction mixture can be modified NTPs. Exemplary nucleotides include, but are not limited to, 5-methoxyuridine-5'- triphosphate, inosine-5'-triphosphate, 7-deazaguanosine-5'-triphosphate, 7-methylguanosine- 5'-triphosphate, 5,6-dihydrouridine-5'-triphosphate, 2'-O-methylguanosine-5'-triphosphate, 2'- fluoro-2'-deoxycytidine-5'-triphosphate, pseudouridine, N1-methylpseudouridine-5'- triphosphate, 5-methylcytidine -5'-triphosphate, and 5-methyluridine -5'-triphosphate. In some methods, one or more uridines in the in vitro transcribed RNA are replaced by a modified nucleoside. The method further comprises (c) incubating the reaction mixture with modified NTP and a polymerase. The polymerase may by a poly U polymerase, poly A polymerase or RNA nucleotidyl transferase. Optionally, some methods further comprise incubating the reaction mixture comprising the capped mRNA transcripts with a DNase IAttorney Docket No.: 095109-001300WO-1513793 buffer including Ca2+and DNase I to degrade and remove the DNA template.

[0145] Optionally, some methods further comprise subjecting the DNase treated reaction mixture to eliminate proteins from the in vitro transcription reaction. Optionally, some methods further comprise subjecting the DNase treated reaction mixture to phosphatase treatment. Optionally, the method further comprises subjecting the DNase treated reaction mixture to one or more purification steps. The mRNA transcripts produced by the methods described herein can be purified using one or more purification techniques known to those of skill in the art. See, Baronti et al., (2018) Anal. Bioanal. Chem.410(14): 3239-33252.

[0146] For example, the mRNAs can be purified by liquid chromatography (e.g., HPLC, reversed-phase ion pairing HPLC (RP-IP-HPLC), anion-exchange chromatography, cation exchange chromatography, affinity chromatography, size-exclusion chromatography), precipitation, diafiltration, tangential flow filtration, oligo dT chromatography, silica membrane purification, and hydrophobic interaction chromatography, to name a few. The synthesized capped mRNA transcripts can be substantially free of impurities such as DNA, protein, double-stranded RNA and / or incomplete mRNA transcripts. Therapeutic Use

[0147] In an aspect, provided herein is a cell comprising any one of the RNA molecules described herein. In embodiments, the cell is an isolated cell. In embodiments, the cell is a mammalian cell. In embodiments, the cell is a human cell.

[0148] In an aspect, provided herein is a cell comprising a protein or a peptide translated from any one of the RNA molecules described herein. In an aspect, provided herein is a cell comprising a protein translated from any one of the RNA molecules described herein. In an aspect, provided herein is a cell comprising a peptide translated from any one of the RNA molecules described herein. In embodiments, the cell is an isolated cell. In embodiments, the cell is a mammalian cell. In embodiments, the cell is a human cell.

[0149] In embodiments, the RNA molecules described herein include pharmaceutically acceptable salts of the RNA molecules described herein. As used herein, “pharmaceutically acceptable salts” refers to derivatives of the disclosed RNA molecules wherein the parent RNA molecule is altered by converting an existing acid or base moiety to its salt form (e.g., by reacting the free base group with a suitable organic acid or inorganic acid). Representative salts include, but are not limited to, the hydrobromide, hydrochloride, sulfate, bisulfate, nitrate, acetate, oxalate, valerate, oleate, palmitate, stearate, laurate, borate,Attorney Docket No.: 095109-001300WO-1513793 benzoate, lactate, phosphate, tosylate, citrate, maleate, fumarate, succinate, tartrate, naphthylate mesylate, glucoheptonate, lactobionate, methane sulphonate, and laurylsulphonate salts, and the like. Salts may include, for example, cations based on the alkali and alkaline earth metals, such as sodium, lithium, potassium, calcium, magnesium, and the like, as well as non-toxic ammonium, quaternary ammonium, and amine cations including, but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like. (See S.M. Barge et al., J. Pharm. Sci. (1977) 66, 1; and Remington: The Science and Practice of Pharmacy, 23d Edition, Adejare et al. eds., Academic Press (2020); which are incorporated herein by reference in their entireties.)

[0150] In an aspect, provided herein is a pharmaceutical composition comprising any one of the RNA molecules described herein, and a pharmaceutically acceptable carrier. In embodiments, the pharmaceutically acceptable carrier includes, but is not limited to, a solvent, dispersion media, diluent, surface active agent, isotonic agent, thickening or emulsifying agent, lipid, liposome, nanoparticle, lipid nanoparticle (LNP), polymer, lipoplex, protein, or any mixture thereof. In embodiments, the pharmaceutical composition comprises a cell which comprises an RNA molecule described herein.

[0151] In embodiments, the pharmaceutically acceptable carrier is a solvent. In embodiments, the pharmaceutically acceptable carrier is a dispersion media. In embodiments, the pharmaceutically acceptable carrier is a diluent. In embodiments, the pharmaceutically acceptable carrier is a surface-active agent. In embodiments, the pharmaceutically acceptable carrier is an isotonic agent. In embodiments, the pharmaceutically acceptable carrier is a thickening agent. In embodiments, the pharmaceutically acceptable carrier is an emulsifying agent. In embodiments, the pharmaceutically acceptable carrier is a lipid. In embodiments, the pharmaceutically acceptable carrier is a liposome. In embodiments, the pharmaceutically acceptable carrier is a nanoparticle. In embodiments, the pharmaceutically acceptable carrier is a lipid nanoparticle (LNP). In embodiments, the pharmaceutically acceptable carrier is a polymer. In embodiments, the pharmaceutically acceptable carrier is a lipoplex. In embodiments, the pharmaceutically acceptable carrier is protein. In embodiments, the pharmaceutically acceptable carrier is a mixture of two or more of the following: a solvent, dispersion media, diluent, surface active agent, isotonic agent, thickening or emulsifying agent, lipid, liposome, nanoparticle, lipid nanoparticle (LNP), polymer, lipoplex, or protein.

[0152] In embodiments, the preparation of pharmaceutically acceptable carriers and formulations containing these materials is described in, e.g., Remington: The Science andAttorney Docket No.: 095109-001300WO-1513793 Practice of Pharmacy, 22d Edition, Loyd et al. eds., Pharmaceutical Press and Philadelphia College of Pharmacy at University of the Sciences (2012).

[0153] Examples of physiologically acceptable carriers include buffers, such as phosphate buffers, citrate buffer, and buffers with other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers, such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrins; chelating agents, such as EDTA; sugar alcohols, such as mannitol or sorbitol; salt- forming counterions, such as sodium; and / or nonionic surfactants, such as TWEEN® (ICI, Inc.; Bridgewater, New Jersey), polyethylene glycol (PEG), and PLURONICSTM(BASF; Florham Park, NJ).

[0154] Compositions containing the RNA molecules described herein or derivatives thereof suitable for parenteral injection may comprise physiologically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Examples of suitable aqueous and nonaqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols (propyleneglycol, polyethyleneglycol, glycerol, and the like), suitable mixtures thereof, vegetable oils (such as olive oil) and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants.

[0155] These compositions may also contain adjuvants, such as preserving, wetting, emulsifying, and dispensing agents. Prevention of the action of microorganisms can be promoted by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, and the like. Isotonic agents, for example, sugars, sodium chloride, and the like may also be included. Prolonged absorption of the injectable pharmaceutical form can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0156] Administration of the RNA molecules and compositions described herein or pharmaceutically acceptable salts thereof can be carried out using therapeutically effective amounts of the RNA molecules and compositions described herein or pharmaceutically acceptable salts thereof as described herein for periods of time effective to prevent or treat a disease or disorder. Administration of the RNA molecules and compositions described hereinAttorney Docket No.: 095109-001300WO-1513793 or pharmaceutically acceptable salts thereof can be carried out using therapeutically effective amounts of the RNA molecules and compositions described herein or pharmaceutically acceptable salts thereof as described herein for periods of time effective to prevent a disease or disorder. Administration of the RNA molecules and compositions described herein or pharmaceutically acceptable salts thereof can be carried out using therapeutically effective amounts of the RNA molecules and compositions described herein or pharmaceutically acceptable salts thereof as described herein for periods of time effective to treat a disease or disorder. The effective amount of the RNA molecules and compositions described herein or pharmaceutically acceptable salts thereof as described herein may be determined by one of ordinary skill in the art.

[0157] Those of skill in the art will understand that the specific dose level and frequency of dosage for any particular subject may be varied and will depend upon a variety of factors, including the activity of the specific compound employed, the metabolic stability and length of action of that compound, the species, age, body weight, general health, sex and diet of the subject, the mode and time of administration, rate of excretion, drug combination, and severity of the particular condition.

[0158] The precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness of the disease or disorder, and should be decided according to the judgment of the practitioner and each subject's circumstances. Effective doses can be extrapolated from dose-response curves derived from in vitro or animal model test systems. Further, depending on the route of administration, one of skill in the art would know how to determine doses that result in a plasma concentration for a desired level of response in the cells, tissues and / or organs of a subject.

