Polynucleic acid molecules targeting inhbe and uses thereof
Patent Information
- Application Number
- PCT/US2025/036035
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-04-30
- Filing Date
- 2025-07-01
- Publication Date
- 2026-02-12
AI Technical Summary
Current methods lack effective inhibitors for modulating the expression of Inhibin Subunit Beta E (INHBE), which is associated with metabolic disorders and cardiometabolic diseases, necessitating a more targeted approach to reduce the risk of these conditions.
Development of polynucleic acid molecules, including siRNAs with specific nucleic acid sequences, that modulate INHBE expression by hybridizing to targeted regions of INHBE mRNA, optionally conjugated with asialoglycoprotein receptor targeting moieties, to effectively regulate INHBE gene expression.
The polynucleic acid molecules provide a targeted mechanism to reduce INHBE expression, potentially preventing or alleviating metabolic disorders and cardiometabolic diseases by specifically modulating INHBE gene activity.
Smart Images

Figure US2025036035_12022026_PF_FP_ABST
Abstract
Description
POLYNUCLEIC ACID MOLECULES TARGETING INHBE AND USES THEREOFCROSS-REFERENCE
[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 667,524, filed on July 3, 2024, and U.S. Provisional Application No. 63 / 797,373, filed on April 30, 2025, each of which is incorporated herein by reference in its entirety.BACKGROUND OF THE DISCLOSURE
[0002] Inhibin subunit beta E (INHBE) is a member of the TGF-beta (transforming growth factorbeta) superfamily. INHBE is predominantly expressed in the liver. Increased expression of INHBE has been reported in mice model of a metabolic disorder. Targeting INHBE can be one approach to reduce risk of metabolic disorder and / or cardiometabolic disease.INCORPORATION BY REFERENCE
[0003] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.To the extent publications and patents or patent applications incorporated by reference contradict the disclosure contained in the specification, the specification is intended to supersede and / or take precedence over any such contradictory material.SUMMARY OF THE DISCLOSURE
[0004] To meet the need for a more effective INHBE inhibitor, disclosed herein, in certain aspects, are polynucleic acid molecules for modulating expression of Inhibin Subunit Beta E (INHBE) gene, wherein the polynucleic acid molecule comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence selected from Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, and Table 18.
[0005] In some instances, the polynucleic acid molecule is a single-stranded nucleic acid molecule. In some instances, the single-stranded nucleic acid molecule comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 1-328, 1319-1331, 1371-1383, and 1423-1432. In some instances, the single-stranded nucleic acid molecule comprises at least 15, 16, 17, 18, 19 consecutive nucleotides of the nucleic acid sequence selected from SEQ ID NOs: 1-328, 1319-1331, 1371-1383, and 1423-1432, with no more than 1, 2, 3, or 4 mismatches.
[0006] In some instances, the polynucleic acid molecule is a double-stranded nucleic acid molecule comprising a passenger strand and a guide strand.
[0007] In some instances, the guide strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 1-328, 1319-1331, 1371-1383, and 1423-1432. In some instances, the guide strand comprises a nucleic acid sequence that is at least 15, 16, 17, 18, 19 consecutive nucleotides of the nucleic acid sequence selected from SEQ ID NOs: 1-328, 1319-1331, 1371-1383, and 1423-1432, with no more than 1, 2, 3, or 4 mismatches.
[0008] In some instances, the passenger strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 331-658, 1332-1344, 1384-1396, and 1433-1443. In some instances, the passenger strand comprises a nucleic acid sequence that is at least 15, 16, 17, 18, 19 consecutive nucleotides of the nucleic acid sequence selected from SEQ ID NOs: 331-658, 1332-1344, 1384-1396, and 1433-1443, with no more than 1, 2, 3, or 4 mismatches.
[0009] In some instances, the polynucleic acid molecule comprises (1) a 2’ -fluoro modified nucleotides; (2) a 2’-O-methyl modified nucleotides; (3) 2’-deoxy modified nucleotides, or (4) a modified internucleotide linkage. In some instances, the modified internucleotide linkage is a phosphorothioate internucleotide linkage or a phosphorodithioate intemucleotide linkage. In some instances, the polynucleic acid molecule comprises the phosphorothioate internucleotide linkage located between the two nucleotides at position 11 and 12 from the 5’ end of the guide strand. In some instances, the polynucleic acid molecule comprises the phosphorodithioate internucleotide linkage located between the two nucleotides at position 11 and 12 from the 5’ end of the guide strand. In some instances, the modified intemucleotide linkage comprises a stereochemically enriched phosphorothioate intemucleotide linkage.
[0010] In some instances, the passenger strand comprises 5’ - nnnnnnNfnNfnNfnnnnnnnnnn -3’, wherein the guide strand comprises 5’- nNfnnnnNfnnnnNfnNfnNfnnnnnnn -3’, wherein “Nf” stands for a 2’-fluoro modified nucleotide, and “n” stands for a 2’-O-methyl modified nucleotide. In some instances, the passenger strand comprises 5’ - nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein the guide strand comprises 5’-_nsNfsnnnnNfnnnnNfnNfnNfnnnnnsnsn -3’, wherein “Nf’ stands for a 2’-fluoro modified nucleotide, “n” stands for a 2’-O-methyl modified nucleotide, and “s” stands for phosphorothioate intemucleotide linkage.
[0011] In some instances, the guide strand comprises a nucleotide analogue selected from a group consisting of acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’-phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i).
[0012] In some instances, the nucleotide analogue is located at the seed region of the guide strand (positions 2-8) from the 5’ end.
[0013] In some instances, the passenger strand comprises 5'- nsnsnnnnNfnNfnNfnnnnnnnnnn -3', and the guide strand comprises 5'- nsNfsnnnnXnnnnssNfnNfnNfnnnnnsnsn -3', wherein "Nf ' stands for a 2'-fluoro modified nucleotide, "n" stands for a 2'-O-methyl modified nucleotide, "s" stands for phosphorothioate internucleotide linkage, “ss” stands for phosphorodithioate internucleotide linkage, and “X” stands for a nucleotide analogue. In some instances, the passenger strand comprises 5'- nsnsnnnnNfnNfnNfnnnnnnnnnn -3', and the guide strand comprises 5'- nsNfsnnnnXnnnnNfnNfnNfnnnnnsnsn -3', wherein "Nf ' stands for a 2'-fluoro modified nucleotide, "n" stands for a 2'-O-methyl modified nucleotide, "s" stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue. In some instances, the passenger strand comprises 5'- nsnsnnnnNfnNfnNfnnnnnnnnnn -3', wherein the guide strand comprises 5'- nsNfsnnnnXnnnnsNfnNfnNfnnnnnsnsn -3', wherein "Nf1stands for a 2'-fluoro modified nucleotide, "n" stands for a 2'-O-methyl modified nucleotide, "s" stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue.
[0014] In some instances, the guide strand comprises a vinyl phosphonate modified nucleotide at the 5’ end. In some instances, the vinyl phosphonate modified nucleotide is 5 ’(E) vinylphosphonate-2’-O-methoxy-ethyl-5-methyluridine-3’-phosphate (vpt4) or 5'(E) vinylphosphonate-2-O-methyluridine-3 'phosphate (vpu).
[0015] In some instances, the guide strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 661-988, 1345-1357, 1397-1409, and 1444-1462. In some instances, the guide strand comprises a nucleic acid sequence that is at least 15, 16, 17, 18, 19 consecutive nucleotides of the nucleic acid sequence selected from SEQ ID NOs: 661-988, 1345-1357, 1397-1409, and 1444- 1462, with no more than 1, 2, 3, or 4 mismatches.
[0016] In some instances, the passenger strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 991-1318, 1358-1370, 1410-1422, and 1463-1475. In some instances, the passenger strand comprises a nucleic acid sequence that is at least 15, 16, 17, 18, 19 consecutive nucleotides of the nucleic acid sequence selected from SEQ ID NOs: 991-1318, 1358-1370, 1410-1422, and 1463-1475, with no more than 1, 2, 3, or 4 mismatches.
[0017] In some instances, the polynucleic acid molecule is 19-25 nucleotides in length. In some instances, the polynucleic acid molecule is 21-23 nucleotides in length.
[0018] In some instances, the guide stand comprises or consists of a nucleic acid sequence selected from SEQ ID NO: 661-988, 1345-1357, 1397-1409, and 1444-1462, and the passenger stand comprises or consists of a nucleic acid sequence selected from SEQ ID NO: 991-1318, 1358-1370, 1410-1422, and 1463-1475.
[0019] In one aspect, provided herein is a polynucleic acid molecule (e.g., siRNA) for modulating expression of inhibin subunit beta E (INHBE) gene, comprising:(a) a guide strand comprising a nucleic acid sequence of UAUCGGAAGAUCCUCAAGCACAG (SEQ ID NO: 1379) and a passenger strand comprising a nucleic acid sequence of GUGCUUGAGGAUCUUCCGAUA (SEQ ID NO: 1392); or(b) a guide strand comprising a nucleic acid sequence of UUAUGAUCCAGGUAGAGGAGAGA (SEQ ID NO: 1429) and a passenger strand comprising a nucleic acid sequence of UCUCCUCUACCUGGAUCAUAA (SEQ ID NO: 1437).
[0020] In another aspect, provided herein is a polynucleic acid molecule (e.g., siRNA) for modulating expression of inhibin subunit beta E (INHBE) gene, comprising:(a) a guide strand comprising a nucleic acid sequence of usUfsaugaUfccagGfuAfgAfggagasgsa (SEQ ID NO: 1451) and a passenger strand comprising a nucleic acid sequence of uscsuccuCfuAfcCfuggaucauaa (SEQ ID NO: 1468);(b) a guide strand comprising a nucleic acid sequence of usUfsaugaUfccagGfuAfgAfggagasgsa (SEQ ID NO: 1451) and a passenger strand comprising a nucleic acid sequence of uscsuccuCfuAfcCfuggaucauaa (SEQ ID NO: 1473);(c) a guide strand comprising a nucleic acid sequence of usUfsaugaUfccagssGfuAfgAfggagasgsa (SEQ ID NO: 1458) and a passenger strand comprising a nucleic acid sequence of uscsuccuCfuAfcCfuggaucauaa (SEQ ID NO: 1473);(d) a guide strand comprising a nucleic acid sequence of vpusUfsaugaUfccagssGfuAfgAfggagasgsa (SEQ ID NO: 1459) and a passenger strand comprising a nucleic acid sequence of uscsuccuCfuAfcCfuggaucauaa (SEQ ID NO: 1473);(e) a guide strand comprising a nucleic acid sequence of usAfsucgg(T-A)agaussCfcUfcAfagcacsasg (SEQ ID NO: 1461) and a passenger strand comprising a nucleic acid sequence of gsusgcuuGfaGfgAfucuuccgaua (SEQ ID NO: 1475);(f) a guide strand comprising a nucleic acid sequence of usAfsucgg(T-A)agauCfcUfcAfagcacsasg (SEQ ID NO: 1405) and a passenger strand comprising a nucleic acid sequence of gsusgcuuGfaGfgAfucuuccgaua (SEQ ID NO: 1475);(g) a guide strand comprising a nucleic acid sequence of usAfsucgg(T-A)agausCfcUfcAfagcacsasg (SEQ ID NO: 1462) and a passenger strand comprising a nucleic acid sequence of gsusgcuuGfaGfgAfucuuccgaua (SEQ ID NO: 1475); or(h) a guide strand comprising a nucleic acid sequence of usAfsucgg(T-A)agauCfcUfcAfagcacsasg (SEQ ID NO: 1405) and a passenger strand comprising a nucleic acid sequence of gsusgcuuGfaGfgAfucuuccgaua (SEQ ID NO: 1418), wherein “A” refers to adenosine-3’ -phosphate; “a” refers to 2’-O-methyladenosine-3’-phosphate; “Af’ refers to 2’ -fluoroadenosine-3 ’ -phosphate; “C” refers to cytidine-3’ -phosphate; “c” refers to 2’-O-methylcytidine-3 ’-phosphate; “Cf” refers to 2’-fluorocytidine-3 ’-phosphate; “G” refers to guanosine-3 ’-phosphate; “g” refers to 2’-O-methylguanosine-3’-phosphate; “Gf” refers to 2’- fluoroguanosine-3 ’-phosphate; “U” refers to uridine-3’ -phosphate; “u” refers to 2’-O- methyluridine-3 ’ -phosphate; “Uf” refers to 2’ -fluorouridine-3 ’-phosphate; “T” refers to 5- methyluridine-3 ’ -phosphate; “t” refers to 2’-O-methyl-5-methyluridine-3’-phosphate; “Tf” refers to 2’-fluoro-5-methyluridine-3’-phosphate; "(T-A)" refers to acyclic L-threoninol nucleic acid- adenine-3 '-phosphate; "s" refers to phosphorothioate internucleotide linkage; “ss” refers to phosphorodithioate intemucleotide linkage; and "vpu" refers to 5 ’(E) vinylphosphonate-2-O- methyluridine-3 ’phosphate.
[0021] In another aspect, the present disclosure provides a polynucleic acid molecule conjugate for modulating expression of Inhibin Subunit Beta E (INHBE) gene, wherein the polynucleic acid molecule conjugate comprises a polynucleic acid molecule described herein and an asialoglycoprotein receptor targeting moiety. In some instances, the asialoglycoprotein receptor targeting moiety comprises N-Acetylgalactosamine (GalNAc) or galactose. In some instances, the polynucleic acid molecule and the asialoglycoprotein receptor targeting moiety is coupled via a linker. In some instances, the linker comprises formula (IV) below,wherein at least one of Y1 and Y2 is a nucleotide in the polynucleicacid molecule; wherein the is connected to the asialoglycoprotein receptor targeting moiety.
[0022] In some instances, the Y1 is the last nucleotide on the 3’ end of the passenger strand of the polynucleic acid molecule. In some instances, the Y1 and Y2 are two consecutive nucleotides in the polynucleic acid molecule.
[0023] In some instances, the asialoglycoprotein receptor targeting moiety comprises N- Acetylgalactosamine (GalNAc). In some instances, the linker and the asialoglycoprotein receptor targeting moiety with the last nucleotide on the 3’ end of the passenger strand of the polynucleic acid molecule are shown in :wherein Z in formula (V’), (VI”), or (VI’”) is -H, -OH, -O-Methyl, -F, or -O-m ethoxy ethyl; R in formula (V’), (VI”), or (VI’”) is adenine, uracil, guanine, cytosine, thymine, abasic, or others; and the is to connect to an adjacent nucleotide of the polynucleic acid molecule.
[0024] In one aspect, the present disclosure provides a pharmaceutical composition comprising a polynucleic acid molecule described herein, or a polynucleic acid molecule conjugate described herein, and a pharmaceutically acceptable excipient. In some instances, the pharmaceutical composition is formulated as a nanoparticle formulation. In some instances, the pharmaceutical composition is formulated for parenteral, oral, intranasal, buccal, rectal, transdermal, intravenous, subcutaneous, or intrathecal administration.
[0025] In another aspect, the present disclosure provides a method of modulating expression of Inhibin Subunit Beta E (INHBE) gene in a subject by administering to the subject a polynucleic acid molecule described herein or a polynucleic acid molecule conjugate described herein, or a pharmaceutical composition described herein, thereby modulating the expression of INHBE gene in the subject.
[0026] In various aspects, the present disclosure provides a method of preventing, alleviating, or treating INHBE-associated disease or symptom thereof in a subject in need thereof by administering to the subject a polynucleic acid molecule described herein or a polynucleic acid molecule conjugate described herein, or a pharmaceutical composition described herein, thereby modulating the INHBE expression level in the subject.
[0027] In some instances, the disease associated with INHBE comprises a metabolic syndrome, a cardiometabolic disease, an non-alcoholic fatty liver disease, and obesity.BRIEF DESCRIPTION OF THE DRAWINGS
[0028] Various aspects of the disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative aspects, in which the principles of the disclosure are utilized, and the accompanying drawings below.
[0029] FIG. 1 depicts relative expression of INHBE from cynomolgus monkey liver biopsy samples as described in Example 2.
[0030] FIG. 2 depicts relative expression of INHBE from cynomolgus monkey liver biopsy samples as described in Example 3.
[0031] FIG. 3 depicts relative expression of INHBE from cynomolgus monkey liver biopsy samples as described in Example 4.
[0032] FIG. 4 depicts relative expression of INHBE from cynomolgus monkey liver biopsy samples as described in Example 6.
[0033] FIG. 5 depicts relative expression of INHBE from cynomolgus monkey liver biopsy samples as described in Example 7.
[0034] FIG. 6 depicts relative expression of INHBE from cynomolgus monkey liver biopsy samples as described in Example 10.DETAILED DESCRIPTION OF THE DISCLOSURE
[0035] Obesity is positively associated with increased risk of many diseases, e.g., cardiovascular diseases or metabolic disorder. Inhibin beta subunit E or INHBE is a member of the TGF-beta (transforming growth factor-beta) super family and encodes a secreted protein, the hepatokine activin E. In human, rare loss-of-function variants of INHBE (activin E) are associated with reduced abdominal obesity, lower waist-to-hip ratio, and reduced risk from metabolic disorder, e.g., type 2 diabetes. INHBE may also play an important role in metabolic disorders, e.g., type 2 diabetes or lipid metabolic disorder, body weight associated disorder, and / or cardiovascular disease. Thus, targeting INHBE can be one approach to reduce risk of metabolic disorder and / or cardiometabolic disease.
[0036] Described herein is a polynucleic acid molecule for modulating expression of inhibin beta subunit E (INHBE) gene, wherein the polynucleic acid molecule comprises a passenger strand and a guide strand, and wherein the polynucleic acid molecule comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical, or 100% identical to a nucleic acid sequence in Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18. Accordingly, provided herein are various target regions of human INHBE mRNA thepolynucleic acid molecule described herein hybridizes to. In some embodiments, provided herein is the sequences of the polynucleic acid molecule described herein. In some embodiments, provided herein is the modifications of the polynucleic acid molecule described herein. In some embodiments, provided herein is the conjugates of the polynucleic acid molecule with a targeting ligand described herein.
[0037] Also described herein is a method of modulating expression of inhibin beta subunit E (INHBE) gene in a subject.Definitions
[0038] The singular form “a”, “an”, and “the” include plural references unless the context clearly dictates otherwise. For example, the term “a cell” includes one or more cells, including mixtures thereof. “A and / or B” is used herein to include all of the following alternatives: “A”, “B”, “A or B”, and “A and B.”
[0039] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure.
[0040] Certain ranges are presented herein with numerical values being preceded by the term “about.” The term “about” is used herein to provide literal support for the exact number that it precedes, as well as a number that is near to or approximately the number that the term precedes. In determining whether a number is near to or approximately a specifically recited number, the near or approximating unrecited number may be a number which, in the context in which it is presented, provides the substantial equivalent of the specifically recited number.
[0041] “Percent (%) sequence identity” or “Percent (%) identity” with respect to the nucleic acid sequences identified herein is defined as the percentage of nucleic acid in a candidate sequence that are identical with the nucleic acid sequence being compared, after aligning the sequences considering any conservative substitutions as part of the sequence identity.
[0042] All ranges disclosed herein also encompass any and all possible sub-ranges and combinations of sub-ranges thereof. Any listed range can be recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths,tenths, and so forth. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, and the like. As will also be understood by one skilled in the art all language such as “up to,” “at least,” “greater than,” “less than,” and the like include the number recited and refer to ranges which can be subsequently broken down into subranges as discussed above. Finally, as will be understood by one skilled in the art, a range includes each individual member. Thus, for example, a group having 1-3 articles refers to groups having 1, 2, or 3 articles. Similarly, a group having 1-5 articles refers to groups having 1, 2, 3, 4, or 5 articles, and so forth.
[0043] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the polynucleic acid molecules, the polynucleic acid molecule conjugates, the pharmaceutical compositions, the methods and other aspects belong.
[0044] As used herein, the term “complementary” indicates a sufficient degree of complementarity between two nucleic acid molecules that bind stably and specifically to avoid nonspecific binding.
[0045] As used herein, the term “polynucleic acid” and the term “polynucleotide” are interchangeably used to refer a chain of nucleotides. The term “nucleotide” includes a sequence “G,” “C,” “A,” “T” and “U” each generally stand for a nucleotide that contains guanine, cytosine, adenine, thymidine and uracil as a base. In some instances, the “nucleotide” can refer to a modified nucleotide (e.g., with modified sugar moiety, modified base, modified internucleotide linkage, or combination thereof, including, but not limited to 2’-modified nucleotide, LNA, ENA, BNA, UNA, GNA etc.) In some instances, the “nucleotide” can refer to a modified nucleotide with a non- canonical base (e.g. including, but not limited to, 2-thiouridine, 2-thiothymidine, inosine, 2- aminopurine, 2,6-diaminopurine, dihydrouridine, 4-thiouridine, 4-thiothymidine, 2-thiocytidine).
[0046] As used herein, a “subject” can be any mammal, including a human and a non-human primate.
[0047] The term “condition,” as used herein, includes diseases, disorders, and susceptibilities. In some cases, the condition is an INHBE related disorder or symptoms thereof.
[0048] As used herein, the term “treat,” “treating” or “treatment” of any disease or disorder refers, in one instance, to ameliorating the disease or disorder (i.e., slowing or arresting or reducing the development of the disease or at least one of the clinical symptoms thereof). In another instance, “treat”, “treating” or “treatment” refers to alleviating or ameliorating at least one physical parameter including those which may not be discernible by the patient. In yet another instance, “treat”, “treating” or “treatment” refers to modulating the disease or disorder, either physically,(e.g., stabilization of a discernible symptom), physiologically, (e.g., stabilization of a physical parameter), or both.
[0049] The terms “prevent,” “preventing,” and “prevention,” as used herein, refer to a decrease in the occurrence of pathology of a condition in a subject, who does not have, but is at risk of or susceptible to developing a disease or condition. The prevention may be complete, e.g., the total absence of pathology of a condition in a subject. The prevention may also be partial, such that the occurrence of pathology of a condition in a subject is less than that which would have occurred without the present disclosure.
[0050] “Administering” and its grammatical equivalents as used herein can refer to providing pharmaceutical compositions described herein to a subject or a patient. Conventional methods, known to those of ordinary skill in the art of medicine, can be used to administer the composition to the subject, depending upon the type of disease to be treated or the site of the disease. For example, the composition can be administered, e.g., orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally, via an implanted reservoir, or via infusion. One or more such routes can be employed.
[0051] The terms “pharmaceutical composition” and its grammatical equivalents as used herein can refer to a mixture or solution comprising a therapeutically effective amount of an active pharmaceutical ingredient together with one or more pharmaceutically acceptable excipients, carriers, and / or a therapeutic agent to be administered to a subject, e.g., a human in need thereof.
[0052] The term “pharmaceutically acceptable” and its grammatical equivalents as used herein can refer to an attribute of a material which is useful in preparing a pharmaceutical composition that is generally safe, non-toxic, and neither biologically nor otherwise undesirable and is acceptable for veterinary as well as human pharmaceutical use. “Pharmaceutically acceptable” can refer a material, such as a carrier or diluent, which does not abrogate the biological activity or properties of the compound, and is relatively nontoxic, i.e., the material may be administered to a subject without causing undesirable biological effects or interacting in a deleterious manner with any of the components of the pharmaceutical composition in which it is contained.
[0053] A “pharmaceutically acceptable excipient” refers to an excipient that can be administered to a subject, together with an agent, and which does not destroy the pharmacological activity thereof and is nontoxic when administered in doses sufficient to deliver a therapeutic amount of the agent.
[0054] The term “therapeutic agent” can refer to any agent that, when administered to a subject, has a therapeutic, diagnostic, and / or prophylactic effect and / or elicits a desired biological and / or pharmacological effect. Therapeutic agents can also be referred to as “actives” or “active agents.”Such agents include, but are not limited to, cytotoxins, radioactive ions, chemotherapeutic agents, small molecule drugs, proteins, and nucleic acids.
[0055] As used herein, the term “sense strand” can be interchangeably used with the term “passenger strand”, and the tern “antisense strand” can be interchangeably used with the term “guide strand”. In some instances, a nucleic acid sequence described herein for a sense strand and a passenger strand can be interchangeably used. Also, in some instances, a nucleic acid sequence described herein for an antisense strand and a guide strand can be interchangeably used.
[0056] As used herein, the term “consecutive sequence” or “consecutive nucleotide” refers to a sequence contains a number of consecutive nucleotides from a reference sequence. For example, if a reference sequence is N1N2N3N4N5N6N7, a consecutive sequence can be N1N2N3N4 or N3N4N5N6, but a sequence of N1N3N4N5 or N3N4N7 cannot be a consecutive sequence.
[0057] As used herein, the term “negative control” refers to a subject or a cell receiving no treatment or placebo.
[0058] It is appreciated that certain features of the polynucleic acid molecules, and / or polynucleic acid molecule conjugates, pharmaceutical composition comprising the polynucleic acid molecules or the polynucleic acid molecule conjugates, methods and other aspects, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the polynucleic acid molecules, and / or polynucleic acid molecule conjugates, pharmaceutical composition comprising the polynucleic acid molecules or the polynucleic acid molecule conjugates, methods and other aspects, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. All combinations of the embodiments are specifically embraced by the present disclosure and are disclosed herein just as if each and every combination was individually and explicitly disclosed, to the extent that such combinations embrace operable processes and / or compositions. In addition, all sub-combinations listed in the embodiments describing such variables are also specifically embraced by the present polynucleic acid molecules, and / or polynucleic acid molecule conjugates, pharmaceutical composition comprising the polynucleic acid molecules or the polynucleic acid molecule conjugates, methods and other aspects and are disclosed herein just as if each and every such sub-combination was individually and explicitly disclosed herein.Polynucleic Acid MoleculesTarget Regions of Polynucleic Acid Molecules
[0059] Described herein is a polynucleic acid molecule for modulating expression of inhibin beta subunit E (INHBE) gene. In some aspects, the polynucleic acid molecule is a single-stranded nucleic acid molecule that hybridizes to certain regions of mRNA. In some aspects, the polynucleic acid molecule is a double-stranded nucleic acid molecule. In some instances, the polynucleic acid molecule comprises a passenger strand (a sense strand) and a guide strand (an antisense strand), and wherein the guide strand hybridizes to certain regions of INHBE mRNA.
[0060] In some aspects, the polynucleic acid molecule described herein hybridizes to certain regions of human INHBE mRNA. In some aspects, the polynucleic acid molecule described herein hybridizes to certain regions of non-human INHBE mRNA.
[0061] In some aspects, the polynucleic acid molecule described herein hybridizes to the 5’ UTR region of human INHBE mRNA. In some aspects, the polynucleic acid molecule described herein hybridizes to the coding region of human INHBE mRNA. Human INHBE gene (NCBI Reference Sequence: NM_031479.5) contains 2 exons and 1 introns. Accordingly, in some aspects, the polynucleic acid molecule described herein hybridizes to the coding region in exon 1 of human INHBE mRNA. In some aspects, the polynucleic acid molecule described herein hybridizes to exon 2 of human INHBE mRNA. In some aspects, the polynucleic acid molecule described herein hybridizes to the 3’ UTR region of human INHBE mRNA. In some aspects, the polynucleic acid molecule described herein hybridizes to human INHBE mRNA (NCBI Reference Sequence: NM_03 1479.5) with a range of transcription starting sites specified in Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18. In some aspects, the polynucleic acid molecule described herein hybridizes to human INHBE mRNA (NCBI Reference Sequence: NM_03 1479.5)
[0062] In some aspects, the target region that the polynucleic acid molecule described herein hybridizes to is determined by an algorithm that predicts the maximal INHBE silencing effectiveness and lowest possible off-target effects. In some specific embodiment, the algorithm is disclosed in He et al., 2017, Scientific Reports, 7, 44836. In some specific embodiment, the algorithm is disclosed in Han et al., 2018, BMC Genomics 19, 669. In some specific embodiment, the algorithm is siRNArules, siRNA-Finder, siRNA Wizard™, siDirect, sirna wizard, Dharmacon siRNA designing tool, White head siRNA designing tool, or Genscript siRNA software.
[0063] In some instances, the target region is from positions 339-387 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 400-436 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances,the target region is from positions 501-553 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 630-677 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 705-808 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 821-914 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 973-1009 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 1035-1063 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 1100-1155 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 1202-1262 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 1296-1336 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 1347-1491 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 1513-1580 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 1609-1697 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 1784-1845 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 1854-1889 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 2163-2188 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 2246-2319 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 2346-2371 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 2403-2456 of human INHBE mRNA (NM_031479.5) counting from the 5’ end.
[0064] In some instances, the target region is from positions 632-655 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 644-667 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 875-898 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 1107-1130 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 1202-1225 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 1209-1232 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 1302-1325 ofhuman INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 1310-1333 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 1862-1885 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 2296-2319 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 2347-2370 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 2348-2371 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 2403-2426 of human INHBE mRNA (NM_031479.5) counting from the 5’ end.
[0065] In some instances, the target region is from positions 407-430 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 937-996 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 1296-1319 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 1348-1371 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 1514-1537 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 1670-1693 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 1786-1809 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 1810-1833 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 2164-2187 of human INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the target region is from positions 1303-1326 of human INHBE mRNA (NM_031479.5) counting from the 5’ end.
[0066] In some instances, the polynucleic acid molecule hybridizes to nucleotides at positions 339- 387, 400-436, 501-553, 630-677, 705-808, 821-914, 973-1009, 1035-1063, 1100-1155, 1202-1262, 1296-1336, 1347-1491, 1513-1580, 1609-1697, 1784-1845, 1854-1889, 2163-2188, 2246-2319, 2346-2371, or 2403-2456 of INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the polynucleic acid molecule hybridizes to nucleotides at positions 632-655, 644-667, 875-898, 1107-1130, 1202-1225, 1209-1232, 1302-1325, 1310-1333, 1862-1885, 2296-2319, 2347- 2370, 2348-2371, or 2403-2426 of INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, the polynucleic acid molecule hybridizes to nucleotides at positions 407-430, 937- 996, 1296-1319, 1348-1371, 1514-1537, 1670-1693, 1786-1809, 1810-1833, 2164-2187, or 1303- 1326 of INHBE mRNA (NM_031479.5) counting from the 5’ end. In some instances, thepolynucleic acid molecule hybridizes to nucleotides at positions 644-667 or 1202-1225 of INHBE mRNA (NM_031479.5) counting from the 5’ end.
[0067] In some instances, the polynucleic acid molecule hybridizes to a subregion of the target gene (e.g., NM_031479.5) and comprises a nucleic acid sequence that are 80%, 85%, 90%, 95%, 98%, or 100% complementary to the subregion in its at least 80%, 85%, 90%, 95%, or 100% of its entire length. In some instances, the polynucleic acid molecule hybridizes to a subregion of the target gene (e.g., NM_031479.5) and comprises a nucleic acid sequence having at least 16, 17, 18, 19, or 20 consecutive nucleotide sequences that are fully complementary to the subregion.Structure of Polynucleic Acid MoleculesSingle-stranded nucleic acid molecule
[0068] Described herein is a polynucleic acid molecule for modulating expression of INHBE gene, wherein the polynucleic acid molecule single-stranded nucleic acid molecule that is reverse complementary to the target region of INHBE mRNA as described above.
[0069] In some aspects, the polynucleic acid molecule described herein is not 100% complementary to the target region of INHBE mRNA. Accordingly, in some instances, the polynucleic acid molecule described herein is about 95% complementary to the target region of INHBE mRNA. In some aspects, the polynucleic acid molecule described herein is about 90% complementary to the target region of INHBE mRNA. In some aspects, the polynucleic acid molecule described herein is about 85% complementary to the target region of INHBE mRNA. In some aspects, the polynucleic acid molecule described herein is about 80% complementary to the target region of INHBE mRNA. In some aspects, the polynucleic acid molecule described herein is about 75% complementary to the target region of INHBE mRNA. In some aspects, the polynucleic acid molecule described herein is about 70% complementary to the target region of INHBE mRNA.
[0070] In some aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence in Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18. In other aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence in Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18. In some instances, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 1-328, 1319-1331, 1371-1383, and 1423-1432. In some instances, the polynucleic acid molecule described herein comprises a nucleic acid sequence that isat least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 1319-1331, 1371-1383, and 1423-1432. In some instances, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% complementary to a nucleic acid sequence selected from SEQ ID NOs: 331-658, 1332-1344, 1384-1396, and 1433-1443. In some instances, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% complementary to a nucleic acid sequence selected from SEQ ID NOs: 1332-1344, 1384-1396, and 1433-1443.
