Method for preparing gene-edited chicken

Abstract

The present application relates to the technical field of genetic engineering, and in particular to a method for preparing a gene-edited chicken. In the present application, an in-situ ovarian injection method is used in a hen. By means of selecting a hen approaching the onset of laying and injecting a gene-editing reagent into the ovarian medulla thereof, the exogenously injected gene editing reagent enters developing follicles via blood circulation, such that a chimeric chicken with both edited somatic and germ cells is successfully and efficiently obtained in the G0 generation, with the editing efficiency reaching up to 36.36% in the G0 generation. Compared with traditional PGC-mediated methods, the in-situ ovarian injection method provided by the present application saves both time and labor, and is convenient and efficient, low-cost and highly safe.

Description

A method for producing gene-edited chickens

[0001] This application claims priority to Chinese Patent Application No. CN202410931448.9, filed on July 12, 2024, entitled "A Method for Preparing Gene-Edited Chickens", the entire contents of which are incorporated herein by reference. Technical Field

[0002] This application relates to the field of genetic engineering technology, and in particular to a method for preparing gene-edited chickens. Background Technology

[0003] As oviparous animals, chicken embryonic development consists of two parts: internal and external development. After sexual maturity, follicles develop rapidly and gradually increase in size. Based on follicle diameter, they can be classified into pre-ovulatory follicles such as small white follicles, large white follicles, and small yellow follicles, as well as F1 to F6 pre-ovulatory follicles. After ovulation, the F1 follicle is received by the infundibulum of the oviduct, where fertilization occurs. The yolk carrying the fertilized egg then migrates through the oviduct, remaining in the swollen part for about 4 hours to form egg white, and in the isthmus for about 1 hour to complete the deposition of the inner and outer shell membranes. The first mitosis of the fertilized egg also begins in the isthmus. The egg then enters the uterus and remains there for about 18-19 hours to complete shell mineralization and pigment deposition. Finally, it is expelled from the vagina. At this stage, the chicken embryo is in the blastocyst stage, consisting of a blastodisc with a diameter of about 3.5 mm visible to the naked eye on the yolk surface, containing approximately 55,000 cells. If the eggs are stored at a low temperature of 16°C, embryonic development will stop; if they are placed back incubation at 37.8°C, the embryo will restart development in the environment after being separated from the mother. After an incubation process of 21 days, the chicks will hatch.

[0004] Due to the unique reproductive physiology of chickens, early fertilized eggs are difficult to obtain. Methods suitable for mammalian micromanipulation of fertilized eggs or somatic cell nuclear transfer to produce genome-modified individuals are not feasible in chickens. Currently, the mainstream method for producing gene-edited chickens is the primordial germ cell (PGC)-mediated method. This method requires skilled PGC culture techniques, extensive experience in PGC transfer, and a strictly controlled laboratory environment, placing high demands on the operators. Furthermore, this method has a long cycle for obtaining homozygous mutant individuals, and competition from endogenous PGCs leads to low and unstable transmission efficiency in the G0 generation (typically below 10%). Currently, sterile chicken strains can be obtained based on the PGC method, which can be used as surrogate hosts for exogenous PGC donors. This can shorten the preparation cycle for homozygous mutant individuals and improve the transmission efficiency of the G0 generation. However, the surrogate host is a transgenic chicken, posing a potential biosafety risk.

[0005] Summary of the Invention

[0006] To address the aforementioned problems, this application provides a method for preparing gene-edited chickens. This application utilizes a novel approach, independent of PGC mediation, to prepare gene-edited chickens (G... -1 By injecting CRISPR / Cas9 RNP into the ovaries of chickens in situ (G0 generation), chimeric chickens with both somatic cells and gonads edited can be efficiently obtained in the G0 generation. This is a simple, convenient, safe, and efficient new method for preparing gene-edited chickens.

[0007] To achieve the above objectives, this application provides the following technical solution:

[0008] This application provides a method for preparing gene-edited chickens, comprising the following steps: injecting gene-editing reagent into the ovarian medulla of a hen 10-15 days before laying, to obtain G... -1 The broiler hen; the gene editing reagent includes a reagent for gene editing using CRISPR / Cas9 RNP; the G -1 Fertilizer is applied to a surrogate hen to obtain hatching eggs; the hatching eggs are artificially incubated to obtain a G0 generation population; the gene editing results are detected in the G0 generation population to obtain gene-edited chickens.

[0009] Preferably, the reagents for gene editing using CRISPR / Cas9 RNP include: Cas9 protein, gRNA, and buffer; the molar ratio of Cas9 protein to gRNA is 1:1 to 2; and the injection concentration of Cas9 protein is 3.5 μg / μL.

[0010] Preferably, the buffer solution comprises 20 mM HEPES and 500 mM NaCl.

[0011] Preferably, the Cas9 protein includes the Cas9 protein expressed in prokaryotes.

[0012] Preferably, before injecting the gene editing reagent, the editing efficiency of the gRNA is detected using a chicken tool cell line, and gRNAs with an editing efficiency ≥45% are selected.

[0013] Preferably, the chicken tool cell line includes DF-1 cells.

[0014] Preferably, the hens injected with the gene-editing reagent are fasted on the day of injection.

[0015] Preferably, the method further includes: after obtaining gene-edited chickens, self-crossing the roosters and hens in the gene-edited chickens to obtain homozygous gene-edited chickens.

[0016] Preferably, the method for detecting the results of gene editing includes 1) and / or 2), specifically:

[0017] 1) Observe the phenotype of individuals in the G0 generation population based on the mutational effects produced after gene editing;

[0018] 2) Determine the gene editing events and types in individuals within the G0 generation population.

[0019] Preferably, the assay method in 2) includes PCR amplification and / or sequencing.