[0159] Any suitable formulation of the RNA molecules described herein can be prepared. See generally, Remington's Pharmaceutical Sciences, (2000) Hoover, J. E. editor, 20th edition, Lippincott Williams and Wilkins Publishing Company, Easton, Pa., pages 780- 857. A formulation is selected to be suitable for an appropriate route of administration. In embodiments, the RNA molecule is formulated for oral administration; in other embodiments, the RNA molecule is formulated for parenteral administration, such as injection or infusion.

[0160] Where contemplated RNA molecules are administered in a pharmacological composition, it is contemplated that the RNA molecules can be formulated in admixture with a pharmaceutically acceptable excipient and / or carrier. For example, contemplated RNA molecules can be administered orally as neutral compounds or as pharmaceuticallyAttorney Docket No.: 095109-001300WO-1513793 acceptable salts, or intravenously in a physiological saline solution. Conventional buffers such as phosphates, bicarbonates or citrates can be used for this purpose. Of course, one of ordinary skill in the art may modify the formulations within the teachings of the specification to provide numerous formulations for a particular route of administration. In particular, contemplated RNA molecules may be modified to render them more soluble in water or other vehicle, which for example, may be easily accomplished with minor modifications (salt formulation, esterification, etc.) that are well within the ordinary skill in the art. It is also well within the ordinary skill of the art to modify the route of administration and dosage regimen of a particular compound in order to manage the pharmacokinetics of the present compounds for maximum beneficial effect in a patient.

[0161] Depending on the intended mode of administration, the pharmaceutical composition can be in the form of solid, semi-solid or liquid dosage forms, such as, for example, tablets, suppositories, pills, capsules, powders, liquids, or suspensions, preferably in unit dosage form suitable for single administration of a precise dosage. The compositions will include a therapeutically effective amount of the RNA molecules described herein or derivatives thereof in combination with a pharmaceutically acceptable carrier and, in addition, may include other medicinal agents, pharmaceutical agents, carriers / excipients or diluents. By pharmaceutically acceptable is meant a material that is not biologically or otherwise undesirable, which can be administered to an individual along with the selected RNA molecule without causing unacceptable biological effects or interacting in a deleterious manner with the other components of the pharmaceutical composition in which it is contained.

[0162] To practice the method described herein, RNA molecules having formula and pharmaceutical compositions thereof may be administered orally, parenterally, by inhalation, topically (including transdermally, buccally, and sublingually), rectally, nasally, vaginally, via an implanted reservoir, or other drug administration methods. The term “parenteral” as used herein includes subcutaneous, intracutaneous, intravenous, intramuscular, intraarticular, intraarterial, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques. The compositions may be prepared by any method well known in the art of pharmacy.

[0163] Such methods include the step of bringing in association RNA molecules as described herein or combinations thereof with any auxiliary agent. The auxiliary agent(s), also named accessory ingredient(s), include those conventional in the art, such as excipients (e.g., starch, lactose), fillers, binders (e.g., gelatin, cellulose, gum tragacanth), diluents,Attorney Docket No.: 095109-001300WO-1513793 disintegrants (e.g., alginate, Primogel, and corn starch), lubricants (e.g., magnesium stearate, silicon dioxide), colorants, flavouring agents (e.g., glucose, sucrose, saccharin, methyl salicylate, and peppermint), anti-oxidants, wetting agents, or other material well known in the art for use in pharmaceutical formulations.

[0164] The preparation of pharmaceutically acceptable carriers and formulations containing these materials is described in, e.g., Remington: The Science and Practice of Pharmacy, 22d Edition, Loyd et al. eds., Pharmaceutical Press and Philadelphia College of Pharmacy at University of the Sciences (2012).

[0165] Solid dosage forms for oral administration of the RNA molecules described herein or derivatives thereof include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the RNA molecules described herein or derivatives thereof is admixed with at least one inert customary excipient (or carrier), such as sodium citrate or dicalcium phosphate, or (a) fillers or extenders, as for example, starches, lactose, sucrose, glucose, mannitol, and silicic acid, (b) binders, as for example, carboxymethylcellulose, alignates, gelatin, polyvinylpyrrolidone, sucrose, and acacia, (c) humectants, as for example, glycerol, (d) disintegrating agents, as for example, agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain complex silicates, and sodium carbonate, (e) solution retarders, as for example, paraffin, (f) absorption accelerators, as for example, quaternary ammonium compounds, (g) wetting agents, as for example, cetyl alcohol, and glycerol monostearate, (h) adsorbents, as for example, kaolin and bentonite, and (i) lubricants, as for example, talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, or mixtures thereof. In the case of capsules, tablets, and pills, the dosage forms may also comprise buffering agents.

[0166] Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethyleneglycols, and the like.

[0167] Solid dosage forms such as tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells, such as enteric coatings and others known in the art. They may contain opacifying agents and can also be of such composition that they release the active compound or compounds in a certain part of the intestinal tract in a delayed manner. Examples of embedding compositions that can be used are polymeric substances and waxes. The active compounds can also be in micro-encapsulated form, if appropriate, with one or more of the above-mentioned excipients.

[0168] Liquid dosage forms for oral administration of the RNA molecules describedAttorney Docket No.: 095109-001300WO-1513793 herein or derivatives thereof include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, and elixirs. In addition to the active compounds, the liquid dosage forms may contain inert diluents commonly used in the art, such as water or other solvents, solubilizing agents, and emulsifiers, as for example, ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propyleneglycol, 1,3- butyleneglycol, dimethylformamide, oils, in particular, cottonseed oil, groundnut oil, corn germ oil, olive oil, castor oil, sesame oil, glycerol, tetrahydrofurfuryl alcohol, polyethyleneglycols, and fatty acid esters of sorbitan, or mixtures of these substances, and the like.

[0169] Besides such inert diluents, the composition can also include additional agents, such as wetting, emulsifying, suspending, sweetening, flavoring, or perfuming agents.

[0170] Suspensions, in addition to the active compounds, may contain additional agents, as for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, or mixtures of these substances, and the like.

[0171] Routes of topical administration include nasal, bucal, mucosal, rectal, or vaginal applications. Compositions of the RNA molecules described herein or derivatives thereof for rectal administrations are optionally suppositories, which can be prepared by mixing the compounds with suitable non-irritating excipients or carriers, such as cocoa butter, polyethyleneglycol or a suppository wax, which are solid at ordinary temperatures but liquid at body temperature and, therefore, melt in the rectum or vaginal cavity and release the active component.

[0172] Dosage forms for topical administration of the RNA molecules described herein or derivatives thereof include ointments, lotions, creams, gels, pastes, suspensions, drops, powders, sprays, inhalants, and transdermal patches. One or more thickening agents, humectants, and stabilizing agents can be included in the formulations. Examples of such agents include, but are not limited to, polyethylene glycol, sorbitol, xanthan gum, petrolatum, beeswax, or mineral oil, lanolin, squalene, and the like. Methods for preparing transdermal patches are disclosed, e.g., in Brown, et al. (1988) Ann. Rev. Med.39:221-229 which is incorporated herein by reference. The RNA molecules described herein or derivatives thereof are admixed under sterile conditions with a physiologically acceptable carrier and any preservatives, buffers, or propellants as may be required. Ophthalmic formulations, ointments, powders, and solutions are also contemplated as being within the scope of the compositions.Attorney Docket No.: 095109-001300WO-1513793

[0173] Optionally, the RNA molecules described herein can be contained in a drug depot. A drug depot comprises a physical structure to facilitate implantation and retention in a desired site (e.g., a synovial joint, a disc space, a spinal canal, abdominal area, a tissue of the patient, etc.). The drug depot can provide an optimal concentration gradient of the compound at a distance of up to about 0.1 cm to about 5 cm from the implant site. A depot, as used herein, includes but is not limited to capsules, microspheres, microparticles, microcapsules, microfibers particles, nanospheres, nanoparticles, coating, matrices, wafers, pills, pellets, emulsions, liposomes, micelles, gels, antibody-compound conjugates, protein- compound conjugates, or other pharmaceutical delivery compositions. Suitable materials for the depot include pharmaceutically acceptable biodegradable materials that are preferably FDA approved or GRAS materials. These materials can be polymeric or non-polymeric, as well as synthetic or naturally occurring, or a combination thereof. The depot can optionally include a drug pump.

[0174] For transdermal administration, e.g. gels, patches or sprays can be contemplated. Compositions or formulations suitable for pulmonary administration e.g. by nasal inhalation include fine dusts or mists which may be generated by means of metered dose pressurized aerosols, nebulisers or insufflators. A nasal aerosol or inhalation compositions can be prepared according to techniques well-known in the art of pharmaceutical formulation and can be prepared as solutions in, for example saline, employing suitable preservatives (for example, benzyl alcohol), absorption promoters to enhance bioavailability, and / or other solubilizing or dispersing agents known in the art.

[0175] The compositions may be presented in unit-dose or multi-dose containers, for example sealed vials and ampoules, and may be stored in a freeze-dried (lyophilised) condition requiring only the addition of sterile liquid carrier, for example water, prior to use.

