Novel acetyl-coa acetyltransferase variant and use thereof

Novel acetyl-CoA acetyltransferase variants with specific amino acid modifications enhance PHA production yields and copolymer properties, addressing processability issues and cost challenges in PHA polymer manufacturing.

WO2026014968A1PCT designated stage Publication Date: 2026-01-15CJ CHEILJEDANG CORP
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/010147
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-12
Filing Date
2025-07-11
Publication Date
2026-01-15

AI Technical Summary

Technical Problem

Existing methods for producing polyhydroxyalkanoate (PHA) polymers, such as P(3HB-co-4HB), face limitations in processability due to high crystallinity and brittleness, and there is a need to enhance enzyme activity to improve production yield and monomer ratio variability.

Method used

Development of novel acetyl-CoA acetyltransferase variants with specific amino acid substitutions at positions 87, 351, or 378, or sequences with at least 45% identity, which are used to culture microorganisms, enhancing the production of PHA, particularly 3-hydroxybutyrate-4-hydroxybutyrate copolymers with higher yields.

Benefits of technology

The novel acetyl-CoA acetyltransferase variants increase PHA production yields and enable the production of 3-hydroxybutyrate-4-hydroxybutyrate copolymers with improved properties, expanding the range of physical characteristics and reducing manufacturing costs.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present application relates to: a novel protein having an acetyl-CoA acetyltransferase activity; a polynucleotide encoding the protein; a microorganism comprising the protein, the polynucleotide encoding the protein, or a vector comprising the polynucleotide; and a method for producing polyhydroxyalkanoate (PHA), comprising a step of culturing the microorganism in a medium.
Need to check novelty before this filing date? Find Prior Art

Description

Novel acetyl-COA acetyltransferase variants and uses thereof

[0001] The present application relates to a method for producing polyhydroxyalkanoate (PHA), comprising: a protein having novel acetyl-CoA acetyltransferase activity; a polynucleotide encoding the protein; a microorganism comprising the protein, the polynucleotide encoding the protein, or a vector comprising the polynucleotide; and a step of culturing the microorganism in a medium.

[0002]

[0003] Polyhydroxyalkanoate (PHA), which has recently been in the spotlight as a biodegradable polymer material, is a natural polymer with a polyester structure that microorganisms accumulate as a carbon source and energy storage material when nutrients such as nitrogen and phosphorus are deficient in the presence of an excess carbon source.

[0004] P3HB (poly-3-hydroxybutyrate), a well-known polyhydroxyalkanoate, is a polymerized substance using the 3HB (3-hydroxybutyrate) monomer. It has mechanical properties similar to polypropylene, a commercially available petroleum-derived synthetic polymer, and is completely decomposed by microorganisms in nature, attracting attention as an environmentally friendly plastic raw material.

[0005] Among the polyhydroxyalkanoate polymers, 3-hydroxybutyrate homopolymer (Poly(3-hydroxybutyrate), P(3HB)), the most widely studied in microorganisms, has a high crystallinity, making it brittle and decomposing near its melting point, limiting its processability. Therefore, research is being conducted to produce PHA copolymers through blending with new materials or copolymerizing them with monomers.

[0006] Among them, 3-hydroxybutyrate (3HB) and 4-hydroxybutyrate (4HB) copolymers (P(3HB-co-4HB)) are endowed with soft properties as the 4-hydroxybutyrate content increases. In this way, P(3HB-co-4HB) can have a wide range of physical properties, from a hard crystalline plastic to a highly elastic rubber, depending on the monomer ratio, and is therefore highly valued as a polymer material applicable to various products.

[0007] Therefore, research on enhancing the expression or activity of each enzyme involved in 3HB or 4HB monomer biosynthesis can not only expand the portfolio of PHA properties by varying the monomer ratio of P(3HB-co-4HB) in microorganisms, but also reduce manufacturing costs by improving PHA production yield. Therefore, research on improving related enzymes is ongoing (US 11702681 B2).

[0008]

[0009] The present invention was completed by confirming that when culturing a microorganism containing a protein having the novel acetyl-CoA acetyltransferase activity of the present application, polyhydroxyalkanoate (PHA) can be produced at a higher yield than a microorganism having an existing unmodified polypeptide.

[0010]

[0011] One object of the present application is to provide a protein having acetyl-CoA acetyltransferase activity, wherein the amino acid corresponding to the 87th, 351st or 378th position of the amino acid sequence of SEQ ID NO: 1 is replaced with another amino acid in the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having at least 45% sequence identity with the amino acid sequence of SEQ ID NO: 1.

[0012] Another object of the present application is to provide a polynucleotide encoding the above protein.

[0013] Another object of the present application is to provide a microorganism comprising the protein or a polynucleotide encoding the protein or a vector comprising the polynucleotide.

[0014] Another object of the present application is to provide a method for producing polyhydroxyalkanoate (PHA), comprising a step of culturing the microorganism in a medium.

[0015]

[0016] When culturing a microorganism comprising a protein having acetyl-CoA acetyltransferase activity of the present invention, high yields of polyhydroxyalkanoate (PHA) can be produced compared to microorganisms having conventional unmodified polypeptides. Furthermore, the variant of the present invention can be used to produce a 3-hydroxybutyrate-4-hydroxybutyrate copolymer having a high 3-hydroxybutyrate content.

[0017]

[0018] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application can also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions described below. Furthermore, numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated into this specification in their entirety by reference to more clearly explain the level of the technical field to which this application belongs and the contents of this application.

[0019]

[0020] One aspect of the present application provides a protein having acetyl-CoA acetyltransferase activity, wherein the amino acid corresponding to the 87th, 351st or 378th position of the amino acid sequence of SEQ ID NO: 1 is replaced with another amino acid in the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having at least 45% sequence identity with the amino acid sequence of SEQ ID NO: 1.

[0021] In the present application, "a protein having acetyl-CoA acetyltransferase activity in which an amino acid corresponding to the 87th, 351st or 378th position of the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having at least 45% sequence identity with the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid" may mean an acetyl-CoA acetyltransferase variant comprising one or more amino acid substitutions in the amino acid sequence of an unmodified parent acetyl-CoA acetyltransferase having acetyl-CoA acetyltransferase activity, and may be used interchangeably with terms such as "acetyl-CoA acetyltransferase variant", "variant", or "variant polypeptide".

[0022] Specifically, the protein may be, but is not limited to, one in which the amino acid corresponding to the 87th, 351st or 378th position of any one of the amino acid sequences of SEQ ID NOs: 78, 79, 81, 82 and 83 is substituted with another amino acid, or the amino acid corresponding to the 88th, 352nd or 379th position of the amino acid sequence of SEQ ID NO: 80 is substituted with another amino acid, or the amino acid corresponding to the 88th, 351st or 378th position of the amino acid sequence of SEQ ID NO: 84 is substituted with another amino acid.

[0023]

[0024] In this application, the term "acetyl-CoA acetyltransferase (PhaA)" refers to an enzyme that catalyzes the reversible reaction of two molecules of acetyl-CoA to form CoA and acetoacetyl-CoA, and is used interchangeably with acetoacetyl-CoA thiolase, acetoacetyl thiolase, etc. Acetyl-CoA acetyltransferase is known to be an essential enzyme in the pathway for biosynthesizing 3HB monomers.

[0025] In the present application, the term "parent acetyl-CoA acetyltransferase" refers to an acetyl-CoA acetyltransferase that is modified to produce an acetyl-CoA acetyltransferase variant, variant, or mutant polypeptide of the present application. Specifically, the parent acetyl-CoA acetyltransferase or parent sequence may be a naturally occurring polypeptide or a wild-type polypeptide, may be a mature polypeptide thereof, may include a variant or functional fragment thereof, but is not limited thereto as long as it is a polypeptide that has acetyl-CoA acetyltransferase activity and can be a parent of a variant.

[0026] In the present application, the above-mentioned parent acetyl-CoA acetyltransferase may be a protein having acetyl-CoA acetyltransferase activity encoded by the phaA gene, but is not particularly limited in type as long as it has an activity corresponding to acetyl-CoA acetyltransferase and can produce polyhydroxyalkanoate (PHA).

[0027] Specifically, the above-described parent acetyl-CoA acetyltransferase protein may include, for example, an amino acid sequence having SEQ ID NO: 1 or an amino acid sequence having at least 45% homology or identity therewith, but is not limited thereto, as long as it has acetyl-CoA acetyltransferase activity.

[0028] Specifically, any one of the amino acids of SEQ ID NOs: 78 to 84 has a sequence identity of at least 45% and less than 100% with the amino acid sequence of SEQ ID NO: 1. Specifically, the variant of the present application may include an amino acid sequence having at least 45%, 46%, 47%, 48%, 49%, 50%, 55%, 60%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 95%, 96%, 97%, 98%, 99% or more; and less than 100% homology or identity with the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 1. Specifically, the amino acid sequence may include an amino acid sequence having at least 45%, 46%, 47%, 48%, 49%, 50%, 55%, 60%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity with any one of the amino acid sequences of SEQ ID NO: 1 and any one of the amino acid sequences of SEQ ID NO: 78 to SEQ ID NO: 84. In addition, it is obvious that an auxiliary protein having an amino acid sequence in which some sequences are deleted, modified, substituted, or added is also included within the scope of the present application, as long as it has such homology or identity and exhibits an effect corresponding to the protein. The amino acid sequence of any one of SEQ ID NO: 1 and SEQ ID NO: 78 to SEQ ID NO: 84 can be obtained from a known database such as NCBI's GenBank or KEGG (Kyoto Encyclopedia of Genes and Genomes).

[0029] In the present application, the acetyl-CoA acetyltransferase is from Cupriavidus necator, Alcaligenes eutrophus, Ralstonia eutropha, Alcaligenes eutrophus H16, Pseudomonas putida (P. putida), Alcaligenes latus, Azohydromonas lata, Azohydromonas australica, Allochromatium vinosum DSM 180, Azotobacter Beijerinckii, Pandoraea sp. B-6, Burkholderiaceae bacterium 16, or Candidatus Accumulibacter phosphatis. Acetyl-CoA acetyltransferase may be, but is not limited to, acetyl-CoA acetyltransferase.

[0030] The acetyl-CoA acetyltransferase derived from Cupriavidus necator (Alcaligenes eutrophus, Ralstonia eutropha, Alcaligenes eutrophus H16) presented as an example in the present application may be a polypeptide / protein comprising an amino acid sequence set forth in SEQ ID NO: 1, but is not limited thereto.

[0031] The acetyl-CoA acetyltransferase derived from Pseudomonas putida (P. putida) presented as an example in the present application may be a polypeptide / protein comprising an amino acid sequence set forth in SEQ ID NO: 78, but is not limited thereto.

[0032] The acetyl-CoA acetyltransferase derived from Alcaligenes latus (Azohydromonas lata, Azohydromonas australica) presented as an example in the present application may be a polypeptide / protein comprising an amino acid sequence set forth in SEQ ID NO: 79, but is not limited thereto.

[0033] The acetyl-CoA acetyltransferase derived from Allochromatium vinosum DSM 180 presented as an example in the present application may be a polypeptide / protein comprising an amino acid sequence set forth in SEQ ID NO: 80, but is not limited thereto.

[0034] The acetyl-CoA acetyltransferase derived from Azotobacter Beijerinckii presented as an example in the present application may be a polypeptide / protein comprising an amino acid sequence set forth in SEQ ID NO: 81, but is not limited thereto.

[0035] The acetyl-CoA acetyltransferase derived from the genus Pandoraea (Pandoraea sp. B-6) presented as an example in the present application may be a polypeptide / protein comprising an amino acid sequence set forth in SEQ ID NO: 82, but is not limited thereto.

[0036] The acetyl-CoA acetyltransferase derived from Burkholderiaceae bacterium 16 presented as an example in the present application may be a polypeptide / protein comprising an amino acid sequence set forth in SEQ ID NO: 83, but is not limited thereto.

[0037] The acetyl-CoA acetyltransferase derived from Candidatus Accumulibacter phosphatis presented as an example in the present application may be a polypeptide / protein comprising an amino acid sequence set forth in SEQ ID NO: 84, but is not limited thereto.

[0038]

[0039] In addition, the polynucleotide sequence encoding the parent acetyl-CoA acetyltransferase may be a polynucleotide sequence encoding a protein that exhibits the activity of acetyl-CoA acetyltransferase and thus enables production of polyhydroxyalkanoate (PHA) in a microorganism. In addition, the polynucleotide sequence encoding the parent acetyl-CoA acetyltransferase may be a polynucleotide sequence encoding a protein that exhibits the activity of acetyl-CoA acetyltransferase and thereby enhances the activity of the microorganism, thereby improving the production ability of polyhydroxyalkanoate (PHA).

[0040] For example, acetyl-CoA acetyltransferase (SEQ ID NO: 1) from Cupriavidus necator (Alcaligenes eutrophus, Ralstonia eutropha, Alcaligenes eutrophus H16), acetyl-CoA acetyltransferase (SEQ ID NO: 78) from Pseudomonas putida (P. putida), acetyl-CoA acetyltransferase (SEQ ID NO: 79) from Alcaligenes latus (Azohydromonas lata, Azohydromonas australica), acetyl-CoA acetyltransferase (SEQ ID NO: 80) from Allochromatium vinosum DSM 180, and acetyl-CoA acetyltransferase (SEQ ID NO: 81) from Azotobacter Beijerinckii. It may be a polynucleotide sequence encoding, but is not limited to, acetyl-CoA acetyltransferase (SEQ ID NO: 81), acetyl-CoA acetyltransferase from Pandoraea sp. B-6 (SEQ ID NO: 82), acetyl-CoA acetyltransferase from Burkholderiaceae bacterium 16 (SEQ ID NO: 83), or acetyl-CoA acetyltransferase from Candidatus Accumulibacter phosphatis (SEQ ID NO: 84).

