MNK inhibitors for treating rheumatoid arthritis

MNK inhibitors like eFT508 and BAY 1143269 address the dual challenge of inflammation and pain in rheumatoid arthritis by inhibiting MNK activity, providing a more effective and convenient treatment.

WO2026015691A1PCT designated stage Publication Date: 2026-01-154E THERAPEUTICS INC

Patent Information

Application Number
PCT/US2025/037076
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-10-25
Filing Date
2025-07-10
Publication Date
2026-01-15

AI Technical Summary

Technical Problem

Current treatments for rheumatoid arthritis often fail to effectively address both inflammation and pain simultaneously, leading to complex dosing schedules and administration procedures.

Method used

Administering MNK inhibitors to target both inflammation and pain associated with rheumatoid arthritis, utilizing compounds such as eFT508, BAY 1143269, and ETC-1907206 to inhibit MNK activity, thereby reducing cytokine production and alleviating symptoms.

Benefits of technology

MNK inhibitors provide a simpler and more effective treatment approach by reducing inflammation and pain in rheumatoid arthritis, offering a more convenient dosing regimen.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000012_0001
    Figure IMGF000012_0001
  • Figure IMGF000013_0001
    Figure IMGF000013_0001
  • Figure IMGF000013_0002
    Figure IMGF000013_0002
Patent Text Reader

Abstract

The present disclosure provides methods of treating rheumatoid arthritis comprising administering a MNK inhibitor.
Need to check novelty before this filing date? Find Prior Art

Description

Docket No.: 408994-412WO (219666) MNK INHIBITORS FOR TREATING RHEUMATOID ARTHRITIS CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of and priority to United States Provisional Patent Application serial number 63 / 669,549, filed July 10, 2024, and United States Provisional Patent Application serial number 63 / 711,884 filed October 25, 2024, the contents of each of which are hereby incorporated by reference in their entirety. REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] This application contains a Sequence Listing which has been submitted electronically via Patent Center in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on July 7, 2025, is named 219666_seqlist.xml and is 11,430 bytes in size. BACKGROUND

[0003] A breakdown of T-cell and / or B-cell tolerance starts the complex process of RA. This leads to activation and subsequent production of a range of antibodies that recognize self-proteins including disease-specific IgG autoantibodies directed towards modified IgG (rheumatoid factors), citrullinated or carbamylated proteins and collagen type II. Circulating autoantibodies activate the innate and adaptive immune system with the production of a range of inflammatory factors, including cytokines. Cytokines can be classified as circulating pro-inflammatory cytokines and / or inflammatory cytokines in the joints, but anti-inflammatory cytokines and natural cytokine antagonists are also involved.

[0004] RA involves increased levels of cytokines of different classes, with dynamic alterations through the disease process, whereby different combinations of cytokines display a hierarchical dominance. Examples of cytokines with altered systemic levels that have been associated with RA include pro-inflammatory cytokines interleukin (IL)-1, IL-32, IL-33, IL-36, tumor necrosis factor (TNF)-alpha, as well as an increase in joints of IL-1, TNF-alpha, IL-6, IL-15, IL-16, IL-17, IL-18, granulocyte macrophage-colony stimulating factor (GM-CSF) and various types of interferons (IFN). Some anti-inflammatory cytokines associated with RA include IL-10, IL-4, IL13, IL-20, IL-27, IL-35, IL-37, IL-38, as well as natural cytokine antagonists to the IL-1 receptor, soluble forms of IL-1 and TNF receptors, IL-18 binding protein and more (Alunno, F. Page 1 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) Carubbi, R. Giacomelli, R. Gerli, Cytokines in the pathogenesis of rheumatoid arthritis: new players and therapeutic targets. BMC Rheumatology 1, 3 (2017); N. Selim, B. Ahmet Merih, in New Developments in the Pathogenesis of Rheumatoid Arthritis, I. S. Lazaros, Ed. (IntechOpen, Rijeka, 2017), pp. Ch. 3; L. A. Ridgley, A. E. Anderson, A. G. Pratt, What are the dominant cytokines in early rheumatoid arthritis? Current Opinion in Rheumatology 30, (2018)). SUMMARY

[0005] In some embodiments, the present disclosure provides methods of treating rheumatoid arthritis, comprising administering a MNK inhibitor to a subject in need thereof. In some embodiments, provided methods reduce inflammation associated with rheumatoid arthritis. In some embodiments, provided methods reduce pain associated with rheumatoid arthritis.

[0006] In some embodiments, the present disclosure encompasses the recognition that MNK inhibitors may be uniquely suited to treat both inflammation and pain associated with rheumatoid arthritis. Therapies that treat both pain and the underlying inflammation (e.g., disease-modifying treatments) are desirable, as they could provide patients with simpler and more convenient dosing schedules and administration procedures. BRIEF DESCRIPTION OF THE DRAWINGS

[0007] FIG. 1 is a graph showing arthritis score in C57BL / 6N mice with cartilage autoantibody-induced arthritis and treated with vehicle (RA) or eFT508, as indicated.

[0008] FIG.2 is a graph showing withdrawal threshold to von Frey filaments in C57BL / 6N mice with cartilage autoantibody-induced arthritis and treated with vehicle (RA) or eFT508, as indicated.

[0009] FIG. 3 is a graph showing nocifensive responses to pricking pain (a 2.0 g von Frey filament) applied to both hind paws in C57BL / 6N mice with cartilage autoantibody-induced arthritis and treated with vehicle (RA) or eFT508, as indicated.

[0010] FIG.4 is a graph showing joint pain measured as shaking numbers in squeeze test in C57BL / 6N mice with cartilage autoantibody-induced arthritis and treated with vehicle (RA) or eFT508 (RA+eFT508) 19 days after antibody injection and 6 days after last administration of eFT508 that was dosed once daily for 5 days (10 mg / kg). Page 2 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666)

[0011] FIG.5 is a graph showing arthritis score in BALB / C mice with cartilage autoantibody- induced arthritis and treated with vehicle (RA) or eFT508, as indicated.

[0012] FIG. 6 is a graph showing joint pain responses measured as shaking numbers in a squeeze test 1 hour after the tenth injection of eFT508 (RA+eFT508) or vehicle (RA) in BALB / C mice with cartilage autoantibody-induced arthritis.

[0013] FIG. 7A is a schematic illustration of the cartilage autoantibody-induced arthritis a (Cab) mouse model.

[0014] FIG.7B is a graph showing transient joint inflammation (clinical score) from day 6 to day 23 after Cab injection in C57BL / 6 N mice.

[0015] FIG.7C is a graph showing mechanical allodynia in C57BL / 6 N mice from as early as 4 hours and lasting until day 63 after Cab injection (n=6).

[0016] FIG. 8 is a graph showing the arthritis score in C57BL / 6N mice with cartilage autoantibody-induced arthritis and treated with vehicle (VEH) or TYK2 inhibitor twice daily (15 mg / kg) for 9 days starting day 13.

[0017] FIG.9A is a graph showing withdrawal threshold to von Frey filaments to 2g von Frey pricking pain in C57BL / 6N mice with cartilage autoantibody-induced arthritis and treated with vehicle (Veh) or TYK2 inhibitor (inhibitor), as in Fig. 8. BL, basal level of behavioral response prior to inducing arthritis. n.s., non-significant in inhibitor treated animals as compared to basal level of behavioral response.

[0018] FIG.9B is a graph showing nocifensive responses (Shaking numbers) to 2g von Frey pricking pain in C57BL / 6N mice with cartilage autoantibody-induced arthritis and treated with vehicle (Veh) or TYK2 inhibitor (inhibitor), as in Fig. 8. BL, basal level of behavioral response prior to inducing arthritis. n.s., non-significant in inhibitor treated animals as compared to basal level of behavioral response.

[0019] FIG.10 is a graph showing joint pain measured as shaking numbers in squeeze test in C57BL / 6N mice in the chronic phase with cartilage autoantibody-induced arthritis and treated with TYK2 inhibitor (inhibitor) 5 days after first administration of that was dosed twice daily (15 mg / kg). Pre: sensitivity in the arthritis mice prior to administering TYK2 inhibitors.

[0020] FIG. 11 is a panel of joint histology results from a control group, RA mice, and RA mice treated with eFT508 (from left to right). Page 3 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666)

[0021] FIG.12 shows phospho-eIF4E (S209) expression in human dorsal root ganglion (DRG) cells from healthy donors (control) and patients with RA pain. Left panel shows p-eIF4E staining (red) in human DRGs, with arrowheads indicating different signal intensities of p-eIF4E between the two groups. Right panel shows the averaged signal intensity of p-eIF4E staining of individual neurons from control donors and patients with RA pain.

[0022] FIG. 13A is a graph showing arthritic score in control BALB / c mice, BALB / c mice with cartilage autoantibody-induced arthritis treated with vehicle (RA), or BALB / c mice with arthritis treated continuously with IFNAR1 mAB.

[0023] FIG.13B is a graph showing withdrawal threshold to von Frey filaments up to 2g von Frey pricking pain of control BALB / c mice, BALB / c mice with cartilage autoantibody-induced arthritis treated with vehicle (RA), or BALB / c mice with arthritis treated continuously with IFNAR1 mAB.

[0024] FIG.13C is a graph showing nocifensive responses (shaking numbers) to 2g von Frey pricking pain of control BALB / c mice, BALB / c mice with cartilage autoantibody-induced arthritis treated with vehicle (RA), or BALB / c mice with arthritis treated continuously with IFNAR1 mAB.

[0025] FIG. 13D is a graph showing the number of rotations in a sunflower seed assay of control BALB / c mice, BALB / c mice with cartilage autoantibody-induced arthritis treated with vehicle (RA), or BALB / c mice with arthritis treated continuously with IFNAR1 mAB.

[0026] FIG.14A is a graph showing mechanical allodynia in male and female C57BL / 6N mice with cartilage autoantibody-induced arthritis.

[0027] FIG.14B is a graph showing nocifensive responses (shaking numbers) to 2g von Frey pricking pain of male and female C57BL / 6N mice with cartilage autoantibody-induced arthritis.

[0028] FIG.14C is a graph showing joint pain measured as shaking numbers in a squeeze test of male and female C57BL / 6N mice with cartilage autoantibody-induced arthritis.

[0029] FIG. 14D is a graph showing the product of hanging time and body weight in an inverted screen test of male and female C57BL / 6N mice with cartilage autoantibody-induced arthritis.

[0030] FIG.14E is a graph showing number of rotations in a sunflower seed assay of male and female C57BL / 6N mice with cartilage autoantibody-induced arthritis. Page 4 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666)

[0031] FIG.15A is a graph showing joint pain measured as shaking numbers in a squeeze test of male and female C57BL / 6N mice with cartilage autoantibody-induced arthritis treated with deucravacitinib.

[0032] FIG.15B is a graph showing number of rotations in a sunflower seed assay of male and female C57BL / 6N mice with cartilage autoantibody-induced arthritis treated with deucravacitinib.

[0033] FIG.15C is a graph showing hanging time in an inverted screen test of male and female C57BL / 6N mice with cartilage autoantibody-induced arthritis treated with deucravacitinib.

[0034] FIG.16A is a graph showing joint pain measured as shaking numbers in a squeeze test of male and female C57BL / 6N mice with cartilage autoantibody-induced arthritis treated with eFT508.

[0035] FIG.16B is a graph showing withdrawal threshold to von Frey filaments up to 2g von Frey pricking pain of male and female C57BL / 6N mice with cartilage autoantibody-induced arthritis treated with eFT508.

[0036] FIG.16C is a graph showing nocifensive responses (shaking numbers) to 2g von Frey pricking pain in male and female C57BL / 6N mice with cartilage autoantibody-induced arthritis treated with eFT508.

[0037] FIG.17A is a graph showing mRNA fold change of Il1b in DRG cells of C57BL / 6N mice with cartilage autoantibody-induced arthritis at various timepoints, and in control C57BL / 6N mice.

[0038] FIG. 17B is a graph showing mRNA fold change of Il6 in DRG cells of C57BL / 6N mice with cartilage autoantibody-induced arthritis at various timepoints, and in control C57BL / 6N mice.

[0039] FIG.17C is a graph showing mRNA fold change of Tnfa in DRG cells of C57BL / 6N mice with cartilage autoantibody-induced arthritis at various timepoints, and in control C57BL / 6N mice.

[0040] FIG.18A is a graph showing relative mRNA levels of pan-Ifna in DRG cells of control C57BL / 6N mice, C57BL / 6N mice with cartilage autoantibody-induced arthritis, and C57BL / 6N mice with cartilage autoantibody-induced arthritis treated with IFNAR1 mAb.

[0041] FIG. 18B is a graph showing relative mRNA levels of Ifnb in DRG cells of control C57BL / 6N mice, C57BL / 6N mice with cartilage autoantibody-induced arthritis, and C57BL / 6N mice with cartilage autoantibody-induced arthritis treated with IFNAR1 mAb. Page 5 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666)

[0042] FIG. 18C is a graph showing relative mRNA levels of Il1b in DRG cells of control C57BL / 6N mice, C57BL / 6N mice with cartilage autoantibody-induced arthritis, and C57BL / 6N mice with cartilage autoantibody-induced arthritis treated with IFNAR1 mAb.

[0043] FIG. 18D is a graph showing relative mRNA levels of Il6 in DRG cells of control C57BL / 6N mice, C57BL / 6N mice with cartilage autoantibody-induced arthritis, and C57BL / 6N mice with cartilage autoantibody-induced arthritis treated with IFNAR1 mAb.

[0044] FIG.19A shows the structure of the engineered light-activatable Myc-tagged MNK2 construct.

[0045] FIG.19B is a western blot showing co-transfection and expression of light-activatable Myc-tagged MNK2 construct and FLAG-tagged eIF4E in MNK1 and MNK2 double knockout HEK293 cells in light or dark conditions.

[0046] FIG.19C is a graph showing withdrawal threshold to von Frey filaments up to 2g von Frey pricking pain of adult control mice or adult mice that received an intrathecal injection of AAV-packaged light-activatable Mnk2. The mice were of the C57 / BL6 mouse strain.

[0047] FIG.19D is a graph showing withdrawal threshold to von Frey filaments up to 2g von Frey pricking pain in control mice or mice that received an intraperitoneal injection of AAV- packaged light-activatable Mnk2 at 2 days postnatal.

[0048] FIG.20A is a graph showing the synovial inflammation score of tibiae and hind ankle joints in control BALB / c mice, BALB / c mice with cartilage autoantibody-induced arthritis, and BALB / c mice with cartilage autoantibody-induced arthritis treated continuously with IFNAR1 mAB . Synovial inflammation scoring: 0 = no inflammation, 1 = slight thickening of the synovial cell layer and / or some inflammatory cells in the sublining, 2 = moderate infiltration of the sublining, and 3 = marked-to-severe infiltration.

[0049] FIG.20B is a graph showing the bone erosion score of tibiae and hind ankle joints in control BALB / c mice, BALB / c mice with cartilage autoantibody-induced arthritis, and BALB / c mice with cartilage autoantibody-induced arthritis treated continuously with IFNAR1 mAB. Bone erosion scoring: 0 = normal bone, 1 = small areas of resorption, 2 = more numerous areas of resorption, and 3 = full-thickness resorption areas in the bone.

[0050] FIG. 20C is a graph showing the cartilage destruction score of tibiae and hind ankle joints in control BALB / c mice, BALB / c mice with cartilage autoantibody-induced arthritis, and BALB / c mice with cartilage autoantibody-induced arthritis treated continuously with IFNAR1 Page 6 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) mAB. Cartilage destruction scoring: 0 = normal cartilage, 1 = cartilage surface irregularities, 2 = minor-to-moderate loss of surface cartilage, and 3 = marked cartilage destruction and loss of surface cartilage.

[0051] FIG. 21A shows western blot staining (left panel) and quantification (right panel) of eIF4E and p-eIF4E in DRG cells of control C57BL / 6N mice and C57BL / 6N mice with cartilage autoantibody-induced arthritis.

[0052] FIG. 21B shows western blot staining (left panel) and quantification (right panel) of eIF4E and p-eIF4E in DRG cells of control C57BL / 6N mice, C57BL / 6N mice with cartilage autoantibody-induced arthritis, and C57BL / 6N mice with cartilage autoantibody-induced arthritis treated with IFNAR1 mAb.

[0053] FIG.21C is a graph showing relative mRNA levels of pan-Ifna in DRG cells of control C57BL / 6N mice, C57BL / 6N mice with cartilage autoantibody-induced arthritis, and C57BL / 6N mice with cartilage autoantibody-induced arthritis treated with IFNAR1 mAb.

[0054] FIG. 21D is a graph showing relative mRNA levels of Ifnb in DRG cells of control C57BL / 6N mice, C57BL / 6N mice with cartilage autoantibody-induced arthritis, and C57BL / 6N mice with cartilage autoantibody-induced arthritis treated with IFNAR1 mAb.

[0055] FIG. 21E is a graph showing relative mRNA levels of Il1b in DRG cells of control C57BL / 6N mice, C57BL / 6N mice with cartilage autoantibody-induced arthritis, and C57BL / 6N mice with cartilage autoantibody-induced arthritis treated with IFNAR1 mAb.

[0056] FIG. 21F is a graph showing relative mRNA levels of Il6 in DRG cells of control C57BL / 6N mice, C57BL / 6N mice with cartilage autoantibody-induced arthritis, and C57BL / 6N mice with cartilage autoantibody-induced arthritis treated with IFNAR1 mAb.

[0057] FIG. 22A is a current patch-clamp readout of DRG cells of C57BL / 6N mice treated with recombinant mouse IFN^3 protein and vehicle or recombinant mouse IFN^3 protein and eFT508.

[0058] FIG. 22B a graph showing the number of spikes at each given current in the patch- clamp readout of FIG.22A.

[0059] FIG. 22C a graph showing the minimum current (rheobase) required to produce a voltage spike in the patch-clamp readout of FIG.22A.

[0060] FIG.22D a graph showing delay to first spike at different ramp currents in the patch- clamp readout of FIG.22A. Page 7 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) DETAILED DESCRIPTION Definitions

[0061] As used herein, the term “administering” or “administration” typically refers to administration of a composition to a subject to achieve delivery of an active agent to a site of interest (e.g., a target site which may, in some embodiments, be a site of disease or damage, and / or a site of responsive processes, cells, tissues, etc.). As will be understood by those skilled in the art, reading the present disclosure, in some embodiments, one or more particular routes of administration may be feasible and / or useful in the practice of the present disclosure. For example, in some embodiments, administration may be parenteral. In some embodiments, administration may be oral. In some embodiments, administration may involve only a single dose. In some embodiments, administration may involve application of a fixed number of doses. In some embodiments, administration may involve dosing that is intermittent (e.g., a plurality of doses separated in time) and / or periodic (e.g., individual doses separated by a common period of time) dosing.

[0062] The term “pharmaceutically acceptable salt,” as used herein, refers to a form of a relevant compound as a salt appropriate for use in pharmaceutical contexts, i.e., salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and / or other mammals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, S. M. Berge, et al. describes pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 66:1-19 (1977).

[0063] As used herein, the term “subject” refers to an organism, typically a mammal (e.g., a human). In some embodiments, a subject is suffering from a relevant disease, disorder or condition. In some embodiments, a human subject is an adult, adolescent, or pediatric subject. In some embodiments, a subject is at risk of (e.g., susceptible to), e.g., at elevated risk of relative to an appropriate control individual or population thereof, a disease, disorder, or condition. In some embodiments, a subject displays one or more symptoms or characteristics of a disease, disorder or condition. In some embodiments, a subject does not display any symptom or characteristic of a disease, disorder, or condition. In some embodiments, a subject is someone with one or more Page 8 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) features characteristic of susceptibility to or risk of a disease, disorder, or condition. In some embodiments, a subject is an individual to whom diagnosis and / or therapy and / or prophylaxis is and / or has been administered. The terms “subject” and “patient” are used interchangeably herein.

[0064] As used herein, the term “treat” (also “treatment” or “treating”) refers to any administration of a therapy that partially or completely alleviates, ameliorates, relieves, inhibits, delays onset of, reduces severity of, and / or reduces incidence of one or more symptoms, features, and / or causes of a particular disease, disorder, and / or condition. In some embodiments, such treatment may be of a subject who does not exhibit signs of the relevant disease, disorder and / or condition and / or of a subject who exhibits only early signs of the disease, disorder, and / or condition. Alternatively or additionally, such treatment may be of a subject who exhibits one or more established signs of the relevant disease, disorder, and / or condition. In some embodiments, treatment may be of a subject who has been diagnosed as suffering from the relevant disease, disorder, and / or condition. MNK Inhibitors

[0065] As will be appreciated, in humans MNK1 and MNK2 are encoded by the MKNK1 and MKNK2 genes. These proteins are a member of the serine-threonine kinase family, and MNK activation associates with activation of the IFNAR receptors. Upon receptor binding, TYK2 may phosphorylate the receptor units to activate downstream signalling which leads to activation of MNK kinase.

[0066] Without being bound by theory, MNK inhibitors may work by inhibiting MNK activity on downstream substrates or in any other way to inhibit downstream signalling of type I interferon.

[0067] Those in the art will be aware of MNK inhibitors and / or be capable of identifying such inhibitors.

[0068] Examples of MNK inhibitors include those described in the following documents, all of which inhibitors and related disclosures are hereby incorporated by reference: ^MNK inhibitors as described in WO2019079369, WO2015200481, WO2018152117,WO2017075412, WO2017075394, WO2017087808, WO2020086713, US2019152988, US2019330216, US2017266185, US2018085368, US2018085368, US2018228803, US11083727, US2019275039, US2017266185 (eFFECTOR Therapeutics Inc); Page 9 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) ^MNK inhibitors as described in WO2023278686, WO2023014943, and WO2022006331(4E Therapeutics); ^MNK inhibitors as described in WO2013174744, WO2012163942, WO2014118226,WO2014048894, WO2013174735, WO2015181104, WO2015181063, WO2018134335, WO2017081003, WO2014118229, WO2014118135, WO2014076162, WO2014044691, WO2015104254, WO2015004024, WO2015074986, WO2014128093, WO2014048869, WO2013034570, WO2012156367, WO2016102427, WO2016096721, WO2018134148 (Bayer Schering Pharma AG); ^MNK inhibitors as described in WO2017085483 and WO2017085484 as well asCN108495855, EP3377501 and JP2018534314 (LifeArc); ^MNK inhibitors as described in CN116425750 (Nuowosida Pharmaceutical Co., Ltd);^ MNK inhibitors such as ETC-7114 and ETC-206, the latter also called tinodasertibavailable at MedChem Express, and related compounds as described in WO2013147711, WO2014088519 WO2019013703, WO2015050505 (Agency For Science Technology & Research Bioprocessing Technology Institute); ^MNK inhibitors as described in CN110903286 (Shenyang Pharmaceutical University);^ MNK inhibitors as described in WO2007147874 (Swedish Orphan Biovitrum AB);^ MNK inhibitors as described in WO2007115822, WO2006136402 WO2008006547,WO2007059905 (Evotec (Goettingen) AG); ^MNK inhibitors as described in WO2013087581, WO2013034570, WO2012163942,WO2012175591, WO2013041634, WO2013144189 (Bayer Intellectual Property GmbH); ^MNK inhibitors as described in WO2015169677, WO2015091156, WO2006066937,WO2014206922, WO2011104340, WO2015082324, WO2010023181, WO2011104338, WO2013149909, WO2011104334, WO2006066937, US2015361055 (Boehringer Ingelheim Pharma GmbH & Co KG); ^MNK inhibitor as described in CN103417545 (Taicang Shengzhou Biotechnology Co.,Ltd); ^MNK inhibitors as described in WO2020155842 (Novostar Pharmaceuticals Ltd);^ MNK inhibitors as described in WO2020115072 (Instituto Ramon y Cajal de InvestigacionSanitaria); Page 10 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) ^MNK inhibitors as described in US2018244654, WO2017075367 (NorthwesternUniversity); ^MNK inhibitors as described in WO2020233716, CN111978317, CN111978318 (ShanghaiDaoshang Biology Tech Co., Ltd.); ^MNK inhibitors as described in WO2020108619 (Shanghai De Novo Pharmatech Co Ltd);^ MNK inhibitors as described in WO2017165908 and WO2023093700 (South AustralianHealth and Medical Research Institute and Ocean University of China); ^MNK inhibitors as described in WO2017068064 (Ryvu Therapeutics);^ MNK inhibitors as described in WO2010055072 (Friedrich Miescher Institute forBiomedical Research); ^MNK inhibitors as described in WO2018228275 (Beijing InnoCare Pharma Tech Co Ltd);^ MNK inhibitors as described in WO2021127589 (The Children's Hospital of Philadelphia);^ MNK inhibitors as described in WO2016081589 and WO2021127438 (University ofMaryland); ^MNK inhibitors as described in WO2016128465 (Basilea Pharmaceutica Ltd, Allschwil);^ MNK inhibitors as described in WO2023168381 (University of Maryland);^ MNK inhibitors as described in WO2021005183 (Centro de Investigacion Biomedica enRed and Institut Quimic de Sarria and Vall d'Hebron Institut de Recerca); ^MNK inhibitors as described in US2020197400 (New York University);^ MNK inhibitors as described in WO2022237682 (Jumbo Drug Bank Co Ltd); and^ MNK inhibitors as described in WO2022038563 (Hepagene Therapeutics (HK) Ltd).

[0069] In some embodiments, a MNK inhibitor is a small molecule, or is an antibody or part thereof. In some embodiments, a MNK inhibitor is selected from the group consisting of: eFT508 (also called Tomivosertib); 4ET-03-053; BAY1143269; ETC-1907206 (also called ETC-206 (AUM 001) and tinodasertib), and derivatives of the above compounds.

[0070] The structure of eFT508, described in WO2015200481 and WO2020086713, is: .Page 11 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666)

[0071] The structure of 4ET-03-053, described in WO2023278686, is: .

[0072] Additional MNK i3278686 include: .

[0073] thereof (which are described in WO2023278686): nd

[0074] Further MNK inhibitors include the following compound (4ET-01-21), and derivatives thereof, which are described in WO2022006331: Page 12 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) .

[0075] In some embod-1143269, which is described in WO2013034570, and has the following structure: .

[0076] In some embodimen, -1907206 (also called tinodasertib, AUM001, or ETC206), which is described in WO2013147711, and has the following structure: .

[0077] In some embodiments, a MNK inhibitor is a MNK inhibitor described in Li, Q. et al., Discovery of D25, a Potent and Selective MNK Inhibitor for Sepsis-Associated Acute Spleen Injury, J. Med. Chem. 2024, 67, 4, 3167-89, which is incorporated herein by reference. For example, in some embodiments, a MNK inhibitor is compound D25 from Li et al.: NNHNH .

[0078] In some embodiments,a MNK inhibitor is compound 7g, compound 18, or phorbazole C from Li et al.: Page 13 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) or

[0079] Iatsui, Y., et al., A novel inhibitor stabilizes the inactive conformation of MAPK-interacting kinase 1, Acta Cryst. 2018, F74, 156-60: .MNK Inhibitors of Structure I and Structure II

[0080] In one aspect, a MNK inhibitor is a compound of Structure (I): or a pharmaceutically acceptabof R1a, R1b, and R3are as defined herein.

[0081] In another aspect, a MNK inhibitor is a compound of Structure (II): Page 14 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) or a pharmaceutically acceptabl R1b, R2, X, Y, and L are as definedherein.

[0082] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which this disclosure belongs. As used in the specification and claims, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise.

[0083] The following definitions apply to Structure (I) and Structure (II) and subgenera thereof:

[0084] “Amino” refers to the ˗NH2 radical.

[0085] “Carboxy” or “carboxyl” refers to the ˗CO2H radical.

[0086] “Cyano” refers to the ˗CN radical.

[0087] “Hydroxy” or “hydroxyl” refers to the ˗OH radical.

[0088] “Nitro” refers to the ˗NO2 radical.

[0089] “Oxo” refers to the =O substituent.

[0090] “Thiol” refers to the ˗SH substituent.

[0091] “Thioxo” refers to the =S substituent.

[0092] “Alkyl” refers to a saturated, straight or branched hydrocarbon chain radical consisting solely of carbon and hydrogen atoms, having from one to twelve carbon atoms (C1-C12alkyl), one to eight carbon atoms (C1-C8 alkyl) or one to six carbon atoms (C1-C6 alkyl), or any value within these ranges, such as C4-C6 alkyl and the like, and which is attached to the rest of the molecule by a single bond, e.g., methyl, ethyl, n-propyl, 1-methylethyl (iso-propyl), n-butyl, n-pentyl, 1,1-dimethylethyl (t-butyl), 3-methylhexyl, 2-methylhexyl and the like. The number of carbons referred to relates to the carbon backbone and carbon branching, but does not include carbon atoms belonging to any substituents. Unless stated otherwise specifically in the specification, an alkyl group is optionally substituted. Page 15 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666)

[0093] “Alkenyl” refers to an unsaturated, straight or branched hydrocarbon chain radical consisting solely of carbon and hydrogen atoms, which contains one or more carbon-carbon double bonds, having from two to twelve carbon atoms (C2-C12 alkenyl), two to eight carbon atoms (C2- C8alkenyl) or two to six carbon atoms (C2-C6alkenyl), or any value within these ranges, and which is attached to the rest of the molecule by a single bond, e.g., ethenyl, prop-1-enyl, but-1-enyl, pent-1-enyl, penta-1,4-dienyl, and the like. The number of carbons referred to relates to the carbon backbone and carbon branching, but does not include carbon atoms belonging to any substituents. Unless stated otherwise specifically in the specification, an alkenyl group is optionally substituted.

[0094] The term “alkynyl” refers to unsaturated straight or branched hydrocarbon radical, having 2 to 12 carbon atoms (C2-C12alkynyl), two to nine carbon atoms (C2-C9alkynyl), or two to six carbon atoms (C2-C6alkynyl), or any value within these ranges, and having at least one carbon- carbon triple bond. Examples of alkynyl groups may be selected from the group consisting of ethynyl, propargyl, but-1-ynyl, but-2-ynyl and the like. The number of carbons referred to relates to the carbon backbone and carbon branching, but does not include carbon atoms belonging to any substituents. Unless stated otherwise specifically in the specification, an alkynyl group is optionally substituted.

[0095] “Alkoxy” refers to a radical of the formula ˗ORawhere Rais an alkyl radical as defined above containing one to twelve carbon atoms (C1-C12 alkoxy), one to eight carbon atoms (C1-C8 alkoxy) or one to six carbon atoms (C1-C6 alkoxy), or any value within these ranges. Unless stated otherwise specifically in the specification, an alkoxy group is optionally substituted.

[0096] “Aminyl” refers to a radical of the formula ˗NRaRb, where Rais H or C1-C6alkyl and Rb is C1-C6 alkyl as defined above. The C1-C6 alkyl portion of an aminyl group is optionally substituted unless stated otherwise.

[0097] “Aminylalkylcycloalkyl” refers to a radical of the formula –RaRbNRcRdwhere Rais cycloalkyl as defined herein, Rb is C1-C6 alkyl, Rc is H or C1-C6 alkyl and Rd is C1-C6 alkyl as defined above. The cycloalkyl and each C1-C6 alkyl portion of an aminylalkylcycloalkyl group are optionally substituted unless stated otherwise.