[0071] In some aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that comprises at least 15, 16, 17, 18, 19 consecutive nucleotides of the nucleic acid sequence selected from SEQ ID NOs: 1-328, 1319-1331, 1371-1383, and 1423-1432, with no more than 1, 2, 3, or 4 mismatches.
[0072] In yet other aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is 15 consecutive nucleotides out of the sequences in Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 with no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is 15 consecutive nucleotides that are complementary to a nucleic acid sequence of SEQ ID NOs: 331-658, 1332-1344, 1384-1396, and 1433-1443 with no more than 1, 2, 3, or 4 mismatches. In yet still other aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is 16 consecutive nucleotides out of the sequences in Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 with no more than 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is 16 consecutive nucleotides that are complementary to a nucleic acid sequence of SEQ ID NOs: 331-658, 1332-1344, 1384-1396, and 1433-1443 with no more than 1, 2, 3, or 4 mismatches. In yet still other aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is 17 consecutive nucleotides out of the sequences in Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 with no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is 17 consecutive nucleotides that are complementary to a nucleic acid sequence of SEQ ID NOs: 331-658, 1332-1344, 1384-1396, and 1433-1443 with no more than 1, 2, 3, or 4 mismatches. In yet other aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is 18 consecutive nucleotides out of the sequences in Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 with no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecule described herein comprises anucleic acid sequence that is 18 consecutive nucleotides that are complementary to a nucleic acid sequence of SEQ ID NOs: 331-658, 1332-1344, 1384-1396, and 1433-1443 with no more than 1, 2, 3, or 4 mismatches. In yet other aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is 19 consecutive nucleotides out of the sequences in Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 with no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is 19 consecutive nucleotides that are complementary to a nucleic acid sequence of SEQ ID NOs: 331-658, 1332-1344, 1384-1396, and 1433-1443 with no more than 1, 2, 3, or 4 mismatches. In yet other aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is 20 consecutive nucleotides out of the sequences in Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 with no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is 20 consecutive nucleotides that are complementary to a nucleic acid sequence of SEQ ID NOs: 331-658, 1332-1344, 1384-1396, and 1433-1443 with no more than 1, 2, 3, or 4 mismatches. In yet other aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is 21 consecutive nucleotides out of the sequences in Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 with no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is 21 consecutive nucleotides that are complementary to a nucleic acid sequence of SEQ ID NOs: 331-658, 1332-1344, 1384-1396, and 1433-1443 with no more than 1, 2, 3, or 4 mismatches. In yet other aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is 22 consecutive nucleotides out of the sequences in Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 with no more than 1, 2, 3, or 4 mismatches. In some aspects, the passenger strand described herein comprises a nucleic acid sequence that is 22 consecutive nucleotides that are complementary to a nucleic acid sequence of SEQ ID NOs: 331-658, 1332-1344, 1384-1396, and 1433-1443 with no more than 1, 2, 3, or 4 mismatches.
[0073] In some aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is 15 consecutive nucleotides that are complementary to a nucleic acid sequence of SEQ ID NOs: 1332-1344, 1384-1396, and 1433-1443 with no more than 1, 2, or 3 mismatches. In some aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is 16 consecutive nucleotides that are complementary to a nucleic acid sequence of SEQ ID NOs: 1332-1344, 1384-1396, and 1433-1443 with no more than 1, 2, or 3 mismatches. In some aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is17 consecutive nucleotides that are complementary to a nucleic acid sequence of SEQ ID NOs: 1332-1344, 1384-1396, and 1433-1443 with no more than 1, 2, or 3 mismatches. In some aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is 18 consecutive nucleotides that are complementary to a nucleic acid sequence of SEQ ID NOs: 1332- 1344, 1384-1396, and 1433-1443 with no more than 1, 2, or 3 mismatches. In some aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is 19 consecutive nucleotides that are complementary to a nucleic acid sequence of SEQ ID NOs: 1332- 1344, 1384-1396, and 1433-1443 with no more than 1, 2, or 3 mismatches. In some aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is 20 consecutive nucleotides that are complementary to a nucleic acid sequence of SEQ ID NOs: 1332- 1344, 1384-1396, and 1433-1443 with no more than 1, 2, or 3 mismatches. In some aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is 21 consecutive nucleotides that are complementary to a nucleic acid sequence of SEQ ID NOs: 1332- 1344, 1384-1396, and 1433-1443 with no more than 1, 2, or 3 mismatches. In some aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is 22 consecutive nucleotides that are complementary to a nucleic acid sequence of SEQ ID NOs: 1332- 1344, 1384-1396, and 1433-1443 with no more than 1, 2, or 3 mismatches.
[0074] In some aspects, the polynucleic acid molecule described herein comprises about 15-30, 16- 30, 17-30, 18-30, 18-27, 18-25, 18-23, 19-23, 20-23, or 21-23 nucleotides in length. In some aspects, the polynucleic acid molecule described herein comprises about 15, 16, 17, 18, 19, 20 nucleotides long. In some aspects, the polynucleic acid molecule described herein comprises about 21, 22, 23, 24, 25 nucleotides long. In some aspects, the polynucleic acid molecule described herein comprises about 26, 27, 28, 29, 30 nucleotides in length. In some aspects, the polynucleic acid molecule described herein comprises 19 nucleotides in length. In some aspects, the polynucleic acid molecule described herein comprises 21 nucleotides in length. In some aspects, the polynucleic acid molecule described herein comprises 23 nucleotides in length.Double-stranded nucleic acid molecule
[0075] Described herein is a polynucleic acid molecule for modulating expression of INHBE gene, wherein the polynucleic acid molecule is a double-stranded molecule that comprises a passenger strand and a guide strand, and wherein the guide strand is reverse complementary to the target region of INHBE mRNA as described above.
[0076] In some aspects, the guide strand described herein is 100% complementary to the target region of INHBE mRNA. In some aspects, the guide strand described herein is not 100% complementary to the target region of INHBE mRNA. Accordingly, in some instances, the guidestrand described herein is about 95% complementary to the target region of INHBE mRNA. In some aspects, the guide strand described herein is about 90% complementary to the target region of INHBE mRNA. In some aspects, the guide strand described herein is about 85% complementary to the target region of INHBE mRNA. In some aspects, the guide strand described herein is about 80% complementary to the target region of INHBE mRNA. In some aspects, the guide strand described herein is about 75% complementary to the target region of INHBE mRNA. In some aspects, the guide strand described herein is about 70% complementary to the target region of INHBE mRNA.
[0077] In some aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a sequence in Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18. In other aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence in Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18. In some instances, the passenger strand described herein comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 331-658, 1332-1344, 1384-1396, and 1433-1443. In some instances, the guide strand described herein comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 1-328, 1319- 1331, 1371-1383, and 1423-1432. In some instances, the passenger strand described herein comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 1332-1344, 1384-1396, and 1433- 1443. In some instances, the guide strand described herein comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 1319-1331, 1371-1383, and 1423-1432.
[0078] In yet other aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is 14 consecutive nucleotides out of the sequences in Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 with no more than 1, 2, 3, or 4 mismatches. In some aspects, the passenger strand described herein comprises a nucleic acid sequence that is 14 consecutive nucleotides of SEQ ID NOs: 331-658, 1332-1344, 1384-1396, and 1433-1443 with no more than 1, 2, 3, or 4 mismatches. In some aspects, the guide strand described herein comprises a nucleic acid sequence that is 14 consecutive nucleotides of SEQ ID NOs: 1-328, 1319-1331, 1371-1383, and 1423-1432 with no more than 1, 2, 3, or 4 mismatches. In yet other aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is 15 consecutive nucleotides out of the sequences in Table 1, Table 3, Table 5, Table 7, Table 9,Table 11, Table 13, Table 15, or Table 18 with no more than 1, 2, 3, or 4 mismatches. In some aspects, the passenger strand described herein comprises a nucleic acid sequence that is 15 consecutive nucleotides of SEQ ID NOs: 331-658, 1332-1344, 1384-1396, and 1433-1443 with no more than 1, 2, 3, or 4 mismatches. In some aspects, the guide strand described herein comprises a nucleic acid sequence that is 15 consecutive nucleotides of SEQ ID NOs: 1-328, 1319-1331, 1371- 1383, and 1423-1432 with no more than 1, 2, 3, or 4 mismatches. In yet still other aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is 16 consecutive nucleotides out of the sequences in Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 with no more than 1, 2, 3, or 4 mismatches. In some aspects, the passenger strand described herein comprises a nucleic acid sequence that is 16 consecutive nucleotides of SEQ ID NOs: 331-658, 1332-1344, 1384-1396, and 1433-1443 with no more than 1, 2, 3, or 4 mismatches. In some aspects, the guide strand described herein comprises a nucleic acid sequence that is 16 consecutive nucleotides of SEQ ID NOs: 1-328, 1319-1331, 1371- 1383, and 1423-1432 with no more than 1, 2, 3, or 4 mismatches. In yet still other aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is 17 consecutive nucleotides out of the sequences in Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 with no more than 1, 2, 3, or 4 mismatches. In some aspects, the passenger strand described herein comprises a nucleic acid sequence that is 17 consecutive nucleotides of SEQ ID NOs: 331-658, 1332-1344, 1384-1396, and 1433-1443 with no more than 1, 2, 3, or 4 mismatches. In some aspects, the guide strand described herein comprises a nucleic acid sequence that is 17 consecutive nucleotides of SEQ ID NOs: 1-328, 1319-1331, 1371- 1383, and 1423-1432 with no more than 1, 2, 3, or 4 mismatches. In yet other aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is 18 consecutive nucleotides out of the sequences in Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 with no more than 1, 2, 3, or 4 mismatches. In some aspects, the passenger strand described herein comprises a nucleic acid sequence that is 18 consecutive nucleotides of SEQ ID NOs: 331-658, 1332-1344, 1384-1396, and 1433-1443 with no more than 1, 2, 3, or 4 mismatches. In some aspects, the guide strand described herein comprises a nucleic acid sequence that is 18 consecutive nucleotides of SEQ ID NOs: 1-328, 1319-1331, 1371- 1383, and 1423-1432 with no more than 1, 2, 3, or 4 mismatches. In yet other aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is 19 consecutive nucleotides out of the sequences in Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 with no more than 1, 2, 3, or 4 mismatches. In some aspects, the passenger strand described herein comprises a nucleic acid sequence that is 19consecutive nucleotides of SEQ ID NOs: 331-658, 1332-1344, 1384-1396, and 1433-1443 with no more than 1, 2, 3, or 4 mismatches. In some aspects, the guide strand described herein comprises a nucleic acid sequence that is 19 consecutive nucleotides of SEQ ID NOs: 1-328, 1319-1331, 1371- 1383, and 1423-1432 with no more than 1, 2, 3, or 4 mismatches. In yet other aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is 20 consecutive nucleotides out of the sequences in Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 with no more than 1, 2, 3, or 4 mismatches. In some aspects, the passenger strand described herein comprises a nucleic acid sequence that is 20 consecutive nucleotides of SEQ ID NOs: 331-658, 1332-1344, 1384-1396, and 1433-1443 with no more than 1, 2, 3, or 4 mismatches. In some aspects, the guide strand described herein comprises a nucleic acid sequence that is 20 consecutive nucleotides of SEQ ID NOs: 1-328, 1319-1331, 1371- 1383, and 1423-1432 with no more than 1, 2, 3, or 4 mismatches. In yet other aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is 21 consecutive nucleotides out of the sequences in Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 with no more than 1, 2, 3, or 4 mismatches. In some aspects, the passenger strand described herein comprises a nucleic acid sequence that is 21 consecutive nucleotides of SEQ ID NOs: 331-658, 1332-1344, 1384-1396, and 1433-1443 with no more than 1, 2, 3, or 4 mismatches. In some aspects, the guide strand described herein comprises a nucleic acid sequence that is 21 consecutive nucleotides of SEQ ID NOs: 1-328, 1319-1331, 1371- 1383, and 1423-1432 with no more than 1, 2, 3, or 4 mismatches. In yet other aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is 22 consecutive nucleotides out of the sequences in Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 with no more than 1, 2, 3, or 4 mismatches. In some aspects, the passenger strand described herein comprises a nucleic acid sequence that is 22 consecutive nucleotides of SEQ ID NOs: 331-658, 1332-1344, 1384-1396, and 1433-1443 with no more than 1, 2, 3, or 4 mismatches. In some aspects, the guide strand described herein comprises a nucleic acid sequence that is 22 consecutive nucleotides of SEQ ID NOs: 1-328, 1319-1331, 1371- 1383, and 1423-1432 with no more than 1, 2, 3, or 4 mismatches. In some aspects, the polynucleic acid molecule described herein comprises a nucleic acid sequence that is 23 consecutive nucleotides out of the sequences in Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 with no more than 1, 2, 3, or 4 mismatches. In some aspects, the guide strand described herein comprises a nucleic acid sequence that is 23 consecutive nucleotides of SEQ ID NOs: 1-328, 1319-1331, 1371-1383, and 1423-1432 with no more than 1, 2, 3, or 4 mismatches.
[0079] In some aspects, the passenger strand described herein comprises a nucleic acid sequence that is 14 consecutive nucleotides of SEQ ID NOs: 1332-1344, 1384-1396, and 1433-1443 with no more than 1, 2, or 3 mismatches. In some aspects, the guide strand described herein comprises a nucleic acid sequence that is 14 consecutive nucleotides of SEQ ID NOs: 1319-1331, 1371-1383, and 1423-1432 with no more than 1, 2, or 3 mismatches. In some aspects, the passenger strand described herein comprises a nucleic acid sequence that is 15 consecutive nucleotides of SEQ ID NOs: 1332-1344, 1384-1396, and 1433-1443 with no more than 1, 2, or 3 mismatches. In some aspects, the guide strand described herein comprises a nucleic acid sequence that is 15 consecutive nucleotides of SEQ ID NOs: 1319-1331, 1371-1383, and 1423-1432 with no more than 1, 2, or 3 mismatches. In some aspects, the passenger strand described herein comprises a nucleic acid sequence that is 16 consecutive nucleotides of SEQ ID NOs: 1332-1344, 1384-1396, and 1433- 1443 with no more than 1, 2, or 3 mismatches. In some aspects, the guide strand described herein comprises a nucleic acid sequence that is 16 consecutive nucleotides of SEQ ID NOs: 1319-1331, 1371-1383, and 1423-1432 with no more than 1, 2, or 3 mismatches. In some aspects, the passenger strand described herein comprises a nucleic acid sequence that is 17 consecutive nucleotides of SEQ ID NOs: 1332-1344, 1384-1396, and 1433-1443 with no more than 1, 2, or 3 mismatches. In some aspects, the guide strand described herein comprises a nucleic acid sequence that is 17 consecutive nucleotides of SEQ ID NOs: 1319-1331, 1371-1383, and 1423-1432 with no more than 1, 2, or 3 mismatches. In some aspects, the passenger strand described herein comprises a nucleic acid sequence that is 18 consecutive nucleotides of SEQ ID NOs: 1332-1344, 1384-1396, and 1433-1443 with no more than 1, 2, or 3 mismatches. In some aspects, the guide strand described herein comprises a nucleic acid sequence that is 18 consecutive nucleotides of SEQ ID NOs: 1319-1331, 1371-1383, and 1423-1432 with no more than 1, 2, or 3 mismatches. In some aspects, the passenger strand described herein comprises a nucleic acid sequence that is 19 consecutive nucleotides of SEQ ID NOs: 1332-1344, 1384-1396, and 1433-1443 with no more than 1, 2, or 3 mismatches. In some aspects, the guide strand described herein comprises a nucleic acid sequence that is 19 consecutive nucleotides of SEQ ID NOs: 1319-1331, 1371-1383, and 1423- 1432 with no more than 1, 2, or 3 mismatches. In some aspects, the passenger strand described herein comprises a nucleic acid sequence that is 20 consecutive nucleotides of SEQ ID NOs: 1332- 1344, 1384-1396, and 1433-1443 with no more than 1, 2, or 3 mismatches. In some aspects, the guide strand described herein comprises a nucleic acid sequence that is 20 consecutive nucleotides of SEQ ID NOs: 1319-1331, 1371-1383, and 1423-1432 with no more than 1, 2, or 3 mismatches. In some aspects, the passenger strand described herein comprises a nucleic acid sequence that is 21 consecutive nucleotides of SEQ ID NOs: 1332-1344, 1384-1396, and 1433-1443 with no more than1, 2, or 3 mismatches. In some aspects, the guide strand described herein comprises a nucleic acid sequence that is 21 consecutive nucleotides of SEQ ID NOs: 1319-1331, 1371-1383, and 1423- 1432 with no more than 1, 2, or 3 mismatches. In some aspects, the passenger strand described herein comprises a nucleic acid sequence that is 22 consecutive nucleotides of SEQ ID NOs: 1332- 1344, 1384-1396, and 1433-1443 with no more than 1, 2, or 3 mismatches. In some aspects, the guide strand described herein comprises a nucleic acid sequence that is 22 consecutive nucleotides of SEQ ID NOs: 1319-1331, 1371-1383, and 1423-1432 with no more than 1, 2, or 3 mismatches. In some aspects, the guide strand described herein comprises a nucleic acid sequence that is 23 consecutive nucleotides of SEQ ID NOs: 1319-1331, 1371-1383, and 1423-1432 with no more than 1, 2, or 3 mismatches.
[0080] In some aspects, the polynucleic acid molecule described herein comprises a passenger strand and a guide strand of about 15-30, 16-30, 17-30, 18-30, 18-27, 18-25, 18-23, 19-23, 20-23, or 21-23 nucleotides in length. In some aspects, the polynucleic acid molecule described herein comprises a passenger strand and a guide strand of about 15, 16, 17, 18, 19, 20 nucleotides in length. In some aspects, the polynucleic acid molecule described herein comprises a passenger strand and a guide strand of about 21, 22, 23, 24, 25 nucleotides in length. In some aspects, the polynucleic acid molecule described herein comprises a passenger strand and a guide strand of about 26, 27, 28, 29, 30 nucleotides in length. In some aspects, the polynucleic acid molecule described herein comprises a passenger strand of 19 nucleotides in length, and a guide strand of about 21 nucleotides in length. In some aspects, the polynucleic acid molecule described herein comprises a passenger strand of 21 nucleotides in length, and a guide strand of about 23 nucleotides in length. In some instances, the polynucleic acid molecule is 19-25 nucleotides in length. In some instances, the polynucleic acid molecule is 21-23 nucleotides in length.
[0081] In some aspects, the passenger strand and the guide strand described herein are reverse complementary to each other and form a duplex with a 3’ overhang on the guide strand. In some aspects, the passenger strand and the guide strand described herein are reverse complementary to each other and form a duplex with a 5’ overhang on the guide strand. In some aspects, the passenger strand and the guide strand described herein are reverse complementary to each other and form a duplex with a 3’ overhang on the passenger strand. In some aspects, the passenger strand and the guide strand described herein are reverse complementary to each other and form a duplex with a 5’ overhang on the passenger strand.
[0082] In one aspect, provided herein is a polynucleic acid molecule (e.g., an siRNA molecule) for modulating expression of inhibin subunit beta E (INHBE) gene, comprising: (a) an antisense strand comprising a nucleic acid sequence of UUAUGAUCCAGGUAGAGGAGAGA (SEQ ID NO:1429) and a sense strand comprising a nucleic acid sequence of UCUCCUCUACCUGGAUCAUAA (SEQ ID NO: 1437); or (b) an antisense strand comprising a nucleic acid sequence of UAUCGGAAGAUCCUCAAGCACAG (SEQ ID NO: 1379) and a sense strand comprising a nucleic acid sequence of GUGCUUGAGGAUCUUCCGAUA (SEQ ID NO: 1392).Modifications of Polynucleic Acid Molecules
[0083] In some aspects, described herein is the polynucleic acid molecule described herein with modifications. In some aspects, the modifications described herein occurs one or more different structures of the polynucleotide acid molecule described herein (e.g., modifications on sugar ring(s), backbone(s), base(s)). In some aspects, the modifications described herein comprise substitutions of one or more nucleotide in the polynucleic acid molecule described herein. In some aspects, different percentages of the polynucleic acid molecule described herein comprise the modifications described herein. In some aspects, different positions of the polynucleic acid molecule described herein comprise the modifications described herein. An international patent publication No. W02018 / 035380 is herein incorporated by reference in its entirety.Types of modifications
[0084] In some aspects, the polynucleotide acid molecule described herein comprises one or more sugar-modified nucleotide. In some aspects, the sugar-modified nucleotide is a 2’-fluoro modified nucleotide. In some instances, the 2’ -fluoro modified nucleotide comprises thio-modified base containing nucleotide, e.g., 2'-fluoro-2-thiouridine-3'-phosphate (U3f). In some instances, the sugar-modified nucleotide includes, but are not limited to, a modification at a 2’ hydroxyl group of the ribose moiety. In some instances, the sugar-modified nucleotide includes, but are not limited to, modification with an H, OR, R, halo, SH, SR, NH2, NHR, NR2, or CN, wherein R is an alkyl moiety. In some aspects, the sugar-modified nucleotide is a 2’-O-methyl modified nucleotide or 2’- alkoxy modified nucleotide (e.g., 2’ -methoxy modified nucleotide). In some instances, 2' hydroxyl group modification includes, but are not limited to, 2’-deoxy, 2 ’-deoxy-2’ -fluoro, 2’-O- aminopropyl (2’-O-AP), 2’-O-dimethylaminoethyl (2’-O-DMAOE), 2’-O-dimethylaminopropyl (2’-O-DMAP), 2’-O- dimethylaminoethyloxyethyl (2’-O-DMAEOE), or 2’-O-N-methylacetamido (2’-0-NMA). In some instances, the alkyl moiety comprises a hetero substitution. In some instances, the carbon of the heterocyclic group is substituted by a nitrogen, oxygen or sulfur. In some aspects, the sugar-modified nucleotide is a 2’- amino modified nucleotide. In some aspects, the sugar-modified nucleotide is a 2’- azido modified nucleotide. In some aspects, the sugar- modified nucleotide is a 2’- deoxy modified nucleotide. In some aspects, the sugar-modifiednucleotide is a 2’-O-methoxythyl (2’-M0E). In some aspects, the sugar-modified nucleotide is a locked nucleic acid (LNA). In some aspects, the sugar-modified nucleotide is an ethylene-bridged nucleic acid (ENA). In some aspects, the sugar-modified nucleotide is a (S)-constrained ethyl (cEt). In some aspects, the sugar-modified nucleotide is a tricyclo-DNA (tcDNA). In some aspects, the sugar-modified nucleotide is a 2’-NH2 nucleic acid.
[0085] In some aspects, the polynucleotide acid molecule described herein comprises one or more sugarphosphate-modified nucleotide. In some aspects, the modified sugarphosphate is phosphorodiamidate morpholino (PMO). In some aspects, the modified sugarphosphate is phosphoramidate. In some instances, the heterocyclic substitution includes imidazole, and pyrrolidino. In some aspects, the modified sugarphosphate is thiophosphoramidate. In some aspects, the modified sugarphosphate is peptide nucleic acid (PNA).
[0086] In some aspects, the polynucleotide acid molecule described herein comprises one or more backbone-modified nucleotide. In some aspects, the polynucleotide acid molecule described herein comprises one or more modified internucleotide linkage. In some aspects, the modified backbone is a methylphosphonate. In some instances, the modified internucleotide linkage is a phosphorothioate internucleotide linkage or a pho sphorodi thioate internucleotide linkage. In some aspects, the modified backbone is phosphorothioate. In some aspects, the modified backbone is phosphorodithioate, e.g., 3’phosphorodithioate (ss). In some aspects, the modified backbone is a guanidinopropyl phosphoramidate. In some aspects, the modified backbone is a mesyl- phosphoramidate (MsPA) linkages. In some instances, the modified backbone comprises one or more of phosphorothioate, phosphorodithioates, methylphosphonates, 5'- alkylenephosphonates, 5'- methylphosphonate, 3'-alkylene phosphonates, borontrifluoridates, borano phosphate esters and selenophosphates of 3'-5' linkage or 2'-5' linkage, phosphotriesters, thionoalkylphosphotriesters, hydrogen phosphonate linkages, alkyl phosphonates, alkylphosphonothioates, arylphosphonothioates, phosphoroselenoates, phosphoramidates.
[0087] In some instances, the modified backbone is phosphorothioate. In some instances, the guide strand comprises one or more phosphorothioate intemucleotide linkage. In some instances, the phosphorothioate internucleotide linkage, is covalently bonded to the 1st nucleoside (e.g., the 3'- carbon atom of the 1st nucleoside) and the 2nd nucleoside (e.g., the 5'-carbon atom of the 2nd nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorothioate internucleotide linkage, is covalently bonded to the 2nd nucleoside (e.g., the 3'-carbon atom of the 2nd nucleoside) and the 3rd nucleoside (e.g., the 5'-carbon atom of the 3rd nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorothioate intemucleotide linkage, is covalently bonded to the 3rd nucleoside (e.g., the 3'-carbon atom of the 3rd nucleoside) and the 4thnucleoside (e.g., the 5'-carbon atom of the 4th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorothioate internucleotide linkage, is covalently bonded to the 4th nucleoside (e.g., the 3'-carbon atom of the 4th nucleoside) and the 5th nucleoside (e.g., the 5'- carbon atom of the 5th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorothioate internucleotide linkage, is covalently bonded to the 5th nucleoside (e.g., the 3'- carbon atom of the 5th nucleoside) and the 6th nucleoside (e.g., the 5'-carbon atom of the 6th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorothioate internucleotide linkage, is covalently bonded to the 6th nucleoside (e.g., the 3'-carbon atom of the 6th nucleoside) and the 7th nucleoside (e.g., the 5'-carbon atom of the 7th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorothioate intemucleotide linkage, is covalently bonded to the 7th nucleoside (e.g., the 3'-carbon atom of the 7th nucleoside) and the 8th nucleoside (e.g., the 5'-carbon atom of the 8th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorothioate internucleotide linkage, is covalently bonded to the 8th nucleoside (e.g., the 3'-carbon atom of the 8th nucleoside) and the 9th nucleoside (e.g., the 5'- carbon atom of the 9th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorothioate internucleotide linkage, is covalently bonded to the 9th nucleoside (e.g., the 3'- carbon atom of the 9th nucleoside) and the 10th nucleoside (e.g., the 5'-carbon atom of the 10th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorothioate internucleotide linkage, is covalently bonded to the 10th nucleoside (e.g., the 3'-carbon atom of the 10th nucleoside) and the 11th nucleoside (e.g., the 5'-carbon atom of the 11th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorothioate intemucleotide linkage, is covalently bonded to the 11th nucleoside (e.g., the 3'-carbon atom of the 11th nucleoside) and the 12th nucleoside (e.g., the 5'-carbon atom of the 12th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorothioate intemucleotide linkage, is covalently bonded to the 12th nucleoside (e.g., the 3 '-carbon atom of the 12th nucleoside) and the 13th nucleoside (e.g., the 5'-carbon atom of the 13th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorothioate intemucleotide linkage, is covalently bonded to the 13th nucleoside (e.g., the 3'- carbon atom of the 13th nucleoside) and the 14th nucleoside (e.g., the 5'-carbon atom of the 14th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorothioate intemucleotide linkage, is covalently bonded to the 14th nucleoside (e.g., the 3'-carbon atom of the 14th nucleoside) and the 15th nucleoside (e.g., the 5'-carbon atom of the 15th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorothioate intemucleotide linkage, is covalently bonded to the 15th nucleoside (e.g., the 3'-carbon atom of the 15th nucleoside) and the 16th nucleoside (e.g., the 5'-carbon atom of the 16th nucleoside) from the 5’ end of the guidestrand. In some instances, the phosphorothioate internucleotide linkage, is covalently bonded to the 16th nucleoside (e.g., the 3 '-carbon atom of the 16th nucleoside) and the 17th nucleoside (e.g., the 5'-carbon atom of the 17th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorothioate internucleotide linkage, is covalently bonded to the 17th nucleoside (e.g., the 3'- carbon atom of the 17th nucleoside) and the 18th nucleoside (e.g., the 5'-carbon atom of the 18th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorothioate internucleotide linkage, is covalently bonded to the 18th nucleoside (e.g., the 3'-carbon atom of the 18th nucleoside) and the 19th nucleoside (e.g., the 5'-carbon atom of the 19th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorothioate intemucleotide linkage, is covalently bonded to the 19th nucleoside (e.g., the 3'-carbon atom of the 19th nucleoside) and the 20th nucleoside (e.g., the 5'-carbon atom of the 20th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorothioate internucleotide linkage, is covalently bonded to the 20th nucleoside (e.g., the 3'-carbon atom of the 20th nucleoside) and the 21st nucleoside (e.g., the 5'-carbon atom of the 21st nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorothioate internucleotide linkage, is covalently bonded to the 21st nucleoside (e.g., the 3'- carbon atom of the 21st nucleoside) and the 22nd nucleoside (e.g., the 5'-carbon atom of the 22nd nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorothioate internucleotide linkage, is covalently bonded to the 22nd nucleoside (e.g., the 3'-carbon atom of the 22nd nucleoside) and the 23rd nucleoside (e.g., the 5'-carbon atom of the 23rd nucleoside) from the 5’ end of the guide strand.
[0088] In some instances, the passenger strand comprises one or more phosphorothioate internucleotide linkage. In some instances, the phosphorothioate intemucleotide linkage, is covalently bonded to the 1st nucleoside (e.g., the 3 '-carbon atom of the 1st nucleoside) and the 2nd nucleoside (e.g., the 5'-carbon atom of the 2nd nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorothioate intemucleotide linkage, is covalently bonded to the 2nd nucleoside (e.g., the 3'-carbon atom of the 2nd nucleoside) and the 3rd nucleoside (e.g., the 5'- carbon atom of the 3rd nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorothioate intemucleotide linkage, is covalently bonded to the 3rd nucleoside (e.g., the 3'- carbon atom of the 3rd nucleoside) and the 4th nucleoside (e.g., the 5'-carbon atom of the 4th nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorothioate intemucleotide linkage, is covalently bonded to the 4th nucleoside (e.g., the 3'-carbon atom of the 4th nucleoside) and the 5th nucleoside (e.g., the 5'-carbon atom of the 5th nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorothioate intemucleotide linkage, is covalently bonded to the 5th nucleoside (e.g., the 3 '-carbon atom of the 5th nucleoside) and the 6thnucleoside (e.g., the 5'-carbon atom of the 6th nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorothioate internucleotide linkage, is covalently bonded to the 6th nucleoside (e.g., the 3'-carbon atom of the 6th nucleoside) and the 7th nucleoside (e.g., the 5'- carbon atom of the 7th nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorothioate internucleotide linkage, is covalently bonded to the 7th nucleoside (e.g., the 3'- carbon atom of the 7th nucleoside) and the 8th nucleoside (e.g., the 5'-carbon atom of the 8th nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorothioate internucleotide linkage, is covalently bonded to the 8th nucleoside (e.g., the 3'-carbon atom of the 8th nucleoside) and the 9th nucleoside (e.g., the 5'-carbon atom of the 9th nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorothioate intemucleotide linkage, is covalently bonded to the 9th nucleoside (e.g., the 3'-carbon atom of the 9th nucleoside) and the 10th nucleoside (e.g., the 5'-carbon atom of the 10th nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorothioate internucleotide linkage, is covalently bonded to the 10th nucleoside (e.g., the 3'-carbon atom of the 10th nucleoside) and the 11th nucleoside (e.g., the 5'-carbon atom of the 11th nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorothioate internucleotide linkage, is covalently bonded to the 11th nucleoside (e.g., the 3'-carbon atom of the 11th nucleoside) and the 12th nucleoside (e.g., the 5'-carbon atom of the 12th nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorothioate internucleotide linkage, is covalently bonded to the 12th nucleoside (e.g., the 3 '-carbon atom of the 12th nucleoside) and the 13th nucleoside (e.g., the 5'-carbon atom of the 13th nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorothioate internucleotide linkage, is covalently bonded to the 13th nucleoside (e.g., the 3'-carbon atom of the 13th nucleoside) and the 14th nucleoside (e.g., the 5'-carbon atom of the 14th nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorothioate intemucleotide linkage, is covalently bonded to the 14th nucleoside (e.g., the 3 '-carbon atom of the 14th nucleoside) and the 15th nucleoside (e.g., the 5'-carbon atom of the 15th nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorothioate intemucleotide linkage, is covalently bonded to the 15th nucleoside (e.g., the 3'-carbon atom of the 15th nucleoside) and the 16th nucleoside (e.g., the 5'-carbon atom of the 16th nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorothioate intemucleotide linkage, is covalently bonded to the 16th nucleoside (e.g., the 3'-carbon atom of the 16th nucleoside) and the 17th nucleoside (e.g., the 5'-carbon atom of the 17th nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorothioate intemucleotide linkage, is covalently bonded to the 17th nucleoside (e.g., the 3'-carbon atom of the 17th nucleoside) and the 18th nucleoside (e.g., the 5'-carbon atom of the 18th nucleoside) from the 5’ end of the passengerstrand. In some instances, the phosphorothioate internucleotide linkage, is covalently bonded to the 18th nucleoside (e.g., the 3 '-carbon atom of the 18th nucleoside) and the 19th nucleoside (e.g., the 5'-carbon atom of the 19th nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorothioate internucleotide linkage, is covalently bonded to the 19th nucleoside (e.g., the 3'-carbon atom of the 19th nucleoside) and the 20th nucleoside (e.g., the 5'-carbon atom of the 20th nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorothioate internucleotide linkage, is covalently bonded to the 20th nucleoside (e.g., the 3'-carbon atom of the 20th nucleoside) and the 21st nucleoside (e.g., the 5'-carbon atom of the 21st nucleoside) from the 5’ end of the passenger strand.