[0020] Beneficial Effects: This application employs an in situ ovarian injection method in hens. By selecting hens nearing the start of egg production and injecting gene-editing reagents into the medulla of their ovaries, the exogenously injected gene-editing reagents enter the developing follicles through blood circulation. In the G0 generation, chimeric chickens with edited somatic and germ cells were successfully and efficiently obtained, with an editing efficiency of up to 36.36%. Compared to traditional PGC-mediated methods, the in situ ovarian injection method in this application is time-saving, labor-saving, convenient, quick, low-cost, and highly safe. The specific advantages are reflected in the following aspects: (1) Since the G0 generation gene-edited chickens obtained by the ovarian orthotopic injection method are somatic cell chimeras, the mutant individuals can be identified within one week after hatching by extracting blood genomic DNA, which shortens the identification time of mutant individuals; (2) Since the G0 generation gene-edited chickens obtained by the ovarian orthotopic injection method are somatic cell chimeras, they can show the mutant phenotype of functional genes in the current generation, and can determine in advance whether gene mutation affects its normal function, which is of great significance for the research of new genes and accelerates the research progress of functional genes; (3) Both roosters and hens obtained by the ovarian orthotopic injection method can produce mutants. After the mutants reach sexual maturity, they can be self-crossed, and homozygous mutant individuals can be obtained in the G1 generation, shortening the preparation cycle to 8 months; For individuals, the TA cloning results of genomic DNA show that the chimerism rate of individuals is 8.33% to 52.94%, and the target gene site was also detected to be edited in the semen of roosters (Figure 2), indicating that the chimerism rate of the obtained G0 generation individuals is high, and it is easier to obtain heterozygotes or homozygotes in the G1 generation; (4) When the gene editing reagent injected is Cas9 During RNP, the Cas9 protein is degraded after it plays its role, and only the editing event occurs without introducing foreign genes and without contaminating the chicken's own genome, thus ensuring biosafety; (5) Furthermore, the method provided in this application avoids the process of PGC culture and transfection. After verifying the gRNA editing efficiency of the target gene at the DF-1 cell level, only the expression and purification of Cas9 protein and in vitro transcription of gRNA are required before surgical injection. The preparation process is relatively mature, the surgical procedure is simple and easy to learn, and only a universal animal anesthesia machine, surgical instruments and a 1mL disposable sterile syringe are needed to complete the ovarian in situ injection operation; (6) Furthermore, the cost of the method provided in this application is concentrated in the universal animal anesthesia machine equipment, gRNA in vitro transcription kit, identification of edited individuals and feeding, etc., which is much lower than the cost of PGC-mediated methods.

[0021] In summary, the ovarian in situ injection method provided in this application has the potential to replace the traditional PGC method for preparing gene-edited chickens. It can be applied in non-specialized laboratories, used for the study of functional genes, and can accelerate the research process of gene-edited chickens. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0023] Figure 1 shows the design of gRNA targeting the IHH gene and the results of editing efficiency detection in DF-1 cells;

[0024] Figure 2 shows the phenotypes of some IHH mutants and the results of gRNA-R3 target site editing detection;

[0025] Figure 3 shows the TA cloning results of the IHH gene mutant;

[0026] Figure 4 shows the results of gene editing detection in the G0 generation after injecting pX330 plasmid into the ovaries of hens.

[0027] Figure 5 shows the results of Cas9 gene editing and IHH gene editing detection in different tissues of G0 generation mutant individuals. Detailed Implementation

[0028] This application provides a method for preparing gene-edited chickens, comprising the following steps: injecting gene-editing reagent into the ovarian medulla of a hen 10-15 days before laying, to obtain G... -1 The broiler hen; the gene editing reagent includes a reagent for gene editing using CRISPR / Cas9 RNP; the G -1 Fertilizer is applied to a surrogate hen to obtain hatching eggs; the hatching eggs are artificially incubated to obtain a G0 generation population; the gene editing results are detected in the G0 generation population to obtain gene-edited chickens.

[0029] This application describes injecting gene-editing reagents into the ovarian medulla of hens 10-15 days before egg production to obtain G... -1The gene-editing reagent described in this application includes a reagent for gene editing using CRISPR / Cas9 RNP; the reagent for gene editing using CRISPR / Cas9 RNP preferably includes Cas9 protein and gRNA; the injection concentration of the Cas9 protein is preferably 3.5 μg / μL; the molar ratio of Cas9 to gRNA is preferably 1:1 to 2, more preferably 1:1. When injecting Cas9 RNP, the final concentration of its storage buffer components is preferably 20 mM HEPES and 500 mM NaCl. On the day of injection, the Cas9 protein and gRNA are preferably thawed and prepared immediately, the reagent is prepared in a centrifuge tube, incubated at 37°C for 5 min, and then transferred to a disposable sterile syringe to ensure that the Cas9 RNP is injected into the hen's ovary within 1 hour. If there are two or more gRNAs, each gRNA is preferably incubated separately with an equal volume of Cas9 protein to form an RNP before mixing and transferring to a disposable sterile syringe for ovarian injection.

[0030] This application preferably designs candidate gRNAs based on target genes; after obtaining the candidate gRNAs, this application preferably identifies the activity of the candidate gRNAs in chicken tool cell lines, and preferably selects gRNAs with an editing efficiency of 45% or higher, thereby ensuring that the target gRNAs used for in vivo ovarian injection can achieve gene editing. This step is to screen for gRNAs with high activity at the cellular level. In this application, the chicken tool cell line preferably includes DF-1 cells.

[0031] After obtaining gRNA, this application preferably uses in vitro transcription to prepare a large quantity of gRNA. In this application, two 10 μL in vitro transcription reaction systems can meet the gRNA injection dosage for one chicken. This application preferably uses prokaryotic expression to prepare Cas9 protein and purifies Cas9 protein using nickel column affinity chromatography, which is not only low-cost but also allows for the design of Cas9 protein fusion proteins as needed.

[0032] After obtaining Cas9 protein and gRNA, this application preferably uses an in vitro cleavage method to verify the activity of Cas9 protein and gRNA. This application has certain requirements regarding the age and ovarian development status of the hens to be injected. Hens close to laying age (10-15 days before laying), approximately 15-17 weeks old, vary depending on the breed of hen used. The advantages of selecting hens close to laying age are: 1) The follicles of hens close to laying age have not yet developed to the pre-ovulatory stage. When performing ovarian injection surgery, there will be no pre-ovulatory follicles blocking the surgical opening, making it easier to locate the ovary and determine the needle insertion point when injecting exogenous substances, which is beneficial for the injection operation; 2) When the follicles of hens close to laying age develop to the small yellow and large yellow follicle stages, it is the rapid yolk deposition stage. The exogenously injected protein is more easily taken up by the follicles, improving the efficiency of G0 generation editing.

[0033] The injection (ovarian in situ injection) described in this application is preferably performed in the morning. The hen to be operated on is preferably fasted on the day of the surgery to avoid obstructing the surgical incision view due to a distended intestine and to prevent accidents during the procedure. For specific details, please refer to step 7 in Example 1. The injection method provided in this application has a low operational threshold and can be performed by those skilled in the art without the need for professional personnel.

[0034] Get G -1 broiler hens, in the G -1 After the broiler hen lays its first egg, this application will transfer the G described above. -1 The hen is fertilized to obtain hatching eggs. After obtaining the hatching eggs, the hen is artificially incubated to obtain a GE generation population. The injection surgery performed on the hen in this application will not affect the fertilization rate and hatching rate of the hatching eggs.