[0098] “Aromatic ring” refers to a cyclic planar molecule or portion of a molecule (i.e., a radical) with a ring of resonance bonds that exhibits increased stability relative to other connective arrangements with the same sets of atoms. Generally, aromatic rings contain a set of covalently bound co-planar atoms and comprises a number of π-electrons (for example, alternating double Page 16 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) and single bonds) that is even but not a multiple of 4 (i.e., 4n + 2 π-electrons, where n = 0, 1, 2, 3, etc.). Aromatic rings include, but are not limited to, phenyl, naphthenyl, imidazolyl, pyrrolyl, pyridinyl, pyrimidinyl, pyrazinyl, pyridonyl, pyridazinyl, and pyrimidonyl. Unless stated otherwise specifically in the specification, an “aromatic ring” includes all radicals that are optionally substituted.

[0099] “Aryl” refers to a carbocyclic ring system radical comprising 6 to 18 carbon atoms, for example 6 to 10 carbon atoms (C6-C10aryl) and at least one carbocyclic aromatic ring. For purposes of embodiments of this disclosure, the aryl radical is a monocyclic, bicyclic, tricyclic or tetracyclic ring system, which may include fused or bridged ring systems. Aryl radicals include, but are not limited to, aryl radicals derived from aceanthrylene, acenaphthylene, acephenanthrylene, anthracene, azulene, benzene, chrysene, fluoranthene, fluorene, as-indacene, s-indacene, indane, indene, naphthalene, phenalene, phenanthrene, pleiadene, pyrene, and triphenylene.

[0100] “Aryl” as used herein, includes a fused ring system that includes non-aromatic moieties. For example, in some embodiments, aryl may have one of the following structures: .

[0101] Unless statn aryl group is optionally substituted.

[0102] The term “arylalkyl” or “aralkyl” refers to the group –alkyl-aryl, where the alkyl and aryl groups are as defined herein. Aralkyl groups of the present disclosure are optionally substituted. Examples of arylalkyl groups include, for example, benzyl, 1-phenylethyl, 2- phenylethyl, 3-phenylpropyl, 2-phenylpropyl, fluorenylmethyl and the like.

[0103] “Cyanoalkyl” refers to an alkyl group comprising at least one cyano substituent. The –CN substituent may be on a primary, secondary or tertiary carbon. Unless stated otherwise specifically in the specification, a cyanoalkyl group is optionally substituted.

[0104] “Carbocyclic” or “carbocycle” refers to a ring system, wherein each of the ring atoms are carbon. Page 17 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666)

[0105] “Cycloalkyl” refers to a non-aromatic monocyclic or polycyclic carbocyclic radical consisting solely of carbon and hydrogen atoms, which may include fused or bridged ring systems, having from three to fifteen ring carbon atoms (C3-C15 cycloalkyl), from three to ten ring carbon atoms (C3-C10cycloalkyl), or from three to eight ring carbon atoms (C3-C8cycloalkyl), or any value within these ranges such as three to four carbon atoms (C3-C4 cycloalkyl), and which is saturated or partially unsaturated and attached to the rest of the molecule by a single bond. Monocyclic radicals include, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Polycyclic radicals include, for example, adamantyl, norbornyl, decalinyl, 7,7-dimethyl-bicyclo[2.2.1]heptanyl, and the like. Unless otherwise stated specifically in the specification, a cycloalkyl group is optionally substituted.

[0106] “Alkylcycloalkyl” refers to a radical group of the formula –RaRbwhere Rais a cycloalkyl group and Rb is an alkyl group as defined above. Unless otherwise stated specifically in the specification, an alkylcycloalkyl group is optionally substituted.

[0107] “Fused” refers to any ring structure described herein which is fused to another ring structure.

[0108] “Halo” refers to bromo, chloro, fluoro or iodo.

[0109] “Haloalkyl” refers to an alkyl radical, as defined above, that is substituted by one or more halo radicals, as defined above, e.g., trifluoromethyl, difluoromethyl, trichloromethyl, 2,2,2-trifluoroethyl, 1,2-difluoroethyl, 3-bromo-2-fluoropropyl, 1,2-dibromoethyl, and the like. Unless stated otherwise specifically in the specification, a haloalkyl group is optionally substituted.

[0110] “Halocycloalkyl” refers to a cycloalkyl radical, as defined above, that is substituted by one or more halo radicals, as defined above, e.g., trifluoromethyl, difluoromethyl, trichloromethyl, 2,2,2-trifluoroethyl, 1,2-difluoroethyl, 3-bromo-2-fluoropropyl, 1,2-dibromoethyl, and the like. Unless stated otherwise specifically in the specification, a halocycloalkyl group is optionally substituted.

[0111] “Haloalkylcycloalkyl” refers to a radical group of the formula –RaRb where Ra is a cycloalkyl group and Rbis a haloalkyl group as defined above. Unless otherwise stated specifically in the specification, a haloalkylcycloalkyl group is optionally substituted.

[0112] “Halocycloalkylalkyl” refers to a radical group of the formula –RaRb where Ra is an alkyl group and Rbis a halocycloalkyl group as defined above. Unless otherwise stated specifically in the specification, a halocycloalkylalkyl group is optionally substituted. Page 18 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666)

[0113] “Heterocyclylcycloalkyl” refers to a radical group of the formula –RaRbwhere Rais a cycloalkyl group and Rb is a heterocyclyl group as defined herein. Unless otherwise stated specifically in the specification, a heterocyclylcycloalkyl group is optionally substituted.

[0114] “Hydroxylalkyl” refers to an alkyl radical, as defined above that is substituted by one or more hydroxyl radical. The hydroxyalkyl radical is joined at the main chain through the alkyl carbon atom. Unless stated otherwise specifically in the specification, a hydroxylalkyl group is optionally substituted.

[0115] “Heterocyclyl,” “heterocyclic,” or “heterocycle” refer to a 3- to 18-membered, for example 3- to 10-membered or 3- to 8-membered, non-aromatic ring radical having one to ten ring carbon atoms (e.g., two to ten) and from one to six ring heteroatoms selected from the group consisting of nitrogen, oxygen and sulfur. Unless stated otherwise specifically in the specification, the heterocyclyl radical is partially or fully saturated and is a monocyclic, bicyclic, tricyclic or tetracyclic ring system, which may include fused, spirocyclic, and / or bridged ring systems. Nitrogen, carbon, and sulfur atoms in a heterocyclyl radical are optionally oxidized, and nitrogen atoms may be optionally quaternized. Non-limiting examples of heterocyclic units having a single ring include: diazirinyl, aziridinyl, urazolyl, azetidinyl, pyrazolidinyl, imidazolidinyl, oxazolidinyl, isoxazolinyl, isoxazolyl, thiazolidinyl, isothiazolyl, isothiazolinyl oxathiazolidinonyl, oxazolidinonyl, hydantoinyl, tetrahydrofuranyl, pyrrolidinyl, morpholinyl, piperazinyl, piperidinyl, dihydropyranyl, tetrahydropyranyl, piperidin-2-I (valerolactam), 2,3,4,5- tetrahydro-1H-azepinyl, 2,3-dihydro-1H-indole, and 1,2,3,4-tetrahydro-quinoline. Non-limiting examples of heterocyclic units having 2 or more rings include: hexahydro-1H-pyrrolizinyl, 3a,4,5,6,7,7a-hexahydro-1H-benzo[d]imidazolyl, 3a,4,5,6,7,7a-hexahydro-1H-indolyl, 1,2,3,4- tetrahydroquinolinyl, chromanyl, isochromanyl, indolinyl, isoindolinyl, and decahydro-1H- cycloocta[b]pyrrolyl. “Heterocyclyl” as used herein, includes a fused ring system that comprises additional non-heterocyclyl components. For example, in some embodiments, heterocyclyl may have one of the following structures: .

[0116] Unlesy , eterocyclyl group is optionally substituted. Page 19 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666)

[0117] “Haloheterocyclyl” refers to a heterocyclyl group comprising at least one halo substituent. The halo substituent may be on a primary, secondary or tertiary carbon. Unless stated otherwise specifically in the specification, a haloheterocyclyl group is optionally substituted.

[0118] “Haloheterocyclylalkyl” refers to a radical group of the formula –RaRbwhere Rais an alkyl group and Rb is a haloheterocyclyl group as defined herein. Unless otherwise stated specifically in the specification, a haloheterocyclylalkyl group is optionally substituted.

[0119] “Heterocyclylalkyl” refers to a radical group of the formula –RaRbwhere Rais an alkyl group and Rb is a heterocyclyl group as defined herein. Unless otherwise stated specifically in the specification, a heterocyclylalkyl group is optionally substituted.

[0120] “Heteroaryl” refers to a 5- to 18-membered, for example 5- to 6-membered, ring system radical comprising one to thirteen ring carbon atoms, one to six ring heteroatoms selected from the group consisting of nitrogen, oxygen and sulfur, and at least one aromatic ring. Heteroaryl radicals may be a monocyclic, bicyclic, tricyclic or tetracyclic ring system, which may include fused or bridged ring systems; and the nitrogen, carbon or sulfur atoms in the heteroaryl radical may be optionally oxidized; the nitrogen atom may be optionally quaternized. Examples include, but are not limited to, azepinyl, acridinyl, benzimidazolyl, benzothiazolyl, benzindolyl, benzodioxolyl, benzofuranyl, benzooxazolyl, benzothiazolyl, benzothiadiazolyl, benzo[b][1,4]dioxepinyl, 1,4-benzodioxanyl, benzonaphthofuranyl, benzoxazolyl, benzodioxolyl, benzodioxinyl, benzopyranyl, benzopyranonyl, benzofuranyl, benzofuranonyl, benzothienyl (benzothiophenyl), benzotriazolyl, benzo[4,6]imidazo[1,2-a]pyridinyl, carbazolyl, cinnolinyl, dibenzofuranyl, dibenzothiophenyl, furanyl, isothiazolyl, imidazolyl, indazolyl, indolyl, indazolyl, isoindolyl, indolinyl, isoindolinyl, isoquinolyl, indolizinyl, isoxazolyl, naphthyridinyl, oxadiazolyl, 2-oxoazepinyl, oxazolyl, 1-oxidopyridinyl, 1-oxidopyrimidinyl, 1-oxidopyrazinyl, 1- oxidopyridazinyl, 1-phenyl-1H-pyrrolyl, phenazinyl, phenothiazinyl, phenoxazinyl, phthalazinyl, pteridinyl, purinyl, pyrrolyl, pyrazolyl, pyridinyl, pyrazinyl, pyrimidinyl, pyridazinyl, quinazolinyl, quinoxalinyl, quinolinyl, isoquinolinyl, tetrahydroquinolinyl, thiazolyl, thiadiazolyl, triazolyl, tetrazolyl, triazinyl, and thiophenyl (i.e., thienyl). “Heteroaryl” as used herein, includes a fused ring system where the heteroatom (e.g., oxygen, sulfur, nitrogen, etc.) is not part of the aryl moiety. For example, in some embodiments, heteroaryl may have the following structure: Page 20 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666)

[0121] Unless stated otherwise sp the specification, a heteroaryl group isoptionally substituted.

[0122] Non-limiting examples of heteroaryl rings containing a single ring include: 1,2,3,4- tetrazolyl, [1,2,3]triazolyl, [1,2,4]triazolyl, triazinyl, thiazolyl, 1H-imidazolyl, oxazolyl, furanyl, thiopheneyl, pyrimidinyl, 2-phenylpyrimidinyl, pyridinyl, 3-methylpyridinyl, and 4- dimethylaminopyridinyl. Non-limiting examples of heteroaryl rings containing 2 or more fused rings include: benzofuranyl, benzothiophenyl, benzoxazolyl, benzthiazolyl, benztriazolyl, cinnolinyl, naphthyridinyl, phenanthridinyl, 7H-purinyl, 9H-purinyl, 6-amino-9H-purinyl, 5H- pyrrolo[3,2-d]pyrimidinyl, 7H-pyrrolo[2,3-d]pyrimidinyl, pyrido[2,3-d]pyrimidinyl, 2- phenylbenzo[d]thiazolyl, 1H-indolyl, 4,5,6,7-tetrahydro-1-H-indolyl, quinoxalinyl, 5- methylquinoxalinyl, quinazolinyl, quinolinyl, 8-hydroxy-quinolinyl, and isoquinolinyl.

[0123] One non-limiting example of a heteroaryl group as described above is C1-C5heteroaryl, which has 1 to 5 carbon ring atoms and at least one additional ring atom that is a heteroatom (preferably 1 to 4 additional ring atoms that are heteroatoms) independently selected from nitrogen (N), oxygen (O), or sulfur (S). Examples of C1-C5heteroaryl include, but are not limited to, triazinyl, thiazol-2-yl, thiazol-4-yl, imidazol-1-yl, 1H-imidazol-2-yl, 1H-imidazol-4-yl, isoxazolin-5-yl, furan-2-yl, furan-3-yl, thiophen-2-yl, thiophen-4-yl, pyrimidin-2-yl, pyrimidin-4- yl, pyrimidin-5-yl, pyridin-2-yl, pyridin-3-yl, and pyridin-4-yl.

[0124] Unless otherwise noted, when two substituents are taken together to form a ring having a specified number of ring atoms (e.g., two R groups taken together with the nitrogen (N) to which they are attached to form a ring having from 3 to 7 ring members), the ring can have carbon atoms and optionally one or more (e.g., 1 to 3) additional heteroatoms independently selected from nitrogen (N), oxygen (O), or sulfur (S). The ring can be saturated or partially saturated and can be optionally substituted.

[0125] For the purpose of the present disclosure fused ring units, as well as spirocyclic rings, bicyclic rings and the like, which comprise a single heteroatom will be considered to belong to the cyclic family corresponding to the heteroatom containing ring. For example, 1,2,3,4- tetrahydroquinoline having the formula: Page 21 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) is, for the purposes of the present discl dered a heterocyclic unit. 6,7-Dihydro-5H-cyclopentapyrimidine having the formula: is, for the purposes of the present disclos red a heteroaryl unit. When a fused ring unitcontains heteroatoms in both a saturated and an aryl ring, the aryl ring will predominate and determine the type of category to which the ring is assigned. For example, 1,2,3,4-tetrahydro- [1,8]naphthyridine having the formula: is, for the purposes of the present disclosred a heteroaryl unit.

[0126] Whenever a term or either of their prefix roots appear in a name of a substituent the name is to be interpreted as including those limitations provided herein. For example, whenever the term “alkyl” or “aryl” or either of their prefix roots appear in a name of a substituent (e.g., arylalkyl, alkylamino) the name is to be interpreted as including those limitations given above for “alkyl” and “aryl.”

[0127] The term “substituted” is used throughout the specification. The term “substituted” is defined herein as a moiety, whether acyclic or cyclic, which has one or more hydrogen atoms replaced by a substituent or several (e.g., 1 to 10) substituents as defined herein below. The substituents are capable of replacing one or two hydrogen atoms of a single moiety at a time. In addition, these substituents can replace two hydrogen atoms on two adjacent carbons to form said substituent, new moiety or unit. For example, a substituted unit that requires a single hydrogen atom replacement includes halogen, hydroxyl, and the like. A two hydrogen atom replacement includes carbonyl, oximino, and the like. A two hydrogen atom replacement from adjacent carbon atoms includes epoxy, and the like. The term “substituted” is used throughout the present specification to indicate that a moiety can have one or more of the hydrogen atoms replaced by a substituent. When a moiety is described as “substituted” any number of the hydrogen atoms may Page 22 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) be replaced. For example, difluoromethyl is a substituted C1alkyl; trifluoromethyl is a substituted C1 alkyl; 4-hydroxyphenyl is a substituted aromatic ring; (N,N-dimethyl-5-amino)octanyl is a substituted C8 alkyl; 3-guanidinopropyl is a substituted C3 alkyl; and 2-carboxypyridinyl is a substituted heteroaryl.

[0128] The variable groups defined herein, e.g., alkyl, alkenyl, alkynyl, cycloalkyl, alkoxy, aryloxy, aryl, heterocycle and heteroaryl groups defined herein, whether used alone or as part of another group, can be optionally substituted. Optionally substituted groups are so indicated.

[0129] The compounds of the disclosure (i.e., compounds of Structure (I) or (II)) or their pharmaceutically acceptable salts may contain one or more centers of geometric asymmetry and may thus give rise to stereoisomers such as enantiomers, diastereomers, and other stereoisomeric forms that are defined, in terms of absolute stereochemistry, as (R)- or (S)- or, as (D)- or (L)- for amino acids. Embodiments thus include all such possible isomers, as well as their racemic and optically pure forms. Optically active (+) and (-), (R)- and (S)-, or (D)- and (L)- isomers may be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques, for example, chromatography and fractional crystallization. Conventional techniques for the preparation / isolation of individual enantiomers include chiral synthesis from a suitable optically pure precursor or resolution of the racemate (or the racemate of a salt or derivative) using, for example, chiral high pressure liquid chromatography (HPLC). When the compounds described herein contain olefinic double bonds or other centers of geometric asymmetry, and unless specified otherwise, it is intended that the compounds include both E and Z geometric isomers. Likewise, all tautomeric forms are also intended to be included.

[0130] Embodiments of the present disclosure include all manner of rotamers and conformationally restricted states of a compound of the disclosure. Atropisomers, which are stereoisomers arising because of hindered rotation about a single bond, where energy differences due to steric strain or other contributors create a barrier to rotation that is high enough to allow for isolation of individual conformers, are also included. As an example, certain compounds of the disclosure may exist as mixtures of atropisomers or purified or enriched for the presence of one atropisomer.

[0131] In some embodiments, the compounds of Structure (I) or (II) are a mixture of enantiomers or diastereomers. In other embodiments, the compounds of Structure (I) or (II) are substantially one enantiomer or diastereomer. Page 23 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666)

[0132] A “tautomer” refers to a proton shift from one atom of a molecule to another atom of the same molecule. Embodiments thus include tautomers of the disclosed compounds.

[0133] In some embodiments, a MNK inhibitor has the following Structure (Ia): or a pharmaceutically acceptable salt 1aand R1Rbare each independently alkyl. In some embodiments, R1aand R1bare the same. In certain embodiments, R1aand R1bare different. R1aor R1bmay be alkyl groups, such as a methyl, ethyl, propyl, isopropyl, or tert-butyl group. The R1aor R1bsubstituent groups may be the same alkyl group, or different alkyl groups. For example, R1amay be a methyl group, while R1bmay be an ethyl group. By way of another example, R1amay be an isopropyl group, while R1bmay be a tert-butyl group. Any alkyl group combinations of substituents R1aor R1bmay be used.

[0134] In some embodiments, R1aand R1bjoint to form a cyclic moiety. In certain embodiments, the compound has the following Structure (Ib): or a pharmaceutically acceptable salt t R1aand R1bmay join together to form ring A.

[0135] The Structure (Ib), substituents R1aor R1bmay together form a cyclic compound indicated as cyclic moiety A. For example, the cyclic moiety A of the Structure (Ib) may include a five-membered ring. The cyclic moiety A of the Structure (Ib) may be a non-substituted cyclic compound. For instance, the cyclic moiety A may be a non-substituted five-membered ring such as a cyclopentane. Further, the cyclic moiety A of the Structure (Ib) may have one or more alkyl substitutions. For example, the alkyl substitutions on the cyclic moiety A may include methyl, ethyl, propyl, isopropyl, cyclopropyl, or tert-butyl group. Substituted positions may be 2-, 3-, 4-, Page 24 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) or 5- position of the cyclopentane. The degree of the substitutions may include mono-, di-, tri-, or tetra-substitutions. For instance, the cyclic moiety A may be 2,2,5,5- tetramethylcyclopentane. Synthetic routes may be used to install different substitution patterns on the cyclopentane ring. For example, the cyclic moiety A may be 3,3,4,4- tetramethylcyclopentane.

[0136] Additionally, the cyclic moiety A may have a fused ring. A part of the cyclic moiety A may include a fused benzene ring. For example, the cyclic moiety A may include the fused benzene ring with a cyclopentyl or cyclohexyl ring. For instance, the synthetic route to prepare the benzene fused cyclohexyl compound may involve the use of 1-tetralone. Further, the cyclic moiety A may include a fused cyclopentyl or cyclohexyl ring with other cyclic structures.

[0137] The cyclic moiety A may include a six-membered ring. The cyclic moiety A may be non-substituted cyclic moiety. For example, the cyclic moiety A may be a non-substituted six- membered ring such as a cyclohexane. Further, the cyclic moiety A may have one or more alkyl substitutions. For example, the alkyl substitutions on the cyclic moiety A may include methyl, ethyl, propyl, isopropyl, cyclopropyl, or tert-butyl group. The cyclic moiety A may have one or more heteroatom-containing substituents, such as alcohols, sulfonamides, or carboxylic acids. Substituted positions may be 2-, 3-, 4-, 5-, or 6- position of the cyclohexane. The degree of the substitutions may include mono-, di-, tri-, or tetra-substitutions. For instance, the cyclic moiety A may be 3,5- dimethylcyclohexane. Synthetic routes may be used to install different substitution patterns on the cyclohexane ring. For example, the cyclic moiety A may be 2,3,4,5,6- pentamethylcyclohexane.

[0138] The cyclic moiety A may include a heterocyclic compound. The heterocyclic compound is a cyclic compound that has atoms of at least two different elements such as a carbon and an oxygen atom. For example, the cyclic moiety A may be tetrahydropyran. The tetrahydropyran includes one oxygen atom and five carbon atoms in a six-membered ring. The heterocyclic compound may further be substituted with alkyl substituents or functional groups on various positions with various degrees of substitutions. It is noted that, while some of the structures shown in the present disclosure include an oxygen atom in a cyclic compound, such a structure is merely provided for illustrative purposes. Synthetic routes may be used to install different heteroatoms in the cyclic compounds. For example, the cyclic moiety A of the structure (Ib) may include piperidine (a nitrogen atom), phosphinate (a phosphorus atom), silinane (a silicon atom), or thiane (a sulfur atom). Page 25 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666)

[0139] The cyclic moiety A may be unsaturated. Unsaturated cyclic compounds may include aromatic cyclic compounds such as a benzene, pyridine, diazine, oxazine, dioxine, or thiazine. Alternatively, the cyclic moiety A may be saturated.

[0140] The cyclic moiety A may have one or more functional group substitutions. For example, the functional groups may include a hydroxyl, amine, amide, carboxylic acid, ether, or sulfonamide. Thus, the cyclic moiety A may include 4-hydroxyl cyclohexane, 4-carboxylic acid cyclohexane, 4-methoxyl cyclohexane, or 4-alkylsulfonamide cyclohexane. Substituted positions may be 2-, 3-, 4-, 5-, or 6- position of the cyclohexane. The degree of the substitutions may include mono-, di-, tri-, tetra-, or penta-substitutions. One or more functional groups may be installed on a heterocyclic compound with various substitution positions and degree.

[0141] The substituent R2of the structures (Ia) and (Ib) may include a nitrogen containing functional group. For example, the nitrogen containing functional group of the substituent R2may include amides, amidine, amines, amine oxides, azo, carbamates, carbodiimides, enamines, aromatic heterocycles, non-aromatic heterocycles, hydrazones, hydroxamic acids, imides, imines, nitriles, sulfonamide, or urea. For example, the aromatic heterocycles may include pyrrole, imidazole, pyrazole, thiazole, pyridine, pyridazine, pyrimidine, pyrazine, or triazine. The nitrogen containing functional group of substituent R2may be unsubstituted or substituted. For instance, a pyridazine may be substituted with an amine group at 3 position as shown in 4ET-004-006 hereinafter. In another instance, a pyridazine may be substituted with an amide containing a cyclopropyl ring at 3 position as shown in 4ET-004-003 hereinafter. The degree and location of substitution on the nitrogen containing functional group may differ. The nitrogen containing functional group of the substituent R2may be attached via an alkyl chain represented by -CnH2n- where n is between zero and five. In this regard, the nitrogen containing functional groups of the substituent R2and the backbone structures (Ia) and (Ib) are separated by n carbon atoms.

[0142] Substituent R2of the structures (Ia) and (Ib) may include an aromatic heterocycle. For instance, in some embodiments, substituent R2may include 4-aminopyrimidinyl moiety. In some specific embodiments, the compound is a compound of Structure (Ic): Page 26 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) or pharmaceutically acceptable s include an amine.

[0143] In some embodiments, the amine is a primary amine. In some embodiments, R3is – NH2.

[0144] In some embodiments, R3may include a secondary amine. When the amine is a secondary amine, R3may further include a functional group at one end. For example, the functional group may include a hydroxyl, sulfonamide, carboxylic acid, ester, amine, amide, morpholine, piperazine, or thiomorpholine. The secondary amine and the functional group may be attached via an alkyl chain represented by -CnH2n- where n is between one and five. Thus, the secondary amine of the substituent R3and the functional group may be separated by n carbon atoms. For example, the secondary amine attached to a hydroxyl group separated by carbons atoms forms an aminoalcohol (HO-C2H4NH-), which is shown as examples 4ET-02-001, 4ET-03-004, 4ET-03- 007, and 4ET-03-011 hereinafter. By way of another example, the secondary amine attached to a sulfonamide group separated by two carbon atoms forms amino sulfonamide (CH3SO2NHC2H4NH-), which is shown as examples 4ET-02-004, 4ET-03-012, 4ET-03-013, and 4ET-03-014 hereinafter.

[0145] The amine of substituent R3may include a tertiary amine. The tertiary amine of the substituent R3may be cyclic. The cyclic tertiary amine of the substituent R3may be a part of saturated five-membered ring or six-membered ring. For example, the cyclic tertiary amine of the substituent R3in a saturated five-membered ring may be pyrrolidine, imidazolidine, or pyrazolidine. The cyclic tertiary amine of the substituent R3in a saturated six-membered ring may be piperidine or piperazine.

[0146] The tertiary amine may further include a functional group at one end. For example, the functional group may include a hydroxyl, sulfonamide, carboxylic acid, ester, amide, amine, morpholine, piperazine, or thiomorpholine. The tertiary amine and the functional group may be attached via an alkyl chain represented by -CnH2n- where n is between one and five. Thus, the tertiary amine of the substituent R3and the functional group may be separated by n carbon atoms. Page 27 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666)

[0147] The tertiary amine of the substituent R3may be cyclic. The cyclic tertiary amine of the substituent R3may be a part of unsaturated five-membered ring or six-membered ring. For example, the cyclic tertiary amine of the substituent R3in an unsaturated five- membered ring may be pyrazole, imidazole, or oxazole. The cyclic tertiary amine of the substituent R3in an unsaturated six-membered ring may be pyridine, diazine, triazine, or oxazine.

[0148] The amine of substituent R3may also include an amide group. The amide group of substituent R3may further include a functional group at one end. For example, the functional group may include a hydroxyl, sulfonamide, carboxylic acid, ester, amine, amide, morpholine, piperazine, or thiomorpholine.

[0149] The amide of the substituent R3and the functional group may be attached via an alkyl chain represented by -CnH2n- where n is between zero and five. Thus, the amide of the substituent R3and the functional group may be separated by n carbon atoms. For example, the amide attached to morpholine group by one methylene forms morpholine amide, which is shown as examples 4ET- 02-007, 4ET-03-027, and 4ET-03-028 hereinafter. The amide attached to morpholine group by two methylenes forms morpholine amide, which is shown as example 4ET-02-031 hereinafter. The amide of the substituent R3may also be directly attached to one of the functional groups.

[0150] The amide of the substituent R3may be directly attached to a cyclic structure. For example, the amide of the substituent R3may be directly attached to cyclopropane. In this case, there is no carbon atom between the amide and cyclopropane. Structures with the amide group directly attached to cyclopropane as a part of the substituent R3include 4ET- 02-003, 4ET-02-009, 4ET-02-010, 4ET-02-011, 4ET-02-012, 4ET-02-016, 4ET-03-002, 4ET-03-009, 4ET-03-017, 4ET- 03-019, 4ET-03-020, 4ET-03-023, 4ET-03-026, 4ET-03-034, and 4ET-04-003 hereinafter. Cyclopropanes may be unsubstituted or substituted with one or more functional groups. For instance, the substituted cyclopropanes may include fluorine, hydroxyl, hydroxylmethylene, alkyl, carboxylic acid, amine, aminomethylene, ester, ether, amide, sulfonamide, morpholine, piperazine, or thiomorpholine group attached to a cyclopropane ring. The substituted position on the cyclopropane where the functional group is attached may be the 1-, 2-, or 3-position. The functional group attached to the cyclopropane may have an additional alkyl chain (-CnH2n-) between the functional group and the cyclopropane where n is between zero and 5. When n is equal to zero, there is no methylene between the functional group and the cyclopropane. Thus, the functional group may be directly attached to the cyclopropane on the 1-, 2-, or 3-position. Page 28 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) Similarly, when n is equal to one, there is one methylene between the functional group and the cyclopropane. In this case, the functional group is one carbon away from the cyclopropane, which gives an extra degree of freedom to the structure. Structures with the amide group directly attached to substituted cyclopropane as a part of the substituent R3include 4ET- 02-009, 4ET-02-010, 4ET- 02-011, 4ET-02-012, 4ET-02-016, 4ET-03-019, 4ET-03-020,4ET-03-023, 4ET-03-026, and 4ET- 03-034 hereinafter.

[0151] The amide of the substituent R3may be directly attached to cyclobutane. In this case, there is no carbon atom between the amide and cyclobutane. The cyclobutane may further have a functional group. For instance, the functional group may include hydroxyl, alkyl, carboxylic acid, amine, ester, ether, amide, sulfonamide, morpholine, piperazine, or thiomorpholine. The substituted position on the cyclobutane where the functional group is attached may be the 1-, 2-, 3-, or 4-position. The functional group may have an additional alkyl chain (CnH2n) between the functional group and the cyclobutane where n is between zero and 5.

[0152] The cyclic structure that is attached to the amide via an alkyl chain or directly may include at least one heteroatom to form a heterocyclic compound. The heterocyclic compound may include a three-membered ring with one heteroatom or a four-membered ring with one heteroatom. For example, the three-membered ring with one heteroatom may include aziridines or ethylene oxide. By way of another example, the four-membered ring with one heteroatom may include azetidine or oxetane. Azetidine directly attached to the amide is shown for example in 4ET-02-017 hereinafter. As described above, functional groups may be attached to the heterocyclic compound. In the case of ethylene oxide (epoxide), Sharpless epoxidation may be used to generate chiral epoxides.

[0153] While the examples herein only have a monosubstitution on the cyclic structure, such a configuration is merely provided for illustrative purposes. Embodiments of the present disclosure include disubstituted cyclic structures as well. For example, a total of two amine groups may be attached to the cyclopropane; a first amine group may be attached to 1-position of cyclopropane, while a second amine group is attached to 2-position of cyclopropane.

[0154] The amide of the substituent R3may be a reverse amide. Instead of a nitrogen atom of the amide of the substituent R3being directly attached to the structure (Ic), a carbon atom of the amide of the substituent R3may be attached to the structure (Ic). The reverse amide attached to the structure (Ic) is shown for example in 4ET-03-024 hereinafter. Embodiments of the present Page 29 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) disclosure described above including the amide in the substituent R3may also be replaced with a reverse amide. For instance, the amide group of examples such as 4ET-02-003, 4ET-02-009, 4ET- 02-010, 4ET-02-011, 4ET-02-012, 4ET-02-016, 4ET-03-002, 4ET-03-009, 4ET-03-017, 4ET-03- 019, 4ET-03-020, 4ET-03-023, 4ET-03-026, 4ET-03-034, 4ET-04-003, 4ET-02-007, 4ET-03-027, 4ET-03-028, and 4ET-02-031 may be replaced with a reverse amide.