[0089] In some instances, the modified backbone is 3’phosphorodithioate (ss). In some instances, shown as below:
[0090] In some instances, the 3’phosphorodithioate (ss) is incorporated into the polynucleic acid molecule. In some instances, the 3’phosphorodithioate (ss) is incorporated into the siRNA. In some instances, the 3’phosphorodithioate (ss) is incorporated into a guide strand. In some instances, the 3’phosphorodithioate (ss) is incorporated into a passenger strand. In some instances, an incorporated 3’phosphorodithioate (ss) has a structure shown as below, where the base can be any suitable base or modified base that can make Watson-Crick binding with the base on the opposite strand:
[0091] In some instances, the 3’phosphorodithioate (ss) comprises 2’-O-methylguanosine-3’- phosphorodithioate (gss). In some instances, the amidite structure of 2’-O-methylguanosine-3’- phosphorodithioate (gss) is shown as below:
[0092] In some instances, the 2’-O-methylguanosine-3’-phosphorodithioate (gss) is incorporated into the polynucleic acid molecule. In some instances, the 2’-O-methylguanosine-3’- phosphorodithioate (gss) is incorporated into the siRNA. In some instances, the 2’-O- methylguanosine-3’-phosphorodithioate (gss) is incorporated into a guide strand. In some instances, the 2’-O-methylguanosine-3’-phosphorodithioate (gss) is incorporated into a passenger strand. In some instances, an incorporated 2’-O-methylguanosine-3’-phosphorodithioate (gss) has a structure shown as below, where the base can be any suitable base or modified base that can make Watson- Crick binding with the base on the opposite strand:
[0093] In some instances, the guide strand comprises one or more phosphorothioate internucleotide linkage. In some instances, the guide strand comprises one or more phosphorothioate internucleotide linkage and one or more phosphorodithioate internucleotide linkage, e.g., 3’phosphorodithioate (ss). In some instances, the phosphorodithioate intemucleotide linkage, e.g., 3’phosphorodithioate (ss), is covalently bonded to the 1st nucleoside (e.g., the 3'-carbon atom of the 1st nucleoside) and the 2nd nucleoside (e.g., the 5'-carbon atom of the 2ndnucleoside) from the 5’ end of the guide strand. In some instances, the phosphorodithioate intemucleotide linkage, e.g., 3’phosphorodithioate (ss), is covalently bonded to the 2nd nucleoside (e.g., the 3'-carbon atom ofthe 2nd nucleoside) and the 3rd nucleoside (e.g., the 5'-carbon atom of the 3rd nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorodithioate intemucleotide linkage, e.g., 3’phosphorodithioate (ss), is covalently bonded to the 3rd nucleoside (e.g., the 3'-carbon atom of the 3rd nucleoside) and the 4th nucleoside (e.g., the 5'-carbon atom of the 4th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorodithioate intemucleotide linkage, e.g., 3’phosphorodithioate (ss), is covalently bonded to the 4th nucleoside (e.g., the 3'-carbon atom of the 4th nucleoside) and the 5th nucleoside (e.g., the 5'-carbon atom of the 5th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorodithioate intemucleotide linkage, e.g., 3’phosphorodithioate (ss), is covalently bonded to the 5th nucleoside (e.g., the 3'-carbon atom of the 5th nucleoside) and the 6th nucleoside (e.g., the 5'-carbon atom of the 6th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorodithioate intemucleotide linkage, e.g., 3’phosphorodithioate (ss), is covalently bonded to the 6th nucleoside (e.g., the 3'-carbon atom of the 6th nucleoside) and the 7th nucleoside (e.g., the 5'-carbon atom of the 7th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorodithioate intemucleotide linkage, e.g., 3’phosphorodithioate (ss), is covalently bonded to the 7th nucleoside (e.g., the 3'-carbon atom of the 7th nucleoside) and the 8th nucleoside (e.g., the 5'-carbon atom of the 8th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorodithioate intemucleotide linkage, e.g., 3’phosphorodithioate (ss), is covalently bonded to the 8th nucleoside (e.g., the 3'-carbon atom of the 8th nucleoside) and the 9th nucleoside (e.g., the 5'-carbon atom of the 9th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorodithioate intemucleotide linkage, e.g., 3’phosphorodithioate (ss), is covalently bonded to the 9th nucleoside (e.g., the 3'-carbon atom of the 9th nucleoside) and the 10th nucleoside (e.g., the 5'-carbon atom of the 10th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorodithioate intemucleotide linkage, e.g., 3’phosphorodithioate (ss), is covalently bonded to the 10th nucleoside (e.g., the 3'-carbon atom of the 10th nucleoside) and the 11th nucleoside (e.g., the 5'-carbon atom of the 11th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorodithioate intemucleotide linkage, e.g., 3’phosphorodithioate (ss), is covalently bonded to the 11th nucleoside (e.g., the 3'- carbon atom of the 11th nucleoside) and the 12th nucleoside (e.g., the 5'-carbon atom of the 12th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorodithioate intemucleotide linkage, e.g., 3’phosphorodithioate (ss), is covalently bonded to the 12th nucleoside (e.g., the 3'-carbon atom of the 12th nucleoside) and the 13th nucleoside (e.g., the 5'-carbon atom of the 13th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorodithioate intemucleotide linkage, e.g., 3’phosphorodithioate (ss), is covalently bonded to the 13th nucleoside (e.g., the 3'-carbon atom of the 13th nucleoside) and the 14th nucleoside (e.g., the 5'-carbon atom ofthe 14th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorodithioate internucleotide linkage, e.g., 3 ’phosphorodithioate (ss), is covalently bonded to the 14th nucleoside (e.g., the 3'-carbon atom of the 14th nucleoside) and the 15th nucleoside (e.g., the 5'-carbon atom of the 15th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorodithioate internucleotide linkage, e.g., 3 ’phosphorodithioate (ss), is covalently bonded to the 15th nucleoside (e.g., the 3'-carbon atom of the 15th nucleoside) and the 16th nucleoside (e.g., the 5'-carbon atom of the 16th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorodithioate internucleotide linkage, e.g., 3 ’phosphorodithioate (ss), is covalently bonded to the 16th nucleoside (e.g., the 3'-carbon atom of the 16th nucleoside) and the 17th nucleoside (e.g., the 5'-carbon atom of the 17th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorodithioate internucleotide linkage, e.g., 3 ’phosphorodithioate (ss), is covalently bonded to the 17th nucleoside (e.g., the 3'-carbon atom of the 17th nucleoside) and the 18th nucleoside (e.g., the 5'-carbon atom of the 18th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorodithioate internucleotide linkage, e.g., 3 ’phosphorodithioate (ss), is covalently bonded to the 18th nucleoside (e.g., the 3'-carbon atom of the 18th nucleoside) and the 19th nucleoside (e.g., the 5'-carbon atom of the 19th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorodithioate internucleotide linkage, e.g., 3 ’phosphorodithioate (ss), is covalently bonded to the 19th nucleoside (e.g., the 3'-carbon atom of the 19th nucleoside) and the 20th nucleoside (e.g., the 5'-carbon atom of the 20th nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorodithioate internucleotide linkage, e.g., 3 ’phosphorodithioate (ss), is covalently bonded to the 20th nucleoside (e.g., the 3'-carbon atom of the 20th nucleoside) and the 21st nucleoside (e.g., the 5'-carbon atom of the 21st nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorodithioate internucleotide linkage, e.g., 3 ’phosphorodithioate (ss), is covalently bonded to the 21st nucleoside (e.g., the 3'-carbon atom of the 21st nucleoside) and the 22nd nucleoside (e.g., the 5'-carbon atom of the 22nd nucleoside) from the 5’ end of the guide strand. In some instances, the phosphorodithioate intemucleotide linkage, e.g., 3 ’phosphorodithioate (ss), is covalently bonded to the 22nd nucleoside (e.g., the 3'-carbon atom of the 22nd nucleoside) and the 23rd nucleoside (e.g., the 5'-carbon atom of the 23rd nucleoside) from the 5’ end of the guide strand.
[0094] In some instances, the guide strand comprises one or more phosphorothioate intemucleotide linkage and one phosphorodithioate intemucleotide linkage, e.g., 3 ’phosphorodithioate (ss). In some instances, the guide strand comprises one or more phosphorothioate intemucleotide linkages and two phosphorodithioate intemucleotide linkages, e.g., 3 ’phosphorodithioate (ss). In some instances, the guide strand comprises one or more phosphorothioate intemucleotide linkages and three phosphorodithioate intemucleotide linkages, e.g., 3 ’phosphorodithioate (ss). In someinstances, the guide strand comprises one or more phosphorothioate intemucleotide linkages and four phosphorodi thioate intemucleotide linkages, e.g., 3’phosphorodithioate (ss).
[0095] In some instances, the guide strand comprises one or more phosphorothioate intemucleotide linkages and one phosphorodithioate intemucleotide linkage, e.g., 3’phosphorodithioate (ss), wherein the one phosphorodithioate intemucleotide linkage is covalently bonded to two consecutive nucleosides between positions 9-12 of the guide strand from the 5’ end.
[0096] In some instances, the passenger strand comprises one or more phosphorothioate intemucleotide linkage. In some instances, the passenger strand comprises one or more phosphorothioate intemucleotide linkage and one or more phosphorodithioate intemucleotide linkage, e.g., 3’phosphorodithioate (ss). In some instances, the phosphorodithioate intemucleotide linkage, e.g., 3’phosphorodithioate (ss), is covalently bonded to the 1st nucleoside (e.g., the 3'- carbon atom of the 1st nucleoside) and the 2nd nucleoside (e.g., the 5'-carbon atom of the 2ndnucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorodithioate intemucleotide linkage, e.g., 3’phosphorodithioate (ss), is covalently bonded to the 2nd nucleoside (e.g., the 3'-carbon atom of the 2nd nucleoside) and the 3rd nucleoside (e.g., the 5'-carbon atom of the 3rd nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorodithioate intemucleotide linkage, e.g., 3’phosphorodithioate (ss), is covalently bonded to the 3rd nucleoside (e.g., the 3'-carbon atom of the 3rd nucleoside) and the 4th nucleoside (e.g., the 5'-carbon atom of the 4th nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorodithioate intemucleotide linkage, e.g., 3’phosphorodithioate (ss), is covalently bonded to the 4th nucleoside (e.g., the 3'-carbon atom of the 4th nucleoside) and the 5th nucleoside (e.g., the 5'-carbon atom of the 5th nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorodithioate intemucleotide linkage, e.g., 3’phosphorodithioate (ss), is covalently bonded to the 5th nucleoside (e.g., the 3'-carbon atom of the 5th nucleoside) and the 6th nucleoside (e.g., the 5'-carbon atom of the 6th nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorodithioate intemucleotide linkage, e.g., 3’phosphorodithioate (ss), is covalently bonded to the 6th nucleoside (e.g., the 3'-carbon atom of the 6th nucleoside) and the 7th nucleoside (e.g., the 5'-carbon atom of the 7th nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorodithioate intemucleotide linkage, e.g., 3’phosphorodithioate (ss), is covalently bonded to the 7th nucleoside (e.g., the 3'-carbon atom of the 7th nucleoside) and the 8th nucleoside (e.g., the 5'-carbon atom of the 8th nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorodithioate intemucleotide linkage, e.g., 3’phosphorodithioate (ss), is covalently bonded to the 8th nucleoside (e.g., the 3'-carbon atom of the 8th nucleoside) and the 9th nucleoside (e.g., the 5'-carbon atom of the 9th nucleoside) fromthe 5’ end of the passenger strand. In some instances, the phosphorodithioate intemucleotide linkage, e.g., 3 ’phosphorodithioate (ss), is covalently bonded to the 9th nucleoside (e.g., the 3'- carbon atom of the 9th nucleoside) and the 10th nucleoside (e.g., the 5'-carbon atom of the 10th nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorodithioate internucleotide linkage, e.g., 3 ’phosphorodithioate (ss), is covalently bonded to the 10th nucleoside (e.g., the 3'-carbon atom of the 10th nucleoside) and the 11th nucleoside (e.g., the 5'-carbon atom of the 11th nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorodithioate intemucleotide linkage, e.g., 3 ’phosphorodithioate (ss), is covalently bonded to the 11th nucleoside (e.g., the 3'-carbon atom of the 11th nucleoside) and the 12th nucleoside (e.g., the 5'-carbon atom of the 12th nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorodithioate intemucleotide linkage, e.g., 3 ’phosphorodithioate (ss), is covalently bonded to the 12th nucleoside (e.g., the 3'-carbon atom of the 12th nucleoside) and the 13th nucleoside (e.g., the 5'-carbon atom of the 13th nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorodithioate intemucleotide linkage, e.g.,3 ’phosphorodithioate (ss), is covalently bonded to the 13th nucleoside (e.g., the 3 '-carbon atom of the 13th nucleoside) and the 14th nucleoside (e.g., the 5'-carbon atom of the 14th nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorodithioate intemucleotide linkage, e.g., 3 ’phosphorodithioate (ss), is covalently bonded to the 14th nucleoside (e.g., the 3'- carbon atom of the 14th nucleoside) and the 15th nucleoside (e.g., the 5'-carbon atom of the 15th nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorodithioate intemucleotide linkage, e.g., 3 ’phosphorodithioate (ss), is covalently bonded to the 15th nucleoside (e.g., the 3'-carbon atom of the 15th nucleoside) and the 16th nucleoside (e.g., the 5'-carbon atom of the 16th nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorodithioate intemucleotide linkage, e.g., 3 ’phosphorodithioate (ss), is covalently bonded to the 16th nucleoside (e.g., the 3'-carbon atom of the 16th nucleoside) and the 17th nucleoside (e.g., the 5'-carbon atom of the 17th nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorodithioate intemucleotide linkage, e.g., 3 ’phosphorodithioate (ss), is covalently bonded to the 17th nucleoside (e.g., the 3'-carbon atom of the 17th nucleoside) and the 18th nucleoside (e.g., the 5'-carbon atom of the 18th nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorodithioate intemucleotide linkage, e.g.,3 ’phosphorodithioate (ss), is covalently bonded to the 18th nucleoside (e.g., the 3'-carbon atom of the 18th nucleoside) and the 19th nucleoside (e.g., the 5'-carbon atom of the 19th nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorodithioate intemucleotide linkage, e.g., 3 ’phosphorodithioate (ss), is covalently bonded to the 19th nucleoside (e.g., the 3'-carbon atom of the 19th nucleoside) and the 20th nucleoside (e.g., the 5'-carbon atom of the 20th nucleoside) from the 5’ end of the passenger strand. In some instances, the phosphorodithioate internucleotide linkage, e.g., 3 ’phosphorodithioate (ss), is covalently bonded to the 20th nucleoside (e.g., the 3'-carbon atom of the 20th nucleoside) and the 21st nucleoside (e.g., the 5'-carbon atom of the 21st nucleoside) from the 5’ end of the passenger strand.
[0097] In some instances, the passenger strand comprises one or more phosphorothioate internucleotide linkage and one phosphorodithioate intemucleotide linkage, e.g., 3 ’phosphorodithioate (ss). In some instances, the passenger strand comprises one or more phosphorothioate internucleotide linkage and two phosphorodithioate intemucleotide linkages, e.g., 3 ’phosphorodithioate (ss). In some instances, the passenger strand comprises one or more phosphorothioate intemucleotide linkage and three phosphorodithioate intemucleotide linkages, e.g., 3 ’phosphorodithioate (ss). In some instances, the passenger strand comprises one or more phosphorothioate intemucleotide linkage and four phosphorodithioate intemucleotide linkages, e.g., 3 ’phosphorodithioate (ss).
[0098] In some aspects, the modified nucleotide comprises a modified guanine (e.g., inosine) or one or more of any types of unnatural nucleic acids.
[0099] In some aspects, the modified backbone is phosphorothioate, and the phosphorothioate is a stereochemically enriched phosphorothioate. In certain aspects, the strand contains at least one stereochemically enriched phosphorothioate. In some aspects, the strand comprises at least 1, 2, 3 stereochemically enriched phosphorothioates. In some aspects, the strand comprises only 1, 2, 3, or 4 stereochemically enriched phosphorothioates. In further aspects, at least one (e.g., one or two) stereochemically enriched phosphorothioate is disposed between two consecutive nucleosides that are two of six 5’ end nucleosides of the strand. In yet further aspects, at least one (e.g., one or two) stereochemically enriched phosphorothioate is disposed between two consecutive nucleosides that are two of six 3’ end nucleosides of the strand. In still further aspects, one stereochemically enriched phosphorothioate is covalently bonded to the first nucleoside and the second nucleoside from the 5’ end within the strand. In some aspects, one stereochemically enriched phosphorothioate is covalently bonded to the twenty first nucleoside and the twenty second nucleoside from the 5’ end within the strand. In certain aspects, one stereochemically enriched phosphorothioate is covalently bonded to the twenty second nucleoside and the twenty third nucleoside from the 5’ end within the strand. In particular aspects, the stereochemically enriched phosphorothioate has R? stereochemical identity. In certain aspects, the stereochemically enriched phosphorothioate has Sp stereochemical identity. In some instances, the modified backbone connects the linker and the targeting moieties to the polynucleic acid molecule.
[0100] In some aspects, the modified backbone comprises 3’phosphorothioate, Rp diastereomer ( / ^-enriched phosphorothioate or Rps), 3'phosphorothioate, Sp diastereomer Sp-enriched phosphorothioate or Sps), or combinations thereof. In some instances, an incorporated 3’phosphorothioate, Rp diastereomer (7?p-enriched phosphorothioate or Rps) has a structure shown as below, where the base can be any suitable base or modified base that can make Watson-Crick binding with the base on the opposite strand:
[0101] In some instances, an incorporated Sp diastereomer (Sp-enriched phosphorothioate or Sps) has a structure shown as below, where the base can be any suitable base or modified base that can make Watson-Crick binding with the base on the opposite strand:
[0102] In some aspects, the polynucleotide molecules described herein comprises one or more (e.g., from 1 to 20, from 1 to 10, or from 1 to 5) stereochemically enriched (e.g., intemucleoside) phosphorothioates (e.g., having diastereomeric excess of at least 10%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%, e.g., up to about 99%, for the P-stereogenic center). The polynucleotide molecules described herein comprises one or more (e.g., from 1 to 20, from 1 to 10, or from 1 to 5; e.g., internucleoside) phosphorodithioates. The phosphorodithioates may be non-P- stereogenic in the polynucleotide molecules described herein. Phosphorothioates and phosphorodithioates may enhance the stability of the polynucleotide molecules described herein toexonuclease activity of serum. Non-P-stereogenic phosphorodithioates may simplify the synthesis of the polynucleotide molecule described herein by reducing the number of possible diastereomers. Typically, the phosphorothioate or phosphorodithioate may connect two contiguous nucleosides within the six 3’ end nucleosides and the six 5’ end nucleosides of the polynucleotide molecules described herein. In some aspects, the stereochemically enriched phosphorothioate (e.g., R\>- enriched phosphorothioate or 5p-enriched phosphorothioate) may be covalently bonded to the first nucleoside (e.g., the 3’-carbon atom of the first nucleoside) and the second nucleoside (e.g., the 5’- carbon atom of the second nucleoside) from the 5’ end of the guide strand. In some instances, the stereochemically enriched phosphorothioate (e.g., Ap-enriched phosphorothioate or 5p-enriched phosphorothioate) may be covalently bonded to the second nucleoside (e.g., the 3’-carbon atom of the second nucleoside) and the third nucleoside (e.g., the 5’-carbon atom of the third nucleoside) from the 5’ end of the guide strand. Additionally or alternatively, the stereochemically enriched phosphorothioate (e.g., Ap-enriched phosphorothioate or 5p-enriched phosphorothioate) may be covalently bonded to the 21stnucleoside (e.g., the 3’-carbon atom of the 21stnucleoside) from the 5’ end and the 22ndnucleoside (e.g., the 5 ’-carbon atom of the 22ndnucleoside) of the guide strand. Further, additionally or alternatively, the stereochemically enriched phosphorothioate (e.g., Sp- enriched phosphorothioate or Ap-enriched phosphorothioate) may be covalently bonded to the 22ndnucleoside (e.g., the 3 ’-carbon atom of the 22ndnucleoside) and the 23rdnucleoside (e.g., the 5’- carbon atom of the 23rdnucleoside) from the 5’ end of the guide strand.
[0103] Combinations of a 5’ stereochemically enriched phosphorothioate (e.g., Ap-enriched phosphorothioate or 5p-enriched phosphorothioate covalently bonded to the first nucleoside (e.g., the 3 ’-carbon atom of the first nucleoside) and the second nucleoside (e.g., the 5 ’-carbon atom of the second nucleoside) from the 5 ’-end) and a 3’ stereochemically enriched phosphorothioate (e.g., Ap-enriched phosphorothioate or 5p-enriched phosphorothioate covalently bonded to the 21stnucleoside (e.g., the 3’-carbon atom of the 21stnucleoside) and the 22ndnucleoside (e.g., the 5’- carbon atom of the 22ndnucleoside) from the 5 ’-end) in the guide strand can produce superior efficacy and / or duration of action, e.g., as measured by the reduction in the activity of the target relative to a reference guide strand that lacks the combination of a stereochemically enriched phosphorothioate and a 3’ stereochemically enriched phosphorothioate.
[0104] In some aspects, the polynucleotide molecule described herein comprises one or more purine modification. In some aspects, the purine modification described herein is 2,6- diaminopurine. In some aspects, the purine modification described herein is 3 -deaza-adenine. In some aspects, the purine modification described herein is 7-deaza-guanine. In some aspects, the purine modification described herein is 8-azido-adenine.
[0105] In some aspects, the polynucleotide molecule described herein comprises one or more pyrimidine modification. In some aspects, the pyrimidine modification described herein is 2-thio- thymidine. In some aspects, the pyrimidine modification described herein is 5-carboxamide-uracil. In some aspects, the pyrimidine modification described herein is 5-methyl-cytosine. In some aspects, the pyrimidine modification described herein is 5-ethynyl uracil.
[0106] In some embodiment, the polynucleic acid molecule described herein comprises an abasic substitution. In those cases where a hybridized polynucleotide construct is contemplated for use as siRNA, a reduction of miRNA-like off-target effects is desirable. The inclusion of one or more (e.g., one or two) abasic substitutions in the hybridized polynucleotide constructs may reduce or even eliminate miRNA-like off-target effects, as the abasic substitutions lack nucleobases that are capable of engaging in base-pairing interactions and alleviate steric hindrance. Thus, the polynucleotide molecule disclosed herein may include one or more (e.g., one or two) abasic substitutions. In some aspects, abasic substitution is at the 5thnucleotide from the 5’ end of the guide strand described herein. In some aspects, abasic substitution is at the 7thnucleotide from the 5’ end of the guide strand described herein.
[0107] When the polynucleotide molecule disclosed herein includes two or more of the abasic substitutions, their structures may be same or different. In certain aspects, a passenger strand contains one abasic substitution (e.g., a guide strand may be free of abasic substitutions). In other aspects, a guide strand contains one abasic substitution (e.g., a passenger strand may be free of abasic substitutions). In yet other aspects, a guide strand contains one abasic substitution, and a passenger strand contains one abasic substitution. In further aspects, a passenger strand includes an abasic substitution between a nucleoside number (x) and a nucleoside number (x+1), where x is an integer from 2 to 7. In yet further aspects, a guide strand includes an abasic substitution between a nucleoside number (x) and a nucleoside number (x+1), where x is an integer from 2 to 7.
[0108] The abasic substitution may be of formula (III):whereL is a sugar analogue, or is substituted with a heteroacyl from A, U ,C, G, or is any other substituted nucleic acid (e.g., locked or unlocked nucleic acid, glycol nucleic acid, etc.; each X4is independently O or S; each X5is independently O, S, NH, or a bond;each R9is independently H, optionally substituted Ci-6 alkyl, optionally substituted C2-6 alkenyl, optionally substituted C2-6 alkynyl, optionally substituted (C1-9 heterocyclyl)-Ci-6-alkyl, optionally substituted (Ce-io aryl)-Ci-6-alkyl, optionally substituted (C3-8 cycloalkyl)-Ci-6-alkyl, - LinkA(-T)p, or a conjugation moiety; each LinkA is independently a multivalent linker (e.g., including -C(O)-N(H)-); each T is independently an auxiliary moiety;R10is a bond to a 3 ’-carbon atom of a nucleoside (x) in the strand;R11is a bond to a 5’-oxygen atom of a nucleoside (x+1) in the strand; p is an integer from 1 to 6; and t is an integer from 1 to 6.
[0109] In some aspects, the abasic substitution described herein is attached to the guide strand of the polynucleic acid molecule described herein. In particular aspects, an abasic substitution (e.g., an internucleotide, abasic spacer of formula (III) in which t is 1) may be included in the guide strand described herein (e.g., within the seed region of the guide strand). In some aspects, an abasic substitution (e.g., an intemucleotide, abasic spacer of formula (III) in which t is 1) may be bonded to the 3’ carbon atom of the second, third, fourth, or fifth nucleoside from the 5’ end of the guide strand described herein. In certain aspects, an abasic substitution (e.g., an intemucleotide, abasic spacer of formula (III) in which t is 1) may be bonded to the 3’ carbon atom of the thirteenth, fourteenth, fifteenth, or sixteenth nucleoside from the 5’ end of the guide strand described herein. In some aspects, an abasic substitution fourth, fifth, sixth, seventh, eighth, and / or ninth nucleoside from the 5’ end of the guide strand described herein.
[0110] The polynucleotide molecule described herein may contain a strand including a seed region including a hypoxanthine nucleobase-containing nucleoside (e.g., inosine).
[0111] In certain aspects, the hypoxanthine nucleobase-containing nucleoside is a second nucleoside from the 5’ end in the strand. In further aspects, the hypoxanthine nucleobase- containing nucleoside is a third nucleoside from the 5’ end in the strand. In yet further aspects, the hypoxanthine nucleobase-containing nucleoside is a fourth nucleoside from the 5’ end in the strand. In still further aspects, the hypoxanthine nucleobase-containing nucleoside is a fifth nucleoside from the 5’ end in the strand. In particular aspects, the hypoxanthine nucleobase-containing nucleoside is a sixth nucleoside in the strand. In particular aspects, the hypoxanthine nucleobase- containing nucleoside is a seventh nucleoside in the strand.Nucleotide Analogue
[0112] In some aspects, the present disclosure provides a polynucleic acid molecule incorporating a nucleotide analogue.
[0113] In some instances, modifications of the nucleotide with the nucleotide analogue described herein can alter base pairings and structural changes of the inhibitory polynucleic acid molecule. In some instances, the nucleotide analogue can be incorporated into the polynucleic acid molecule, thereby suppressing off-target effects. In some instances, the nucleotide analogue can be incorporated into the polynucleic acid molecule, thereby improving stability and efficacy of the polynucleic acid molecule. In some instances, the nucleotide analogue described herein can be incorporated into a guide strand, a passenger strand, or a combination thereof.
[0114] In some instances, the nucleotide analogue can be placed in the polynucleic acid molecule or be a substitute for a nucleotide in the polynucleic acid molecule, thereby suppressing the off- target effects. In some instances, the nucleotide analogue can be substituted for a nucleotide in the polynucleic acid molecule, thereby improving stability and / or efficacy of the polynucleic acid molecule. In some instances, the nucleotide analogue described herein can be placed in a guide strand, a passenger strand, or both.
[0115] In some aspects, the present disclosure provides a polynucleic acid molecule comprising a passenger strand (sense strand) and a guide strand (antisense strand), wherein the guide strand comprises a nucleotide analogue as described herein. In some instances, the nucleotide analogue comprises acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid- 3'phosphate (T-NAc), l',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’ -O-methyl-2-thiouridine-3’ -phosphate (u3), 2’-fluoro-2-thiouridine-3’- phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (al), 5’(E) vinylphosphonate-2’-O- methoxy-ethyl-5-methyluridine-3’ -phosphate (vpt4), 5'(E) vinylphosphonate-2-O-methyluridine- 3 'phosphate (vpu), 2'-methoxyethyladenosine-3 'phosphate (A6), 2'-methoxyethyluridine-3'- phosphate (U6), 2’ -deoxy adenosine-3 -phosphate (dA), 2’-deoxycytidine-3’-phosphate (dC), 2’- deoxyguanosine-3 ’ -phosphate (dG), 2 ’-deoxythymidine-3 ’-phosphate (dT), or 2’-O-methylinosine- 3 ’-phosphate (i). In some instance, the nucleotide analogue is selected from a group consisting of the nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T- T), acyclic L-threoninol nucleic acid-adenine-3 ’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 'phosphate (T-NAc), l',2'-Dideoxyribose-3 '-phosphate (dAB), thymidineglycol nucleic acid (GNA) S-isomer (Tgn), 2’ -O-methyl-2-thiouridine-3’ -phosphate (u3), 2’-fluoro- 2-thiouridine-3 ’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’ -phosphate (al), 5’(E) vinylphosphonate-2’-O-methoxy-ethyl-5-methyluridine-3 ’-phosphate (vpt4), 5'(E)vinylphosphonate-2-O-methyluridine-3 'phosphate (vpu), 2'-methoxyethyladenosine-3 'phosphate (A6), 2'-methoxyethyluridine-3'-phosphate (U6), 2’ -deoxy adenosine-3 -phosphate (dA), 2’- deoxycytidine-3’ -phosphate (dC), 2 ’-deoxyguanosine-3’ -phosphate (dG), 2’-deoxythymidine-3’- phosphate (dT), and 2’-O-methylinosine-3 ’-phosphate (i). In some instances, the nucleotide analogue is selected from a group consisting of the nucleotide analogue selected from acyclic L- threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’- phosphate (T-A), and 2 ’-O-methylinosine-3’ -phosphate (i).
[0116] In some instances, the acyclic L-threoninol nucleic acid-3 '-phosphate has a generic representation shown as below, where the base can be any suitable base or modified base that can make Watson-Crick binding with the base on the opposite strand:
[0117] In some instances, the amidite structure of acyclic L-threoninol nucleic acid-thymine-3 '- phosphate (T-T) is shown as below:
[0118] In some instances, the acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T) is incorporated into the polynucleic acid molecule. In some instances, the acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T) is incorporated into the siRNA. In some instances, the acyclic L- threoninol nucleic acid-thymine-3 '-phosphate (T-T) is incorporated into a guide strand. In some instances, the acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T) is incorporated into apassenger strand. In some instances, an incorporated acyclic L-threoninol nucleic acid-thymine-3'- phosphate (T-T) has a structure shown as below:
[0119] In some instances, the acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T) is placed in the polynucleic acid molecule. In some instances, the acyclic L-threoninol nucleic acid- thymine-3 '-phosphate (T-T) substitutes one or more nucleotide in siRNA. In some instances, the acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T) substitutes one or more nucleotide in a passenger strand and / or a guide strand. In some instances, the acyclic L-threoninol nucleic acid- thymine-3 '-phosphate (T-T) substitutes one or more nucleotide in a passenger strand. In some instances, the acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T) substitutes one or more nucleotide in a guide strand.