[0176] In addition, the RNA molecules or any of the exemplary compounds disclosed herein or an enantiomer, a mixture of enantiomers, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof, may be administered alone or in combination with other therapeutic agents. Combination therapies according to the present disclosure comprise the administration of at least one exemplary RNA molecule of the present disclosure and at least one other therapeutic agent in a pharmaceutical composition. The at least one exemplary RNA molecule of the present disclosure and at least one other therapeutic agent(s) may be administered as a pharmaceutical composition separately or together. The amounts of the at least one exemplary RNA molecule of theAttorney Docket No.: 095109-001300WO-1513793 present disclosure and the at least one other therapeutic agent(s) and the relative timings of administration will be selected in order to achieve the desired combined therapeutic effect.

[0177] In an aspect, provided herein is a method of treating a disease in a subject in need thereof comprising introducing an effective amount of any one of the RNA molecules described herein. In an aspect, provided herein is a method of treating a disease in a subject in need thereof comprising introducing an effective amount of a cell comprising any one of RNA molecules described herein. In an aspect, provided herein is a method of treating a disease in a subject in need thereof comprising introducing an effective amount of a cell comprising a protein or a peptide translated from any one of RNA molecules described herein. In an aspect, provided herein is a method of treating a disease in a subject in need thereof comprising introducing an effective amount of a cell comprising a peptide translated from any one of RNA molecules described herein. In an aspect, provided herein is a method of treating a disease in a subject in need thereof comprising introducing an effective amount of a cell comprising a protein translated from any one of RNA molecules described herein. In embodiments, the cell is an isolated cell. In embodiments, the cell is a mammalian cell. In embodiments, the cell is a human cell.

[0178] In an aspect, provided herein is a method of treating a disease in a subject in need thereof comprising introducing an effective amount of a pharmaceutical composition comprising any one of the RNA molecules described herein and a pharmaceutically acceptable carrier. In embodiments, the pharmaceutically acceptable carrier is a solvent, dispersion media, diluent, surface active agent, isotonic agent, thickening or emulsifying agent, lipid, liposome, nanoparticle, lipid nanoparticle (LNP), polymer, lipoplex, protein, or a mixture thereof. In embodiments, the pharmaceutically acceptable carrier is a lipid nanoparticle (LNP).

[0179] In an aspect, provided herein is a method of preventing a disease in a subject in need thereof comprising introducing an effective amount of any one of the RNA molecules described herein. In an aspect, provided herein is a method of preventing a disease in a subject in need thereof comprising introducing an effective amount of a cell comprising any one of RNA molecules described herein. In an aspect, provided herein is a method of preventing a disease in a subject in need thereof comprising introducing an effective amount of a cell comprising a protein or a peptide translated from any one of RNA molecules described herein. In an aspect, provided herein is a method of preventing a disease in a subject in need thereof comprising introducing an effective amount of a cell comprising a peptide translated from any one of RNA molecules described herein. In an aspect, providedAttorney Docket No.: 095109-001300WO-1513793 herein is a method of preventing a disease in a subject in need thereof comprising introducing an effective amount of a cell comprising a protein translated from any one of RNA molecules described herein. In embodiments, the cell is an isolated cell. In embodiments, the cell is a mammalian cell. In embodiments, the cell is a human cell.

[0180] In an aspect, provided herein is a method of preventing a disease in a subject in need thereof comprising introducing an effective amount of a pharmaceutical composition comprising any one of the RNA molecules described herein and a pharmaceutically acceptable carrier. In embodiments, the pharmaceutically acceptable carrier is a solvent, dispersion media, diluent, surface active agent, isotonic agent, thickening or emulsifying agent, lipid, liposome, nanoparticle, lipid nanoparticle (LNP), polymer, lipoplex, protein, or a mixture thereof. In embodiments, the pharmaceutically acceptable carrier is a lipid nanoparticle (LNP).

[0181] In an aspect, provided herein is a method of increasing the expression of a protein or a peptide of interest in a cell, comprising contacting the cell with any one of the RNA molecules described herein, wherein the RNA molecule encodes the protein or peptide of interest, wherein the expression is increased when compared to that of an RNA molecule without the modified NTP at the 3’ end of the poly-A region. In an aspect, provided herein is a method of increasing the expression of a peptide of interest in a cell, comprising contacting the cell with any one of the RNA molecules described herein, wherein the RNA molecule encodes the peptide of interest, wherein the expression is increased when compared to that of an RNA molecule without the modified NTP at the 3’ end of the poly-A region. In an aspect, provided herein is a method of increasing the expression of a protein of interest in a cell, comprising contacting the cell with any one of the RNA molecules described herein, wherein the RNA molecule encodes the protein of interest, wherein the expression is increased when compared to that of an RNA molecule without the modified NTP at the 3’ end of the poly-A region. In embodiments, the cell is isolated, in vitro, or ex vivo. In embodiments, the cell is an isolated cell. In embodiments, the cell is an in vitro cell. In embodiments, the cell is an ex vivo cell. In embodiments, the modified NTP increases the nuclease resistance of the RNA molecules described herein. In embodiments, the modified NTP increases the nuclease resistance of the RNA molecules described herein as compared to an RNA molecule without the modified NTP covalently linked to the 3’ end of the poly-A region. In embodiments, the modified NTP increases the stability of the RNA molecules described herein. In embodiments, the modified NTP increases the stability of the RNA molecules described herein as compared to an RNA molecule without the modified NTP covalently linked to theAttorney Docket No.: 095109-001300WO-1513793 3’ end of the poly-A region. In embodiments, the modified NTP increases the half-life of the RNA molecules described herein. In embodiments, the modified NTP increases the half-life of the RNA molecules described herein as compared to an RNA molecule without the modified NTP covalently linked to the 3’ end of the poly-A region.

[0182] In an aspect, provided herein is a method of expressing a protein or a peptide of interest in a cell, comprising contacting the cell with any one of the RNA molecules described herein, wherein the RNA molecule encodes the protein or peptide of interest and the cell translates the protein or peptide of interest from the RNA molecule. In an aspect, provided herein is a method of expressing a peptide of interest in a cell, comprising contacting the cell with any one of the RNA molecules described herein, wherein the RNA molecule encodes the peptide of interest and the cell translates the peptide of interest from the RNA molecule. In an aspect, provided herein is a method of expressing a protein of interest in a cell, comprising contacting the cell with any one of the RNA molecules described herein, wherein the RNA molecule encodes the protein of interest and the cell translates the protein of interest from the RNA molecule. In embodiments, the cell is isolated, in vitro, or ex vivo. In embodiments, the cell is an isolated cell. In embodiments, the cell is an in vitro cell. In embodiments, the cell is an ex vivo cell.

[0183] In an aspect, provided herein is a method of increasing the half-life of an RNA molecule in a cell, comprising contacting the cell with any one of the RNA molecules described herein, wherein the half-life is increased when compared to that of an RNA molecule without the modified NTP at the 3’ end of the poly-A region. In an aspect, provided herein is a method of increasing the half-life of an RNA molecule in a cell, comprising contacting the cell with any one of the RNA molecules described herein, wherein the half-life is increased when compared to that of an RNA molecule without the modified NTP at the 3’ end of the poly-A region. In an aspect, provided herein is a method of increasing the half-life of an RNA molecule in a cell, comprising contacting the cell with any one of the RNA molecules described herein, wherein the half-life is increased when compared to that of an RNA molecule without the modified NTP at the 3’ end of the poly-A region. In embodiments, the cell is isolated, in vitro, or ex vivo. In embodiments, the cell is an isolated cell. In embodiments, the cell is an in vitro cell. In embodiments, the cell is an ex vivo cell.

[0184] In embodiments, the RNA molecules described herein can be used as guide RNAs (gRNAs) in gene editing.Attorney Docket No.: 095109-001300WO-1513793 Kits

[0185] In an aspect, provided herein is a kit comprising any of the RNA molecules described herein. In embodiments, the kits may comprise sufficient amounts of the required components to allow for multiple treatments of a subject in need of such treatment. In embodiments, the kits may comprise sufficient amounts of the required components to allow for multiple experiments.

[0186] In embodiments, provided herein is a kit for protein production, including an RNA molecule, comprising a 5’-cap, a 5’ UTR, a translatable region, a 3’ UTR, a poly-A region, and a modified NTP 3’ to the poly-A region, wherein the RNA molecule exhibits reduced degradation by exonucleases, and instructions for using the kit.