[0041] For example, the base sequence of SEQ ID NO: 2, the base sequence of SEQ ID NO: 106, the base sequence of SEQ ID NO: 107, the base sequence of SEQ ID NO: 108, the base sequence of SEQ ID NO: 109, the base sequence of SEQ ID NO: 110, the base sequence of SEQ ID NO: 111, or the base sequence of SEQ ID NO: 112; or a base sequence having at least 45%, at least 50%, at least 55%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology or identity with the base sequence of SEQ ID NO: 2, the base sequence of SEQ ID NO: 106, the base sequence of SEQ ID NO: 107, the base sequence of SEQ ID NO: 108, the base sequence of SEQ ID NO: 109, the base sequence of SEQ ID NO: 110, the base sequence of SEQ ID NO: 111, or the base sequence of SEQ ID NO: 112; or may be encoded by a polynucleotide that comprises or consists essentially of such a base sequence, but is not limited thereto. The above base sequence may undergo modifications in the coding region due to the degeneracy of the codons, and various modifications may be made in the coding region within a range that does not change the amino acid sequence, taking into account the codons preferred by the organism that is to express the base sequence. In addition, it is obvious that a polynucleotide sequence that encodes a protein that has such homology or identity and exhibits an effect substantially identical or corresponding to the above protein is also included within the scope of the present application, in which a part of the sequence is deleted, modified, substituted, or added.

[0042]

[0043] As used herein, the term "variant" refers to a polypeptide in which one or more amino acids are conservatively substituted and / or modified, thereby differing from the amino acid sequence of the variant before the mutation, but retaining functions or properties. Such variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the polypeptide and evaluating the properties of the modified polypeptide. That is, the ability of the variant may be increased, unchanged, or decreased compared to the polypeptide before the mutation. Furthermore, some variants may include variants in which one or more portions, such as the N-terminal leader sequence or the transmembrane domain, are deleted. Other variants may include variants in which portions are deleted from the N- and / or C-terminus of the mature protein. The above term "variant" may be used interchangeably with terms such as variant, modification, variant polypeptide, variant protein, variant and variant (in English, modification, modified polypeptide, modified protein, mutant, mutein, divergent, etc.), and is not limited thereto if the term is used in the meaning of variant.

[0044] Additionally, variants may include deletions or additions of amino acids that have minimal impact on the properties and secondary structure of the polypeptide. For example, the polypeptide may be conjugated to a signal (or leader) sequence at the N-terminus of a protein that is involved in co-translational or post-translational protein transfer. Furthermore, the polypeptide may be conjugated to other sequences or linkers to facilitate identification, purification, or synthesis of the polypeptide.

[0045]

[0046] In the present application, the term "acetyl-CoA acetyltransferase variant", "variant", or "variant polypeptide" refers to a protein having one or more amino acids different from the amino acid sequence of the parent acetyl-CoA acetyltransferase and having the activity of acetyl-CoA acetyltransferase.

[0047] Specifically, the acetyl-CoA acetyltransferase variant of the present application may be, but is not limited to, an acetyl-CoA acetyltransferase variant in which the amino acid corresponding to the 87th, 351st or 378th position of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid, or the amino acid corresponding to the 87th, 351st or 378th position of any one of SEQ ID NOs: 78, 79, 81, 82 and 83 is substituted with another amino acid, or the amino acid corresponding to the 88th, 352nd or 379th position of the amino acid sequence of SEQ ID NO: 80 is substituted with another amino acid, or the amino acid corresponding to the 88th, 351st or 378th position of the amino acid sequence of SEQ ID NO: 84 is substituted with another amino acid.

[0048] The above "other amino acid" is not limited to an amino acid different from the amino acid prior to substitution. Furthermore, when the present application states that "a specific amino acid has been substituted," it is self-evident that the amino acid has been substituted with an amino acid different from the amino acid prior to substitution, even if it is not specifically stated that it has been substituted with another amino acid.

[0049] Amino acids can generally be classified based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of their residues.

[0050] Examples of these classifications include positively charged (basic) amino acids such as arginine, lysine, and histidine; negatively charged (acidic) amino acids such as glutamic acid and aspartic acid; amino acids with nonpolar side chains (nonpolar amino acids) such as glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline; and amino acids with polar or hydrophilic side chains (polar amino acids) such as serine, threonine, cysteine, tyrosine, asparagine, and glutamine. As another example, amino acids with charged side chains (electrically charged amino acids) include arginine, lysine, histidine, glutamic acid, and aspartic acid; and amino acids with uncharged side chains (neutral amino acids) include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. As another example, phenylalanine, tryptophan, and tyrosine can be classified as aromatic amino acids. As another example, valine, leucine, and isoleucine can be classified as branched amino acids. As another example, the 20 amino acids can be classified by size into five groups: glycine, alanine, and serine; cysteine, proline, threonine, aspartic acid, and asparagine; valine, histidine, glutamic acid, and glutamine; isoleucine, leucine, methionine, lysine, and arginine; and phenylalanine, tryptophan, and tyrosine. However, this is not necessarily limited to these groups.

[0051] For example, if it is described that "the amino acid corresponding to position 87 in SEQ ID NO: 1 is replaced with another amino acid," it may mean that the amino acid is replaced with, but is not limited to, alanine, glutamic acid, phenylalanine, arginine, aspartic acid, cysteine, asparagine, glutamine, histidine, proline, serine, tyrosine, isoleucine, lysine, tryptophan, glycine, threonine, or leucine, excluding valine.

[0052] For example, if it is described that "the amino acid corresponding to position 351 in SEQ ID NO: 1 is replaced with another amino acid," it may mean that the amino acid is replaced with alanine, glutamate, phenylalanine, arginine, cysteine, asparagine, glutamine, histidine, proline, serine, tyrosine, valine, tryptophan, glycine, methionine, threonine, or leucine, excluding isoleucine, but is not limited thereto.

[0053] For example, if it is described that "the amino acid corresponding to position 378 in SEQ ID NO: 1 is replaced with another amino acid," it may mean, but is not limited to, a replacement with alanine, glutamic acid, phenylalanine, arginine, aspartic acid, cysteine, asparagine, glutamine, histidine, proline, serine, tyrosine, isoleucine, lysine, tryptophan, glycine, methionine, threonine, or valine, excluding leucine.

[0054]

[0055] Even if the present application describes a "protein having an amino acid sequence described by a specific sequence number", it is obvious that a protein having an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted, or added may also be used in the present application, as long as it has the same or corresponding activity as the protein consisting of the amino acid sequence of the corresponding sequence number. For example, if it has the same or corresponding activity as the mutant protein, it does not exclude sequence additions that do not alter the function of the protein before or after the amino acid sequence, mutations that may occur naturally, silent mutations thereof, or conservative substitutions, and it is obvious that even if it has such sequence additions or mutations, it falls within the scope of the present application.

[0056] The "N-position" of the present application may include the N-position and an amino acid position corresponding to the N-position. Specifically, it may include an amino acid position corresponding to any amino acid residue in a mature polypeptide disclosed in a specific amino acid sequence. The specific amino acid sequence may be any one of SEQ ID NO: 1 and SEQ ID NOs: 78 to 84.

[0057] As used herein, the term "corresponding to" refers to an amino acid residue at a position listed in a polypeptide, or an amino acid residue that is similar, identical, or homologous to the residue listed in the polypeptide. Identifying an amino acid at a corresponding position may be determining a specific amino acid in a sequence that references a particular sequence. As used herein, "corresponding region" generally refers to a similar or corresponding position in a related or reference protein.

[0058] For example, any amino acid sequence can be aligned with SEQ ID NO: 1, and based on this, each amino acid residue of the amino acid sequence can be numbered by referring to the numerical position of the amino acid residue corresponding to the amino acid residue in SEQ ID NO: 1. For example, a sequence alignment algorithm such as that described in the present application can identify the position of an amino acid, or the position at which a modification such as a substitution, insertion, or deletion occurs, by comparing it to a query sequence (also referred to as a “reference sequence”).

[0059] For such alignment, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) can be used, but is not limited thereto, and any sequence alignment program known in the art, pairwise sequence comparison algorithm, etc. can be appropriately used.

[0060] In the present application, when the amino acid sequence of any one of SEQ ID NOs: 78, 79, 81, 82 and 83 is aligned with the amino acid sequence of SEQ ID NO: 1, the amino acid corresponding to the 87th, 351st or 378th position of each of the amino acid sequences of any one of SEQ ID NOs: 78, 79, 81, 82 and 83 corresponds to the 87th, 351st or 378th position of the amino acid residue corresponding to the amino acid residue of SEQ ID NO: 1.

[0061] In the present application, when the amino acid sequence of SEQ ID NO: 80 is aligned with the amino acid sequence of SEQ ID NO: 1, the amino acid corresponding to the 88th, 352nd, or 379th position of the amino acid sequence of SEQ ID NO: 80 corresponds to the 87th, 351st, or 378th position of the amino acid residue corresponding to the amino acid residue of SEQ ID NO: 1.

[0062] In the present application, when the amino acid sequence of SEQ ID NO: 84 is aligned with the amino acid sequence of SEQ ID NO: 1, the amino acid corresponding to the 88th, 351st, or 378th position of the amino acid sequence of SEQ ID NO: 84 corresponds to the 87th, 351st, or 378th position of the amino acid residue corresponding to the amino acid residue of SEQ ID NO: 1.

[0063] That is, a person skilled in the art can align the amino acid sequence of any one of SEQ ID NOs: 78 to 84 with SEQ ID NO: 1 through sequence alignment known in the art, and based on this, when each amino acid residue of the amino acid sequence is numbered with reference to the numerical position of the amino acid residue corresponding to the amino acid residue of SEQ ID NO: 1, it can be seen that the amino acid corresponding to the 87th, 351st, or 378th position is substituted with a different amino acid.

[0064]

[0065] In one embodiment, the acetyl-CoA acetyltransferase variant of the present application may be a polypeptide in which the amino acid corresponding to position 87 of SEQ ID NO: 1 is substituted with a amino acid selected from the group consisting of alanine, glutamic acid, phenylalanine, arginine, aspartic acid, cysteine, asparagine, glutamine, histidine, proline, serine, tyrosine, isoleucine, lysine, tryptophan, glycine, and threonine, but is not limited thereto.

[0066] In any one of the embodiments described above, the acetyl-CoA acetyltransferase variant of the present application may be a polypeptide in which the amino acid corresponding to position 87 of SEQ ID NO: 1 is substituted with threonine, but is not limited thereto.

[0067]

[0068] In one embodiment, the acetyl-CoA acetyltransferase variant of the present application may be a polypeptide in which the amino acid corresponding to position 351 of SEQ ID NO: 1 is substituted with a amino acid selected from the group consisting of glutamic acid, phenylalanine, arginine, cysteine, asparagine, glutamine, histidine, proline, serine, tyrosine, valine, tryptophan, glycine, methionine, and leucine, but is not limited thereto.

[0069] In any one of the embodiments described above, the acetyl-CoA acetyltransferase variant of the present application may be a polypeptide in which the amino acid corresponding to position 351 of SEQ ID NO: 1 is substituted with valine or leucine, but is not limited thereto.

[0070]

[0071] In one embodiment, the acetyl-CoA acetyltransferase variant of the present application may be a polypeptide in which the amino acid corresponding to position 378 of SEQ ID NO: 1 is substituted with a amino acid selected from the group consisting of alanine, glutamic acid, phenylalanine, arginine, aspartic acid, cysteine, asparagine, glutamine, histidine, proline, serine, tyrosine, isoleucine, lysine, tryptophan, glycine, methionine, threonine, and valine, but is not limited thereto.

[0072] In any one of the embodiments described above, the acetyl-CoA acetyltransferase variant of the present application may be a polypeptide in which the amino acid corresponding to position 378 of SEQ ID NO: 1 is substituted with isoleucine, alanine, valine or threonine, but is not limited thereto.

[0073]

[0074] Meanwhile, a person skilled in the art can identify an amino acid corresponding to the 87th, 351st or 378th position of the amino acid sequence of SEQ ID NO: 1 of the present application; the 87th, 351st or 378th position of the amino acid sequence of any one of SEQ ID NOs: 78, 79, 81, 82 and 83; the 88th, 352nd or 379th position of the amino acid sequence of SEQ ID NO: 80; and the 88th, 351st or 378th position of the amino acid sequence of SEQ ID NO: 84 through sequence alignment known in the art, and even if not described separately in the present application, when "an amino acid at a specific position in a specific sequence number" is described, it is self-evident that it includes "an amino acid at a corresponding position" in any amino acid sequence.

[0075] In one embodiment, the variant of the present application may have and / or comprise, or consist essentially of, an amino acid sequence of any one of SEQ ID NOs: 5 to 7 and SEQ ID NOs: 85 to 105. Alternatively, the variant may comprise an amino acid sequence having at least 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity with an amino acid sequence selected from the group consisting of the amino acid sequences of any one of SEQ ID NOs: 5 to 7 and SEQ ID NOs: 85 to 105.