[0120] In some instances, the amidite structure of acyclic L-threoninol nucleic acid-adenine-3 ’- phosphate (T-A) is shown as below:
[0121] In some instances, the acyclic L-threoninol nucleic acid-adenine-3’ -phosphate (T-A) is incorporated into the polynucleic acid molecule. In some instances, the acyclic L-threoninol nucleic acid-adenine-3 ’-phosphate (T-A) is incorporated into the siRNA. In some instances, the acyclic L- threoninol nucleic acid-adenine-3 ’-phosphate (T-A)is incorporated into a guide strand. In some instances, the acyclic L-threoninol nucleic acid-adenine-3 ’-phosphate (T-A) is incorporated into apassenger strand. In some instances, an incorporated acyclic L-threoninol nucleic acid-adenine-3’- phosphate (T-A) has a structure shown as below:
[0122] In some instances, the acyclic L-threoninol nucleic acid-adenine-3’ -phosphate (T-A) is placed in the polynucleic acid molecule. In some instances, the acyclic L-threoninol nucleic acid- adenine-3 ’-phosphate (T-A) substitutes one or more nucleotide in siRNA. In some instances, the acyclic L-threoninol nucleic acid-adenine-3 ’-phosphate (T-A) substitutes one or more nucleotide in a passenger strand and / or a guide strand. In some instances, the acyclic L-threoninol nucleic acid- adenine-3 ’-phosphate (T-A) substitutes one or more nucleotide in a passenger strand. In some instances, the acyclic L-threoninol nucleic acid-adenine-3 ’-phosphate (T-A) substitutes one or more the nucleotide in a guide strand.
[0123] In some instances, the amidite structure of acyclic N-Acetyl L-threoninol abasic nucleic acid-3 ’-phosphate (T-NAc) is shown as below:
[0124] In some instances, the acyclic N-Acetyl L-threoninol abasic nucleic acid-3 ’-phosphate (T- NAc) is incorporated into the polynucleic acid molecule. In some instances, the acyclic N-Acetyl L-threoninol abasic nucleic acid-3 ’-phosphate (T-NAc) is incorporated into the siRNA. In some instances, the acyclic N-Acetyl L-threoninol abasic nucleic acid-3 ’-phosphate (T-NAc) is incorporated into a guide strand. In some instances, the acyclic N-Acetyl L-threoninol abasic nucleic acid-3 ’-phosphate (T-NAc) is incorporated into a passenger strand. In some instances, an incorporated acyclic N-Acetyl L-threoninol abasic nucleic acid-3 ’-phosphate (T-NAc) has a structure shown as below:
[0125] In some instances, the acyclic N-Acetyl L-threoninol abasic nucleic acid-3 ’-phosphate (T- NAc) is placed in the polynucleic acid molecule. In some instances, the acyclic N-Acetyl L- threoninol abasic nucleic acid-3 ’-phosphate (T-NAc) substitutes one or more nucleotide in siRNA. In some instances, the acyclic N-Acetyl L-threoninol abasic nucleic acid-3 ’-phosphate (T-NAc) substitutes one or more nucleotide in a passenger strand and / or a guide strand. In some instances, acyclic N-Acetyl L-threoninol abasic nucleic acid-3 ’-phosphate (T-NAc) substitutes one or more nucleotide in a passenger strand. In some instances, the acyclic N-Acetyl L-threoninol abasic nucleic acid-3 ’-phosphate (T-NAc) substitutes one or more nucleotide in a guide strand.
[0126] In some instances, the amidite structure of 1’, 2’ -Dideoxyribose-3’ -phosphate (dAB) is shown as below:
[0127] In some instances, the 1’, 2’ -Dideoxyribose-3 ’-phosphate (dAB) is incorporated into the polynucleic acid molecule. In some instances, the l’,2’-Dideoxyribose-3’-phosphate (dAB) is incorporated into the siRNA. In some instances, the l’,2’-Dideoxyribose-3 ’-phosphate (dAB) is incorporated into a guide strand. In some instances, the l’,2’-Dideoxyribose-3’-phosphate (dAB) is incorporated into a passenger strand. In some instances, an incorporated l’,2’-Dideoxyribose-3’- phosphate (dAB) has a structure shown as below:
[0128] In some instances, the 1’, 2’ -Dideoxyribose-3’ -phosphate (dAB) is placed in the polynucleic acid molecule. In some instances, the r,2’-Dideoxyribose-3’-phosphate (dAB) substitutes one or more nucleotide in siRNA. In some instances, the 1’, 2’ -Dideoxyribose-3 ’- phosphate (dAB) substitutes one or more nucleotide in a passenger strand and / or a guide strand. In some instances, the 1’, 2’ -Dideoxyribose-3 ’-phosphate (dAB) substitutes one or more nucleotide in a passenger strand. In some instances, the r,2’-Dideoxyribose-3’-phosphate (dAB) substitutes one or more nucleotide in a guide strand.
[0129] In some instances, the amidite structure of thymidine-glycol nucleic acid (GNA) S-isomer (Tgn) is shown as below:
[0130] In some instances, the thymidine-glycol nucleic acid (GNA) S-isomer (Tgn) is incorporated into the polynucleic acid molecule. In some instances, the thymidine-glycol nucleic acid (GNA) S- isomer (Tgn) is incorporated into the siRNA. In some instances, the thymidine-glycol nucleic acid (GNA) S-isomer (Tgn) is incorporated into a guide strand. In some instances, the thymidine-glycol nucleic acid (GNA) S-isomer (Tgn) is incorporated into a passenger strand. In some instances, an incorporated thymidine-glycol nucleic acid (GNA) S-isomer (Tgn) has a structure shown as below:
[0131] In some instances, the thymidine-glycol nucleic acid (GNA) S-isomer (Tgn) is placed in the polynucleic acid molecule. In some instances, the thymidine-glycol nucleic acid (GNA) S-isomer (Tgn) substitutes one or more nucleotide in siRNA. In some instances, the thymidine-glycol nucleic acid (GNA) S-isomer (Tgn) substitutes one or more nucleotide in a passenger strand and / or a guidestrand. In some instances, the thymidine-glycol nucleic acid (GNA) S-isomer (Tgn) substitutes one or more nucleotide in a passenger strand. In some instances, the thymidine-glycol nucleic acid (GNA) S-isomer (Tgn) substitutes one or more nucleotide in a guide strand.
[0132] In some instances, the amidite structure of 2’-O-methyl-2-thiouridine-3’-phosphate (u3) is shown as below:
[0133] In some instances, the 2’ -O-methyl-2-thiouridine-3’ -phosphate (u3) is incorporated into the polynucleic acid molecule. In some instances, the 2’ -O-methyl-2-thiouridine-3’ -phosphate (u3) is incorporated into the siRNA. In some instances, the 2’-O-methyl-2-thiouridine-3’-phosphate (u3) is incorporated into a guide strand. In some instances, the 2’ -O-methyl-2-thiouridine-3’ -phosphate (u3) is incorporated into a passenger strand. In some instances, an incorporated 2’-O-methyl-2- thiouridine-3’ -phosphate (u3) has a structure shown as below:
[0134] In some instances, the 2’ -O-methyl-2-thiouridine-3’ -phosphate (u3) is placed in the polynucleic acid molecule. In some instances, the 2’ -O-methyl-2-thiouridine-3’ -phosphate (u3) substitutes one or more nucleotide in siRNA. In some instances, the 2’-O-methyl-2-thiouridine-3’- phosphate (u3) substitutes one or more nucleotide in a passenger strand and / or a guide strand. In some instances, the 2’ -O-methyl-2-thiouridine-3’ -phosphate (u3) substitutes one or more nucleotide in a passenger strand. In some instances, the 2’-O-methyl-2-thiouridine-3’-phosphate (u3) substitutes one or more nucleotide in a guide strand.
[0135] In some instances, the amidite structure of 2’ -fluoro-2 -thiouridine-3 ’-phosphate (U3f) is shown as below:
[0136] In some instances, the 2’ -fluoro-2-thiouridine-3 ’-phosphate (U3f) is incorporated into the polynucleic acid molecule. In some instances, the 2’ -fluoro-2-thiouridine-3’ -phosphate (U3f) is incorporated into the siRNA. In some instances, the 2’-fluoro-2-thiouridine-3’-phosphate (U3f) is incorporated into a guide strand. In some instances, the 2’-fluoro-2-thiouridine-3’-phosphate (U3f) is incorporated into a passenger strand. In some instances, an incorporated 2’ -fluoro-2 -thiouridines’ -phosphate (U3f) has a structure shown as below:
[0137] In some instances, the 2’ -fluoro-2-thiouridine-3 ’-phosphate (U3f) is placed in the polynucleic acid molecule. In some instances, the 2’ -fluoro-2-thiouridine-3’ -phosphate (U3f) substitutes one or more nucleotide in siRNA. In some instances, the 2’-fluoro-2-thiouridine-3’- phosphate (U3f) substitutes one or more nucleotide in a passenger strand and / or a guide strand. In some instances, the 2’ -fluoro-2 -thiouridine-3’ -phosphate (U3f) substitutes one or more the nucleotide in a passenger strand. In some instances, the 2’-fluoro-2-thiouridine-3’-phosphate (U3f) substitutes one or more the nucleotide in a guide strand.
[0138] In some instances, the amidite structure of 2-amino-2’-O-methyladenosine-3’-phosphate (al) is shown as below:
[0139] In some instances, the 2-amino-2’-O-methyladenosine-3’-phosphate (al) is incorporated into the polynucleic acid molecule. In some instances, the 2-amino-2’-O-methyladenosine-3’- phosphate (al) is incorporated into the siRNA. In some instances, the 2-amino-2’-O- methyladenosine-3’ -phosphate (al) is incorporated into a guide strand. In some instances, the 2- amino-2’-O-methyladenosine-3’-phosphate (al) is incorporated into a passenger strand. In some instances, an incorporated 2-amino-2’-O-methyladenosine-3’-phosphate (al) has a structure shown as below:
[0140] In some instances, the 2-amino-2’-O-methyladenosine-3’-phosphate (al) is placed in the polynucleic acid molecule. In some instances, the 2-amino-2’-O-methyladenosine-3’-phosphate (al) substitutes one or more nucleotide in siRNA. In some instances, the 2-amino-2’-O- methyladenosine-3’ -phosphate (al) substitutes one or more nucleotide in a passenger strand and / or a guide strand. In some instances, the 2-amino-2’-O-methyladenosine-3’-phosphate (al) substitutes one or more nucleotide in a passenger strand. In some instances, the 2-amino-2’-O- methyladenosine-3’ -phosphate (al) substitutes one or more nucleotide in a guide strand.
[0141] In some instances, the nucleotide analogue comprises hypoxanthine nucleobase-containing nucleoside (e.g., inosine).
[0142] In some instances, the amidite structure of 5’(E) vinylphosphonate-2’-O-methoxy-ethyl-5- methyluridine-3 ’ -phosphate (vpt4) is shown as below:
[0143] In some instances, the 5’(E) vinylphosphonate-2’-O-methoxy-ethyl-5-methyluridine-3’- phosphate (vpt4) is incorporated into the polynucleic acid molecules. In some instances, the 5 ’(E) vinylphosphonate-2’-O-methoxy-ethyl-5-methyluridine-3’-phosphate (vpt4) is incorporated into the siRNA. In some instances, the 5’(E) vinylphosphonate-2’-O-methoxy-ethyl-5-methyluridine-3’- phosphate (vpt4) is incorporated into a guide strand. In some instances, the 5 ’(E) vinylphosphonate-2’-O-methoxy-ethyl-5-methyluridine-3’-phosphate (vpt4) is incorporated into a passenger strand. In some instances, the 5 ’(E) vinylphosphonate-2’-O-methoxy-ethyl-5- methyluridine-3 ’ -phosphate (vpt4) is located at the 5’ end of the guide strand. In some instances, the 5’(E) vinylphosphonate-2’-O-methoxy-ethyl-5-methyluridine-3’-phosphate (vpt4) is located at the 5’ end of the passenger strand. In some instances, an incorporated 5 ’(E) vinylphosphonate-2’- O-methoxy-ethyl-5-methyluridine-3 ’-phosphate (vpt4) has a structure shown as below:
[0144] In some instances, the 5’(E) vinylphosphonate-2’-O-methoxy-ethyl-5-methyluridine-3’- phosphate (vpt4) substitutes one or more nucleotide in siRNA. In some instances, the 5 ’(E) vinylphosphonate-2’-O-methoxy-ethyl-5-methyluridine-3’-phosphate (vpt4) substitutes one or more nucleotide in a passenger strand and / or a guide strand. In some instances, the 5 ’(E) vinylphosphonate-2’-O-methoxy-ethyl-5-methyluridine-3’-phosphate (vpt4) substitutes one or more nucleotide in a passenger strand. In some instances, the 5 ’(E) vinylphosphonate-2’-O- methoxy-ethyl-5-methyluridine-3’ -phosphate (vpt4) substitutes one or more nucleotide in a guide strand.
[0145] In some instances, the amidite structure of 5 ’(E) vinylphosphonate-2-O-methyluridine- 3 ’phosphate (vpu) is shown as below:
[0146] In some instances, the 5’(E) vinylphosphonate-2-O-methyluridine-3’ phosphate (vpu) is incorporated into the polynucleic acid molecule. In some instances, the 5 ’(E) vinylphosphonate-2- O-methyluridine-3 ’phosphate (vpu) is incorporated into the siRNA. In some instances, the 5 ’(E) vinylphosphonate-2-O-methyluridine-3 ’phosphate (vpu) is incorporated into a guide strand. In some instances, the 5’(E) vinylphosphonate-2-O-methyluridine-3’phosphate (vpu) is incorporated into a passenger strand. In some instances, the 5 ’(E) vinylphosphonate-2-O-methyluridine- 3’phosphate (vpu) is located at the 5’ end of a guide strand. In some instances, the 5’(E) vinylphosphonate-2-O-methyluridine-3’phosphate (vpu) is located at the 5’ end of a passenger strand. In some instances, an incorporated 5 ’(E) vinylphosphonate-2-O-methyluridine-3 ’phosphate (vpu) has a structure shown as below:
[0147] In some instances, the 5 ’(E) vinylphosphonate-2-O-methyluridine-3’ phosphate (vpu) substitutes one or more nucleotide in siRNA. In some instances, the 5 ’(E) vinylphosphonate-2-O- methyluridine-3 ’ phosphate (vpu) substitutes one or more nucleotide in a passenger strand and / or a guide strand. In some instances, the 5 ’(E) vinylphosphonate-2-O-methyluridine-3 ’phosphate (vpu) substitutes one or more nucleotide in a passenger strand. In some instances, the 5 ’(E)vinylphosphonate-2-O-methyluridine-3 ’phosphate (vpu) substitutes one or more the nucleotide in a guide strand.The Amount and Location of Modifications
[0148] In some aspects, the polynucleotide molecule described herein comprises one or more type of modifications as described above. Accordingly, in some aspects, about 10% of the nucleotides from the polynucleotide molecule described herein are modified with one or more type of modifications as described above. In some aspects, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% of the nucleotides from the polynucleotide molecule described herein are modified with one or more type of modifications as described above.
[0149] In some aspects, the one or more types of modifications described herein occurs at different positions within the polynucleotide molecule described herein. In some aspects, the one or more types of modifications described herein occurs in the seed region within the polynucleotide molecule described herein. In some aspects, the one or more types of modifications described herein occurs at 3’ end of the polynucleotide molecule described herein. In some aspects, the one or more types of modifications described herein occurs at 5’ end of the polynucleotide molecule described herein. In some aspects, the one or more types of modifications described herein occurs dispersedly within the polynucleotide molecule described herein. In some aspects, the one or more types of modifications described herein occurs in clusters within the polynucleotide molecule described herein.
[0150] In some aspects, the polynucleic acid molecule is modified with a nucleotide analogue described herein by incorporating the nucleotide analogue in a seed region of the guide strand (positions 2-8 from 5’ end of the guide strand). As described herein, “seed region” refers to a region on the polynucleic acid molecule that comprises sequence that is essential for the binding of the polynucleic acid molecule described herein to the target RNA.
[0151] In some instances, the polynucleic acid molecule is modified with a nucleotide analogue described herein at positions 3-8, positions 4-8, positions 5-8, positions 6-8, or positions 7-8 from the 5’ end of the guide strand. In some instances, the polynucleic acid molecule is modified with a nucleotide analogue described herein at position 2, position 3, position 4, position 5, position 6, position 7, position 8, position 9, position 10, position 11, position 12, position 13, position 14, position 15, position 16, position 17, position 18, position 19, or a combination thereof, from the 5’ end of the guide strand or combination thereof. In some instances, the polynucleic acid molecule is modified with one, two, three, four, five, six, or seven nucleotide analogues. In some instances, two or more consecutive positions in the guide strand of the polynucleic acid molecule aremodified with nucleotide analogues. In some instances, two or more nucleotide analogue modifications can be placed in the polynucleic acid molecule at alternative positions (e.g., positions 3 and 5, positions 4 and 6, positions 5 and 7, etc.).
[0152] In some instances, the polynucleic acid molecule comprises a polynucleic acid molecule. In some instances, the polynucleic acid molecule is an siRNA comprising a guide strand and a passenger strand. In some instances, the nucleotide analogue is located at the seed region of the guide strand at positions 2-8 from the 5’ end. In some instances, the nucleotide analogue is located at positions 3-8 from the 5’ end. In some instances, the nucleotide analogue is located at positions 4-8 from the 5’ end. In some instances, the nucleotide analogue is located at positions 5-8 from the 5’ end. In some instances, the nucleotide analogue is located at positions 6-8 from the 5’ end. the nucleotide analogue is located at positions 6-7 from the 5’ end. In some instances, the nucleotide analogue is located at positions 7-8 from the 5’ end.
[0153] In some instances, the nucleotide analogue is located at any one of positions 2-8 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at any one of positions 3-8 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at any one of positions 4-8 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at any one of positions 5-8 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at any one of positions 6-8 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at any one of positions 6-7 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at any one of positions 7-8 from the 5’ end of the guide strand.
[0154] In some instances, the nucleotide analogue is located at position 1 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 2 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 3 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 4 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 5 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 6 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 7 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 8 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 9 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 10 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 11 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 12 from the 5’ end of the guide strand. In some instances,the nucleotide analogue is located at position 13 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 14 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 15 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 16 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 17 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 18 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 19 from the 5’ end of the guide strand.
[0155] In some instances, the nucleotide analogue is located at position 3 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 3 from the 5’ end of the guide strand, and the guide strand further comprises 2-thiouridine-3’ -phosphate nucleotide. In some instances, the nucleotide analogue located at position 3 from the 5’ end of the guide strand, and the guide strand further comprises 2 ’-O-methyl-2-thiouridine-3’ -phosphate (u3). In some instances, the nucleotide analogue is located at position 3 from the 5’ end of the guide strand, and the guide strand further comprises at least one, at least two, at least three, or at least four 2’ -fluoro modified nucleotides. In some instances, the nucleotide analogue is located at position 3 from the 5’ end of the guide strand, and the guide strand further comprises 2’ -fluoro modified nucleotides at at least one of positions 2, 7, 12, 14, and 16 from the 5’ end. In some instances, the nucleotide analogue is located at position 3 from the 5’ end of the guide strand, and the guide strand further comprises 2’-fluoro modified nucleotides at positions 2, 7, 12, 14, and 16 from the 5’ end.Specific Modification Patterns
[0156] In some aspects, described herein is a specific modification pattern for the polynucleic acid molecule which is a double- stranded nucleic acid molecule comprising a passenger strand and a guide strand. In some aspects, the guide strand comprises a 2’-fluoro modified nucleotide in position 2. In some aspects, the guide strand comprises a 2’ -fluoro modified nucleotide in position 14. In some aspects, the guide strand comprises 2’-fluoro modified nucleotides in positions 2 and 14. In some aspects, the guide strand comprises a 2’-fluoro modified nucleotide in position 12. In some aspects, the guide strand comprises a 2’ -fluoro modified nucleotide in position 16. In other aspects, the guide strand comprises a 2’ -fluoro modified nucleotide in position 6. In other aspects, the guide strand comprises a 2’-fluoro modified nucleotide in position 7. In other aspects, the guide strand comprises a 2’-fluoro modified nucleotide in position 8. In other aspects, the guide strand comprises a 2’ -fluoro modified nucleotide in position 9. In other aspects, the guide strand comprises a 2’ -fluoro modified nucleotide in position 4.
[0157] In some aspects, described herein is a specific modification pattern for the polynucleic acid molecule which is a double- stranded nucleic acid molecule comprising a passenger strand and a guide strand. In some aspects, the passenger strand comprises a 2’ -fluoro modified nucleotide in position 9. In some aspects, the passenger strand comprises a 2’ -fluoro modified nucleotide in position 11. In some aspects, the passenger strand comprises 2’-fluoro modified nucleotides in positions 9 and 11. In some aspects, the passenger strand comprises a 2’-fluoro modified nucleotide in position 7. In some aspects, the passenger strand comprises a 2’ -fluoro modified nucleotide in position 10. In some aspects, the passenger strand comprises 2’-fluoro modified nucleotides in positions 9, 11, and 7. the passenger strand comprises 2’ -fluoro modified nucleotides in positions 9 and 11, and 10. the passenger strand comprises 2’ -fluoro modified nucleotides in positions 9 and 7. the passenger strand comprises 2’ -fluoro modified nucleotides in positions 9 and 10. the passenger strand comprises 2’ -fluoro modified nucleotides in positions 9, 11, 7, and 10. In other aspects, the passenger strand comprises a 2’ -fluoro modified nucleotide in position 8. In other aspects, the passenger strand comprises a 2’-fluoro modified nucleotide in position 12. In other aspects, the passenger strand comprises a 2’-fluoro modified nucleotide in position 16.
[0158] In some aspects, the passenger strand and the guide strand of the polynucleic acid molecule comprises any combination of two or more 2’ -fluoro modified nucleotides at the positions described in the above two paragraphs.
[0159] In some aspects, the guide strand comprises 5’ - nNfnnnnNfnnnnNfnNfnNfnnnnnnn -3’. In some aspects, the passenger strand comprises 5’- nnnnnnNfnNfnNfnnnnnnnnnn -3’. In the modification patterns described above, “Nf’ stands for a 2’ -fluoro modified nucleotide, and wherein “n” stands for a 2’-O-methyl modified nucleotide.
[0160] In some aspects, the passenger strand comprises 5’ - nnnnnnNfnNfnNfnnnnnnnnnn -3’, and the guide strand comprises 5’ - nNfnnnnNfnnnnNfnNfnNfnnnnnnn -3’, where “Nf’ stands for a 2’- fluoro modified nucleotide, and “n” stands for a 2’-O-methyl modified nucleotide.
[0161] In some aspects, described herein is a specific modification pattern for the polynucleic acid molecule which is a double-stranded nucleic acid molecule comprising a passenger strand and a guide strand, wherein the passenger strand comprises about three 2’-fluoro modified nucleotides and about eighteen 2’-O-methyl modified nucleotides, and wherein the guide strand comprises about three 2’-fluoro modified nucleotides and about twenty 2’-O-methyl modified nucleotides.
[0162] In some aspects, described herein is a specific modification pattern for the polynucleic acid molecule which is a double-stranded nucleic acid molecule comprising a passenger strand and a guide strand, wherein the passenger strand comprises about three 2’-fluoro modified nucleotidesand about eighteen 2’-O-methyl modified nucleotides, and wherein the guide strand comprises about four 2’ -fluoro modified nucleotides and about nineteen 2’-O-methyl modified nucleotides.
[0163] In some aspects, described herein is a specific modification pattern for the polynucleic acid molecule which is a double-stranded nucleic acid molecule comprising a passenger strand and a guide strand, wherein the passenger strand comprises about three 2’-fluoro modified nucleotides and about eighteen 2’-O-methyl modified nucleotides, and wherein the guide strand comprises about five 2’-fluoro modified nucleotides and about eighteen 2’-O-methyl modified nucleotides.
[0164] In some aspects, described herein is a specific modification pattern, wherein the passenger strand comprises 5’- nnnnnnNfnNfnNfnnnnnnnnnn -3’, wherein the guide strand comprises 5’- nNfnnnnNfnnnnNfnNfnNfnnnnnnn -3’, wherein “Nf’ stands for a 2’-fluoro modified nucleotide, and wherein “n” stands for a 2’-O-methyl modified nucleotide.
[0165] In some aspects, described herein is a specific modification pattern, wherein the passenger strand comprises 5’- nnnnnnNfnNfnNfnnnnnnnnnn -3’, wherein the guide strand comprises 5’- nNfnnnnNfnnnnnnNfnNfnnnnnnn -3’, wherein the passenger strand and / or guide strand comprises one or more phosphorothioate linkage, wherein “Nf’ stands for a 2’ -fluoro modified nucleotide, and wherein “n” stands for a 2’-O-methyl modified nucleotide.
[0166] In some aspects, the guide strand comprises 5’ - nsNfsnnnnNfnnnnNfnNfnNfnnnnnsnsn-3 ’ . In some aspects, the guide strand comprises 5’ - nsNfsnnnnNfnnnnnnNfnNfnnnnnsnsn-3’. In the modification patterns described above, “Nf’ stands for a 2’ -fluoro modified nucleotide, “n” stands for a 2’-O-methyl modified nucleotide, and “s” stands for phosphorothioate linkages.
[0167] In some aspects, the passenger strand comprises 5’ - nsnsnnnnNfnNfnNfnnnnnnnnnn-3’. In the modification patterns described above, “Nf ’ stands for a 2 ’-fluoro modified nucleotide, “n” stands for a 2’-O-methyl modified nucleotide, and “s” stands for phosphorothioate linkages.
[0168] In some instances, the guide strand comprises a modification pattern described herein and one or more phosphorothioate internucleotide linkage. In some instances, the passenger strand comprises a modification pattern described herein and one or more phosphorothioate internucleotide linkage.
[0169] In some aspects, described herein is a specific modification pattern, wherein the passenger strand comprises 5 ’-nsnsnnnnNfnNfnNfnnnnnnnnnn-3’, wherein the guide strand comprises 5’- nsNfsnnnnNfnnnnNfnNfnNfnnnnnsnsn-3’, wherein the passenger comprises two phosphorothioate linkages, wherein “s” stands for phosphorothioate linkages, wherein “Nf’ stands for a 2’ -fluoro modified nucleotide, and wherein “n” stands for a 2’-O-methyl modified nucleotide.
[0170] In some aspects, described herein is a specific modification pattern, wherein the passenger strand comprises 5 ’-nsnsnnnnNfnNfnNfnnnnnnnnnn-3’, wherein the guide strand comprises 5’-nsNfsnnnnNfnnnnnnNfnNfnnnnnsnsn-3’, wherein the passenger comprises two phosphorothioate linkages, wherein “s” stands for phosphorothioate linkages, wherein “Nf” stands for a 2’ -fluoro modified nucleotide, and wherein “n” stands for a 2’-O-methyl modified nucleotide.
[0171] In some aspects, described herein is a specific modification pattern, wherein the passenger strand and / or guide strand is modified as Type I in Table 17.Table 17. Nucleotide Modification PatternsNote: “Nf ’ stands for a 2’ -fluoro modified nucleotide, “n” stands for a 2’-O-methyl modified nucleotide, and “s” stands for a 3 '-phosphorothioate linkage.
[0172] In some aspects, the polynucleotide molecule provided herein comprises a passenger strand from a nucleic acid sequence of SEQ ID NOs: 331-658, 1332-1344, 1384-1396, and 1433-1443 and a guide strand comprises a nucleic acid sequence of SEQ ID NOs: 1-328, 1319-1331, 1371-1383, and 1423-1432. In other aspects, the polynucleotide molecule provided herein comprises a passenger strand from a nucleic acid sequence of SEQ ID NOs: 331-658, 1332-1344, 1384-1396, and 1433-1443, a guide strand comprises a nucleic acid sequence of SEQ ID NOs: 1-328, 1319- 1331, 1371-1383, and 1423-1432, and wherein the passenger strand and / or guide strand is modified in Type I or II modification pattern specified in Table 17. In some aspects, the polynucleotide molecule provided herein comprises a passenger strand from a nucleic acid sequence of SEQ ID NOs: 1332-1344, 1384-1396, and 1433-1443 and a guide strand comprises a nucleic acid sequence of SEQ ID NOs: 1319-1331, 1371-1383, and 1423-1432. In other aspects, the polynucleotide molecule provided herein comprises a passenger strand from a nucleic acid sequence of SEQ ID NOs: 1332-1344, 1384-1396, and 1433-1443, a guide strand comprises a nucleic acid sequence of SEQ ID NOs: 1319-1331, 1371-1383, and 1423-1432, and wherein the passenger strand and / or guide strand is modified in Type I modification pattern specified in Table 17.
[0173] In some aspects, described herein is a specific modification pattern, wherein the passenger strand is fully modified and comprises three 2’ -fluoro modified nucleotides, eighteen 2’-O-methylmodified nucleotides, and wherein the guide strand is fully modified and comprises four 2’ -fluoro modified nucleotides, nineteen 2’-O-methyl modified nucleotides.
[0174] In some aspects, described herein is a specific modification pattern, wherein the passenger strand is fully modified and comprises three 2’-fluoro modified nucleotides and eighteen 2’-O- methyl modified nucleotides, and wherein the guide strand is fully modified and comprises five 2’- fluoro modified nucleotides, eighteen 2’-O-methyl modified nucleotides.
[0175] In some aspects, described herein is a specific modification pattern, wherein the passenger strand and / or guide strand is modified as Type I in Table 17.
[0176] In some aspects, the polynucleotide molecule provided herein comprises a passenger strand comprising a nucleic acid sequence of SEQ ID NOs: 331-658, 1332-1344, 1384-1396, and 1433- 1443, and / or a guide strand comprising a nucleic acid sequence of SEQ ID NOs: 1-328, 1319-1331, 1371-1383, and 1423-1432, and wherein the passenger strand and / or guide strand is modified in Type I modification pattern specified in Table 17. In other aspects, the polynucleotide molecule provided herein comprises a passenger strand comprising a nucleic acid sequence of SEQ ID NOs: 1332-1344, 1384-1396, and 1433-1443, and / or a guide strand comprising a nucleic acid sequence of SEQ ID NOs: 1319-1331, 1371-1383, and 1423-1432, and wherein the passenger strand and / or guide strand is modified in Type I modification pattern specified in Table 17.
[0177] In some aspects, described herein is a specific modification pattern, wherein the passenger strand comprises 5’- nnnnnnNfnNfnNfnnnnnnnnnn-invdN-invdN -3’, wherein “Nf’ stands for a 2’- fluoro modified nucleotide, wherein “n” stands for a 2’-O-methyl modified nucleotide, and “invdN” stands for an inverted deoxy -nucleotide. In some instances, the invdN is an inverted deoxy 1 -thymine. In some aspects, the linker conjugated with one or more targeting moieties as shown in Formula (IV’”) is added to the first nucleic acid on the 5’ end. In some aspects, the linker conjugated with one or more GalNAc as shown in Formula (V’”) is added to the first nucleic acid on the 5’ end. In some aspects, the modification pattern comprises one or more phosphorothioate linkages. In some aspects, the modification pattern is shown in Formula (VII). In some aspects, the 5’ end modification known in the art is applied to the one or more inverted nucleotides.wherein R is a moiety that corresponds to the sugar modification described herein, in some instances, R is -O-methyl; wherein R’ is thymine, abasic, or others; wherein A is -O or -S; and wherein A’ is -O or -S.
[0178] In some aspects, described herein is a specific modification pattern, wherein the passenger strand comprises 5’-nsnsnnnnNfnNfnNfnnnnnnnnnn-3’, where “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, and “s” stands for phosphorothioate intemucleotide linkage.