[0187] In embodiments, provided herein is a kit for protein production, including an RNA molecule, comprising a 5’-cap, a 5’ UTR, a translatable region, a 3’ UTR, and a poly-A region, a polymerase for linking a modified NTP, and a modified NTP. In embodiments, the kit further comprises instructions for administering any of the pharmaceutical compositions provided herein to a subject. LIST OF SEQUENCES:

[0188] 39 mer model RNA sequence SEQ ID NO:1 5’-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-3’

[0189] 40-mer Cy3 labeled DNA sequence SEQ ID NO:3 5’- / Cy3 / AAT TAA TAC GAC TCA CTA TAA GGA AAT AAG AGA GAA AAG A-3’

[0190] eGFP mRNA (capped with CleanCap AG and where all Us are 5-methoxy U) SEQ ID NO:4 AGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACCAUGGU GAGCAAGGGCGAGGAGCUGUUCACCGGGGUGGUGCCCAUCCUGGUCGAGCUGG ACGGCGACGUAAACGGCCACAAGUUCAGCGUGUCCGGCGAGGGCGAGGGCGAU GCCACCUACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCC CGUGCCCUGGCCCACCCUCGUGACCACCCUGACCUACGGCGUGCAGUGCUUCA GCCGCUACCCCGACCACAUGAAGCAGCACGACUUCUUCAAGUCCGCCAUGCCC GAAGGCUACGUCCAGGAGCGCACCAUCUUCUUCAAGGACGACGGCAACUACAA GACCCGCGCCGAGGUGAAGUUCGAGGGCGACACCCUGGUGAACCGCAUCGAGC UGAAGGGCAUCGACUUCAAGGAGGACGGCAACAUCCUGGGGCACAAGCUGGA GUACAACUACAACAGCCACAACGUCUAUAUCAUGGCCGACAAGCAGAAGAACGAttorney Docket No.: 095109-001300WO-1513793 GCAUCAAGGUGAACUUCAAGAUCCGCCACAACAUCGAGGACGGCAGCGUGCAG CUCGCCGACCACUACCAGCAGAACACCCCCAUCGGCGACGGCCCCGUGCUGCU GCCCGACAACCACUACCUGAGCACCCAGUCCGCCCUGAGCAAAGACCCCAACG AGAAGCGCGAUCACAUGGUCCUGCUGGAGUUCGUGACCGCCGCCGGGAUCACU CUCGGCAUGGACGAGCUGUACAAGUAAGCGGCCGCUUAAUUAAGCUGCCUUCU GCGGGGCUUGCCUUCUGGCCAUGCCCUUCUUCUCUCCCUUGCACCUGUACCUC UUGGUCUUUGAAUAAAGCCUGAGUAGGAAGAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0191] eGFP mRNA (capped with CleanCap M6 and where all Us are N1- methylpseudouridines) SEQ ID NO:5 m6AGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACCAUG GUGAGCAAGGGCGAGGAGCUGUUCACCGGGGUGGUGCCCAUCCUGGUCGAGCU GGACGGCGACGUAAACGGCCACAAGUUCAGCGUGUCCGGCGAGGGCGAGGGCG AUGCCACCUACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUG CCCGUGCCCUGGCCCACCCUCGUGACCACCCUGACCUACGGCGUGCAGUGCUU CAGCCGCUACCCCGACCACAUGAAGCAGCACGACUUCUUCAAGUCCGCCAUGC CCGAAGGCUACGUCCAGGAGCGCACCAUCUUCUUCAAGGACGACGGCAACUAC AAGACCCGCGCCGAGGUGAAGUUCGAGGGCGACACCCUGGUGAACCGCAUCGA GCUGAAGGGCAUCGACUUCAAGGAGGACGGCAACAUCCUGGGGCACAAGCUGG AGUACAACUACAACAGCCACAACGUCUAUAUCAUGGCCGACAAGCAGAAGAAC GGCAUCAAGGUGAACUUCAAGAUCCGCCACAACAUCGAGGACGGCAGCGUGCA GCUCGCCGACCACUACCAGCAGAACACCCCCAUCGGCGACGGCCCCGUGCUGC UGCCCGACAACCACUACCUGAGCACCCAGUCCGCCCUGAGCAAAGACCCCAAC GAGAAGCGCGAUCACAUGGUCCUGCUGGAGUUCGUGACCGCCGCCGGGAUCAC UCUCGGCAUGGACGAGCUGUACAAGUAAGCGGCCGCUUAAUUAAGCUGCCUUC UGCGGGGCUUGCCUUCUGGCCAUGCCCUUCUUCUCUCCCUUGCACCUGUACCU CUUGGUCUUUGAAUAAAGCCUGAGUAGGAAGAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA METHODS FOR MAKING COMPOUNDS DESCRIBED HEREIN

[0192] As used herein, common organic chemistry abbreviations are defined as follows:Attorney Docket No.: 095109-001300WO-1513793 Ac Acetyl ACN Acetonitrile AcOH Acetic acid aq. Aqueous AX chromatography Anion exchange chromatography DBU 1,8-Diazabicyclo[5.4.0]undec-7-ene DCM dichloromethane ddC 2’,3’-dideoxy Cytidine DI water Deionized water DIAD Diisopropyl azodicarboxylate DIEA or DIPEA Diisopropylethylamine DMAP 4-dimethylaminopyridine DMF N,N'-Dimethylformamide DMS Dimethyl sulfate DMSO Dimethyl sulfoxide dTAm 2’-deoxy-5-(N-(6-aminohexyl)prop-2-enamide) thymidine EDC or EDC.HCl 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride EtOAc or EA Ethyl acetate EtOH Ethanol g Gram(s) hrs. Hour (hours) HCl Hydrochloric acid HPLC High-performance liquid chromatography IPA Isopropyl alcohol LC / MS Liquid chromatography-mass spectrometry LNP Lipid nanoparticle mg milligrams MeOH Methanol mL Milliliter(s) ^L or uL Microliter(s) mmol millimoles ^mol or umol micromoles MS mass spectrometry NaH Sodium hydride NaOAc Sodium acetate NaOH Sodium hydroxide Pyr Pyridine RP-HPLC reverse phase HPLCAttorney Docket No.: 095109-001300WO-1513793 RT room temperature t-Bu tert-Butyl TEA Triethylamine TEAB Tetraethylammonium bromide Tert, t tertiary TEA salt triethylammonium salt TEAB triethylammonium bromide TFA Trifluoracetic acid TFAA Trifluoracetic anhydride THF Tetrahydrofuran TMP Trimethylphosphate TPP Triphenylphosphine EXAMPLES

[0193] The following examples are meant to be illustrative and can be used to further understand embodiments of the present disclosure and should not be construed as limiting the scope of the present teachings in any way.

[0194] The chemical reactions described in the Examples can be readily adapted to prepare a number of other compounds of the present disclosure, and alternative methods for preparing the compounds of this disclosure are deemed to be within the scope of this disclosure. For example, the synthesis of non-exemplified compounds according to the present disclosure can be successfully performed by modifications apparent to those skilled in the art, e.g., by utilizing other suitable reagents known in the art other than those described, or by making routing modifications of reaction conditions, reagents, and starting materials. Alternatively, other reactions disclosed herein or known in the art will be recognized as having applicability for preparing other compounds of the present disclosure. Synthetic Examples: General Example: Synthesis of Sequence 2xAttorney Docket No.: 095109-001300WO-1513793

[0195] To a 1.5 mL Eppendorf tube were added RNAse free water (16.0 µL), NEBuffer 2 reaction buffer (New England Biolabs Inc. Catalog #: M0337S, 500 mM NaCl, 100 mM Tris-HCl, 100 mM MgCl2, 10 mM DTT, pH 7.9, 2.5 µL), NTP (custom ordered from TriLink Biotechnologies, 2.5 µL), and RNase Inhibitor, Murine (New England Biolabs Inc. Catalog # M0314B, 40 U / µL, 1.0 µL). To the resulting solution were added Sequence 1 (custom ordered from TriLink Biotechnologies, 10 mM, 2.0 µL) (SEQ ID NO: 1) and Poly(U) Polymerase (New England Biolabs Inc. Catalog #: M0337S, 2 U / µL, 1.0 µL) and thoroughly mixed. The reaction was incubated at 37⁰C for 30 minutes. EDTA was added to the cooled reaction (Fiser Scientific Catalog #: BP2482100, 500 mM, 2.0 µL). Analysis by LC-MS confirmed Sequence 2x was obtained. Example S1: Synthesis of Sequence 2a

[0196] Analysis by LC-MS confirmed Sequence 2a was obtained (99% yield by HPLC). Retention Time Sequence 2a: 4.576 min. as shown in FIG.1A.

[0197] MS m / z = 13120.8 [M-H].Attorney Docket No.: 095109-001300WO-1513793 Example S2: Synthesis of Sequence 2b

[0198] Analysis by LC-MS confirmed Sequence 2b was obtained (99% yield by HPLC). Retention Time Sequence 2b: 4.620 min. as shown in FIG.1B.

[0199] MS m / z = 13134.2 [M-H]. Example S3: Synthesis of Sequence 2cAttorney Docket No.: 095109-001300WO-1513793

[0200] Analysis by LC-MS confirmed Sequence 2c was obtained (99% yield by HPLC). Retention Time Sequence 2c: 4.630 min. as shown in FIG.1C.

[0201] MS m / z = 13095.6 [M-H].