[0035] After obtaining the G0 generation population, this application detects the gene editing results in the G0 generation population to obtain gene-edited chickens. In this application, the preferred method for detecting the gene editing results includes: after hatching, detecting the offspring of the operated hens at both the phenotypic and genetic levels. Phenotypically, it is preferred to observe the phenotype of individuals in the G0 generation population based on the mutational effects produced by functional genes. At the genetic level, it is preferred to collect blood from 1-day-old chicks using the carotid artery blood sampling method, extract genomic DNA, perform PCR amplification on the gRNA sites of target genes, and identify gene-edited individuals using the LabChip GXll Touch microfluidic capillary electrophoresis system, preferably using the HT DNA High Sens chip and matching reagents. Other methods such as TA cloning are used to detect the Indel type of the edited individuals, confirming that the edited individuals are suitable for breeding. Thus, chimeric chickens with both somatic and germ cells edited are obtained in the G0 generation.

[0036] After obtaining gene-edited chickens, this application preferably involves self-crossing the roosters and hens in the gene-edited chickens to obtain homozygous gene-edited chickens.

[0037] To further illustrate this application, a method for preparing gene-edited chickens provided by this application is described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of this application.

[0038] Example 1

[0039] In nature, a single copy deletion of the IHH gene results in a creeping phenotype in Xingyi dwarf chickens, characterized by stunted growth, short shanks, short body, and small wings. This mutation can be identified during the embryonic stage. Homozygous deletion of the IHH gene causes early embryonic death, demonstrating that mutations in the IHH gene affect embryonic development and produce easily detectable mutant phenotypes. Using the IHH gene as a target gene facilitates preliminary phenotypic identification of edited individuals.

[0040] 1. gRNA Design and Vector Construction: To interfere with the function of the chicken IHH gene as much as possible, two gRNA combinations were designed targeting the first exon of the chicken IHH gene to achieve fragment knockout. gRNA sequences were designed with gRNA-R1 located at the end of the first exon, and gRNA-R2 and gRNA-R3 located at the front and middle / back ends of the first exon, respectively. gRNA-R1 and gRNA-R2, and gRNA-R3 were combined (denoted as IHH-gR2+gR1 and IHH-gR3+gR1) to construct the pX330-dual gRNA knockout plasmid. The gRNA sequences and locations are shown in Figure 1A and Figure 1B. The specific sequences are as follows: gRNA-R1: 5'-tacctgggtcatgagccggt-3' (SEQ ID NO.1); gRNA-R2: 5'-cggcggcaataaatagcgaa-3' (SEQ ID NO.2); gRNA-R3: 5'-gcgagcgggatgagcttgcg-3' (SEQ ID NO.3).

[0041] The construction process of pX330-dual gRNA knockout plasmid is as follows: (1) When constructing the pX330-dual gRNA knockout vector for the first time, the element sequence that can transcribe dual gRNA is obtained by gene synthesis. The specific sequence is as follows:

[0042] IHH-gR2+gR1: 5'-ATCGGAAGACCTCACCGcggcggcaataaatagcgaaGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGtacctgggtcatgagccggtGTTTGGGTCTTCATCG-3' (SEQ ID NO.4);

[0043] IHH-gR3+gR1: 5'-ATCGGAAGACCTCACCgcgagcgggatgagcttgcgGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGtacctgggtcatgagccggtGTTTGGGTCTTCATCG-3' (SEQ ID NO.5);

[0044] Clone the sequences shown in SEQ ID NO.4 and SEQ ID NO.5 into the pUC57 vector respectively, and use this vector as the template for PCR amplification of the dual gRNA.

[0045] (2) Using KOD One TM PCR master mix (TOYOBO) was used to amplify the double gRNA transcription sequence using primer sequences as follows: IHH-gR2+gR1-F: 5'-atcggaagacctcaccgcggcggcaataaatagcgaagttttagagctagaaatag-3' (SEQ ID NO. 6); IHH-gR2+gR1-R: 5'-cgatgaagacccaaacaccggctcatgacccaggtacggtgtttcgtcctttcc-3' (SEQ ID NO. 7); IHH-gR3+gR1-F: 5'-atcggaagacctcaccgcgagcgggatgagcttgcggttttagagctagaaatag-3' (SEQ ID NO. 8); The primer sequence for IHH-gR3+gR1-R is shown in SEQ ID NO. 7.

[0046] (3) The pX330 linearized vector obtained by Bbs I digestion and the PCR product of double gRNA digested by Bbs I digestion were ligated using T4 ligase. The ligation products were transformed and identified as single clones. The bacterial cultures with correct sequencing were subjected to endotoxin-free plasmid extraction to obtain pX330-gRNA-(R2+R1) and pX330-gRNA-(R3+R1) knockout vectors.

[0047] 2. DF-1 cell transfection: Chicken DF-1 cells were resuscitated and cultured. One day before transfection, DF-1 cells were passaged and plated into 6-well plates, ensuring a cell confluence of 60-70% at transfection the following day. The two pX330-dual gRNA vectors constructed in step 1 were co-transfected into DF-1 cells with the PiggyBac transposon plasmid and transposase plasmid, respectively, at a mass ratio of 3:3:1. Transfection was performed using HD transfection reagent (Promega) according to the manufacturer's instructions. After 48 hours, the cells were screened with 1.5% puromycin. Three days later, when all negative cells had died, the cells were collected, and genomic DNA was extracted. Primers targeting the target sequence were designed, and PCR was performed. The primer sequences were: F: 5'-aatttcccctctcactcc-3' (SEQ ID NO. 9); R: 5'-ctttgccatcctactctg-3' (SEQ ID NO. 10).

[0048] The editing efficiency of different gRNA combinations was detected by 1.5% agarose gel electrophoresis, and the results are shown in Figure 1C. The fragment deletion efficiency of the gRNA-R1 and gRNA-R3 combination was 48.4%, while that of the gRNA-R1 and gRNA-R2 combination was 23.8%. Therefore, the gRNA-R1 and gRNA-R3 combination, which had higher editing efficiency, was selected for in vivo ovarian injection.