[0155] The structure (Ic) may be equipped with an amide analog of the substituent R3. For example, a thioamide group may be used instead of the amide group shown in 4ET- 02-013 hereinafter. Similar to the amide substituent, the thioamide group may be replaced with a reverse thioamide. In this regard, instead of a nitrogen atom of the thioamide of the substituent R3being directly attached to the structure (Ic), a carbon atom of the thioamide of the substituent R3may be attached to the structure (Ic).

[0156] Additionally, other amide analogs of the substituent R3may be used for the structure (Ic). For example, a urea group may be used instead of the amide group shown in 4ET-02-015 hereinafter. By way of another example, a thiourea group may be used instead of the amide group. An amide, a reverse amide, a thioamide, a reverse thioamide, a urea, and a thiourea as a part of the substituent R3are interchangeable in the structure (Ic).

[0157] In some MNK inhibitors of the present disclosure, the 4-aminopyrimidine moiety in structure (Ic) may be modified. The pyrimidine moiety and the parent structure as shown in the structure (Ia) or (Ib) are connected via the amine linker (-NH-) in the structure (Ic). The amine linker may be extended. For example, the amine linker may include additional alkyl chain (-CnH2n- ) between the amine and pyrimidine moiety where n is between one and five. For instance, one extra carbon atom (n=1) may be added, such that the amine linker and pyrimidine are one carbon away from the parent structure, as shown in 4ET-04-004, which gives the structure (Ic) more structural flexibility via an extra degree of freedom. One carbon extension, which is an insertion of a methylene unit, between the amine and the pyrimidine moiety provides a benzylpyrimidine moiety. By way of another example, the amine linker may include additional alkyl chain (-CnH2n- ) between the amine and the parent structure shown as the structure (Ia) or (Ib) where n is between one and five. For instance, one extra carbon atom (n=1) may be added, as shown in 4ET-04-015, such that the amine linker and the parent structure shown as the structure (Ia) or (Ib) are one carbon away from the parent structure. One carbon extension, which is an insertion of a methylene unit, between the amine and the structure (Ia) or (Ib) provides a methylaminopyrimidine moiety. In this Page 30 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) regard, methylene units may be added both sides of the amine linker of the structure (Ic). Amine linker extension with extra methylene units may be used in conjunction with any of the other variations of structures (Ia), (Ib), and (Ic) disclosed herein.

[0158] Additionally, the pyrimidine moiety in the structure (Ic) may be modified to substitute a different unsaturated six-membered ring with two nitrogen atoms isomer, such as 1,2-diazine (pyridazine) or 1,4-diazine (pyrazine). For example, 1,2-diazine (pyridazine) may be used instead of 1,3-diazine (pyrimidine) in the structure (Ic) shown in example 4ET-04-003 and 4ET-04-006 hereinafter. These modifications may be used in conjunction with any of the other variations of structures (Ia), (Ib), and (Ic) disclosed herein.

[0159] Pyrimidine in the structure (Ic) may be replaced with a five-membered heterocyclic compound. Pyrimidine is a six-membered heterocyclic compound with two nitrogen atoms. In general, five-membered heterocyclic compounds have different chemical and physical properties than the six-membered heterocyclic compounds. Some MNK inhibitors of the present disclosure may take advantage of such differences between five- and six-membered heterocyclic compounds. For example, the five-membered heterocyclic compound may include nitrogen and sulfur atoms. For instance, the five- membered heterocyclic compound with N and S may include thiazole as shown in example 4ET-04-001 hereinafter. By way of another example, the five-membered heterocyclic compound with S may include thiophene. The five-membered heterocyclic compound may include nitrogen and oxygen atoms. For instance, the five-membered heterocyclic compound with N and O may include oxazole or isoxazole. Yet in another example, the five-membered heterocyclic compound may include two nitrogen atoms. For instance, the five-membered heterocyclic compound with two nitrogen atoms may include imidazole or pyrazole. These modifications may be used on conjunction with any of the other variations of structures (Ia), (Ib), and (Ic) disclosed herein.

[0160] As examples of how various modifications disclosed herein may be used in combination with one another, the amine linker with additional carbon atom may be attached to a pyridazine moiety and the pyridazine moiety may be connected to the pyridone scaffold with an amine or sulfonamide. By way of another example, the amine linker with additional carbon atom may be attached to a pyridazine moiety and the pyridazine moiety may be directly connected to an amino group. Page 31 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666)

[0161] In some MNK inhibitors of the present disclosure, the 4-aminopyrimidine moiety and a parent structure, for example, a pyridone moiety in structure (Ic) may be attached via other nitrogen containing linkers. The pyrimidine moiety and the parent structure as shown in the structure (Ia) or (Ib) are connected via the amine linker (-NH-) in the structure (Ic). Embodiments of the present disclosure may be configured to install an amide group between the 4- aminopyrimidine moiety and the parent structure. This can be synthesized by using an amide containing starting material in Buchwald-Hartwig amination. For example, the resulting MNK inhibitor may include an amide as shown in example 4ET-04-013 or a reverse amide as shown in example 4ET-04-014 hereinbelow between the 4-aminopyrimidine moiety and the parent structure.

[0162] Further, embodiments of the present disclosure may be configured to install a sulfonamide group between the 4-aminopyrimidine moiety and the parent structure. This can be synthesized by using a sulfonamide containing starting material in Buchwald- Hartwig amination. Another approach involves the use of a sulfonyl chloride reagent or intermediate. For example, the resulting MNK inhibitor may include a sulfonamide as shown in examples 4ET-04-010 and 4ET- 04-011 or a reverse sulfonamide as shown in example 4ET-04-012 hereinbelow between the 4- aminopyrimidine moiety and the parent structure.

[0163] Additionally, embodiments of the present disclosure may be configured to install an ether group between the 4-aminopyrimidine moiety and the parent structure. This can be synthesized by using an alcohol containing starting material in Buchwald-Hartwig amination. Another approach involves using an alcohol containing starting material in an Ullmann-type coupling reaction.

[0164] The substituents R1aor R1bof the structure (Ic) may be alkyl groups, as discussed hereinabove in the structure (Ia). Alternatively, the substituents R1aor R1bof the structure (Ic) may together form a cyclic compound indicated as a ring structure A below. The detailed discussion of the ring structure A of the structure (Ib) may also apply to the structure (Id): or pharmaceutically acceptable s, y include an amine. Page 32 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666)

[0165] One embodiment provides an MNK inhibitor having the following Structure (II): or a pharmaceutically acceptabl 1aR is C1-C6 alkyl or aryl; R1bis C1-C6alkyl or aryl, or R1aand R1b, together with the carbon to which they are both attached, join to form cycloalkyl, cycloalkenyl, heterocyclyl, aryl, or heteroaryl; R2is –NHR3a, –NHC(=O)R3b, –NHC(=S)R3b, or –C(=O)R3c; R3ais hydrogen, C1-C6alkyl, or C3-C6cycloalkyl, each of which is optionally substituted with one or more substituents selected from the group consisting of hydroxyl, C3-C6 cycloalkyl, -NHS(O)2CH3, heterocyclyl, -C(=O)OH, -C(=O)N(R3d)R3d, or -N(R3d)R3d; R3bis C1-C6alkyl, C3-C6cycloalkyl, or heterocyclyl each of which is optionally substituted with one or more substituents selected from the group consisting of hydroxyl, halo, C1-C6 alkyl, C3-C6 cycloalkyl, -NHS(O)2CH3, -N(R3d)R3d, heterocyclyl, -C(=O)OH, -C(=O)N(R3d)R3d, -NHC(=O)CH3, -CH2C(=O)OH, R3cis -N(R3d)R3dor heterocyclyl; R3dis, at each occurrence, independently hydrogen, C1-C6 alkyl, or C3-C6 cycloalkyl; L is –NH– or –CH2NH–; and X is N and Y is CH or X is CH and Y is N.

[0166] In some embodiments, when R1aand R1bare both –CH3 or when R1aand R1bjoin to form a 5- or 6-membered cycloalkyl or heterocyclyl, then R2does not have the following structure: O .bodiments, R1ais C1-C6alkyl. In some embodiments, R1ais methyl. In certain embodiments, R1ais aryl. In certain embodiments, R1ais phenyl. Page 33 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666)

[0168] In certain specific embodiments, R1bis C1-C6alkyl. In some embodiments, R1bis methyl. In some embodiments, R1aand R1b, together with the carbon to which they are both attached, join to form cycloalkyl. In more specific embodiments, the cycloalkyl is cyclopentyl or cyclohexyl. In some embodiments, R1aand R1b, together with the carbon to which they are both attached, join to form cycloalkenyl. In some embodiments, the cycloalkenyl is cyclopentenyl, cyclohexenyl, or cycloheptenyl. In certain specific embodiments, R1aand R1b, together with the carbon to which they are both attached, join to form heterocyclyl. In some specific embodiments, R1aand R1b, together with the carbon to which they are both attached, join to form aryl. In some embodiments, R1aand R1b, together with the carbon to which they are both attached, join to form heteroaryl.

[0169] In more specific embodiments, the compound has one of the following structures: ; , or a phary p , Page 34 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) indicates a double or single bond; R4is, at each occurrence, independently C1-C6 alkyl, C3-C6 cycloalkyl, halo, haloalkyl, hydroxyl, -NHS(O)2CH3, or -C(O)OH, or two R4, together with the carbon to which they are both attached, join to form a cycloalkyl; W is N or O; Z is C or O; and n is 0, 1, 2, 3, or 4.

[0170] In some embodiments, n is 0, 1, or 2. In some more specific embodiments, only one location depicted with is a double bond and the rest are single bonds. In some embodiments, the compound has the following structure: .

[0171] ucture: . orPage 35 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666)

[0173] In more specific embodiments, R2is –NHR3a. In more specific embodiments, R2has one of the following structures: ;

[0174] R2has oneof the following structures: O O ;, . , the following structure: S .Page 36 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666)

[0176] In certain embodiments, R2is –C(=O)R3c. In some embodiments, R2has one of the following structures: O ; ; ; ;

[0177] n certan spec c embodments, as one o te o owng structures: Page 37 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) O N .

[0178] In some embodiments, n certain embodiments, X is N and Y isCH. In some embodiments, L is –NH–. In more embodiments, L is –CH2NH–.

[0179] In some embodiments, R3ais a branched C1-C6 alkyl. In some embodiments, R3ais iso- propyl.

[0180] In various different embodiments, the compound has one of the structures set forth in Table 1 below, or a pharmaceutically acceptable salt thereof. Compounds in Table 1 were prepared as described in WO 2022006331 and / or methods known in the art. Table 1. No. StructurePage 38 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. StructurePage 39 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. StructurePage 40 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. StructurePage 41 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. StructurePage 42 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. StructurePage 43 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. StructurePage 44 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. StructurePage 45 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. StructurePage 46 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. StructurePage 47 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. StructurePage 48 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. StructurePage 49 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. StructurePage 50 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. StructurePage 51 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. StructurePage 52 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. StructurePage 53 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. StructurePage 54 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. StructurePage 55 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. StructurePage 56 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. StructurePage 57 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. StructurePage 58 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. StructurePage 59 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. StructurePage 60 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. StructurePage 61 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. StructurePage 62 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. StructurePage 63 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. Structure OPage 64 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. StructurePage 65 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. StructurePage 66 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. StructurePage 67 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. StructurePage 68 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) MNK Inhibitors of Formula (I ) and Formula (IA)

[0181] In some embodiments, a MNK inhibitor is a compound of Formula (I’): Page 69 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) Formula (I’) or a pharmaceutically accepterein: R1is selected from the group consisting of hydrogen, halogen, C1-6 alkyl, C3-7 branched alkyl, C1-6haloalkyl, C3-7branched haloalkyl, C1-6hydroxyalkyl, C3-7branched hydroxyalkyl, cyano, C1-6alkoxyl, C3-7branched alkoxy, hydroxy, and C3-6cycloalkyl that is optionally substituted with 1 to 3 substituents selected from the groups consisting of halogen, C1-6 alkyl, C1-6 haloalkyl, and C1-6 hydroxyalkyl: , , ,hed alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, C1-6 hydroxyalkyl, C3-7 branched hydroxyalkyl, cyano, C1-6alkoxyl, C3-7branched alkoxy , hydroxy, and C3-6cycloalkyl that is optionally substituted with 1 to 3 substituents selected from the groups consisting of halogen, C1-6alkyl, C1-6haloalkyl, and C1-6 hydroxyalkyl; Page 70 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) R1cand R1dare taken together to form a 3- to 7-membered ring having 0-2 heteroatoms selected from the group consisting of N, O and S, wherein the 3- to 7-membered ring may be further optionally substituted with one or more substituents selected from the group consisting of halo, oxo, C1-6alkyl, R8, and –C(=O)OR9; Z1and Z2are each independently a direct bond or –{C(R4a)(R4b)}p–Y1–; wherein p is 0, 1, 2, 3, 4, or 5, Y1is a direct bond, –O–, or –N(R8)–; R4ais at each occurrence independently selected from the group consisting of hydrogen, halogen, C1-6 alkyl, C3-7 branched alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, hydroxy, C1-6 alkoxyl, C3-7 branched alkoxy, NHCO(C1-6alkyl), NHCO(C3-7 branched alkyl), NHCO(C3-7 cycloalkyl), NHSO2(C1-6alkyl), NHSO2(C3-7branched alkyl), and NHSO2(C3-7cycloalkyl); or two R4aattached to two adjacent carbons to form a direct bond; R4bis at each occurrence independently selected from the group consisting of hydrogen, halogen, C1-6 alkyl, C3-7 branched alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, hydroxy, C1-6 alkoxyl, C3-7branched alkoxy, NHCO(C1-6alkyl), NHCO(C3-7branched alkyl), NHCO(C3-7cycloalkyl), NHSO2(C1-6alkyl), NHSO2(C3-7 branched alkyl), and NHSO2(C3-7 cycloalkyl); R5is selected from the group consisting of hydrogen, halogen, C1-6 alkyl, C3-7 branched alkyl, C1-6haloalkyl, C3-7branched haloalkyl, C1-6alkoxyl, C3-7branched alkoxy, and hydroxy: R6is selected from the group consisting of hydrogen, NH2, NHR6a, NHCH2CH2OH, NHCH2CH2NHSO2Me, C1-6 alkoxyl, C3-7 branched alkoxy, and hydroxy; R6ais selected from the group consisting of -(CO)C1-6alkyl, -(CO)C3-7branched alkyl, - , andq , , , , , ; Page 71 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) e is 1, 2, 3, 4, 5, or 6; X2is selected from the group consisting of hydrogen, halogen, C1-6alkyl, C3-7 branched alkyl, C1-6haloalkyl, C3-7 branched haloalkyl, hydroxy, C1-6hydroxyalkyl, C3-7 branched hydroxyalkyl, C1-6alkoxy, C3-7branched alkoxy, C1-6haloalkoxy, C3-7branched haloalkoxy, NH2, NH(C1-6alkyl), N(C1-6alkyl)2, C1-5(COOH), C1-6(NHSO2Me); X3is selected from the group consisting of hydrogen, halogen, C1-5 alkyl, C3-7 branched alkyl, C1-5haloalkyl, C3-7branched haloalkyl, hydroxy, C1-5hydroxyalkyl, C3-7branched hydroxyalkyl, C1-5 alkoxy, C3-7 branched alkoxy, C1-5 haloalkoxy, C3-7 branched haloalkoxy, NH2, NH(C1-6 alkyl), N(C1-6 alkyl)2, COOH, C1-5(COOH), NHSO2Me, C1-5(NHSO2Me); R7is selected from the group consisting of hydrogen, halogen, C1-6alkyl, C3-7branched alkyl, C1-6haloalkyl, C3-7branched haloalkyl, C1-6alkoxyl, C3-7branched alkoxy, and hydroxyl; R8is selected from the group consisting of C1-6 alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, C1-6 hydroxyalkyl, C3-7 branched hydroxyalkyl, C1-6 alkoxyl, C3-7 branched alkoxy, CO(C1-6alkyl), CO(C3-7branched alkyl), SO2(C1-6alkyl),and SO2(C3.7branched alkyl); R9is selected from the group consisting of hydrogen, C1-6 alkyl, and aralkyl.

[0182] In more specific embodiments, a MNK inhibitor is a pyridine-1,5-dione of formula (IA): or a pharmaceutically acceptable salt, ;, ,6alkyl, C3-7branched alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, C1-6 hydroxyalkyl, C3-7 branched hydroxyalkyl, cyano, C1-6 alkoxyl, C3-7 branched alkoxy, hydroxy, and C3-6 cycloalkyl that is optionally Page 72 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) substituted with 1 to 3 substituents selected from the groups consisting of halogen, C1-6alkyl, C1-6haloalkyl, and C1-6 hydroxyalkyl; , , ,hed alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, C1-6 hydroxyalkyl, C3-7 branched hydroxyalkyl, cyano, C1-6alkoxyl, C3-7branched alkoxy , hydroxy, and C3-6cycloalkyl that is optionally substituted with 1 to 3 substituents selected from the groups consisting of halogen, C1-6alkyl, C1-6haloalkyl, and C1-6 hydroxyalkyl; R4ais at each occurrence independently selected from the group consisting of hydrogen, halogen, C1-6alkyl, C3-7branched alkyl, C1-6haloalkyl, C3-7branched haloalkyl, hydroxy, C1-6alkoxyl, C3-7 branched alkoxy, NHCO(C1-6alkyl), NHCO(C3-7 branched alkyl), NHCO(C3-7 cycloalkyl), NHSO2(C1-6alkyl), NHSO2(C3-7 branched alkyl), and NHSO2(C3-7 cycloalkyl); R4bis at each occurrence independently selected from the group consisting of hydrogen, halogen, C1-6alkyl, C3-7branched alkyl, C1-6haloalkyl, C3-7branched haloalkyl, hydroxy, C1-6alkoxyl, C3-7 branched alkoxy, NHCO(C1-6alkyl), NHCO(C3-7 branched alkyl), NHCO(C3-7 cycloalkyl), NHSO2(C1-6alkyl), NHSO2(C3-7branched alkyl), and NHSO2(C3-7cycloalkyl) R4cis at each occurrence independently selected from the group consisting of hydrogen, halogen, C1-6 alkyl, C3-7 branched alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, C1-6 hydroxyalkyl, C3-7 branched hydroxyalkyl, hydroxy, C1-6 alkoxyl, C3-7 branched alkoxy, NHCO(C1-6alkyl), Page 73 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) NHCO(C3-7branched alkyl), NHCO(C3-7cycloalkyl), NHSO2(C1-6alkyl), NHSO2(C3-7branched alkyl), and NHSO2(C3-7 cycloalkyl) R4dis at each occurrence independently selected from the group consisting of hydrogen, halogen, C1-6alkyl, C3-7branched alkyl, C1-6haloalkyl, C3-7branched haloalkyl, C1-6hydroxyalkyl, C3-7 branched hydroxyalkyl, hydroxy, C1-6 alkoxyl, C3-7 branched alkoxy, NHCO(C1-6alkyl), NHCO(C3-7 branched alkyl), NHCO(C3-7 cycloalkyl), NHSO2(C1-6alkyl), NHSO2(C3-7 branched alkyl), and NHSO2(C3-7cycloalkyl); R4eis hydrogen, halogen, C1-6 alkyl, C3-7 branched alkyl, C1-6 haloalkyl, and C3-7 branched haloalkyl; R4fis hydrogen, halogen, C1-6alkyl, C3-7branched alkyl, C1-6haloalkyl, and C3-7branched haloalkyl; R1cand R1dare taken together to form an optionally substituted 3 to 7 membered ring that optionally contains an X1group; X1is selected from the group consisting of CF2, CHCO2R12, O, NH, NR8, and SO2; m is 0, 1, or 2; n1is 1, 2, or 3; R5is selected from the group consisting of hydrogen, halogen, C1-6alkyl, C3-7branched alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, C1-6 alkoxyl, C3-7 branched alkoxy, and hydroxy; R6is selected from the group consisting of hydrogen, NH2, NHR6a, NHCH2CH2OH, NHCH2CH2NHSO2Me, C1-6alkoxyl, C3-7branched alkoxy, and hydroxy; R6ais selected from the group consisting of -(CO)C1-6alkyl, -(CO)C3-7branched alkyl, - , andPage 74 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) q is 1, 2, 3, 4, 5, or 6; e is 1, 2, 3, 4, 5, or 6; X2is selected from the group consisting of hydrogen, halogen, C1-6alkyl, C3-7 branched alkyl, C1-6haloalkyl, C3-7branched haloalkyl, hydroxy, C1-6hydroxyalkyl, C3-7branched hydroxyalkyl, C1-6alkoxy, C3-7 branched alkoxy, C1-6haloalkoxy, C3-7 branched haloalkoxy, NH2, NH(C1-6alkyl), N(C1-6alkyl)2, C1-5(COOH), C1-6(NHSO2Me); X3is selected from the group consisting of hydrogen, halogen, C1-5alkyl, C3-7branched alkyl, C1-5 haloalkyl, C3-7 branched haloalkyl, hydroxy, C1-5 hydroxyalkyl, C3-7 branched hydroxyalkyl, C1-5 alkoxy, C3-7 branched alkoxy, C1-5 haloalkoxy, C3-7 branched haloalkoxy, NH2, NH(C1-6alkyl), N(C1-6alkyl)2, COOH, C1-5(COOH), NHSO2Me, C1-5(NHSO2Me); R7is selected from the group consisting of hydrogen, halogen, C1-6alkyl, C3-7branched alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, C1-6 alkoxyl, C3-7 branched alkoxy, and hydroxy; R8is selected from the group consisting of C1-6 alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, C1-6hydroxyalkyl, C3-7branched hydroxyalkyl, C1-6alkoxyl, C3-7branched alkoxy, CO(C1-6alkyl), CO(C3-7 branched alkyl), SO2(C1-6alkyl),and SO2(C3.7 branched alkyl); R10is selected from the group consisting of hydrogen, C1-6 alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, C1-6hydroxyalkyl, C1-6alkoxyl, C3-7branched alkoxy, CO(C1-6alkyl), CO(C3-7 branched alkyl), SO2(C1-6alkyl),and SO2(C3.7 branched alkyl); R11is selected from the group consisting of hydrogen and C1-6 alkyl; R12is selected from the group consisting of hydrogen and C1-6alkyl.

[0183] The following definitions apply to Formula (I’) and Formula (IA) and subgenera thereof:

[0184] As used herein, the term "halogen" shall mean chlorine, bromine, fluorine and iodine.

[0185] As used herein, unless otherwise noted, “alkyl” and / or “aliphatic” whether used alone or as part of a substituent group refers to straight and branched carbon chains having 1 to 20 carbon atoms or any number within this range, for example, 1 to 6 carbon atoms or 1 to 4 carbon atoms. Designated numbers of carbon atoms (e.g. C1-6) shall refer independently to the number of carbon atoms in an alkyl moiety or to the alkyl portion of a larger alkyl-containing substituent. Non- limiting examples of alkyl groups include methyl, ethyl, n-propyl, iso-propyl, n-butyl, sec-butyl, iso-butyl, tert-butyl, and the like. Alkyl groups can be optionally substituted. Non-limiting examples of substituted alkyl groups include hydroxymethyl, chloromethyl, trifluoromethyl, Page 75 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) aminomethyl, 1-chloroethyl, 2-hydroxyethyl, 1,2-difluoroethyl, 3-carboxypropyl, and the like. In substituent groups with multiple alkyl groups such as (C1-6alkyl)2amino, the alkyl groups may be the same or different.

[0186] As used herein, unless otherwise noted, “hydroxyalkyl” whether used alone or as part of a substituent group refers to straight and branched carbon chains having 1 to 20 carbon atoms or any number within this range, for example, 1 to 6 carbon atoms or 1 to 4 carbon atoms that also contains a hydroxyl substituent. Designated numbers of carbon atoms (e.g. C1-6) shall refer independently to the number of carbon atoms in an alkyl moiety or to the alkyl portion of a larger alkyl-containing substituent. Non-limiting examples of hydroxyalkyl groups include hydroxymethyl, hydroxyethyl, hydroxy-n-propyl, hydroxy-iso-propyl, hydroxy-n-butyl, hydroxy- sec-butyl, hydroxy-iso-butyl and the like. Hydroxyalkyl groups can be optionally substituted. In substituent groups with multiple alkyl groups such as (C2-6hydroxyalkyl)2amino, the hydroxyalkyl groups may be the same or different.

[0187] As used herein, the terms “alkenyl” and “alkynyl” groups, whether used alone or as part of a substituent group, refer to straight and branched carbon chains having 2 or more carbon atoms, preferably 2 to 20, wherein an alkenyl chain has at least one double bond in the chain and an alkynyl chain has at least one triple bond in the chain. Alkenyl and alkynyl groups can be optionally substituted. Nonlimiting examples of alkenyl groups include ethenyl, 3-propenyl, 1- propenyl (also 2-methylethenyl), isopropenyl (also 2-methylethen-2-yl), buten-4-yl, and the like. Nonlimiting examples of substituted alkenyl groups include 2-chloroethenyl (also 2-chlorovinyl), 4-hydroxybuten-1-yl, 7-hydroxy-7-methyloct-4-en-2-yl, 7-hydroxy-7-methyloct-3,5-dien-2-yl, and the like. Nonlimiting examples of alkynyl groups include ethynyl, prop-2-ynyl (also propargyl), propyn-1-yl, and 2-methyl-hex-4-yn-1-yl. Nonlimiting examples of substituted alkynyl groups include, 5-hydroxy-5-methylhex-3-ynyl, 6-hydroxy-6-methylhept-3-yn-2-yl, 5- hydroxy-5-ethylhept-3-ynyl, and the like.

[0188] As used herein, “cycloalkyl,” whether used alone or as part of another group, refers to a non-aromatic carbon-containing ring including cyclized alkyl, alkenyl, and alkynyl groups, e.g., having from 3 to 14 ring carbon atoms, preferably from 3 to 7 or 3 to 6 ring carbon atoms, or even 3 to 4 ring carbon atoms, and optionally containing one or more (e.g., 1, 2, or 3) double or triple bond. Cycloalkyl groups can be monocyclic (e.g., cyclohexyl) or polycyclic (e.g., containing fused, bridged, and / or spiro ring systems), wherein the carbon atoms are located inside or outside Page 76 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) of the ring system. Any suitable ring position of the cycloalkyl group can be covalently linked to the defined chemical structure. Cycloalkyl rings can be optionally substituted. Nonlimiting examples of cycloalkyl groups include: cyclopropyl, 2-methyl-cyclopropyl, cyclopropenyl, cyclobutyl, 2,3-dihydroxycyclobutyl, cyclobutenyl, cyclopentyl, cyclopentenyl, cyclopentadienyl, cyclohexyl, cyclohexenyl, cycloheptyl, cyclooctanyl, decalinyl, 2,5- dimethylcyclopentyl, 3,5-dichlorocyclohexyl, 4-hydroxycyclohexyl, 3,3,5-trimethylcyclohex-1- yl, octahydropentalenyl, octahydro-1H-indenyl, 3a,4,5,6,7,7a-hexahydro-3H-inden-4-yl, decahydroazulenyl; bicyclo[6.2.0]decanyl, decahydronaphthalenyl, and dodecahydro-1H- fluorenyl. The term “cycloalkyl” also includes carbocyclic rings which are bicyclic hydrocarbon rings, non-limiting examples of which include, bicyclo-[2.1.1]hexanyl, bicyclo[2.2.1]heptanyl, bicyclo[3.1.1]heptanyl, 1,3-dimethyl[2.2.1]heptan-2-yl, bicyclo[2.2.2]octanyl, and bicyclo[3.3.3]undecanyl.

[0189] “Haloalkyl” is intended to include both branched and straight-chain saturated aliphatic hydrocarbon groups having the specified number of carbon atoms, substituted with 1 or more halogen. Haloalkyl groups include perhaloalkyl groups, wherein all hydrogens of an alkyl group have been replaced with halogens (e.g., -CF3, -CF2CF3). Haloalkyl groups can optionally be substituted with one or more substituents in addition to halogen. Examples of haloalkyl groups include, but are not limited to, fluoromethyl, dichloroethyl, trifluoromethyl, trichloromethyl, pentafluoroethyl, and pentachloroethyl groups.

[0190] The term “alkoxy” refers to the group –O-alkyl, wherein the alkyl group is as definedabove. Alkoxy groups optionally may be substituted. The term C3-C6 cyclic alkoxy refers to aring containing 3 to 6 carbon atoms and at least one oxygen atom (e.g., tetrahydrofuran, tetrahydro- 2H-pyran). C3-C6 cyclic alkoxy groups optionally may be substituted.

[0191] The term “aryl,” wherein used alone or as part of another group, is defined herein as a an unsaturated, aromatic monocyclic ring of 6 carbon members or to an unsaturated, aromatic polycyclic ring of from 10 to 14 carbon members. Aryl rings can be, for example, phenyl or naphthyl ring each optionally substituted with one or more moieties capable of replacing one or more hydrogen atoms. Non-limiting examples of aryl groups include: phenyl, naphthylen-1-yl, naphthylen-2-yl, 4-fluorophenyl, 2-hydroxyphenyl, 3-methylphenyl, 2-amino-4-fluorophenyl, 2- (N,N-diethylamino)phenyl, 2-cyanophenyl, 2,6-di-tert-butylphenyl, 3-methoxyphenyl, 8- hydroxynaphthylen-2-yl 4,5-dimethoxynaphthylen-1-yl, and 6-cyano-naphthylen-1-yl. Aryl Page 77 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) groups also include, for example, phenyl or naphthyl rings fused with one or more saturated or partially saturated carbon rings (e.g., bicyclo[4.2.0]octa-1,3,5-trienyl, indanyl), which can be substituted at one or more carbon atoms of the aromatic and / or saturated or partially saturated rings.

[0192] The term “arylalkyl” or “aralkyl” refers to the group –alkyl-aryl, where the alkyl and aryl groups are as defined herein. Aralkyl groups of the present disclosure are optionally substituted. Examples of arylalkyl groups include, for example, benzyl, 1-phenylethyl, 2- phenylethyl, 3-phenylpropyl, 2-phenylpropyl, fluorenylmethyl and the like.

[0193] The terms “heterocyclic” and / or “heterocycle” and / or “heterocyclyl,” whether used alone or as part of another group, are defined herein as one or more ring having from 3 to 20 atoms wherein at least one atom in at least one ring is a heteroatom selected from nitrogen (N), oxygen (O), or sulfur (S), and wherein further the ring that includes the heteroatom is non-aromatic. In heterocycle groups that include 2 or more fused rings, the non-heteroatom bearing ring may be aryl (e.g., indolinyl, tetrahydroquinolinyl, chromanyl). Exemplary heterocycle groups have from 3 to 14 ring atoms of which from 1 to 5 are heteroatoms independently selected from nitrogen (N), oxygen (O), or sulfur (S). One or more N or S atoms in a heterocycle group can be oxidized. Heterocycle groups can be optionally substituted.