[0202] The following 40-mer oligonucleotide models were synthesized and tested for stability using digestion with CNOT7. Digestion assay is described below in Example B1. The synthesized 40-mer oligonucleotide models comprise a 39-mer poly-A (SEQ ID NO:1) and a modified NTP at the 3’ end. The modified NTP at the 3’ end was selected from the group consisting of 2-amino-6-chloropurineriboside-5'-triphosphate, 6-chloropurineriboside- 5'-triphosphate, 5-iodocytidine-5'-triphosphate, 5-iodouridine-5'-triphosphate, 2'-O- methyladenosine-5'-triphosphate, 2'-O-methylguanosine-5'-triphosphate, puromycin-5'- triphosphate, 4-thiouridine-5'-triphosphate, 2'-amino-2'-deoxycytidine-5'-triphosphate, 2'- amino-2'-deoxyuridine-5-triphosphate, 2'-azido-2'-deoxyuridine-5'-triphosphate, 2- thiouridine-5'-triphosphate, arabinoseuridine-5'-triphosphate, 2-thiocytidine-5'-triphosphate, 6-azacytidine-5'-triphosphate, 6-azauridine-5'-triphosphate, 2'-O-methyl-2-aminoadenosine- 5'-triphosphate, 2'-O-methylpseudouridine-5'-triphosphate, 2'-O-methyl-5-methyluridine-5'- triphosphate, 2'-azido-2'-deoxyadenosine-5'-triphosphate, 8-azidoadenosine-5'-triphosphate, 5-bromocytidine-5'-triphosphate, 5-bromouridine-5'-triphosphate, 3'-O-methyladenosine-5'- triphosphate, 3'-O-methylcytidine-5'-triphosphate, 3'-O-methylguanosine-5'-triphosphate, 3'- O-methyluridine-5'-triphosphate, 7-deazaadenosine-5'-triphosphate, 5-aminoallyluridine-5'- triphosphate, 2'-azido-2'-deoxyguanosine-5'-triphosphate, 5-aminoallylcytidine-5'- triphosphate, 2-aminopurine-riboside-5'-triphosphate, pseudoisocytidine-5'-triphosphate, N4- methylcytidine-5'-triphosphate, 5,6-dihydro-5-methyl-uridine-5'-triphosphate, 5- carboxycytidine-5'-triphosphate, 5-formylcytidine-5'-triphosphate, 5-hydroxymethylcytidine- 5'-triphosphate, 5-hydroxycytidine-5'-triphosphate, 5-formyluridine-5'-triphosphate, 5-Attorney Docket No.: 095109-001300WO-1513793 carboxyuridine 5'-triphosphate, 5-hydroxyuridine-5'-triphosphate, 5-methoxycytidine-5’- triphosphate, thienouridine-5'-triphosphate, 5-carboxymethylesteruridine-5'-triphosphate, thienocytidine-5'-triphosphate, 8-oxoadenosine-5'-triphosphate, isoguanosine-5'-triphosphate, 2'-O-methyluridine-5'-triphosphate, 2'-O-methylcytidine-5'-triphosphate, 2'-O-methyl-N6- methyladenosine-5'-triphosphate, guanosine-5'-O-(1-thiotriphosphate), uridine-5'-O-(1- thiotriphosphate), N1-propylpseudouridine-5'-triphosphate, N1-methylpseudouridine-5'- triphosphate, N1-ethylpseudouridine-5'-triphosphate, N1-methyl-2’-O-methylpseudouridine- 5'-triphosphate, 5-methylcytidine-5'-triphosphate, N6-methyladenosine-5'-triphosphate, 2'- fluoro-2'-deoxyuridine-5'-triphosphate, 2'-fluoro-2'-deoxycytidine-5'-triphosphate, 5- methoxyuridine-5'-triphosphate, 5,6-dihydrouridine-5'-triphosphate, 5-methyluridine-5'- triphosphate, 8-oxoguanosine-5'-triphosphate, arabinoseguanosine-5'-triphosphate, 2’,3’- dideoxyadenosine-5'-triphosphate, adenosine-5'-O-(1-thiotriphosphate), 7-deaza-7- aminoethynyl-2’-deoxyadenosine-5'-triphosphate, 2’-deoxyadenosine-5'-triphosphate, 2’- Fluoro-2’-deoxyadenosine-5'-triphosphate, 2’dexoyadenosine-5'-O-(1-thiotriphosphate), 2- aminoadenosine-5'-triphosphate, 2’,3’-dideoxyguanosine-5'-triphosphate, thienoguanosine-5'- triphosphate, 7-deaza-7-aminoethynyl-2’-deoxyguanosine-5'-triphosphate, 5-aminoethynyl- 2’-deoxycytidine-5'-triphosphate, 5-aminoethynyl-2’, 3’-dideoxycytidine-5'-triphosphate, 5- aminoethynyl-2’-deoxyuridine-5'-triphosphate, N1-methoxymethylpseudouridine-5'- triphosphate, and N1-methyladenosine-5'-triphosphate. All 87 oligo models were prepared. General Example: Synthesis of Sequence 4x or Sequence 5x

[0203] To a 1.5 mL Eppendorf tube were added RNAse free water (39.9 µL), NEBuffer 2 reaction buffer (New England Biolabs Inc. Catalog #: M0337S, 500 mM NaCl, 100 mM Tris-HCl, 100 mM MgCl2, 10 mM DTT, pH 7.9, 10.0 µL), NTP (custom ordered from TriLink Biotechnologies, 10.0 µL), and RNase Inhibitor, Murine (New England BiolabsAttorney Docket No.: 095109-001300WO-1513793 Inc. Catalog # M0314B, 40 U / µL, 4.0 µL). To the resulting solution were added eGFP mRNA (TriLink Biotechnologies Catalog: L-7201 SEQ ID NO: 4 or L-8101 SEQ ID NO: 5, 1.56 mg / mL, 32.1 µL) and Poly(U) Polymerase (New England Biolabs Inc. Catalog #: M0337S, 2 U / µL, 4.0 µL) and thoroughly mixed. The reaction was incubated at 37⁰C for 30 minutes. The reaction was stored at -20⁰C until purification by Oligo-dT column. Example S4: Synthesis of Sequence 4a or Sequence 5a

[0204] Sequence 4a (and Sequence 5a) were synthesized according to the method described above in General Example: synthesis of Sequence 4x. Additional eGFP mRNAs were synthesized and tested for protein expression in cell-based assay. Cell-based assay is described below in Example B2.

[0205] The following eGFP mRNAs were synthesized and tested for protein expression in cell-based assays, as described below in Example B2. The synthesized mRNAs comprise an eGFP mRNA (SEQ ID NO:4 or SEQ ID NO:5) and one modified NTP at the 3’ end. The modified NTP at the 3’ end (also referred to as: terminating modified NTP) was selected from the group consisting of 8-oxoguanosine-5'-triphosphate, 3’-O- methylguanosine-5'-triphosphate, N1-methylpseudouridine-5'-triphosphate, N1-methyl-2’-O- methylpseudouridine-5'-triphosphate, 2’-O-methylguanosine-5'-triphosphate, 2’-amino-2’- deoxycytidine-5'-triphosphate, 6-azacytidine-5'-triphosphate, 6-azauridine-5'-triphosphate, 8- oxoadenosine-5'-triphosphate, 2’-O-methylcytidine-5'-triphosphate, and 2’-O-methyl-2- aminoadenosine-5'-triphosphate. All 11 mRNAs were prepared and tested in cell-based assays. The synthesized mRNAs were of two types; Type 1: where the mRNA was cappedAttorney Docket No.: 095109-001300WO-1513793 with CleanCap AG and where all uridines were replaced with 5-methoxy uridines (SEQ ID NO:4); and Type 2: where the mRNA was capped with CleanCap M6 and where all uridines were replaced with N1-methylpseudouridines (SEQ ID NO:5). Example S5: Synthesis of Sequence 5c 13 µmol), dryDMSO (133 µL), and n-butylamine (1.4 µL, 14 µmol) were mixed in a vial, and stirred at room temperature for 1 hour. A small aliquot of reaction mixture (1 µL) was dissolved in 50% ACN in water (100 µL) and analyzed by LCMS confirming full conversion to compound 2. The crude mixture was used in subsequent steps as is.

[0207] MS m / z = 361.2 [M+H].NEBuffer 2 reaction buffer (New England Biolabs Inc. Catalog #: M0337S, 500 mM NaCl, 100 mM Tris-HCl, 100 mM MgCl2, 10 mM DTT, pH 7.9, 10.0 µL), eGFP mRNA (TriLink Biotechnologies, L-8101 SEQ ID NO: 5, 1.24 mg / mL, 80.6 µL), and RNase Inhibitor,Attorney Docket No.: 095109-001300WO-1513793 murine (New England Biolabs Inc. Catalog # M0314B, 40 U / µL, 8.0 µL). To the resulting solution were added Compound 3 (10 mM, 20 µL) and Poly (U) Polymerase (New England Biolabs Inc. Catalog #: M0337S, 2 U / µL, 8.0 µL) and thoroughly mixed. The reaction was shaken at 37⁰C for 30 minutes and the mRNA was isolated with an RNEasy Mini kit (Qiagen, Catalog #: 74104). mRNA was eluted with RNase free water (100 µL) at a concentration of 1.136 mg / mL. Analysis was carried out by IPRP HPLC using a DNAPac RP 4µm 3.0 x 50 mm column (Thermofisher Catalog #: 088920) eluting with a gradient of 40% Buffer B (100 mM TEAA, 1 mM EDTA, 25% ACN, pH 7.3) in Buffer A (100 mM TEAA, 1 mM EDTA, pH 7.3) to 80% Buffer B in Buffer A over 14.9 minutes.