[0179] In some aspects, the polynucleotide molecule provided herein comprises a passenger strand comprising a nucleic acid sequence of SEQ ID NOs: 331-658, 1332-1344, 1384-1396, and 1433- 1443, and / or a guide strand comprising a nucleic acid sequence of SEQ ID NOs: 1-328, 1319-1331, 1371-1383, and 1423-1432, and wherein the passenger strand is modified in Type II modification pattern specified in Table 17 or as described in the preceding paragraph. In other aspects, the polynucleotide molecule provided herein comprises a passenger strand comprising a nucleic acid sequence of SEQ ID NOs: 1332-1344, 1384-1396, and 1433-1443, and / or a guide strand comprising a nucleic acid sequence of SEQ ID NOs: 1319-1331, 1371-1383, and 1423-1432, and wherein the passenger strand is modified in Type II modification pattern specified in Table 17 or as described in the preceding paragraph.
[0180] Described herein is a polynucleic acid molecule, whose passenger strand comprises a nucleic acid sequence that is at least 80% identical to a nucleic acid sequence selected from SEQ ID NOs: 991-1318, 1358-1370, 1410-1422, and 1463-1475. Described herein is a polynucleic acid molecule, whose passenger strand comprises a nucleic acid sequence that is at least 85% identical to a nucleic acid sequence selected from SEQ ID NOs: 991-1318, 1358-1370, 1410-1422, and 1463-1475. Described herein is a polynucleic acid molecule, whose passenger strand comprises a nucleic acid sequence that is at least 90% identical to a nucleic acid sequence selected from SEQ ID NOs: 991-1318, 1358-1370, 1410-1422, and 1463-1475. Described herein is a polynucleic acidmolecule, whose passenger strand comprises a nucleic acid sequence that is at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 991-1318, 1358-1370, 1410-1422, and 1463-1475. In some instances, the passenger strand comprises a nucleic acid sequence that is at least 15, 16, 17, 18, 19 consecutive nucleotides of the nucleic acid sequence selected from SEQ ID NOs: 991-1318, 1358-1370, 1410-1422, and 1463-1475, with no more than 1, 2, 3, or 4 mismatches.
[0181] Described herein is a polynucleic acid molecule, which guide strand comprises a nucleic acid sequence that is at least 80% identical to a nucleic acid sequence selected from SEQ ID NOs: 661-988, 1345-1357, 1397-1409, and 1444-1462. Described herein is a polynucleic acid molecule, which guide strand comprises a nucleic acid sequence that is at least 85% identical to a nucleic acid sequence selected from SEQ ID NOs: 661-988, 1345-1357, 1397-1409, and 1444-1462. Described herein is a polynucleic acid molecule, which guide strand comprises a nucleic acid sequence that is at least 90% identical to a nucleic acid sequence selected from SEQ ID NOs: 661-988, 1345-1357, 1397-1409, and 1444-1462. Described herein is a polynucleic acid molecule, which guide strand comprises a nucleic acid sequence that is at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 661-988, 1345-1357, 1397-1409, and 1444-1462. In some instances, the guide strand comprises a nucleic acid sequence that is at least 15, 16, 17, 18, 19 consecutive nucleotides of the nucleic acid sequence selected from SEQ ID NOs: 661-988, 1345-1357, 1397-1409, and 1444-1462, with no more than 1, 2, 3, or 4 mismatches.
[0182] In some instances, the guide stand comprises or consists of a nucleic acid sequence selected from SEQ ID NO: 661-988, 1345-1357, 1397-1409, and 1444-1462, and the passenger stand comprises or consists of a nucleic acid sequence selected from SEQ ID NO: 991-1318, 1358-1370, 1410-1422, and 1463-1475.
[0183] In some aspects, the guide strand comprises a nucleotide analogue at one of positions 2-8 from the 5’ end, and further comprises a 2’-fluoro modified nucleotide at position 2 from the 5’ end. In some aspects, the guide strand comprises a nucleotide analogue at one of positions 2-8 from the 5’ end, and further comprises a 2’ -fluoro modified nucleotide at position 7 from the 5’ end. In some aspects, the guide strand comprises a nucleotide analogue at one of positions 2-8 from the 5’ end, and further comprises 2’-fluoro modified nucleotides at position 12 from the 5’ end. In some aspects, the guide strand comprises a nucleotide analogue at one of positions 2-8 from the 5’ end, and further comprises a 2’-fluoro modified nucleotide at position 14 from the 5’ end. In some aspects, the guide strand comprises a nucleotide analogue at one of positions 2-8 from the 5’ end, and further comprises a 2’ -fluoro modified nucleotide at position 16 from the 5’ end. In other aspects, the guide strand comprises a nucleotide analogue at one of positions 2-8 from the 5’ end,and further comprises a 2’-fluoro modified nucleotide at positions 2, 12, 14, 16, or combination thereof from the 5’ end. In other aspects, the guide strand comprises a nucleotide analogue at one of positions 2-8 from the 5’ end, and further comprises a 2’-fluoro modified nucleotide at positions 2, 7, 12, 14, 16, or combination thereof from the 5’ end. In other aspects, the guide strand comprises a nucleotide analogue at one of positions 2-8 from the 5’ end, and further comprises a 2’ -fluoro modified nucleotide at at least three of positions 2, 12, 14, and 16 from the 5’ end. In other aspects, the guide strand comprises a nucleotide analogue at one of positions 2-8 from the 5’ end, and further comprises a 2’-fluoro modified nucleotide at at least three of positions 2, 7, 12, 14, and 16 from the 5’ end.
[0184] In some instances, the nucleotide analogue is located at position 6 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 6 from the 5’ end of the guide strand, and the guide strand further comprises 2’-fluoro modified nucleotides at at least one of positions 2, 7, 12, 14, and 16 from the 5’ end. In some instances, the nucleotide analogue is located at position 6 from the 5’ end of the guide strand, and the guide strand further comprises 2’- fluoro modified nucleotides at at least two of positions 2, 7, 12, 14, and 16 from the 5’ end. In some instances, the nucleotide analogue is located at position 6 from the 5’ end of the guide strand, and the guide strand further comprises 2’-fluoro modified nucleotides at at least three of positions 2, 7, 12, 14, and 16 from the 5’ end. In some instances, the nucleotide analogue is located at position 6 from the 5’ end of the guide strand, and the guide strand further comprises 2’ -fluoro modified nucleotides at positions 2, 7, 12, 14, and 16 from the 5’ end.
[0185] In some instances, the nucleotide analogue is located at position 7 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 7 from the 5’ end of the guide strand, and the guide strand further comprises 2’ -fluoro modified nucleotides at at least one of positions 2, 6, 8, 12, 14, and 16 from the 5’ end. In some instances, the nucleotide analogue is located at position 7 from the 5’ end of the guide strand, and the guide strand further comprises 2’-fluoro modified nucleotides at at least one of positions 2, 12, 14, and 16 from the 5’ end. In some instances, the nucleotide analogue is located at position 7 from the 5’ end of the guide strand, and the guide strand further comprises 2’-fluoro modified nucleotides at at least two of positions 2, 12, 14, and 16 from the 5’ end. In some instances, the nucleotide analogue is located at position 7 from the 5’ end of the guide strand, and the guide strand further comprises 2’ -fluoro modified nucleotides at at least three of positions 2, 12, 14, and 16 from the 5’ end. In some instances, the nucleotide analogue is located at position 7 from the 5’ end of the guide strand, and the guide strand further comprises 2’-fluoro modified nucleotides at positions 2, 12, 14, and 16 from the 5’ end. In some instances, the nucleotide analogue is located at position 7 from the 5’ end of the guidestrand, and the guide strand comprises 2’-fluoro modified nucleotides at positions 2, 6, 12, 14, and 16 from the 5’ end. In some instances, the nucleotide analogue is located at position 7 from the 5’ end of the guide strand, and the guide strand comprises 2’ -fluoro modified nucleotides at positions 2, 8, 12, 14, and 16 from the 5’ end.
[0186] In some instances, the nucleotide analogue is located at position 8 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 8 from the 5’ end of the guide strand, and the guide strand further comprises 2’-fluoro modified nucleotides at at least one of positions 2, 7, 12, 14, and 16 from the 5’ end. In some instances, the nucleotide analogue is located at position 8 from the 5’ end of the guide strand, and the guide strand further comprises 2’- fluoro modified nucleotides at at least two of positions 2, 7, 12, 14, and 16 from the 5’ end. In some instances, the nucleotide analogue is located at position 8 from the 5’ end of the guide strand, and the guide strand further comprises 2’-fluoro modified nucleotides at at least three of positions 2, 7, 12, 14, and 16 from the 5’ end. In some instances, the nucleotide analogue is located at position 8 from the 5’ end of the guide strand, and the guide strand further comprises 2’ -fluoro modified nucleotides at positions 2, 7, 12, 14, and 16 from the 5’ end.
[0187] In some instances, the nucleotides of the guide strand comprises DNA or RNA. As described herein, in some instances, the DNA nucleotide comprises an unmodified DNA comprising: an unmodified adenine nucleotide (A), an unmodified guanine nucleotide (G), an unmodified thymine nucleotide (T), or an unmodified cytosine nucleotide (C). As described herein, in some instances, the RNA comprises an unmodified RNA comprising: an unmodified adenine nucleotide (A), an unmodified guanine nucleotide (G), an unmodified uracil nucleotide (U), or an unmodified cytosine nucleotide (C).
[0188] In some instances, the nucleotides of the guide strand comprises the DNA, RNA, nucleotide analogue, 2’ -fluoro modified nucleotide, or 2’-O-alkyl modified nucleotide. In some instances, the 2’-O-alkly modified nucleotide comprises 2’-O-methyl modified nucleotides. In some instances, the nucleotides of the guide strand that are not the nucleotide analogue or 2’ -fluoro modified nucleotide are selected from DNA nucleotide, RNA nucleotide, and 2’-O-alkly modified nucleotide. In some instances, the nucleotides of the guide strand that are not the nucleotide analogue or 2’-fluoro modified nucleotide are 2’-O-methyl modified nucleotides.
[0189] In some instances, the guide strand comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight phosphorothioate modified internucleotide linkages. In some instances, the guide strand comprises at least two, at least three, or at least four phosphorothioate modified internucleotide linkages. In some instances, the guide strand comprises at most one, at most two, at most three, at most four, at most five, at most six, atmost seven, or at most eight phosphorothioate modified internucleotide linkages. In some instances, the guide strand comprises one, two, three, four, five, six, seven, or eight phosphorothioate modified internucleotide linkages. In some instances, the guide strand comprises from 1 to 8, from 2 to 8, from 3 to 8, from 4 to 8, from 5 to 8, or from 6 to 8 phosphorothioate modified internucleotide linkages. In some instances, the guide strand comprises from 1 to 4, from 2 to 4, or from 3 to 4 phosphorothioate modified intemucleotide linkages.
[0190] In some instances, the guide strand comprises one phosphorothioate modified internucleotide linkages at the 5’ end and one phosphorothioate modified intemucleotide linkages at the 3’ end. In some instances, the guide strand comprises two phosphorothioate modified intemucleotide linkages at the 5’ end and two phosphorothioate modified intemucleotide linkages at the 3’ end. In some instances, the guide strand comprises three phosphorothioate modified intemucleotide linkages at the 5’ end and three phosphorothioate modified intemucleotide linkages at the 3’ end. In some instances, the guide strand comprises four phosphorothioate modified intemucleotide linkages at the 5’ end and four phosphorothioate modified intemucleotide linkages at the 3’ end.
[0191] In some instances, the guide strand comprises a modification pattern described herein and a nucleotide analogue described herein. In some instances, the passenger strand comprises a modification pattern described herein and a nucleotide analogue described herein.
[0192] In some instances, the guide strand comprises 2’-O-methyl modified nucleotide, 2’-fluoro modified nucleotide, nucleotide analogue described herein. In some instances, the guide strand comprises a nucleic acid sequence of 5’ - nNfnnnnXnnnnNfnNfnNfnnnnnnn-3’, wherein “n” stands for a 2’-O-methyl modified nucleotide, “Nf ’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’ -phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 'phosphate (T- NAc), l',2'-Dideoxyribose-3 '-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’ -O-methyl-2-thiouridine-3’ -phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2- amino-2’-O-methyladenosine-3’-phosphate (al), 2'-methoxyethyladenosine-3'phosphate (A6), 2'- methoxyethyluridine-3'-phosphate (U6), and 2'-O-methylinosine-3 '-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- nNfnnnnXnnnnNfnNfnNfnnnnnnn-3’, wherein “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’-phosphate (T-A), and 2'- O-methylinosine-3 '-phosphate (i).
[0193] In some aspects, described herein is a specific modification pattern for a double stranded polynucleic acid molecule comprising a passenger strand and a guide strand. In some instances, the guide strand comprises a nucleic acid sequence of 5’-nNfnnnnXnnnnNfnNfnNfnnnnnnn -3’, and the passenger strand comprises 5’-nnnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’- O-methyl modified nucleotide, “Nf’ stands for a 2’-fluoro modified nucleotide, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 'phosphate (T-NAc), l',2'-Dideoxyribose-3 '-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2- thiouridine-3’ -phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (al), and 2'-O- methylinosine-3 '-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’-nNfnnnnXnnnnNfnNfnNfnnnnnnn -3’, and the passenger strand comprises 5’- nnnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’-fluoro modified nucleotide, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’-phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i).
[0194] In some instances, the guide strand comprises a modification pattern described herein, one or more phosphorothioate internucleotide linkage, and further comprises a nucleotide analogue described herein. In some instances, the passenger strand comprises a modification pattern described herein, one or more phosphorothioate intemucleotide linkage, and further comprises a nucleotide analogue described herein.
[0195] In some instances, the guide strand comprises 2’-O-methyl modified nucleotide, 2’-fluoro modified nucleotide, nucleotide analogue described herein, or phosphorothioate internucleotide linkage. In some instances, the guide strand comprises one or more phosphorothioate modified internucleotide linkages at the 5’ end and one or more phosphorothioate modified intemucleotide linkages at the 3’ end. In some instances, the guide strand comprises two phosphorothioate modified intemucleotide linkages at the 5’ end and two phosphorothioate modified intemucleotide linkages at the 3’ end. In some instances, the polynucleic acid molecule described herein comprises the phosphorothioate intemucleotide linkage located between the two nucleotides at position 11 and 12 from the 5’ end of the guide strand.
[0196] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnXnnnnNfnNfnNfnnnnnsnsn-3’, wherein “n” stands for a 2’-O-methyl modifiednucleotide, “Nf” stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L- threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’- phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 'phosphate (T-NAc), 1 ',2'- Dideoxyribose-3 '-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O- methyl-2-thiouridine-3’ -phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O- methyladenosine-3’ -phosphate (al), 2'-methoxyethyladenosine-3'phosphate (A6), 2'- methoxyethyluridine-3'-phosphate (U6), and 2'-O-methylinosine-3 '-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnXnnnnNfnNfnNfnnnnnsnsn-3’, wherein “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L- threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’- phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i).
[0197] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnXNfnnnnNfnNfnNfnnnnnsnsn-3’, wherein “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L- threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’- phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 'phosphate (T-NAc), 1 ',2'- Dideoxyribose-3 '-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O- methyl-2-thiouridine-3’ -phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O- methyladenosine-3’ -phosphate (al), 2'-methoxyethyladenosine-3'phosphate (A6), 2'- methoxyethyluridine-3'-phosphate (U6), and 2'-O-methylinosine-3 '-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnXNfnnnnNfnNfnNfnnnnnsnsn-3’, wherein “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L- threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’- phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i).
[0198] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnNfXnnnNfnNfnNfnnnnnsnsn -3’, wherein “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’- phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 'phosphate (T-NAc), 1 ',2'- Dideoxyribose-3 '-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O- methyl-2-thiouridine-3’ -phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O- methyladenosine-3’ -phosphate (al), 2'-methoxyethyladenosine-3'phosphate (A6), 2'- methoxyethyluridine-3'-phosphate (U6), and 2'-O-methylinosine-3 '-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnNfXnnnNfnNfnNfnnnnnsnsn -3’, wherein “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L- threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’- phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i).
[0199] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnNfnnnXNfnNfnNfnnnnnsnsn-3’, where “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L- threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’- phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 'phosphate (T-NAc), 1 ',2'- Dideoxyribose-3 '-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn),2’- O-methyl-2-thiouridine-3’ -phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’- O-methyladenosine-3 ’ -phosphate (al), 2'-methoxyethyladenosine-3'phosphate (A6), 2'- methoxyethyluridine-3'-phosphate (U6), and 2'-O-methylinosine-3 '-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnNfnnnXNfnNfnNfnnnnnsnsn -3’ , where “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L- threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’- phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i).
[0200] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnXNfnnnXNfnNfnNfnnnnnsnsn -3’, where “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L- threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’- phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 'phosphate (T-NAc), 1 ',2'-Dideoxyribose-3 '-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’- O-methyl-2-thiouridine-3’ -phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’- O-methyladenosine-3 ’ -phosphate (al), 2'-methoxyethyladenosine-3'phosphate (A6), 2'- methoxyethyluridine-3'-phosphate (U6), and 2'-O-methylinosine-3 '-phosphate (i).. In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnXNfnnnXNfnNfnNfnnnnnsnsn -3’, where “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L- threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’- phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’ - nsNfsnnnXiNfnnnX2NfnNfnNfnnnnnsnsn - 3’, where “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, “Xi” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T) and acyclic L-threoninol nucleic acid-adenine-3 ’-phosphate (T-A), and “X2” stands for a nucleotide analogue, e.g., 2'-O- methylinosine-3 '-phosphate (i).
[0201] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnNfnnnnXnNfnNfnnnnnsnsn - 3’, where “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L- threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’- phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 'phosphate (T-NAc), 1 ',2'- Dideoxyribose-3 '-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’- O-methyl-2-thiouridine-3’ -phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’- O-methyladenosine-3 ’ -phosphate (al), 2'-methoxyethyladenosine-3'phosphate (A6), 2'- methoxyethyluridine-3'-phosphate (U6), and 2'-O-methylinosine-3 '-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnNfnnnnXnNfnNfnnnnnsnsn-3’, where “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L- threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’- phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i).
[0202] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnNfnnnnNfXNfnNfnnnnnsnsn - 3’, where “n” stands for a 2’-O-methyl modifiednucleotide, “Nf” stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L- threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’- phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 'phosphate (T-NAc), 1 ',2'- Dideoxyribose-3 '-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’- O-methyl-2-thiouridine-3’ -phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’- O-methyladenosine-3 ’ -phosphate (al), 2'-methoxyethyladenosine-3'phosphate (A6), 2'- methoxyethyluridine-3'-phosphate (U6), and 2'-O-methylinosine-3 '-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnNfnnnnNfXNfnNfnnnnnsnsn-3’, where “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L- threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’- phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i).
[0203] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnNfnnnnNfnNfnNfXnnnnsnsn - 3’, where “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L- threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’- phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 'phosphate (T-NAc), 1 ',2'- Dideoxyribose-3 '-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’- O-methyl-2-thiouridine-3’ -phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’- O-methyladenosine-3 ’ -phosphate (al), 2'-methoxyethyladenosine-3'phosphate (A6), 2'- methoxyethyluridine-3'-phosphate (U6), and 2'-O-methylinosine-3 '-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnNfnnnnNfnNfnNfXnnnnsnsn-3’, where “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L- threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’- phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i).
[0204] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnNfnnnnNfnNfnNfnXnnnsnsn - 3’, where “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’- phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 'phosphate (T-NAc), 1 ',2'- Dideoxyribose-3 '-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’- O-methyl-2-thiouridine-3’ -phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’- O-methyladenosine-3 ’ -phosphate (al), 2'-methoxyethyladenosine-3'phosphate (A6), 2'- methoxyethyluridine-3'-phosphate (U6), and 2'-O-methylinosine-3 '-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnNfnnnnNfnNfnNfnXnnnsnsn-3’, where “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L- threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’- phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i).
[0205] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnXnNfnnnnNfnNfnNfnnnnnsnsn - 3’, where “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L- threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’- phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 'phosphate (T-NAc), 1 ',2'- Dideoxyribose-3 '-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’- O-methyl-2-thiouridine-3’ -phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’- O-methyladenosine-3 ’ -phosphate (al), 2'-methoxyethyladenosine-3'phosphate (A6), 2'- methoxyethyluridine-3'-phosphate (U6), and 2'-O-methylinosine-3 '-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnXnNfnnnnNfnNfnNfnnnnnsnsn-3’, where “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L- threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’- phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i).
[0206] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnXnnnXNfnNfnNfnnnnnsnsn- 3’, where “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L- threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’- phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 'phosphate (T-NAc), 1 ',2'-Dideoxyribose-3 '-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’- O-methyl-2-thiouridine-3’ -phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’- O-methyladenosine-3 ’ -phosphate (al), 2'-methoxyethyladenosine-3'phosphate (A6), 2'- methoxyethyluridine-3'-phosphate (U6), and 2'-O-methylinosine-3 '-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnXnnnXNfnNfnNfnnnnnsnsn-3’, where “n” stands for a 2’-O-methyl modified nucleotide, “Nf” stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L- threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’- phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’ - nsNfsnnnnXinnnX2NfnNfnNfnnnnnsnsn-3’, where “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, “Xi” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T) and acyclic L-threoninol nucleic acid-adenine-3 ’-phosphate (T-A), and “X2” stands for a nucleotide analogue, e.g., 2'-O- methylinosine-3 '-phosphate (i).
[0207] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnXNfnnnnXnNfnNfnnnnnsnsn- 3’, where “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L- threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’- phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 'phosphate (T-NAc), 1 ',2'- Dideoxyribose-3 '-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’- O-methyl-2-thiouridine-3’ -phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’- O-methyladenosine-3 ’ -phosphate (al), 2'-methoxyethyladenosine-3'phosphate (A6), 2'- methoxyethyluridine-3'-phosphate (U6), and 2'-O-methylinosine-3 '-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnXNfnnnnXnNfnNfnnnnnsnsn-3’, where “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L- threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’- phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’ - nsNfsnnnXiNfnnnnX2nNfnNfnnnnnsnsn-3’, where “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s”stands for phosphorothioate intemucleotide linkage, “Xi” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T) and acyclic L-threoninol nucleic acid-adenine-3 ’-phosphate (T-A), and “ X2 stands for a nucleotide analogue, e.g., 2'-O- methylinosine-3 '-phosphate (i).
[0208] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnNfnnnnNfnNfnNfnnXnnsnsn- 3’, where “n” stands for a 2’-O-methyl modified nucleotide, “Nf” stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L- threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’- phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 'phosphate (T-NAc), 1 ',2'- Dideoxyribose-3 '-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’- O-methyl-2-thiouridine-3’ -phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’- O-methyladenosine-3 ’ -phosphate (al), 2'-methoxyethyladenosine-3'phosphate (A6), 2'- methoxyethyluridine-3'-phosphate (U6), and 2'-O-methylinosine-3 '-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnNfnnnnNfnNfnNfnnXnnsnsn-3’, where “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L- threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’- phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i).
[0209] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnXNfnnnnNfnNfnNfnnXnnsnsn- 3’, where “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L- threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’- phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 'phosphate (T-NAc), 1 ',2'- Dideoxyribose-3 '-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’- O-methyl-2-thiouridine-3’ -phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’- O-methyladenosine-3 ’ -phosphate (al), 2'-methoxyethyladenosine-3'phosphate (A6), 2'- methoxyethyluridine-3'-phosphate (U6), and 2'-O-methylinosine-3 '-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnXNfnnnnNfnNfnNfnnXnnsnsn-3’, where “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’- phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’ - nsNfsnnnXiNfnnnnNfnNfnNfnnX2nnsnsn-3’, where “n” stands for a 2’-O-methyl modified nucleotide, “Nf” stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, “Xi” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’ -phosphate (T-A), and “X2” stands for a nucleotide analogue, e.g., 2'-O- methylinosine-3 '-phosphate (i).
[0210] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnNfnXnnNfnNfnNfnnnnnsnsn- 3’, where “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L- threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’- phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 'phosphate (T-NAc), 1 ',2'- Dideoxyribose-3 '-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’- O-methyl-2-thiouridine-3’ -phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’- O-methyladenosine-3 ’ -phosphate (al), 2'-methoxyethyladenosine-3'phosphate (A6), 2'- methoxyethyluridine-3'-phosphate (U6), and 2'-O-methylinosine-3 '-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnNfnXnnNfnNfnNfnnnnnsnsn-3’, where “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L- threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’- phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i).
[0211] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnXnnnnsNfnNfnNfnnnnnsnsn-3’, wherein “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L- threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’- phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 'phosphate (T-NAc), 1 ',2'- Dideoxyribose-3 '-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O- methyl-2-thiouridine-3’ -phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O- methyladenosine-3’ -phosphate (al), 2'-methoxyethyladenosine-3'phosphate (A6), 2'- methoxyethyluridine-3'-phosphate (U6), and 2'-O-methylinosine-3 '-phosphate (i). In someinstances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnXnnnnsNfnNfnNfnnnnnsnsn-3’, wherein “n” stands for a 2’-O-methyl modified nucleotide, “Nf” stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L- threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’- phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i).
[0212] In some instances, the guide strand comprises a modification pattern described herein, a nucleotide analogue, one or more phosphorothioate internucleotide linkage, and further comprises one or more phosphorodithioate intemucleotide linkage. In some instances, the passenger strand comprises a modification pattern described herein, a nucleotide analogue, one or more phosphorothioate internucleotide linkage, and further comprises one or more phosphorodithioate internucleotide linkage. In some instances, the polynucleic acid molecule described herein comprises the phosphorodithioate internucleotide linkage located between the two nucleotides at position 11 and 12 from the 5’ end of the guide strand.
[0213] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnXnnnnssNfnNfnNfnnnnnsnsn-3’, wherein “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, “ss” stands for phosphorodithioate intemucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 'phosphate (T-NAc), l',2'-Dideoxyribose-3'-phosphate (dAB), thymidineglycol nucleic acid (GNA) S-isomer (Tgn), 2’ -O-methyl-2-thiouridine-3’ -phosphate (u3), 2’-fluoro- 2-thiouridine-3 ’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’ -phosphate (al), 2'- m ethoxy ethyladenosine-3 'phosphate (A6), 2'-methoxyethyluridine-3 '-phosphate (U6), and 2'-O- methylinosine-3 '-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnXnnnnssNfnNfnNfnnnnnsnsn-3’, wherein “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, “ss” stands for phosphorodithioate intemucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid- thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’-phosphate (T-A), and 2'- O-methylinosine-3 '-phosphate (i).
[0214] In some aspects, described herein is a specific modification motif of pattern for the doublestranded polynucleic acid molecule comprising a passenger strand and an guide strand. In some aspects, described herein is a specific modification pattern of the passenger strand.
[0215] In some instances, the passenger strand comprises one or more nucleotide analogue. In some instances, the passenger strand comprises one or more nucleotide analogue at locations opposite to the seed region of the guide strand. In some instances, the passenger strand comprises one or more nucleotide analogue at locations 12-22 from the 5’ end. In some instances, the passenger strand comprises one or more nucleotide analogue at locations 2-10 from the 3’ end.
[0216] In some instances, the passenger strand comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight 2’ -fluoro modified nucleotides. In some instances, the passenger strand comprises at least two, at least three, or at least four 2’ -fluoro modified nucleotides. In some instances, the passenger strand comprises at most one, at most two, at most three, at most four, at most five, at most six, at most seven, or at most eight 2’ -fluoro modified nucleotides. In some instances, the passenger strand comprises from one to eight, from two to eight, from three to eight, from four to eight, from five to eight, from six to eight, or from seven to eight 2’ -fluoro modified nucleotides. In some instances, the passenger strand comprises one, two, three, four, five, six, seven, or eight 2’ -fluoro modified nucleotides. In some instances, the passenger strand comprises one 2’-fluoro modified nucleotides. In some instances, the passenger strand comprises two 2’ -fluoro modified nucleotides. In some instances, the passenger strand comprises three 2’ -fluoro modified nucleotides. In some instances, the passenger strand comprises four 2’ -fluoro modified nucleotides. In some instances, the passenger strand comprises five 2’ -fluoro modified nucleotides.
[0217] In some aspects, the passenger strand comprises a 2’-fluoro modified nucleotide at position 7 from the 5’ end. In some aspects, the passenger strand comprises a 2’-fluoro modified nucleotide at position 9 from the 5’ end. In some aspects, the passenger strand comprises 2’-fluoro modified nucleotides at position 11 from the 5’ end. In some aspects, the passenger strand comprises a 2’- fluoro modified nucleotide at at least one of positions 7, 9, and 11 from the 5’ end. In some aspects, the passenger strand comprises a 2’ -fluoro modified nucleotide at positions 7, 9, 11, or combination thereof from the 5’ end. In some aspects, the passenger strand comprises a 2’ -fluoro modified nucleotide at positions 7, 9, and 11 from the 5’ end.
[0218] In some instances, the nucleotides of the passenger strand comprises DNA nucleotide or RNA nucleotide. As described herein, in some instances, the DNA nucleotide comprises an unmodified DNA nucleotide comprising: an unmodified adenine nucleotide (A), an unmodified guanine nucleotide (G), an unmodified thymine nucleotide (T), or an unmodified cytosine nucleotide (C). As described herein, in some instances, the RNA nucleotide comprises an unmodified RNA nucleotide comprising: an unmodified adenine nucleotide (A), an unmodifiedguanine nucleotide (G), an unmodified uracil nucleotide (U), or an unmodified cytosine nucleotide (C).
[0219] In some instances, the nucleotides of the passenger strand comprises the DNA nucleotide, RNA nucleotide, nucleotide analogue, 2’ -fluoro modified nucleotide, or 2’-O-alkyl modified nucleotide. In some instances, the 2’-O-alkly modified nucleotide comprises 2’-O-methyl modified nucleotides. In some instances, the nucleotides of the passenger strand that are not the nucleotide analogue or 2’-fluoro modified nucleotide are selected from 2'-O-alkyl modified nucleotide, 2'- alkoxy modified nucleotide, 2'-alkyl modified nucleotide, 2'-halo modified nucleotide, DNA nucleotide, RNA nucleotide, ENA, BNA, LNA, and UNA. In some instances, the nucleotides in the passenger strand that are not 2’-fluoro modified nucleotide are 2’-O-methyl modified nucleotides.
[0220] In some instances, the passenger strand comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight phosphorothioate modified internucleotide linkages. In some instances, the passenger strand comprises at least two, at least three, or at least four phosphorothioate modified internucleotide linkages. In some instances, the passenger strand comprises at least one phosphorothioate modified internucleotide linkage. In some instances, the passenger strand comprises at most one, at most two, at most three, at most four, at most five, at most six, at most seven, or at most eight phosphorothioate modified internucleotide linkages. In some instances, the passenger strand comprises one, two, three, four, five, six, seven, or eight phosphorothioate modified internucleotide linkages. In some instances, the passenger strand comprises from 1 to 8, from 2 to 8, from 3 to 8, from 4 to 8, from 5 to 8, or from 6 to 8 phosphorothioate modified internucleotide linkages. In some instances, the passenger strand comprises from 1 to 4, from 2 to 4, or from 3 to 4 phosphorothioate modified intemucleotide linkages.
[0221] In some instances, the passenger strand comprises at least one, at least two, at least three, or at least four phosphorothioate modified internucleotide linkage at the 5’ end. In some instances, the passenger strand comprises at least one phosphorothioate modified internucleotide linkage at the 5’ end. In some instances, the passenger strand comprises at least one, at least two, at least three, or at least four phosphorothioate modified internucleotide linkage at the 3’ end. In some instances, the passenger strand comprises at least one phosphorothioate modified internucleotide linkage at the 3’ end.
[0222] In some instances, the passenger strand comprises one phosphorothioate modified internucleotide linkage at the 5’ end. In some instances, the passenger strand comprises two phosphorothioate modified internucleotide linkage at the 5’ end. In some instances, the passengerstrand comprises three phosphorothioate modified intemucleotide linkage at the 5’ end. In some instances, the passenger strand comprises four phosphorothioate modified intemucleotide linkage at the 5’ end.