[0194] Non-limiting examples of heterocyclic units having a single ring include: diazirinyl, aziridinyl, urazolyl, azetidinyl, pyrazolidinyl, imidazolidinyl, oxazolidinyl, isoxazolinyl, isoxazolyl, thiazolidinyl, isothiazolyl, isothiazolinyl oxathiazolidinonyl, oxazolidinonyl, hydantoinyl, tetrahydrofuranyl, pyrrolidinyl, morpholinyl, piperazinyl, piperidinyl, dihydropyranyl, tetrahydropyranyl, piperidin-2-onyl (valerolactam), 2,3,4,5-tetrahydro-1H- azepinyl, 2,3-dihydro-1H-indole, and 1,2,3,4-tetrahydro-quinoline. Non-limiting examples of heterocyclic units having 2 or more rings include: hexahydro-1H-pyrrolizinyl, 3a,4,5,6,7,7a- hexahydro-1H-benzo[d]imidazolyl, 3a,4,5,6,7,7a-hexahydro-1H-indolyl, 1,2,3,4- tetrahydroquinolinyl, chromanyl, isochromanyl, indolinyl, isoindolinyl, and decahydro-1H- cycloocta[b]pyrrolyl.

[0195] The term “heteroaryl,” whether used alone or as part of another group, is defined herein as one or more rings having from 5 to 20 atoms wherein at least one atom in at least one ring is a heteroatom chosen from nitrogen (N), oxygen (O), or sulfur (S), and wherein further at least one of the rings that includes a heteroatom is aromatic. In heteroaryl groups that include 2 or more Page 78 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) fused rings, the non-heteroatom bearing ring may be a carbocycle (e.g., 6,7-Dihydro-5H- cyclopentapyrimidine) or aryl (e.g., benzofuranyl, benzothiophenyl, indolyl). Exemplary heteroaryl groups have from 5 to 14 ring atoms and contain from 1 to 5 ring heteroatoms independently selected from nitrogen (N), oxygen (O), or sulfur (S). One or more N or S atoms in a heteroaryl group can be oxidized. Heteroaryl groups can be substituted. Non-limiting examples of heteroaryl rings containing a single ring include: 1,2,3,4-tetrazolyl, [1,2,3]triazolyl, [1,2,4]triazolyl, triazinyl, thiazolyl, 1H-imidazolyl, oxazolyl, furanyl, thiopheneyl, pyrimidinyl, 2- phenylpyrimidinyl, pyridinyl, 3-methylpyridinyl, and 4-dimethylaminopyridinyl. Non-limiting examples of heteroaryl rings containing 2 or more fused rings include: benzofuranyl, benzothiophenyl, benzoxazolyl, benzthiazolyl, benztriazolyl, cinnolinyl, naphthyridinyl, phenanthridinyl, 7H-purinyl, 9H-purinyl, 6-amino-9H-purinyl, 5H-pyrrolo[3,2-d]pyrimidinyl, 7H-pyrrolo[2,3-d]pyrimidinyl, pyrido[2,3-d]pyrimidinyl, 2-phenylbenzo[d]thiazolyl, 1H-indolyl, 4,5,6,7-tetrahydro-1-H-indolyl, quinoxalinyl, 5-methylquinoxalinyl, quinazolinyl, quinolinyl, 8- hydroxy-quinolinyl, and isoquinolinyl.

[0196] One non-limiting example of a heteroaryl group as described above is C1-C5 heteroaryl, which has 1 to 5 carbon ring atoms and at least one additional ring atom that is a heteroatom (preferably 1 to 4 additional ring atoms that are heteroatoms) independently selected from nitrogen (N), oxygen (O), or sulfur (S). Examples of C1-C5 heteroaryl include, but are not limited to, triazinyl, thiazol-2-yl, thiazol-4-yl, imidazol-1-yl, 1H-imidazol-2-yl, 1H-imidazol-4-yl, isoxazolin-5-yl, furan-2-yl, furan-3-yl, thiophen-2-yl, thiophen-4-yl, pyrimidin-2-yl, pyrimidin-4- yl, pyrimidin-5-yl, pyridin-2-yl, pyridin-3-yl, and pyridin-4-yl.

[0197] Unless otherwise noted, when two substituents are taken together to form a ring having a specified number of ring atoms (e.g., two R groups taken together with the nitrogen (N) to which they are attached to form a ring having from 3 to 7 ring members), the ring can have carbon atoms and optionally one or more (e.g., 1 to 3) additional heteroatoms independently selected from nitrogen (N), oxygen (O), or sulfur (S). The ring can be saturated or partially saturated and can be optionally substituted.

[0198] For the purpose of the present disclosure fused ring units, as well as spirocyclic rings, bicyclic rings and the like, which comprise a single heteroatom will be considered to belong to the cyclic family corresponding to the heteroatom containing ring. For example, 1,2,3,4- tetrahydroquinoline having the formula: Page 79 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) is, for the purposes of the present disclo dered a heterocyclic unit. 6,7-Dihydro-5H- cyclopentapyrimidine having the formula: N is, for the purposes of the present disclos red a heteroaryl unit. When a fused ring unitcontains heteroatoms in both a saturated and an aryl ring, the aryl ring will predominate and determine the type of category to which the ring is assigned. For example, 1,2,3,4-tetrahydro- [1,8]naphthyridine having the formula: H N N is, for the purposes of the present disclosred a heteroaryl unit.

[0199] Whenever a term or either of their prefix roots appear in a name of a substituent the name is to be interpreted as including those limitations provided herein. For example, whenever the term “alkyl” or “aryl” or either of their prefix roots appear in a name of a substituent (e.g., arylalkyl, alkylamino) the name is to be interpreted as including those limitations given above for “alkyl” and “aryl.”

[0200] The term “substituted” is used throughout the specification. The term “substituted” is defined herein as a moiety, whether acyclic or cyclic, which has one or more hydrogen atoms replaced by a substituent or several (e.g., 1 to 10) substituents as defined herein below. The substituents are capable of replacing one or two hydrogen atoms of a single moiety at a time. In addition, these substituents can replace two hydrogen atoms on two adjacent carbons to form said substituent, new moiety or unit. For example, a substituted unit that requires a single hydrogen atom replacement includes halogen, hydroxyl, and the like. A two hydrogen atom replacement includes carbonyl, oximino, and the like. A two hydrogen atom replacement from adjacent carbon atoms includes epoxy, and the like. The term “substituted” is used throughout the present specification to indicate that a moiety can have one or more of the hydrogen atoms replaced by a substituent. When a moiety is described as “substituted” any number of the hydrogen atoms may be replaced. For example, difluoromethyl is a substituted C1 alkyl; trifluoromethyl is a substituted Page 80 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) C1alkyl; 4-hydroxyphenyl is a substituted aromatic ring; (N,N-dimethyl-5-amino)octanyl is a substituted C8 alkyl; 3-guanidinopropyl is a substituted C3 alkyl; and 2-carboxypyridinyl is a substituted heteroaryl.

[0201] The variable groups defined herein, e.g., alkyl, alkenyl, alkynyl, cycloalkyl, alkoxy, aryloxy, aryl, heterocycle and heteroaryl groups defined herein, whether used alone or as part of another group, can be optionally substituted. Optionally substituted groups will be so indicated.

[0202] The following are non-limiting examples of substituents which can substitute for hydrogen atoms on a moiety: halogen (chlorine (Cl), bromine (Br), fluorine (F) and iodine(I)), – CN, –NO2, oxo (=O), –ORx, –SRx, –N(Rx)2, –NRxC(O)Rx, –SO2Rx, –SO2ORx, –SO2N(Rx)2, – C(O)Rx, –C(O)ORx, –C(O)N(Rx)2, C1-6alkyl, C1-6haloalkyl, C1-6alkoxy, C2-8alkenyl, C2-8alkynyl, C3-14cycloalkyl, aryl, heterocycle, or heteroaryl, wherein each of the alkyl, haloalkyl, alkenyl, alkynyl, alkoxy, cycloalkyl, aryl, heterocycle, and heteroaryl groups is optionally substituted with 1-10 (e.g., 1-6 or 1-4) groups selected independently from halogen, –CN, –NO2, oxo, and Rx; wherein Rx, at each occurrence, independently is hydrogen, –ORx+1, –SRx+1, – C(O)Rx+1, –C(O)ORx+1, –C(O)N(Rx+1)2, –SO2Rx+1, -S(O)2ORx+1, –N(Rx+1)2, –NRx+1C(O)Rx+1, C1- 6 alkyl, C1-6 haloalkyl, C2-8 alkenyl, C2-8 alkynyl, cycloalkyl (e.g., C3-6 cycloalkyl), aryl, heterocycle, or heteroaryl, or two Rxunits taken together with the atom(s) to which they are bound form an optionally substituted carbocycle or heterocycle wherein said carbocycle or heterocycle has 3 to 7 ring atoms; wherein Rx+1, at each occurrence, independently is hydrogen, C1-6 alkyl, C1-6haloalkyl, C2-8alkenyl, C2-8alkynyl, cycloalkyl (e.g., C3-6cycloalkyl), aryl, heterocycle, or heteroaryl, or two Rx+1units taken together with the atom(s) to which they are bound form an optionally substituted carbocycle or heterocycle wherein said carbocycle or heterocycle preferably has 3 to 7 ring atoms.

[0203] In some embodiments, the substituents are selected from i) –ORx+2; for example, –OH, –OCH3, –OCH2CH3, –OCH2CH2CH3; ii) –C(O)Rx+2; for example, –COCH3, –COCH2CH3, –COCH2CH2CH3; iii) –C(O)ORx+2; for example, –CO2CH3, –CO2CH2CH3, –CO2CH2CH2CH3; iv) –C(O)N(Rx+2)2; for example, –CONH2, –CONHCH3, –CON(CH3)2; v) –N(Rx+2)2; for example, –NH2, –NHCH3, –N(CH3)2, –NH(CH2CH3); vi) halogen, –F, –Cl, –Br, and –I; Page 81 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) vii) –CHeXg; wherein X is halogen, m is from 0 to 2, e+g =3; for example, –CH2F, – CHF2, –CF3, –CCl3, or –CBr3; viii) –SO2Rx+2; for example, –SO2H; –SO2CH3; –SO2C6H5; ix) C1-C6linear, branched, or cyclic alkyl; x) Cyano xi) Nitro; xii) N(Rx+2)C(O)Rx+2; xiii) Oxo (=O); xiv) Heterocycle; and xv) Heteroaryl. wherein each Rx+2is independently hydrogen, optionally substituted C1-C6linear or branched alkyl (e.g., optionally substituted C1-C4 linear or branched alkyl), or optionally substituted C3-C6 cycloalkyl (e.g optionally substituted C3-C4 cycloalkyl); or two Rx+2units can be taken together to form a ring comprising 3-7 ring atoms. In certain aspects, each Rx+2is independently hydrogen, C1-C6 linear or branched alkyl optionally substituted with halogen or C3-C6 cycloalkyl or C3-C6 cycloalkyl.

[0204] Compounds described herein can contain an asymmetric atom (also referred as a chiral center), and some of the compounds can contain one or more asymmetric atoms or centers, which can thus give rise to optical isomers (enantiomers) and diastereomers. The present teachings and compounds disclosed herein include such enantiomers and diastereomers, as well as the racemic and resolved, enantiomerically pure R and S stereoisomers, as well as other mixtures of the R and S stereoisomers and pharmaceutically acceptable salts thereof. Optical isomers can be obtained in pure form by standard procedures known to those skilled in the art, which include, but are not limited to, diastereomeric salt formation, kinetic resolution, and asymmetric synthesis. The present teachings also encompass cis and trans isomers of compounds containing alkenyl moieties (e.g., alkenes and imines). It is also understood that the present teachings encompass all possible regioisomers, and mixtures thereof, which can be obtained in pure form by standard separation procedures known to those skilled in the art, and include, but are not limited to, column chromatography, thin-layer chromatography, and high-performance liquid chromatography.

[0205] In some embodiments, a MNK inhibitor of the present disclosure is a pyridine-1,5- dione having the formula (I’): Page 82 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) Formula (I’) or a pharmaceutically accepterein: R1is selected from the group consisting of hydrogen, halogen, C1-6 alkyl, C3-7 branched alkyl, C1-6haloalkyl, C3-7branched haloalkyl, C1-6hydroxyalkyl, C3-7branched hydroxyalkyl, cyano, C1-6alkoxyl, C3-7branched alkoxy, hydroxy, and C3-6cycloalkyl that is optionally substituted with 1 to 3 substituents selected from the groups consisting of halogen, C1-6 alkyl, C1-6 haloalkyl, and C1-6 hydroxyalkyl; , , ,hed alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, C1-6 hydroxyalkyl, C3-7 branched hydroxyalkyl, cyano, C1-6alkoxyl, C3-7branched alkoxy, hydroxy, and C3-6cycloalkyl that is optionally substituted with 1 to 3 substituents selected from the groups consisting of halogen, C1-6alkyl, C1-6haloalkyl, and C1-6 hydroxyalkyl; Page 83 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) R1cand R1dare taken together to form a 3- to 7-membered ring having 0-2 heteroatoms selected from the group consisting of N, O and S, wherein the 3- to 7-membered ring may be further optionally substituted with one or more substituents selected from the group consisting of halo, oxo, C1-6alkyl, R8, and –C(=O)OR9; Z1and Z2are each independently a direct bond or –{C(R4a)(R4b)}p–Y1–; wherein p is 0, 1, 2, 3, 4, or 5, Y1is a direct bond, –O–, or –N(R8)–; R4ais at each occurrence independently selected from the group consisting of hydrogen, halogen, C1-6 alkyl, C3-7 branched alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, hydroxy, C1-6 alkoxyl, C3-7 branched alkoxy, NHCO(C1-6alkyl), NHCO(C3-7 branched alkyl), NHCO(C3-7 cycloalkyl), NHSO2(C1-6alkyl), NHSO2(C3-7branched alkyl), and NHSO2(C3-7cycloalkyl); or two R4aattached to two adjacent carbons to form a direct bond; R4bis at each occurrence independently selected from the group consisting of hydrogen, halogen, C1-6 alkyl, C3-7 branched alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, hydroxy, C1-6 alkoxyl, C3-7branched alkoxy, NHCO(C1-6alkyl), NHCO(C3-7branched alkyl), NHCO(C3-7cycloalkyl), NHSO2(C1-6alkyl), NHSO2(C3-7 branched alkyl), and NHSO2(C3-7 cycloalkyl); R5is selected from the group consisting of hydrogen, halogen, C1-6 alkyl, C3-7 branched alkyl, C1-6haloalkyl, C3-7branched haloalkyl, C1-6alkoxyl, C3-7branched alkoxy, and hydroxy; R6is selected from the group consisting of hydrogen, NH2, NHR6a, NHCH2CH2OH, NHCH2CH2NHSO2Me, C1-6 alkoxyl, C3-7 branched alkoxy, and hydroxy; R6ais selected from the group consisting of -(CO)C1-6alkyl, -(CO)C3-7branched alkyl, - , andq , , , , , ; Page 84 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) e is 1, 2, 3, 4, 5, or 6; X2is selected from the group consisting of hydrogen, halogen, C1-6alkyl, C3-7 branched alkyl, C1-6haloalkyl, C3-7 branched haloalkyl, hydroxy, C1-6hydroxyalkyl, C3-7 branched hydroxyalkyl, C1-6alkoxy, C3-7branched alkoxy, C1-6haloalkoxy, C3-7branched haloalkoxy, NH2, NH(C1-6alkyl), N(C1-6alkyl)2, C1-5(COOH), C1-6(NHSO2Me); X3is selected from the group consisting of hydrogen, halogen, C1-5 alkyl, C3-7 branched alkyl, C1-5haloalkyl, C3-7branched haloalkyl, hydroxy, C1-5hydroxyalkyl, C3-7branched hydroxyalkyl, C1-5 alkoxy, C3-7 branched alkoxy, C1-5 haloalkoxy, C3-7 branched haloalkoxy, NH2, NH(C1-6 alkyl), N(C1-6 alkyl)2, COOH, C1-5(COOH), NHSO2Me, C1-5(NHSO2Me); R7is selected from the group consisting of hydrogen, halogen, C1-6alkyl, C3-7branched alkyl, C1-6haloalkyl, C3-7branched haloalkyl, C1-6alkoxyl, C3-7branched alkoxy, and hydroxyl; R8is selected from the group consisting of C1-6 alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, C1-6 hydroxyalkyl, C3-7 branched hydroxyalkyl, C1-6 alkoxyl, C3-7 branched alkoxy, CO(C1-6alkyl), CO(C3-7branched alkyl), SO2(C1-6alkyl),and SO2(C3.7branched alkyl); R9is selected from the group consisting of hydrogen, C1-6 alkyl, and aralkyl.

[0206] In more specific embodiments, the compound exhibiting MNK inhibition has the following structure, represented by Formula (IA): or a pharmaceutically acceptable salt, ;, , -6 alkyl, C3-7 branched alkyl, C1-6haloalkyl, C3-7branched haloalkyl, C1-6hydroxyalkyl, C3-7branched hydroxyalkyl, cyano, C1-6 alkoxyl, C3-7 branched alkoxy, hydroxy, and C3-6 cycloalkyl that is optionally Page 85 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) substituted with 1 to 3 substituents selected from the groups consisting of halogen, C1-6alkyl, C1-6haloalkyl, and C1-6 hydroxyalkyl; , , ,hed alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, C1-6 hydroxyalkyl, C3-7 branched hydroxyalkyl, cyano, C1-6alkoxyl, C3-7branched alkoxy , hydroxy, and C3-6cycloalkyl that is optionally substituted with 1 to 3 substituents selected from the groups consisting of halogen, C1-6alkyl, C1-6haloalkyl, and C1-6 hydroxyalkyl; R4ais at each occurrence independently selected from the group consisting of hydrogen, halogen, C1-6alkyl, C3-7branched alkyl, C1-6haloalkyl, C3-7branched haloalkyl, hydroxy, C1-6alkoxyl, C3-7 branched alkoxy, NHCO(C1-6alkyl), NHCO(C3-7 branched alkyl), NHCO(C3-7 cycloalkyl), NHSO2(C1-6alkyl), NHSO2(C3-7 branched alkyl), and NHSO2(C3-7 cycloalkyl); R4bis at each occurrence independently selected from the group consisting of hydrogen, halogen, C1-6alkyl, C3-7branched alkyl, C1-6haloalkyl, C3-7branched haloalkyl, hydroxy, C1-6alkoxyl, C3-7 branched alkoxy, NHCO(C1-6alkyl), NHCO(C3-7 branched alkyl), NHCO(C3-7 cycloalkyl), NHSO2(C1-6alkyl), NHSO2(C3-7branched alkyl), and NHSO2(C3-7cycloalkyl); R4cis at each occurrence independently selected from the group consisting of hydrogen, halogen, C1-6 alkyl, C3-7 branched alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, C1-6 hydroxyalkyl, C3-7 branched hydroxyalkyl, hydroxy, C1-6 alkoxyl, C3-7 branched alkoxy, NHCO(C1-6alkyl), Page 86 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) NHCO(C3-7branched alkyl), NHCO(C3-7cycloalkyl), NHSO2(C1-6alkyl), NHSO2(C3-7branched alkyl), and NHSO2(C3-7 cycloalkyl); R4dis at each occurrence independently selected from the group consisting of hydrogen, halogen, C1-6alkyl, C3-7branched alkyl, C1-6haloalkyl, C3-7branched haloalkyl, C1-6hydroxyalkyl, C3-7 branched hydroxyalkyl, hydroxy, C1-6 alkoxyl, C3-7 branched alkoxy, NHCO(C1-6alkyl), NHCO(C3-7 branched alkyl), NHCO(C3-7 cycloalkyl), NHSO2(C1-6alkyl), NHSO2(C3-7 branched alkyl), and NHSO2(C3-7cycloalkyl); R4eis hydrogen, halogen, C1-6 alkyl, C3-7 branched alkyl, C1-6 haloalkyl, and C3-7 branched haloalkyl; R4fis hydrogen, halogen, C1-6alkyl, C3-7branched alkyl, C1-6haloalkyl, and C3-7branched haloalkyl; R1cand R1dare taken together to form an optionally substituted 3 to 7 membered ring that optionally contains an X1group forming a part of the ring; X1is selected from the group consisting of –C(F)2–, –CH(CO2R12)–, –O–, –NH–, –N(R8)– , and –S(=O)2–; m is 0, 1, or 2; n1is 1, 2, or 3; R5is selected from the group consisting of hydrogen, halogen, C1-6 alkyl, C3-7 branched alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, C1-6 alkoxyl, C3-7 branched alkoxy, and hydroxy; R6is selected from the group consisting of hydrogen, NH2, NHR6a, NHCH2CH2OH, NHCH2CH2NHSO2Me, C1-6alkyl, C3-7branched alkyl, C1-6alkoxyl, C3-7branched alkoxy, and hydroxy; R6ais selected from the group consisting of -(CO)C1-6 alkyl, -(CO)C3-7 branched alkyl, - (CO)C1-6hydroxyalkyl, ,Page 87 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) ande is 1, 2, 3, 4, 5, or 6; X2is selected from the group consisting of hydrogen, halogen, C1-6alkyl, C3-7 branched alkyl, C1-6haloalkyl, C3-7branched haloalkyl, hydroxy, C1-6hydroxyalkyl, C3-7branched hydroxyalkyl, C1-6alkoxy, C3-7branched alkoxy, C1-6haloalkoxy, C3-7branched haloalkoxy, NH2, NH(C1-6alkyl), N(C1-6alkyl)2, C1-5(COOH), C1-6(NHSO2Me); X3is selected from the group consisting of hydrogen, halogen, C1-5alkyl, C3-7branched alkyl, C1-5haloalkyl, C3-7branched haloalkyl, hydroxy, C1-5hydroxyalkyl, C3-7branched hydroxyalkyl, C1-5 alkoxy, C3-7 branched alkoxy. C1-5 haloalkoxy, C3-7 branched haloalkoxy. NH2, NH(C1-6alkyl), N(C1-6alkyl)2, COOH, C1-5(COOH), NHSO2Me, C1-5(NHSO2Me); R7is selected from the group consisting of hydrogen, halogen, C1-6alkyl, C3-7branched alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, C1-6 alkoxyl, C3-7 branched alkoxy, and hydroxy; R8is selected from the group consisting of C1-6 alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, C1-6hydroxyalkyl, C3-7branched hydroxyalkyl, C1-6alkoxyl, C3-7branched alkoxy, CO(C1-6alkyl), CO(C3-7 branched alkyl), SO2(C1-6alkyl),and SO2(C3.7 branched alkyl); R10is selected from the group consisting of hydrogen. C1-6 alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, C1-6hydroxyalkyl, C1-6alkoxyl, C3-7branched alkoxy, CO(C1-6alkyl), CO(C3-7branched alkyl), SO2(C1-6alkyl),and SO2(C3.7branched alkyl). R11is selected from the group consisting of hydrogen and C1-6 alkyl; R12is selected from the group consisting of hydrogen and C1-6alkyl.

[0207] In more specific embodiments, the compounds of the present disclosure include compounds having formula (IIA): Page 88 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) 3'R5R O R1Z11dor a pharmaceutically acceptab4d 4c 1 1 5 6 7, R , R , n, Z, R, R and R are as defined herein.

[0208] In more specific embodiments, the compounds of the present disclosure include compounds having formula (III): or a pharmaceutically acceptabR3’, R4d, R4c, n1, Z1, and R6are as defined herein.

[0209] In more specific embodiments, the compounds of the present disclosure include compounds having formula (IV):Page 89 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) or a pharmaceutically acceptable salt thereof. R1c, R1d, R1, R3’, R4d, R4c, n1, Z1, and R6are as defined herein.

[0210] In more specific embodiments, the compounds of the present disclosure include compounds having formula (V): or a pharmaceutically accepta3’ 4d 4c 1 1 6R , R , R , n , Z , and R are as defined herein.

[0211] In more specific embodiments, the compounds of the present disclosure include compounds having formula (VI):, R1, R2’, R3’, R4d, R4c, n1, and Z1are as defined herein; R8ais at each occurrence independently selected from the group consisting of hydrogen, halogen, C1-6alkyl, C3-7branched alkyl, C1-6haloalkyl, C3-7branched haloalkyl, C1-6hydroxyalkyl, C3-7 branched hydroxyalkyl, hydroxy, C1-6 alkoxyl, C3-7 branched alkoxy, NHCO(C1-6alkyl), NHCO(C3-7 branched alkyl),NHSO2(C1-6alkyl), and NHSO2(C3-7 branched alkyl); Page 90 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) R8bis at each occurrence independently selected from the group consisting of hydrogen, halogen, C1-6 alkyl, C3-7 branched alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, C1-6 hydroxyalkyl, C3-7 branched hydroxyalkyl, hydroxy, C1-6 alkoxyl, C3-7 branched alkoxy, NHCO(C1-6alkyl), NHCO(C3-7branched alkyl), NHSO2(C1-6alkyl), and NHSO2(C3-7branched alkyl); R8cis at each occurrence independently selected from the group consisting of hydrogen, halogen, C1-6 alkyl, C3-7 branched alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, C1-6 hydroxyalkyl, C3-7branched hydroxyalkyl, hydroxy, C1-6alkoxyl, C3-7branched alkoxy, NHCO(C1-6alkyl), NHCO(C3-7 branched alkyl), NHSO2(C1-6alkyl), and NHSO2(C3-7 branched alkyl); R8dis at each occurrence independently selected from the group consisting of hydrogen, halogen, C1-6alkyl, C3-7branched alkyl, C1-6haloalkyl, C3-7branched haloalkyl, C1-6hydroxyalkyl, C3-7branched hydroxyalkyl, hydroxy, C1-6alkoxyl, C3-7branched alkoxy, NHCO(C1-6alkyl), NHCO(C3-7 branched alkyl), NHSO2(C1-6alkyl), and NHSO2(C3-7 branched alkyl); R9ais selected from the group consisting of hydrogen, halogen, C1-6 alkyl, C3-7 branched alkyl, C1-6haloalkyl, C3-7branched haloalkyl, C1-6hydroxyalkyl, C3-7branched hydroxyalkyl, hydroxy, C1-6 alkoxyl, and C3-7 branched alkoxy; R9bis selected from the group consisting of hydrogen, halogen, C1-6 alkyl, C3-7 branched alkyl, C1-6haloalkyl, C3-7branched haloalkyl, C1-6hydroxyalkyl, C3-7branched hydroxyalkyl, hydroxy, C1-6 alkoxyl, and C3-7 branched alkoxy; R9aand R9bare taken together to form an optionally substituted 3 to 7-membered ring; q is 1, 2, or 3; and z is 0, 1, or 2.

[0212] In more specific embodiments, the compounds of the present disclosure include compounds having formula (VII): Page 91 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) or a pharmaceutically acceptablR1, R2’, R3’, R4d, R4c, Z1, X1and n1are as defined herein; R8ais at each occurrence independently selected from the group consisting of hydrogen, halogen, C1-6alkyl, C3-7branched alkyl, C1-6haloalkyl, C3-7branched haloalkyl, C1-6hydroxyalkyl, C3-7 branched hydroxyalkyl, hydroxy, C1-6 alkoxyl, C3-7 branched alkoxy, NHCO(C1-6alkyl), NHCO(C3-7branched alkyl),NHSO2(C1-6alkyl), and NHSO2(C3-7branched alkyl); R8bis at each occurrence independently selected from the group consisting of hydrogen, halogen, C1-6 alkyl, C3-7 branched alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, C1-6 hydroxyalkyl, C3-7 branched hydroxyalkyl, hydroxy, C1-6 alkoxyl, C3-7 branched alkoxy, NHCO(C1-6alkyl), NHCO(C3-7branched alkyl), NHSO2(C1-6alkyl), and NHSO2(C3-7branched alkyl); R8cis at each occurrence independently selected from the group consisting of hydrogen, halogen, C1-6 alkyl, C3-7 branched alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, C1-6 hydroxyalkyl, C3-7branched hydroxyalkyl, hydroxy, C1-6alkoxyl, C3-7branched alkoxy, NHCO(C1-6alkyl), NHCO(C3-7branched alkyl), NHSO2(C1-6alkyl), and NHSO2(C3-7branched alkyl); R8dis at each occurrence independently selected from the group consisting of hydrogen, halogen, C1-6alkyl, C3-7branched alkyl, C1-6haloalkyl, C3-7branched haloalkyl, C1-6hydroxyalkyl, C3-7branched hydroxyalkyl, hydroxy, C1-6alkoxyl, C3-7branched alkoxy, NHCO(C1-6alkyl), NHCO(C3-7 branched alkyl), NHSO2(C1-6alkyl), and NHSO2(C3-7 branched alkyl); q is 1, 2, or 3; and z is 0, 1, or 2.

[0213] In more specific embodiments, the compounds of the present disclosure include compounds having formula (VIII): Page 92 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) R3'R5O R1bqor a pharmaceutically acceR1, R3’, R4d, R4c, Z1, R5, R6, R7, and n1are as defined herein; R8ais at each occurrence independently selected from the group consisting of hydrogen, halogen, C1-6 alkyl, C3-7 branched alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, C1-6 hydroxyalkyl, C3-7branched hydroxyalkyl, hydroxy, C1-6alkoxyl, C3-7branched alkoxy, NHCO(C1-6alkyl), NHCO(C3-7branched alkyl),NHSO2(C1-6alkyl), and NHSO2(C3-7branched alkyl); R8bis at each occurrence independently selected from the group consisting of hydrogen, halogen, C1-6 alkyl, C3-7 branched alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, C1-6 hydroxyalkyl, C3-7branched hydroxyalkyl, hydroxy, C1-6alkoxyl, C3-7branched alkoxy, NHCO(C1-6alkyl), NHCO(C3-7 branched alkyl), NHSO2(C1-6alkyl), and NHSO2(C3-7 branched alkyl); R8cis at each occurrence independently selected from the group consisting of hydrogen, halogen, C1-6alkyl, C3-7branched alkyl, C1-6haloalkyl, C3-7branched haloalkyl, C1-6hydroxyalkyl, C3-7branched hydroxyalkyl, hydroxy, C1-6alkoxyl, C3-7branched alkoxy, NHCO(C1-6alkyl), NHCO(C3-7 branched alkyl), NHSO2(C1-6alkyl), and NHSO2(C3-7 branched alkyl); R8dis at each occurrence independently selected from the group consisting of hydrogen, halogen, C1-6alkyl, C3-7branched alkyl, C1-6haloalkyl, C3-7branched haloalkyl, C1-6hydroxyalkyl, C3-7 branched hydroxyalkyl, hydroxy, C1-6 alkoxyl, C3-7 branched alkoxy, NHCO(C1-6alkyl), NHCO(C3-7 branched alkyl), NHSO2(C1-6alkyl), and NHSO2(C3-7 branched alkyl); R9ais selected from the group consisting of hydrogen, halogen, C1-6alkyl, C3-7branched alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, C1-6 hydroxyalkyl, C3-7 branched hydroxyalkyl, Page 93 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) hydroxy, C1-6alkoxyl, C3-7branched alkoxy, NHCO(C1-6alkyl), NHCO(C3-7branched alkyl),NHSO2(C1-6alkyl), and NHSO2(C3-7 branched alkyl); R9bis selected from the group consisting of hydrogen, halogen, C1-6 alkyl, C3-7 branched alkyl, C1-6haloalkyl, C3-7branched haloalkyl, C1-6hydroxyalkyl, C3-7branched hydroxyalkyl, hydroxy, C1-6 alkoxyl, C3-7 branched alkoxy, NHCO(C1-6alkyl), NHCO(C3-7 branched alkyl),NHSO2(C1-6alkyl), and NHSO2(C3-7 branched alkyl); q is 1, 2, or 3; and z is 0, 1, or 2.