[0209] Retention Time SEQ ID NO: 5: 10.809; Sequence 5b: 11.117 min.acetate buffer (1 M, pH 7.0, 4.0 µL), Sequence 5b (1.136 mg / mL, 17.6 µL), and dry DMSOAttorney Docket No.: 095109-001300WO-1513793 (16.0 µL). To the resulting solution was added compound 2 (1.0 µL) and thoroughly mixed. The reaction was shaken at room temperature for 3.5 hours. Analysis was carried out IPRP HPLC using a DNAPac RP 4µm 3.0 x 50 mm column (Thermofisher Catalog #: 088920) eluting with a gradient of 40% Buffer B (100 mM TEAA, 1 mM EDTA, 25% ACN, pH 7.3) in Buffer A (100 mM TEAA, 1 mM EDTA, pH 7.3) to 60% Buffer B in Buffer A over 14.9 minutes. The presence of the new product was confirmed by HPLC.

[0211] Retention Time eGFP mRNA (SEQ ID NO: 5): 10.809 min.; Retention Time Sequence 5c1 / 5c2: 15.099 min. as shown in FIGS.5A and 5B. Example S6: Synthesis of Sequence 5dacetate buffer (1 M, pH 7.0, 4.0 µL), Sequence 5b (1.136 mg / mL, 17.6 µL), and dry DMSO (16.0 µL). To the resulting solution was added compound 4 (from Broadpharm, Catalog #:Attorney Docket No.: 095109-001300WO-1513793 BP-25745, 1.0 µL) and thoroughly mixed. The reaction was shaken at room temperature for 3.5 hours. Analysis was carried out IPRP HPLC using a DNAPac RP 4µm 3.0 x 50 mm column (Thermofisher Catalog #: 088920) eluting with a gradient of 40% Buffer B (100 mM TEAA, 1 mM EDTA, 25% ACN, pH 7.3) in Buffer A (100 mM TEAA, 1 mM EDTA, pH 7.3) to 60% Buffer B in Buffer A over 14.9 minutes. The presence of the new product was confirmed by HPLC.

[0213] Retention Time eGFP mRNA (SEQ ID NO: 5): 10.809 min.; Retention Time Sequence 5d1 / 5d2: 13.459 min. as shown in FIGS.6A and 6B. Example B1: CNOT7 Digestion Assay of 40-mer Oligonucleotide Models.

[0214] CNOT7 reaction buffer was prepared by adding Tris-HCl (1 M, pH 8.0, 200 µL), MgCl2(1 M, 100 µL), and dithiothreitol (custom ordered from TriLink Biotechnologies, 1 M, 200 µL), to KCl (2 M, 500 µL) and stored in a -20⁰C freezer until use. CNOT7 was purchased from Creative Biomart, Recombinant Human, GST-tagged, Catalog #: CNOT7- 1793H.

[0215] The 40-mer oligonucleotide models were prepared as described above in the General Example synthesis of Sequence 2x, except after the 30-minute incubation at 37⁰C the reaction mixture was incubated for another 20 minutes at 65⁰C (instead of treatment with EDTA). Following the incubation at 65⁰C, CNOT7 reaction buffer (200 mM Tris-HCl, 100 mM MgCl2, 200 mM DTT, 1 M KCl, pH 8.0, 4.0 µL) was added to the crude reaction mixture 34.9 µL (containing Sequence 2x). A 10 µL aliquot was taken from the reaction mixture (t=0 hrs.) and added to EDTA (0.5M, 1 µL) and a single stranded DNA sequence (for reference) (SEQ ID NO:3, custom ordered from Integrated DNA Technologies, 6.25 ^M, 1 µL) in a sample vial. CNOT7 (0.25 ug / µL, 1.1 µL) was then added to the remaining mixture.

[0216] The reaction mixture was incubated at 37⁰C for 48 hours.10 µL aliquots of the reaction mixture were removed at 24 hrs. and at 48 hrs. and were added each time to a sample vial containing EDTA (0.5M, 1 µL) and SEQ ID NO:3 (internal reference: 6.25 ^M, 1 µL). All samples were analyzed by HPLC by loading onto a ACQUITY UPLC Oligonucleotide BEH C18 Column, 130A, 1.7 um, 2.1 mm x 50 mm, and eluting with a gradient of 2-20% ACN in Buffer A (1% Hexafluoroisopropanol, 0.1% diisopropylethylamine, 2 µM EDTA in water) over 10 minutes. Peaks corresponding to Sequence 2x and SEQ ID NO:3 (internal reference) were integrated and Sequence 2x peak integrations adjusted to reflect the same concentration as that of SEQ ID NO:3. FIG.2A is an example of HPLC chromatogramsAttorney Docket No.: 095109-001300WO-1513793 obtained for oligonucleotide Sequence 2x. Sequence 2x were 40-mer oligos with one modified NTP at the 3’ end (in this example the modified NTP is 8-oxo ATP and the sequence is Sequence 2a), at t=0 hrs., t=24 hrs., and t=48 hrs. following digestion with CNOT7. The HPLC chromatograms show that the 40-mer oligo with one modified NTP is digested over time while the reference peak of SEQ ID NO:3 remains constant.

[0217] FIG.2B shows the remaining fraction of modified 40-mer oligos, following digestion with CNOT7 at t=24 hrs. The 40-mer oligos are composed of SEQ ID NO:3 where a modified NTP (indicated in FIG.2B) is added with poly U polymerase at the 3’ end of SEQ ID NO:3. Negative control, designated as H2O on FIG.2B was a 39-mer oligo with adenosine as the last nucleoside (i.e. SEQ ID NO:1). FIG.2C provides the full NTP names for the NTP abbreviations used in FIG.2B. Example B2: Protein Expression in Cell-based Assays.

[0218] Protein expression in cell-based assays was measured by Allele Biotechnology (FIG.3A and 3B) or by Structure Based Design Inc. (FIG.4).

[0219] Procedure by Allele Biotechnology

[0220] eGFPfluorescence assay:

[0221] The day before transfection: cells were seeded as follows: HeLa cells: 3.125 x104 / cm2The cells were dissociated with TrypLE HeLa cells were seeded in 96 well plates (no coating required). The cells were seeded in 100^L of growth media (Growth Media: DMEM+10% FBS supplemented with GlutaMAX and MEM Non-Essential Amino Acids).

[0222] The day of transfection: Opti-MEM and MessengerMax Transfection Reagent were allowed to reach room temperature. Two tubes were set up for each mRNA (i.e., for each modified NTP).

[0223] Preparing tube 1: 0.1 ^L of MessengerMax was added to 5 ^L Opti-MEM (these amounts were multiplied by the number of wells for each modified NTP, in this case 6 repeats per mRNA were done), and the mixture was incubated at room temperature for 10 minutes.

[0224] Preparing tube 2: During the 10-minute incubation of mixture in tube 1, 1 ng of each mRNA (with different modified NTP) was added to tubes containing 5 ^L of Opti- MEM each (these amounts were multiplied by the number of wells for each modified NTP, inAttorney Docket No.: 095109-001300WO-1513793 this case 6 repeats per mRNA were done).

[0225] After the 10 min incubation of mixture in tube 1, mixture of tube 2 was added to mixture of tube 1, and the new mixture was incubated for 5 minutes.

[0226] 96-well plates containing the cells, were washed once with 100^L dPBS and the supernatant was aspirated and discarded. 10 ^L of the mixture (mix of tube 1 and tube 2) was added to the cells within a 15-minute window (after the 5 min incubation period).25 ^L of Opti-MEM was added to each well, and the plates were incubated for 4 hours. After 4 hours, 100^L of growth media was added to each well.

[0227] eGFP fluorescent expression was quantified using Cytation 10 after 1 hour, 3 hours, 6 hours, 9 hours, 12 hours, 15 hours, 18 hours, 21 hours, 24 hours, 48 hours, and 72 hours.

[0228] Cell Counts and viability readings taken in separate plate after 24hrs using NC-200.

[0229] FIG.3A shows fluorescence intensity (i.e., protein expression levels) as a function of time, for translation of mRNA terminated with various modified NTP, in HeLa cells. FIG.3B shows fluorescence intensity (i.e., protein expression levels) 24 hrs., 48 hrs., and 72 hrs. post transfection of mRNA terminated with different modified NTP, in HeLa cells. Negative control, designated as H2O poly in FIG.3A and FIG.3B was an eGFP encoding mRNA where water is added during the polymerization process instead of a modified NTP. eGFP mRNA (SEQ ID NO:5) with 8-oxoadenosine-5'-triphosphate at the 3’ end is the most promising out of the 11 mRNAs tested. FIG.3C provides the full NTP names for the NTP abbreviations used in FIG.3A and FIG.3B.