[0049] 3. gRNA Preparation: The two gRNAs were cloned into the linearized pX330 vector obtained by BBSI digestion to obtain pX330-gR1 and pX330-gR3 knockout plasmids. These plasmids were used as templates for PCR amplification. The upstream primer contained the T7 promoter and the gRNA sequence, and the downstream primer was a polyA sequence and a partially inverse complementary sequence of the gRNAscaffold on the pX330 vector. The specific primer sequences are as follows:

[0050] T7_IHH_gR1_F: 5'-TAATACGACTCACTATAGGGtacctgggtcatgagccggt-3' (SEQ ID NO. 11); T7_IHH-gR3_F: 5'-TAATACGACTCACTATAGGGgcgagcgggatgagcttgcg-3' (SEQ ID NO.12); The sequence of T7_uni_R is 5'-AAAAAAgcaccgactcggtgccac-3' (SEQ ID NO.13);

[0051] Among them, 5'-TAATACGACTCACTATAGGG-3' (SEQ ID NO.14) in the upstream primer is the T7 promoter sequence, AAAAAA in the downstream primer is a polyA tail sequence, which is the transcription termination sequence, and 5'-gcaccgactcggtgccac-3' (SEQ ID NO.15) is a partial sequence of gRNAscaffold.

[0052] The obtained PCR product was purified or gel-recovered and used as a DNA template for in vitro transcription of gRNA. The procedure was performed according to the instructions of the MEGAshortscriptT7 transcription kit (Thermo Fisher Scientific, catalog number AM1354). The gRNA was purified using the phenol-formaldehyde method. The obtained gRNA was dissolved in nuclease-free water, and the concentration and OD value were determined using Nanodrop 2000. The gRNA concentration was between 1 and 5 μg / μL, which is sufficient for injection.

[0053] 4. Cas9 protein preparation: The 2NLS sequence was synthesized by gene and cloned into the pET28a-Cas9 plasmid (Addgeneplasmid, #53261) to obtain the pET28a-Cas9-2NLS plasmid. The specific steps for constructing the pET28a-Cas9-2NLS prokaryotic expression vector are as follows: (1) Vector linearization: The pET28a-Cas9 plasmid was double-digested with MreI and XhoI, and the digestion products were recovered by gel extraction. (2) PCR amplification of partial Cas9 sequence: Primers Cas9-tyF: 5'-caagcgcatgctggccagcgccggcgagctgcagaagggca-3' (SEQ ID NO.16) and Cas9-tyR: 5'-tctcgtacagaccggtgatgctctggtggatcagggtg-3' (SEQ ID NO.17) were designed and synthesized using KOD One. TM PCR masterMix was used to amplify a portion of the Cas9 sequence in the pET28a-Cas9 plasmid, and the product was purified and recovered. (3) 2NLS sequence gene synthesis and PCR amplification: The 2NLS sequence was synthesized and cloned into the pUC57 vector backbone; the 2NLS sequence is as follows: 5'-catcaccggtctgtacgagacccgcatcgacctgagccagctgggcggcgacggcggctccggacctccaaagaaaaagagaaaagtagaggacccaaagaaaaagagaaaagtatacccctacgacgtgcccgactacgcctgttaactcgagcaccac-3' (SEQ ID NO.18). Using this as a PCR template, primers 2NLS-tyF: 5'-catcaccggtctgtacgagacccgcatcgacctga-3' (SEQ ID NO.19) and 2NLS-tyR: 5'-cagtggtggtggtggtggtgctcgagttaacaggcgtagtcgg-3' (SEQ ID NO.20) were designed and synthesized using KOD One. TM PCR amplification was performed using PCRmasterMix, and the products were purified and recovered. (4) Homologous recombination: using The Seamless Cloning and Assembly Kit (Beijing TransGen Biotech Co., Ltd.) utilizes homologous recombination to insert partial Cas9 and 2NLS sequences into the pET28a-Cas9 linearized vector. Subsequent transformation, single-clone identification, and plasmid extraction steps yield the pET28a-Cas9-2NLS prokaryotic expression vector, which was then used for prokaryotic expression and purification of the target protein.

[0054] The BL21(DE3) *Escherichia coli* strain was transformed into the pET28a-Cas9-2NLS prokaryotic expression vector, then plated onto kanamycin-resistant LB agar plates. Single colonies were picked and transferred to 20 mL of kanamycin-resistant 2×YT medium, and cultured overnight at 37°C and 200 rpm with shaking. The culture was then inoculated into 1 L of kanamycin-resistant 2×YT medium and cultured with shaking until OD (outlet size) was reached. 600 The concentration was brought to approximately 0.6. The culture was allowed to return to room temperature for 30 minutes, and then 0.5 M IPTG solution was added to bring the final concentration to 0.5 mM. The culture was then incubated for 20 hours at 16°C and 120 rpm on a low-temperature shaker. The bacterial cells were then obtained by centrifugation at 8000 g for 10 minutes at 4°C. Lysis buffer (20 mM Tris-HCl, 500 mM NaCl, 10% glycerol, 0.1% Trixon X-100, 1 mg / mL lysozyme, 1 mM PMSF) was added, and the cells were lysed using sonication. The supernatant was collected by centrifugation at 12000 rpm and 4°C for 30 minutes. The supernatant contained soluble Cas9-2NLS target protein.

[0055] The supernatant was bound to Ni Sepharose 6 FastFlow packing material (Cytiva) at 4°C for 1 h, and eluted with 10, 20, 50, 100, and 250 mM imidazole buffer, respectively. The 250 mM imidazole buffer (20 mM Tris-HCl, 500 mM NaCl, 250 mM imidazole) was collected and added to a 50 kDa ultrafiltration tube. The tube was centrifuged at 4000 g and 4°C. When the volume of the solution in the ultrafiltration tube was less than 500 μL, protein storage buffer (20 mM HEPES, 500 mM NaCl) was added to replace the buffer. Centrifugation continued until the volume of the solution was less than 1 mL. The solution was then transferred to 1.5 mL centrifuge tubes, and the Cas9-2NLS protein concentration was determined using the Bradford method. The solution was aliquoted according to the dosage for each chicken, flash-frozen in liquid nitrogen, and stored at -80°C. Typically, one single colony is inoculated into 1L of 2×YT medium, and the resulting bacterial cells produce enough Cas9 protein to supply the injection dose for 2 to 3 hens.

[0056] 5. In vitro cleavage activity assay: Using chicken genomic DNA as a template, the target sequence containing gRNA was amplified by PCR, and the PCR product was recovered. 200 ng of PCR product, 400 ng of gRNA, 1 μg of Cas9 protein, and 2 μL of 10×Reaction Buffer were added to a 20 μL reaction system, with the remainder made up with nuclease-free water. The mixture was incubated at 37℃ for 1 h and then at 70℃ for 10 min. The results were then detected by 1.5% agarose gel electrophoresis. The results are shown in Figure 1, D.