[0214] In more specific embodiments, the compounds of the present disclosure include compounds having formula (IX): or a pharmaceutically accep, R6, R8a, R8b, R8c, R8d, n1and z are as defined herein.

[0215] In more specific embodiments, the compounds of the present disclosure include compounds having formula (X): Page 94 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) or a pharmaceutically acce R6, R8a, R8b, R8c, R8d, R9a, R9b,n1and z are as defined herein.

[0216] In more specific embodiments, the compounds of the present disclosure include compounds having formula (XI): or a pharmaceutically acce, , , , , R6, R8a, R8b, R8c, R8d, R9a, R9b, n1and z are as defined herein.

[0217] In more specific embodiments, the compounds of the present disclosure include compounds having formula (XII): Page 95 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) or a pharmaceutically acceR1, R3’, R4d, R4c, Z1, R5, R6, R7, X1, and n1are as defined herein; R8ais at each occurrence independently selected from the group consisting of hydrogen, halogen, C1-6alkyl, C3-7branched alkyl, C1-6haloalkyl, C3-7branched haloalkyl, C1-6hydroxyalkyl, C3-7 branched hydroxyalkyl, hydroxy, C1-6 alkoxyl, C3-7 branched alkoxy, NHCO(C1-6alkyl), NHCO(C3-7branched alkyl),NHSO2(C1-6alkyl), and NHSO2(C3-7branched alkyl); R8bis at each occurrence independently selected from the group consisting of hydrogen, halogen, C1-6 alkyl, C3-7 branched alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, C1-6 hydroxyalkyl, C3-7 branched hydroxyalkyl, hydroxy, C1-6 alkoxyl, C3-7 branched alkoxy, NHCO(C1-6alkyl), NHCO(C3-7branched alkyl), NHSO2(C1-6alkyl), and NHSO2(C3-7branched alkyl); R8cis at each occurrence independently selected from the group consisting of hydrogen, halogen, C1-6 alkyl, C3-7 branched alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, C1-6 hydroxyalkyl, C3-7branched hydroxyalkyl, hydroxy, C1-6alkoxyl, C3-7branched alkoxy, NHCO(C1-6alkyl), NHCO(C3-7branched alkyl), NHSO2(C1-6alkyl), and NHSO2(C3-7branched alkyl); R8dis at each occurrence independently selected from the group consisting of hydrogen, halogen, C1-6alkyl, C3-7branched alkyl, C1-6haloalkyl, C3-7branched haloalkyl, C1-6hydroxyalkyl, C3-7branched hydroxyalkyl, hydroxy, C1-6alkoxyl, C3-7branched alkoxy, NHCO(C1-6alkyl), NHCO(C3-7 branched alkyl), NHSO2(C1-6alkyl), and NHSO2(C3-7 branched alkyl); q is 1, 2, or 3; and z is 0, 1, or 2.

[0218] In more specific embodiments, the compounds of the present disclosure include compounds having formula (XIII): Page 96 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) or a pharmaceutically acce1 6 8a 8b 8c 8d 1 1, R, R , R , R , R , X, n and z are as defined herein.

[0219] In more specific embodiments, the compounds of the present disclosure include compounds having formula (XIV): or a pharmaceutically acce. , , , ,1, R6, R8a, R8b, R8c, R8d, X1, n1and z are as defined herein.

[0220] In more specific embodiments, the compounds of the present disclosure include compounds having formula (XV): Page 97 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) or a pharmaceutically acce1 6 8a 8b 8c 8d 1 1, R, R , R , R , R , X, n and z are as defined herein.

[0221] In more specific embodiments, the compounds of the present disclosure include compounds having formula (XVI): or a pharmaceutically accepR4d, R4c, R4e, R4f, R5, R6, R7and n1are as defined herein.

[0222] The compounds of the present disclosure include compounds having formula (XV):Page 98 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) or a pharmaceutically acceptable salt thereof. R1c, R1d, R1, R3’, R4d, R4c, R4e, R4f, R6, and n1are as defined herein.

[0223] In more specific embodiments, the compounds of the present disclosure include compounds having formula (XVI): or a pharmaceutically accepta R4d, R4c,4e 4f 6 1R , R , R , and n are as defined herein.

[0224] In more specific embodiments, the compounds of the present disclosure include compounds having formula (XVII): R3'O R14e4for a pharmaceutically accepta, , , , R4d, R4c, R4e, R4f, R6, and n1are as defined herein.

[0225] In more specific embodiments, the compounds of the present disclosure include compounds having formula (XVIII): Page 99 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) or a pharmaceutically acce4a 4b 4d 4c 5 6 7, R , R , R , R, R, R, m and n1are as defined herein.

[0226] In more specific embodiments, the compounds of the present disclosure include compounds having formula (XIX): or a pharmaceutically accepd, R4c, R4a, R4b, R6, m and n1are as defined herein.

[0227] In more specific embodiments, the compounds of the present disclosure include compounds having formula (XX):Page 100 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) or a pharmaceutically acceptable salt thereof. R1c, R1d, R1, R3’, R4d, R4c, R4a, R4b, R6, m and n1are as defined herein.

[0228] In more specific embodiments, the compounds of the present disclosure include compounds having formula (XX): or a pharmaceutically accepd, R4c, R4a, R4b, R6, m a1nd n are as defined herein.

[0229] In more specific embodiments, the compounds of the present disclosure include compounds having formula (XXI): or a pharmaceutically acceptabl. , , , , R4c, R4e, R4f, R8a, R8b, R8c, R8d, R9a, R9b, n1, q and z are as defined herein.

[0230] In more specific embodiments, the compounds of the present disclosure include compounds having formula (XXII): Page 101 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) or a pharmaceutically acceptabl4c 4e 4f 8a 8b 8c 8d 9aR , R , R , R , R , R , R , R , R9b, m, n1, q and z are as defined herein.

[0231] In more specific embodiments, the compounds of the present disclosure include compounds having formula (XXIII): or a pharmaceutically acceptable. , , ,d, R4c, R4e, R4f, R8a, R8b, R8c, R8d, X1, n1, q and z are as defined herein.

[0232] In more specific embodiments, the compounds of the present disclosure include compounds having formula (XXIV): Page 102 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) or a pharmaceutically acceptabled, R4c, R4e, R4f, R8a, R8b, R8c, R8d, X1,m, n1, q and z are as defined herein.

[0233] In more specific embodiments, the compounds of the present disclosure include compounds having formula (XXV): or a pharmaceutically acce, , , , , R4f, R5, R6, R7, R8a, R8b, R8c, R8d, R9a, R9b, n1, q and z are as defined herein.

[0234] In more specific embodiments, the compounds of the present disclosure include compounds having formula (XXVI): Page 103 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) or a pharmaceutically accep , R4f, R6, R8a, R8b, R8c, R8d, R9a,R9b, n1, q and z are as defined herein.

[0235] In more specific embodiments, the compounds of the present disclosure include compounds having formula (XXVII): or a pharmaceutically accep, R4f, R6, R8a, R8b, R8c, R8d, R9a, R9b, n1, q and z are as defined herein.

[0236] In more specific embodiments, the compounds of the present disclosure include compounds having formula (XXVIII): Page 104 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) or a pharmaceutically accep , R4f, R6, R8a, R8b, R8c, R8d, R9a,R9b, n1, q and z are as defined herein.

[0237] In more specific embodiments, the compounds of the present disclosure include compounds having formula (XXIX): or a pharmaceutically acced, R4c, R5, R6, R7, R8a, R8b, R8c, R8d, R9a, R9b, m, n1, q and z are as defined herein.

[0238] In more specific embodiments, the compounds of the present disclosure include compounds having formula (XXX): Page 105 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) or a pharmaceutically acce R4c, R6, R8a, R8b, R8c, R8d, R9a,R9b, m, n1, q and z are as defined herein.

[0239] In more specific embodiments, the compounds of the present disclosure include compounds having formula (XXXI): or a pharmaceutically acce, , , , , R4c, R6, R8a, R8b, R8c, R8d, R9a, R9b, m, n1, q and z are as defined herein.

[0240] In more specific embodiments, the compounds of the present disclosure include compounds having formula (XXXII): Page 106 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) or a pharmaceutically acce , R4c, R6, R8a, R8b, R8c, R8d, R9a,R9b, m, n1, q and z are as defined herein.

[0241] In more specific embodiments, the compounds of the present disclosure include compounds having formula (XXXIII): or a pharmaceutically acce. , , , ,e, R4f, R5, R6, R7, R8a, R8b, R8c, R8d, X1, n1, q and z are as defined herein.

[0242] In more specific embodiments, the compounds of the present disclosure include compounds having formula (XXXIV): Page 107 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) or a pharmaceutically accepe 4f 6 8a 8b 8c 8d 1, R , R, R , R , R , R , X, n1, q and z are as defined herein.

[0243] In more specific embodiments, the compounds of the present disclosure include compounds having formula (XXXV): R3'O R1bqor a pharmaceutically accep. , , , ,e, R4f, R6, R8a, R8b, R8c, R8d, X1, n1, q and z are as defined herein.

[0244] In more specific embodiments, the compounds of the present disclosure include compounds having formula (XXXVI): Page 108 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) or a pharmaceutically acce4b 5 6 7 8a 8b 8c, R , R, R, R, R , R , R , R8d, X1, m, n1, q and z are as defined herein.

[0245] In more specific embodiments, the compounds of the present disclosure include compounds having formula (XXXVII): R3'O R1m q or a pharmaceutically accep. , , , , , R4b, R6, R8a, R8b, R8c, R8d, X1, m, n1, q and z are as defined herein.

[0246] In more specific embodiments, the compounds of the present disclosure include compounds having formula (XXXVIII): Page 109 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) or a pharmaceutically accep4b 6 8a 8b 8c 8d 1, R , R, R , R , R , R , X, m, n1, q and z are as defined herein.

[0247] In more specific embodiments, the compounds of the present disclosure include compounds having formula (XXXVIIII) through (LI): R3'O N R1Page 110 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) , o

[0248] In some embodiments, Z1i . In some embodiments, Z1.

[0249] In some embodiments, R1. In some embodiments, R1is. In some embodiments, R1is C1-6 alkyl. In some embodiments, R1is C3-7 branched alkyl. In some embodiments, R1is C1-6 haloalkyl. In some embodiments, R1is C3-7 branched haloalkyl. In some embodiments, R1is C1-6hydroxyalkyl. In some embodiments, R1is C3-7branched hydroxyalkyl. In some embodiments, R1is cyano. In some embodiments, R1is C1-6alkoxyl. In some embodiments, R1is C3-7 branched alkoxy. In some embodiments, R1is hydroxy. In some embodiments, R1is C3-6cycloalkyl. In some embodiments, R1is C3-6cycloalkyl that is substituted 1 substituent selected from the groups consisting of halogen, C1-6alkyl, C1-6haloalkyl, and C1-6hydroxyalkyl. In some embodiments, R1is C3-6 cycloalkyl that is substituted 2 substituents selected from the groups consisting of halogen, C1-6 alkyl, C1-6 haloalkyl, and C1-6 hydroxyalkyl. In some embodiments, R1is C3-6cycloalkyl that is substituted 3 substituents selected from the groups consisting of halogen, C1-6 alkyl, C1-6 haloalkyl, and C1-6 hydroxyalkyl. Page 111 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666)

[0250] In some embodiments, . In some embodiments, R2’is NIn some embodiments, R2’isH N ’ isIn some embodiments, R2’is. In some embodiments, R2’is. In some embodiments, R2’is. In some embodiments,nts,, y g . , g . me embodiments, R3’is C1-6alkyl. In some embodiments, R3’is C3-7branched alkyl. In some embodiments, R3’is C1-6haloalkyl. In some embodiments, R3’is C3-7branched haloalkyl. In some embodiments, R3’is C1-6 hydroxyalkyl. In some embodiments, R3’is C3-7 branched hydroxyalkyl. In some embodiments, R3’is cyano. In some embodiments, R3’is C1-6 alkoxyl. In some Page 112 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) embodiments, R3’is C3-7branched alkoxy. In some embodiments, R3’is hydroxy. In some embodiments, R3’is C3-6 cycloalkyl. In some embodiments, R3’is C3-6 cycloakyl that is substituted with 1 substituent selected from the groups consisting of halogen, C1-6 alkyl, C1-6 haloalkyl, and C1-6hydroxyalkyl. In some embodiments, R3’is C3-6cycloakyl that is substituted with 2 substituent selected from the groups consisting of halogen, C1-6 alkyl, C1-6 haloalkyl, and C1-6 hydroxyalkyl. In some embodiments, R3’is C3-6 cycloakyl that is substituted with 3 substituent selected from the groups consisting of halogen, C1-6alkyl, C1-6haloalkyl, and C1-6hydroxyalkyl.

[0252] In some embodiments, R4ais hydrogen. In some embodiments, R4ais halogen. In some embodiments, R4ais C1-6 alkyl. In some embodiments, R4ais C3-7 branched alkyl. In some embodiments, R4ais C1-6haloalkyl. In some embodiments, R4ais C3-7branched haloalkyl. In some embodiments, R4ais hydroxy. In some embodiments, R4ais C1-6alkoxyl. In some embodiments, R4ais C3-7 branched alkoxy. In some embodiments, R4ais NHCO(C1-6alkyl). In some embodiments, R4ais NHCO(C3-7 branched alkyl). In some embodiments, R4ais NHCO(C3-7 cycloalkyl). In some embodiments, R4ais NHSO2(C1-6alkyl). In some embodiments, R4ais NHSO2(C3-7branched alkyl). In some embodiments, R4ais NHSO2(C3-7 cycloalkyl).

[0253] In some embodiments, R4bis hydrogen. In some embodiments, R4bis halogen. In some embodiments, R4bis C1-6alkyl. In some embodiments, R4bis C3-7branched alkyl. In some embodiments, R4bis C1-6 haloalkyl. In some embodiments, R4bis C3-7 branched haloalkyl. In some embodiments, R4bis hydroxy. In some embodiments, R4bis C1-6 alkoxyl. In some embodiments, R4bis C3-7branched alkoxy. In some embodiments, R4bis NHCO(C1-6alkyl). In some embodiments, R4bis NHCO(C3-7branched alkyl). In some embodiments, R4bis NHCO(C3-7cycloalkyl). In some embodiments, R4bis NHSO2(C1-6alkyl). In some embodiments, R4bis NHSO2(C3-7 branched alkyl). In some embodiments, R4bis NHSO2(C3-7 cycloalkyl).

[0254] In some embodiments, R4cis hydrogen. In some embodiments, R4cis halogen. In some embodiments, R4cis C1-6 alkyl. In some embodiments, R4cis C3-7 branched alkyl. In some embodiments, R4cis C1-6 haloalkyl. In some embodiments, R4cis C3-7 branched haloalkyl. In some embodiments, R4cis hydroxy. In some embodiments, R4cis C1-6alkoxyl. In some embodiments, R4cis C3-7 branched alkoxy. In some embodiments, R4cis NHCO(C1-6alkyl). In some embodiments, R4cis NHCO(C3-7 branched alkyl). In some embodiments, R4cis NHCO(C3-7 cycloalkyl). In some embodiments, R4cis NHSO2(C1-6alkyl). In some embodiments, R4cis NHSO2(C3-7branched alkyl). In some embodiments, R4cis NHSO2(C3-7cycloalkyl). Page 113 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666)

[0255] In some embodiments, R4dis hydrogen. In some embodiments, R4dis halogen. In some embodiments, R4dis C1-6 alkyl. In some embodiments, R4dis C3-7 branched alkyl. In some embodiments, R4dis C1-6 haloalkyl. In some embodiments, R4dis C3-7 branched haloalkyl. In some embodiments, R4dis hydroxy. In some embodiments, R4dis C1-6alkoxyl. In some embodiments, R4dis C3-7 branched alkoxy. In some embodiments, R4dis NHCO(C1-6alkyl). In some embodiments, R4dis NHCO(C3-7 branched alkyl). In some embodiments, R4dis NHCO(C3-7 cycloalkyl). In some embodiments, R4dis NHSO2(C1-6alkyl). In some embodiments, R4dis NHSO2(C3-7 branched alkyl). In some embodiments, R4dis NHSO2(C3-7 cycloalkyl).

[0256] In some embodiments, R4eis hydrogen. In some embodiments, R4eis halogen. In some embodiments, R4eis C1-6alkyl. In some embodiments, R4eis C3-7branched alkyl. In some embodiments, R4eis C1-6haloalkyl. In some embodiments, R4eis C3-7branched haloalkyl.

[0257] In some embodiments, R4fis hydrogen. In some embodiments, R4fis halogen. In some embodiments, R4fis C1-6 alkyl. In some embodiments, R4fis C3-7 branched alkyl. In some embodiments, R4fis C1-6haloalkyl. In some embodiments, R4fis C3-7branched haloalkyl.

[0258] In some embodiments, R1cand R1dare taken together to form an optionally substituted 3 membered ring. In some embodiments, R1cand R1dare taken together to form an optionally substituted 4 membered ring. In some embodiments, R1cand R1dare taken together to form an optionally substituted 5 membered ring. In some embodiments, R1cand R1dare taken together to form an optionally substituted 6 membered ring. In some embodiments, R1cand R1dare taken together to form an optionally substituted 7 membered ring. In some embodiments, R1cand R1dare taken together to form an optionally substituted 3 membered ring that contains an X1group. In some embodiments, R1cand R1dare taken together to form an optionally substituted 4 membered ring that contains an X1group. In some embodiments, R1cand R1dare taken together to form an optionally substituted 5 membered ring that contains an X1group. In some embodiments, R1cand R1dare taken together to form an optionally substituted 6 membered ring that contains an X1group. In some embodiments, R1cand R1dare taken together to form an optionally substituted 7 membered ring that contains an X1group.

[0259] In some embodiments, X1is CF2. In some embodiments, X1is CHCO2R12. In some embodiments, X1is O. In some embodiments, X1is NH. In some embodiments, X1is NR8. In some embodiments, X1is SO2. Page 114 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666)

[0260] In some embodiments, m is 0. In some embodiments, m is 1. In some embodiments, m is 2.

[0261] In some embodiments, n1is 1. In some embodiments, n1is 2. In some embodiments, n1is 3.

[0262] In some embodiments, R5is hydrogen. In some embodiments, R5is halogen. In some embodiments, R5is C1-6 alkyl. In some embodiments, R5is C3-7 branched alkyl. In some embodiments, R5is C1-6haloalkyl. In some embodiments, R5is C3-7branched haloalkyl. In some embodiments, R5is C1-6 alkoxyl. In some embodiments, R5is C3-7 branched alkoxy. In some embodiments, R5is hydroxy.

[0263] In some embodiments, R6is hydrogen. In some embodiments, R6is NH2. In some embodiments, R6is NHR6a. In some embodiments, R6is NHCH2CH2OH. In some embodiments, R6is NHCH2CH2NHSO2Me. In some embodiments, R6is C1-6 alkoxyl. In some embodiments, R6is C3-7 branched alkoxy. In some embodiments, R6is hydroxy.

[0264] In some embodiments, R6ais –(CO)C1-6alkyl. In some embodiments, R6ais –(CO)C3-7 branched alkyl. In some embodiments, R6ais –(CO)C1-6 hydroxyalkyl. In some embodiments, some embodiments, In some embodiments, R6aisme embodiments . In some embodiments, R6aisn some embodiments, R6ai . In some embodiments, R6ais. In some embodiments, R6ais.Page 115 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666)

[0265] In some embodiments, q is 1. In some embodiments, q is 2. In some embodiments, q is 3. In some embodiments, q is 4. In some embodiments, q is 5. In some embodiments, q is 6.

[0266] In some embodiments, e is 1. In some embodiments, e is 2. In some embodiments, e is 3. In some embodiments, e is 4. In some embodiments, e is 5. In some embodiments, e is 6.

[0267] In some embodiments, X2is hydrogen. In some embodiments, X2is halogen. In some embodiments, X2is C1-6alkyl. In some embodiments, X2is C3-7 branched alkyl. In some embodiments, X2is C1-6haloalkyl. In some embodiments, X2is C3-7branched haloalkyl. In some embodiments, X2is hydroxy. In some embodiments, X2is C1-6hydroxyalkyl. In some embodiments, X2is C3-7 branched hydroxyalkyl. In some embodiments, X2is C1-6alkoxy. In some embodiments, X2is C3-7branched alkoxy. In some embodiments, X2is C1-6haloalkoxy. In some embodiments, X2is C3-7branched haloalkoxy. In some embodiments, X2is NH2. In some embodiments, X2is NH(C1-6alkyl). In some embodiments, X2is N(C1-6alkyl)2. In some embodiments, X2is C1-5(COOH). In some embodiments, X2is C1-6(NHSO2Me).

[0268] In some embodiments, X3is hydrogen. In some embodiments, X3is halogen. In some embodiments, X3is C1-5 alkyl. In some embodiments, X3is C3-7 branched alkyl. In some embodiments, X3is C1-5 haloalkyl. In some embodiments, X3is C3-7 branched haloalkyl. In some embodiments, X3is hydroxy. In some embodiments, X3is C1-5hydroxyalkyl. In some embodiments, X3is C3-7 branched hydroxyalkyl. In some embodiments, X3is C1-5 alkoxy. In some embodiments, X3is C3-7 branched alkoxy. In some embodiments, X3is C1-5 haloalkoxy. In some embodiments, X3is C3-7branched haloalkoxy. In some embodiments, X3is NH2. In some embodiments, X3is NH(C1-6alkyl). In some embodiments, X3is N(C1-6alkyl)2. In some embodiments, X3is COOH. In some embodiments, X3is C1-5(COOH). In some embodiments, X3is NHSO2Me. In some embodiments, X3is C1-5(NHSO2Me).

[0269] In some embodiments, R7is hydrogen. In some embodiments, R7is halogen. In some embodiments, R7is C1-6 alkyl. In some embodiments, R7is C3-7 branched alkyl. In some embodiments, R7is C1-6 haloalkyl. In some embodiments, R7is C3-7 branched haloalkyl. In some embodiments, R7is C1-6alkoxyl. In some embodiments, R7is C3-7branched alkoxy. In some embodiments, R7is hydroxy.

[0270] In some embodiments, R8is C1-6 alkyl. In some embodiments, R8is C1-6 haloalkyl. In some embodiments, R8is C3-7branched haloalkyl. In some embodiments, R8is C1-6hydroxyalkyl. In some embodiments, R8is C3-7branched hydroxyalkyl. In some embodiments, R8is C1-6alkoxyl. Page 116 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) In some embodiments, R8is C3-7branched alkoxy. In some embodiments, R8is CO(C1-6alkyl). In some embodiments, R8is CO(C3-7 branched alkyl). In some embodiments, R8is SO2(C1-6alkyl). In some embodiments, R8is SO2(C3.7 branched alkyl).

[0271] In some embodiments, R8ais hydrogen. In some embodiments, R8ais halogen. In some embodiments, R8ais C1-6 alkyl. In some embodiments, R8ais C3-7 branched alkyl. In some embodiments, R8ais C1-6 haloalkyl. In some embodiments, R8ais C3-7 branched haloalkyl. In some embodiments, R8ais C1-6hydroxyalkyl. In some embodiments, R8ais C3-7branched hydroxyalkyl. In some embodiments, R8ais hydroxy. In some embodiments, R8ais C1-6 alkoxyl. In some embodiments, R8ais C3-7 branched alkoxy. In some embodiments, R8ais NHCO(C1-6alkyl). In some embodiments, R8ais NHCO(C3-7branched alkyl). In some embodiments, R8ais NHSO2(C1-6alkyl). In some embodiments, R8ais NHSO2(C3-7branched alkyl).

[0272] In some embodiments, R8bis hydrogen. In some embodiments, R8bis halogen. In some embodiments, R8bis C1-6 alkyl. In some embodiments, R8bis C3-7 branched alkyl. In some embodiments, R8bis C1-6haloalkyl. In some embodiments, R8bis C3-7branched haloalkyl. In some embodiments, R8bis C1-6 hydroxyalkyl. In some embodiments, R8bis C3-7 branched hydroxyalkyl. In some embodiments, R8bis hydroxy. In some embodiments, R8bis C1-6 alkoxyl. In some embodiments, R8bis C3-7branched alkoxy. In some embodiments, R8bis NHCO(C1-6alkyl). In some embodiments, R8bis NHCO(C3-7 branched alkyl). In some embodiments, R8bis NHSO2(C1- 6alkyl). In some embodiments, R8bis NHSO2(C3-7 branched alkyl).

[0273] In some embodiments, R8cis hydrogen. In some embodiments, R8cis halogen. In some embodiments, R8cis C1-6alkyl. In some embodiments, R8cis C3-7branched alkyl. In some embodiments, R8cis C1-6 haloalkyl. In some embodiments, R8cis C3-7 branched haloalkyl. In some embodiments, R8cis C1-6 hydroxyalkyl. In some embodiments, R8cis C3-7 branched hydroxyalkyl. In some embodiments, R8cis hydroxy.

[0274] In some embodiments, R8cis C1-6 alkoxyl. In some embodiments, R8cis C3-7 branched alkoxy. In some embodiments, R8cis NHCO(C1-6alkyl). In some embodiments, R8cis NHCO(C3-7 branched alkyl). In some embodiments, R8cis NHSO2(C1-6alkyl). In some embodiments, R8cis NHSO2(C3-7 branched alkyl).

[0275] In some embodiments, R8dis hydrogen. In some embodiments, R8dis halogen. In some embodiments, R8dis C1-6alkyl. In some embodiments, R8dis C3-7branched alkyl, In some embodiments, R8dis C1-6haloalkyl. In some embodiments, R8dis C3-7branched haloalkyl. In some Page 117 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) embodiments, R8dis C1-6hydroxyalkyl. In some embodiments, R8dis C3-7branched hydroxyalkyl. In some embodiments, R8dis hydroxy. In some embodiments, R8dis C1-6 alkoxyl. In some embodiments, R8dis C3-7 branched alkoxy. In some embodiments, R8dis NHCO(C1-6alkyl). In some embodiments, R8dis NHCO(C3-7branched alkyl). In some embodiments, R8dis NHSO2(C1-6alkyl). In some embodiments, R8dis NHSO2(C3-7 branched alkyl).

[0276] In some embodiments, R9ais hydrogen. In some embodiments, R9ais halogen. In some embodiments, R9ais C1-6alkyl. In some embodiments, R9ais C3-7branched alkyl. In some embodiments, R9ais C1-6 haloalkyl. In some embodiments, R9ais C3-7 branched haloalkyl. In some embodiments, R9ais C1-6 hydroxyalkyl. In some embodiments, R9ais C3-7 branched hydroxyalkyl. In some embodiments, R9ais hydroxy. In some embodiments, R9ais C1-6alkoxyl. In some embodiments, R9ais C3-7branched alkoxy.

[0277] In some embodiments, R9bis hydrogen. In some embodiments, R9bis halogen. In some embodiments, R9bis C1-6 alkyl. In some embodiments, R9bis C3-7 branched alkyl. In some embodiments, R9bis C1-6haloalkyl. In some embodiments, R9bis C3-7branched haloalkyl. In some embodiments, R9bis C1-6 hydroxyalkyl. In some embodiments, R9bis C3-7 branched hydroxyalkyl. In some embodiments, R9bis hydroxy. In some embodiments, R9bis C1-6 alkoxyl. In some embodiments, R9bis C3-7branched alkoxy.

[0278] In some embodiments, R9aand R9bare taken together to form a 3 membered ring. In some embodiments, R9aand R9bare taken together to form a 4 membered ring. In some embodiments, R9aand R9bare taken together to form a 5 membered ring. In some embodiments, R9aand R9bare taken together to form a 6 membered ring. In some embodiments, R9aand R9bare taken together to form a 7 membered ring. In some embodiments, R9aand R9bare taken together to form an optionally substituted 3 membered ring. In some embodiments, R9aand R9bare taken together to form an optionally substituted 4 membered ring. In some embodiments, R9aand R9bare taken together to form an optionally substituted 5 membered ring. In some embodiments, R9aand R9bare taken together to form an optionally substituted 6 membered ring. In some embodiments, R9aand R9bare taken together to form an optionally substituted 7 membered ring.

[0279] In some embodiments, q is 1. In some embodiments, q is 2. In some embodiments, q is 3.

[0280] In some embodiments, z is 0. In some embodiments, z is 1. In some embodiments, z is 2. Page 118 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666)

[0281] In some embodiments, R10is hydrogen. In some embodiments, R10is C1-6alkyl. In some embodiments, R10is C1-6 haloalkyl. In some embodiments, R10is C3-7 branched haloalkyl. In some embodiments, R10is C1-6 hydroxyalkyl. In some embodiments, R10is C1-6 alkoxyl. In some embodiments, R10is C3-7branched alkoxy. In some embodiments, R10is CO(C1-6alkyl). In some embodiments, R10is CO(C3-7 branched alkyl). In some embodiments, R10is SO2(C1-6alkyl). In some embodiments, R10is SO2(C3.7 branched alkyl).

[0282] In some embodiments, R11is hydrogen. In some embodiments, R11is C1-6alkyl.

[0283] In some embodiments, R12is hydrogen. In some embodiments, R12is C1-6 alkyl.

[0284] In some embodiments the compounds of Formula (IA), (I’) or substructures exclude N- (6-((8’’-methyl-1’’,5’’-dioxo-1’’,5’’-dihydro-2’’H-dispiro[cyclopropane-1,1’-cyclohexane-4’,3’’- imidazo[1,5-a]pyridin]-6’’-yl)amino)pyrimidin-4-yl)cyclopropanecarboxamide; and / or 3-((6- ((8’’-methyl-1’’,5’’-dioxo-1’’,5’’-dihydro-2’’H-dispiro[cyclopropane-1,1’-cyclohexane-4’,3’’- imidazo[1,5-a]pyridin]-6’’-yl)amino)pyrimidin-4-yl)amino)propanoic acid.