[0230] Procedure by Structure Based Design Inc.

[0231] eGFPfluorescence assay:

[0232] On the day of transfection, 500 µL of Expi293F cells in Expi293 expression medium were transferred to each well in a 24-well plate at a concentration of 1.5 x 106 / mL.

[0233] The cells were transfected with Lipofectamine™ MessengerMAX reagent following the manufacturer’s instruction.

[0234] mRNA was diluted to 0.1 µg / µL and used in the next step

[0235] In one tube, for each well to be transfected, 1 µL of mRNA (0.1 µg) was added to 25 µL Opti-MEM® I Reduced Serum.

[0236] In another tube, 0.75 µL of Lipofectamine™ MessengerMAX reagent was added to 25 µL Opti-MEM® I Reduced Serum (for each well to be transfected). The solutionAttorney Docket No.: 095109-001300WO-1513793 was gently mixed and incubated at room temperature for 10 minutes.

[0237] The mixture in tube 1 was combined with mixture of tube 2. The combined mixture was gently mixed and incubated at room temperature for 10 minutes.

[0238] 24-well plates containing the cells, were washed once with 100^L dPBS and the supernatant was aspirated and discarded. ~52 ^L of the mRNA- Lipofectamine™ MessengerMAX complexes (mix of tube 1 and tube 2) were added to each well containing cells.

[0239] At 4, 24, 48 and 72 hours after the transfection, 50 µL of cells were transferred to a well in a 96-well plate for fluorescence quantification, and 50 µL of fresh Expi293 expression medium was added to each well in the 24-well plate containing cells.

[0240] The fluorescence intensity was measured using a Tecan Spark microplate reader at excitation 495 nm and emission 520 nm.

[0241] Each experiment was repeated three times with triplicates each time.

[0242] FIG.4 shows fluorescence intensity (i.e., protein expression levels) 4 hrs., 24 hrs., 48 hrs., and 72 hrs. post transfection of mRNA terminated with different modified NTP, in Expi293F cells. Negative control, indicated as Control eGFP, is an eGFP encoding mRNA where water is added during the polymerization process instead of a modified NTP. eGFP mRNA (SEQ ID NO:4) with N1-methyl-2’-O-methylpseudouridine-5'-triphosphate at the 3’ end is the most promising of the mRNAs tested.

[0243] The detailed description set forth above is provided to aid those skilled in the art in practicing the present invention. However, the invention described and claimed herein is not to be limited in scope by the specific embodiments herein disclosed because these embodiments are intended as illustration of several aspects of the invention. Any equivalent embodiments are intended to be within the scope of this invention. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description which do not depart from the spirit or scope of the present inventive discovery. Such modifications are also intended to fall within the scope of the appended claims. The description is to be read from the perspective of one of ordinary skill in the art; therefore, information well known to the skilled artisan is not necessarily included.

[0244] All publications, patents, patent applications and other references cited in this application are incorporated herein by reference in their entirety for all purposes to the same extent as if each individual publication, patent, patent application or other reference wasAttorney Docket No.: 095109-001300WO-1513793 specifically and individually indicated to be incorporated by reference in its entirety for all purposes. Citation of a reference herein shall not be construed as an admission that such is prior art to the present invention.

Claims

Attorney Docket No.: 095109-001300WO-1513793 WHAT IS CLAIMED IS:

1. An RNA molecule comprising: a) a 5’-cap structure; b) a 5’ untranslated region (5’ UTR); c) an open reading frame (ORF) encoding a polypeptide of interest; d) a 3’ untranslated region (3’ UTR); and e) a poly-A region having a 3’ end, wherein one modified nucleotide triphosphate (NTP) is covalently linked to the 3’ end of the poly-A region.

2. The RNA molecule of claim 1, wherein the modified NTP is covalently linked to the 3’ end of the poly-A region using a polymerase.

3. The RNA molecule of claim 1 or 2, wherein the polymerase is a poly U polymerase.

4. The RNA molecule of any one of claims 1-3, wherein the modified NTP increases the nuclease resistance of the RNA molecule as compared to an RNA molecule without the modified NTP covalently linked to the 3’ end of the poly-A region.

5. The RNA molecule of any one of claims 1-4, wherein the modified NTP comprises a modified phosphate and / or a modified nucleobase and / or a modified sugar.

6. The RNA molecule of any one of claims 1-5, wherein the modified NTP comprises a modified nucleobase.

7. The RNA molecule of claim 5 or 6, wherein the modified nucleobase is a modified uracil, a modified cytosine, a modified guanine, or a modified adenine.

8. The RNA molecule of any one of claims 5-7, wherein the modified nucleobase is pseudouracil (^), 2-thio-uracil, 4-thio-uracil, 4-thio-pseudouridine, 2-thio- pseudouridine, 5-hydroxy-uracil, 5-halo-uracil, 3-methyl-uracil, 5-aza-uracil, or 2- thio-5-aza-uracil.

9. The RNA molecule of any one of claims 5-7, wherein the modified nucleobase is 5- aza-cytosine, 6-aza-cytosine, pseudoisocytidine, 3-methyl-cytosine, 5-methyl- cytosine, 5-halo-cytosine, 2-thio-cytosine, N4-acetyl cytosine, or 2-thio-5-methyl- cytosine.

10. The RNA molecule of any one of claims 5-7, wherein the modified nucleobase is 2- amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, 2-amino-6- methyl-purine, 8-azido-adenine, 7-deaza-adenine, N6-methyl-adenine, or 2- methylthio-N6-methyl-adenine.Attorney Docket No.: 095109-001300WO-1513793 11. The RNA molecule of any one of claims 5-7, wherein the modified nucleobase is inosine, 1-methyl-inosine, 7-cyano-7-deaza-guanine, 7-aminomethyl-7-deaza- guanine, 6-thio-guanine, 6-thio-7-deaza-guanine, or 6-methoxy-guanine.

12. The RNA molecule of any one of claims 1-11, wherein the modified NTP comprises a modified sugar.

13. The RNA molecule of claim 12, wherein the modified sugar comprises a 5-membered ring, a 6-membered ring, or is a modified ribose.

14. The RNA molecule of claim 13, wherein the modified sugar is a modified ribose and wherein the modified ribose is 2 '-thioribose, 2', 3 '-dideoxyribose, 2'-amino-2'- deoxyribose, 2' deoxyribose, 2'- azido-2 '-deoxyribose, 2'-fluoro-2'-deoxyribose, 2'-O- methylribose, 2'-O-methyldeoxyribose, or 3'- amino-2 ',3 '-dideoxyribose.

15. The RNA molecule of claim 13, wherein the modified sugar is a modified ribose and orNTP comprises a morpholino ring.Attorney Docket No.: 095109-001300WO-1513793 17. The RNA molecule of any one of claims 1-16, wherein the modified NTP comprises a modified phosphate.

18. The RNA molecule of claim 17, wherein the modified phosphate is phosphorothioate, phosphorodithioate, thiophosphate, 5'-O-methylphosphonate, 3'-O- methylphosphonate, 5'-hydroxyphosphonate, hydroxyphosphanate, phosphoroselenoate, selenophosphate, phosphoramidate, carbophosphonate, phenylphosphonate, ethylphosphonate, H-phosphonate, guanidinium ring, triazole ring, boranophosphate, methylphosphonate, or guanidinopropyl phosphoramidate.