[0223] In some instances, the passenger strand comprises one phosphorothioate modified intemucleotide linkage at the 3’ end. In some instances, the passenger strand comprises two phosphorothioate modified intemucleotide linkage at the 3’ end. In some instances, the passenger strand comprises three phosphorothioate modified intemucleotide linkage at the 3’ end. In some instances, the passenger strand comprises four phosphorothioate modified intemucleotide linkage at the 3’ end.
[0224] In some instances, the passenger strand comprises one phosphorothioate modified intemucleotide linkages at the 5’ end and one phosphorothioate modified intemucleotide linkages at the 3’ end. In some instances, the passenger strand comprises two phosphorothioate modified intemucleotide linkages at the 5’ end and two phosphorothioate modified intemucleotide linkages at the 3’ end. In some instances, the passenger strand comprises three phosphorothioate modified intemucleotide linkages at the 5’ end and three phosphorothioate modified intemucleotide linkages at the 3’ end. In some instances, the passenger strand comprises four phosphorothioate modified intemucleotide linkages at the 5’ end and four phosphorothioate modified intemucleotide linkages at the 3’ end.
[0225] In some instances, the guide strand comprises a vinyl phosphonate modified nucleotide at the 5’ end. In some instances, the vinyl phosphonate modified nucleotide is 5 ’(E) vinylphosphonate-2’-O-methoxy-ethyl-5-methyluridine-3 ’-phosphate (vpt4) or 5'(E)vinylphosphonate-2-O-methyluridine-3'phosphate (vpu). In some instances, the vinyl phosphonate modified nucleotide substitutes a 5’ end nucleotide of SEQ ID NOs: 1-328, 1319- 1331, and 1371-1383.
[0226] In some aspects, described herein is a specific modification pattern for a double stranded polynucleic acid molecule comprising a passenger strand and a guide strand. In some instances, the guide strand comprises a nucleic acid sequence of 5’-nsNfsnnnnXnnnnNfnNfnNfnnnnnsnsn -3’, and the passenger strand comprises 5’-nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3’ -phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 'phosphate (T- NAc), l',2'-Dideoxyribose-3 '-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’ -O-methyl-2-thiouridine-3’ -phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (al), and 2'-O-methylinosine-3'-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnXnnnnNfnNfnNfnnnnnsnsn -3’, and the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid- thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’-phosphate (T-A), and 2'- O-methylinosine-3 '-phosphate (i).
[0227] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnXNfnnnnNfnNfnNfnnnnnsnsn-3’, and the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid- thymine-3’ -phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 ’phosphate (T-NAc), l ’,2’-Dideoxyribose-3’-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’- phosphate (u3), 2’ -fluoro-2-thiouridine-3’ -phosphate (U3f), or 2-amino-2’-O-methyladenosine-3’- phosphate (al), and 2’-O-methylinosine-3’-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’ - nsNfsnnnXNfnnnnNfnNfnNfnnnnnsnsn -3’, and the passenger strand comprises 5’ - nsnsnnnnNfnNfnNfnnnnnnnnnn-3’, wherein “n” stands for a 2’-O- methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3 ’-phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i).
[0228] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnNfXnnnNfnNfnNfnnnnnsnsn -3’, and the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid- thymine-3 ’-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 ’phosphate (T-NAc), l ’,2’-Dideoxyribose-3’-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’- phosphate (u3), 2’ -fluoro-2-thiouridine-3’ -phosphate (U3f), or 2-amino-2’-O-methyladenosine-3’- phosphate (al), and 2’-O-methylinosine-3’-phosphate (i). In some instances, the guide strandcomprises a nucleic acid sequence of 5’ - nsNfsnnnnNfXnnnNfnNfnNfnnnnnsnsn -3’, and the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’- O-methyl modified nucleotide, “Nf” stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3’ -phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i).
[0229] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnNfnnnXNfnNfnNfnnnnnsnsn-3’, and the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid- thymine-3 ’-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’ -phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 ’phosphate (T-NAc), l ’,2’-Dideoxyribose-3’-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’- phosphate (u3), 2’ -fluoro-2-thiouridine-3’ -phosphate (U3f), or 2-amino-2’-O-methyladenosine-3’- phosphate (al), and 2’-O-methylinosine-3’-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’ - nsNfsnnnnNfnnnXNfnNfnNfnnnnnsnsn-3’, and the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’- O-methyl modified nucleotide, “Nf’ stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3 ’-phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i).
[0230] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnXNfnnnXNfnNfnNfnnnnnsnsn -3’, and the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid- thymine-3 ’-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 ’phosphate (T-NAc), l ’,2’-Dideoxyribose-3’-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’- phosphate (u3), 2’ -fluoro-2-thiouridine-3’ -phosphate (U3f), or 2-amino-2’-O-methyladenosine-3’- phosphate (al), and 2’-O-methylinosine-3’-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’ - nsNfsnnnXNfnnnXNfnNfnNfnnnnnsnsn -3’, and the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3’ -phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’ - nsNfsnnnXiNfnnnX2NfnNfnNfnnnnnsnsn - 3’, and the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, where “n” stands for a 2’ -O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, “Xi” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T) and acyclic L-threoninol nucleic acid-adenine-3’ -phosphate (T-A), and “X2” stands for a nucleotide analogue, e.g., 2'-O- methylinosine-3 '-phosphate (i).
[0231] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnNfnnnnXnNfnNfnnnnnsnsn -3’, and the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’ -O-methyl modified nucleotide, “Nf’ stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid- thymine-3 ’-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 ’phosphate (T-NAc), l ’,2’-Dideoxyribose-3’-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’- phosphate (u3), 2’ -fluoro-2-thiouridine-3’ -phosphate (U3f), or 2-amino-2’-O-methyladenosine-3’- phosphate (al), and 2’-O-methylinosine-3’-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’ - nsNfsnnnnNfnnnnXnNfnNfnnnnnsnsn -3’, and the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’- O-methyl modified nucleotide, “Nf’ stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3 ’-phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i).
[0232] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnNfnnnnNfXNfnNfnnnnnsnsn -3’, and the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’ -O-methyl modified nucleotide, “Nf’ stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid- thymine-3 ’-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 ’phosphate (T-NAc), l ’,2’-Dideoxyribose-3’-phosphate(dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’- phosphate (u3), 2’ -fluoro-2-thiouridine-3’ -phosphate (U3f), or 2-amino-2’-O-methyladenosine-3’- phosphate (al), and 2’-O-methylinosine-3’-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’ - nsNfsnnnnNfnnnnNfXNfnNfnnnnnsnsn -3’, and the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’- O-methyl modified nucleotide, “Nf” stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3’ -phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i).
[0233] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnNfnnnnNfnNfnNfXnnnnsnsn -3’, and the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid- thymine-3 ’-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’ -phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 ’phosphate (T-NAc), l ’,2’-Dideoxyribose-3’-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’- phosphate (u3), 2’ -fluoro-2-thiouridine-3’ -phosphate (U3f), or 2-amino-2’-O-methyladenosine-3’- phosphate (al), and 2’-O-methylinosine-3’-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’ - nsNfsnnnnNfnnnnNfnNfnNfXnnnnsnsn -3’, and the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’- O-methyl modified nucleotide, “Nf’ stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3 ’-phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i).
[0234] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnNfnnnnNfnNfnNfnXnnnsnsn -3’, and the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid- thymine-3 ’-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 ’phosphate (T-NAc), l ’,2’-Dideoxyribose-3’-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’- phosphate (u3), 2’ -fluoro-2-thiouridine-3’ -phosphate (U3f), or 2-amino-2’-O-methyladenosine-3’-phosphate (al), and 2’-O-methylinosine-3’-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’ - nsNfsnnnnNfnnnnNfnNfnNfnXnnnsnsn -3’, and the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’- O-methyl modified nucleotide, “Nf” stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3’ -phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i).
[0235] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnXnNfnnnnNfnNfnNfnnnnnsnsn -3’, and the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid- thymine-3 ’-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’ -phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 ’phosphate (T-NAc), l ’,2’-Dideoxyribose-3’-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’- phosphate (u3), 2’ -fluoro-2-thiouridine-3’ -phosphate (U3f), or 2-amino-2’-O-methyladenosine-3’- phosphate (al), and 2’-O-methylinosine-3’-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’ - nsNfsnnXnNfnnnnNfnNfnNfnnnnnsnsn -3’, and the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’- O-methyl modified nucleotide, “Nf’ stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3 ’-phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i).
[0236] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnXnnnXNfnNfnNfnnnnnsnsn -3’, and the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid- thymine-3 ’-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 ’phosphate (T-NAc), l ’,2’-Dideoxyribose-3’-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’- phosphate (u3), 2’ -fluoro-2-thiouridine-3’ -phosphate (U3f), or 2-amino-2’-O-methyladenosine-3’- phosphate (al), and 2’-O-methylinosine-3’-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’ - nsNfsnnnnXnnnXNfnNfnNfnnnnnsnsn -3’, and thepassenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’- O-methyl modified nucleotide, “Nf” stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3’ -phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’ - nsNfsnnnnXinnnX2NfnNfnNfnnnnnsnsn-3’, and the passenger strand comprises 5’ - nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, where “n” stands for a 2’- O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, “Xi” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T) and acyclic L-threoninol nucleic acid-adenine-3’ -phosphate (T-A), and “X2” stands for a nucleotide analogue, e.g., 2'-O- methylinosine-3 '-phosphate (i).
[0237] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnXNfnnnnXnNfnNfnnnnnsnsn -3’, and the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid- thymine-3 ’-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 ’phosphate (T-NAc), l ’,2’-Dideoxyribose-3’-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’- phosphate (u3), 2’ -fluoro-2-thiouridine-3’ -phosphate (U3f), or 2-amino-2’-O-methyladenosine-3’- phosphate (al), and 2’-O-methylinosine-3’-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’ - nsNfsnnnXNfnnnnXnNfnNfnnnnnsnsn -3’, and the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’- O-methyl modified nucleotide, “Nf’ stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3 ’-phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’ - nsNfsnnnXiNfnnnnX2nNfnNfnnnnnsnsn-3’, and the passenger strand comprises 5’ - nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, where “n” stands for a 2’- O-methyl modified nucleotide, “Nf’ stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, “Xi” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T) and acyclic L-threoninol nucleicacid-adenine-3’ -phosphate (T-A), and “ X2 stands for a nucleotide analogue, e.g., 2'-O- methylinosine-3 '-phosphate (i).
[0238] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnNfnnnnNfnNfnNfnnXnnsnsn -3’, and the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’-O-methyl modified nucleotide, “Nf” stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid- thymine-3’ -phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 ’phosphate (T-NAc), l ’,2’-Dideoxyribose-3’-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’- phosphate (u3), 2’ -fluoro-2-thiouridine-3’ -phosphate (U3f), or 2-amino-2’-O-methyladenosine-3’- phosphate (al), and 2’-O-methylinosine-3’-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’ - nsNfsnnnnNfnnnnNfnNfnNfnnXnnsnsn -3’, and the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’- O-methyl modified nucleotide, “Nf’ stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3 ’-phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i).
[0239] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnXNfnnnnNfnNfnNfnnXnnsnsn -3’, and the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid- thymine-3 ’-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 ’phosphate (T-NAc), l ’,2’-Dideoxyribose-3’-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’- phosphate (u3), 2’ -fluoro-2-thiouridine-3’ -phosphate (U3f), or 2-amino-2’-O-methyladenosine-3’- phosphate (al), and 2’-O-methylinosine-3’-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’ - nsNfsnnnXNfnnnnNfnNfnNfnnXnnsnsn -3’, and the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’- O-methyl modified nucleotide, “Nf’ stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3 ’-phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i). In some instances, the guidestrand comprises a nucleic acid sequence of 5’ - nsNfsnnnXiNfnnnnNfnNfnNfnnX2nnsnsn-3’, and the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, where “n” stands for a 2’- O-methyl modified nucleotide, “Nf” stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, “Xi” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3’ -phosphate (T-A), and “X2” stands for a nucleotide analogue, e.g., 2'-O-methylinosine- 3'-phosphate (i).
[0240] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnNfnXnnNfnNfnNfnnnnnsnsn -3’, and the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid- thymine-3 ’-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’ -phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 ’phosphate (T-NAc), l ’,2’-Dideoxyribose-3’-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’- phosphate (u3), 2’ -fluoro-2-thiouridine-3’ -phosphate (U3f), or 2-amino-2’-O-methyladenosine-3’- phosphate (al), and 2’-O-methylinosine-3’-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’ - nsNfsnnnnNfnXnnNfnNfnNfnnnnnsnsn -3’, and the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’- O-methyl modified nucleotide, “Nf’ stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3 ’-phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i).
[0241] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnXnnnnsNfnNfnNfnnnnnsnsn -3’, and the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid- thymine-3 ’-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 ’phosphate (T-NAc), l ’,2’-Dideoxyribose-3’-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’- phosphate (u3), 2’ -fluoro-2-thiouridine-3’ -phosphate (U3f), or 2-amino-2’-O-methyladenosine-3’- phosphate (al), and 2’-O-methylinosine-3’-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’ - nsNfsnnnnXnnnnsNfnNfnNfnnnnnsnsn -3’, and thepassenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’- O-methyl modified nucleotide, “Nf” stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate intemucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3’ -phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i).
[0242] In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnXnnnnssNfnNfnNfnnnnnsnsn -3’, and the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’-fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, “ss” stands for phosphorodithioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 ’-phosphate (T-T), acyclic L- threoninol nucleic acid-adenine-3 ’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 ’phosphate (T-NAc), l’,2’-Dideoxyribose-3’-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’ -O-methyl-2-thiouridine-3’ -phosphate (u3), 2’-fluoro-2-thiouridine- 3’-phosphate (U3f), or 2-amino-2’-O-methyladenosine-3’-phosphate (al), and 2 ’-O-m ethylinosines’ -phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- nsNfsnnnnXnnnnssNfnNfnNfnnnnnsnsn -3’, and the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein “n” stands for a 2’-O-methyl modified nucleotide, “Nf’ stands for a 2’ -fluoro modified nucleotide, “s” stands for phosphorothioate internucleotide linkage, “ss” stands for phosphorodithioate internucleotide linkage, and “X” stands for a nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L- threoninol nucleic acid-adenine-3 ’-phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i).
[0243] In one aspect, described herein is a specific modification motif or pattern for the doublestranded inhibitiory polynucleic acid molecule comprising a passenger strand and a guide strand.
[0244] In some aspects, the guide strand comprises a nucleotide analogue selected from acyclic L- threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’- phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3 'phosphate (T-NAc), 1 ',2'- Dideoxyribose-3 '-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O- methyl-2-thiouridine-3’ -phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’- O-methyladenosine-3 ’ -phosphate (al), 5’(E) vinylphosphonate-2’-O-methoxy-ethyl-5- methyluridine-3 ’ -phosphate (vpt4), 5'(E) vinylphosphonate-2-O-methyluridine-3'phosphate (vpu), 2'-methoxyethyladenosine-3'phosphate (A6), 2'-methoxyethyluridine-3'-phosphate (U6), or 2'-O- methylinosine-3 '-phosphate (i). In some instance, the nucleotide analogue is selected from a group consisting of the nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’ -phosphate (T-A), acyclic N-acetyl L- threoninol abasic nucleic acid-3 'phosphate (T-NAc), l',2'-Dideoxyribose-3 '-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3 ’-phosphate (u3), 2’ -fluoro-2-thiouridine-3’ -phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (al), 5’(E) vinylphosphonate-2’-O-methoxy-ethyl-5-methyluridine-3’-phosphate (vpt4), 5'(E) vinylphosphonate-2-O-methyluridine-3 'phosphate (vpu), 2'-methoxyethyladenosine-3 'phosphate (A6), 2'-methoxyethyluridine-3'-phosphate (U6), and 2'-O-methylinosine-3 '-phosphate (i). In some instances, the nucleotide analogue is selected from a group consisting of the nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’-phosphate (T-A), 5’(E) vinylphosphonate-2’-O-methoxy-ethyl-5- methyluridine-3 ’ -phosphate (vpt4), 5'(E) vinylphosphonate-2-O-methyluridine-3'phosphate (vpu), 2'-methoxyethyladenosine-3'phosphate (A6), 2'-methoxyethyluridine-3'-phosphate (U6), and 2'-O- methylinosine-3 '-phosphate (i).
[0245] In some instances, a polynucleic acid molecule for modulating expression of INHBE gene comprises a guide strand comprising a nucleic acid sequence of usAfsaugaGfaauuCfaAfaAfggcacsasu (SEQ ID NO: 1345) and a passenger strand comprising a nucleic acid sequence of gsusgccuUfuUfgAfauucucauua (SEQ ID NO: 1358), where smaller case “n” stands for 2’-O-methyl modified nucleotide, upper case followed with an “f” (z.e., “Nf”) stands for 2’-fluoro modified nucleotide, and “s” stands for 3'-phosphorothioate.
[0246] In some instances, a polynucleic acid molecule for modulating expression of INHBE gene comprises a guide strand comprising a nucleic acid sequence of usAfsucggAfagauCfcUfcAfagcacsasg (SEQ ID NO: 1346) and a passenger strand comprising a nucleic acid sequence of gsusgcuuGfaGfgAfucuuccgaua (SEQ ID NO: 1359), where smaller case “n” stands for 2’-O-methyl modified nucleotide, upper case followed with an “f” (i.e., “Nf’) stands for 2’-fluoro modified nucleotide, and “s” stands for 3'-phosphorothioate.
[0247] In some instances, a polynucleic acid molecule for modulating expression of INHBE gene comprises a guide strand comprising a nucleic acid sequence of usUfsugccAfuuauGfaUfcCfaggucsgsa (SEQ ID NO: 1347) and a passenger strand comprising a nucleic acid sequence of gsasccugGfaUfcAfuaauggcaaa (SEQ ID NO: 1360), where smaller case “n” stands for 2’-O-methyl modified nucleotide, upper case followed with an “f” (i.e., “Nf’) stands for 2’-fluoro modified nucleotide, and “s” stands for 3'-phosphorothioate.
[0248] In some instances, a polynucleic acid molecule for modulating expression of INHBE gene comprises a guide strand comprising a nucleic acid sequence of usGfsaaacUfucauCfuUfgGfucuccsusc (SEQ ID NO: 1348) and a passenger strand comprising anucleic acid sequence of gsgsagacCfaAfgAfugaaguuuca (SEQ ID NO: 1361), where smaller case “n” stands for 2’-O-methyl modified nucleotide, upper case followed with an “f” (i.e., “Nf”) stands for 2’-fluoro modified nucleotide, and “s” stands for 3'-phosphorothioate.
[0249] In some instances, a polynucleic acid molecule for modulating expression of INHBE gene comprises a guide strand comprising a nucleic acid sequence of usUfscaagCfaaagAfgUfgCfcaggusasg (SEQ ID NO: 1349) and a passenger strand comprising a nucleic acid sequence of ascscuggCfaCfuCfuuugcuugaa (SEQ ID NO: 1362), where smaller case “n” stands for 2’-O-methyl modified nucleotide, upper case followed with an “f” (i.e., “Nf’) stands for 2’-fluoro modified nucleotide, and “s” stands for 3'-phosphorothioate.
[0250] In some instances, a polynucleic acid molecule for modulating expression of INHBE gene comprises a guide strand comprising a nucleic acid sequence of usUfsgaugUfaaucAfcAfuGfucaccscsg (SEQ ID NO: 1350) and a passenger strand comprising a nucleic acid sequence of gsgsugacAfuGfuGfauuacaucaa (SEQ ID NO: 1363), where smaller case “n” stands for 2’-O-methyl modified nucleotide, upper case followed with an “f” (i.e., “Nf’) stands for 2’-fluoro modified nucleotide, and “s” stands for 3'-phosphorothioate.
[0251] In some instances, a polynucleic acid molecule for modulating expression of INHBE gene comprises a guide strand comprising a nucleic acid sequence of usUfsaugaUfccagGfuAfgAfggagusgsa (SEQ ID NO: 1351) and a passenger strand comprising a nucleic acid sequence of ascsuccuCfuAfcCfuggaucauaa (SEQ ID NO: 1364), where smaller case “n” stands for 2’-O-methyl modified nucleotide, upper case followed with an “f” (i.e., “Nf’) stands for 2’-fluoro modified nucleotide, and “s” stands for 3'-phosphorothioate.
[0252] In some instances, a polynucleic acid molecule for modulating expression of INHBE gene comprises a guide strand comprising a nucleic acid sequence of usAfsucuuGfgucuCfuUfcAfcucccsasa (SEQ ID NO: 1352) and a passenger strand comprising a nucleic acid sequence of gsgsgaguGfaAfgAfgaccaagaua (SEQ ID NO: 1365), where smaller case “n” stands for 2’-O-methyl modified nucleotide, upper case followed with an “f” (i.e., “Nf’) stands for 2’-fluoro modified nucleotide, and “s” stands for 3'-phosphorothioate.
[0253] In some instances, a polynucleic acid molecule for modulating expression of INHBE gene comprises a guide strand comprising a nucleic acid sequence of usUfsaagcUfcuagGfaAfgGfgcuggsusg (SEQ ID NO: 1353) and a passenger strand comprising a nucleic acid sequence of cscsagccCfuUfcCfuagagcuuaa (SEQ ID NO: 1366), where smaller case “n” stands for 2’-O-methyl modified nucleotide, upper case followed with an “f” (i.e., “Nf’) stands for 2’-fluoro modified nucleotide, and “s” stands for 3'-phosphorothioate.
[0254] In some instances, a polynucleic acid molecule for modulating expression of INHBE gene comprises a guide strand comprising a nucleic acid sequence of usUfsaaugAfgaauUfcAfaAfaggccsasa (SEQ ID NO: 1354) and a passenger strand comprising a nucleic acid sequence of gsgsccuuUfuGfaAfuucucauuaa (SEQ ID NO: 1367), where smaller case “n” stands for 2’-O-methyl modified nucleotide, upper case followed with an “f” (i.e., “Nf”) stands for 2’-fluoro modified nucleotide, and “s” stands for 3'-phosphorothioate.
[0255] In some instances, a polynucleic acid molecule for modulating expression of INHBE gene comprises a guide strand comprising a nucleic acid sequence of usAfsaguaUfaaauGfcUfuGfucucgscsa (SEQ ID NO: 1355) and a passenger strand comprising a nucleic acid sequence of csgsagacAfaGfcAfuuuauacuua (SEQ ID NO: 1368), where smaller case “n” stands for 2’-O-methyl modified nucleotide, upper case followed with an “f” (i.e., “Nf’) stands for 2’-fluoro modified nucleotide, and “s” stands for 3'-phosphorothioate.
[0256] In some instances, a polynucleic acid molecule for modulating expression of INHBE gene comprises a guide strand comprising a nucleic acid sequence of usAfsagacGfgcagAfaUfgGfaaagcsgsg (SEQ ID NO: 1356) and a passenger strand comprising a nucleic acid sequence of gscsuuucCfaUfuCfugccgucuua (SEQ ID NO: 1369), where smaller case “n” stands for 2’-O-methyl modified nucleotide, upper case followed with an “f” (i.e., “Nf’) stands for 2’-fluoro modified nucleotide, and “s” stands for 3'-phosphorothioate.
[0257] In some instances, a polynucleic acid molecule for modulating expression of INHBE gene comprises a guide strand comprising a nucleic acid sequence of usUfsugacUfuuguGfgAfcAfccccasgsa (SEQ ID NO: 1357) and a passenger strand comprising a nucleic acid sequence of usgsggguGfuCfcAfcaaagucaaa (SEQ ID NO: 1370), where smaller case “n” stands for 2’-O-methyl modified nucleotide, upper case followed with an “f” (i.e., “Nf’) stands for 2’-fluoro modified nucleotide, and “s” stands for 3'-phosphorothioate.
[0258] In some instances, a polynucleic acid molecule for modulating expression of INHBE gene comprises a guide strand comprising a nucleic acid sequence of usUfsuaagAfaaguAfuAfaGfccagcscsg (SEQ ID NO: 1397) and a passenger strand comprising a nucleic acid sequence of gscsuggcUfuAfuAfcuuucuuaaa (SEQ ID NO: 1 10), where smaller case “n” stands for 2’-O-methyl modified nucleotide, upper case followed with an “f” (i.e., “Nf’) stands for 2’-fluoro modified nucleotide, and “s” stands for 3'-phosphorothioate.
[0259] In some instances, a polynucleic acid molecule for modulating expression of INHBE gene comprises a guide strand comprising a nucleic acid sequence of usUfsacguAfaugiUfcUfcGfccuggsasa (SEQ ID NO: 1398) and a passenger strand comprising a nucleic acid sequence of cscsaggcGfaGfaCfcauuacguaa (SEQ ID NO: 1411), where smaller case“n” stands for 2’-0-methyl modified nucleotide, upper case followed with an “f” (i.e., “Nf”) stands for 2’-fluoro modified nucleotide, “i” stands for 2’ -O-methylinosine-3 ’ -phosphate, and “s” stands for 3'-phosphorothioate.
[0260] In some instances, a polynucleic acid molecule for modulating expression of INHBE gene comprises a guide strand comprising a nucleic acid sequence of usGfsaaucUfgaugCfcUfcCfagucascsa (SEQ ID NO: 1399) and a passenger strand comprising a nucleic acid sequence of usgsacugGfaGfgCfaucagauuca (SEQ ID NO: 1412), where smaller case “n” stands for 2’-O-methyl modified nucleotide, upper case followed with an “f” (i.e., “Nf’) stands for 2’-fluoro modified nucleotide, and “s” stands for 3'-phosphorothioate.
[0261] In some instances, a polynucleic acid molecule for modulating expression of INHBE gene comprises a guide strand comprising a nucleic acid sequence of usAfsugcuUfucugigUfaGfacccgsusu (SEQ ID NO: 1401) and a passenger strand comprising a nucleic acid sequence of csgsggucUfaCfcCfagaaagcaua (SEQ ID NO: 1414), where smaller case “n” stands for 2’-O-methyl modified nucleotide, upper case followed with an “f” (i.e., “Nf’) stands for 2’-fluoro modified nucleotide, “i” stands for 2’ -O-methylinosine-3 ’-phosphate, and “s” stands for 3'-phosphorothioate.
[0262] In some instances, a polynucleic acid molecule for modulating expression of INHBE gene comprises a guide strand comprising a nucleic acid sequence of usGfsaug(T- A)GfuuauUfcUfgGfgacguscsu (SEQ ID NO: 1402) and a passenger strand comprising a nucleic acid sequence of ascsguccCfaGfaAfuaacucauca (SEQ ID NO: 1415), where smaller case “n” stands for 2’-O-methyl modified nucleotide, upper case followed with an “f ’ (i.e., “Nf’) stands for 2’- fluoro modified nucleotide, “(T-A)” stands for acyclic L-threoninol nucleic acid-adenine-3'- phosphate, and “s” stands for 3'-phosphorothioate.
[0263] In some instances, a polynucleic acid molecule for modulating expression of INHBE gene comprises a guide strand comprising a nucleic acid sequence of usUfsaccc(T- T)gcuuCfaAfgCfcugcasgsg (SEQ ID NO: 1403) and a passenger strand comprising a nucleic acid sequence of usgscaggCfuUfgAfagcaggguaa (SEQ ID NO: 1416), where smaller case “n” stands for 2’-O-methyl modified nucleotide, upper case followed with an “f” (i.e., “Nf ’) stands for 2’-fluoro modified nucleotide, “(T-T)” stands for acyclic L-threoninol nucleic acid-thymine-3 '-phosphate, and “s” stands for 3'-phosphorothioate.
[0264] In some instances, a polynucleic acid molecule for modulating expression of INHBE gene comprises a guide strand comprising a nucleic acid sequence of usGfsucuc(T- T)ucacUfcCfaAfagccgscsa (SEQ ID NO: 1404) and a passenger strand comprising a nucleic acid sequence of csgsgcuuUfgGfaGfugaagagaca (SEQ ID NO: 1417), where smaller case “n” stands for2’-O-methyl modified nucleotide, upper case followed with an “f’ (i.e., “Nf ’) stands for 2’-fluoro modified nucleotide, “(T-T)” stands for acyclic L-threoninol nucleic acid-thymine-3 '-phosphate, and “s” stands for 3'-phosphorothioate.
[0265] In some instances, a polynucleic acid molecule for modulating expression of INHBE gene comprises a guide strand comprising a nucleic acid sequence of usAfsacuuCfuuagGfcUfuAfguicgsusc (SEQ ID NO: 1406) and a passenger strand comprising a nucleic acid sequence of csgscacuAfaGfcCfuaagaaguua (SEQ ID NO: 1 19), where smaller case “n” stands for 2’-O-methyl modified nucleotide, upper case followed with an “f’ (i.e., “Nf’) stands for 2’-fluoro modified nucleotide, “i” stands for 2’ -O-methylinosine-3 ’ -phosphate, and “s” stands for 3'-phosphorothioate.
[0266] In some instances, a polynucleic acid molecule for modulating expression of INHBE gene comprises a guide strand comprising a nucleic acid sequence of usUfsuucc(T- T)gacuCfcUfgUfuucucsgsg (SEQ ID NO: 1407) and a passenger strand comprising a nucleic acid sequence of gsasgaaaCfaGfgAfgucaggaaaa (SEQ ID NO: 1420), where smaller case “n” stands for 2’-O-methyl modified nucleotide, upper case followed with an “f’ (i.e., “Nf ’) stands for 2’-fluoro modified nucleotide, “(T-T)” stands for acyclic L-threoninol nucleic acid-thymine-3 '-phosphate, and “s” stands for 3'-phosphorothioate.
[0267] In some instances, a polynucleic acid molecule for modulating expression of INHBE gene comprises a guide strand comprising a nucleic acid sequence of usUfsaugaUfccagGfuAfgAfggagasgsa (SEQ ID NO: 1451) and a passenger strand comprising a nucleic acid sequence of uscsuccuCfuAfcCfuggaucauaa (SEQ ID NO: 1468), where smaller case “n” stands for 2’-O-methyl modified nucleotide, upper case followed with an “f’ (i.e., “Nf’) stands for 2’-fluoro modified nucleotide, and “s” stands for 3'-phosphorothioate.
[0268] In some instances, a polynucleic acid molecule for modulating expression of INHBE gene comprises a guide strand comprising a nucleic acid sequence of usUfsaugaUfccagGfuAfgAfggagasgsa (SEQ ID NO: 1451) and a passenger strand comprising a nucleic acid sequence of uscsuccuCfuAfcCfuggaucauaa (SEQ ID NO: 1473), where smaller case “n” stands for 2’-O-methyl modified nucleotide, upper case followed with an “f’ (i.e., “Nf’) stands for 2’-fluoro modified nucleotide, and “s” stands for 3'-phosphorothioate.
[0269] In some instances, a polynucleic acid molecule for modulating expression of INHBE gene comprises a guide strand comprising a nucleic acid sequence of usUfsaugaUfccagssGfuAfgAfggagasgsa (SEQ ID NO: 1458) and a passenger strand comprising a nucleic acid sequence of uscsuccuCfuAfcCfuggaucauaa (SEQ ID NO: 1473), where smaller case “n” stands for 2’-O-methyl modified nucleotide, upper case followed with an “f’ (i.e., “Nf’) standsfor 2’-fluoro modified nucleotide, “s” stands for 3'-phosphorothioate, and “ss” stands for 3'- phosphorodithioate.
[0270] In some instances, a polynucleic acid molecule for modulating expression of INHBE gene comprises a guide strand comprising a nucleic acid sequence of vpusUfsaugaUfccagssGfuAfgAfggagasgsa (SEQ ID NO: 1459) and a passenger strand comprising a nucleic acid sequence of uscsuccuCfuAfcCfuggaucauaa (SEQ ID NO: 1473), where smaller case “n” stands for 2’-O-methyl modified nucleotide, upper case followed with an “f” (i.e., “Nf”) stands for 2’-fluoro modified nucleotide, "vpu" stands for 5’(E) vinylphosphonate-2-O-methyluridine- 3 ’phosphate, “s” stands for 3'-phosphorothioate, and “ss” stands for 3' -pho sphorodi thioate.