[0285] MNK inhibitors of the present disclosure include compounds having the formula (LII) or a pharmaceutically acceptable salt form thereof: Wherein m, n1, R3’and R2’are as defin

[0286] Examples of R2’, R3’, m and n1, without limitation, are set forth in Table 2. Table 2. Entry R2’ R3’ n1 m Entry R2’ R3’ m n1Page 119 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) Entry R2’ R3’ n1 m Entry R2’ R3’ m n13 CH3 3 1 75 CH3 3 1Page 120 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) Entry R2’ R3’ n1 m Entry R2’ R3’ m n112 Cl 4 1 84 Cl 4 1Page 121 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) Entry R2’ R3’ n1 m Entry R2’ R3’ m n121 Cl 3 1 93 Cl 3 1Page 122 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) Entry R2’ R3’ n1 m Entry R2’ R3’ m n130 CH3 4 1 102 CH3 4 1Page 123 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) Entry R2’ R3’ n1 m Entry R2’ R3’ m n139 CH3 3 1 111 CH3 3 1Page 124 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) Entry R2’ R3’ n1 m Entry R2’ R3’ m n149 CH3 1 1 121 CH3 1 1Page 125 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) Entry R2’ R3’ n1 m Entry R2’ R3’ m n159 Cl 3 2 131 Cl 3 2Page 126 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) Entry R2’ R3’ n1 m Entry R2’ R3’ m n170 Cl 2 2 142 Cl 2 2[ ] n ors o e presen scosurencue compouns avng e ormua ( III) or a pharmaceutically acceptable salt form thereof: wherein non-limiting examplesed herein below in Table 3. Table 3. R3’ R2’ m n1 Entry R3’ R2’ m n11 1 1Page 127 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) Entry R3’ R2’ m n1 Entry R3’ R2’ m n14 CH3 N N 2 2 30 CH2F N N 2 2 2 1 1 1 1 2 2 1Page 128 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) Entry R3’ R2’ m n1 Entry R3’ R2’ m n113 ClN N1 1 39 CH2CH2FN N1 1112211 1 1Page 129 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) Entry R3’ R2’ m n1 Entry R3’ R2’ m n122 CH3ON N 2 2 48 CF2CH3N N2 2 2 1

[0288] MNK inhibitors of the present disclosure include compounds having the formula (LIV) or a pharmaceutically acceptable salt form thereof: wherein non-limiting examples of R3, , fined herein below in Table 4. Table 4. Entry R3’ R4f n1 Entry R3’ R4f n1Page 130 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) Entry R3’ R4f n1 Entry R3’ R4f n14 CH3 CH(CH3)2 1 22 Cl CH(CH3)2 1

[0289] In some embodiments, a MNK inhibitor is a compound selected from: N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane- 3',3''-imidazo[1,5-a]pyridin]-6''-yl)amino)pyrimidin-4-yl)cyclopropanecarboxamide; 6''-((6-Aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclopropane-1,1'-cyclohexane- 3',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane- 4',3''-imidazo[1,5-a]pyridin]-6''-yl)amino)pyrimidin-4-yl)cyclopropanecarboxamide; N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[aziridine-2,1'-cyclohexane-4',3''- imidazo[1,5-a]pyridin]-6''-yl)amino)pyrimidin-4-yl)cyclopropanecarboxamide; N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclobutane-1,1'-cyclobutane-3',3''- imidazo[1,5-a]pyridin]-6''-yl)amino)pyrimidin-4-yl)cyclopropanecarboxamide; benzyl 6''-((6-(cyclopropanecarboxamido)pyrimidin-4-yl)amino)-8''-methyl-1'',5''-dioxo- 1'',5''-dihydro-2''H-dispiro[aziridine-2,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-1- carboxylate; Page 131 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) tert-butyl 6''-((6-(cyclopropanecarboxamido)pyrimidin-4-yl)amino)-8''-methyl-1'',5''-dioxo- 1'',5''-dihydro-2''H-dispiro[azetidine-3,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-1- carboxylate; N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[azetidine-3,1'-cyclohexane-4',3''- imidazo[1,5-a]pyridin]-6''-yl)amino)pyrimidin-4-yl)cyclopropanecarboxamide; 6''-((6-((2-hydroxyethyl)amino)pyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclopropane- 1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; 6''-((6-Aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclopropane-1,1'-cyclohexane- 4',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; benzyl 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H- dispiro[aziridine-2,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-1-carboxylate; 1-(aminomethyl)-N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'- cyclohexane-4',3''-imidazo[1,5-a]pyridin]-6''-yl)amino)pyrimidin-4-yl)cyclopropane-1- carboxamide; (1R,5S,6r)-N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'- cyclohexane-4',3''-imidazo[1,5-a]pyridin]-6''-yl)amino)pyrimidin-4-yl)-3- azabicyclo[3.1.0]hexane-6-carboxamide; N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane- 4',3''-imidazo[1,5-a]pyridin]-6''-yl)amino)pyrimidin-4-yl)-2-azaspiro[3.3]heptane-6- carboxamide; 2-methyl-N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'- cyclohexane-4',3''-imidazo[1,5-a]pyridin]-6''-yl)amino)pyrimidin-4-yl)-2- azaspiro[3.3]heptane-6-carboxamide; (1R,5S,6r)-3-methyl-N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane- 1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridin]-6''-yl)amino)pyrimidin-4-yl)-3- azabicyclo[3.1.0]hexane-6-carboxamide; N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane- 4',3''-imidazo[1,5-a]pyridin]-6''-yl)amino)pyrimidin-4-yl)-1-(methylsulfonamido methyl)cyclopropane-1-carboxamide; Page 132 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) 1-((dimethylamino)methyl)-N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H- dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridin]-6''- yl)amino)pyrimidin-4-yl)cyclopropane-1-carboxamide; 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclobutane-1,1'-cyclobutane- 3',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[aziridine-2,1'-cyclohexane-4',3''- imidazo[1,5-a]pyridine]-1'',5''-dione; 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclopropane -1,1'-cyclopentane- 3',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclopentane-1,1'-cyclopentane- 3',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; 6''-((6-aminopyrimidin-4-yl)amino)-3,3-difluoro-8''-methyl-2''H-dispiro[cyclobutane-1,1'- cyclobutane-3',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclopentane-1,1'-cyclobutane- 3',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclobutane-1,1'-cyclohexane- 4',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclohexane-1,1'-cyclobutane- 3',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; ethyl 6''-((6-(cyclopropanecarboxamido)pyrimidin-4-yl)amino)-8''-methyl-1'',5''-dioxo-1'',5''- dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-2- carboxylate; tert-butyl (6''-((6-(cyclopropanecarboxamido)pyrimidin-4-yl)amino)-8''-methyl-1'',5''-dioxo- 1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridin]- 2-yl)carbamate; N-(6-((2,2-difluoro-8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'- cyclohexane-4',3''-imidazo[1,5-a]pyridin]-6''-yl)amino)pyrimidin-4- yl)cyclopropanecarboxamide; 6''-((6-aminopyrimidin-4-yl)amino)-2,2-difluoro-8''-methyl-2''H-dispiro[cyclopropane-1,1'- cyclohexane-4',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; Page 133 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) 6''-((6-Aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclopropane-1,1'-cycloheptane- 4',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; 6''-((6-Aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclopropane-1,1'-cyclohexane- 4',3''-imidazo[1,5-a]pyridin]-2'-ene-1'',5''-dione; or a pharmaceutically acceptable salt thereof. MNK Inhibitors of Formula (IB)

[0290] In some embodiments, a MNK inhibitor is a compound of Formula (IB): or a pharmaceutically acceptablW1and W2are independently O, S or N-OR', where R' is lower alkyl; Y is ‒N(R5”)‒, -O-, -S-, -C(O)-, -S=O, -S(O)2-, or ‒CHR9‒; R1”is hydrogen, lower alkyl, cycloalkyl or heterocyclyl wherein any lower alkyl, cycloalkyl or heterocyclyl is optionally substituted with 1, 2 or 3 J groups; n2is 1, 2 or 3; R2”and R3”are each independently hydrogen, alkyl, alkenyl, alkynyl, aryl, araalkylene, heteroaryl, heteroarylalkylene, cycloalkyl, cycloalkylalkylene, heterocyclyl, or heterocyclylalkylene, wherein any alkyl, aryl, araalkylene, heteroaryl, heteroarylalkylene, cycloalkyl, cycloalkylalkylene, heterocyclyl, or heterocyclylalkylene, is optionally substituted with 1, 2 or 3 J groups; or R2”and R3”taken together with the carbon atom to which they are attached form a cycloalkyl or heterocyclyl, wherein any cycloalkyl or heterocyclyl is optionally substituted with 1, 2 or 3 J groups; R4a”and R4b”are each independently hydrogen, halogen, hydroxyl, thiol, hydroxyalkylene, cyano, alkyl, alkoxy, acyl, thioalkyl, alkenyl, alkynyl, cycloalkyl, aryl, or heterocyclyl; R5”is hydrogen, cyano, or lower alkyl; Page 134 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) or R5”and R8taken together with the atoms to which they are attached form a fused heterocyclyl optionally substituted with 1, 2 or 3 J groups; R6”, R7”and R8are each independently hydrogen, hydroxy, halogen, cyano, amino, alkyl, alkenyl, alkynyl, alkoxy, cycloalkyl, cycloalkylalkylene, cycloalkylalkenylene, alkylaminyl, alkylcarbonylaminyl, cycloalkylcarbonylaminyl, cycloalkylaminyl, heterocyclylaminyl, heteroaryl, or heterocyclyl, and wherein any amino, alkyl, alkenyl, alkynyl, alkoxy, cycloalkyl, cycloalkylalkylene, cycloalkylalkenylene, amino, alkylaminyl, alkylcarbonylaminyl, cycloalkylcarbonylaminyl, cycloalkylaminyl, heterocyclylaminyl, heteroaryl, or heterocyclyl is optionally substituted with 1, 2 or 3 J groups; or R7”and R8taken together with the atoms to which they are attached form a fused heterocyclyl or heteroaryl optionally substituted with 1, 2 or 3 J groups; J is ‒SH, -SR9, -S(O)R9, -S(O)2R9, -S(O)NH2, -S(O)NR9R9, -NH2, -NR9R9, -COOH, - C(O)OR9, -C(O)R9, -C(O)-NH2, -C(O)-NR9R9, hydroxy, cyano, halogen, acetyl, alkyl, lower alkyl, alkenyl, alkynyl, alkoxy, haloalkyl, thioalkyl, cyanoalkylene, alkylaminyl, NH2-C(O)-alkylene , NR9R9-C(O)-alkylene, -CHR9-C(O)-lower alkyl, -C(O)-lower alkyl, alkylcarbonylaminyl, cycloalkyl, cycloalkylalkylene, cycloalkylalkenylene, cycloalkylcarbonylaminyl, cycloalkylaminyl, -CHR9-C(O)-cycloalkyl, -C(O)-cycloalkyl, - CHR9-C(O)-aryl, -CHR9-aryl, -C(O)-aryl, -CHR9-C(O)-heterocycloalkyl, -C(O)- heterocycloalkyl, heterocyclylaminyl, or heterocyclyl; or any two J groups bound to the same carbon or hetero atom may be taken together to form oxo; and R9is hydrogen, lower alkyl or -OH.

[0291] The following definitions apply to Formula (IB) and subgenera thereof:

[0292] "Amino" refers to the -NH2substituent.

[0293] "Aminocarbonyl" refers to the ‒C(O)NH2 substituent.

[0294] "Carboxyl" refers to the ‒CO2H substituent.

[0295] "Carbonyl" refers to a ‒C(O)- or ‒C(=O)- group.

[0296] "Cyano" refers to the ‒C≡N substituent.

[0297] "Cyanoalkylene" refers to the -(alkylene)C≡N substituent.

[0298] "Acetyl" refers to the ‒C(O)CH3substituent.

[0299] "Hydroxy" or "hydroxyl" refers to the -OH substituent. Page 135 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666)

[0300] "Hydroxyalkylene" refers to the -(alkylene)OH substituent.

[0301] "Oxo" refers to an oxygen of‒O- substituent.

[0302] "Thio" or "thiol" refer to a ‒SH substituent.

[0303] "Alkyl" refers to a saturated, straight or branched hydrocarbon chain radical consisting solely of carbon and hydrogen atoms, having from one to twelve carbon atoms (C1-C12 alkyl), from one to eight carbon atoms (C1-C8 alkyl) or from one to six carbon atoms (C1-C6 alkyl), and which is attached to the rest of the molecule by a single bond. Exemplary alkyl groups include methyl, ethyl, n-propyl, 1-methylethyl (iso-propyl), n-butyl, n-pentyl, 1,1-dimethylethyl (t-butyl), 3- methylhexyl, 2-methylhexyl, and the like.

[0304] "Lower alkyl" has the same meaning as alkyl defined above but having from one to four carbon atoms (C1-C4alkyl).

[0305] "Alkenyl" refers to an unsaturated alkyl group having at least one double bond and from two to twelve carbon atoms (C2-C12 alkenyl), from two to eight carbon atoms (C2-C8 alkenyl) or from two to six carbon atoms (C2-C6alkenyl), and which is attached to the rest of the molecule by a single bond, e.g., ethenyl, propenyl, butenyl, pentenyl, hexenyl, and the like.

[0306] "Alkynyl" refers to an unsaturated alkyl group having at least one triple bond and from two to twelve carbon atoms (C2-C12alkynyl), from two to ten carbon atoms (C2-C10alkynyl) from two to eight carbon atoms (C2-C6 alkynyl) or from two to six carbon atoms (C2-C6 alkynyl), and which is attached to the rest of the molecule by a single bond, e.g., ethynyl, propynyl, butynyl, pentynyl, hexynyl, and the like.

[0307] "Alkylene" or "alkylene chain" refers to a straight or branched divalent hydrocarbon (alkyl) chain linking the rest of the molecule to a radical group, consisting solely of carbon and hydrogen, respectively. Alkylenes can have from one to twelve carbon atoms, e.g., methylene, ethylene, propylene, n-butylene, and the like. The alkylene chain is attached to the rest of the molecule through a single or double bond. The points of attachment of the alkylene chain to the rest of the molecule can be through one carbon or any two carbons within the chain. "Optionally substituted alkylene" refers to alkylene or substituted alkylene.

[0308] "Alkenylene" refers to divalent alkene. Examples of alkenylene include without limitation, ethenylene (-CH=CH-) and all stereoisomer^ and conformational isomeric forms thereof. "Substituted alkenylene" refers to divalent substituted alkene. "Optionally substituted alkenylene" refers to alkenylene or substituted alkenylene. Page 136 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666)

[0309] "Alkynylene" refers to divalent alkyne. Examples of alkynylene include without limitation, ethynylene, propynylene. "Substituted alkynylene" refers to divalent substituted alkyne.

[0310] "Alkoxy" refers to a radical of the formula -ORa where Ra is an alkyl having the indicated number of carbon atoms as defined above. Examples of alkoxy groups include without limitation ‒O-methyl (methoxy), -O-ethyl (ethoxy), -O-propyl (propoxy), -O-isopropyl (iso propoxy) and the like.

[0311] "Acyl" refers to a radical of the formula ‒C(O)Rawhere Rais an alkyl having the indicated number of carbon atoms.

[0312] "Alkylaminyl" refers to a radical of the formula -NHRa or -NRaRa where each Ra is, independently, an alkyl radical having the indicated number of carbon atoms as defined above.

[0313] "Cycloalkylaminyl" refers to a radical of the formula -NHRawhere Rais a cycloalkyl radical as defined herein.

[0314] "Alkylcarbonylaminyl" refers to a radical of the formula ‒NHC(O)Ra, where Ra is an alkyl radical having the indicated number of carbon atoms as defined herein.

[0315] "Cycloalkylcarbonylaminyl" refers to a radical of the formula -NHC(O)Ra, where Ra is a cycloalkyl radical as defined herein.

[0316] "Alkylaminocarbonyl" refers to a radical of the formula -C(O)NHRaor -C(O)NRaRa, where each Ra is independently, an alkyl radical having the indicated number of carbon atoms as defined herein.

[0317] "Cyclolkylaminocarbonyl" refers to a radical of the formula -C(O)NHRa, where Rais a cycloalkyl radical as defined herein.

[0318] "Aryl" refers to a hydrocarbon ring system radical comprising hydrogen, 6 to 18 carbon atoms and at least one aromatic ring. Exemplary aryls are hydrocarbon ring system radical comprising hydrogen and 6 to 9 carbon atoms and at least one aromatic ring; hydrocarbon ring system radical comprising hydrogen and 9 to 12 carbon atoms and at least one aromatic ring; hydrocarbon ring system radical comprising hydrogen and 12 to 15 carbon atoms and at least one aromatic ring; or hydrocarbon ring system radical comprising hydrogen and 15 to 18 carbon atoms and at least one aromatic ring. For purposes of this invention, the aryl radical may be a monocyclic, bicyclic, tricyclic or tetracyclic ring system, which may include fused or bridged ring systems. Aryl radicals include, but are not limited to, aryl radicals derived from aceanthrylene, acenaphthylene, acephenanthrylene, anthracene, azulene, benzene, chrysene, fluoranthene, Page 137 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) fluorene, as-indacene, s-indacene, indane, indene, naphthalene, phenalene, phenanthrene, pleiadene, pyrene, and triphenylene. "Optionally substituted aryl" refers to an aryl group or a substituted aryl group.

[0319] "Arylene" denotes divalent aryl, and "substituted arylene" refers to divalent substituted aryl.

[0320] "Aralkyl" or "araalkylene" may be used interchangeably and refer to a radical of the formula -Rb-Rcwhere Rbis an alkylene chain as defined herein and Rcis one or more aryl radicals as defined herein, for example, benzyl, diphenylmethyl and the like.

[0321] "Cycloalkyl" refers to a stable non-aromatic monocyclic or polycyclic hydrocarbon radical consisting solely of carbon and hydrogen atoms, which may include fused or bridged ring systems, having from three to fifteen carbon atoms, preferably having from three to ten carbon atoms, three to nine carbon atoms, three to eight carbon atoms, three to seven carbon atoms, three to six carbon atoms, three to five carbon atoms, a ring with four carbon atoms, or a ring with three carbon atoms. The cycloalkyl ring may be saturated or unsaturated and attached to the rest of the molecule by a single bond. Monocyclic radicals include, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Polycyclic radicals include, for example, adamantyl, norbornyl, decalinyl, 7,7-dimethyl-bicyclo[2.2.1]heptanyl, and the like.

[0322] "Cycloalkylalkylene" or "cycloalkylalkyl" may be used interchangeably and refer to a radical of the formula -RbRe where Rb is an alkylene chain as defined herein and Re is a cycloalkyl radical as defined herein. In certain embodiments, Rbis further substituted with a cycloalkyl group, such that the cycloalkylalkylene comprises two cycloalkyl moieties. Cyclopropylalkylene and cyclobutylalkylene are exemplary cycloalkylalkylene groups, comprising at least one cyclopropyl or at least one cyclobutyl group, respectively.

[0323] "Fused" refers to any ring structure described herein which is fused to an existing ring structure in the compounds of the invention. When the fused ring is a heterocyclyl ring or a heteroaryl ring, any carbon atom on the existing ring structure which becomes part of the fused heterocyclyl ring or the fused heteroaryl ring may be replaced with a nitrogen atom.

[0324] "Halo" or "halogen" refers to bromo (bromine), chloro (chlorine), fluoro (fluorine), or iodo (iodine).

[0325] "Haloalkyl" refers to an alkyl radical having the indicated number of carbon atoms, as defined herein, wherein one or more hydrogen atoms of the alkyl group are substituted with a Page 138 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) halogen (halo radicals), as defined above. The halogen atoms can be the same or different. Exemplary haloalkyls are trifluoromethyl, difluoromethyl, trichloromethyl, 2,2,2-trifluoroethyl, 1,2-difluoroethyl, 3-bromo-2-fluoropropyl, 1,2-dibromoethyl, and the like.

[0326] "Heterocyclyl", heterocycle", or "heterocyclic ring" refers to a stable 3- to 18- membered saturated or unsaturated radical which consists of two to twelve carbon atoms and from one to six heteroatoms, for example, one to five heteroatoms, one to four heteroatoms, one to three heteroatoms, or one to two heteroatoms selected from the group consisting of nitrogen, oxygen and sulfur. Exemplary heterocycles include without limitation stable 3-15 membered saturated or unsaturated radicals, stable 3-12 membered saturated or unsaturated radicals, stable 3-9 membered saturated or unsaturated radicals, stable 8-membered saturated or unsaturated radicals, stable 7- membered saturated or unsaturated radicals, stable 6-membered saturated or unsaturated radicals, or stable 5 -membered saturated or unsaturated radicals.

[0327] Unless stated otherwise specifically in the specification, the heterocyclyl radical may be a monocyclic, bicyclic, tricyclic or tetracyclic ring system, which may include fused or bridged ring systems; and the nitrogen, carbon or sulfur atoms in the heterocyclyl radical may be optionally oxidized; the nitrogen atom may be optionally quaternized; and the heterocyclyl radical may be partially or fully saturated. Examples of non-aromatic heterocyclyl radicals include, but are not limited to, azetidinyl, dioxolanyl, thienyl[1,3]dithianyl, decahydroisoquinolyl, imidazolinyl, imidazolidinyl, isothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindolyl, octahydroisoindolyl, 2-oxopiperazinyl, 2-oxopiperidinyl, 2-oxopyrrolidinyl, oxazolidinyl, piperidinyl, piperazinyl, 4-piperidonyl, pyrrolidinyl, pyrazolidinyl, quinuclidinyl, thiazolidinyl, tetrahydrofuryl, thietanyl, trithianyl, tetrahydropyranyl, thiomorpholinyl, thiamorpholinyl, 1-oxo- thiomorpholinyl, and 1,1-dioxo-thiomorpholinyl. Heterocyclyls include heteroaryls as defined herein, and examples of aromatic heterocyclyls are listed in the definition of heteroaryls below.

[0328] "Heterocyclylalkyl" or "heterocyclylalkylene" refers to a radical of the formula - RbRf where Rb is an alkylene chain as defined herein and Rf is a heterocyclyl radical as defined above, and if the heterocyclyl is a nitrogen-containing heterocyclyl, the heterocyclyl may be attached to the alkyl radical at the nitrogen atom.

[0329] "Heteroaryl" or "heteroarylene" refers to a 5- to 14-membered ring system radical comprising hydrogen atoms, one to thirteen carbon atoms, one to six heteroatoms selected from the group consisting of nitrogen, oxygen and sulfur, and at least one aromatic ring. For purposes Page 139 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) of this invention, the heteroaryl radical may be a stable 5-12 membered ring, a stable 5-10 membered ring, a stable 5-9 membered ring, a stable 5-8 membered ring, a stable 5-7 membered ring, or a stable 6 membered ring that comprises at least 1 heteroatom, at least 2 heteroatoms, at least 3 heteroatoms, at least 4 heteroatoms, at least 5 heteroatoms or at least 6 heteroatoms. Heteroaryls may be a monocyclic, bicyclic, tricyclic or tetracyclic ring system, which may include fused or bridged ring systems; and the nitrogen, carbon or sulfur atoms in the heteroaryl radical may be optionally oxidized; the nitrogen atom may be optionally quaternized. The heteroatom may be a member of an aromatic or non-aromatic ring, provided at least one ring in the heteroaryl is aromatic. Examples include, but are not limited to, azepinyl, acridinyl, benzimidazolyl, benzothiazolyl, benzindolyl, benzodioxolyl, benzofuranyl, benzooxazolyl, benzothiazolyl, benzothiadiazolyl, benzo[b][1,4]dioxepinyl, 1,4-benzodioxanyl, benzonaphthofuranyl, benzoxazolyl, benzodioxolyl, benzodioxinyl, benzopyranyl, benzopyranonyl, benzofuranyl, benzofuranonyl, benzothienyl (benzothiophenyl), benzotriazolyl, benzo[4,6]imidazo[1,2- a]pyridinyl, carbazolyl, cinnolinyl, dibenzofuranyl, dibenzothiophenyl, furanyl, furanonyl, isothiazolyl, imidazolyl, indazolyl, indolyl, indazolyl, isoindolyl, indolinyl, isoindolinyl, isoquinolyl, indolizinyl, isoxazolyl, naphthyridinyl, oxadiazolyl, 2-oxoazepinyl, oxazolyl, oxiranyl, 1-oxidopyridinyl, 1-oxidopyrimidinyl, 1-oxidopyrazinyl, 1-oxidopyridazinyl, 1-phenyl- 1H-pyrrolyl, phenazinyl, phenothiazinyl, phenoxazinyl, phthalazinyl, pteridinyl, purinyl, pyrrolyl, pyrazolyl, pyridinyl, pyrazinyl, pyrimidinyl, pyridazinyl, quinazolinyl, quinoxalinyl, quinolinyl, quinuclidinyl, isoquinolinyl, tetrahydroquinolinyl, thiazolyl, thiadiazolyl, triazolyl, tetrazolyl, triazinyl, and thiophenyl (i.e. thienyl).

[0330] "Heteroarylalkyl" or "heteroarylalkylene" refers to a radical of the formula - RbRg where Rb is an alkylene chain as defined above and Rg is a heteroaryl radical as defined above.

[0331] "Thioalkyl" refers to a radical of the formula -SRa where Ra is an alkyl radical as defined above containing one to twelve carbon atoms, at least 1-10 carbon atoms, at least 1-8 carbon atoms, at least 1-6 carbon atoms, or at least 1-4 carbon atoms.

[0332] "Heterocyclylaminyl" refers to a radical of the formula ‒NHRf where Rf is a heterocyclyl radical as defined above.

[0333] "Thione" refers to a =S group attached to a carbon atom of a saturated or unsaturated (C3-C8)cyclic or a (C1-C8)acyclic moiety. Page 140 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666)

[0334] "Sulfoxide" refers to a ‒S(O)- group in which the sulfur atom is covalently attached to two carbon atoms.

[0335] "Sulfone" refers to a ‒S(O)2- group in which a hexavalent sulfur is attached to each of the two oxygen atoms through double bonds and is further attached to two carbon atoms through single covalent bonds.

[0336] The term "oxime" refers to a ‒C(Ra)=N-ORa radical where Ra is hydrogen, lower alkyl, an alkylene or arylene group as defined above.

[0337] The compound of the disclosure can exist in various isomeric forms, as well as in one or more tautomeric forms, including both single tautomers and mixtures of tautomers. The term "isomer" is intended to encompass all isomeric forms of a compound of this invention, including tautomeric forms of the compound.

[0338] Some compounds described here can have asymmetric centers and therefore exist in different enantiomeric and diastereomeric forms. A compound of the disclosure can be in the form of an optical isomer or a diastereomer. Accordingly, the disclosure encompasses compounds of the disclosure and their uses as described herein in the form of their optical isomers, diastereoisomers and mixtures thereof, including a racemic mixture. Optical isomers of the compounds of the disclosure can be obtained by known techniques such as asymmetric synthesis, chiral chromatography, or via chemical separation of stereoisomers through the employment of optically active resolving agents.

[0339] In some embodiments, a MNK inhibitor is a compound selected from Table 5, or a pharmaceutically acceptable salt thereof. Table 5. No. Compound ePage 141 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. Compound B8 3-isopropyl-3-methyl-6-(pyrimidin-4-ylamino)-2,3-dihydroimidazo[1,5-a]pyridine- - )-Page 142 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. Compound B30 N-[6-[[3-(3-fluorophenyl)-3-methyl-1,5-dioxo-2H-imidazo[1,5-a]pyridin-6- - 5- -age o BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. Compound B52 N-[6-[[8-chloro-3-(3-fluorophenyl)-3-methyl-1,5-dioxo-2H-imidazo[1,5-a]pyridin- - 5- 3- e -Page 144 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. Compound B75 8-chloro-3-methyl-3-(4-pyridyl)-6-(pyrimidin-4-ylamino)-2H-imidazo[1,5- - e e- 5-Page 145 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. Compound B97 N-(6-((8-chloro-3-methyl-1,5-dioxo-3-phenyl-1,2,3,5-tetrahydroimidazo[1,5- -Page 146 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. Compound B119 6-[(6-aminopyrimidin-4-yl)amino]-8-chloro-3-(3-fluorophenyl)-2,3- - '-Page 147 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. Compound B141 8-chloro-3-methyl-3-(prop-1-yn-1-yl)-6-(pyrimidin-4-ylamino)-2,3- '- -Page 148 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. Compound B163 1'-acetyl-8-chloro-6-(pyrimidin-4-ylamino)-2H-spiro[imidazo[1,5-a]pyridine-3,4'- - - -age o BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. Compound B185 8'-chloro-6'-(pyrimidin-4-ylamino)-2'H-spiro[bicyclo[2.2.1]heptane-7,3'- '- '- '-Page 150 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. Compound B207 6'-((6-aminopyrimidin-4-yl)amino)-8'-(hydroxymethyl)-2'H-spiro[cyclohexane-1,3'- - - - -Page 151 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) No. Compound B229 2-(6-((5-methoxypyrimidin-4-yl)amino)-8-methyl-1,5-dioxo-1,5-dihydro-2H- H- - H- -Provided Methods

[0340] In some embodiments, the present disclosure provides methods of treating rheumatoid arthritis (RA), including inflammation and / or pain associated with RA, comprising administering a MNK inhibitor (e.g., a MNK inhibitor described herein) to a subject in need thereof. Page 152 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666)

[0341] In some embodiments, the present disclosure provides a method of treating rheumatoid arthritis, comprising administering a MNK inhibitor (e.g., a MNK inhibitor described herein) to a subject in need thereof.

[0342] In some embodiments, the present disclosure provides a method of reducing inflammation in a subject suffering from rheumatoid arthritis, comprising administering a MNK inhibitor (e.g., a MNK inhibitor described herein) to the subject.

[0343] In some embodiments, the present disclosure provides a method, comprising administering a MNK inhibitor (e.g., a MNK inhibitor described herein) to a subject suffering from rheumatoid arthritis, wherein the MNK inhibitor is administered according to a regimen established to reduce inflammation.

[0344] RA is a systemic autoimmune disease characterized by chronic inflammation and progressive deterioration of the joints. The disease progression can be divided into: early stage (joint pain stiffness, swelling and tenderness); moderate stage (inflammation damages the cartilage of the joint bones, patient has reduced mobility and range of motion); severe stage (further increase in impact on mobility and motion, development of joint deformities, formation of rheumatoid nodules); and end stage (symptoms become much more chronic and severe, possible inability to manage day-to-day tasks, need of assistive devices).

[0345] In some embodiments, a subject is in an active RA inflammatory disease state. By “active RA inflammatory disease state”, the present disclosure includes the meaning that the inflammation reaches the level of clinical inflammation, which can be assessed as described herein. For example, by Clinical Disease Activity Index (CDAI), by Routine Assessment of Patient Index Data 3 (RAPID3), or by DAS28 score. Inflammatory disease activity may be classified as low activity, moderate activity, or high activity, as known in the art. For example, a DAS28 score greater than or equal to 2.6 and less than 3.1 indicates low activity; a score greater than or equal to 3.1 and less than 5.1 indicates moderate activity and a score a score greater than or equal to 5.1 indicates high activity.

[0346] In some embodiments, a subject is in an inactive RA inflammatory disease state before, during or after being considered as “having RA”. A patient is considered as having RA when diagnosed as such, including differential diagnosis of other inflammatory polyarthritis diagnoses. A patient in an inactive RA inflammatory disease state before being considered as “having RA” may be experiencing any of the pain described herein as well have circulating antibodies to Page 153 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) citrullinated peptides (ACPA) / cyclic citrullinated peptide (CCP). In some embodiments, an inactive RA inflammatory disease state is not present before the patient has RA. A patient in an inactive RA inflammatory disease state during being considered as “having RA” may be able to control inflammatory disease using disease-modifying antirheumatic drugs (DMARDs); however, upon stopping using DMARDs (i) the patient would fall back into an active RA inflammatory state, or (ii) the patient will remain in an inactive RA inflammatory disease state (i.e. RA remission). By “remission” we include the meaning of a decrease in or disappearance of inflammatory signs and / or symptoms. Those skilled in the art will be capable of selecting the appropriate method of determining remission, for example a DAS28 score of less than 2.6.

[0347] In some embodiments, the present disclosure encompasses the recognition that MNK inhibitors may be uniquely suited to treat both inflammation and pain associated with rheumatoid arthritis.

[0348] In some embodiments, the present disclosure provides a method of reducing pain and inflammation in a subject suffering from rheumatoid arthritis, comprising administering a MNK inhibitor (e.g., a MNK inhibitor described herein) to the subject.

[0349] In some embodiments, the present disclosure provides a method, comprising administering a MNK inhibitor (e.g., a MNK inhibitor described herein) to a subject suffering from rheumatoid arthritis, wherein the MNK inhibitor is administered according to a regimen established to reduce inflammation and pain.