19. The RNA molecule of any one of claims 1-18, wherein the modified NTP is selected from the group consisting of 2-amino-6-chloropurineriboside-5'-triphosphate, 6- chloropurineriboside-5'-triphosphate, 5-iodocytidine-5'-triphosphate, 5-iodouridine-5'- triphosphate, 2'-O-methyladenosine-5'-triphosphate, 2'-O-methylguanosine-5'- triphosphate, puromycin-5'-triphosphate, 4-thiouridine-5'-triphosphate, 2'-amino-2'- deoxycytidine-5'-triphosphate, 2'-amino-2'-deoxyuridine-5’-triphosphate, 2'-azido-2'- deoxyuridine-5'-triphosphate, 2-thiouridine-5'-triphosphate, arabinoseuridine-5'- triphosphate, 2-thiocytidine-5'-triphosphate, 6-azacytidine-5'-triphosphate, 6- azauridine-5'-triphosphate, 2'-O-methyl-2-aminoadenosine-5'-triphosphate, 2'-O- methylpseudouridine-5'-triphosphate, 2'-O-methyl-5-methyluridine-5'-triphosphate, 2'-azido-2'-deoxyadenosine-5'-triphosphate, 8-azidoadenosine-5'-triphosphate, 5- bromocytidine-5'-triphosphate, 5-bromouridine-5'-triphosphate, 3'-O- methyladenosine-5'-triphosphate, 3'-O-methylcytidine-5'-triphosphate, 3'-O- methylguanosine-5'-triphosphate, 3'-O-methyluridine-5'-triphosphate, 7- deazaadenosine-5'-triphosphate, 5-aminoallyluridine-5'-triphosphate, 2'-azido-2'- deoxyguanosine-5'-triphosphate, 5-aminoallylcytidine-5'-triphosphate, 2- aminopurine-riboside-5'-triphosphate, pseudoisocytidine-5'-triphosphate, N4- methylcytidine-5'-triphosphate, 5,6-dihydro-5-methyl-uridine-5'-triphosphate, 5- carboxycytidine-5'-triphosphate, 5-formylcytidine-5'-triphosphate, 5- hydroxymethylcytidine-5'-triphosphate, 5-hydroxycytidine-5'-triphosphate, 5- formyluridine-5'-triphosphate, 5-carboxyuridine 5'-triphosphate, 5-hydroxyuridine-5'- triphosphate, 5-methoxycytidine-5’-triphosphate, thienouridine-5'-triphosphate, 5- carboxymethylesteruridine-5'-triphosphate, thienocytidine-5'-triphosphate, 8- oxoadenosine-5'-triphosphate, isoguanosine-5'-triphosphate, 2'-O-methyluridine-5'- triphosphate, 2'-O-methylcytidine-5'-triphosphate, 2'-O-methyl-N6-methyladenosine- 5'-triphosphate, guanosine-5'-O-(1-thiotriphosphate), uridine-5'-O-(1-Attorney Docket No.: 095109-001300WO-1513793 thiotriphosphate), N1-propylpseudouridine-5'-triphosphate, N1-methylpseudouridine- 5'-triphosphate, N1-ethylpseudouridine-5'-triphosphate, N1-methyl-2’-O- methylpseudouridine-5'-triphosphate, 5-methylcytidine-5'-triphosphate, N6- methyladenosine-5'-triphosphate, 2'-fluoro-2'-deoxyuridine-5'-triphosphate, 2'-fluoro- 2'-deoxycytidine-5'-triphosphate, 5-methoxyuridine-5'-triphosphate, 5,6- dihydrouridine-5'-triphosphate, 5-methyluridine-5'-triphosphate, 8-oxoguanosine-5'- triphosphate, arabinoseguanosine-5'-triphosphate, 2’,3’-dideoxyadenosine-5'- triphosphate, adenosine-5'-O-(1-thiotriphosphate), 7-deaza-7-aminoethynyl-2’- deoxyadenosine-5'-triphosphate, 2’-deoxyadenosine-5'-triphosphate, 2’-Fluoro-2’- deoxyadenosine-5'-triphosphate, 2’-dexoyadenosine-5'-O-(1-thiotriphosphate), 2- aminoadenosine-5'-triphosphate, 2’,3’-dideoxyguanosine-5'-triphosphate, thienoguanosine-5'-triphosphate, 7-deaza-7-aminoethynyl-2’-deoxyguanosine-5'- triphosphate, 5-aminoethynyl-2’-deoxycytidine-5'-triphosphate, 5-aminoethynyl-2’, 3’-dideoxycytidine-5'-triphosphate, 5-aminoethynyl-2’-deoxyuridine-5'-triphosphate, N1-methoxymethylpseudouridine-5'-triphosphate, and N1-methyladenosine-5'- triphosphate.

20. The RNA molecule of claim 19, wherein the modified NTP is selected from the group consisting of 2’-deoxyadenosine-5'-triphosphate, 2'-O-methylguanosine-5'- triphosphate, 8-oxoguanosine-5'-triphosphate, 6-azacytidine-5'-triphosphate, 2'-O- methyl-2-aminoadenosine-5'-triphosphate, 2'-O-methylguanosine-5'-triphosphate, arabinoseuridine-5'-triphosphate, 2'-O-methylcytidine-5'-triphosphate, 8- oxoadenosine-5'-triphosphate, 2'-amino-2’-deoxycytidine-5'-triphosphate, arabinoseguanosine-5'-triphosphate, and 6-azauridine-5'-triphosphate.

21. The RNA molecule of claim 19, wherein the modified NTP is selected from the group consisting of 2'-O-methyl-2-aminoadenosine-5'-triphosphate, 8-oxoadenosine-5'- triphosphate, 2'-amino-2'-deoxycytidine-5'-triphosphate, 2'-O-methylcytidine-5'- triphosphate, 6-azacytidine-5'-triphosphate, N1-methylpseudouridine-5'-triphosphate, N1-methyl-2’-O-methylpseudouridine-5'-triphosphate, 2'-O-methylguanosine-5'- triphosphate, 3'-O-methylguanosine-5'-triphosphate, 6-azauridine-5'-triphosphate, and 8-oxoguanosine-5'-triphosphate.

22. The RNA molecule of any one of claims 1-21, wherein the poly-A region is 10 or greater nucleotides in length.

23. The RNA molecule of any one of claims 1-21, wherein the poly-A region is 30 or greater nucleotides in length.Attorney Docket No.: 095109-001300WO-1513793 24. The RNA molecule of any one of claims 1-21, wherein the poly-A region is 70 or greater nucleotides in length.

25. The RNA molecule of any one of claims 1-21, wherein the poly-A region is 100 or greater nucleotides in length.

26. The RNA molecule of any one of claims 1-21, wherein the poly-A region is from 2 to 500 nucleotides in length.

27. The RNA molecule of any one of claims 1-21, wherein the poly-A region is from 5 to 250 nucleotides in length.

28. The RNA molecule of any one of claims 1-21, wherein the poly-A region is from 10 to 200 nucleotides in length.

29. The RNA molecule of any one of claims 1-21, wherein the poly-A region is from 15 to 150 nucleotides in length.

30. The RNA molecule of any one of claims 1-29, wherein the RNA molecule is a messenger RNA (mRNA).

31. A cell comprising an RNA molecule of any one of claims 1-30, optionally wherein the cell is isolated.

32. A cell comprising a protein or a peptide translated from an RNA molecule of any one of claims 1-30, optionally wherein the cell is isolated.

33. A pharmaceutical composition comprising an RNA molecule of any one of claims 1- 30 and a pharmaceutically acceptable carrier.

34. The pharmaceutical composition of claim 33, wherein the pharmaceutically acceptable carrier is a solvent, dispersion media, diluent, surface active agent, isotonic agent, thickening or emulsifying agent, lipid, liposome, nanoparticle, lipid nanoparticle (LNP), polymer, lipoplex, protein, or a mixture thereof.

35. The pharmaceutical composition of claim 34, wherein the pharmaceutically acceptable carrier is an LNP.

36. A pharmaceutical composition comprising a cell comprising an RNA molecule of any one of claims 1-30.

37. A method of increasing the expression of a protein or a peptide of interest in a cell, comprising contacting the cell with the RNA molecule of any one of claims 1-30, wherein the RNA molecule encodes the protein or peptide of interest, wherein the expression is increased when compared to that of an RNA molecule without the modified NTP at the 3’ end of the poly-A region, optionally wherein the cell is isolated, in vitro, or ex vivo.Attorney Docket No.: 095109-001300WO-1513793 38. A method of expressing a protein or a peptide of interest in a cell, comprising contacting the cell with the RNA molecule of any one of claims 1-30, wherein the RNA molecule encodes the protein or peptide of interest and the cell translates the protein or peptide of interest from the RNA molecule, optionally wherein the cell is isolated, in vitro, or ex vivo.

39. A method of increasing the half-life of an RNA molecule in a cell comprising contacting the cell with the RNA molecule of any one of claims 1-30, wherein the half-life is increased when compared to that of an RNA molecule without the modified NTP at the 3’ end of the poly-A region, optionally wherein the cell is isolated, in vitro, or ex vivo.

40. A method of preparing the RNA molecule of any one of claims 1-30, comprising covalently linking a modified NTP to the 3’end of the poly-A region of an RNA molecule comprising providing an RNA molecule comprising: a) a 5’-cap structure; b) a 5’ untranslated region (5’ UTR); c) an open reading frame (ORF) encoding a polypeptide of interest; d) a 3’ untranslated region (3’ UTR); and e) a poly-A region having a 3’ end, and covalently linking one modified NTP to the 3’ end of the poly-A region of the RNA molecule.

41. The method of claim 40, wherein the modified NTP is linked to the 3’end of the poly- A region of an RNA molecule using a polymerase.

42. The method of claim 41, wherein the polymerase is a poly U polymerase.

43. A method of treating a disease in a subject in need thereof comprising introducing an effective amount of the RNA molecule of any one of claims 1-30, the cell of claim 31 or 32, or the pharmaceutical composition of any one of claims 33-36.

44. A method of preventing a disease in a subject in need thereof comprising introducing an effective amount of the RNA molecule of any one of claims 1-30, the cell of claim 31 or 32, or the pharmaceutical composition of any one of claims 33-36.

45. The RNA molecule of any one of claims 1-30, the cell of claim 31 or 32, or the pharmaceutical composition of any one of claims 33-36 for use in therapy.

46. Use of the RNA molecule of any one of claims 1-30, the cell of claim 31 or 32, or the pharmaceutical composition of any one of claims 33-36 for the manufacture of a medicament.

Images