[0057] 6. Preparation of Cas9 RNPs: A 200 μL reaction system included 3.5 μg / μL Cas9 protein, equimolar volumes of gRNA-R1 and gRNA-R3 (Cas9 protein to gRNA molar ratio 1:1), 20 mM HEPES, and 500 mM NaCl. To prepare, each gRNA was first mixed with an equimolar volume of Cas9 protein (100 μL), and incubated at 37°C for 5 min to form RNPs. Then, the two gRNAs were mixed with the RNPs formed from the Cas9 protein and transferred to a disposable 1 mL sterile syringe.

[0058] 7. Ovarian in situ injection: (1) Select hens nearing the start of egg production. In this example, select hens aged 16 weeks and inject them when there are many small yellow follicles. (2) The ovarian in situ injection surgery is performed in the morning. The hens to be operated on are fasted on the day of the surgery. Before the operation, inject an anesthetic (ketamine, mixed with 0.9% sodium chloride solution at a volume ratio of 1:3, with an injection volume of 0.05-0.08 mL) into the hen's pectoral muscles for muscle anesthesia. When the hen is tired, insert the tip of the tracheal tube into the hen's trachea and connect the other end to a general-purpose animal anesthesia machine (R620-S1-IECS, Reward) to provide the hen with a mixture of oxygen and isoflurane. Two experimental personnel restrain the hen, one restraining the hen's head and wings, and the other restraining the hen's legs and assisting the operator in performing the surgery. The hen's left side faces the operator. Remove the feathers from the front of the left leg, determine the incision location, and draw a line at the front edge of the left leg. Make an incision with a scalpel, and use hemostats to insert between the second-to-last and third-to-last ribs, creating a 2cm incision. Expand the incision with a retractor to expose the ovary. Carefully puncture the peritoneum or air sac with a scalpel, and cut the membrane structure on the surface of the ovary to expose it. Inject the CRISPR / Cas9 system into the ovarian medulla using a 1mL disposable sterile syringe with an extended needle. Generally, multiple injections are used, with an injection volume of 200μL, approximately 15 injections. Then remove the retractor, suture the incision with absorbable surgical sutures, and disinfect the wound with iodine. After the hen recovers from surgery, provide water and feed, and continue normal individual cage rearing.

[0059] 8. Hatching and Testing of Hatching Eggs: Hatching Eggs: After the ovarian in situ injection procedure, hens are housed individually in normal cages. After the hens lay eggs, they are mixed-inseminated. Hatching eggs are collected starting on the 3rd day after the first insemination, and insemination is repeated every 5 days. A batch of hatching eggs is hatched every 7 days, for a total of 6-8 batches. Hatching conditions are constant temperature (37.8℃) and constant humidity (60%), with eggs turned every 2 hours. Eggs are transferred to hatching trays on the 18th day of incubation, and hatching occurs on the 22nd day. A wing tag is placed on the right wing of each newborn chick to distinguish individual chicks.

[0060] Sample Collection and DNA Extraction: Embryonic testing was conducted at 12.5 gestational age, using leg tissue or gonadal tissue from chicken embryos. Blood was collected from 1-day-old chicks via the carotid artery method after hatching. Genomic DNA was extracted using a cell / tissue / blood genomic DNA extraction kit (Tiangen Biotech Co., Ltd.). Leg tissue or blood was added to 200 μL of GA solution, and after adding grinding beads, it was homogenized. Then, a mixture of 220 μL of proteinase K and GB solution was added, thoroughly shaken, and incubated in a 70°C water bath for 2–3 hours. Subsequent genomic DNA extraction procedures were performed according to the manufacturer's instructions.

[0061] PCR amplification: This is used to detect individuals with a clear mutant phenotype. Extracted genomic DNA is used as a template, and... HS DNA Polymerase with GC Buffer (Takara) was used for PCR amplification of the IHH-gR3 target site using specific primers. The primer sequences were: F: 5'-gcccttcgctatttattg-3' (SEQ ID NO.21); R: 5'-cgtgagctccttgaagcg-3' (SEQ ID NO.22). Mutation was identified using the LabChip GXll Touch microfluidic capillary electrophoresis system.

[0062] TA cloning: For individuals with detected mutations, it is used... HS DNA Polymerase with GC Buffer (Takara) was used to amplify genomic DNA using primer pairs F: 5'-gcccttcgctatttattgccgc-3' (SEQ ID NO.23); R: 5'-ggataaactcgctgctctgccca-3' (SEQ ID NO.24). The PCR products were purified and recovered, and then used... The appropriate system was prepared using the Cloning Kit (Beijing TransGen Biotech Co., Ltd.). After incubation at 37°C, subsequent transformation and cloning operations were performed. Single colonies were picked and Sanger sequencing was performed, and the sequencing results were compared with the reference sequence. Some detection results are shown in Table 1.

[0063] Table 1. Results of TA clone detection

[0064] As shown in Table 1, the individual chimerism rate ranged from 8.33% to 52.94%.

[0065] 9. Results of Ovarian Injection Editing and Embryonic Period Detection: The phenotype and IHH gene editing status of chicken embryos were detected during the embryonic period. The results are shown in Figures 2 and 3. In Figure 2, wt represents the wild type; DF-1 is the positive control; numbers starting with N indicate embryonic period detection; DNA templates without specific details were taken from leg tissue; numbers 34496, 7079, and 7081 represent the blood genomic DNA analysis of three sexually mature female edited individuals; 7077 represents the semen genomic DNA analysis of one sexually mature male edited individual. Early death, edema and transparency, incomplete limb development, and poor eye development were observed in G0 generation chicken embryos (Figure 2). Gene-level detection results showed that these individuals all underwent gene editing (Figures 2 and 3), indicating that gene-edited individuals obtained by ovarian in situ injection exhibited mutant phenotypes in the current generation. The gonads of chicken embryos were also edited, indicating that both somatic cells and germ cells of gene-edited individuals obtained by ovarian in situ injection were edited. According to statistics, in cases where the IHH gene was edited using the ovarian orthotopic injection method, the gene editing efficiency of the G0 generation of injected hens reached a maximum of 36.36% (Table 2).

[0066] Table 2. Editing efficiency of G0 generation of Cas9 RNPs injected into the ovary targeting the chicken IHH gene.

[0067] Chick testing: Some eggs were incubated to hatching, and some individuals were raised to sexual maturity. Currently, four chimeras have been obtained, including three hens and one rooster. Tests showed that the blood of the hens and the semen of the rooster were edited (Figure 2) and will be reserved for crossbreeding.