[0350] Pain is a troublesome symptom of RA, and its cause is not well understood. People with RA can experience pain at rest and during normal activities and may display increased sensitivity to evoked pain in response to stimuli such as normal movement or gentle pressure on the joints. In addition, widespread pain and other evidence of central sensitisation are common and contribute to pain in people with RA (Heisler AC, Song J, Dunlop DD et al. Association of pain centralization and patient-reported pain in active rheumatoid arthritis. Arthritis Care Res (Hoboken) 2020;72:1122–9).

[0351] Pain associated with RA is thought to be complex with multifactorial causes including alterations in the immune cells as well as several areas of the nervous system, such as primary afferent sensitization, spinal cord sensitization, as well as changes at supraspinal levels. Dysfunction of peripheral nerves, including increased excitability and ectopic activity of afferents are considered likely to contribute to pain. Such sensitization could occur by pro-inflammatory Page 154 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) factors present systemically and / or in the synovial fluid in RA, including TNF, IL-1, IL-6, IL-17, interferons and other cytokines, inflammatory lipids (e.g. PGE2), neuropeptides (CGRP, SP and others) and growth factors (e.g. NGF) (Y. Cao, D. Fan, Y. Yin, Pain Mechanism in Rheumatoid Arthritis: From Cytokines to Central Sensitization. Mediators of Inflammation 2020, 2076328 (2020)).

[0352] Disease-modifying antirheumatic drugs (DMARDs) can be effective in leading to remission of inflammatory disease, but in many cases, pain persists even in the absence of inflammation (P. Vergne-Salle et al, The burden of pain in rheumatoid arthritis: Impact of disease activity and psychological factors. European journal of pain (London, England) 24, 1979-1989 (2020)). DMARDs can reduce pain from the high levels associated with high disease activity but in reality, complete pain resolution is rare. It is estimated that chronic pain remains in about 10- 25% of patients receiving DMARD treatment with successful inflammatory remission.

[0353] Consequently, RA patients often seek to treat the pain symptoms of RA using analgesics; however, the currently available analgesic compounds prescribed to people with RA do not offer an effective and / or long-term solution for preventing or treating pain associated with RA. Therefore, persistent pain associated with RA remains a real problem.

[0354] Many RA patients search for adequate analgesia, in addition to disease-modifying treatments. This lack of adequate pain relief in RA patients illustrates the great need of finding new analgesic strategies. In particular, there is a need for new analgesic strategies for pain relief during the weeks for the DMARD drugs to become effective, for patients with insufficient inflammatory disease control and for those with successful treatment but persistent pain. Identification of a specific cell type and molecular mechanisms of pain associated with RA would allow for more specific and effective analgesics.

[0355] Moreover, therapies that treat both pain and the underlying inflammation (e.g., disease- modifying treatments) are desirable, as they could provide patients with simpler and more convenient dosing schedules and administration procedures.

[0356] As described in the ensuing Examples, blocking type I interferon signaling did not robustly affect inflammatory disease activity which indicates that the pain is a mechanistically separate process from inflammatory disease. Accordingly, a therapy that impacts RA inflammatory pathways, as well as RA pain pathways would be desirable. Page 155 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666)

[0357] In some embodiments of methods provided herein, a subject is experiencing inflammation associated with RA. In some embodiments, a subject is experiencing pain associated with RA. In some embodiments, a subject is experiencing inflammation and pain, both associated with RA.

[0358] In some embodiments, a subject is experiencing inflammatory pain (e.g., inflammatory joint pain). As used herein, “inflammatory pain” is pain accompanied by pro-inflammatory factors (e.g. cytokines, lipid mediators, peptides, growth factors) present systemically (e.g. in the serum) and / or locally at the site of pain, such as the joint (e.g. the synovial joint), leading to pain, swelling and tenderness. Inflammatory pain can be assessed based on various measures of clinical inflammation, i.e., levels of inflammation can be detected using standard clinical measures and markers of inflammation. Those skilled in the art will be able to select appropriate measures, for example erythrocyte sedimentation rate (ESR or “sed” rate), swollen / tender join count, hand tenderness, acute phase reactants (APRs) such as C-reactive protein (CRP), ferritin, plasma fibrinogen and platelet count. Those skilled in the art will be able to select appropriate markers of inflammation, for example proinflammatory cytokines present systemically and / or locally at the site of pain, such as TNF, IL-6, IL1, GM-CSF, IL17, IL20, IL23, IL24.

[0359] In some embodiments, a subject is experiencing non-inflammatory pain. As used herein, “non-inflammatory pain” is pain that is present in the absence of clinical inflammation. Non-inflammatory pain is pain that is not associated with measures of inflammation, and is common in patients with RA. In this case, a patient experiences pain associated with RA despite there being an apparent absence (or a “healthy” level) of pro-inflammatory factors.

[0360] In some embodiments of methods provided herein, a subject has received or is receiving pain treatment. In some embodiments, a subject has received or is receiving pain treatment and pain persists and / or recurs and / or progresses. In some embodiments, pain treatment is selected from the group consisting of: a nonsteroidal anti-inflammatory drug (NSAID), such as celecoxib, diclofenac, etoricoxib, ibuprofen, naproxen; a steroid, such as corticosteroid, glucocorticoid; acetaminophen; an opioid, such as codeine, dextropropoxyphene, tramadol; an antidepressant, such as tricyclic antidepressant; an anticonvulsant; or a combination thereof. In some embodiments, a pain treatment is not a MNK inhibitor.

[0361] In some embodiments of methods provided herein, a subject has received therapy with one or more DMARDs and RA persists and / or recurs and / or progresses. In some embodiments, a Page 156 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) subject has received therapy with one or more DMARDs and pain persists and / or recurs and / or progresses. In some embodiments, a subject has received therapy with one or more DMARDs and the therapy substantially alleviated the subject’s pain. In some embodiments, a subject has stopped taking one or more DMARDs. In some embodiments of methods provided herein (e.g., for the treatment of RA or for reducing inflammation in a subject suffering from RA), a subject administered a MNK inhibitor is receiving or has received a DMARD. In some embodiments, DMARDs are selected from the group consisting of TNF inhibitors, such as adalimumab, certolizumab pegol, etanercept, golimumab, and infliximab; T-cell costimulatory signal inhibitors, such as abatacept; interleukin inhibitors and anatagonists, such as anakinra, sarilumab, secukinumab, tocilizumab, and ustekinumab; JAK inhibitors such as baricitinib, filgotinib, and tofacitinib; purine / pyrimidine synthesis inhibitors, such as azathioprine, leflunomide, and methotrexate; PDE4 inhibitors such as apremilast; CD20 antagonist such as rituximab; ciclosporin; D-penicillamine; minocycline; sulfasalazine; hydroxychloroquine; peresolimab; and combination thereof.

[0362] In some embodiments, provided methods result in a reduction of inflammation in a subject. In some embodiments, provided methods comprise administering a MNK inhibitor in an amount that has been established to reduce inflammation in a population of comparable subjects. A reduction of inflammation can be assessed using any suitable means (e.g., measures of clinical inflammation described above).

[0363] In some embodiments, provided methods result in a reduction and / or slowing of bone erosion in a subject. In some embodiments, provided methods comprise administering a MNK inhibitor in an amount that has been established to reduce or slow bone erosion in a population of comparable subjects.

[0364] In some embodiments, provided methods result in a reduction of pain in a subject. In some embodiments, provided methods comprise administering a MNK inhibitor in an amount that has been established to reduce pain in a population of comparable subjects.

[0365] In some embodiments of provided methods, a MNK inhibitor is administered via any suitable method. In some embodiments, one or more particular routes of administration may be feasible and / or useful. In some embodiments, administration is parenteral. In some embodiments, administration is oral. In some embodiments, administration involves only a single dose. In some embodiments, administration involves application of a fixed number of doses. In some Page 157 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) embodiments, administration involves dosing that is intermittent (e.g., a plurality of doses separated in time) and / or periodic (e.g., individual doses separated by a common period of time) dosing. In some embodiments, a MNK inhibitor is administered in accordance with a dosing regimen (i.e., that includes a single dose or multiple doses separated from one another in time, administered via a particular route of administration) that (e.g., has been demonstrated to be) effective for treating (e.g., delaying onset of and / or decreasing incidence and / or intensity of) a disease or disorder, for example, as described herein. EXAMPLES Example 1. MNK Inhibition Reduced Inflammation and Reversed Mechanical Hypersensitivity in a Mouse Model of Rheumatoid Arthritis

[0366] A MNK inhibitor was tested in a mouse model of rheumatoid arthritis according to the following procedure.

[0367] Animals: Wild type C57BL / 6N and BALB / C mice (adult, 8-9 wk) were ordered from Charles River (Scanbur AB). Animals were provided with food and water ad libitum and maintained on a 12-hour light / dark cycle.

[0368] Cartilage antibody-induced arthritis model: Arthritis was induced by intravenous (i.v.)injection of 6 mg cartilage autoantibody cocktail containing 4 arthritogenic monoclonal antibodies (ACC1: anti-citrullinated C1 epitope of collagen type II (COL2) antibody; M2139: COL2 antibody; L10D9: collagen type XI antibody; 15A: anti-cartilage oligomeric matrix protein antibody) on day 0 followed by 25 μg lipopolysaccharide (LPS, 055:B5, Sigma) intraperitoneally (i.p.) on day 5. Control mice received 150 μL saline i.v. on day 0 while 100 μL saline or 25 μg LPS i.p on day 5.

[0369] Joint inflammation was examined at different time points by arthritis scoring. Briefly, each inflamed (both swollen and redness) digit was given a score of 1 point and if dorsal side of the paw or wrist / ankle joint was inflamed, 2.5 points were given for moderate inflammation and 5 points for severe inflammation, resulting in a maximum 15 points for each limb and in total 60 points per mouse.

[0370] Behavioral tests: For sensory behavioral tests, the mice were habituated to the test environment on two occasions before assessment of baseline. After two baseline recordings Page 158 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) performed on different days, the animals were randomly assigned to saline control and arthritis groups.

[0371] Mechanical allodynia: Mechanical sensitivity was determined by assessment of paw withdrawal using von Frey filament (Stoelting). A series of filaments with a logarithmically incremental stiffness of 0.04, 0.07, 0.16, 0.4, 0.6, 1.0 and 2.0 (g) was applied to the plantar surface of the hind paw and held for 3 sec according to the up–down method as previously described. A brisk withdrawal of the paw was noted as a positive response. The 50% probability of withdrawal threshold (force of the von Frey hair to which an animal reacts to 50% of the presentations) was calculated as threshold. To avoid any potential tissue damage, a cut-off value of 2.0 g was applied. The average withdrawal threshold of two hind paws was used.

[0372] Nocifensive responses to mechanical stimuli: Nocifensive episodes (paw shaking, lifting / guarding or licking) were measured as a quantitative scale of pain responses to a 2.0 g von Frey filament applied to both hind paws. The average shaking numbers of two hind paws were used.

[0373] Joint pain: For joint tenderness, after 1 hour of incubation in the Hargreaves’ box, a toothless clip (420 G) was applied to cover the interphalangeal joints of one hind paw for 5 sec; then nocifensive episodes was measured for 4 min after removal of clip. The shaking number was presented.

[0374] MNK1 / 2 inhibition: Tomivosertib (MNK1 / 2 inhibitor eFT508, MedChemExpress, 10 mg / kg) or vehicle (DMSO:PEG300:Tween 80:Saline of 5:40:5:50) was intraperitoneally injected once daily into arthritic C57BL / 6N or BALB / C mice and behavioral tests (including von Frey test, nocifensive behavior to mechanical stimulus and joint pain) were measured 6 hours later. For C57BL / 6N mice, MNK1 / 2 inhibitor were injected once daily for 5 days (between day 9-13 after inducing arthritis) and BALB / C mice were injected once daily for 10 days (between days 7-17 after inducing arthritis.

[0375] Statistics: Clinical score was shown as mean ± standard error of mean (SEM), andbehavior data for von Frey filament up-down test, nocicfensive behavioral tests and joint pain were presented as median with interquartile range. Data were analyzed with Prism 9.0 (GraphPad software).

[0376] Results: Repeated injection of MNK inhibitor eFT508 (tomivosertib) reduced inflammation and reversed mechanical hypersensitivity in C57BL / 6N mice. As described above, Page 159 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) mice were injected with eFT508 once daily for 5 days (between day 9-13 after inducing arthritis). FIG.1 is a graph showing arthritis score for C57BL / 6N mice injected with eFT508; FIG. 2 is a graph showing withdrawal threshold for C57BL / 6N mice injected with eFT508; and FIG. 3 is a graph showing pain response to a 2.0 g von Frey filament applied to both hind paws for C57BL / 6N mice injected with eFT508. Repeated injection of tomivosertib also reversed RA-induced joint pain in C57BL / 6N mice, as measured by the squeeze test on day 19 after antibody injection (i.e., 6 days after last eFT508 administration). The results of the joint pain squeeze test are shown in FIG.4.

[0377] Similar results were observed in BALB / C mice who were injected with eFT508 once daily for 10 days (between days 7-17 after inducing arthritis), as described above. All RA mice showed joint inflammation 2 days after LPS injection (day 7 after Cab injection). Inflammation was resolved in RA mice who received eFT508 (10 mg / kg) orally for 10 days (N=7), while all of the untreated RA mice (N=7) still showed visual joint inflammation on day 26 (FIG.5) FIG.6 is a graph showing results of a squeeze test 1 hour after the tenth injection of eFT508, indicating that injection of eFT508 also reversed RA-induced joint pain in BALB / C mice. Example 2. Mouse Model of Rheumatoid Arthritis

[0378] Arthritis was induced with intravenous injection of 6 mg cartilage antibody cocktail (Cab) containing 4 arthritogenic monoclonal antibodies (ACC1: anti-citrullinated C1 epitope of CII antibody; M2139: collagen type II antibody; L10D9: collagen type XI antibody; 15A: anti- Cartilage oligomeric matrix protein antibody) on day 0 followed by 25 μg lipopolysaccharide (LPS, 055:B5, Sigma) intraperitoneally on day 5 (Li Y, Tong D, Liang P, Lonnblom E, Viljanen J, Xu B, et al. Cartilage-binding antibodies initiate joint inflammation and promote chronic erosive arthritis. Arthritis Res Ther. 2020;22(1):120). Control mice received 150 μL saline i.v. on day 0 while 100 μL saline or 25 μg LPS i.p on day 5.

[0379] The development of arthritis was checked in different time points by arthritis scoring. Briefly, each inflamed (both swollen and redness) digit was given score of 1 point and if dorsal side of the paw or wrist / ankle joint was inflamed, 2.5 points were given for moderate inflammation and 5 points for severe inflammation, resulting in a maximum 15 for each limb and in total 60 per mouse (Bas DB, Su J, Sandor K, Agalave NM, Lundberg J, Codeluppi S, et al. Collagen antibody- Page 160 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) induced arthritis evokes persistent pain with spinal glial involvement and transient prostaglandin dependency. Arthritis Rheum.2012;64(12):3886-96).

[0380] Injecting a cocktail of autoreactive cartilage-binding antibodies (Li et al, 2020) (Fig. 7A) led to macroscopic clinical arthritis such as swelling and redness observed between day 6 and 23 after antibody injection (Fig.7B). The mice developed allodynia within 4 hours with reduced withdrawal threshold to von Frey hairs before any inflammation (4 h, d1, d3), during inflammation (d9, d12, d17, d23) as well as after inflammation had resolved (d30, d40, d46, d63) (Fig. 7C). Thus, pain hypersensitivity was seen before any inflammation was observed and persisted after inflammation had resolved, similar what can be observed in patients. Example 3. Inhibition of Type I IFN signaling

[0381] C57BL / 6N mice received a small molecule TYK2 inhibitor orally administrated for 9 days from day 13 after autoantibody injection in C57BL / 6N mice twice daily (8 AM and 8 PM, 15 mg / kg, in EtOH:TPGS:PEG300 of 5:5:90). Mechanical sensitivity of von Frey withdrawal threshold and 2 g von Frey nocifensive behavior was measured 1 hour after afternoon injection of TYK2 inhibitor or vehicle on day 5 after first dose of TYK2 inhibitor or vehicle. Chronic joint pain was checked 1-2 hour after morning injection of TYK2 inhibitor or vehicle (EtOH:TPGS:PEG300 for 5:5:90) (n=10). See Figures 8-10. Example 4. Joint Histology in Mice Treated with a MNK Inhibitor

[0382] Autoantibody-induced arthritis model: Arthritis was induced in Balb / c male mice (9- 10 weeks) by intravenous (i.v.) injection of 4 mg cartilage autoantibody cocktail containing 4 arthritogenic monoclonal antibodies (ACC1: anti-citrullinated C1 epitope of collagen type II (COL2) antibody; M2139: COL2 antibody; L10D9: collagen type XI antibody; 15A: anti-cartilage oligomeric matrix protein antibody) on day 0, followed by 25 μg lipopolysaccharide (LPS, 055:B5, Sigma) intraperitoneally (i.p.) on day 5. Control mice received 150 μL saline i.v. on day 0 and 100 μL saline i.p on day 5.

[0383] The mice were examined at different time points by arthritis scoring for joint inflammation. Briefly, each inflamed (both swollen and redness) digit was given score of 1 point, and if dorsal side of the paw or wrist / ankle joint was inflamed, 2.5 points were given for moderate inflammation and 5 points for severe inflammation, resulting in a maximum of 15 points for each Page 161 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) limb and, in total, 60 points per mouse. Joint inflammation started from day 6, and the arthritis score was more than 5 points on day 7 in all the experimental Balb / c mice.

[0384] Treatment with MNK 1 / 2 inhibitor: MNK1 / 2 inhibitor, tomivosertib (eFT508 / HY-100022, MCE), was orally administered repeatedly to the mice from day 7 to day 16 after antibody injection in Balb / c mice (10 mg / kg / daily, in DMSO:PEG300:Tween-80:Saline of 5:40:5:50, n=7). Arthritis score was measured every day until visual inflammation disappeared. Clip squeeze test was measured around 1 h after eFT508 administration on day 16.

[0385] Joint histology: Mice from each of the control, RA (day 60 after antibody injection), and RA with repeat eFT508 treatment groups (n=3) were deeply anesthetized with sodium pentobarbital (60 mg / kg) and perfused transcardially with 20 mL saline, followed by 50 mL of 4% paraformaldehyde in 0.16 M phosphate buffer (pH 7.2-7.4). Hind paws were collected and then post-fixed in the same fixative overnight at 4°C. After fixation, paws were decalcified in 20% ethylenediaminetetraacetic acid solution (containing 2% KOH, 1.2% Tris, pH 7.2-7.4). The decalcification buffer was refreshed every other day for 3 weeks. After cryoprotection in 10% sucrose with 0.1 M phosphate buffer containing 0.01% sodium azide (VWR) and 0.02% bacitracin (Sigma) for 48 h, the tissue was embedded with OCT (HistoLab), frozen with dry ice and sectioned on a CryoStar NX70 cryostat (Thermo Scientific) at 20 µm thickness. Then, sections were stained with hematoxylin / eosin, and finally examined based on the ECLIPSE Ts2 inverted microscope (Nikon).

[0386] As shown in FIG.11, pannus formation and bone erosion (arrowheads) were observed in RA mice, but no phenotype was observed in eFT508-treated RA mice. No differences were observed between the control group and eFT508-treated RA mice.Example 5. Phospho-eIF4E (S209) expression in human DRGs from healthy donors (control)and patients with RA pain.

[0387] Immunohistochemistry for human DRGs: Fresh frozen human lumbar DRGs donated by healthy controls and patients with RA pain were obtained from Anabios. DRGs were sectioned on a cryostat (NX70, Thermo Fisher Scientific) at a thickness of 12 μm, mounted onto Superfrost Plus microscope slides (VWR International) and stored at −80 °C until use. Fresh DRG sections were immersion fixed in ice-cold 4% PFA (Histofix, Roth) for 15 min, rinsed with PBS for 15 min twice and incubated with phospho-eIF4E (S209) rabbit primary antibody (1:150, Abcam) for two Page 162 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) days in a humid chamber at 4°C. Immunoreactivities were visualized using the TSA Plus Fluorescein kit (PerkinElmer) as described above. After rinsing in PBS for 30 min, counterstaining with DAPI was followed, then the slides were mounted with fluorescence mounting medium, dried overnight at RT and stored at −20 °C until imaging.

[0388] Imaging and quantification analysis: Images were acquired using Zeiss LSM800 or900-Airy confocal microscopes equipped with 10^ or 20^ objective. Neurons from mouse and human DRGs were segmented with cellpose and the staining signals were quantified with ImageJ. Representative images are projections of Z-stacks taken at 1^m intervals. See FIG.12. Example 6. Continous blockage of IFNAR1 from the start of arthritis, and effects on joint swelling and histology and pain.

[0389] Autoantibody-induced arthritis model: Arthritis was induced by intravenous (i.v.)injection of 6 mg cartilage autoantibody cocktail containing 4 arthritogenic monoclonal antibodies (ACC1: anti-citrullinated C1 epitope of collagen type II (COL2) antibody; M2139: COL2 antibody; L10D9: collagen type XI antibody; 15A: anti-cartilage oligomeric matrix protein antibody) on day 0 followed by 25 μg lipopolysaccharide (LPS, 055:B5, Sigma) intraperitoneally (i.p.) on day 5. Control mice received 150 μL saline i.v. on day 0 while 100 μL saline i.p on day 5.

[0390] Joint inflammation: The mice were examined at different time points by arthritis scoring. Briefly, each inflamed (both swollen and redness) digital was given score of 1 point and if dorsal side of the paw or wrist / ankle joint was inflamed 2.5 points were given for moderate inflammation and 5 points for severe inflammation, resulting in a maximum 15 for each limb and in total 60 per mouse. See FIG.13A.

[0391] Continuous blockage of IFNAR1: Balb / c male mice received 5 times of a neutralizing monoclonal antibody against IFNAR1 (40 mg / kg, i.p., BioXCell) 1 hour prior to the injection of cartilage autoantibodies (day 0), day 2, day 4, day 6 and day 8 after autoantibody injection. Mechanical sensitivity was tested 1 hour after IFNAR1 mAb injection on day 2, day 4, day 6, day 8 and tested daily on day 9 - 15; sunflower seed assay was measured 4 hours after IFNAR1 mAb injection on day 2, day 4 and day 8 and tested daily on day 9 - 11 after arthritis induction (n = 5).

[0392] Von Frey tests: For sensory behavioral tests, the mice were habituated to the test environment on two occasions before assessment of baseline. After two baseline recordings performed on different days, the animals were randomly assigned to saline control and arthritis Page 163 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) groups. Mechanical sensitivity was determined by assessment of paw withdrawal using von Frey filament (Stoelting). A series of filaments with a logarithmically incremental stiffness of 0.04, 0.07, 0.16, 0.4, 0.6, 1.0 and 2.0 (g) was applied to the plantar surface of the hind paw and held for 3 sec according to the up–down method as previously described. A brisk withdrawal of the paw was noted as a positive response. The 50% probability of withdrawal threshold (force of the von Frey hair to which an animal reacts to 50% of the presentations) was calculated as threshold. To avoid any potential tissue damage, a cut-off value of 2.0 g was applied. The average withdrawal threshold of two hind paws was used. Nocifensive episodes (paw shaking, lifting / guarding or licking) were measured as a quantitative scale of pain responses to a 2.0 g von Frey filament applied to both hind paws. The average shaking numbers of two hind paws were used. See FIG.13B and 13C.

[0393] Sunflower seed assay: To test the dexterity of forepaws, the sunflower seed assay was used, modified from previous descriptions33,100. Animal was habituation to separated test box (animal enclosure, IITC) placed on the grey matte acrylic floor. After habituation, 2-3 sunflower seeds (provided by KM-B, KI) were applied to the floor for 20 min for 3 consecutive days (1 round of training). Two days prior to testing (habituation day 1 and day 2) and during testing day (testing on day 3), animals were transferred from their home cages and placed in the test box and allowedto explore the environment for 10 min. And then 2 seeds were placed on the floor and seed eatingactivity was recorded for 20 min. The episodes of rotation were calculated: the act of manipulating shell orientation rotating for 180 degree within the forepaws. See FIG 13D. Example 7. Examination of sex-differences in arthritis.

[0394] Autoantibody-induced arthritis model: Arthritis was induced in male and femaleC57BL / 6N mice by intravenous (i.v.) injection of 6 mg cartilage autoantibody cocktail containing 4 arthritogenic monoclonal antibodies on day 0 followed by 25 μg lipopolysaccharide (LPS, 055:B5, Sigma) intraperitoneally (i.p.) on day 5. Control mice received 150 μL saline i.v. on day 0 while 100 μL saline i.p on day 5 (n = 6).

[0395] Von Frey tests: For sensory behavioral tests, the mice were habituated to the test environment on two occasions before assessment of baseline. After two baseline recordings performed on different days, the animals were randomly assigned to saline control and arthritis groups. Mechanical sensitivity was determined by assessment of paw withdrawal using von Frey filament (Stoelting). A series of filaments with a logarithmically incremental stiffness of 0.04, 0.07, Page 164 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) 0.16, 0.4, 0.6, 1.0 and 2.0 (g) was applied to the plantar surface of the hind paw and held for 3 sec according to the up–down method as previously described. A brisk withdrawal of the paw was noted as a positive response. The 50% probability of withdrawal threshold (force of the von Frey hair to which an animal reacts to 50% of the presentations) was calculated as threshold. To avoid any potential tissue damage, a cut-off value of 2.0 g was applied. The average withdrawal threshold of two hind paws was used. Nocifensive episodes (paw shaking, lifting / guarding or licking) were measured as a quantitative scale of pain responses to a 2.0 g von Frey filament applied to both hind paws. The average shaking numbers of two hind paws were used. See FIG.14A and FIG.14B.

[0396] Sunflower seed assay: To test the dexterity of forepaws, the sunflower seed assay was used, modified from previous descriptions33,100. Animal was habituation to separated test box (animal enclosure, IITC) placed on the grey matte acrylic floor. After habituation, 2-3 sunflower seeds (provided by KM-B, KI) were applied to the floor for 20 min for 3 consecutive days (1 round of training). Two days prior to testing (habituation day 1 and day 2) and during testing day (testing on day 3), animals were transferred from their home cages and placed in the test box and allowedto explore the environment for 10 min. And then 2 seeds were placed on the floor and seed eatingactivity was recorded for 20 min. The episodes of rotation were calculated: the act of manipulating shell orientation rotating for 180 degree within the forepaws. See FIG.14E.

[0397] Inverted screen test: To perform limb's function, inverted screen test was measured: the mouse was placed in the center of the wire screen (width 7 mm and diameter 2 mm for wire, GMC500) and rotate the screen to an inverted position over 2 sec, with the mouse's head declining first. Hold the screen steadily 45-50 cm above a soft material padded surface. Record the time mouse falls off (hanging time); animal will be removed from screen when it reaches the cut-off point (6 min). Hanging time multiplies body weight was calculated. See FIG.14D

[0398] Clip squeeze test: For checking joint tenderness, after 1 hour of incubation in the Hargreaves’ box (IITC), a toothless clip (420 G) was applied to squeeze the proximal interphalangeal (PIP) joint and extension of the metatarsal-phalangeal (MTP) joint of one hind paw for 5 sec; then nocifensive episode (shaking number) was analysed for 4 min after clip removal. See FIG.14B

[0399] Type I IFN signaling blocking: TYK2 inhibitor (Deucravacitinib / MBS-986165, MCE) was orally administrated for 4 days (7 times) from day 40 after autoantibody injection in C57BL / 6N mice twice daily (8 AM and 8 PM, 15 mg / kg, in EtOH:TPGS:PEG300 of 5:5:90). Page 165 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) Inverted screen test, squeeze nocifensive behavior and sunflower seed assay were measured after 7thinjection of TYK2 inhibitor or vehicle (EtOH:TPGS:PEG300 for 5:5:90) (n = 10, 5 femalesand 5 males). A single i.p. injection of MNK1 / 2 inhibitor, Tomivosertib (eFT508 / HY-100022,MCE) on day 48 after antibody injection in C57BL / 6N mice (1 mg / kg, in DMSO:PEG300:Tween- 80:Saline of 5:40:5:50), and then mechanical sensitivity of von Frey withdrawal threshold as well as nocifensive behavior of 2g von Frey and clip squeeze tests were measured around 1-2 h and 24h after Tomivosertib administration (n = 10, 5 females and 5 males). See FIGS.15A-C and FIGS. 16A-C.Example 8. Kinetics of Il1b, Il6 and Tnfa in mouse DRGs at different timepoints after inducingarthritis.

[0400] Quantitative PCR of interferons in DRG samples: Fresh DRG samples were collectedat different timepoints after autoantibody injection: 1h, 12h, 3d, 33d and 63d, 4 mice for each group (n = 4-5). Naïve C57BL / 6N mice (n = 9) were used as the control group. For IFNAR1 treatment group, samples were harvested on 33d after 12h-treatment of IFNAR1 mAb (40 mg / kg, i.p., BioXCell) (n = 5). Total RNA was extracted from mouse cervical and lumbar DRGs using TRIzol Reagent (Thermo Fisher Scientific) and Motorized Pestle Mixer (Argos Technologies) as previously described107. cDNA was generated from 500 ng RNA using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) with random primers according to the manufacturer’s instructions. qPCR reactions were performed using SYBR Green Master Mix (Thermo Fisher Scientific) on a QuantStudio5 System (Applied Biosystems). Primer pairs used in this study were the following: for mouse genes, Ifna (pan primers, forward: CCTGAGAA / GAGAAGAAACACAGCC [SEQ ID NO: 1], reverse: GGCTCTCCAGAC / TTTCTGCTCTG [SEQ ID NO: 2]), Ifnb (forward: AGGGCGGACTTCAAGATC [SEQ ID NO: 3], reverse: CTCATTCCACCCAGTGCT [SEQ ID NO: 4]), Il1b (forward: GAATCTATACCTGTCCTGTG [SEQ ID NO: 5]; reverse: TTATGTCCTGACCACTGTTG [SEQ ID NO: 6]), Il6 (forward: CTCATTCTGCTCTGGAGCCC [SEQ ID NO: 7]; reverse: TGCCATTGCACAACTCTTTTCT [SEQ ID NO: 8]), Tnfa (forward: GACCCTCACACTCAGATCATCT [SEQ ID NO: 9]; reverse: CCTCCACTTGGTGGTTTGCT [SEQ ID NO: 10]), Gapdh (forward: AACTTTGGCATTGTGGAAGG [SEQ ID NO: 11]; reverse: ACACATTGGGGGTAGGAACA [SEQ ID NO: 12]). All assays were performed in duplicate, and Page 166 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) the levels of transcripts were analyzed by the comparative CT (2-^^Ct) method relative to Gapdh. See FIGS.17A-C and FIGS.18A-D. Example 9. MNK activation alone leads to sensitization in naive mice.

[0401] Engineering light activatable MNK2: To modulate the MNK2 activity by light, anMNK2 protein that was engineered to become light regulated was engineered by inserting two tandemly connected Vivid (dVVD) photoreceptor domains from Neurospora Crassa including a short GPG linker. The dVVD was inserted into the catalytic domain of MNK2 corresponding to G288 in the c-Src kinase. Insertion of dVVD domain containing a linker at this corresponding site in kinases has been shown to enable light-mediated allosteric control of enzymatic activity (Shaaya et al., 2020. Light-regulated allosteric switch enables temporal and subcellular control of enzyme activity eLife 9:e60647. https: / / doi.org / 10.7554 / eLife.60647). The light activatable MNK2 construct included a Myc tag to facilitate biochemical analyses. The construct together with a Flag- tagged eIF4E was transfected into MNK1 and MNK2 double knockout (Mnk1 / 2 DKO) HEK293 cells using lipofectamine 3000 reagent (ThermoFisher) following manufacturers protocol. See FIG.19A.