[0076] For example, if the amino acid sequence has sequence additions or deletions, naturally occurring mutations, silent mutations or conservative substitutions that do not alter the function of the variant of the present application at the N-terminus, C-terminus and / or within the amino acid sequence.

[0077] In this application, the term "conservative substitution" refers to the replacement of one amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions may generally occur based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. For example, positively charged (basic) amino acids include arginine, lysine, and histidine; negatively charged (acidic) amino acids include glutamic acid and aspartic acid; aromatic amino acids include phenylalanine, tryptophan, and tyrosine; and hydrophobic amino acids include alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine, and tryptophan. Additionally, amino acids can be classified into those with electrically charged side chains and those with uncharged side chains. Charged side chain amino acids include aspartic acid, glutamic acid, lysine, arginine, and histidine. Uncharged side chain amino acids can be further classified into nonpolar amino acids or polar amino acids. Nonpolar amino acids include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline. Polar amino acids include serine, threonine, cysteine, tyrosine, asparagine, and glutamine. Typically, conservative substitutions have little or no effect on the activity of the resulting polypeptide. Typically, conservative substitutions may have little or no effect on the activity of a protein or polypeptide.

[0078] In one embodiment, the acetyl-CoA acetyltransferase variant of the present application may have enhanced acetyl-CoA acetyltransferase activity, but is not limited thereto. In addition, the variant of the present application may have an activity that increases polyhydroxyalkanoate (PHA) production ability compared to a wild-type or unmodified polypeptide. Specifically, the variant of the present application may have an activity that increases the production ability of poly-3-hydroxybutyrate (Poly(3-hydroxybutyrate), P(3HB)) and / or 3-hydroxybutyrate-4-hydroxybutyrate copolymer (Poly(3-hydroxybutyrate-co-4-hydroxybutyrate), P(3HB-co-4HB)) including a 3HB monomer, among polyhydroxyalkanoates (PHAs), but is not limited thereto.

[0079]

[0080] Another aspect of the present application provides a polynucleotide encoding an acetyl-CoA acetyltransferase variant of the present application.

[0081] The terms used in this aspect are as described above.

[0082] In this application, the term "polynucleotide" means a polymer of nucleotides in which nucleotide units (monomers) are covalently bonded to form a long chain, a DNA or RNA strand of a certain length or longer, and more specifically, a polynucleotide fragment encoding the variant.

[0083] The polynucleotide encoding the acetyl-CoA acetyltransferase variant of the present application may include, without limitation, any polynucleotide sequence encoding the acetyl-CoA acetyltransferase variant of the present application. For example, the polynucleotide encoding the acetyl-CoA acetyltransferase variant of the present application may be, but is not limited to, a polynucleotide sequence encoding the amino acid sequence of the acetyl-CoA acetyltransferase variant of the present application.

[0084] The polynucleotide of the present application may undergo various modifications in the coding region without altering the amino acid sequence of the variant of the present application, taking into account codon degeneracy or preferred codons in the organism intended to express the variant of the present application. Therefore, it is self-evident that the polynucleotide may also include a polynucleotide that can be translated into a polypeptide comprising the amino acid sequence of the variant of the present application or a polypeptide having homology or identity therewith due to codon degeneracy.

[0085] For example, a polynucleotide encoding an acetyl-CoA acetyltransferase variant of the present application may include, but is not limited to, a base sequence of any one of SEQ ID NOs: 115 to 138; or a base sequence having at least 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity with any one of SEQ ID NOs: 115 to 138. In addition, it is obvious that a variant having a polynucleotide sequence having a deletion, modification, substitution, conservative substitution or addition of a part of a sequence that has such homology or identity and encodes the amino acid sequence of the acetyl-CoA acetyltransferase variant of the present application is also included within the scope of the present application.

[0086] In addition, the polynucleotide of the present application may include, without limitation, a probe that can be prepared from a known genetic sequence, for example, a sequence that can hybridize under stringent conditions with a complementary sequence to all or part of the polynucleotide sequence of the present application. The term "stringent conditions" refers to conditions that enable specific hybridization between polynucleotides. Such conditions are specifically described in the literature (see J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8). For example, conditions under which polynucleotides having high homology or identity hybridize with each other, polynucleotides having 45% or more, 50% or more, 55% or more, 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity hybridize with each other, and polynucleotides having lower homology or identity do not hybridize with each other, or conditions under which washing conditions of typical southern hybridization are performed once, specifically twice or three times, at a salt concentration and temperature equivalent to 60°C, 1ХSSC, 0.1% SDS, specifically 60°C, 0.1ХSSC, 0.1% SDS, and more specifically 68°C, 0.1ХSSC, 0.1% SDS.

[0087] Hybridization requires that two nucleic acids have complementary sequences, although mismatches between bases are possible depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Therefore, the polynucleotides of the present application may also include isolated nucleic acid fragments that are complementary in their entirety, as well as substantially similar nucleic acid sequences.

[0088] Specifically, a polynucleotide having homology or identity with the polynucleotide of the present application can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. In addition, the Tm value may be, but is not limited to, 60°C, 63°C, or 65°C, and can be appropriately adjusted by a person skilled in the art depending on the purpose.

[0089] The appropriate stringency for hybridizing the polynucleotides depends on the length and degree of complementarity of the polynucleotides, variables which are well known in the art (e.g., J. Sambrook et al., supra).

[0090] In this application, the terms "homology" or "identity" refer to the degree of similarity between two given amino acid sequences or base sequences, which may be expressed as a percentage. The terms homology and identity are often used interchangeably.

[0091] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences can generally hybridize with all or part of the sequence under moderate or high stringency conditions. It should be appreciated that hybridization also includes hybridization with polynucleotides containing common codons or codons that take codon degeneracy into account.

[0092] Whether any two polynucleotide or polypeptide sequences are homologous, similar or identical can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387(1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA / .](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST or ClustalW of the National Center for Biotechnology Information Database.

[0093] Homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information, for example, using a GAP computer program such as that of Needleman et al. (1970), J Mol Biol. 48:443, as disclosed, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program include (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and (2) a comparison matrix as disclosed by Gribskov et al. (1986) Nucl. Acids Res. 48:443, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979). 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10 and a gap extension penalty of 0.5); and (3) no penalty for terminal gaps. Accordingly, the term "homology" or "identity" as used herein refers to the relevance between sequences.

[0094]

[0095] Another aspect of the present application provides a vector comprising the polynucleotide of the present application.

[0096] The terms used in this aspect are as described above.

[0097] The above vector may be an expression vector for expressing the above polynucleotide in a microorganism, but is not limited thereto.

[0098] In the present application, the term "vector" may include a DNA construct comprising a base sequence of a polynucleotide encoding a target polypeptide operably linked to a suitable expression control region (or expression control sequence) so as to enable expression of the target polypeptide in a suitable host. The expression control region may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and sequences regulating the termination of transcription and translation. After being transformed into a suitable microorganism, the vector may replicate or function independently of the host genome, or may be integrated into the genome itself.

[0099] The vector used in the present application is not particularly limited, and any vector known in the art can be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pDZ series, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series can be used as plasmid vectors. Specifically, pDZ, pDC24, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors can be used.

[0100] For example, a polynucleotide encoding a target polypeptide can be inserted into a chromosome via a vector for intracellular chromosomal insertion. The insertion of the polynucleotide into the chromosome can be achieved by any method known in the art, for example, homologous recombination, but is not limited thereto. A selection marker for confirming the chromosomal insertion can be additionally included. The selection marker is used to select cells transformed with the vector, i.e., to confirm the insertion of the target nucleic acid molecule. Markers that confer a selectable phenotype, such as drug resistance, nutrient requirement, cytotoxic agent resistance, or expression of a surface polypeptide, can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, so that transformed cells can be selected.

[0101] In this application, the term "transformation" refers to introducing a vector containing a polynucleotide encoding a target polypeptide into a microorganism or into a microorganism so that the polypeptide encoded by the polynucleotide can be expressed in the microorganism. The transformed polynucleotide can be located either within the chromosome of the microorganism or outside the chromosome, as long as it can be expressed in the microorganism. Furthermore, the polynucleotide includes DNA and / or RNA encoding the target polypeptide. The polynucleotide can be introduced in any form as long as it can be introduced into the microorganism and expressed. For example, the polynucleotide can be introduced into the microorganism in the form of an expression cassette, which is a genetic construct containing all elements necessary for autonomous expression. The expression cassette can typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal, all of which are operably linked to the polynucleotide. The expression cassette can be in the form of a self-replicating expression vector. Additionally, the polynucleotide may be introduced into a microorganism in its own form and operably linked to a sequence required for expression in the microorganism, but is not limited thereto.

[0102] Additionally, the term "operably linked" as used herein means that the polynucleotide sequence is functionally linked to a promoter sequence that initiates and mediates transcription of the polynucleotide encoding the target variant of the present application.

[0103]

[0104] Another aspect of the present application provides a microorganism comprising the protein or a polynucleotide encoding the protein or a vector comprising the polynucleotide.

[0105] Specifically, a microorganism is provided, which comprises a protein having acetyl-CoA acetyltransferase activity, in which the amino acid corresponding to the 87th, 351st or 378th position of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid in the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having a sequence identity of 45% or more with the amino acid sequence of SEQ ID NO: 1, or a polynucleotide encoding the protein, or a vector comprising the polynucleotide.

[0106] The terms used in this aspect are as described above.

[0107] In one embodiment, the microorganism of the present application may be a microorganism having the ability to produce polyhydroxyalkanoates (PHA).

[0108] In any one of the above-described embodiments, the microorganism of the present application may be a microorganism having the ability to produce a 3-hydroxybutyrate-4-hydroxybutyrate copolymer and / or poly-3-hydroxybutyrate.

[0109] In this application, the term "polyhydroxyalkanoate (PHA)" refers to a type of biodegradable bioplastic synthesized by various microorganisms. In this application, polyhydroxyalkanoate may be, but is not limited to, a 3-hydroxybutyrate-4-hydroxybutyrate copolymer and / or poly-3-hydroxybutyrate.

[0110] In the present application, the term "3-hydroxybutyrate-4-hydroxybutyrate copolymer (Poly(3-hydroxybutyrate-co-4-hydroxybutyrate), P(3HB-co-4HB))" refers to a biodegradable polyester in which 3-hydroxybutyrate and 4-hydroxybutyrate are combined, which is one of polyhydroxyalkanoates (PHAs).

[0111] In the present application, the term "poly-3-hydroxybutyrate (Poly(3-hydroxybutyrate), P(3HB))" is a polymer of the polyhydroxyalkanoate series, and is a compound belonging to polyester as a polymer of 3-hydroxybutyrate. The poly-3-hydroxybutyrate may be used interchangeably with poly-3-hydroxybutanoate (P3HA) and a 3-hydroxybutyrate homopolymer.

[0112] In the present application, the term "poly-4-hydroxybutyrate (Poly(4-hydroxybutyrate), P(4HB))" is a polymer of the polyhydroxyalkanoate series, and is a compound belonging to polyester as a polymer of 4-hydroxybutyrate. The poly-4-hydroxybutyrate may be used interchangeably with poly-4-hydroxybutanoate (P4HA) and a 4-hydroxybutyrate homopolymer.

[0113]

[0114] In this application, the term "microorganism (or strain)" includes both wild-type microorganisms and microorganisms that have undergone natural or artificial genetic modification. It may be a microorganism that has a specific mechanism strengthened or weakened due to reasons such as the insertion of an external gene or the enhancement or inactivation of the activity of an endogenous gene, and may be a microorganism that includes genetic modification for the production of a desired polypeptide, protein, or product. In this application, "microorganism", "strain", etc. may be used interchangeably without limitation with the same meaning.

[0115] In the present application, the term "microorganism producing polyhydroxyalkanoate (PHA)" refers to a prokaryotic or eukaryotic microorganism capable of producing polyhydroxyalkanoate (PHA) within the organism, and may include both a microorganism in which the ability to produce polyhydroxyalkanoate (PHA) is conferred on a parent strain that does not have the ability to produce polyhydroxyalkanoate (PHA), or a microorganism that inherently has the ability to produce polyhydroxyalkanoate (PHA). The ability to produce polyhydroxyalkanoate (PHA) may be conferred or enhanced by species improvement.

[0116] In one embodiment, the microorganism of the present application may be a microorganism that naturally has an acetyl-CoA acetyltransferase variant or polyhydroxyalkanoate (PHA) production ability; or a microorganism that is introduced into a parent strain that does not have an acetyl-CoA acetyltransferase variant or polyhydroxyalkanoate (PHA) production ability with a polynucleotide encoding the variant of the present application (or a vector including the polynucleotide) and / or is endowed with polyhydroxyalkanoate (PHA) production ability, but is not limited thereto.

[0117] In one embodiment, the microorganism of the present application includes, but is not limited to, a microorganism in which a gene on the chromosome encoding the acetyl-CoA acetyltransferase variant is mutated and includes the sequence of the acetyl-CoA acetyltransferase variant of the present application, and / or a microorganism in which a vector including a polynucleotide encoding the acetyl-CoA acetyltransferase variant of the present application is introduced, thereby including the acetyl-CoA acetyltransferase variant of the present application.