[0068] Comparative Example 1

[0069] In situ injection of the pX330 gene-editing plasmid into the ovary of a hen can also yield chimeras in the G0 generation, where both somatic and germ cells are edited. However, the editing efficiency in the G0 generation is low, at 1.71%. Because pX330 contains the Cas9 gene sequence, G0 generation individuals will carry the Cas9 gene. The specific protocol is as follows:

[0070] 1. Ovarian in situ injection: The pX330-gRNA-(R2+R1) and pX330-gRNA-(R3+R1) knockout vectors obtained in step 1 of Example 1 were directly injected into the ovaries of hens according to the ovarian in situ injection method in step 7. The pX330-gRNA-(R3+R1) plasmid was set up with injection dose treatment groups of 100 μg / hen (hens numbered A10 to A19) and 200 μg / hen (hens numbered A20 to A29), with 10 hens in each treatment; the pX330-gRNA-(R2+R1) plasmid was injected into the ovaries of 2 hens at an injection dose of 100 μg / hen (hens numbered S11 and S12).

[0071] 2. Hatching and Detection of Hatching Eggs: Hatching of hatching eggs is the same as in Example 1. Sample collection and DNA extraction are the same as in Example 1. Cas9 Gene Detection: Using extracted blood genomic DNA as a template, Cas9 gene detection is performed... HS (Premix) was used to amplify the Cas9 gene by PCR using specific primers. The primer sequences are as follows: Cas9-F: 5'-cctgagcgaactggataaggcc-3' (SEQ ID NO.25), Cas9-R: 5'-ctcttggcgatcatcttccgca-3' (SEQ ID NO.26).

[0072] PCR amplification of IHH target genes: Targeting Cas9 gene-positive individuals, using... HS DNA Polymerase with GC Buffer was used to amplify sequences containing two target sites using specific primer pairs. Agarose gel electrophoresis was then performed to detect whether in vivo ovarian injection of the pX330 plasmid resulted in fragment deletion. The primer sequences are as follows: For treatment involving injection of the pX330-gRNA-(R2+R1) plasmid into the hen's ovary, the primer pairs are shown in SEQ ID NO. 9 and SEQ ID NO. 10; for treatment involving injection of the pX330-gRNA-(R3+R1) plasmid into the hen's ovary, the primer pairs are shown in SEQ ID NO. 21 and SEQ ID NO. 22.

[0073] T7E1 digestion assay: For Cas9-positive individuals, the editing status of individual gRNA sites was detected using the T7E1 digestion method. First, using genomic DNA as a template, PCR amplification was performed on fragments containing target sites gRNA-R1, gRNA-R2, and gRNA-R3 using specific primers. The amplified products were then digested with the T7E1 enzyme. Finally, the editing ratio was analyzed by reversing the color of the 1.5% agarose gel electrophoresis results using ImageJ software. Primer sequences are shown in Table 3.

[0074] Table 3 Primer sequences used for T7E1 enzyme digestion detection.

[0075] TA clone: ​​For individuals with mutations in T7E1 restriction enzyme digestion, the TA clone detection method in Example 1 was performed.

[0076] 3. Injection Editing Detection Results: The gene editing detection results of the G0 generation of hens injected with pX330 plasmid are shown in Figure 4 and Table 4. G0 individuals without a "G0 chick wing number" but with a "hatching batch number" are unhatched dead embryos. PCR was performed on the Cas9 and IHH genes to detect the modification status of these genes in the G0 individuals. In the pX330-gRNA-(R3+R1) treatment group, the PCR fragment length of the IHH gene was 1009 bp, and in the pX330-gRNA-(R2+R1) treatment group, the PCR fragment length of the IHH gene was 1254 bp. PCR and T7E1 digestion of gRNA-R1, gRNA-R3, and gRNA-R2 yielded fragment lengths of 655, 472, and 456 bp, respectively. An asterisk indicates a gene-edited individual.

[0077] Table 4. Editing efficiency of G0 generation of pX330 plasmid injected into the ovary targeting the chicken IHH gene.

[0078] As shown in Figure 4, 14 G0 generation chicks or embryos were found to carry the Cas9 gene, of which 11 came from the 100 μg / chicken treatment group and 3 came from the 200 μg / chicken treatment group, indicating that the efficiency of offspring carrying the Cas9 gene is higher when the injection dose is 100 μg / chicken.

[0079] In treatments with plasmid injection doses of 100 μg / chicken and 200 μg / chicken, gene editing was detected in 8 individuals (2.62%) and 2 individuals (0.72%), respectively, indicating that the injection dose of 100 μg / chicken was highly efficient in obtaining edited individuals in the G0 generation. In the treatment with pX330-gRNA-(R3+R1) plasmid injection, gene editing occurred in 5 individuals. Among them, 2 unhatched embryos (A16-3-4 and A25-3-5) showed obvious fragment deletions, and 1 individual (6... Mutations occurred at the gRNA-R1 target site in 100 chicks, and at the gRNA-R3 target site in 2 chicks (50981, 50980). Injection of the pX330-gRNA-(R2+R1) plasmid resulted in gene editing in 5 individuals. Among them, fragment deletions occurred in 2 chicks (60935, 50976), and mutations occurred at the gRNA-R1 target site in 4 chicks (60935, 60957, 50954, 50955) (see Figure 4 and Table 4). These results indicate that increasing the plasmid dosage does not significantly improve the Cas9 positivity rate in offspring, and the choice of gRNA combination affects the editing efficiency of fragment deletions, and not both gRNAs can function simultaneously.

[0080] Subsequently, to detect whether the Cas9 gene was also present in other tissues, this application collected nine tissues from three chick individuals (50980, 50981, and 50955), including the heart, liver, spleen, lungs, kidneys, pectoral muscles, leg muscles, comb, and gonads. Genomic DNA was extracted and the Cas9 gene was amplified. The results are shown in Figure 5A, where pX330 plasmid and H2O were used as DNA amplification templates for positive and negative controls, respectively. The results showed that the Cas9 gene was detected in the heart, spleen, lungs, comb, and gonads of chicks 50980 and 50981 (Figure 5A), indicating that these two chicks were chimeras. However, the Cas9 gene was not detected in the tissues of chick 50955. Because the gRNA-R3 target site was edited in the blood of individuals 50980 and 50981, to assess whether the editing could be inherited by the next generation (G1), the gonads of these two chicks were used to detect mutations in the gRNA-R3 and gRNA-R1 target sites. T7E1 restriction enzyme digestion results showed that only the gRNA-R3 target site was mutated in these two individuals, consistent with the findings in the blood (Figure 5, B). Sanger sequencing results also showed a 3bp knockout in the signal peptide sequence upstream of the gRNA-R3 target site in these two individuals, resulting in the loss of leucine at position 10 (Figure 5, C), which may affect the normal secretion of IHH protein. These results indicate that preparing gene-edited chickens via orthotopic ovarian injection is feasible, but the efficiency needs further improvement.