[0402] HEK293 culture: Mnk1 / 2 DKO HEK293 cells were cultured in 90% MinimumEssential Medium [Invitrogen / Gibco, Cat. No. 21099-022] with GlutaMAX [Invitrogen / Gibco, Cat. No. 35050-038] and 10% heat inactivated horse serum, 1 mM Sodium Pyruvate (Invitrogen / Gibco, Cat. No.11360-039), 0.1 mM non-essential amino acids (Invitrogen / Gibco Cat. No. 11140-35). For detachment during passaging, 0.5 mg / ml Trypsin; 0.2 mg / ml EDTA in PBS was used. Cells were passaged at 80-90% confluency and 5x105cells were seeded per 25 cm2 flask. The cells were passaged 2-3 days before transfection.

[0403] Western blot: To perform western blot cells were kept in the dark or exposed to bluelight for 1 h (2mW / cm2) and thereafter immediately lysed. Total protein was extracted from mouse DRG samples using RIPA lysis buffer (89901, ThermoFisher) containing Protease inhibitor cocktail (G6251, Promega) and Halt Phosphatase inhibitor cocktail (78428, ThermoFisher) according to manufacturer’s instruction and the total protein concentration was measured by BCA assay kit (ThermoFisher). 10 µg of denatured protein was separated by electrophoresis on a NuPAGE 4-12% Bis-Tris gel and transferred onto 0.2 µm nitrocellulose membrane by iBlot2 transfer system. Membranes were blocked with 5% BSA in TBST (0.1% Tween 20) for 1hr at RT Page 167 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) and then incubated with primary antibody against Phospho-eIF4E (Ser209, 1:1,000; #9741, CellSignaling technology) for two days at 4°C. Membranes were washed in TBST for 3 ^ 15 min at RT on a shaker and incubated with polyclonal secondary antibody conjugated with horseradish peroxidase (HRP) in 5% BSA (1:10,000; P039901, DAKO) for 1 hr at RT. The signal was detected with SuperSignal West Femto reagents (1:1 diluted with water, ThermoFisher) after washing the membrane and imaged with a ChemiDoc MP system (Bio-Rad Laboatories). Membranes were stripped in Restore Plus Western Blot stripping buffer (#46430, ThermoFisher) for 1 hr, washed with TBST (3 ^ 15 min), blocked with 5% BSA and re-probed with primary antibody against eIF4E (1:1,000; #9742, CellSignaling technology) overnight at 4°C. The membrane was washed, incubated with HRP conjugated secondary antibody, detected with Amersham ECL prime Western Blotting detection reagents and imaged by the ChemiDoc system. MYC (monoclonal antibody 9E10, 1^g / ml, ThermoFisher 13-2500) was probed on the stripped membranes as the loading control in the end. See FIG.19B.

[0404] In vivo transduction of DRG neurons with the photoactivatable MNK2: Adeno- associated virus (AAV) was constructed and produced by VectorBuilder. The build included the cytomegalovirus enhancer and beta-aktin promoter from chick referred to as the CAG promoter, the photoactivatable MNK2 kinase and a bovine growth hormone polyadenylation sequence. Virus was serotyped PHP.S with a 2x1013GC / ml titer. Virus injections were made intrathecally in adult mice (6–12 weeks) anesthetized with 2–5% isofluorane. After shaving and sterilizing the skin the mouse was placed on a 15-ml conical tube placed under the lower stomach, allowing for easy visualization of the hip and spinal cord protrusions. The mouse was grasped by pinching the hips and lifting slightly, allowing for maximum exposure of the cartilage between the L4 and L5 spinal segments. A 26s-G needle was inserted attached to a Hamilton syringe and 30 ^l volume of AVV virus was injected at a constant rate of 1^l / 15 s.

[0405] Light-induced response: The mice were left for a minimum of 2 weeks after the virusinjection. Thereafter animals were exposed to blue light (470 nm) using a LED floor with exposure of 5 mW / CM2 for 1 hour prior to von Frey behavioral tests. The mice were habituated to the test environment on two occasions before assessment of baseline prior to light exposure. After two baseline recordings performed on different days, the animals were randomly assigned to no light or no light groups. Mechanical sensitivity was determined by assessment of paw withdrawal using von Frey filament (Stoelting). A series of filaments with a logarithmically incremental stiffness of Page 168 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) 0.04, 0.07, 0.16, 0.4, 0.6, 1.0 and 2.0 (g) was applied to the plantar surface of the hind paw and held for 3 sec according to the up–down method as previously described. A brisk withdrawal of the paw was noted as a positive response. The 50% probability of withdrawal threshold (force of the von Frey hair to which an animal reacts to 50% of the presentations) was calculated as threshold. To avoid any potential tissue damage, a cut-off value of 2.0 g was applied. The average withdrawal threshold of two hind paws was used. FIG.19C and 19D. Example 10. HE score in joint histology, demonstrating treatment of RA.

[0406] Joint histology: Hind ankle joints and tibia from balb / c male mice injected i.v. with saline (Con, n = 7), 6 mg cartilage antibody cocktail (RA, n = 7), or continuous IFNAR1 mAb treated arthritic mice (RA + IFNAR1 mAb, n = 5) were collected 60 days after autoantibody injection and then post-fixed in 4% PFA for 48h, decalcified in EDTA (Sigma) for 4-5 weeks, then rinsed in 10% sucrose and embedded in OCT. Sections (20 μm) were cut and stained withhematoxylin and eosin (H&E, Histolab) and scored by blinded investigator. For each animal, 3sections were analyzed for synovial inflammation (synovitis), bone erosion, and cartilage destruction, with a 3-grade scoring system for each aspect. For synovial inflammation, 0 = no inflammation, 1 = slight thickening of the synovial cell layer and / or some inflammatory cells in the sublining, 2 = moderate infiltration of the sublining, and 3 = marked-to-severe infiltration. For bone erosion, 0 = normal bone, 1 = small areas of resorption, 2 = more numerous areas of resorption, and 3 = full-thickness resorption areas in the bone. For cartilage destruction, 0 = normal cartilage, 1 = cartilage surface irregularities, 2 = minor-to-moderate loss of surface cartilage, and 3 = marked cartilage destruction and loss of surface cartilage. See FIGS.20A-C. Example 11. Quanti ication^of,^inter^alia,^MNK^in^tissue / joint^afferents.

[0407] Western blot: To perform western blot in arthritic tissues, cervical and lumbar DRGswere collected at different time points after antibody injection: 2h, 12h, and 33d, 4 mice for each group. For IFNAR1 treatment group, samples were harvested on 33d after 12h treatment of IFNAR1 mAb (40 mg / kg, i.p., BioXCell) (n = 3). Naïve C57BL / 6N mice (n = 9) were used as the control group. Total protein was extracted from mouse DRG samples using N-PER neuronal protein extraction reagent (87792, ThermoFisher) containing Protease inhibitor cocktail (G6251, Promega) and Halt Phosphatase inhibitor cocktail (78428, ThermoFisher). Tissues were Page 169 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) homogenized using micro-pestle (Sigma) and followed by sonication and then sit on ice for 10 min. Centrifuge at 10,000 g for 10 min at 4°C. Supernatants were collected and the total protein concentration was measured by BCA assay kit (ThermoFisher). For mouse DRG lysates, 20 µg of denatured protein was separated by electrophoresis on a NuPAGE 4-12% Bis-Tris gel and transferred onto 0.2 µm nitrocellulose membrane by iBlot2 transfer system. Membranes were blocked with 5% BSA in TBST (0.1% Tween 20) for 1hr at RT and then incubated with primary antibody against Phospho-eIF4E (Ser209, 1:1,000; #9741, CellSignaling technology) for two days at 4°C. Membranes were washed in TBST for 3 ^ 15 min at RT on a shaker and incubated with polyclonal secondary antibody conjugated with horseradish peroxidase (HRP) in 5% BSA (1:10,000; P039901, DAKO) for 1 hr at RT. The signal was detected with SuperSignal West Femto reagents (1:1 diluted with water, ThermoFisher) after washing the membrane and imaged with a ChemiDoc MP system (Bio-Rad Laboratories). Membranes were stripped in Restore Plus Western Blot stripping buffer (#46430, ThermoFisher) for 1 hr, washed with TBST (3 ^ 15 min), blocked with 5% BSA and re-probed with primary antibody against eIF4E (1:1,000; #9742, CellSignaling technology) overnight at 4°C. The membrane was washed, incubated with HRP conjugated secondary antibody, detected with Amersham ECL prime Western Blotting detection reagents and imaged by the ChemiDoc system. GAPDH (1:5,000; #5174, CellSignaling technology) was probed on the stripped membranes as the loading control in the end. Band intensity of specific protein bands were quantified with Image Lab 6.1 software (Bio-Rad laboratories). Protein phosphorylation level was normalized to total protein expression and compared to normalized control samples.

[0408] Assessment of relative mRNA level of pan-Ifna, Ifnb, Il1b and Il6 in IFNAR1 mAb treated mouse DRG in RA:

[0409] Patch-clamp electrophysiology: Cell cultures for patch-clamp electrophysiology wereprepared from adult C57BL / 6N mice (both sexes, 7-10 weeks). Briefly, all levels of cervical and lumbar DRGs were dissected and digested in Papain / Collagenase / Dispase mixture, then triturated using glass Pasteur pipettes. Dissociated cells were suspended in L-15 medium (Liebovitz, L1518, Merck) contained 10% FBS, NaHCO3, Glucose, penicillin / streptomycin (1X) and Floxuridine (PHR2589, Merck) and plated on poly-D-lysine (A-003-E, Merck) and laminin (L2020, Merck) pre-coated coverslip. The following day, changes in neuronal excitability in small-sized nociceptors, (diameter ≤ 20 µm) were tested after 1 hour preincubation in recombinant mouse Page 170 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) IFN^3 protein (12100-1, 300 U / mL, B&D systems), PBS containing 0.1% BSA (Sigma) stimulation in neurons served as controls. To test the effects of MNK1 / 2 inhibition on IFN- stimulated nociceptors, neurons were first incubated with 10 µM eFT508 (in L-15 medium) or vehicle (DMSO, 0.1% v / v) for 1 hour and IFN^3 (300 U / mL) was then added. After 1 hour IFN^3 incubation, the coverslip was placed in a 35 mm petri dish filled with Artificial cerebrospinal fluid (ACSF) solution. ACSF was composed of 125 mM NaCl, 25 mM glucose, 25 mM NaHCO3, 2.5 mM KCl, 2 mM CaCl2, 1.25 mM NaH2PO4, 1 mM MgCl2 that was saturated with 95% oxygen and 5% carbon dioxide and maintained at room temperature (20-22 °C).

[0410] All recordings were performed using whole-cell patch-clamp technique. Patch-clamp electrodes were filled with a solution containing (in mM): 120 K-gluconate, 5 KCl, 10 HEPES, 4 Mg2ATP, 0.3 Na4GTP, 10 Na-phosphocreatine with pH 7.4 adjusted with KOH and an osmolarity of 275 mOsm. Neurons were visualized using a fluorescence microscope (Axioskop FS Plus, Zeiss) equipped with IR-differential interference contrast (DIC) optics and a CCD camera (Hamamatsu). Patch-clamp electrodes were advanced into the dish using a motorized micromanipulator (Luigs & Neumann) while applying constant positive pressure. Intracellular signals were amplified using a MultiClamp 700B amplifier (Molecular Devices) and low-pass filtered at 10 kHz. Electrophysiological data was digitized at 10 or 20 kHz using a Digidata 1322A A / D converter (Molecular Devices) and acquired using pClamp software (Molecular Devices). Neurons were held at -60 mV in current-clamp mode and ramps of depolarizing current (1s duration, peak amplitudes of 100, 300, 500 and 700 pA) were injected into each neuron. The total number of action potentials elicited by each current ramp was quantified for each neuron. See FIGS.21A-F and FIGS.22A-D.

[0411] While we have described a number of embodiments of this invention, it is apparent that our basic examples may be altered to provide other embodiments that utilize compositions and methods of this invention. Therefore, it will be appreciated that the scope of this invention is to be defined by the appended claims rather than by the specific embodiments that have been represented by way of example. Page 171 of 182 BUSINESS.33191060.1

Claims

1. Docket No.: 408994-412WO (219666) CLAIMS 1. A method of treating rheumatoid arthritis, comprising administering a MNK inhibitor to a subject in need thereof.

2. A method of reducing inflammation in a subject suffering from rheumatoid arthritis, comprising administering a MNK inhibitor to the subject.

3. A method, comprising administering a MNK inhibitor to a subject suffering from rheumatoid arthritis, wherein the MNK inhibitor is administered according to a regimen established to reduce inflammation.

4. The method of claim 3, wherein the regimen has also been established to reduce pain.

5. The method of any one of claims 1-4, wherein the subject is not experiencing pain.

6. The method of any one of claims 1-4, wherein the subject is experiencing pain.

7. The method of any one of claims 1-6, wherein the subject is in an active RA inflammatory disease state.

8. The method of any one of claims 1-6, wherein the subject is in an inactive RA inflammatory disease state.

9. The method of any one of claims 1-8, wherein the subject has received or is receiving pain treatment.

10. The method of claim 9, wherein the subject has pain that persists and / or recurs and / or progresses.

11. The method of claim 9 or 10, wherein the pain treatment is selected from the group consisting of: a nonsteroidal anti-inflammatory drug (NSAID), such as celecoxib, diclofenac, Page 172 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) etoricoxib, ibuprofen, naproxen; a steroid, such as corticosteroid, glucocorticoid; acetaminophen; an opioid, such as codeine, dextropropoxyphene, tramadol; an antidepressant, such as tricyclic antidepressant; an anticonvulsant; or a combination thereof.

12. The method of any one of claims 1-11, wherein the subject has received therapy with one or more DMARDs and RA persists and / or recurs and / or progresses.

13. The method of any one of claims 1-12, wherein the subject has received therapy with one or more DMARDs and pain persists and / or recurs and / or progresses.

14. The method of any one of claims 1-12, wherein the subject has received therapy with one or more DMARDs and the therapy substantially alleviated the subject’s pain.

15. The method of any one of claims 12-14, wherein the one or more DMARDs are selected from the group consisting of: TNF inhibitors, such as adalimumab, certolizumab pegol, etanercept, golimumab, and infliximab; T-cell costimulatory signal inhibitors, such as abatacept; interleukin inhibitors and anatagonists, such as anakinra, sarilumab, secukinumab, tocilizumab, and ustekinumab; JAK inhibitors such as baricitinib, filgotinib, and tofacitinib; purine / pyrimidine synthesis inhibitors, such as azathioprine, leflunomide, and methotrexate; PDE4 inhibitors such as apremilast; CD20 antagonist such as rituximab; ciclosporin; D-penicillamine; minocycline; sulfasalazine; hydroxychloroquine; peresolimab; and combination thereof.

16. The method of any one of claims 1-15, wherein the MNK inhibitor is selected from the group consisting of: eFT508, 4ET-03-053, BAY1143269, and ETC-1907206, or a pharmaceutically acceptable salt thereof.

17. The method of claim 16, wherein the MNK inhibitor is eFT508, or a pharmaceutically acceptable salt thereof.

18. The method of claim 16, wherein the MNK inhibitor is 4ET-03-053, or a pharmaceutically acceptable salt thereof. Page 173 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) 19. The method of any one of claims 1-15, wherein the MNK inhibitor is a compound of Structure (II): or a pharmaceutically acceptabl 1aR is C1-C6alkyl or aryl; R1bis C1-C6 alkyl or aryl, or R1aand R1b, together with the carbon to which they are both attached, join to form cycloalkyl, cycloalkenyl, heterocyclyl, aryl, or heteroaryl; R2is –NHR3a, –NHC(=O)R3b, –NHC(=S)R3b, or –C(=O)R3c; R3ais hydrogen, C1-C6 alkyl, or C3-C6 cycloalkyl, each of which is optionally substituted with one or more substituents selected from the group consisting of hydroxyl, C3-C6 cycloalkyl, -NHS(O)2CH3, heterocyclyl, -C(=O)OH, -C(=O)N(R3d)R3d, or -N(R3d)R3d; R3bis C1-C6 alkyl, C3-C6 cycloalkyl, or heterocyclyl each of which is optionally substituted with one or more substituents selected from the group consisting of hydroxyl, halo, C1-C6alkyl, C3-C6cycloalkyl, -NHS(O)2CH3, -N(R3d)R3d, heterocyclyl, -C(=O)OH, -C(=O)N(R3d)R3d, -NHC(=O)CH3, -CH2C(=O)OH, R3cis -N(R3d)R3dor heterocyclyl; R3dis, at each occurrence, independently hydrogen, C1-C6alkyl, or C3-C6cycloalkyl; L is –NH– or –CH2NH–; and X is N and Y is CH or X is CH and Y is N.

20. The method of claim 19, wherein when R1aand R1bare both –CH3or when R1aand R1bjoin to form a 5- or 6-membered cycloalkyl or heterocyclyl, then R2does not have the following structure: O .Page 174 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) 21. The method of claim 19, wherein the MNK inhibitor is selected from Table 1.

22. The method of any one of claims 1-15, wherein the MNK inhibitor is a compound of Formula (I’): Formula (I’) or a pharmaceutically accepterein: R1is selected from the group consisting of hydrogen, halogen, C1-6alkyl, C3-7branched alkyl, C1-6haloalkyl, C3-7branched haloalkyl, C1-6hydroxyalkyl, C3-7branched hydroxyalkyl, cyano, C1-6 alkoxyl, C3-7 branched alkoxy, hydroxy, and C3-6 cycloalkyl that is optionally substituted with 1 to 3 substituents selected from the groups consisting of halogen, C1-6alkyl, C1-6haloalkyl, and C1-6hydroxyalkyl; , , ,Page 175 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) R3’is selected from the group consisting of hydrogen, halogen, C1-6alkyl, C3-7branched alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, C1-6 hydroxyalkyl, C3-7 branched hydroxyalkyl, cyano, C1-6 alkoxyl, C3-7 branched alkoxy , hydroxy, and C3-6 cycloalkyl that is optionally substituted with 1 to 3 substituents selected from the groups consisting of halogen, C1-6alkyl, C1-6haloalkyl, and C1-6 hydroxyalkyl; R1cand R1dare taken together to form a 3- to 7-membered ring having 0-2 heteroatoms selected from the group consisting of N, O and S, wherein the 3- to 7-membered ring may be further optionally substituted with one or more substituents selected from the group consisting of halo, oxo, C1-6 alkyl, R8, and –C(=O)OR9; Z1and Z2are each independently a direct bond or –{C(R4a)(R4b)}p–Y1–; wherein p is 0, 1, 2, 3, 4, or 5, Y1is a direct bond, –O–, or –N(R8)–; R4ais at each occurrence independently selected from the group consisting of hydrogen, halogen, C1-6 alkyl, C3-7 branched alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, hydroxy, C1-6 alkoxyl, C3-7branched alkoxy, NHCO(C1-6alkyl), NHCO(C3-7branched alkyl), NHCO(C3-7cycloalkyl), NHSO2(C1-6alkyl), NHSO2(C3-7 branched alkyl), and NHSO2(C3-7 cycloalkyl); or two R4aattached to two adjacent carbons to form a direct bond; R4bis at each occurrence independently selected from the group consisting of hydrogen, halogen, C1-6 alkyl, C3-7 branched alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, hydroxy, C1-6 alkoxyl, C3-7 branched alkoxy, NHCO(C1-6alkyl), NHCO(C3-7 branched alkyl), NHCO(C3-7 cycloalkyl), NHSO2(C1-6alkyl), NHSO2(C3-7branched alkyl), and NHSO2(C3-7cycloalkyl); R5is selected from the group consisting of hydrogen, halogen, C1-6alkyl, C3-7branched alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, C1-6 alkoxyl, C3-7 branched alkoxy, and hydroxy: R6is selected from the group consisting of hydrogen, NH2, NHR6a, NHCH2CH2OH, NHCH2CH2NHSO2Me, C1-6alkoxyl, C3-7branched alkoxy, and hydroxy; R6ais selected from the group consisting of -(CO)C1-6 alkyl, -(CO)C3-7 branched alkyl, - (CO)C1-6hydroxyalkyl, ,Page 176 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) ande is 1, 2, 3, 4, 5, or 6; X2is selected from the group consisting of hydrogen, halogen, C1-6alkyl, C3-7 branched alkyl, C1-6haloalkyl, C3-7branched haloalkyl, hydroxy, C1-6hydroxyalkyl, C3-7branched hydroxyalkyl, C1-6alkoxy, C3-7 branched alkoxy, C1-6haloalkoxy, C3-7 branched haloalkoxy, NH2, NH(C1-6alkyl), N(C1-6alkyl)2, C1-5(COOH), C1-6(NHSO2Me); X3is selected from the group consisting of hydrogen, halogen, C1-5alkyl, C3-7branched alkyl, C1-5 haloalkyl, C3-7 branched haloalkyl, hydroxy, C1-5 hydroxyalkyl, C3-7 branched hydroxyalkyl, C1-5 alkoxy, C3-7 branched alkoxy, C1-5 haloalkoxy, C3-7 branched haloalkoxy, NH2, NH(C1-6alkyl), N(C1-6alkyl)2, COOH, C1-5(COOH), NHSO2Me, C1-5(NHSO2Me); R7is selected from the group consisting of hydrogen, halogen, C1-6alkyl, C3-7branched alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, C1-6 alkoxyl, C3-7 branched alkoxy, and hydroxyl; R8is selected from the group consisting of C1-6 alkyl, C1-6 haloalkyl, C3-7 branched haloalkyl, C1-6hydroxyalkyl, C3-7branched hydroxyalkyl, C1-6alkoxyl, C3-7branched alkoxy, CO(C1-6alkyl), CO(C3-7 branched alkyl), SO2(C1-6alkyl),and SO2(C3.7 branched alkyl); and R9is selected from the group consisting of hydrogen, C1-6 alkyl, and aralkyl.

23. The method of claim 22, wherein the MNK inhibitor is a compound selected from: N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane- 3',3''-imidazo[1,5-a]pyridin]-6''-yl)amino)pyrimidin-4-yl)cyclopropanecarboxamide; 6''-((6-Aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclopropane-1,1'-cyclohexane- 3',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane- 4',3''-imidazo[1,5-a]pyridin]-6''-yl)amino)pyrimidin-4-yl)cyclopropanecarboxamide; Page 177 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[aziridine-2,1'-cyclohexane-4',3''- imidazo[1,5-a]pyridin]-6''-yl)amino)pyrimidin-4-yl)cyclopropanecarboxamide; N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclobutane-1,1'-cyclobutane-3',3''- imidazo[1,5-a]pyridin]-6''-yl)amino)pyrimidin-4-yl)cyclopropanecarboxamide; benzyl 6''-((6-(cyclopropanecarboxamido)pyrimidin-4-yl)amino)-8''-methyl-1'',5''-dioxo- 1'',5''-dihydro-2''H-dispiro[aziridine-2,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-1- carboxylate; tert-butyl 6''-((6-(cyclopropanecarboxamido)pyrimidin-4-yl)amino)-8''-methyl-1'',5''-dioxo- 1'',5''-dihydro-2''H-dispiro[azetidine-3,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-1- carboxylate; N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[azetidine-3,1'-cyclohexane-4',3''- imidazo[1,5-a]pyridin]-6''-yl)amino)pyrimidin-4-yl)cyclopropanecarboxamide; 6''-((6-((2-hydroxyethyl)amino)pyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclopropane- 1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; 6''-((6-Aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclopropane-1,1'-cyclohexane- 4',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; benzyl 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H- dispiro[aziridine-2,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-1-carboxylate; 1-(aminomethyl)-N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'- cyclohexane-4',3''-imidazo[1,5-a]pyridin]-6''-yl)amino)pyrimidin-4-yl)cyclopropane-1- carboxamide; (1R,5S,6r)-N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'- cyclohexane-4',3''-imidazo[1,5-a]pyridin]-6''-yl)amino)pyrimidin-4-yl)-3- azabicyclo[3.1.0]hexane-6-carboxamide; N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane- 4',3''-imidazo[1,5-a]pyridin]-6''-yl)amino)pyrimidin-4-yl)-2-azaspiro[3.3]heptane-6- carboxamide; 2-methyl-N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'- cyclohexane-4',3''-imidazo[1,5-a]pyridin]-6''-yl)amino)pyrimidin-4-yl)-2- azaspiro[3.3]heptane-6-carboxamide; Page 178 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) (1R,5S,6r)-3-methyl-N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane- 1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridin]-6''-yl)amino)pyrimidin-4-yl)-3- azabicyclo[3.1.0]hexane-6-carboxamide; N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane- 4',3''-imidazo[1,5-a]pyridin]-6''-yl)amino)pyrimidin-4-yl)-1-(methylsulfonamido methyl)cyclopropane-1-carboxamide; 1-((dimethylamino)methyl)-N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H- dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridin]-6''- yl)amino)pyrimidin-4-yl)cyclopropane-1-carboxamide; 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclobutane-1,1'-cyclobutane- 3',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[aziridine-2,1'-cyclohexane-4',3''- imidazo[1,5-a]pyridine]-1'',5''-dione; 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclopropane -1,1'-cyclopentane- 3',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclopentane-1,1'-cyclopentane- 3',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; 6''-((6-aminopyrimidin-4-yl)amino)-3,3-difluoro-8''-methyl-2''H-dispiro[cyclobutane-1,1'- cyclobutane-3',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclopentane-1,1'-cyclobutane- 3',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclobutane-1,1'-cyclohexane- 4',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclohexane-1,1'-cyclobutane- 3',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; ethyl 6''-((6-(cyclopropanecarboxamido)pyrimidin-4-yl)amino)-8''-methyl-1'',5''-dioxo-1'',5''- dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-2- carboxylate; tert-butyl (6''-((6-(cyclopropanecarboxamido)pyrimidin-4-yl)amino)-8''-methyl-1'',5''-dioxo- 1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridin]- 2-yl)carbamate; Page 179 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) N-(6-((2,2-difluoro-8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'- cyclohexane-4',3''-imidazo[1,5-a]pyridin]-6''-yl)amino)pyrimidin-4- yl)cyclopropanecarboxamide; 6''-((6-aminopyrimidin-4-yl)amino)-2,2-difluoro-8''-methyl-2''H-dispiro[cyclopropane-1,1'- cyclohexane-4',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; 6''-((6-Aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclopropane-1,1'-cycloheptane- 4',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; 6''-((6-Aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclopropane-1,1'-cyclohexane- 4',3''-imidazo[1,5-a]pyridin]-2'-ene-1'',5''-dione; or a pharmaceutically acceptable salt thereof.

24. The method of any one of claims 1-15, wherein the MNK inhibitor is a compound of Formula IB: or a pharmaceutically acceptablW1and W2are independently O, S or N-OR', where R' is lower alkyl; Y is ‒N(R5”)‒, -O-, -S-, -C(O)-, -S=O, -S(O)2-, or ‒CHR9‒; R1”is hydrogen, lower alkyl, cycloalkyl or heterocyclyl wherein any lower alkyl, cycloalkyl or heterocyclyl is optionally substituted with 1, 2 or 3 J groups; n2is 1, 2 or 3; R2”and R3”are each independently hydrogen, alkyl, alkenyl, alkynyl, aryl, araalkylene, heteroaryl, heteroarylalkylene, cycloalkyl, cycloalkylalkylene, heterocyclyl, or heterocyclylalkylene, wherein any alkyl, aryl, araalkylene, heteroaryl, heteroarylalkylene, cycloalkyl, cycloalkylalkylene, heterocyclyl, or heterocyclylalkylene, is optionally substituted with 1, 2 or 3 J groups; Page 180 of 182 BUSINESS.33191060.1Docket No.: 408994-412WO (219666) or R2”and R3”taken together with the carbon atom to which they are attached form a cycloalkyl or heterocyclyl, wherein any cycloalkyl or heterocyclyl is optionally substituted with 1, 2 or 3 J groups; R4a”and R4b”are each independently hydrogen, halogen, hydroxyl, thiol, hydroxyalkylene, cyano, alkyl, alkoxy, acyl, thioalkyl, alkenyl, alkynyl, cycloalkyl, aryl, or heterocyclyl; R5”is hydrogen, cyano, or lower alkyl; or R5”and R8taken together with the atoms to which they are attached form a fused heterocyclyl optionally substituted with 1, 2 or 3 J groups; R6”, R7”and R8are each independently hydrogen, hydroxy, halogen, cyano, amino, alkyl, alkenyl, alkynyl, alkoxy, cycloalkyl, cycloalkylalkylene, cycloalkylalkenylene, alkylaminyl, alkylcarbonylaminyl, cycloalkylcarbonylaminyl, cycloalkylaminyl, heterocyclylaminyl, heteroaryl, or heterocyclyl, and wherein any amino, alkyl, alkenyl, alkynyl, alkoxy, cycloalkyl, cycloalkylalkylene, cycloalkylalkenylene, amino, alkylaminyl, alkylcarbonylaminyl, cycloalkylcarbonylaminyl, cycloalkylaminyl, heterocyclylaminyl, heteroaryl, or heterocyclyl is optionally substituted with 1, 2 or 3 J groups; or R7”and R8taken together with the atoms to which they are attached form a fused heterocyclyl or heteroaryl optionally substituted with 1, 2 or 3 J groups; J is ‒SH, -SR9, -S(O)R9, -S(O)2R9, -S(O)NH2, -S(O)NR9R9, -NH2, -NR9R9, -COOH, - C(O)OR9, -C(O)R9, -C(O)-NH2, -C(O)-NR9R9, hydroxy, cyano, halogen, acetyl, alkyl, lower alkyl, alkenyl, alkynyl, alkoxy, haloalkyl, thioalkyl, cyanoalkylene, alkylaminyl, NH2-C(O)-alkylene , NR9R9-C(O)-alkylene, -CHR9-C(O)-lower alkyl, -C(O)-lower alkyl, alkylcarbonylaminyl, cycloalkyl, cycloalkylalkylene, cycloalkylalkenylene, cycloalkylcarbonylaminyl, cycloalkylaminyl, -CHR9-C(O)-cycloalkyl, -C(O)-cycloalkyl, - CHR9-C(O)-aryl, -CHR9-aryl, -C(O)-aryl, -CHR9-C(O)-heterocycloalkyl, -C(O)- heterocycloalkyl, heterocyclylaminyl, or heterocyclyl; or any two J groups bound to the same carbon or hetero atom may be taken together to form oxo; and R9is hydrogen, lower alkyl or -OH.

25. The method of claim 24, wherein the MNK inhibitor is a compound selected from Table 5, or a pharmaceutically acceptable salt thereof. Page 181 of 182 BUSINESS.33191060.1

Citation Information

Patent Citations

  • Thienopyrimidines having mnk1 / mnk2 inhibiting activity for pharmaceutical compositions

    US20100056548A1

  • Inhibitor of MNK for the treatment of neuropathic pain

    US20220226321A1

  • Stabilized c-FMS intracellular fragments (FICD) promote osteoclast differentiation and arthritic bone erosion

    US20220370463A1

  • Composition, methods and uses

    WO2024229072A1

Cited By

  • Baricitinib long-acting derivative as well as preparation method and application thereof

    CN122277573A