[0271] In some instances, a polynucleic acid molecule for modulating expression of INHBE gene comprises a guide strand comprising a nucleic acid sequence of usAfsucgg(T- A)agauCfcUfcAfagcacsasg (SEQ ID NO: 1405) and a passenger strand comprising a nucleic acid sequence of gsusgcuuGfaGfgAfucuuccgaua (SEQ ID NO: 1475), where smaller case “n” stands for 2’-O-methyl modified nucleotide, upper case followed with an “f” (i.e., “Nf ’) stands for 2’-fluoro modified nucleotide, “(T-A)” stands for acyclic L-threoninol nucleic acid-adenine-3 '-phosphate, and “s” stands for 3'-phosphorothioate.
[0272] In some instances, a polynucleic acid molecule for modulating expression of INHBE gene comprises a guide strand comprising a nucleic acid sequence of usAfsucgg(T- A)agausCfcUfcAfagcacsasg (SEQ ID NO: 1462) and a passenger strand comprising a nucleic acid sequence of gsusgcuuGfaGfgAfucuuccgaua (SEQ ID NO: 1475), where smaller case “n” stands for 2’-O-methyl modified nucleotide, upper case followed with an “f” (i.e., “Nf ’) stands for 2’-fluoro modified nucleotide, “(T-A)” stands for acyclic L-threoninol nucleic acid-adenine-3 '-phosphate, and “s” stands for 3'-phosphorothioate.
[0273] In some instances, a polynucleic acid molecule for modulating expression of INHBE gene comprises a guide strand comprising a nucleic acid sequence of usAfsucgg(T- A)agaussCfcUfcAfagcacsasg (SEQ ID NO: 1461) and a passenger strand comprising a nucleic acid sequence of gsusgcuuGfaGfgAfucuuccgaua (SEQ ID NO: 1475), where smaller case “n” stands for 2’-O-methyl modified nucleotide, upper case followed with an “f” (i.e., “Nf ’) stands for 2’-fluoro modified nucleotide, “(T-A)” stands for acyclic L-threoninol nucleic acid-adenine-3 '-phosphate, “s” stands for 3'-phosphorothioate, and “ss” stands for 3'-phosphorodithioate.
[0274] In some instances, a polynucleic acid molecule for modulating expression of INHBE gene comprises a guide strand comprising a nucleic acid sequence of usAfsucgg(T- A)agauCfcUfcAfagcacsasg (SEQ ID NO: 1405) and a passenger strand comprising a nucleic acid sequence of gsusgcuuGfaGfgAfucuuccgaua (SEQ ID NO: 1418), where smaller case “n” stands for2’-O-methyl modified nucleotide, upper case followed with an “f” (i.e., “Nf ’) stands for 2’-fluoro modified nucleotide, “(T-A)” stands for acyclic L-threoninol nucleic acid-adenine-3 '-phosphate, and “s” stands for 3'-phosphorothioate.ConjugationTargeting Moiety
[0275] In certain aspects, the polynucleotide molecule described herein is coupled or conjugated with one or more targeting moieties to form a polynucleotide-targeting moiety conjugate molecule. In some instances, a targeting moiety is selected based on its ability to target the conjugate molecule described herein to a desired cell population, tissue, or an organ selectively or preferably. In some instances, the targeting moiety targets the cell, tissue, or an organ that expresses the corresponding binding partner (e.g., either the corresponding receptor or ligand) of the targeting moiety. For example, the polynucleotide molecule conjugated with N-acetyl galactosamine (GalNAc) can target hepatocytes expressing asialoglycoprotein (ASGP-R). A targeting moiety (i.e., an intracellular targeting moiety) that targets a desired site within the cell (e.g., endoplasmic reticulum, Golgi apparatus, nucleus, or mitochondria) may be included in the hybridized polynucleotide constructs disclosed herein. Non-limiting examples of the intracellular targeting moieties are provided in WO2015 / 069932 and in WO2015 / 188197; the disclosure of the intracellular targeting moieties in WO2015 / 069932 and in WO2015 / 188197 is incorporated herein by reference.
[0276] The polynucleotide molecule described herein, thus, may include one or more targeting moieties selected from the group consisting of intracellular targeting moieties, extracellular targeting moieties, and combinations thereof. Thus, the inclusion of one or more targeting moieties (e.g., extracellular targeting moieties including targeting moieties independently selected from the group consisting of folate, mannose, N-acetyl galactosamine, and prostate specific membrane antigen) and one or more intracellular targeting moiety (e.g., a moiety targeting endoplasmic reticulum, Golgi apparatus, nucleus, or mitochondria) in the polynucleotide molecule described herein can facilitate the delivery of the polynucleotides to a specific site within the specific cell population. In some aspects, the targeting moiety contains one or more mannose carbohydrates. Mannose targets the mannose receptor, which is a 175 KDa membrane-associated receptor that is expressed on sinusoidal liver cells and antigen presenting cells (e.g., macrophages and dendritic cells). It is a highly effective endocytotic / recycling receptor that binds and internalizes mannosylated pathogens and proteins (Lennartz et. al. J. Biol. Chem. 262:9942-9944,1987; Taylor et. al. J. Biol. Chem. 265: 12156-62, 1990).
[0277] Some of the targeting moieties are described herein. In some aspects, the targeting moiety contains or specifically binds to a protein selected from the group including insulin, insulin-like growth factor receptor 1 (IGF1R), IGF2R, insulin-like growth factor (IGF; e.g., IGF 1 or 2), mesenchymal epithelial transition factor receptor (c-met; also known as hepatocyte growth factor receptor (HGFR)), hepatocyte growth factor (HGF), epidermal growth factor receptor (EGFR), epidermal growth factor (EGF), heregulin, fibroblast growth factor receptor (FGFR), platelet- derived growth factor receptor (PDGFR), platelet-derived growth factor (PDGF), vascular endothelial growth factor receptor (VEGFR), vascular endothelial growth factor (VEGF), tumor necrosis factor receptor (TNFR), tumor necrosis factor alpha (TNF-a), TNF-P, folate receptor (FOLR), folate, transferrin, transferrin receptor (TfR), mesothelin, Fc receptor, c-kit receptor, c-kit, an integrin (e.g., an a4 integrin or a P-1 integrin), P-selectin, sphingosine- 1 -phosphate receptor- 1 (S1PR), hyaluronate receptor, leukocyte function antigen-1 (LFA-1), CD4, CD11, CD18, CD20, CD25, CD27, CD52, CD70, CD80, CD85, CD95 (Fas receptor), CD 106 (vascular cell adhesion molecule 1 (VCAM1), CD166 (activated leukocyte cell adhesion molecule (ALCAM)), CD178 (Fas ligand), CD253 (TNF-related apoptosis-inducing ligand (TRAIL)), ICOS ligand, CCR2, CXCR3, CCR5, CXCL12 (stromal cell-derived factor 1 (SDF-1)), interleukin 1 (IL-1), IL-lra, IL- 2, IL-3, IL-4, IL-6, IL-7, IL-8, CTLA-4, MART-1, gplOO, MAGE-1, ephrin (Eph) receptor, mucosal addressin cell adhesion molecule 1 (MAdCAM-1), carcinoembryonic antigen (CEA), LewisY, MUC-1, epithelial cell adhesion molecule (EpCAM), cancer antigen 125 (CA125), prostate specific membrane antigen (PSMA), TAG-72 antigen, and fragments thereof. In further aspects, the targeting moiety contains erythroblastic leukemia viral oncogene homolog (ErbB) receptor (e.g., ErbBl receptor; ErbB2 receptor; ErbB3 receptor; and ErbB4 receptor). In some aspects, the targeting moiety contains one or more (e.g., from 1 to 6) N-acetyl galactosamines (GalNAc). In certain aspects, the targeting moiety contains one or more (e.g., from 1 to 6) mannoses. In other aspects, the targeting moiety contains a folate ligand. The folate ligand has the structure:Certain targeting moieties may include bombesin, gastrin, gastrin-releasing peptide, tumor growth factors (TGF) (e.g., TGF-a or TGF-P), or vaccinia virus growth factor (VVGF). Non- peptidyl targeting moieties can also be used in the targeting moieties and may include, for example,steroids, carbohydrates, vitamins, and lectins. Some targeting moieties may include a polypeptide, such as somatostatin or somatostatin analog (e.g., octreotide or lanreotide), bombesin, or an antibody or antigen-binding fragment thereof. Antibodies may be of any recognized class or subclass, e.g., IgG, IgA, IgM, IgD, or IgE. Typical are those antibodies which fall within the IgG class. The antibodies can be derived from any species according techniques known in the art. Typically, however, the antibody is of human, murine, or rabbit origin. In addition, the antibody may be polyclonal or monoclonal, but is typically monoclonal. Human or chimeric (e.g., humanized) antibodies may be used in targeting moieties. Targeting moieties may include an antigen-binding fragment of an antibody. Such antibody fragments may include, for example, the Fab’, F(ab’)2, Fv, or Fab fragments, single domain antibody, ScFv, or other antigen-binding fragments. Fc fragments may also be employed in targeting moieties. Such antibody fragments can be prepared, for example, by proteolytic enzyme digestion, for example, by pepsin or papain digestion, reductive alkylation, or recombinant techniques. The materials and methods for preparing antibody fragments are well-known to those skilled in the art. See, e.g., Parham, J. Immunology, 131 :2895, 1983; Lamoyi et al., J. Immunological Methods, 56:235, 1983.
[0278] Other peptides for use as a targeting auxiliary moiety in polynucleotide molecule described herein can be selected from KiSS peptides and analogs, urotensin II peptides and analogs, GnRH I and II peptides and analogs, depreotide, vapreotide, vasoactive intestinal peptide (VIP), cholecystokinin (CCK), RGD-containing peptides, melanocyte-stimulating hormone (MSH) peptide, neurotensin, calcitonin, glutathione, YIGSR (SEQ ID NO: 108) (leukocyte-avid peptides, e.g., P483H, which contains the heparin-binding region of platelet factor-4 (PF-4) and a lysine-rich sequence), atrial natriuretic peptide (ANP), P-amyloid peptides, delta-opioid antagonists (such as ITIPP(psi)), annexin-V, endothelin, leukotriene B4 (LTB4), chemotactic peptides (e.g., N-formyl- methionyl-leucyl-phenylalanine-lysine (fMLFK) (SEQ ID NO: 109), GP Ilb / IIIa receptor antagonists (e.g., DMP444), human neutrophil elastase inhibitor (EPI-HNE-2 and EPI-HNE-4), plasmin inhibitor, antimicrobial peptides, apticide (P280 and P274), thrombospondin receptor (including analogs such as TP-1300), bitistatin, pituitary adenylyl cyclase type I receptor (PAC1), fibrin a-chain, peptides derived from phage display libraries, and conservative substitutions thereof.
[0279] One or more (e.g., from 1 to 6) targeting moieties can be linked to MOIETY or to X2 in formula (V’, V”, or V’”) through -LinkA-
[0280] In some aspects, the targeting moiety includes one or more (e.g., from 1 to 6 or from 1 to 3) asialoglycoprotein receptor ligands or asialoglycoprotein receptor targeting moiety (e.g., GalNAc). In some aspects, an asialoglycoprotein receptor ligand or asialoglycoprotein receptor targeting moiety (e.g., GalNAc) is attached to -LinkA- through an anomeric carbon (e.g., where theanomeric carbon is the carbon atom in an acetal or a hemiaminal). In some aspects, an asialoglycoprotein receptor ligand or asialoglycoprotein receptor targeting moiety (e.g., GalNAc) comprises an anomeric carbon bonded to trivalent, tetravalent linker, pentavalent, or hexavalent linker, wherein the anomeric carbon is part of a hemiaminal group. An asialoglycoprotein receptor ligand or asialoglycoprotein receptor targeting moiety (e.g., GalNAc) attached to a linker through a hemiaminal may produce a hybridized polynucleotide construct having superior efficacy in gene silencing as compared to hybridized polynucleotide constructs having the asialoglycoprotein receptor ligand or asialoglycoprotein receptor targeting moiety (e.g., GalNAc) attached to a linker through an acetal. In some instances, the asialoglycoprotein receptor targeting moiety comprises N- Acetylgalactosamine (GalNAc) or galactose.
[0281] In some aspects, the linker and three asialoglycoprotein receptor targeting moieties, each of which comprises GalNAc, are as shown in Formula (V). In some instances, the conjugate described herein only comprises one asialoglycoprotein receptor targeting moiety, so the conjugate comprises a structure of Formula (V) with any two of the targeting moieties removed. In some instances, the conjugate described herein only comprises two asialoglycoprotein receptor targeting moieties, so the conjugate described herein comprises a structure of Formula (V) with any one of the targeting moieties removed.(V), wherein one of Y1 and Y2 is nucleotide, or wherein both Y1 and Y2 are nucleotides and Y1 and Y2 are consecutive or neighboring nucleotides from the polynucleic acid molecule described herein.
[0282] In some aspects, the linker and the targeting moieties described herein are conjugated to 3’ end of the passenger strand (e.g., as shown in Formula (V’)). In some aspects, the linker and the targeting moieties described herein are conjugated to 5’ end of the passenger strand (e.g., as shown in Formula (V’”)). In some aspects, the linker and the targeting moieties described herein are conjugated to 3’ end of the guide strand (e.g., as shown in Formula (V’)). In some aspects, the linker and the targeting moieties described herein are conjugated to 5’ end of the guide strand (e.g.,as shown in Formula (V’”)). In some instances, structures of Formula (V’) or Formula (V’”) are shown below:whereinZ in formula (V’) corresponds to one of the sugar modifications described herein (e.g., -H, -OH, - O-Methyl, -F, or -O-methoxyethyl); R in formula (V’) is adenine, uracil, guanine, cytosine, thymine, abasic, or others; and theis to connect to an adjacent nucleotide of the polynucleic acid molecule; orwherein Z in formula (V’”) is a moiety that corresponds to one of the sugar modifications described herein (e.g., -H, -OH, -O-Methyl, -F, or -O-methoxyethyl); R in formula (V’”) is adenine, uracil, guanine, cytosine, thymine, abasic, or others; and theis to connect to an adjacent nucleotide of the polynucleic acid molecule.
[0283] In some instances, the 3’ end of passenger strand (or sense strand) from Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 is conjugated with X2- GalNAc (see Formula (V) or (V’)). In some instances, the 5’ end of passenger strand (or sense strand) from Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table18 is conjugated with X2-GalNAc (see Formula (V), or (V’)). In some instances, the 5’ end of passenger strand (or sense strand) of a polynucleic acid molecule from Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 is conjugated with X2-GalNAc (see Formula (V) or (V’”)). In some instances, a nucleic acid within passenger strand (or sense strand) (not at the 5’ or 3’ end) from Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 is conjugated with X2-GalNAc (see Formula (V)). In some instances, the 3’ end of guide strand from Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 is conjugated with X2-GalNAc (see Formula (V), or (V’)). In some instances, the 5’ end of guide strand from Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 is conjugated with X2-GalNAc (see Formula (V) or (V’”)). In some instances, a nucleic acid within guide strand (not at the 5’ or 3’ end) from Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 is conjugated with X2-GalNAc (see Formula (V)).
[0284] In some instances, the 5’ end of passenger strand (or sense strand) of a polynucleic acid molecule from Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 is conjugated with Xl-GalNAc (see Formula (V’”)). In some instances, the 3’ end of passenger strand (or sense strand) of a polynucleic acid molecule from Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 is conjugated with X2a-GalNAc (see Formula (V’”””) below). In some instances, the 5’ end of passenger strand (or sense strand) of a polynucleic acid molecule from Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 is conjugated with Xl-GalNAc (see Formula (V’”)) and phosphorothioate internucleotide linkage. In some instances, the 3’ end of passenger strand (or sense strand) of a polynucleic acid molecule from Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 is conjugated with X2a-GalNAc (see Formula (V’”””) below). In some instances, the 3’ end of passenger strand (or sense strand) of a polynucleic acid molecule from Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 is conjugated with X2a-GalNAc (see Formula (V’”””) below) and phosphorothioate intemucleotide linkage. In some instances, Formula (V’”””) is shown below,
[0285] In some instances, the 3’ end of passenger strand (sense strand) of a polynucleic acid molecule from Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, orTable 18 is conjugated with (pl)(X3)(X3)(X3)-GalNAc structure comprising tetraantennaryGalNAc moiety via one phosphotriester group (pl) and three (X3) linkers (see Formula (VI)) as shown below,wherein Z in formula (VI) is a moiety that corresponds to one of the sugar modifications described herein (e.g., -H, -OH, -O-Methyl, -F, or -O-methoxyethyl); R in formula (VI) is adenine, uracil, guanine, cytosine, thymine, abasic, or others; and theis to connect to an adjacent nucleotide of the polynucleic acid molecule.
[0286] In some instances, the 3’ end of passenger strand (sense strand) of a polynucleic acid molecule from Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, orTable 18 is conjugated with (pl)(X3a)(X3a)(X3a)-GalNAc structure comprising tetraantennaryGalNAc moiety via one phosphotriester group (pl) and three (X3a) linkers (see Formula (VI’)) as shown below,wherein Z in formula (VI’) is a moiety that corresponds to one of the sugar modifications described herein (e.g., -H, -OH, -O-Methyl, -F, or -O-methoxyethyl); R in formula (VI’) is adenine, uracil, guanine, cytosine, thymine, abasic, or others; and theis to connect to an adjacent nucleotide of the polynucleic acid molecule.
[0287] In some instances, the 3’ end of passenger strand (sense strand) of a polynucleic acid molecule from Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 is conjugated with (pl)(X3)(X3)-GalNAc structure comprising triantennary GalNAc moiety via one phosphotriester group (pl) and two (X3) linkers (see Formula (VI”)) as shown below,wherein Z in formula (VI”) is a moiety that corresponds to one of the sugar modifications described herein (e.g., -H, -OH, -O-Methyl, -F, or -O-methoxyethyl); R in formula (VI”) is adenine, uracil, guanine, cytosine, thymine, abasic, or others; and theis to connect to an adjacent nucleotide of the polynucleic acid molecule.
[0288] In some instances, the 3’ end of passenger strand (sense strand) of a polynucleic acid molecule from Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, orTable 18 is conjugated with (pl)(X3a)(X3a)-GalNAc structure comprising triantennary GalNAc moiety via one phosphotriester group (pl) and two (X3a) linkers (see Formula (VI’”)) as shownwherein Z in formula (VI’”) is a moiety that corresponds to one of the sugar modifications described herein (e.g., -H, -OH, -O-Methyl, -F, or -O-methoxyethyl); R in formula (VI’”) isadenine, uracil, guanine, cytosine, thymine, abasic, or others; and thecis to connect to an adjacent nucleotide of the polynucleic acid molecule.
[0289] In some instances, the 3’ end of passenger strand (sense strand) of a polynucleic acid molecule from Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 is conjugated with (pl)(X3)(X3)-GalNAc (see Formula (VI”)). In some instances, the 3’ end of passenger strand (sense strand) of a polynucleic acid molecule from Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 is conjugated with (pl)(X3)(X3)- GalNAc (see Formula (VI”)) and phosphorothioate internucleotide linkage.
[0290] In some instances, the 3’ end of passenger strand (sense strand) of a polynucleic acid molecule from Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 is conjugated with (pl)(X3a)(X3a)-GalNAc (see Formula (VI’”)). In some instances, the 3’ end of passenger strand (sense strand) of a polynucleic acid molecule from Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 is conjugated with (pl)(X3a)(X3a)-GalNAc (see Formula (VI’”)) and phosphorothioate internucleotide linkage.
[0291] In some instances, the linker and the targeting moieties described herein are conjugated to lipid, which is conjugated to the 3’ end of the passenger strand. In some instances, the linker and the targeting moieties described herein are conjugated to lipid which is conjugated to the 5’ end of the passenger strand. In some instances, the linker and the targeting moieties described herein are conjugated to lipid which is conjugated to the 3’ end of the guide strand. In some instances, the linker and the targeting moieties described herein are conjugated to lipid which is conjugated to the 5’ end of the guide strand.
[0292] In some instances, the lipid comprises saturated fatty acid or unsaturated fatty acid. In some instances, the lipid comprises short-chain fatty acids (e.g., five or less carbons), medium-chain fatty acids (e.g., 6 to 12 carbons), long-chain fatty acids (e.g., 13 to 21 carbons), or very long chain fatty acids (e.g., 22 or more carbons). In some instances, the lipid comprises a 12 carbon (C12) fatty acid.
[0293] In some instances, the 3’ end of passenger strand (or sense strand) of a polynucleic acid molecule from Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 is conjugated with (C12)(X2)-GalNac (see Formula (VIII)) as shown below. In some instances, the 3’ end of passenger strand (or sense strand) of a polynucleic acid molecule from Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 is conjugated with (C12)(X2)-GalNac (see Formula (VIII)). In some instances, the 3’ end of passenger strand (or sense strand) of a polynucleic acid molecule from Table 1, Table 3, Table 5,Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 is conjugated with (C12)(X2)- GalNac (see Formula (VIII)) and phosphorothioate internucleotide linkage. In some instances, Formula (VIII) is shown below,(VIII).
[0294] In some instances, the 5’ end of passenger strand is conjugated with lipid to improve targeting efficiency. In some instances, the lipid comprises saturated fatty acid or unsaturated fatty acid. In some instances, the lipid comprises short-chain fatty acids (e.g., five or less carbons), medium-chain fatty acids (e.g., 6 to 12 carbons), long-chain fatty acids (e.g., 13 to 21 carbons), or very long chain fatty acids (e.g., 22 or more carbons). In some instances, the lipid comprises a 22 carbon (C22) fatty acid (see Formula (IX)).
[0295] In some instances, the 5’ end of passenger strand (or sense strand) of a polynucleic acid molecule from Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 18 is conjugated with (C22a) (see Formula (IX)) as shown below,(IX).
[0296] One or more endosomal escape moieties (e.g., from 1 to 6 or from 1 to 3) can be attached to a polynucleotide construct or a hybridized polynucleotide construct disclosed herein as an auxiliary moiety. Exemplary endosomal escape moieties include chemotherapeutics (e.g., quinolones such as chloroquine); fusogenic lipids (e.g., dioleoylphosphatidyl-ethanolamine (DOPE)); and polymers such as polyethylenimine (PEI); poly(beta-amino ester)s; polypeptides, such as polyarginines (e.g., octaarginine) and polylysines (e.g., octalysine); proton sponges, viral capsids, and peptide transduction domains as described herein. For example, fusogenic peptides can be derived from the M2 protein of influenza A viruses; peptide analogs of the influenza virus hemagglutinin; the HEF protein of the influenza C virus; the transmembrane glycoprotein of filoviruses; the transmembrane glycoprotein of the rabies virus; the transmembrane glycoprotein (G) of the vesicular stomatitis virus; the fusion protein of the Sendai virus; the transmembrane glycoprotein of the Semliki forestvirus; the fusion protein of the human respiratory syncytial virus (RSV); the fusion protein of the measles virus; the fusion protein of the Newcastle disease virus; the fusion protein of the visna virus; the fusion protein of murine leukemia virus; the fusion protein of the HTL virus; and the fusion protein of the simian immunodeficiency virus (SIV). Other moieties that can be employed to facilitate endosomal escape are described in Dominska et al., Journal of Cell Science, 123(8): 1183-1189, 2010. Specific examples of endosomal escape moieties including moieties suitable for conjugation to the hybridized polynucleotide constructs disclosed herein are provided, e.g., in WO 2015 / 188197; the disclosure of these endosomal escape moieties is incorporated by reference herein.
[0297] One or more endosomal escape moieties (e.g., from 1 to 6 or from 1 to 3) can be attached to a MOIETY or X2 in formula (V’, V”, V’”, V””, V’””, or V”””) through -LinkA-, as described herein.
[0298] One or more cell penetrating peptides (CPP) (e.g., from 1 to 6 or from 1 to 3) can be attached to a polynucleotide construct or a hybridized polynucleotide construct disclosed herein as an auxiliary moiety. The CPP can be linked to the hybridized polynucleotide bioreversibly through a disulfide linkage, as disclosed herein. Thus, upon delivery to a cell, the CPP can be cleaved intracellularly, e.g., by an intracellular enzyme (e.g., protein disulfide isomerase, thioredoxin, or a thioesterase) and thereby release the polynucleotide.
[0299] CPPs are known in the art (e.g., TAT or Arg8) (Snyder and Dowdy, 2005, Expert Opin. Drug Deliv. 2, 43-51). Specific examples of CPPs including moieties suitable for conjugation to the hybridized polynucleotide constructs disclosed herein are provided, e.g., in WO 2015 / 188197; the disclosure of these CPPs is incorporated by reference herein.
[0300] CPPs are positively charged peptides that are capable of facilitating the delivery of biological cargo to a cell. It is believed that the cationic charge of the CPPs is essential for their function. Moreover, the transduction of these proteins does not appear to be affected by cell type, and these proteins can efficiently transduce nearly all cells in culture with no apparent toxicity (Nagahara et al., Nat. Med. 4: 1449-52, 1998). In addition to full-length proteins, CPPs have also been used successfully to induce the intracellular uptake of DNA (Abu- Amer, supra), antisense polynucleotides (Astriab -Fisher et al., Pharm. Res, 19:744-54, 2002), small molecules (Polyakov et al., Bioconjug. Chem. 11 :762-71, 2000) and even inorganic 40 nm iron particles (Dodd et al., J. Immunol. Methods 256:89-105, 2001; Wunderbaldinger et al., Bioconjug. Chem. 13:264-8, 2002; Lewin et al., Nat. Biotechnol. 18:410-4, 2000; Josephson et al., Bioconjug. Chem. 10: 186-91, 1999) suggesting that there is considerable flexibility in particle size in this process.
[0301] In one embodiment, a CPP useful in the methods and compositions as described herein includes a peptide featuring substantial alpha-helicity. It has been discovered that transfection is optimized when the CPP exhibits significant alpha-helicity. In another embodiment, the CPP includes a sequence containing basic amino acid residues that are substantially aligned along at least one face of the peptide. A CPP described herein may be a naturally occurring peptide or a synthetic peptide.
[0302] One or more cell penetrating peptides (e.g., from 1 to 6 or from 1 to 3) can be attached to a MOIETY or X2 in formula (V’) or (V’”) through -LinkA-, as described herein.
[0303] The polynucleotide constructs and the hybridized polynucleotide constructs disclosed herein can also include covalently attached neutral polymer-based auxiliary moieties. Neutral polymers include poly(Cl-6 alkylene oxide), e.g., poly(ethylene glycol) and polypropylene glycol) and copolymers thereof, e.g., di- and triblock copolymers. Other examples of polymers include esterified poly(acrylic acid), esterified poly(glutamic acid), esterified poly(aspartic acid), poly(vinyl alcohol), poly(ethylene-co-vinyl alcohol), poly(N-vinyl pyrrolidone), poly(ethyloxazoline), poly(alkylacrylates), poly(acrylamide), poly(N-alkylacrylamides), poly(N-acryloylmorpholine), poly(lactic acid), poly(glycolic acid), poly(dioxanone), poly(caprolactone), styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolide) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyurethane, N- isopropyl acrylamide polymers, and poly(N,N-dialkylacrylamides). Exemplary polymer auxiliary moieties may have molecular weights of less than 100, 300, 500, 1000, or 5000 Da (e.g., greater than 100 Da). Other polymers are known in the art.
[0304] One or more polymers (e.g., from 1 to 6 or from 1 to 3) can be attached to a MOIETY or X2 in formula (V’) or (V’”) through -LinkA-, as described herein.Conjugation Linkers
[0305] In some aspects, the polynucleic acid molecules described herein comprises a passenger strand or a guide strand bonded to at least one group of formula (I)or a salt thereof, or a stereoisomer thereof, whereeach X1is independently O or S; each X2is independently O, S, NH, or a bond;MOIETY is optionally substituted C2-10 alkane-tetrayl or a group -M1-M2-M3-, wherein each M1and each M3is independently absent or optionally substituted C1-6 alkylene, and M2is optionally substituted C3-9 heterocycle-tetrayl, optionally substituted Ce-io arene-tetrayl, or optionally substituted C3-8 cycloalkane-tetrayl; each R1and each R2is independently H, optionally substituted C1-16 alkyl, optionally substituted C2-16 heteroalkyl, a conjugation moiety, or -LinkA(-T)p, provided that at least one R1or at least one R2is a conjugation moiety or -LinkA(-T)p; each R3is independently H, optionally substituted C1-16 alkyl, optionally substituted C2-16 heteroalkyl, optionally substituted C2-16 alkenyl, optionally substituted C2-16 alkynyl, optionally substituted (C1-9 heterocyclyl)-Ci-6-alkyl, optionally substituted (Ce-io aryl)-Ci-6-alkyl, optionally substituted (C3-8 cycloalkyl)-Ci-6-alkyl, a conjugation moiety, or -LinkA(-T)p;R4is H, optionally substituted C1-6 alkyl, -LinkA(-T)p, or -Sol; each LinkA is independently a multivalent linker (e.g., including -C(O)-N(H)- (e.g., at least one multivalent linker including -C(O)-N(H)- bonded to T)); each T is independently an auxiliary moiety;Sol is solid support; m is an integer from 1 to 6; each n is independently 0 or 1; each p is independently an integer from 1 to 6; and q is an integer from 0 to 3.The at least one group of formula (I) may be bonded to a 5’ end, 3’ end, internucleoside phosphate, intemucleoside phosphorothioate, or intemucleoside phosphorodithioate of the polynucleotide. When the at least one group of formula (I) is bonded to the intemucleoside phosphate, intemucleoside phosphorothioate, or intemucleoside phosphorodithioate, q is 0. The polynucleotide construct contains no more than one Sol.
[0306] Group -LinkA- can include from 0 to 3 multivalent monomers (e.g., optionally substituted Cl -6 alkane-triyl, optionally substituted Cl -6 alkane-tetrayl, or trivalent nitrogen atom) and one or more divalent monomers (e.g., from 1 to 40), where each divalent monomer is independently optionally substituted Cl -6 alkylene; optionally substituted C2-6 alkenylene; optionally substituted C2-6 alkynylene; optionally substituted C3-8 cycloalkylene; optionally substituted C3-8 cycloalkenylene; optionally substituted C6-14 arylene; optionally substituted Cl-9 heteroarylenehaving 1 to 4 heteroatoms selected from N, O, and S; optionally substituted Cl -9 heterocyclylene having 1 to 4 heteroatoms selected from N, O, and S; imino; optionally substituted N; O; or S(0)m, wherein m is 0, 1, or 2. In some aspects, each monomer is independently optionally substituted Cl- 6 alkylene; optionally substituted C3-8 cycloalkylene; optionally substituted C3-8 cycloalkenylene; optionally substituted C6-14 arylene; optionally substituted Cl-9 heteroarylene having 1 to 4 heteroatoms selected from N, O, and S; optionally substituted Cl-9 heterocyclylene having 1 to 4 heteroatoms selected from N, O, and S; imino; optionally substituted N; O; or S(0)m, where m is 0, 1, or 2 (e.g., m is 2). In certain aspects, each monomer is independently optionally substituted Cl-6 alkylene; optionally substituted C3-8 cycloalkylene; optionally substituted C3-8 cycloalkenylene; optionally substituted C6-14 arylene; optionally substituted Cl-9 heteroarylene having 1 to 4 heteroatoms selected from N, O, and S; optionally substituted Cl-9 heterocyclylene having 1 to 4 heteroatoms selected from N, O, and S; optionally substituted N; O; or S(0)m, where m is 0, 1, or 2 (e.g., m is 2). The non-bioreversible linker connecting the auxiliary moiety to the conjugating moiety or to the reaction product thereof can include from 2 to 500 (e.g., from 2 to 300 or from 2 to 200) of such monomers. Group -LinkA- may include a poly(alkylene oxide) (e.g., polyethylene oxide, polypropylene oxide, poly(trimethylene oxide), polybutylene oxide, poly(tetramethylene oxide), and diblock or triblock co-polymers thereof). In some aspects, the non-bioreversible linker includes polyethylene oxide (e.g., polyethylene oxide) having a molecular weight of less than 1 kDa).