[0118] In the present application, the term "unmodified microorganism" does not exclude a strain that contains a mutation that can occur naturally in a microorganism, and may refer to a wild-type strain or a natural strain itself, or a strain before its characteristics are changed by genetic mutation caused by natural or artificial factors. For example, the unmodified microorganism may refer to a strain that has not been introduced or before the acetyl-CoA acetyltransferase variant described herein is introduced. The "unmodified microorganism" may be used interchangeably with "pre-modified strain," "pre-modified microorganism," "unmutated strain," "unmodified microorganism," or "reference microorganism."

[0119]

[0120] The microorganism having polyhydroxyalkanoate (PHA) production ability of the present application may be, but is not limited to, a microorganism comprising at least one of the variant of the present application, the polynucleotide of the present application, and a vector comprising the polynucleotide of the present application; a microorganism modified to express the variant of the present application or the polynucleotide of the present application; a microorganism (e.g., a recombinant strain) expressing the variant of the present application or the polynucleotide of the present application; or a microorganism (e.g., a recombinant strain) having the activity of the variant of the present application.

[0121] For example, the strain of the present application is a cell or microorganism that is transformed with a vector containing a polynucleotide encoding the polynucleotide of the present application or a variant of the present application, and expresses the variant of the present application. The strain of the present application may include all microorganisms capable of producing polyhydroxyalkanoate (PHA), including the variant of the present application.

[0122] For example, the microorganism of the present application may be a recombinant strain having increased polyhydroxyalkanoate (PHA) production ability by introducing a polynucleotide encoding the variant of the present application into a natural wild-type microorganism or a microorganism having polyhydroxyalkanoate (PHA) production ability, thereby expressing an acetyl-CoA acetyltransferase variant. The recombinant strain having increased polyhydroxyalkanoate (PHA) production ability may be a microorganism having increased polyhydroxyalkanoate (PHA) production ability compared to a natural wild-type microorganism or an acetyl-CoA acetyltransferase-unmodified microorganism (e.g., a microorganism expressing a wild-type acetyl-CoA acetyltransferase or a microorganism not expressing the variant of the present application), but is not limited thereto. For example, the microorganism having increased polyhydroxyalkanoate (PHA) production ability of the present application may be a microorganism having increased polyhydroxyalkanoate (PHA) production ability compared to a microorganism comprising SEQ ID NO: 1 or a polypeptide having 45% or more sequence identity with SEQ ID NO: 1 or a polynucleotide encoding the same, but is not limited thereto.

[0123] The microorganism of the present application may include any microorganism capable of expressing the acetyl-CoA acetyltransferase variant of the present application by various known methods in addition to the introduction of the nucleic acid or vector.

[0124] For example, the polyhydroxyalkanoate (PHA) production ability of the microorganism with increased polyhydroxyalkanoate (PHA) production ability may be increased by about 1% or more, specifically, about 1% or more, about 2% or more, about 2.5% or more, about 5% or more, about 10% or more, about 15% or more, about 20% or more, about 25% or more, about 26% or more, about 27% or more, about 28% or more, about 29% or more, about 30% or more, about 31% or more, about 32% or more, or about 33% or more (the upper limit is not particularly limited and may be, for example, about 200% or less, about 150% or less, about 100% or less, about 50% or less, about 45% or less, or about 40% or less) compared to the polyhydroxyalkanoate (PHA) production ability of the parent strain or the unmodified microorganism before mutation. It is not limited to this, as long as it has a positive increase compared to the productivity of the parent strain or non-mutated microorganism before mutation. In another example, the recombinant strain with increased polyhydroxyalkanoate (PHA) production ability has a polyhydroxyalkanoate (PHA) production ability of about 1.1 times or more, about 1.12 times or more, about 1.13 times or more, about 1.14 times or more, about 1.15 times or more, about 1.16 times or more, about 1.17 times or more, about 1.18 times or more, about 1.19 times or more, about 1.2 times or more, about 1.21 times or more, about 1.22 times or more, about 1.23 times or more, about 1.24 times or more, about 1.25 times or more, about 1.26 times or more, about 1.27 times or more, about 1.28 times or more, about 1.29 times or more, about 1.30 times or more, or about It may be increased by, but is not limited to, 1.31 times or more, about 1.32 times or more, or about 1.33 times or more (the upper limit is not particularly limited, and may be, for example, about 10 times or less, about 5 times or less, about 3 times or less, about 2 times or less, about 1.5 times or less, or about 1.4 times or less). The term "about" above means ±0.5, ±0.4, ±0.3, ±0.2, ±0.A range that includes all numbers such as 1, etc., and includes all numbers in a range equal to or similar to the number following the term "about," but is not limited thereto.

[0125]

[0126] The microorganism of the present application may be a microorganism belonging to the genus Escherichia sp., Erwinia sp., Serratia sp., Providencia sp., Corynebacteria sp., Pseudomonas sp., Leptospira sp., Salmonella sp., Brevibacteria sp., Hypomononas sp., Chromobacterium sp., and Norcardia sp., or a fungus or yeast, and specifically, may be a microorganism of the genus Escherichia, more specifically, Escherichia coli (E. coli), but is not limited thereto.

[0127] Meanwhile, the Escherichia genus microorganism having polyhydroxyalkanoate (PHA) production ability of the present application may include a natural wild-type microorganism itself, an Escherichia genus microorganism having improved polyhydroxyalkanoate (PHA) production ability by strengthening or weakening the activity of a gene related to the polyhydroxyalkanoate (PHA) production mechanism, or an Escherichia genus microorganism having improved polyhydroxyalkanoate (PHA) production ability by introducing or strengthening the activity of an external gene.

[0128]

[0129] Additionally, the microorganism of the present application may have enhanced activity of acetyl-CoA acetyltransferase compared to the parent strain.

[0130] In the present application, "enhancement" of polypeptide activity means that the activity of the polypeptide is increased compared to the intrinsic activity. The term "enhancement" may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase. Here, activation, enhancement, up-regulation, overexpression, and increase may all include exhibiting an activity that was not originally present, or exhibiting an activity that is enhanced compared to the intrinsic activity or activity before modification. The term "intrinsic activity" refers to the activity of a specific polypeptide that was originally present in a parent strain or unmodified microorganism before the trait change, when the trait change is due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with "pre-modification activity." "Enhanced," "upregulated," "overexpressed," or "increased" the activity of a polypeptide relative to its intrinsic activity means that the activity and / or concentration (expression amount) of the specific polypeptide is improved compared to the activity and / or concentration (expression amount) that the parent strain or unmodified microorganism originally had prior to the transformation.

[0131] Enhancement of the activity of the polypeptide can be achieved by applying various methods well known in the art, for example, increasing the intracellular copy number of the gene encoding the variant, introducing a mutation into a gene expression control sequence on a chromosome encoding the variant, replacing a gene expression control sequence on a chromosome encoding the variant with a sequence having strong activity, replacing a gene encoding the protein on a chromosome with a mutated gene so as to increase the activity of the variant, and introducing a mutation into a gene encoding the variant protein on a chromosome so as to enhance the activity of the variant, but is not limited thereto.

[0132] In this application, the term "introduction" refers to a method of delivering a polynucleotide encoding the acetyl-CoA acetyltransferase variant or a vector containing the same to a host cell. Such introduction can be easily performed according to a method commonly known in the art. Common methods include the CaCl2 precipitation method, the Hanahan method which increases efficiency by using a reducing agent called dimethyl sulfoxide (DMSO) in the CaCl2 method, electroporation, calcium phosphate precipitation, protoplast fusion, a stirring method using silicon carbide fibers, a transformation method using PEG, dextran sulfate, lipofectamine, and desiccation / inhibition-mediated transformation methods. The method for transforming the vector is not limited to the above examples, and any transformation or transfection method commonly used in the art can be used without limitation. In addition, the delivered polynucleotide can be integrated and located within the chromosome of the host cell or located extrachromosomally, as long as it can be expressed in the host cell. In addition, the polynucleotide may be introduced in any form as long as it can be introduced into a host cell and expressed. For example, the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a polynucleotide structure that includes all elements necessary for self-expression, but is not limited thereto. The expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal that are operably linked to the open reading frame (hereinafter abbreviated as "ORF") of the gene. The expression cassette may be in the form of an expression vector capable of self-replication. In addition, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell, but is not particularly limited thereto.

[0133]

[0134] For example, the microorganism of the present application may be a microorganism having polyhydroxyalkanoate (PHA) production ability or a microorganism having increased production ability by additionally enhancing the activity of any one of acetoacetyl-CoA reductase (phaB), PHA synthase (phaC), or a combination thereof compared to the intrinsic activity, but is not limited thereto.

[0135] For example, the microorganism of the present application may be a microorganism that has the ability to produce polyhydroxyalkanoate (PHA) by additionally introducing any one of a polynucleotide encoding acetoacetyl-CoA reductase (phaB) or a vector including the same; a polynucleotide encoding acetoacetyl-CoA reductase or a vector including the same; a polynucleotide encoding PHA synthase or a vector including the same; or a combination thereof, but is not limited thereto.

[0136] The gene encoding the above acetoacetyl-CoA reductase may be phaB derived from Cupriavidus necator, Ralstonia eutropha, Ralstonia solanacearum, Zoogloea ramigera, Delftia acidovorans, Bacillus megaterium, Cromobacterium sp. USM2, Rhodobacter sphaeroides, Chromobacterium sp. USM2, Alcaligenes latus, Azohydromonas lata, Acidovorax species, Burkholderia pseudomallei, Burkholderia vietnamiensis, or Burkholderia glumae, but may be included without limitation as long as a protein having acetoacetyl-CoA reductase activity can be expressed. The sequence of the phaB gene encoding the above acetoacetyl-CoA reductase can be obtained from a known database such as NCBI's GenBank or KEGG (Kyoto Encyclopedia of Genes and Genomes). For example, the phaB gene encoding acetoacetyl-CoA reductase (SEQ ID NO: 139) derived from Cupriavidus necator may include, but is not limited to, the base sequence of SEQ ID NO: 113.

[0137] The gene encoding the above PHA synthase may be phaC derived from Cupriavidus necator, Ralstonia eutropha, Ralstonia solanacearum, Zoogloea ramigera, Delftia acidovorans, Bacillus megaterium, Cromobacterium sp. USM2, Rhodobacter sphaeroides, Chromobacterium sp. USM2, Alcaligenes latus, Azohydromonas lata, Acidovorax species, Burkholderia pseudomallei, Burkholderia vietnamiensis, or Burkholderia glumae, but may be included without limitation as long as a protein having PHA synthase activity can be expressed. The sequence of the phaC gene encoding the above PHA synthase can be obtained from a known database such as NCBI's GenBank or KEGG (Kyoto Encyclopedia of Genes and Genomes). For example, the phaC gene encoding the PHA synthase (SEQ ID NO: 140) derived from Cupriavidus necator may include, but is not limited to, the base sequence of SEQ ID NO: 114.

[0138]

[0139] Another aspect of the present application provides a method for producing polyhydroxyalkanoate (PHA), comprising the step of culturing the microorganism of the present application in a medium.

[0140] The terms used in this aspect are as described above.

[0141] Specifically, the method for producing polyhydroxyalkanoate (PHA) of the present application may include, but is not limited to, a step of culturing a microorganism including the protein of the present application or a polynucleotide encoding the protein or the vector of the present application in a medium.

[0142] In this application, the term "cultivation" refers to growing the microorganism of this application under appropriately controlled environmental conditions. The culturing process of this application can be performed using any suitable medium and culture conditions known in the art. This culturing process can be easily adjusted and used by those skilled in the art depending on the selected strain. Specifically, the culturing process may be batch, continuous, and / or fed-batch, but is not limited thereto.

[0143] In this application, the term "medium" refers to a material containing nutrients as a main component necessary for culturing the microorganism of this application, and supplies nutrients and growth factors, including water essential for survival and growth. Specifically, the medium and other culture conditions used for culturing the microorganism of this application may be any medium used for culturing general microorganisms without particular limitation, but the microorganism of this application may be cultured under aerobic conditions while controlling temperature, pH, etc. in a general medium containing an appropriate carbon source, nitrogen source, phosphorus source, inorganic compound, amino acid, and / or vitamin.

[0144] In the present application, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc. In addition, natural organic nutrients such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane bagasse, and corn steep liquor may be used, and specifically, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted to reducing sugar) may be used, and other appropriate amounts of carbon sources may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.

[0145] The nitrogen source may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc.; peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.

[0146] The above-mentioned components may include potassium phosphate monobasic, potassium phosphate dibasic, or their corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. In addition, amino acids, vitamins, and / or suitable precursors may be included. These components or precursors may be added to the medium in batch or continuous manner, but are not limited thereto.

[0147] In addition, during the cultivation of the microorganism of the present application, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during the cultivation, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester. In addition, in order to maintain the aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or in order to maintain the anaerobic and microaerobic state, nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection, but is not limited thereto.

[0148] In the culture of the present application, the culture temperature can be maintained at 20 to 45°C, specifically 25 to 40°C, and the culture can be performed for about 10 to 160 hours, but is not limited thereto.

[0149]

[0150] When culturing a microorganism containing a protein having acetyl-CoA acetyltransferase activity of the present application, high yields of polyhydroxyalkanoate (PHA) can be produced compared to microorganisms having conventional unmodified polypeptides.

[0151] In one specific example, the polyhydroxyalkanoate produced by the culture of the present application may specifically be a 3-hydroxybutyrate-4-hydroxybutyrate copolymer and / or poly-3-hydroxybutyrate.