[0081] Example 2

[0082] Compared to Example 1, all steps were the same except for the Cas9 protein used for ovarian injection. The construction process of the pET28a-4NLS-Cas9-2NLS prokaryotic expression vector is as follows:

[0083] (1) Vector linearization: The pET28a-Cas9-2NLS prokaryotic expression vector was double-digested with NdeI and KpnI, and the digestion products were recovered by gel extraction. (2) 4NLS sequence amplification: The 4NLS sequence was synthesized by Beijing Qingke Biotechnology Co., Ltd. and cloned into the pUC57 vector backbone. The 4NLS sequence is as follows: 5'-cagccatatgcccaagaaaaagcgcaaagtgggtggcagcccgaagaagaagcgcaaagtgggcggcagtccgaaaaagaaacgcaaagtgggcggtagcccgaagaagaagcgcaaagtgggtatccacggtgtcccagcagccaccatggacaagaagtacagcatcggcctggacatcggtaccaacagc-3' (SEQ ID NO.30). Using this plasmid as a PCR template, primers 4NLS-F: 5'-ggaattccatatgcccaagaaaaagcgca-3' (SEQ ID NO.31) and 4NLS-R: 5'-cggggtaccgatgtccaggccga-3' (SEQ ID NO.32) were designed and synthesized using KOD One. TM PCR master mix was used for PCR amplification, purification and recovery, followed by double digestion with NdeI and KpnI, purification and recovery. (3) Ligation and cloning: T4 ligase was used for ligation and cloning to obtain the pET28a-4NLS-Cas9-2NLS prokaryotic expression vector.

[0084] The protein purification process for 4NLS-Cas9-2NLS is the same as that for Cas9-2NLS in Example 1.

[0085] The effects of ovarian in situ injection of 4NLS-Cas9-2NLS RNP are shown in Table 5.

[0086] Table 5. Editing efficiency of G0 generation of chicken IHH gene-targeted 4NLS-Cas9-2NLS RNP injection.

[0087] The results in Tables 1 and 5 show that the Cas9 protein is not limited to proteins that use two nuclear localization signals; similar results can be achieved by using 4NLS-Cas9-2NLS.

[0088] Example 3

[0089] A method similar to Example 1 was used, except that the Cas9 RNP was prepared as follows: 41.27 mg of chloroquine diphosphate (Sigma-Aldrich) was dissolved in 1 mL of Cas9 protein buffer (20 mM Hepes, 500 mM NaCl) to a concentration of 80 mM. When preparing Cas9-2NLS RNP, the corresponding volume was calculated to achieve a final chloroquine concentration of 2 mM. The RNP was prepared fresh each time and stored at room temperature, protected from light. The editing results are shown in Table 6.

[0090] Table 6. Editing efficiency of the chicken IHH gene via Cas9-2NLS RNP (2mM chloroquine) injection in the G0 generation.

[0091] As shown in Table 6, adding endosome escape agents such as chloroquine to the buffer solution during Cas9 RNP preparation does not affect the gene editing efficiency of the G0 generation.

[0092] Example 4

[0093] A method similar to Example 1, except that the Cas9 protein used for ovarian injection is a fusion protein of Cas9 expressed by the pET28a-Cas9-mNG prokaryotic expression vector and a fluorescent protein. The construction process of the pET28a-Cas9-mNG prokaryotic expression vector is as follows:

[0094] (1) Vector linearization: Same as step 4 in Example 1. (2) Cas9 sequence PCR amplification: Similar to step 4 in Example 1, except that the primers are Cas9-mNG-CF (EQ ID NO.16) and Cas9-mNG-CR: 5'-gtcgtaggggtatacttttctcttttttctttgggtcctctacttttctctttttt-3' (SEQ ID NO.33). (3) mNG sequence PCR amplification: The G4S*2-mNG-NLS sequence was synthesized by Beijing Qingke Biotechnology Co., Ltd. and cloned into the pUC57 vector backbone. G4S is a flexible linker of GGGGS (SEQ ID NO.34), where G is glycine and S is serine. Adding two flexible links of G4S can reduce the interference between Cas9 and mNG proteins in spatial conformation. NLS is the nuclear localization signal.The G4S*2-mNG-NLS sequence is as follows: 5'-ggtggtggcggtagcggcggcggcggtagtatggtcagcaaaggcgaagaggacaacatggcaagtctgccggcaacccacgaactgcatatttttggcagcatcaacggcgtcgacttcgatatggtaggtcaaggtaccggtaatccgaacgacggttacgaagagctgaacctgaagagcaccaaaggcgat ctgcaatttagtccgtggattctggttccgcacattggttacggcttccatcagtatctgccgtatccggacggtatgagtccgtttcaggcagcgatggtagatggttctggttatcaggtccatcgtaccatgcagtttgaagacggcgcaagtctgaccgttaactatcgctacacctacgaaggcagccatatcaaaggcgaagcgcaggttaaaggtaccggttttccggctgacggtccggttatgaccaatagtctgaccgctgctgattggtgtcgtagcaaaaagacctacccgaacgacaagaccatcatctccaccttcaagtggagctacaccaccggtaacggtaaacgctatcgtagtaccgcacgtaccacctatacctttgctaaaccgatggcggcgaactatctgaaaaaccaaccgatgtacgtcttccgcaagaccgaactgaagcacagcaaaaccgagctgaacttcaaagaatggcagaaagcgttcaccgacgttatgggtatggacgaactgtacaagccgaagaagaagcgcaaagtg-3'(SEQ ID NO.35).Using this plasmid as a template, primers Cas9-mNG-mF: 5'-gaaaagtatacccctacgacgtgcccgactacgcctgtggtggtggcggtagcggcggc-3' (SEQ ID NO.36) and Cas9-mNG-mR: 5'-ggtggtggtggtggtgctcgagcactttgcgcttcttcttcggcttgtacagttcgtcc-3' (SEQ ID NO.37) were designed and synthesized using KOD One. TM PCR master mix was used to amplify the mNG sequence by PCR, and the product was purified and recovered. (4) Homologous recombination: using The Seamless Cloning and Assembly Kit (Beijing TransGen Biotech Co., Ltd.) uses homologous recombination to insert a portion of the Cas9 sequence obtained in step (2) and the mNG sequence obtained in step (3) into the pET28a-Cas9 linearized vector. Subsequent transformation, single-clone identification, and plasmid extraction steps yield the pET28a-Cas9-mNG prokaryotic expression vector.