[0307] Group -LinkA(-T)p in formula (I) may be prepared by a process described in the sections below. In some instances, -LinkA(-T)p is of formula (II):_Q1_Q2([_Q3-Q4_Q5]s_Q6_T)p,(II) where each s is independently an integer from 0 to 20 (e.g., from 0 to 10), where the repeating units are the same or different;Q1is a conjugation linker (e.g., [-Q3-Q4-Q5]s-Qc-, where Qcis optionally substituted C2-12 heteroalkylene (e.g., a heteroalkylene containing -C(O)-N(H)-, -N(H)-C(O)-, -S(O)2-N(H)-, or-N(H)-S(O)2-), optionally substituted C1-12 thioheterocyclylene (e.g.,optionally substituted C1-12 heterocyclylene (e.g., l,2,3-triazole-l,4-diyll obut-3-ene-l,2-di one-3,4- diyl, or pyrid-2-yl hydrazone);Q2is a linear group (e.g., [-Q3-Q4-Q5]s-), if p is 1, or a branched group (e.g., [-Q3-Q4- Q5]s-Q7([-Q3-Q4-Q5]s-(Q7)pi)P2, where pl is 0 or 1, p2 is 0, 1, 2, or 3), if p is an integer from 2 to 6; each Q3and each Q6is independently absent, -CO-, -NH-, -O-, -S-, -SO2-, -OC(O)-, -COO-, -NHC(O)-, -C(O)NH-, -CH2-, -CH2NH-, -NHCH2-, -CH2O-, or -OCH2-; each Q4is independently absent, optionally substituted C1-12 alkylene, optionally substituted C2-12 alkenylene, optionally substituted C2-12 alkynylene, optionally substituted C2-12 heteroalkylene, optionally substituted Ce-io arylene, optionally substituted C1-9 heteroarylene, or optionally substituted C1-9 heterocyclylene; each Q5is independently absent, -CO-, -NH-, -O-, -S-, -SO2-, -CH2-, -C(O)O-, - OC(O)--C(O)NH-, -NH-C(O)-, -NH-CH(Ra)-C(O)-, or -C(O)-CH(Ra)-NH-; each Q7is independently optionally substituted C1-6 alkane-triyl, optionally substituted C1-6 alkane-tetrayl, optionally substituted C2-6 heteroalkane-triyl, or optionally substituted C2-6 heteroalkane-tetrayl; and each Rais independently H or an amino acid side chain; provided that at least one of Q3, Q4, and Q5is present.
[0308] In some aspects, each Q4is independently absent, optionally substituted C1-12 alkylene, optionally substituted C2-12 alkenylene, optionally substituted C2-12 alkynylene, optionally substituted C2-12 heteroalkylene, or optionally substituted C1-9 heterocyclylene. In certain aspects, s is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.
[0309] Thus, in formula (II), LinkA may include a single branching point, if each pl is 0, or multiple branching points, if at least one pl is 1.
[0310] In formula (II), Q1may be -O-QL-QC-, where QLis optionally substituted C2-12 heteroalkylene, optionally substituted C1-12 alkylene, or -(optionally substituted C1-6 alkylene)-(optionally substituted Ce-io arylene)-. In some aspects, QLis optionally substituted C2-12 heteroalkylene or optionally substituted C1-12 alkylene. In formula (II), Qcmay be:
[0311] In formula (II), Q2may be a linear group of formula [-Q3-Q4-Q5]s-, where Q3, Q4, and Q5are as defined for formula (II). Alternatively, Q2may be a branched group [-Q3-Q4-Q5]s-Q7([- Q3-Q4-Q5]S-(Q7)PI)P2, where each Q7is independently optionally substituted C1-6 alkane-triyl, optionally substituted C1-6 alkane-tetrayl, optionally substituted C2-6 heteroalkane-triyl, or optionally substituted C2-6 heteroalkane-tetrayl; where pl is 0 or 1; p2 is 0, 1, 2, or 3; where, when pl is 0, LinkA is a trivalent or tetraval ent linker, and, when pl is 1, LinkA is a tetravalent, pentavalent, or hexavalent linker.In certain aspects, pl is 0.In some aspects, Q7is:
[0312] Compounds that may be used in the preparation of group -LinkA(-T)p in formula (I) are described herein as well as in WO 2015 / 188197. Non-limiting examples of -LinkA include:(i) (ii) (iii)whereR18is a bond to MOIETY, each R19is independently a bond to auxiliary moiety, each m5 is independently an integer from 1 to 20, each m6 is independently an integer from 1 to 10, m7 is an integer from 1 to 6, and each X6is independently O or S.In formula (II), when the conjugation linker is of formula [-Q3-Q4-Q5]s-Qc-, -Q2,-Q3- Q4-Q5]S-Q6-T)Pmay be:(xvi) (xvii) (xviii)whereR20is a bond to Qcin Q1, each R19is independently a bond to an auxiliary moiety, each m5 is independently an integer from 1 to 20, each m6 is independently an integer from 1 to 10, m7 is an integer from 1 to 6, andeach X6is independently O or S.
[0313] In some aspects, the linker described herein is cleavable. In some aspects, the linker described herein is non-cleavable.
[0314] In some aspects, the polynucleic acid molecule described herein comprises a guide strand or a passenger strand bonded to at least one group of formula (IV),(IV), wherein at least one of Y1 or Y2 is a nucleotide from the polynucleic acid molecule; wherein the is connected to the asialoglycoprotein receptor targeting moiety. In some instances, the linker comprises formula (IV). In some instances, the linker and the asialoglycoprotein receptor targeting moiety with the last nucleotide on the 3’ end of the passenger strand of the polynucleic acid molecule are shown in formula (V’) as described herein.
[0315] In some instances, the Y1 is the last nucleotide on the 3’ end of the passenger strand. In some instances, the Y1 is the last nucleotide on the 3’ end or the first nucleotide on the 5’ end of one of the strands of the polynucleic acid molecule. In some instances, the Y1 is the last nucleotide on the 3’ end or the first nucleotide on the 5’ end of the passenger strand of the polynucleic acid molecule. In some instances, the Y1 is the last nucleotide on the 3’ end or the first nucleotide on the 5’ end of the passenger strand of the polynucleic acid molecule, and the Y2 is a 3-hydroxy- propoxy group. In some instances, the Y2 is the first nucleotide on the 5’ end of the passenger strand of the polynucleic acid molecule. In some instances, the Y2 is the first nucleotide on the 5’ end or the last nucleotide on the 3’ end of one of the strands of the polynucleic acid molecule. In some instances, the Y2 is the first nucleotide on the 5’ end or the last nucleotide on the 3’ end of the passenger strand of the polynucleic acid molecule. In some instances, the Y2 is the first nucleotide on the 5’ end or the last nucleotide on the 3’ end of the passenger strand of the polynucleic acid molecule, and the Y1 is a 3 -hydroxy -propoxy group. In other instances, the Y1 and Y2 are two consecutive nucleotides in one of the strands of the polynucleic acid molecule.
[0316] In some aspects, the targeting moiety described herein is conjugated to 3’ end of the passenger strand via a linker (e.g., formula (IV’)). In some aspects, the targeting moiety described herein is conjugated to 5’ end of the passenger strand via a linker (e.g., formula (IV’”)). In someaspects, the targeting moiety described herein is conjugated to 3’ end of the guide strand via a linker (e.g., formula (IV’)). In some aspects, the targeting moiety described herein is conjugated to5’ end of the guide strand via a linker (e.g., formula (IV’”)).wherein Z in formula (IV’) is a moiety that corresponds to one of the sugar modifications described herein (e.g., -H, -OH, -O-Methyl, -F, or -O-methoxyethyl) and R in formula (IV’) is adenine, uracil, guanine, cytosine, thymine, abasic, or others.wherein Z in formula (IV’”) is a moiety that corresponds to one of the sugar modifications described herein (e.g., -H, -OH, -O-Methyl, -F, or -O-methoxyethyl) and R in formula (IV’”) is adenine, uracil, guanine, cytosine, thymine, abasic, or others.
[0317] In some aspects, the linker conjugated with one or more targeting moieties as shown in Formula (IV’”) is added to the first nucleotide on the 5’ end. In some aspects, the linker conjugated with one or more GalNAc as shown in Formula (V’”) is added to the first nucleotide on the 5’ end. In some aspects, the modification pattern comprises one or more phosphorothioate modified internucleotide linkages. In some aspects, the modification pattern is shown in Formula (VII). In some aspects, the 5’ end modification known in the art is applied to the one or more inverted nucleotides.
[0318] In some aspects, the targeting moiety described herein is conjugated to 3’ end of the passenger strand via a linker (e.g., formula (VI’ ” ’) or (VI’ ’ ’ ’ ’)). In some aspects, the targeting moiety described herein is conjugated to 5’ end of the passenger strand via a linker (e.g., formula (VI””) or (VI’””)). In some aspects, the targeting moiety described herein is conjugated to 3’ end of the guide strand via a linker (e.g., formula (VI’ ” ’) or (VP ” ”)). In some aspects, the targeting moiety described herein is conjugated to 5’ end of the guide strand via a linker (e.g., formula(VI””) or (VI’””)).wherein Z in formula (VI””) is a moiety that corresponds to one of the sugar modifications described herein (e.g., -H, -OH, -O-Methyl, -F, or -O-methoxyethyl) and R in formula (VI””) is adenine, uracil, guanine, cytosine, thymine, abasic, or others.wherein Z in formula (VI’””) is a moiety that corresponds to one of the sugar modifications described herein (e.g., -H, -OH, -O-Methyl, -F, or -O-methoxyethyl) and R in formula (VI””’) is adenine, uracil, guanine, cytosine, thymine, abasic, or others.
[0319] In some aspects, the linker conjugated with one or more targeting moieties as shown in Formula (VI””) or (VI’””) is added to the first nucleotide on the 3’ end. In some aspects, the linker conjugated with one or more GalNAc as shown in Formula (VI””) or (VI’””) is added to the first nucleotide on the 3’ end.Pharmaceutical Compositions
[0320] Delivery of the polynucleotide molecules described herein can be achieved by contacting a cell with the construct using a variety of methods. In particular aspects, the polynucleotide molecule described herein is formulated with various excipients, vehicles, and carriers, as described more fully elsewhere herein.
[0321] A pharmaceutical composition described herein can be prepared to include a hybridized polynucleotide construct disclosed herein, into a form suitable for administration to a subject using carriers, excipients, and vehicles. Frequently used excipients include magnesium carbonate, titanium dioxide, lactose, mannitol and other sugars, talc, milk protein, gelatin, starch, vitamins, cellulose and its derivatives, animal and vegetable oils, polyethylene glycols and solvents, such as sterile water, alcohols, glycerol, and polyhydric alcohols. Intravenous vehicles include fluid and nutrient replenishers. Preservatives include antimicrobial, anti-oxidants, chelating agents, and inert gases. Other pharmaceutically acceptable vehicles include aqueous solutions, non-toxic excipients, including salts, preservatives, buffers and the like, as described, for instance, in Remington: The Science and Practice of Pharmacy, 21st Ed., Gennaro, Ed., Lippencott Williams & Wilkins (2005), and The United States Pharmacopeia: The National Formulary (USP 36 NF31), published in 2013. The pH and exact concentration of the various components of the pharmaceutical composition are adjusted according to routine skills in the art. See Goodman and Gilman's, The Pharmacological Basis for Therapeutics.
[0322] The pharmaceutical compositions described herein may be administered locally or systemically. The therapeutically effective amounts may vary according to factors, such as the degree of infection in a subject, the age, sex, and weight of the individual. Dosage regimes can be adjusted to provide the optimum therapeutic response. For example, several divided doses can be administered daily or the dose can be proportionally reduced as indicated by the exigencies of the therapeutic situation.
[0323] The pharmaceutical composition can be administered in a convenient manner, such as by injection (e.g., subcutaneous, intravenous, intraorbital, and the like), oral administration, ophthalmic application, inhalation, topical application, or rectal administration. Depending on theroute of administration, the pharmaceutical composition can be coated with a material to protect the pharmaceutical composition from the action of enzymes, acids, and other natural conditions that may inactivate the pharmaceutical composition. The pharmaceutical composition can also be administered parenterally or intraperitoneally. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof, and in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms. In some instances, the pharmaceutical composition is formulated for parenteral, oral, intranasal, buccal, rectal, transdermal, intravenous, subcutaneous, or intrathecal administration.
[0324] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. The composition will typically be sterile and fluid to the extent that easy syringability exists. Typically the composition will be stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms, such as bacteria and fungi. The vehicle can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size, in the case of dispersion, and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, isotonic agents, for example, sugars, polyalcohols, such as mannitol, sorbitol, or sodium chloride are used in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate and gelatin.
[0325] Sterile injectable solutions can be prepared by incorporating the pharmaceutical composition in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the pharmaceutical composition into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above.
[0326] It is especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein, refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of pharmaceutical composition is calculated to produce the desiredtherapeutic effect in association with the required pharmaceutical vehicle. The specification for the dosage unit forms are related to the characteristics of the pharmaceutical composition and the particular therapeutic effect to be achieve. The principal pharmaceutical composition is compounded for convenient and effective administration in effective amounts with a suitable pharmaceutically acceptable vehicle in an acceptable dosage unit. In the case of compositions containing supplementary active ingredients, the dosages are determined by reference to the usual dose and manner of administration of the ingredients.
[0327] The pharmaceutical composition can be orally administered, for example, in a carrier, e.g., in an enteric-coated unit dosage form. The pharmaceutical composition and other ingredients can also be enclosed in a hard or soft-shell gelatin capsule or compressed into tablets. For oral therapeutic administration, the pharmaceutical composition can be incorporated with excipients and used in the form of ingestible tablets, troches, capsules, pills, wafers, and the like. Such compositions and preparations may contain at least 1% by weight of active compound. The percentage of the compositions and preparations can, of course, be varied and can conveniently be between about 5% to about 80% of the weight of the unit. The tablets, troches, pills, capsules, and the like can also contain the following: a binder, such as gum tragacanth, acacia, com starch, or gelatin; excipients such as dicalcium phosphate; a disintegrating agent, such as corn starch, potato starch, alginic acid, and the like; a lubricant, such as magnesium stearate; and a sweetening agent, such as sucrose, lactose or saccharin, or a flavoring agent such as peppermint, oil of wintergreen, or cherry flavoring. When the dosage unit form is a capsule, it can contain, in addition to materials of the above type, a liquid carrier. Various other materials can be present as coatings or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills, or capsules can be coated with shellac, sugar, or both. A syrup or elixir can contain the agent, sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye, and flavoring, such as cherry or orange flavor. Any material used in preparing any dosage unit form may be of pharmaceutically acceptable purity and substantially non-toxic in the amounts employed. In addition, the pharmaceutical composition can be incorporated into sustained-release preparations and formulations.
[0328] The pharmaceutical composition described herein may comprise one or more permeation enhancer that facilitates bioavailability of the polynucleotide molecule described herein. WO 2000 / 67798, Muranishi, 1990, Crit. Rev. Ther. Drug Carrier Systems, 7, 1, Lee et al., 1991, Crit. Rev. Ther. Drug Carrier Systems, 8, 91 are herein incorporated by reference in its entirety. In some aspects, the permeation enhancer is intestinal. In some aspects, the permeation enhancer is transdermal. In some aspects, the permeation enhancer is to facilitate crossing the brain-blood barrier. In some aspects, the permeation enhancer improves the permeability in the oral, nasal,buccal, pulmonary, vaginal, or corneal delivery model. In some aspects, the permeation enhancer is a fatty acid or a derivative thereof. In some aspects, the permeation enhancer is a surfactant or a derivative thereof. In some aspects, the permeation enhancer is a bile salt or a derivative thereof. In some aspects, the permeation enhancer is a chelating agent or a derivative thereof. In some aspects, the permeation enhancer is a non-chelating non- surfactant or a derivative thereof. In some aspects, the permeation enhancer is an ester or a derivative thereof. In some aspects, the permeation enhancer is an ether or a derivative thereof. In some aspects, the permeation enhancer is arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1 -monocaprate, 1- dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a monoglyceride, a diglyceride or a pharmaceutically acceptable salt thereof. In one specific aspect, the permeation enhancer is sodium caprate (CIO). In some aspects, the permeation enhancer is chenodeoxycholic acid (CDCA), ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glucholic acid, glycholic acid, glycodeoxycholic acid, taurocholic acid taurodeoxycholic acid, sodium tauro-24,25-dihydro-fusidate or sodium glycodihydrofusidate. In some aspects, the permeation enhancer is polyoxyethylene-9-lauryl ether, or polyoxyethylene-20-cetyl ether.
[0329] For the polynucleotide molecule described herein, suitable pharmaceutically acceptable salts include, but are not limited to, (i) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, etc.; (ii) acid addition salts formed with inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, and the like; and (iii) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, algi...
Claims
CLAIMSWHAT IS CLAIMED IS:
1. A polynucleic acid molecule for modulating expression of Inhibin Subunit Beta E (INHBE) gene, wherein the polynucleic acid molecule comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence selected from Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, and Table 18.2 The polynucleic acid molecule of claim 1, wherein the polynucleic acid molecule is a singlestranded nucleic acid molecule.3 The polynucleic acid molecule of claim 2, wherein the single-stranded nucleic acid molecule comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 1-328, 1319-1331, 1371-1383, and 1423-1432.4 The polynucleic acid molecule of claim 2 or 3, wherein the single-stranded nucleic acid molecule comprises at least 15, 16, 17, 18, 19 consecutive nucleotides of the nucleic acid sequence selected from SEQ ID NOs: 1-328, 1319-1331, 1371-1383, and 1423-1432, with no more than 1, 2, 3, or 4 mismatches.5 The polynucleic acid molecule of claim 1, wherein the polynucleic acid molecule is a doublestranded nucleic acid molecule comprising a passenger strand and a guide strand.6 The polynucleic acid molecule of claim 5, wherein the guide strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 1-328, 1319-1331, 1371-1383, and 1423-1432.7 The polynucleic acid molecule of claim 5 or 6, wherein the guide strand comprises a nucleic acid sequence that is at least 15, 16, 17, 18, 19 consecutive nucleotides of the nucleic acid sequence selected from SEQ ID NOs: 1-328, 1319-1331, 1371-1383, and 1423-1432, with no more than 1, 2, 3, or 4 mismatches.8 The polynucleic acid molecule of any one of claims 5-7, wherein the passenger strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 331-658, 1332-1344, 1384- 1396, and 1433-1443.
9. The polynucleic acid molecule of any one of claims 5-8, wherein the passenger strand comprises a nucleic acid sequence that is at least 15, 16, 17, 18, 19 consecutive nucleotides of the nucleic acid sequence selected from SEQ ID NOs: 331-658, 1332-1344, 1384-1396, and 1433-1443, with no more than 1, 2, 3, or 4 mismatches.
10. The polynucleic acid molecule of any one of claims 1-9, wherein the polynucleic acid molecule comprises (1) a 2’-fluoro modified nucleotides; (2) a 2’-O-methyl modified nucleotides; (3) 2’- deoxy modified nucleotides, or (4) a modified intemucleotide linkage.
11. The polynucleic acid molecule of claim 10, wherein the modified intemucleotide linkage is a phosphorothioate intemucleotide linkage or a phosphorodithioate intemucleotide linkage.
12. The polynucleic acid molecule of claim 11, wherein the polynucleic acid molecule comprises the phosphorothioate intemucleotide linkage located between the two nucleotides at position 11 and 12 from the 5’ end of the guide strand.
13. The polynucleic acid molecule of claim 11, wherein the polynucleic acid molecule comprises the phosphorodithioate intemucleotide linkage located between the two nucleotides at position 11 and 12 from the 5’ end of the guide strand.
14. The polynucleic acid molecule of any one of claims 10-13, wherein the modified intemucleotide linkage comprises a stereochemically enriched phosphorothioate intemucleotide linkage.
15. The polynucleic acid molecule of any one of claims 5-10, wherein the passenger strand comprises 5’- nnnnnnNfnNfnNfnnnnnnnnnn -3’, wherein the guide strand comprises 5’- nNfnnnnNfnnnnNfnNfnNfnnnnnnn -3’, wherein “Nf” stands for a 2’-fluoro modified nucleotide, and “n” stands for a 2’-O-methyl modified nucleotide.
16. The polynucleic acid molecule of any one of claims 5-15, wherein the passenger strand comprises 5’- nsnsnnnnNfnNfnNfnnnnnnnnnn -3’, wherein the guide strand comprises 5’- nsNfsnnnnNfnnnnNfnNfnNfnnnnnsnsn -3’, wherein “Nf’ stands for a 2’-fluoro modified nucleotide, “n” stands for a 2’-O-methyl modified nucleotide, and “s” stands for phosphorothioate intemucleotide linkage.
17. The polynucleic acid molecule of any one of claims 5-16, wherein the guide strand comprises a nucleotide analogue selected from a group consisting of acyclic L-threoninol nucleic acid-thymine-3 '-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3 ’-phosphate (T-A), and 2'-O-methylinosine-3 '-phosphate (i).
18. The polynucleic acid molecule of claim 17, wherein the nucleotide analogue is located at the seed region of the guide strand (positions 2-8) from the 5’ end.
19. The polynucleic acid molecule of any one of claims 5-18, wherein the passenger strand comprises 5'- nsnsnnnnNfnNfnNfnnnnnnnnnn -3', wherein the guide strand comprises 5'- nsNfsnnnnXnnnnssNfnNfnNfnnnnnsnsn -3', wherein "Nf ' stands for a 2'-fluoro modified nucleotide, "n" stands for a 2'-O-methyl modified nucleotide, "s" stands for phosphorothioate internucleotide linkage, “ss” stands for phosphorodithioate intemucleotide linkage, and “X” stands for a nucleotide analogue.
20. The polynucleic acid molecule of any one of claims 5-18, wherein the passenger strand comprises 5'- nsnsnnnnNfnNfnNfnnnnnnnnnn -3', wherein the guide strand comprises 5'- nsNfsnnnnXnnnnNfnNfnNfnnnnnsnsn -3', wherein "Nf ' stands for a 2'-fluoro modified nucleotide, "n" stands for a 2'-O-methyl modified nucleotide, "s" stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue.
21. The polynucleic acid molecule of any one of claims 5-18, wherein the passenger strand comprises 5'- nsnsnnnnNfnNfnNfnnnnnnnnnn -3', wherein the guide strand comprises 5'- nsNfsnnnnXnnnnsNfnNfnNfnnnnnsnsn -3', wherein "Nf' stands for a 2'-fluoro modified nucleotide, "n" stands for a 2'-O-methyl modified nucleotide, "s" stands for phosphorothioate internucleotide linkage, and “X” stands for a nucleotide analogue.
22. The polynucleic acid molecule of any one of claims 5-21, wherein the guide strand comprises a vinyl phosphonate modified nucleotide at the 5’ end.
23. The polynucleic acid molecule of any one of claims 5-22, wherein the vinyl phosphonate modified nucleotide is 5 ’(E) vinylphosphonate-2’-O-methoxy-ethyl-5-methyluridine-3’- phosphate (vpt4) or 5'(E) vinylphosphonate-2-O-methyluridine-3'phosphate (vpu).
24. The polynucleic acid molecule of any one of claims 5-23, wherein the guide strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 661-988, 1345-1357, 1397-1409, and 1444- 1462.
25. The polynucleic acid molecule of any one of claims 5-24, wherein the guide strand comprises a nucleic acid sequence that is at least 15, 16, 17, 18, 19 consecutive nucleotides of the nucleic acid sequence selected from SEQ ID NOs: 661-988, 1345-1357, 1397-1409, and 1444-1462, with no more than 1, 2, 3, or 4 mismatches.
26. The polynucleic acid molecule of any one of claims 5-25, wherein the passenger strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95% identical a nucleic acid sequence selected from SEQ ID NOs: 991-1318, 1358-1370, 1410- 1422, and 1463-1475.
27. The polynucleic acid molecule of any one of claims 5-26, wherein the passenger strand comprises a nucleic acid sequence that is at least 15, 16, 17, 18, 19 consecutive nucleotides of the nucleic acid sequence selected from SEQ ID NOs: 991-1318, 1358-1370, 1410-1422, and 1463-1475, with no more than 1, 2, 3, or 4 mismatches.
28. The polynucleic acid molecule of any one of claims 1-27, wherein the polynucleic acid molecule is 19-25 nucleotides in length.
29. The polynucleic acid molecule of any one of claims 1-28, wherein the polynucleic acid molecule is 21-23 nucleotides in length.
30. The polynucleic acid molecule of any one of claims 5-29, wherein the guide stand comprises or consists of a nucleic acid sequence selected from SEQ ID NO: 661-988, 1345-1357, 1397-1409, and 1444-1462, and the passenger stand comprises or consists of a nucleic acid sequence selected from SEQ ID NO: 991-1318, 1358-1370, 1410-1422, and 1463-1475.
31. A polynucleic acid molecule for modulating expression of inhibin subunit beta E (INHBE) gene, comprising:(a) a guide strand comprising a nucleic acid sequence of UAUCGGAAGAUCCUCAAGCACAG (SEQ ID NO: 1379) and a passenger strand comprising a nucleic acid sequence of GUGCUUGAGGAUCUUCCGAUA (SEQ ID NO: 1392); or(b) a guide strand comprising a nucleic acid sequence of UUAUGAUCCAGGUAGAGGAGAGA (SEQ ID NO: 1429) and a passenger strand comprising a nucleic acid sequence of UCUCCUCUACCUGGAUCAUAA (SEQ ID NO: 1437).
2. A polynucleic acid molecule for modulating expression of inhibin subunit beta E (INHBE) gene, comprising:(a) a guide strand comprising a nucleic acid sequence of usUfsaugaUfccagGfuAfgAfggagasgsa (SEQ ID NO: 1451) and a passenger strand comprising a nucleic acid sequence of uscsuccuCfuAfcCfuggaucauaa (SEQ ID NO: 1468);(b) a guide strand comprising a nucleic acid sequence of usUfsaugaUfccagGfuAfgAfggagasgsa (SEQ ID NO: 1451) and a passenger strand comprising a nucleic acid sequence of uscsuccuCfuAfcCfuggaucauaa (SEQ ID NO: 1473);(c) a guide strand comprising a nucleic acid sequence of usUfsaugaUfccagssGfuAfgAfggagasgsa (SEQ ID NO: 1458) and a passenger strand comprising a nucleic acid sequence of uscsuccuCfuAfcCfuggaucauaa (SEQ ID NO: 1473);(d) a guide strand comprising a nucleic acid sequence of vpusUfsaugaUfccagssGfuAfgAfggagasgsa (SEQ ID NO: 1459) and a passenger strand comprising a nucleic acid sequence of uscsuccuCfuAfcCfuggaucauaa (SEQ ID NO: 1473);(e) a guide strand comprising a nucleic acid sequence of usAfsucgg(T- A)agaussCfcUfcAfagcacsasg (SEQ ID NO: 1461) and a passenger strand comprising a nucleic acid sequence of gsusgcuuGfaGfgAfucuuccgaua (SEQ ID NO: 1475);(f) a guide strand comprising a nucleic acid sequence of usAfsucgg(T- A)agauCfcUfcAfagcacsasg (SEQ ID NO: 1405) and a passenger strand comprising a nucleic acid sequence of gsusgcuuGfaGfgAfucuuccgaua (SEQ ID NO: 1475);(g) a guide strand comprising a nucleic acid sequence of usAfsucgg(T- A)agausCfcUfcAfagcacsasg (SEQ ID NO: 1462) and a passenger strand comprising a nucleic acid sequence of gsusgcuuGfaGfgAfucuuccgaua (SEQ ID NO: 1475); or(h) a guide strand comprising a nucleic acid sequence of usAfsucgg(T- A)agauCfcUfcAfagcacsasg (SEQ ID NO: 1405) and a passenger strand comprising a nucleic acid sequence of gsusgcuuGfaGfgAfucuuccgaua (SEQ ID NO: 1418), wherein “A” refers to adenosine-3’ -phosphate; “a” refers to 2’-O-methyladenosine-3’- phosphate; “Af” refers to 2 ’-fluoroadenosine-3 ’-phosphate; “C” refers to cytidine-3’ -phosphate; “c” refers to 2’ -O-methylcytidine-3’ -phosphate; “Cf” refers to 2’-fluorocytidine-3’-phosphate; “G” refers to guanosine-3 ’-phosphate; “g” refers to 2’-O-methylguanosine-3’-phosphate; “Gf” refers to 2 ’-fluoroguanosine-3 ’-phosphate; “U” refers to uridine-3’ -phosphate; “u” refers to 2’- O-methyluridine-3 ’-phosphate; “Uf” refers to 2’ -fluorouridine-3’ -phosphate; “T” refers to 5-methyluridine-3’ -phosphate; “t” refers to 2’-O-methyl-5-methyluridine-3’-phosphate; “Tf” refers to 2’-fluoro-5-methyluridine-3 ’-phosphate; "(T-A)" refers to acyclic L-threoninol nucleic acid-adenine-3 '-phosphate; "s" refers to phosphorothioate internucleotide linkage; “ss” refers to phosphorodithioate intemucleotide linkage; and "vpu" refers to 5 ’(E) vinylphosphonate-2-O- methyluridine-3 ’phosphate.
33. A polynucleic acid molecule conjugate for modulating expression of Inhibin Subunit Beta E (INHBE) gene, wherein the polynucleic acid molecule conjugate comprises a polynucleic acid molecule of any one of claims 1-32 and an asialoglycoprotein receptor targeting moiety.
34. The polynucleic acid molecule conjugate of claim 33, wherein the asialoglycoprotein receptor targeting moiety comprises N-Acetylgalactosamine (GalNAc) or galactose.
35. The polynucleic acid molecule conjugate of any one claims 33-34, wherein the polynucleic acid molecule and the asialoglycoprotein receptor targeting moiety is coupled via a linker.
36. The polynucleic acid molecule conjugate of claim 35, wherein the linker comprises formula (IV) below,wherein at least one of Y1 and Y2 is a nucleotide in the polynucleic acid molecule; wherein theis connected to the asialoglycoprotein receptor targeting moiety.
37. The polynucleic acid molecule conjugate of claim 36, wherein the Y1 is the last nucleotide on the 3’ end of the passenger strand of the polynucleic acid molecule.
38. The polynucleic acid molecule conjugate of claim 36, wherein the Y1 and Y2 are two consecutive nucleotides in the polynucleic acid molecule.
39. The polynucleic acid molecule conjugate of any one of claims 33-38, wherein the asialoglycoprotein receptor targeting moiety comprises N-Acetylgalactosamine (GalNAc).
0. The polynucleic acid molecule conjugate of any one of claims 33-39, wherein the linker and the asialoglycoprotein receptor targeting moiety with the last nucleotide on the 3’ end of the passenger strand of the polynucleic acid molecule are shown in:wherein Z in formula (V’), (VI”), or (VI’”) is -H, -OH, -O-Methyl, -F, or -O-m ethoxy ethyl; R in formula (V’), (VI”), or (VI’”) is adenine, uracil, guanine, cytosine, thymine, abasic, or others; and the is to connect to an adjacent nucleotide of the polynucleic acid molecule.
41. A pharmaceutical composition comprising a polynucleic acid molecule of any one of claims 1- 32 or a polynucleic acid molecule conjugate of any one of claims 33-40, and a pharmaceutically acceptable excipient.
42. The pharmaceutical composition of claim 41, wherein the pharmaceutical composition is formulated as a nanoparticle formulation.
43. The pharmaceutical composition of claim 41 or claim 42, wherein the pharmaceutical composition is formulated for parenteral, oral, intranasal, buccal, rectal, transdermal, intravenous, subcutaneous, or intrathecal administration.
44. A method of modulating expression of Inhibin Subunit Beta E (INHBE) gene in a subject, comprising: administering to the subject a polynucleic acid molecule of any one of claims 1-32 or a polynucleic acid molecule conjugate of any one of claims 33-40, or a pharmaceutical composition of claims 41-43, thereby modulating the expression of INHBE gene in the subject.
45. A method of preventing, alleviating, or treating INHBE-associated disease or symptom thereof in a subject in need thereof, comprising: administering to the subject a polynucleic acid molecule of any one of claims 1-32 or a polynucleic acid molecule conjugate of any one ofclaims 33-40, or a pharmaceutical composition of claims 41-43, thereby modulating the INHBE expression level in the subject.
46. The method of claim 45, wherein the disease associated with INHBE comprises a metabolic syndrome, a cardiometabolic disease, a non-alcoholic fatty liver disease, and obesity.
Citation Information
Patent Citations
Metabolic disorder-associated target gene IRNA compositions and methods of use thereof
WO2023003922A1
Inhibin subunit beta e (INHBE) modulator compositions and methods of use thereof
WO2023044094A1