[0152] In one specific example, the polyhydroxyalkanoate produced by the culture of the present application may be secreted into the medium or remain within the cells.

[0153] In one specific example, the polyhydroxyalkanoate produced by the culture of the present application may have an increased 3-hydroxybutyrate (3HB) content compared to the polyhydroxyalkanoate produced by the culture of a microorganism comprising a protein having unmodified acetyl-CoA acetyltransferase activity or a polynucleotide encoding the same.

[0154]

[0155] The method for producing polyhydroxyalkanoate (PHA) of the present application may additionally include a step of preparing a microorganism of the present application, a step of preparing a medium for culturing the strain, or a combination thereof (in any order), for example, before the culturing step.

[0156] The method for producing polyhydroxyalkanoate (PHA) of the present application may further include a step of recovering polyhydroxyalkanoate (PHA) from the culture medium (medium in which culture is performed) or from the microorganism of the present application. The recovering step may be additionally included after the culturing step.

[0157] The above recovery may be performed by collecting polyhydroxyalkanoate (PHA) using a suitable method known in the art according to the culture method of the microorganism of the present application, such as a batch, continuous or fed-batch culture method. For example, various chromatographies such as centrifugation, filtration, treatment with a crystallized protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC or a combination thereof may be used, and polyhydroxyalkanoate (PHA) may be recovered from a medium or microorganism using a suitable method known in the art.

[0158] In addition, the method for producing polyhydroxyalkanoate (PHA) of the present application may additionally include a purification step. The purification may be performed using any suitable method known in the art. In one example, when the method for producing polyhydroxyalkanoate (PHA) of the present application includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially or discontinuously, regardless of the order, or may be performed simultaneously or integrated into a single step, but is not limited thereto.

[0159]

[0160] Another aspect of the present application provides a composition for producing polyhydroxyalkanoate (PHA), comprising the protein; a polynucleotide encoding the protein; a vector comprising the polynucleotide; or a microorganism comprising the protein, the polynucleotide encoding the protein, or the vector comprising the polynucleotide; a culture of the microorganism; or a combination of two or more thereof.

[0161] The terms used in this aspect are as described above.

[0162] The composition of the present application may further comprise any suitable excipient commonly used in compositions for producing amino acids, and such excipients may be, for example, but are not limited to, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizers, or isotonic agents.

[0163] In one specific example, each component present in the composition of the present application may be included in a microbiologically effective amount, or an amount that can be suitably present in the composition for production.

[0164]

[0165] Another aspect of the present application provides a use of the protein of the present application for producing polyhydroxyalkanoate (PHA).

[0166] The terms used in this aspect are as described above.

[0167]

[0168] The present application will be described in more detail below through examples. However, the following examples are merely preferred embodiments intended to illustrate the present application and are therefore not intended to limit the scope of the present application. Furthermore, technical details not described herein can be readily understood and implemented by those skilled in the technical field of the present application or similar fields.

[0169]

[0170] Example 1. Construction of an acetyl-CoA acetyltransferase expression vector

[0171]

[0172] Example 1-1. Vector construction for the production of P(3HB) producing strain

[0173]

[0174] To produce P(3HB)-producing Escherichia coli, a vector containing phaA, phaB, and phaC was constructed.

[0175] Specifically, the pCL-PuspA_phaA-PuspA_phaB-PuspA_phaC vector containing the PuspA promoter (universal stress protein A promoter) (Prytz et al. 2003; Dyk et al. 1995; Nystrom and Neidhardt 1992; 1994) was constructed to enable the expression of the phaA (SEQ ID NO: 2), phaB (SEQ ID NO: 113), and phaC gene sequences (SEQ ID NO: 114) from Cupriavidus necator in Escherichia coli using the pCL1920 vector (GenBank No. AB236930). The phaA, phaB, and phaC genes were amplified by PCR using primers of SEQ ID NO: 3 and 4 based on the reference sequence NZ_CP039287.1 in the NCBI database.

[0176]

[0177] Primer base sequence SEQ ID NO: 35'-GGTACCCGGGGATCCTCTAGAGAACCACTATCAATATATTCATGTCGAA SEQ ID NO: 45'-CAAGCTTGCATGCCTGCAGGTTTGCCTGGCGGCAGTA

[0178] PCR conditions were denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 1 minute, repeated 30 times. The PCR product was purified by eluting the band after electrophoresis on a 1.0% agarose gel, and the pCL1920 vector (GenBank No. AB236930) was treated with XbaI and PstI restriction enzymes. The restriction enzyme-treated pCL1920 vector and the inserted DNA fragment amplified through the PCR were ligated using an Infusion Cloning Kit, and then transformed into E. coli DH5α. Colonies were selected on LB medium containing 75 mg / L of spectinomycin antibiotic.

[0179]

[0180] Example 1-2. Vector construction for constructing a P(3HB) producing strain expressing an acetyl-CoA acetyltransferase mutant.

[0181]

[0182] To obtain acetyl-CoA acetyltransferase mutants, a vector library was constructed using the following method. Error-prone PCR was performed on the phaA gene (SEQ ID NO: 2), which encodes acetyl-CoA acetyltransferase (SEQ ID NO: 1) from Cupriavidus necator, to obtain phaA gene mutants with randomly introduced base substitution mutations. Error-prone PCR was performed using the Genemorph II Random Mutagenesis Kit (Agilent Technologies, Inc., Santa Clara, CA, USA).

[0183] Mutations were introduced at a rate of 0 to 2 per 1 Kb within the amplified gene fragment, and the PCR conditions were 30 cycles of denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 1 minute. The PCR product was purified by eluting the band after electrophoresis on a 1.0% agarose gel, and the pCL1920 vector was treated with XbaI and PstI restriction enzymes. The pCL1920 vector treated with restriction enzymes and the inserted DNA fragment amplified through the PCR were ligated using an Infusion Cloning Kit, and then transformed into E. coli DH5α, and colonies were selected on LB medium containing 75 mg / L of spectinomycin antibiotic.

[0184] After randomly selecting 20 colonies, plasmids were obtained and sequenced. Results showed that mutations were introduced at different positions at a frequency of 0.8 mutations / Kb. Approximately 10,000 transformed colonies were collected to extract plasmids, which were designated as the pCL-PuspA_phaA(mt)-PuspA_phaB-PuspA_phaC library.

[0185]

[0186] Example 2. Construction of a library of strains expressing acetyl-CoA acetyltransferase mutants and screening of strains expected to have increased P(3HB) production.

[0187]

[0188] Example 2-1. Production of a library of strains expressing acetyl-CoA acetyltransferase mutants.

[0189]

[0190] To construct a mutant strain library, the pCL-PuspA_phaA(mt)-PuspA_phaB-PuspA_phaC library constructed in Example 1-2 was introduced by the TSS method using the Escherichia coli LS5218 strain as the parent strain (Proc Natl Acad Sci US A. 1989 Apr; 86(7): 2172-5). Approximately 5,000 colonies were obtained by spreading on LB solid medium containing 75 mg / L of spectinomycin antibiotic, and the obtained colonies were named E. coli / pCL-PuspA_phaA(mt)-PuspA_phaB-PuspA_phaC-1 to E. coli / pCL-PuspA_phaA(mt)-PuspA_phaB-PuspA_phaC-5000. In addition, the pCL-PuspA_phaA-PuspA_phaB-PuspA_phaC vector produced in Example 1-1 was transformed into E. coli LS5218 strain to produce a control group, and was named E. coli / pCL-PuspA_phaA(wt)-PuspA_phaB-PuspA_phaC.

[0191]

[0192] Example 2-2. Selection of strains expected to have increased P(3HB) production from the strain library.

[0193]

[0194] Approximately 5,000 colonies were inoculated into 350 μL of LB broth containing 75 mg / L of Spectinomycin and cultured in a 96-well plate at 37°C and 1,000 rpm for 16 h. The LB broth (Merk, Darmstadt, Germany) was prepared at 25 g / L and each culture was centrifuged (2,000 × g, 10 min) to remove the supernatant and resuspended in 350 μL of selective medium. The selective medium was prepared to contain 2.5 g of LB broth powder, 50 mmol of phosphate buffer (pH 7), 10 g of glucose, and 75 μg of Spectinomycin per L, and then dispensed into a 96-well plate for use. After culturing the resuspended culture at 35°C and 1000 rpm for approximately 24 hours, strains expected to have increased P3HB production were selected based on the absorbance measured at a wavelength of 600 nm.

[0195] This was inspired by the fact that when acetyl-CoA acetyltransferase is weakened, byproducts derived from its substrate, acetyl-CoA, accumulate and growth is inhibited, and as P3HB production increases, the absorbance (OD) value of the cell culture increases due to granules accumulating within the cells.

[0196] As a result of the culture, three mutant strains were selected whose absorbance values ​​increased by more than 20% compared to the control strain. The selected mutant strains, E. coli / pCL-PuspA_phaA(mt)-PuspA_phaB-PuspA_phaC-1517, 2618, and 2812, showed absorbance increases of 35.4%, 45.3%, and 23.6%, respectively, compared to the control strain, E. coli / pCL-PuspA_phaA(wt)-PuspA_phaB-PuspA_phaC, while the other colonies showed absorbances similar to or decreased compared to the control group (Table 2).

[0197]

[0198] Strain OD (600 nm)E. coli / pCL-PuspA_phaA(wt)-PuspA_phaB-PuspA_phaC2.12E. coli / pCL-PuspA_phaA(mt)-PuspA_phaB-PuspA_phaC-15172.87E. coli / pCL-PuspA_phaA(mt)-PuspA_phaB-PuspA_phaC-26183.08E. coli / pCL-PuspA_phaA(mt)-PuspA_phaB-PuspA_phaC-28122.62

[0199]

[0200] Example 3. Confirmation of P(3HB) production ability of selected strains expressing acetyl-CoA acetyltransferase mutants and confirmation of phaA gene mutations.

[0201]

[0202] Example 3-1. Confirmation of P(3HB) production ability of selected strains

[0203]

[0204] In Example 2, we attempted to determine whether the P(3HB) production ability of the E. coli / pCL-PuspA_phaA(mt)-PuspA_phaB-PuspA_phaC-1517, 2618, and 2812 strains obtained was improved compared to the control strain, E. coli / pCL-PuspA_phaA(wt)-PuspA_phaB-PuspA_phaC.

[0205] Each strain was inoculated into a 250-ml corner-baffle flask containing 25 mL of P(3HB) production medium containing 5% glucose, and then cultured at 37°C for 5 h and 35°C for 43 h with shaking at 230 rpm. The P(3HB) concentration was then analyzed by gas chromatography (GC). GC analysis was performed using a GC (Agilent Technologies, 8890) equipped with an Agilent DB-FFAP (30 mm * 0.25 mm * 0.25 μm) column, with the inlet temperature set to 200°C and the flow rate set to 1.3 mL / min. In addition, the flame ionization detector (FID) temperature was set to 230°C and then analyzed. The concentrations of the analyzed P(3HB) are shown in Table 3 below.

[0206]

[0207] Strain P (3HB) concentration (mg) yield (%) E. coli / pCL-PuspA_phaA(wt)-PuspA_phaB-PuspA_phaC10.920.8E. coli / pCL-PuspA_phaA(mt)-PuspA_phaB-PuspA_phaC-151711.222.1E. coli / pCL-PuspA_phaA(mt)-PuspA_phaB-PuspA_phaC-261812.925.3E. coli / pCL-PuspA_phaA(mt)-PuspA_phaB-PuspA_phaC-281211.921.9

[0208] As a result, it was confirmed that the concentrations of P(3HB) produced by the selected strains E. coli / pCL-PuspA_phaA(mt)-PuspA_phaB-PuspA_phaC-1517, 2618, and 2812 increased by 2.7%, 18.3%, and 9.2%, respectively, compared to the control strain E. coli / pCL-PuspA_phaA(wt)-PuspA_phaB-PuspA_phaC.

[0209]

[0210] 3-2. Confirmation of phaA gene mutations

[0211]

[0212] Since the P(3HB) production ability of the selected strain was confirmed to increase compared to the control group, the base sequence of the phaA gene was analyzed to confirm the random mutation of the acetyl-CoA acetyltransferase introduced into the selected strain. The amino acid sequence of the mutated acetyl-CoA acetyltransferase protein was confirmed by comparing the base sequence of the mutated phaA gene analyzed based on the plasmid obtained from the selected strain with the base sequence of the wild-type phaA gene (SEQ ID NO: 2).

[0213] As a result, as shown in Table 4, it was confirmed that the mutated acetyl-CoA acetyltransferase proteins of the selected E. coli / pCL-PuspA_phaA(mt)-PuspA_phaB-PuspA_phaC-1517, 2618, and 2812 strains had 87th amino acid changed from valine to threonine, 351st amino acid changed from isoleucine to valine, and 378th amino acid changed from leucine to isoleucine, respectively.

[0214]

[0215] Strain Acetyl-CoA acetyltransferase amino acid mutations E. coli / pCL-PuspA_phaA(mt)-PuspA_phaB-PuspA_phaC-1517V87TE. coli / pCL-PuspA_phaA(mt)-PuspA_phaB-PuspA_phaC-2618I351VE. coli / pCL-PuspA_phaA(mt)-PuspA_phaB-PuspA_phaC-2812L378I

[0216]

[0217] Example 4. Production of a strain expressing an acetyl-CoA acetyltransferase mutant derived from an alien species and confirmation of P(3HB) production ability.