[0095] The protein purification process for Cas9-mNG is the same as that for Cas9-2NLS in Example 1.

[0096] The effects of Cas9-mNG RNP injected into the ovary in situ are shown in Table 7.

[0097] Table 7. Editing efficiency of G0 generation of Cas9-mNG RNPs injected into the ovary targeting the chicken IHH gene.

[0098] As shown in Table 7, fusing Cas9 protein with fluorescent protein, such as mNeongreen, to form Cas9-mNG protein can also achieve similar gene editing effects.

[0099] Although the above embodiments have provided a detailed description of this application, they are only some embodiments of this application, not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of this application.

Claims

1. A method for preparing gene-edited chickens, characterized in that, Includes the following steps: Gene editing reagents were injected into the ovarian medulla of hens 10–15 days before egg production to obtain G... -1 The broiler hen; the gene editing reagent includes a reagent for gene editing using CRISPR / Cas9 RNP; G -1 Fertilizer is produced by fertilizing a surrogate hen to obtain hatching eggs; the hatching eggs are then artificially incubated to obtain the G0 generation population; The gene editing results were detected in the G0 generation population, resulting in gene-edited chickens.

2. The method according to claim 1, characterized in that, The reagents for gene editing using CRISPR / Cas9 RNP include: Cas9 protein, gRNA, and buffer; the molar ratio of Cas9 protein to gRNA is 1:1 to 2; and the injection concentration of Cas9 protein is 3.5 μg / μL.

3. The method according to claim 2, characterized in that, The molar ratio of Cas9 protein to gRNA is 1:

1.

4. The method according to claim 2, characterized in that, The buffer solution comprises 20 mM HEPES and 500 mM NaCl.

5. The method according to claim 2, characterized in that, The Cas9 protein includes the Cas9 protein expressed in prokaryotes.

6. The method according to claim 5, characterized in that, The strain used for prokaryotic expression was Escherichia coli BL21(DE3).

7. The method according to claim 5 or 6, characterized in that, The recombinant vector used for prokaryotic expression is either a first recombinant vector or a second recombinant vector; the first recombinant vector consists of a base vector and a Cas9 sequence and a 2NLS sequence inserted into the base vector; the second recombinant vector consists of a base vector and a Cas9 sequence, a 2NLS sequence, and a 4NLS sequence inserted into the base vector; the nucleotide sequences of the amplification primers for the Cas9 sequence are shown in SEQ ID NO.16 and SEQ ID NO.17; the nucleotide sequence of the 2NLS sequence is shown in SEQ ID NO.18; and the nucleotide sequence of the 4NLS sequence is shown in SEQ ID NO.

30.

8. The method according to claim 7, characterized in that, The base vector is the pET28a-Cas9 plasmid.

9. The method according to claim 7, characterized in that, The template for amplifying the Cas9 sequence is the pET28a-Cas9 plasmid.

10. The method according to claim 5, characterized in that, The Cas9 protein obtained from prokaryotic expression is a fusion protein of Cas9 and fluorescent protein.

11. The method according to claim 10, characterized in that, The fluorescent protein is mNG protein.

12. The method according to claim 11, characterized in that, The nucleotide sequence containing the coding sequence of the mNG protein is shown in SEQ ID NO.

35.

13. The method according to claim 2, characterized in that, The reagents used for gene editing with CRISPR / Cas9 RNP also contain endosome escape agents.

14. The method according to claim 13, characterized in that, The endosome escape agent includes chloroquine diphosphate.

15. The method according to claim 2, characterized in that, Before injecting the gene editing reagent, the editing efficiency of the gRNA was detected using a chicken tool cell line, and gRNAs with an editing efficiency of ≥45% were selected.

16. The method according to claim 15, characterized in that, The chicken tool cell line includes DF-1 cells.

17. The method according to claim 2, characterized in that, The target gene of the gRNA is the IHH gene.

18. The method according to claim 17, characterized in that, The target sequence of the IHH gene consists of gRNA-R1 and gRNA-R3; the nucleotide sequence of gRNA-R1 is shown in SEQ ID NO.1, and the nucleotide sequence of gRNA-R3 is shown in SEQ ID NO.

3.

19. The method according to claim 1, characterized in that, The hens injected with the gene-editing reagent were fasted on the day of injection.

20. The method according to claim 1 or 19, characterized in that, The injection method is as follows: An anesthetic is injected into the hen's pectoral muscles for muscle anesthesia; when the hen becomes fatigued, the tip of a tracheal tube is inserted into the hen's trachea, and the other end is connected to a universal animal anesthesia machine to provide the hen with a mixture of oxygen and isoflurane; two operators restrain the hen, one restraining the hen's head and wings, and the other restraining the hen's legs and assisting the operators in performing the surgery; the hen's left side faces upward towards the operators; the feathers on the front of the left leg are plucked to determine the opening location and a line is drawn at the front edge of the left leg; the skin is cut open with a scalpel, and a hemostat is inserted between the second-to-last and third-to-last ribs to form a 2cm incision; the incision is expanded with a retractor to expose the field of vision; the peritoneum or air sac is ruptured with a scalpel, and the membrane structure on the surface of the ovary is cut to expose the ovary; the CRISPR / Cas9 RNP gene editing reagent is injected into the ovarian medulla using a 1mL disposable sterile syringe with an extended needle; Then remove the tensioner, suture the incision with absorbable surgical sutures, and disinfect the wound by wiping it with iodine.

21. The method according to claim 20, characterized in that, The injection was performed at multiple points.

22. The method according to claim 20, characterized in that, The anesthetic is composed of ketamine and sodium chloride solution; the volume ratio of ketamine to sodium chloride solution is 1:3; the mass concentration of sodium chloride solution is 0.9%.

23. The method according to claim 1, characterized in that, The method further includes: after obtaining gene-edited chickens, self-crossing the roosters and hens in the gene-edited chickens to obtain homozygous gene-edited chickens.

24. The method according to claim 1, characterized in that, The methods for detecting the results of gene editing include 1) and / or 2), specifically: 1) Observe the phenotype of individuals in the G0 generation population based on the mutational effects produced after gene editing; 2) Determine the gene editing events and types in individuals within the G0 generation population.

25. The method according to claim 24, characterized in that, The assay method in 2) includes PCR amplification and / or sequencing.

Images