[0218]

[0219] Example 4-1. Production of a vector for introducing acetyl-CoA acetyltransferase from an alien species.

[0220]

[0221] For other microorganisms containing acetyl-CoA acetyltransferase, we also sought to determine the mutational effects of substituting the amino acids corresponding to positions 87, 351, and 378 of acetyl-CoA acetyltransferase from Cupriavidus necator with threonine, valine, and isoleucine, respectively.

[0222] Specifically, phaA genes from seven microorganisms (Pseudomonas putida, Alcaligenes latus, Allochromatium vinosum DSM 180, Azotobacter beijerinckii, Pandoraea sp. B-6, Burkholderiaceae bacterium 16, Candidatus Accumulibacter phosphatis) that have a homology of 45% or more and are structurally similar to the gene phaA (SEQ ID NO: 2) encoding acetyl-CoA acetyltransferase from Cupriavidus necator were selected, and PCR was performed to amplify the wild-type phaA gene from the microorganisms.

[0223] Cloning was performed in the same manner as in Example 1, and as a result, seven vectors containing wild-type phaA genes derived from seven types of microorganisms and phaB and phaC genes derived from Cupriavidus necator were obtained. The obtained vector is EachpCL-PuspA_Ppu_phaA(wt)-PuspA_phaB-PuspA_phaC,pCL-PuspA_Ala_phaA(wt)-PuspA_pha B-PuspA_phaC,pCL-PuspA__Avi_phaA(wt)-PuspA_phaB-PuspA_phaC,pCL-PuspA__Abe_phaA(w t)-PuspA_phaB-PuspA_phaC,pCL-PuspA_P_phaA(wt)-PuspA_phaB-PuspA_phaC,pCL-PuspA__B ba_phaA(wt)-PuspA_phaB-PuspA_phaC,pCL-PuspA__Cac_phaA(wt)-PuspA_phaB-PuspA_phaC It was named.

[0224]

[0225] Example 4-2. Production of a vector introducing the V87T mutation.

[0226]

[0227] For the seven microorganisms selected in Example 4-1 above, the effect of a mutation in which the amino acid at the position corresponding to the 87th position of the acetyl-CoA acetyltransferase derived from Cupriavidus necator was substituted with threonine was examined.

[0228] Specifically, the amino acid at the position corresponding to the 87th position of phaA from Cupriavidus necator was identified among the phaA sequences derived from the seven selected species, and PCR was performed to amplify the phaA genes encoding mutants (SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91) in which the amino acid at the corresponding position was substituted with threonine. The primers used to amplify the phaA mutants derived from the seven species are shown in Table 5.

[0229]

[0230] Derived primer base sequences Pseudomonas putida SEQ ID NO: 85'-TGACGATCAACAAGacgTGCGGCTCGGGCCTG SEQ ID NO: 95'-AGGCCCGAGCCGCAcgtCTTGTTGATCGTCATGC Alcaligenes latus SEQ ID NO: 105'-TGACCATCAACGCCacgTGCGGCTCCGGCCTG SEQ ID NO: 115'-AGGCCGGAGCCGCAcgtGGCGTTGATGGTCAGCG Allochromatium vinosum DSM 180 SEQ ID NO: 125'-TGACCATCAACAAGacgTGCGGCAGCGGTCTG SEQ ID NO: 135'-AGACCGCTGCCGCAcgtCTTGTTGATGGTCATGGGA Zotobacter Biernacki SEQ ID NO: 145'-TGACCCTAAACAAGacgTGCGGTTCTGGACTC SEQ ID NO: 155'-AGTCCAGAACCGCAcgtCTTGTTTAGGGTCATGGPandoraea sp. B-6 SEQ ID NO: 165'-TGACCATCAACAAGacgTGCGGCTCGGGCCTG SEQ ID NO: 175'-AGGCCCGAGCCGCAcgtCTTGTTGATGGTCATGGBurkholderiaceae bacterium 16 SEQ ID NO: 185'-TGACGATCAACAAGacgTGCGGCTCGGGCCTC SEQ ID NO: 195'-AGGCCCGAGCCGCAcgtCTTGTTGATCGTCATGCCandidatus Accumulibacter phosphatis SEQ ID NO: 205'-CCACCCTGACCAAGacgTGCAGCTCTGCCCAG SEQ ID NO: 215'-TGGGCAGAGCTGCAcgtCTTGGTCAGGGTGGTGC

[0231] Cloning was performed using the same method as in Example 1, and as a result, seven phaA mutants derived from selected alien species (Pseudomonas putida, Alcaligenes latus, Allochromatium vinosum DSM 180, Azotobacter beijerinckii, Pandoraea sp. B-6, Burkholderiaceae bacterium 16, Candidatus Accumulibacter phosphatis) and seven vectors containing the phaB and phaC genes were obtained. The seven obtained vectors are EachpCL-PuspA_Ppu_phaA(V87T)-PuspA_phaB-PuspA_phaC,pCL-PuspA_Ala_phaA(V87T)-PuspA_ph aB-PuspA_phaC,pCL-PuspA_Avi_phaA(V88T)-PuspA_phaB-PuspA_phaC,pCL-PuspA_Abe_phaA(V8 7T)-PuspA_phaB-PuspA_phaC,pCL-PuspA_P_phaA(V87T)-PuspA_phaB-PuspA_phaC,pCL-PuspA_B ba_phaA(V87T)-PuspA_phaB-PuspA_phaC,pCL-PuspA_Cac_phaA(M88T)-PuspA_phaB-PuspA_phaC It was named.

[0232]

[0233] Example 4-3. Production of a vector introducing the I351V mutation.

[0234]

[0235] For the seven microorganisms selected in Example 4-1 above, the effect of a mutation in which the amino acid at the position corresponding to the 351st position of the acetyl-CoA acetyltransferase derived from Cupriavidus necator was substituted with valine was examined.

[0236] Specifically, the amino acid at the position corresponding to the 351st position of phaA from Cupriavidus necator was identified among the phaA sequences derived from the seven selected species, and PCR was performed to amplify the phaA genes encoding mutants (SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98) in which the amino acid at the corresponding position was substituted with valine. The primers used to amplify the phaA mutants derived from the seven species are shown in Table 6.

[0237]

[0238] Derived primer base sequence Pseudomonas putida SEQ ID NO: 225'-GCACCCGgtgGGCGCGTCCGGTTG SEQ ID NO: 235'-CGCGCCcacCGGGTGCCCGATCGCAllochromatium vinosum DSM 180 SEQ ID NO: 245'-CCACCCCgtgGGCGCCTCCGGCTG SEQ ID NO: 255'-GGCGCCcacGGGGTGGCCGATGGCAzotobacter beijerinckii SEQ ID NO: 265'-TCATCCGgtgGGCGCCTCCGGTGC SEQ ID NO: 275'-GGCGCCcacCGGATGACCGATGGCAlcaligenes latus SEQ ID NO: 285'-CCATCCCgtgGGAGCCTCTGGCTG SEQ ID NO: 295'-GGCTCCcacGGGATGGCCGATGGCPandoraea sp. B-6 SEQ ID NO: 305'-TCACCCGgtgGGCGCGTCGGGCTG SEQ ID NO: 315'-CGCGCCcacCGGGTGACCGATGGCBurkholderiaceae bacterium 16 SEQ ID NO: 325'-TCACCCGgtgGGCGCTTCGGGCTG SEQ ID NO: 335'-AGCGCCcacCGGGTGACCGATCGCCandidatus Accumulibacter phosphatis SEQ ID NO: 345'-CCATCCGgtgGGCGCCACGGGGTC SEQ ID NO: 355'-GGCGCCcacCGGATGGCCCAGCGC

[0239] Cloning was performed in the same manner as in Example 1, and as a result, seven phaA mutants derived from selected alien species (Pseudomonas putida, Alcaligenes latus, Allochromatium vinosum DSM 180, Azotobacter beijerinckii, Pandoraea sp. B-6, Burkholderiaceae bacterium 16, Candidatus Accumulibacter phosphatis) and seven vectors containing phaB and phaC genes, respectively, were obtained. Obtained vectors The 7 types are pCL-PuspA_Ppu_phaA(I351V)-PuspA_phaB-PuspA_phaC, pCL-PuspA_Ala_phaA(I351V)-PuspA_p haB-PuspA_phaC,pCL-PuspA_Avi_phaA(I352V)-PuspA_phaB-PuspA_phaC,pCL-PuspA_Abe_phaA(I3 51V)-PuspA_phaB-PuspA_phaC,pCL-PuspA_P_phaA(I351V)-PuspA_phaB-PuspA_phaC,pCL-PuspA_B ba_phaA(I351V)-PuspA_phaB-PuspA_phaC,pCL-PuspA_Cac_phaA(I351V)-PuspA_phaB-PuspA_phaC It was named.

[0240]

[0241] Example 4-4. Construction of a vector introducing the L378I mutation.

[0242]

[0243] For the seven microorganisms selected in Example 4-1 above, the effect of a mutation in which the amino acid at the position corresponding to the 378th position of the acetyl-CoA acetyltransferase derived from Cupriavidus necator was substituted with isoleucine was examined.

[0244] Specifically, the amino acid at position 378 of phaA from Cupriavidus necator was identified among the phaA sequences from the seven selected species, and PCR was performed to amplify the phaA genes encoding mutants (SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105) in which the amino acid at that position was substituted with isoleucine. The primers used to amplify the phaA mutants from the seven species are shown in Table 7.

[0245]

[0246] Derived primer base sequences Pseudomonas putida SEQ ID NO: 365'-AAAAGGGCCTGGCGTCGataTGTATCGGCGGCGGC SEQ ID NO: 375'-ATGCCGCCGCCGATACAtatCGACGCCAGGCCCAllochromatium vinosum DSM 180 SEQ ID NO: 385'-AGAAGGGCGTGGCCGCGataTGCATCGGTGGCGGC SEQ ID NO: 395'-ATGCCGCCACCGATGCAtatCGCGGCCACGCCCAzotobacter beijerinckii SEQ ID NO: 405'-AGAAGGGTCTGGCGACGataTGCATCGGCGGCGGC SEQ ID NO: 415'-TGGCCGCCGCCGATGCAtatCGTCGCCAGACCCAlcaligenes latus SEQ ID NO: 425'-AGAAAGGCTTGGCAACTataTGCATCGGTGGCGGG SEQ ID NO: 435'-TGCCCGCCACCGATGCAtatAGTTGCCAAGCCTPandoraea sp. B-6 SEQ ID NO: 445'-GTCGCGGTCTGGCATCGataTGCATCGGCGGCGGC SEQ ID NO: 455'-ATGCCGCCGCCGATGCAtatCGATGCCAGACCGBurkholderiaceae bacterium 16 SEQ ID NO: 465'-AGAAGGGTCTGGCGTCGataTGCATCGGCGGCGGC SEQ ID NO: 475'-ATGCCGCCGCCGATGCAtatCGACGCCAGACCCCandidatus Accumulibacter phosphatis SEQ ID NO: 485'-AGCGCGGCATCGCGGGCataTGCGCTGGCGGCGGC SEQ ID NO: 495'-TCGCCGCCGCCAGCGCAtatGCCCGCGATGCCG

[0247] Cloning was performed in the same manner as in Example 1, and as a result, seven phaA mutants derived from selected alien species (Pseudomonas putida, Alcaligenes latus, Allochromatium vinosum DSM 180, Azotobacter beijerinckii, Pandoraea sp. B-6, Burkholderiaceae bacterium 16, Candidatus Accumulibacter phosphatis) and seven vectors containing phaB and phaC genes, respectively, were obtained. Obtained vectors The 7 types are pCL-PuspA_Ppu_phaA(L378I)-PuspA_phaB-PuspA_phaC, pCL-PuspA_Ala_phaA(L378I)-PuspA_p haB-PuspA_phaC,pCL-PuspA_Avi_phaA(L379I)-PuspA_phaB-PuspA_phaC,pCL-PuspA_Abe_phaA(L3 78I)-PuspA_phaB-PuspA_phaC,pCL-PuspA_P_phaA(L378I)-PuspA_phaB-PuspA_phaC,pCL-PuspA_B ba_phaA(L378I)-PuspA_phaB-PuspA_phaC,pCL-PuspA_Cac_phaA(L378I)-PuspA_phaB-PuspA_phaC It was named.

[0248]

[0249] Example 4-5. Production of a strain expressing an acetyl-CoA acetyltransferase mutant and confirmation of P(3HB) production ability.

[0250]

[0251] The P(3HB) production ability of strains expressing mutant acetyl-CoA acetyltransferases derived from seven species, in which amino acids corresponding to positions 87, 351, and 378 of acetyl-CoA acetyltransferase derived from Cupriavidus necator were substituted with threonine, valine, and isoleucine, respectively, was investigated.

[0252] 구체적으로, 상기 실시예 4-2에서 제작한 V87T 변이 도입 벡터 7종(pCL-PuspA_Ppu_phaA(V87T)-PuspA_phaB-PuspA_phaC,pCL-PuspA_Ala_phaA(V87T)-PuspA_p haB-PuspA_phaC,pCL-PuspA_Avi_phaA(V88T)-PuspA_phaB-PuspA_phaC,pCL-PuspA_Abe_phaA(V8 7T)-PuspA_phaB-PuspA_phaC,pCL-PuspA_P_phaA(V87T)-PuspA_phaB-PuspA_phaC,pCL-PuspA_Bb a_phaA(V87T)-PuspA_phaB-PuspA_phaC,pCL-PuspA_Cac_phaA(M88T)-PuspA_phaB-PuspA_phaC), 실시예 4-3에서 제작한 I351V 변이 도입 벡터 7종(pCL-PuspA_Ppu_phaA(I351V)-PuspA_phaB-PuspA_phaC,pCL-PuspA_Ala_phaA(I351V)-PuspA_p haB-PuspA_phaC,pCL-PuspA_Avi_phaA(I352V)-PuspA_phaB-PuspA_phaC,pCL-PuspA_Abe_phaA(I35 1V)-PuspA_phaB-PuspA_phaC,pCL-PuspA_P_phaA(I351V)-PuspA_phaB-PuspA_phaC,pCL-PuspA_Bb a_phaA(I351V)-PuspA_phaB-PuspA_phaC,pCL-PuspA_Cac_phaA(I351V)-PuspA_phaB-PuspA_phaC), 그리고 실시예 4-4에서 제작한 L378I 변이 도입 벡터 7종(pCL-PuspA_Ppu_phaA(L378I)-PuspA_phaB-PuspA_phaC,pCL-PuspA_Ala_phaA(L378I)-PuspA_phaB-PuspA_pha C,pCL-PuspA_Avi_phaA(L379I)-PuspA_phaB-PuspA_phaC,pCL-PuspA_Abe_phaA(L378I)-PuspA_phaB-PuspA_phaC,pCL-PuspA_P_phaA(L378I)-PuspA_phaB-PuspA_phaC, pCL-PuspA_Bba_phaA(L378I)-PuspA_phaB-PuspA_phaC, pCL-PuspA_Cac_phaA(L378I)-PuspA_phaB-PuspA_phaC) were introduced into E. coli strain LS5218 by TSS method, and colonies were selected on LB medium containing 75 mg / L of spectinomycin antibiotic (Proc Natl Acad Sci US A. 1989 Apr; 86(7): 2172-5).

[0253] In addition, the vector produced in the above Example 4-1 7 types (pCL-PuspA_Ppu_phaA(wt)-PuspA_phaB-PuspA_phaC, pCL-PuspA_Ala_phaA(wt)-PuspA_ph aB-PuspA_phaC,pCL-PuspA_Avi_phaA(wt)-PuspA_phaB-PuspA_phaC,pCL-PuspA_Abe_phaA(w t)-PuspA_phaB-PuspA_phaC,pCL-PuspA_P_phaA(wt)-PuspA_phaB-PuspA_phaC,pCL-PuspA_B ba_phaA(wt)-PuspA_phaB-PuspA_phaC,pCL-PuspA_Cac_phaA(wt)-PuspA_phaB-PuspA_phaC) E. coli After introduction into the LS5218 strain using the TSS method, a control strain was created by selecting colonies on LB medium containing 75 mg / L of spectinomycin antibiotic (Proc Natl Acad Sci US A. 1989 Apr; 86(7): 2172-5).

[0254] To determine whether the P(3HB) production ability of the selected mutant expression strain increased compared to the control strain containing the wild-type phaA, the selected strain was inoculated into a 250-ml corner-baffle flask containing 25 mL of P(3HB) production medium containing 5% glucose, and then cultured with shaking at 230 rpm for 5 hours at 37°C and 43 hours at 35°C. The P(3HB) concentration was then analyzed by Gas Chromatograph (GC), and the analyzed P(3HB) concentrations are shown in Table 8 below.

[0255]

[0256] 균주P(3HB) concentration (mg)수을(%)pCL-PuspA_Ppu_phaA(wt)-PuspA_phaB-PuspA_phaC10.120.3pCL-PuspA_Ppu_phaA(V87T)-PuspA_phaB-PuspA_phaC10.721.4pCL-P uspA_Ppu_phaA(I351V)-PuspA_phaB-PuspA_phaC11.022.0pCL-PuspA_Ppu_phaA(L378I)-PuspA_phaB-PuspA_phaC11.122.3pCL-PuspA_Ala_pCL haA(wt)-PuspA_phaB-PuspA_phaC9.919.8pCL-PuspA_Ala_phaA(V87T)-PuspA_phaB-PuspA_phaC10.621.2pCL-PuspA_Ala_phaA(I351V)-PuspA_phaB-PuspA_phaC10.921.8pCL-PuspA_Ala_phaA(L378I)-PuspA_phaB-PuspA_phaC10.521.0pCL-PuspA_Avi_phaA(wt)-PuspA_phaB-PuspA_p haC6.212.4pCL-PuspA_Avi_phaA(V88T)-PuspA_phaB-PuspA_phaC7.214.4pCL-PuspA_Avi_phaA(I352V)-PuspA_phaB-PuspA_phaC7.515.1pCL -PuspA_Avi_phaA(L379I)-PuspA_phaB-PuspA_phaC7.414.8pCL-PuspA_Abe_phaA(wt)-PuspA_phaB-PuspA_phaC7.114.2pCL-PuspA_Abe_phaA(wt) V87T)-PuspA_phaB-PuspA_phaC7.515.0pCL-PuspA_Abe_phaA(I351V)-PuspA_phaB-PuspA_phaC7.815.6pCL-PuspA_Abe_phaA(L378I)-PuspA_phaB phaB-PuspA_phaC8.116.2pCL-PuspA_P_phaA(wt)-PuspA_phaB-PuspA_phaC6.713.4pCL-PuspA_P_phaA(V87T)-PuspA_phaB-PuspA_phaC6.913.8pCL-PuspA_P_phaA(I351V)-PuspA_phaB-PuspA_phaC7.314.6pCL-PuspA_P_phaA(L378I)-PuspA_phaB-PuspA_phaC7.114.2pCL-PuspA_Bba_phaA(wt)-Pusp A_phaB-PuspA_phaC4.89.6pCL-PuspA_Bba_phaA(V87T)-PuspA_phaB-PuspA_phaC5.511.0pCL-PuspA_Bba_phaA(I351V)-PuspA_phaB-PuspA_phaC5.611.2pC L-PuspA_Bba_phaA(L378I)-PuspA_phaB-PuspA_phaC5.410.8pCL-PuspA_Cac_phaA(wt)-PuspA_phaB-PuspA_phaC5.110.1pCL-PuspA_Cac_phaA(M88T)-Pusp A_phaB-PuspA_phaC5.911.7pCL-PuspA_Cac_phaA(I351V)-PuspA_phaB-PuspA_phaC5.911.8pCL-PuspA_Cac_phaA(L378I)-PuspA_phaB-PuspA_phaC5.611.2.

[0257] As shown in Table 8 above, when strains expressing acetyl-CoA acetyltransferase mutants derived from seven types of microorganisms were cultured, it was confirmed that the yield of P(3HB) increased in all strains compared to each control strain.

[0258] This suggests that when the amino acids at positions corresponding to the 87th, 351st, and 378th amino acids of acetyl-CoA acetyltransferase from Cupriavidus necator are substituted with threonine, valine, and isoleucine, respectively, in phaA from other alien species, the activity of the enzyme expressed by phaA is enhanced, thereby increasing P(3HB) production ability.

[0259]

[0260] Example 5. Production of a strain expressing an acetyl-CoA acetyltransferase mutant and confirmation of P(3HB-co-4HB) production ability.

[0261]

[0262] Example 5-1. Vector production

[0263]

[0264] The pSKH vector (KR 10-2006-0137650 A) was used to construct a vector capable of inserting the sequences phaA(V87T), phaA(I351V), and phaA(L378I), which encode three acetyl-CoA acetyltransferase mutants (V87T, I351V, and L378I) derived from Cupriavidus necator, into the genome, respectively. Specifically, PCR was performed using the pCL-PuspA_phaA(V87T)-PuspA_phaB-PuspA_phaC, pCL-PuspA_phaA(I351V)-PuspA_phaB-PuspA_phaC, and pCL-PuspA_phaA(L378I)-PuspA_phaB-PuspA_phaC constructed in the above Example 1-2 as templates and SEQ ID NOs: 50 and 51. In order to include a site having the same sequence as the position to be inserted, PCR was performed using SEQ ID NOs: 52, 53 and 54, 55 based on E. coli genomic DNA. The primer sequence information used for PCR is shown in Table 9.

[0265]

[0266] Primer base sequences SEQ ID NO: 505'-CTCACGATGCTCGCGTATTGAgatatcAACCACTATCAATATATTCATG SEQ ID NO: 515'-CGAAAGTTTGAGGCGTAAAAAGCGATATCTTTGCCTGGCGGCAGTAG SEQ ID NO: 525'-CCGGGCTGCAGGAATTCGATACGAAACACGCGTTCATTGA SEQ ID NO: 535'-CATGAATATATTGATAGTGGTTgatatcTCAATACGCGAGCATCGTGAG SEQ ID NO: 545'-CTACTGCCGCCAGGCAAAGATATCGCTTTTTACGCCTCAAACTTTCG SEQ ID NO: 555'- GCTAGGTCGACTAGCGTGATGCACACGCCGATGCTTTTGA

[0267] The PCR conditions were denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 1 minute, repeated 30 times. The PCR product was purified by eluting the band after electrophoresis on a 1.0% agarose gel, and the pSKH vector was treated with EcoRV restriction enzyme. The restriction enzyme-treated pSKH vector and the insert DNA fragment amplified through the PCR were ligated using an Infusion Cloning Kit, and then transformed into E. coli. Colonies were selected on LB medium containing 50 mg / L of Kanamycin antibiotic. The three vectors obtained as a result of the cloning were named pSKH-PuspA-phaA(V87T), pSKH-PuspA-phaA(I351V), and pSKH-PuspA-phaA(L378I), respectively.

[0268]

[0269] Example 5-2. Production of a strain expressing an acetyl-CoA acetyltransferase mutant and confirmation of P(3HB-co-4HB) production ability.

[0270]

[0271] Based on the P(3HB-co-4HB) producing strain, we attempted to confirm the change in the production ratio of 3HB and 4HB due to the increase in 3HB production capacity following the introduction of the mutant phaA gene. To this end, the previously constructed P(3HB-co-4HB) producing strain (Strain 13) was transformed with pSKH-PuspA-phaA(V87T), pSKH-PuspA-phaA(I351V), and pSKH-PuspA-phaA(L378I) constructed in Example 5-1 using the electric pulse method (US 10323261 B1). The constructed strains were named CB02-6922, CB02-6923, and CB02-6924, respectively.

[0272] Next, the production ability of P(3HB-co-4HB) of the P(3HB-co-4HB) producing strains CB02-6922, CB02-6923, and CB02-6924, in which the mutant phaA genes phaA(V87T), phaA(I351V), and phaA(L378I) were introduced into the genome, respectively, was tested. As a control, the parent strain, Strain 13, which was previously produced as a P(3HB-co-4HB) producing strain, was used, and the concentration of P(3HB-co-4HB) and 3HB content analyzed through Gas Chromatograph (GC) are shown in Table 10 below.

[0273]

[0274] Strain P(3HB-co-4HB) Concentration (mg)3HB Content (%)Yield (%)Strain 1312.982.125.8CB02-692214.183.428.2CB02-692314.985.329.8CB02-692414.384.728.6

[0275] In the case of CB02-6922, CB02-6923, and CB02-6924 strains introducing acetyl-CoA acetyltransferase mutants, the 3HB content increased by 1.3%, 3.2%, and 2.6%, respectively, compared to the parent strain, as the amount of 3HB produced increased due to the strengthening of the 3HB biosynthetic pathway. In addition, it was confirmed that the P(3HB-co-4HB) yield increased by 2.4%, 4.0%, and 2.8%, respectively, compared to the parent strain, as the activity of acetyl-CoA acetyltransferase was strengthened.

[0276]

[0277] Example 6: Production of a strain expressing an acetyl-CoA acetyltransferase mutant with a different amino acid substituted at the same mutation position and confirmation of P(3HB) production ability.

[0278]

[0279] Example 6-1. Construction of a vector containing DNA encoding acetyl-CoA acetyltransferase with a different amino acid substituted at the same mutation position.

[0280]

[0281] In the above examples, it was confirmed that the positions corresponding to the 87th, 351st, and 378th positions of acetyl-CoA acetyltransferase are important positions for polyhydroxyalkanoate (PHA) production. Therefore, a mutant strain was created based on the E. coli LS5218 strain to express a mutant protein in which the amino acids corresponding to the 87th, 351st, and 378th positions of acetyl-CoA acetyltransferase were substituted with other amino acids, and it was attempted to confirm whether the P(3HB) production ability increased.

[0282] To this end, vectors were constructed that each included a mutation in which the 87th amino acid in the acetyl-CoA acetyltransferase protein was substituted with an amino acid other than valine or threonine, a mutation in which the 351st amino acid was substituted with an amino acid other than isoleucine or valine, and a mutation in which the 378th amino acid was substituted with an amino acid other than leucine or isoleucine. Specifically, for the introduction of the coding sequence of Cupriavidus necator-derived phaA encoding the acetyl-CoA acetyltransferase V87A mutant and the phaB, phaC sequences, SEQ ID NOs: 3, 4 and 56, 57, for the introduction of the V87I mutant coding sequence, SEQ ID NOs: 3, 4 and 58, 59, for the introduction of the V87L mutant coding sequence, SEQ ID NOs: 3, 4 and 60, 61, for the introduction of the I351A mutant coding sequence, SEQ ID NOs: 3, 4 and 62, 63, for the introduction of the I351D mutant coding sequence, SEQ ID NOs: 3, 4 and 64, 65, for the introduction of the I351K mutant coding sequence, SEQ ID NOs: 3, 4 and 66, 67, for the introduction of the I351L mutant coding sequence, SEQ ID NOs: 3, 4 and 68, 69, PCR was performed using SEQ ID NOs: 3, 4 and 70, 71 for introducing the I351T mutant coding sequence, SEQ ID NOs: 3, 4 and 72, 73 for introducing the L378A mutant coding sequence, SEQ ID NOs: 3, 4 and 74, 75 for introducing the L378V mutant coding sequence, and SEQ ID NOs: 3, 4 and 76, 77 for introducing the L378T mutant coding sequence. The primer sequence information used for vector construction is shown in Table 11.

[0283]

[0284] Primer base sequences SEQ ID NO: 565'-TGACCATCAACAAGgcgTGCGGCTCGGGCCTGG SEQ ID NO: 575'-AGGCCCGAGCCGCAcgcCTTGTTGATGGTCATGG SEQ ID NO: 585'-TGACCATCAACAAGataTGCGGCTCGGGCCTGG SEQ ID NO: 595'-AGGCCCGAGCCGCAtatCTTGTTGATGGTCATGG SEQ ID NO: 605'-TGACCATCAACAAGttgTGCGGCTCGGGCCTGG SEQ ID NO: 615'-AGGCCCGAGCCGCAcaaCTTGTTGATGGTCATGG SEQ ID NO: 625'-CCACCCGgcgGGCGCGTCGGGCTG SEQ ID NO: 635'-CGCGCCcgcCGGGTGGCCGATGGC SEQ ID NO: 645'-CCACCCGgatGGCGCGTCGGGCTG SEQ ID NO: 655'-CGCGCCatcCGGGTGGCCGATGGCSEQ ID NO: 665'-CCACCCGaaaGGCGCGTCGGGCTGSEQ ID NO: 675'-CGCGCCtttCGGGTGGCCGATGGCSEQ ID NO: 685'-CCACCCGctgGGCGCGTCGGGCTGSEQ ID NO: 695'-CGCGCCcagCGGGTGGCCGATGGCSEQ ID NO: 705'-CCACCCGacgGGCGCGTCGGGCTGSEQ ID NO: 715'-CGCGCCcgtCGGGTGGCCGATGGCSEQ ID NO: 725'-AGAAGGGCCTGGCCTCGgcgTGCATCGGCGGCGGCSEQ ID NO: 735'-ATGCCGCCGCCGATGCAcgcCGAGGCCAGGCCCSEQ ID NO: 745'-AGAAGGGCCTGGCCTCGgtgTGCATCGGCGGCGGCSEQ ID NO: 755'-ATGCCGCCGCCGATGCAcacCGAGGCCAGGCCCSEQ ID NO: 765'-AGAAGGGCCTGGCCTCGacgTGCATCGGCGGCGGCSEQ ID NO: 775'-ATGCCGCCGCCGATGCAcgtCGAGGCCAGGCCC

[0285] Cloning was performed in the same manner as in Example 1, and as a result, 11 vectors were obtained, each including a mutation in which the 87th amino acid of the acetyl-CoA acetyltransferase protein was substituted with alanine, isoleucine, or leucine, a mutation in which the 351st amino acid was substituted with alanine, aspartic acid, lysine, leucine, or threonine, and a phaA mutation in which the 378th amino acid was substituted with alanine, valine, or threonine. The 11 obtained vectors are EachpCL-PuspA_phaA(V87A)-PuspA_phaB-PuspA_phaC,pCL-PuspA_phaA(V87I)-PuspA_phaB-PuspA_phaC,pCL-PuspA_phaA(V87L)- PuspA_phaB-PuspA_phaC,pCL-PuspA_phaA(I351A)-PuspA_phaB-PuspA_phaC,pCL-PuspA_phaA(I351D)-PuspA_phaB-PuspA_phaC, pCL-PuspA_phaA(I351K)-PuspA_phaB-PuspA_phaC,pCL-PuspA_phaA(I351L)-PuspA_phaB-PuspA_phaC,pCL-PuspA_phaA(I351T)- PuspA_phaB-PuspA_phaC,pCL-PuspA_phaA(L378A)-PuspA_phaB-PuspA_phaC,pCL-PuspA_phaA(L378V)-PuspA_phaB-PuspA_phaC, It was named pCL-PuspA_phaA(L378T)-PuspA_phaB-PuspA_phaC.In addition, for the three vectors selected in Example 2, pCL-PuspA_phaA(mt)-PuspA_phaB-PuspA_phaC-1517, pCL-PuspA_phaA(mt)-PuspA_phaB-PuspA_phaC-2618, and pCL-PuspA_phaA(mt)-PuspA_phaB-PuspA_phaC-2812, the vector names were changed to pCL-PuspA_phaA(V87T)-PuspA_phaB-PuspA_phaC, pCL-PuspA_phaA(I351V)-PuspA_phaB-PuspA_phaC, and pCL-PuspA_phaA(L378I)-PuspA_phaB-PuspA_phaC based on the confirmed phaA mutation sequence.

[0286]

[0287] Example 6-2. Production of a strain expressing an acetyl-CoA acetyltransferase mutant with a different amino acid substituted at the same mutation position and confirmation of P(3HB) production ability.

[0288]

[0289] The P(3HB) production ability of the expression strains of mutants in which the 87th amino acid of the acetyl-CoA acetyltransferase protein was substituted with an amino acid other than valine or threonine, a mutant in which the 351st amino acid was substituted with an amino acid other than isoleucine or valine, and a mutant in which the 378th amino acid was substituted with an amino acid other than leucine or isoleucine was investigated. The 11 vectors constructed in Example 6-1 were introduced into the E. coli LS5218 strain by the TSS method, and colonies were selected by spreading on LB medium containing 75 mg / L of spectinomycin antibiotic (Proc Natl Acad Sci US A. 1989 Apr; 86(7): 2172-5).

[0290] To determine whether the P(3HB) production ability of the selected strain increased compared to the control strain, E. coli / pCL-PuspA_phaA(WT)-PuspA_phaB-PuspA_phaC, the selected strain was inoculated into a 250-ml corner-baffle flask containing 25 mL of P(3HB) production medium containing 5% glucose, and then cultured with shaking at 230 rpm for 5 hours at 37°C and 43 hours at 35°C. The P(3HB) concentration was then analyzed by Gas Chromatograph (GC), and the analyzed P(3HB) concentrations are shown in Table 12 below.

[0291]

[0292] Strain P(3HB) Concentration (mg) Yield (%) E. coli / pCL-PuspA_phaA(WT)-PuspA_phaB-PuspA_phaC11.222.37% E. coli / pCL-PuspA_phaA(V87A)-PuspA_phaB-PuspA_phaC11.222.48% E. coli / pCL-PuspA_phaA(V87I)-PuspA_phaB-PuspA_phaC11.222.47% E. coli / pCL-PuspA_phaA(V87L)-PuspA_phaB-PuspA_phaC11.122.27% E. coli / pCL-PuspA_phaA(V87T)-PuspA_phaB-PuspA_phaC11.7823.54% E. coli / pCL-PuspA_phaA(I351A)-PuspA_phaB-PuspA_phaC10.721.45%E. coli / pCL-PuspA_phaA(I351D)-PuspA_phaB-PuspA_phaC5.611.27%E. coli / pCL-PuspA_phaA(I351K)-PuspA_phaB-PuspA_phaC6.913.94%E. coli / pCL-PuspA_phaA(I351V)-PuspA_phaB-PuspA_phaC13.025.91%E. coli / pCL-PuspA_phaA(I351L)-PuspA_phaB-PuspA_phaC13.426.75%E. coli / pCL-PuspA_phaA(I351T)-PuspA_phaB-PuspA_phaC11.022.13%E. coli / pCL-PuspA_phaA(L378A)-PuspA_phaB-PuspA_phaC12.524.98%E. coli / pCL-PuspA_phaA(L378V)-PuspA_phaB-PuspA_phaC14.027.99%E. coli / pCL-PuspA_phaA(L378I)-PuspA_phaB-PuspA_phaC11.923.88%E. coli / pCL-PuspA_phaA(L378T)-PuspA_phaB-PuspA_phaC11.823.52%

[0293] As a result, it was confirmed that the P(3HB) production ability increased not only in the mutant in which the 87th amino acid of acetyl-CoA acetyltransferase was substituted from valine to threonine, the 351st amino acid was substituted from isoleucine to valine, and the 378th amino acid was substituted from leucine to isoleucine, as confirmed in Example 3 above, but also in the selected strain in which the mutant in which the 351st amino acid was substituted from isoleucine to leucine, and the 378th amino acid was substituted from leucine to alanine, valine, or threonine was introduced.

[0294] In addition, it was confirmed that the selected strains in which the 87th amino acid was substituted from valine to alanine, isoleucine, or leucine, and the 351st amino acid was substituted from isoleucine to alanine or threonine had a similar level of P(3HB) production ability compared to the wild-type phaA-expressing strain.

[0295] On the other hand, when the 351st isoleucine of acetyl-CoA acetyltransferase was substituted with aspartic acid or lysine, respectively, it was confirmed that the P(3HB) production ability decreased compared to the wild-type phaA expression strain.

[0296] This suggests that amino acid substitutions at positions corresponding to amino acids 87, 351, and 378 of acetyl-CoA acetyltransferase affect whether P(3HB) production increases.

[0297]

[0298] From the above description, those skilled in the art will understand that the present application can be implemented in other specific forms without altering its technical concept or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of this application should be interpreted to include all changes or modifications derived from the meaning and scope of the following claims and their equivalents, rather than the detailed description above.

Claims

1. A protein having acetyl-CoA acetyltransferase activity, wherein the amino acid corresponding to the 87th, 351st, or 378th position of the amino acid sequence of SEQ ID NO: 1 is replaced with another amino acid in the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having a sequence identity of 45% or more with the amino acid sequence of SEQ ID NO:

1.

2. In the first paragraph, the protein has an amino acid sequence of sequence number 1. i) the amino acid corresponding to position 87 is replaced with threonine, or ii) the amino acid corresponding to position 351 is replaced with valine or leucine, or iii) A protein in which the amino acid corresponding to position 378 is substituted with isoleucine, alanine, valine, or threonine.

3. In the first paragraph, the protein is substituted with another amino acid corresponding to the 87th, 351st or 378th position of the amino acid sequence of any one of SEQ ID NOs: 78, 79, 81, 82 and 83, The amino acid corresponding to the 88th, 352nd or 379th position of the amino acid sequence of SEQ ID NO: 80 is replaced with another amino acid, or A protein in which the amino acid corresponding to the 88th, 351st, or 378th position of the amino acid sequence of SEQ ID NO: 84 is replaced with another amino acid.

4. In the third paragraph, the protein has an amino acid sequence of any one of SEQ ID NOs: 78, 79, 81, 82 and 83. i) the amino acid corresponding to position 87 is replaced with threonine, or ii) the amino acid corresponding to position 351 is replaced with valine or leucine, or iii) A protein in which the amino acid corresponding to position 378 is substituted with isoleucine, alanine, valine, or threonine.

5. In the third paragraph, the protein has an amino acid sequence of SEQ ID NO:

80. i) the amino acid corresponding to position 88 is replaced with threonine, or ii) the amino acid corresponding to position 352 is replaced with valine or leucine, or iii) A protein in which the amino acid corresponding to position 379 is substituted with isoleucine, alanine, valine, or threonine.

6. In the third paragraph, the protein has an amino acid sequence of SEQ ID NO:

84. i) the amino acid corresponding to position 88 is replaced with threonine, or ii) the amino acid corresponding to position 351 is replaced with valine or leucine, or iii) A protein in which the amino acid corresponding to position 378 is substituted with isoleucine, alanine, valine, or threonine.

7. A protein according to claim 1, wherein the protein comprises an amino acid sequence of any one of SEQ ID NO: 5 to SEQ ID NO: 7 and SEQ ID NO: 85 to SEQ ID NO:

105.

8. A polynucleotide encoding a protein of any one of claims 1 to 7.

9. A microorganism comprising a protein according to any one of claims 1 to 7, a polynucleotide encoding the protein, or a vector comprising the polynucleotide.

10. In the 9th paragraph, the microorganism has an increased polyhydroxyalkanoate (PHA) production ability compared to a non-modified microorganism.

11. A microorganism according to claim 9, wherein the microorganism is a microorganism of the genus Escherichia.

12. A microorganism according to claim 11, wherein the Escherichia genus microorganism is Escherichia coli.

13. A method for producing polyhydroxyalkanoate (PHA), comprising a step of culturing the microorganism of clause 9 in a medium.

14. A method according to claim 13, further comprising a step of recovering polyhydroxyalkanoate (PHA) from the cultured microorganism, a culture of the microorganism, a fermented product of the microorganism, or the culture medium.

Citation Information

Patent Citations

  • Acetyl-coenzyme A acetyltransferase mutant and application thereof

    CN115612679A

  • Polyhydroxyalkanoate copolymer compositions and methods of making the same

    US20180057848A1

  • Methods and cells for production of volatile compounds

    US20240026391A1